CN111575252B

CN111575252B - Identification and application of rice fertility related gene OsLysRS

Info

Publication number: CN111575252B
Application number: CN202010646041.3A
Authority: CN
Inventors: 于鲲; 刘春霞; 魏娟; 陈希; 梁大伟; 刘宇博
Original assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Current assignee: Syngenta Crop Protection AG Switzerland; Syngenta Biotechnology China Co Ltd
Priority date: 2020-07-07
Filing date: 2020-07-07
Publication date: 2023-10-24
Anticipated expiration: 2040-07-07
Also published as: CN111575252A

Abstract

The application relates to the technical fields of plant genetic engineering and rice molecular breeding, in particular to application of a gene OsLysRS in cultivating a male sterile line, preventing transgenic pollen from diffusing and improving non-transgenic offspring proportion in transgenic offspring. The application identifies a gene related to the stadium of rice male gametes and verifies the function of the gene through transgenes.

Description

Identification and application of rice fertility related gene OsLysRS

Technical Field

The application relates to the technical fields of plant genetic engineering and rice molecular breeding, in particular to identification and application of a rice fertility related gene OsLysRS.

Background

Rice is one of the most important food crops in the world, and more than half of the world population takes rice as main food. In order to meet the increasing requirements of people on the yield and quality of rice, the cross breeding is an effective way for improving the yield of crops, the cross breeding has obvious advantages in the aspects of yield, stress resistance, quality and the like compared with common seeds, the cross breeding is generally shorter than the conventional seed breeding period, takes effect quickly, and the development of a male sterile system becomes a sustainable requirement. Currently, commercial hybrid rice production includes three-line systems based on Cytoplasmic Male Sterility (CMS) and two-line systems based on photo-thermo-sensitive nuclear sterility (PTGMS) ^[1] . Three-line methodNamely, the breeding and the production of the hybrid rice must be matched with a male sterile line (sterile line for short), a male sterile maintainer line (maintainer line for short) and a male sterile restorer line. But the three-line method has the defects of long period, low efficiency, more popularization links, low speed, high seed cost and high price of the new combination due to complex breeding procedures and production links. However, PTGMS systems also have some inherent problems, mainly its fertility being regulated by environmental conditions. Thus, both propagation of PTGMS seed and production of hybrid seed require stringent environmental conditions and are susceptible to unpredictable environmental changes. In addition, the critical temperature for fertility switching of PTGMS lines tends to increase after several generations of propagation. Fertility transition critical temperature characteristics are influenced by genetic background, so that the difficulty and uncertainty of breeding a practical PTGMS new line are obviously increased ^[2] . The recessive cell nucleus sterile gene is fully utilized to construct a stable sterile line with fertility not influenced by environment, the restriction of environmental factors on cross breeding is relieved, and the potential risk in production is eliminated. The sterile line technology controlled by the single recessive genic male sterile gene overcomes the defects of the three-line method and the two-line method and has important market utilization value ^[3] 。

Plant male reproductive development involves a series of events ranging from development of stamen meristem to pollen grain formation and pollination, any defect possibly resulting in male sterility ^[4] . Over 40 rice nuclear male sterility genes have been identified in rice. These genes involved in rice pollen development encode various types of proteins including transcriptional regulators, signal transduction proteins, protein degradation regulators and enzymes in hormone biosynthesis ^[5] . Therefore, the research of the rice fertility-related gene has important significance. At present, studies on the OsLysR gene have not been reported yet, and the functions of the OsLysR gene are not clear.

Disclosure of Invention

The application aims to provide a novel rice fertility related gene LysRS (LOC 4333345: lysine-tRNA (tRNA) in the like), the expression quantity of the gene can influence the rice fertility, and the gene is overexpressed in wild rice to generate a rice sterile line. The obtained gene sterile mutant can be applied to theoretical research of rice fertility regulation, creation of sterile lines, transgenic pollen control, hybrid seed preparation and the like.

The above object of the present application is achieved by the following technical processes.

In the previous study, it was found that among mutants produced by knockout of the OsMATL gene of rice by gene editing, the offspring of the T0 mutant having one single insertion of T-DNA had a specific T-DNA isolation ratio of 2 copies (homozygote): single copies (heterozygote): T1 offspring without T-DNA at a ratio of 0:1:1. The results indicate that T-DNA transfer in gametophytes is hindered, i.e., it is possible that defects are created in either the male gametophyte or the female gametophyte of the mutant containing T-DNA insertions. The subsequent forward and reverse hybridization experiments of the wild type and the mutant prove that the male gametophyte containing the T-DNA insertion cannot inherit the T-DNA to the offspring through hybridization with the wild type, which proves that the fertility of the male gametophyte containing the T-DNA insertion is influenced due to the insertion of the T-DNA.

The application locates T-DNA at the position of chromosome 23920880 of mutant genome 3 by genome walking, and the T-DNA is reversely inserted into a non-coding region between two genes LysRS (LOC 4333345) and SMUBP-2 (LOC 4333346). The application compares the expression conditions of LysRS and SMUBP-2 in leaves and anthers of wild plants and T-DNA insertion mutants by RT-PCR, and finds that: expression of LysRS was up-regulated in anthers and leaf tissue of T-DNA insertion mutants compared to wild type, especially in anthers. While the other gene SUMBP-2 was unchanged, it was inferred that the 35S enhancer on the T-DNA increased LysRS expression near the insert, thereby affecting fertility of male gametophytes containing T-DNA inserts.

Since the 35S enhancer can affect gene expression within 20KB from RB and LB ^[6] The present application compares the expression of five candidate genes in this region in wild-type and T-DNA insertion mutants by RT-PCR, including: lysRS, SUMBP-2, paladin (LOC 4333344), inositol monophosphatase 3 (LOC 4333347) and KIN-12C (LOC 4333349). The results indicate that only LysRS expression in the T-DNA insertion mutants is up-regulated.

Since the OsMATL gene was knocked out in the T-DNA insertion mutant, to exclude that up-regulation of LysRS expression was not due to OsMATL gene mutation, we compared LysRS expression in roots, leaves and anthers of wild-type, T-DNA insertion-containing OsMATL mutant and T-DNA insertion-free OsMATL mutant by QRT, found that LysRS expression in T-DNA insertion mutant was up-regulated in both leaves and anthers as compared to wild-type, T-DNA-free OsMATL mutant except in roots.

In order to further verify that the up-regulation of LysRS expression affects male gamete fertility, the present application uses constitutive expression promoter UBI to overexpress LysRS gene in rice by means of transgene function verification. As a result, it was found that the T-DNA isolation ratio of the progeny of the transgenic overexpressing plant with 4T-DNA single inserts was identical to that of the previously found T-DNA single inserted OsMATL mutant, i.e., the ratio of 2 copies (homozygous): single copy (heterozygous): T1 progeny without T-DNA was 0:1:1. The result shows that the up-regulation of the expression of the OsLysRS gene can influence the fertility of male gametophytes of rice.

The experimental result proves that the overexpression of the OsLysRS gene leads to male sterility and female fertility, and can be used for crossbreeding of a rice nuclear male sterility system, transgenic pollen control and hybrid seed production.

In one aspect, the application relates to the use of a rice fertility-related gene LysRS gene with a nucleotide sequence shown as SEQ ID NO. 1 or 2 or a rice development-related protein LysRS protein with an amino acid sequence shown as SEQ ID NO. 3 for creating male sterile rice.

In another aspect, the application relates to the use of a rice fertility-related gene LysRS gene with a nucleotide sequence shown as SEQ ID NO. 1 or 2 or a rice development-related protein LysRS protein with an amino acid sequence shown as SEQ ID NO. 3 for interfering fertility of transgenic pollen.

In another aspect, the application relates to the use of a rice fertility-related gene LysRS gene with a nucleotide sequence shown as SEQ ID NO. 1 or 2 or a rice development-related protein LysRS protein with an amino acid sequence shown as SEQ ID NO. 3 for preventing the spread of transgenic pollen.

In another aspect, the present application relates to a method for creating male sterile rice, which comprises overexpressing the rice fertility-related gene LysRS gene having a nucleotide sequence shown in SEQ ID NO. 1 or 2 or overexpressing the rice development-related protein LysRS protein having an amino acid sequence shown in SEQ ID NO. 3 in rice.

In another aspect, the application relates to a method for interfering fertility of transgenic pollen, comprising overexpressing a rice fertility-related gene LysRS gene having a nucleotide sequence shown in SEQ ID No. 1 or 2, or overexpressing a rice development-related protein LysRS protein having an amino acid sequence shown in SEQ ID No. 3, in rice.

In another aspect, the present application relates to a method for preventing the spread of transgenic pollen, which comprises overexpressing the rice fertility-related gene LysRS gene having the nucleotide sequence shown in SEQ ID NO. 1 or 2 or overexpressing the rice development-related protein LysRS protein having the amino acid sequence shown in SEQ ID NO. 3 in rice.

Drawings

FIG. 1 shows the result of the second round PCR amplification by genome walking. BL: amplifying a T-DNA left border sequence; BR: amplifying a T-DNA right border sequence; numerals 2, 3, 4 represent genomic templates digested by restriction enzymes PvuII, stuI, and EcoRV, respectively; none: negative control.

FIG. 2. Schematic representation of the insertion position of T-DNA in the genome.

FIG. 3. Identity of T-DNA insertion in the T1 generation mutant population was verified by two pairs of primers. A: amplification results with primers SP10110 and SP 10111; b: amplification results with primers SP10110 and SP 10112.

FIG. 4 analysis of expression changes of candidate genes SMUBP-2 and LysRS gene in T-DNA insertion mutants by RT-PCR.

FIG. 5.T-schematic representation of candidate gene names and positions in the genome within 25KB upstream and downstream of the DNA insertion site.

FIG. 6 analysis of the expression changes of candidate genes within 25KB upstream and downstream of the T-DNA insertion site in the T-DNA insertion mutants by RT-PCR.

FIG. 7 shows comparison of LysRS gene expression levels in leaves and anthers of wild type, mutant containing T-DNA insertion and mutant not containing T-DNA insertion by RT-PCR. W: wild type; t-: mutants without T-DNA insertion; t+: mutants containing T-DNA insertions.

FIG. 8 shows comparison of the expression level of LysRS gene in leaves, anthers and roots of wild type, mutant with T-DNA insertion and mutant without T-DNA insertion by QRT. W: wild type; t-: mutants without T-DNA insertion; t+: mutants containing T-DNA insertions.

FIG. 9 is a schematic representation of a vector for overexpressing LysRS.

FIG. 10 QRT detection and seed setting rate of LysRS expression of T0 transgenic lines.

FIG. 11 is a drawing of heading stage plant type for wild type rice varieties IR58025B and T0 overexpressing transgenic plants.

Detailed Description

The application is further illustrated in the following drawings and specific examples, which are not to be construed as limiting the application in any manner. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present application are those conventional in the art. The reagents and materials used in the examples below are all commercially available unless otherwise specified.

EXAMPLE 1 genetic analysis of T-DNA Single insert OsMATL mutant T1 offspring

We analyzed the T-DNA isolation of E1 offspring of one T-DNA single insert OsMATL mutant by Taqman, and found that 2-copy homozygous T-DNA insertion was not detected in the offspring in three independent experiments, whereas the ratio of heterozygous T-DNA mutant to wild-type offspring was close to 1:1 (Table 1). According to the experimental results, the inheritance of T-DNA is hindered in either female or male gametophytes, i.e. the development or fertility of either male or female gametophytes containing T-DNA insertions is affected.

TABLE 1T-DNA isolation ratio in T1 offspring

EXAMPLE 2T-DNA Single insertion mutant and wild-type Forward and reverse Cross experiments

To determine whether this defect is due to problems in the development and production of either male or female gametophytes, the present application performed a positive and negative crossover verification using the T-DNA heterozygous mutant and the corresponding IR58025B wild type as parent materials and performed Taqman analysis of the T-DNA of the resulting hybrid offspring, the results of which are shown in table 2. When the T-DNA heterozygous mutant is used as a female parent, offspring of wild type and T-DNA heterozygous are obtained, respectively. When the T-DNA heterozygous mutant is used as a pollen donor, only wild-type offspring are obtained. The results indicate that the T-DNA containing male gametophytes are defective.

TABLE 2 genetic analysis of T-DNA transfer in Male and female gametes

EXAMPLE 3 genome walking to obtain flanking sequences of the Gene and to locate the position of T-DNA insertion in the genome

To determine the insertion position of the T-DNA in the mutant genome, flanking sequences of the gene of interest were obtained by genome walking. The genome walking kit is Clontech product (Cat. No. 636405) and the specific method is as follows:

(1) The genome of rice is extracted by CTAB method.

(2) The genome was digested with the restriction enzymes EcoRV, pvuII and StuI.

(3) And adding joints at two ends of the enzyme digestion product.

(4) Two nested anchor primers were designed at the positions of RB and LB of T-DNA, respectively:

LB-gsp1：GCATGACAGCAACTTGATCACACCAGC

LB-gsp2：ATACACATTCTTGCCAGTCTTGGTTAGAG

RB-gsp1：CGTCAGTGGAGATATCACATCAATCCAC

RB-gsp2：TTGGGACCACTGTCGGCAGAGGCATCTTC。

(5) The first round of amplification was performed using gsp1 and AP1, and the amplification conditions were as described.

(6) The amplified product was recovered, and then subjected to a second round of amplification using gsp2 and AP2 under the same conditions as described in the specification, and the amplified product was shown in fig. 1.

(7) The amplified product was ligated to a Blunt zero vector and sequenced.

(8) The sequencing result is to remove the sequences of the left and right boundaries on the vector, and then to compare with the genome sequence shown in SEQ ID NO. 4 and SEQ ID NO. 5.

(9) Sequences were aligned at NCBI and T-DNA was inserted between two genes on chromosome 3, as shown in FIG. 2.

(10) The consistency of T-DNA insertion in the T1 generation mutant population is verified by two pairs of primers, the primers are designed at the T-DNA insertion position, one common primer SP10110 is arranged on the T-DNA, the other two primers SP10111 and SP10112 are respectively arranged at the genome position, and the amplified target fragments are 690bp and 899bp respectively. The primer sequences were as follows:

SP10110：TGGCCTTTCCTTTATCGCAA

SP10111：AACTCCTGCAGCGACACCATCCTC

SP10112：ATGACGCAACCCCTCCTCTCGA。

as a result, as shown in FIG. 3, all T1 generation populations had the same T-DNA insertion pattern.

EXAMPLE 4 detection of expression changes in mutants of candidate genes upstream and downstream of the T-DNA insertion site by RT-PCR and QRT

In the mutant, the insertion site of T-DNA was located at the position of chromosome 3 23920880, which is exactly the non-coding region between the two genes, namely the DNA binding protein gene SMUBP-2 (LOC 433346) and the lysine-like tRNA ligase gene LysRS (LOC 433345) (FIG. 2). To confirm which gene expression was altered by T-DNA insertion in the mutants and the phenotype described above, semi-quantitative RT-PCR analysis was performed with leaf and anther cdnas of wild-type and T-DNA single-insert osmtl mutants as templates, and actin as an internal control, and expression of SMUBP-2 and LysRS was detected using the following gene-specific primers:

SMUBP-2 (fragment size of interest: 1884 bp):

SMUBP-F：5’-CAGGAGTTCGTCTCTCCA-3’

SMUBP-R：5’-TCAGCTCTGGTATTCTGATGC-3’

LysRS (fragment size: 1805 bp):

LYSRS-F：5’-CGGAGTCGGGCTCGT-3’

LYSRS-R：5’-CTAATCTTGAGGCTTCATAGCC-3’

reference gene actin (size of target fragment 889 bp):

ACTIN-F：5’-GCAGAAGGATGCCTATGTTG-3’

ACTIN-R：5’-GGACCCTCCTATCCAGACAC-3’。

the reaction system of RT-PCR is as follows: 1.0. Mu.l of cDNA template, 2.0. Mu.l of 10 XKOD buffer, 0.5. Mu.l of upstream and downstream specific primers (10. Mu.M) each, 1.0. Mu.l of dNTPs (2 mM each), mgSO ₄ (25 mM) 1. Mu.l, KOD DNA polymerase (1U/. Mu.l) 1.0. Mu.l, with ddH ₂ O was made up to 12. Mu.l. The procedure used for RT-PCR was: pre-denaturation at 95 ℃ for 10 min; denaturation at 95℃for 2 min, annealing at 58℃for 30 sec, elongation at 68℃for 1 min, elongation at 68℃for 10 min after 28 cycles, and storage at 4 ℃. The PCR products were detected by electrophoresis on a 1.0% agarose gel and photographed. To ensure accuracy of the results, the validation test was repeated 2 times.

The results showed that there was no significant difference in the expression of the SMUBP-2 gene in the anthers and leaves of the wild type and T-DNA insertion mutants. Expression of LysRS gene was up-regulated in both leaves and anthers of T-DNA insertion mutants, especially in anthers, compared to wild type (fig. 4). Thus, it is presumed that since T-DNA is inserted in the middle of two genes in the reverse direction and the transcription direction of T-DNA is identical to that of LysRS gene, the 35S enhancer of T-DNA upregulates the expression of LysRS gene. Since the 35S enhancer can affect gene expression within about 20kb from each of the upstream and downstream of LB and RB, we searched for five genes in total, including SMUBP-2 and LysRS (FIG. 5). Expression of these 5 genes in leaves and anthers of wild type and T-DNA mutants was compared by RT-PCR (FIG. 6). The results showed that only the expression of LysRS gene was up-regulated in leaves and anthers of the T-DNA insertion mutants, which is consistent with previous results.

To exclude the effect that the OsMATL mutation may have on LysRS gene expression, in the second round of RT-PCR validation, osMATL mutants without T-DNA insert were added as controls, and the results also indicated that LysRS gene expression was not different in leaves and anthers of wild type and OsMATL mutants without T-DNA insert, but was up-regulated in mutants with T-DNA insert (FIG. 7). The above experimental results show that the expression level of LysRS gene in the mutant is increased due to single copy insertion of T-DNA, especially in anther, thereby causing male gametes containing T-DNA to be affected, so that T-DNA cannot pass through male gametes, and finally homozygous T-DNA offspring cannot be obtained in offspring, and the ratio of single copy offspring to wild type offspring becomes 1:1.

The up-regulation relative amounts of LysRS genes in different tissues of mutants were detected by QRT. The Primerexpress 3.0 software is used for designing a qPCR primer and a probe with specific genes, and the internal reference gene is a rice OsEF1a gene, and the sequence is as follows:

TABLE 3 sequences of qPCR primers and probes

The reaction system of qPCR is: DNA template 5.0. Mu.L, 2X JumpStart MasterMix 12.5.5. Mu.L, qPCR primer probe set (primer 300nM, probe 100 nM) 0.5. Mu.L, and ddH ₂ O was made up to 25. Mu.L. The procedure used for qPCR was: 95 ℃ for 5 minutes; 95 ℃ for 5 seconds; 60 ℃ for 30 seconds; 40 cycles.

The experimental results showed (FIG. 8) that in the roots, the LysRS gene was unchanged in the wild type, the mutant containing T-DNA insertion and the mutant not containing T-DNA insertion. The expression level of LysRS was increased by 3078.93% and 2760.52% in the leaves of the mutant compared to the wild type and the mutant without T-DNA insertion, respectively, and by 367.81% and 188.50% in the anther, respectively.

Example 6 Gene function verification by overexpressing OsLysRS

6.1. Binary vector construction

The OsLysRS gene used in the experiment is synthesized by gold Style (GenScript), and the vector is constructed by adopting a standard enzyme digestion connection method. Is linked to a binary vector containing the maize Ubi promoter and the Nos terminator, and also contains an expression cassette for red fluorescent protein and an expression cassette for PMI selection marker (fig. 9).

6.2. Agrobacterium transformation of rice

The rice transformation variety in the experiment was IR58025B. The agrobacterium transformation method is adopted, and specific operations are described in reference ^[7] . The transformed positive strain is detected by Taqman, and the T-DNA single-inserted transformant is selected to be cultivated in a greenhouse.

OsLysRS gene expression analysis and phenotypic observation of T0 transgenic plants

The expression of the OsLysRS gene of the transgenic plant is analyzed through QRT (figure 10), 94% of the OsLysRS gene of the T0 transgenic plant is over-expressed, the expression quantity is 22-156 times of that of the wild type, and the expression quantity of the LysRS gene of the T-DNA single-inserted OsMATL mutant is 6 times of that of the wild type. The seed setting rate of the transgenic overexpression line is reduced to a different degree compared with that of the wild type (fig. 10 and 11), the average seed setting rate is 45.61%, the seed setting rate is reduced by 46.34%, and 2 transgenic lines are sterile, which shows that the OsLysRS gene is a fertility-related gene, and the up-regulation of the expression level of the OsLysRS gene affects the fertility of rice.

Genetic analysis of T1 offspring of LysRS over-expression transgenic lines

We performed genetic analysis of T-DNA isolation of partial T-DNA single and multiple insert T0 transgenic line offspring by Taqman and red fluorescent protein expression (Table 4). The result of the segregation ratio of the heterozygous offspring of the four single insertion transgenic lines and the wild-type offspring being 1:1 verifies that upregulation of LysRS expression results in defects in the male gametophyte containing the T-DNA insertion, thereby preventing the transmission of T-DNA through the male gametophyte to the offspring. In the offspring of the T-DNA multiple insert transgenic line, no RFP expression was detected in 45% (5/11) of the offspring (Table 5), indicating that upregulation of the LysRS gene could prevent inheritance of the T-DNA to the offspring. Therefore, the results show that LysRS gene can be applied to prevent transgene from diffusing and improve the proportion of non-transgene offspring.

TABLE 4.T Single insert transgenic line offspring genetic analysis

Table 5.T-DNA multiple insert transgenic line offspring genetic analysis

The above examples are only for illustrating the present application, and the embodiments of the present application are not limited to the above examples, but any other changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be considered as equivalent embodiments. They are included in the scope of the present application.

Reference to the literature

Cheng, S.H. et al Progress in research and development on hybrid rice: a super-dope catalyst in China.Ann Bot 2007.100 (5): p.959-66.

2.Chen L,L.D.,Tang W,Xiao Y,Thoughts and practice on some problems about research and application of two-line hybrid rice.Chin J Rice Sci,2011.18(2):p.79-85.

3. Wang Chao, an Xueli, zhang Zengwei et al, research progress in the plant recessive nuclear male sterility gene breeding technology system and hope, journal of Chinese bioengineering, 2013.33 (10): p.124-130.

Chang, Z et al Construction of a male sterility system for hybrid rice breeding and seed production using a nuclear male sterility gene Proc Natl Acad Sci U S A,2016.113 (49): p.14145-14150.

5. Tan Hexin, wenye, zhang Dabing, molecular mechanism of rice pollen development. Plant science bulletins, 2007.24 (3): p.330-339.

Lu, G.H. et al Application of T-DNA activation tagging to identify glutamate receptor-like genes that enhance drought tolerance in plants [ J ]. Plant Cell Reports,2014,33 (4): 617-631

Ge, X. Et al A tissue culture system for different germplasms of indica price. Plant Cell Rep,2006.25 (5): p.392-402.

Sequence list information

SEQ ID NO. 1: gene sequence of fertility-related gene OsLysRS

/>

SEQ ID NO. 2: cDNA sequence of fertility related gene OsLysRS

/>

SEQ ID NO. 3: amino acid sequence of fertility-related gene OsLysRS

SEQ ID NO. 4: T-DNA flanking sequences close to the left border sequence

/>

SEQ ID NO. 5: T-DNA flanking sequences close to the right border sequence

SEQ ID NO. 6: primer LB-gsp1

GCATGACAGCAACTTGATCACACCAGC

SEQ ID NO. 7: primer LB-gsp2

ATACACATTCTTGCCAGTCTTGGTTAGAG

SEQ ID NO. 8: primer RB-gsp1

CGTCAGTGGAGATATCACATCAATCCAC

SEQ ID NO. 9: primer RB-gsp2

TTGGGACCACTGTCGGCAGAGGCATCTTC

SEQ ID NO. 10: primer SP10110

TGGCCTTTCCTTTATCGCAA

SEQ ID NO. 11: primer SP10111

AACTCCTGCAGCGACACCATCCTC

SEQ ID NO. 12: primer SP10112

ATGACGCAACCCCTCCTCTCGA

SEQ ID NO. 13: primer SMUBP-F

CAGGAGTTCGTCTCTCCA

SEQ ID NO. 14: primer SMUBP-R

TCAGCTCTGGTATTCTGATGC

SEQ ID NO. 15: primer LYSRS-F

CGGAGTCGGGCTCGT

SEQ ID NO. 16: primer LYSRS-R

CTAATCTTGAGGCTTCATAGCC

SEQ ID NO. 17: primer ACTIN-F

GCAGAAGGATGCCTATGTTG

SEQ ID NO. 18: primer ACTIN-R

GGACCCTCCTATCCAGACAC

SEQ ID NO. 19: osLysRS forward primer

CACGTTTATTATCAACCATCCAGAGA

SEQ ID NO. 20: osLysRS reverse primer

GCTCAAACCTCTCAGTCAATCCAG

SEQ ID NO. 21: osLysRS probe

ATGAGTCCATTGGCAAAGTGGCATAGGTC

SEQ ID NO. 22: osEF1a forward primer

AGCCCAAGAGGCCATCAGA

SEQ ID NO. 23: osEF1a reverse primer

GCCAATACCACCGATCTTGTACA

SEQ ID NO. 24: osEF1a probe

AAGCCCCTGCGTCTTCCCCTTCA

Sequence listing

<110> Xianzhengda crop protection Co., ltd (Syngenta Crop Protection AG)

First, zhengda biotechnology (china) limited (Syngenta Biotechnology China co., ltd.)

<120> identification of rice fertility-related gene OsLysRS and application thereof

<130> 82126-CN-REG-ORG-NAT-1

<141> 2020-07-07

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 7262

<212> DNA

<213> Rice

<220>

<223> Gene sequence of fertility-related Gene OsLysRS

<400> 1

atggcggagt cgggctcgtc gggtctggag gagaagctgg cgggtctctc cgcgggcggc 60

ggcgaggagc cgcagcagct ctcgaagaag tgcgctttct catcgcgcac gcagccggca 120

tttcttctta ttgttttttt tttcctccgt agtgtggctt ttgtttaata tgagttttgt 180

ggcgggtgca gtgccaagaa gagggaggag aaaaggaaga agcaggagga ggagcgccgg 240

ttgaaggagg aagagaagaa gaagaaggtg aagcagtttg aacttaacct ttgccgattt 300

ttttccagtg ttgtttttat ggagcgagtt ttggatgcgt tcatttgtag atgatgccaa 360

tgtgacaagc aacactcttt gctcttgtta gatacggata tacctctgca gctagggtgt 420

gagagagagt tttccatatc atgattgcta agctctaaat atatatacac ccttttttta 480

aaaaaatttt gtaggccgct gcaacagcag ctgctagtgg agagcccccg aaggaatctg 540

ccgccgacga tgaggaaatg gatcccactg tatgtgatat tgatgcccct ttggtgctgc 600

tgtgctattt gttgtattga attcttttgt ttaggaaaat tcagacatgt gtttcttgct 660

gcagcaatat tatgagaatc gcctcaaggc acttgattca ctcaaggcca cgggtgtaaa 720

cccctatccc cataagttcc tggctaatat taccgtagcc gattatattg agaaatacaa 780

gagcatgaat gttggggata agcttgttga cgtcaccgag tgcctagcag gtatttttcg 840

ttctctttga ctagatatga tagtgtagtt gattagagat acatttgggt gggatttgta 900

tttattattt ttttttatta aagggaggat catgaccaag agagcgcaat cttccaagct 960

cttattttat gatctttatg gtggtggtga gaaagttcaa gtttttgctg atgccaggta 1020

aaactttgtc tgttcaactg tattgcttac cttttatgcc atttagctgg tttgttccca 1080

gacactttca gcatttcact aaaatctcac tatgtgcaga tatgcctgac taaaatgcat 1140

cctttggtta attttcatat cagttaaatc tattttttaa tgttggtgaa tttcataaag 1200

tttgtatcag ttaaatatat ttttcaacat tggtgaattt cataaagttt attgccaaag 1260

aattctcact gcaactttat aaacatatgc taggccatgg attgtgatga atgtcataga 1320

tttagagcaa ggtttctgta gcttattatc ttcctgcaaa tgtgtcaata gtacgccggg 1380

tgctactcat gcttggcata gctggctact tatgtgtggt ccgtattggc aataatcaca 1440

ttatgcacaa aacccccctt cttttacata gttgggtttt cttcttgttt tgtacatgtt 1500

aatgcttaga atttttcttc ttgttatttt tgcatgcttt cccaacttgg gtaatatgct 1560

tcatgattat gtacataaca gtatgtatgc ttgtacatag taaaagtgta aaatacacga 1620

ggttgcatac aatccatatc tcataaagtc tgggggcttg ctgacttgca attttctatt 1680

agttataatg tttaaacaaa caaaaaggtg cattcttttt tgttattttg actaactgtt 1740

ctttggctat cgttgttatc tcgtggctat catttcgctc atgtttaagt actacgccgt 1800

ttactgccta ctattgtcgg tctcataaaa agtaaactaa tgatttaact gattttacct 1860

gatataggac ctcagagttg gaagataatg aattcattaa gtttcactct actctgaaac 1920

gaggtgatat tgttggtgta tgtggttatc caggtttgta agcatctatt caagttcatt 1980

ttgaaattat tacatagtca gatgttccaa catcaaaatt aagtaggtac ttatattctt 2040

tcagttggaa tgccaatagg acattttgag tacatggatc cttatctgat tgagtttgta 2100

attttattta ataaataact taaactttat atgtagctta tgcccatact tgattgtaca 2160

gtttgtttgt tttaaaacaa ttaggagtat aaatagtttg atggttactg gaaattctta 2220

tattgtttta ctgtgtctga taatgacgac ttctcaattt tgatgaatac caggaaagag 2280

caagagaggg gagctcagta tattcccaaa gaaaattgtt gtgctctccc catgccttca 2340

tatgatgcct cgacaggtga gaatcagatt ttttaggaag agatgtttcc agatgatata 2400

cctaatatct cagagcaatt tacttcatat taatctgaac ttttatattt aaatctgtac 2460

atactaacat agagaccata aaataactag agttaagtct gatttacccc catcccccct 2520

ctctctctct aactatagaa ccggacattt gacaccccta aaattttgga accgtacgaa 2580

ttaccttcct aaacataatc taggtggttt tgtcctatgt ggcagacagg tggcaataat 2640

ctgaccatgt ggcaacccag tcagcaaaac aatcaattgt ttttaggaaa aaatatgtta 2700

gcccacattg tcatccacct agttgtcttc ttccgcccat tctcccattt ctcacattag 2760

gcatgggctg caaactgcca gatcctttgc ctcgttagtc tcagtgctcc ttgcttcgga 2820

ggaagtccat ggacaagcgc ctcaaagcag tgctccggcc tgcttgagac ggccgagctt 2880

gagtgctcga cgggacatag cagcgctggc accgcctcgc ctccatcagt gcgcccgtgc 2940

aacagttcgt ggtggttgtg gggagcatat gtttgcccct gccggagtat gccaccatgt 3000

cagctgcaca gcagcaggtg cagctagccg ccactgccag ggagctgaag caccagcaag 3060

gacggagaca ctctggctcc gaaggccgcg gagcggggac gccagggacg gcagcttgtc 3120

ctccccggcc gtctcatggt cgtcacagac cacctccgct tcattacatg tgcgaatgag 3180

agagcagctt tgatttcttg gagttttttt ttttcaaaga gtgatttttc agaactatct 3240

agcttgatta catgtacgta tgacaacaac cgtcttgtgg atcttgaggg ctgcaggtaa 3300

gctagtgctt acacaggctt gggtagagat tggaacagaa aggatagagg aagaagtgca 3360

tgccactgat tgctgggtcc catggagagg gagaagcatg ttgctgatga tgcacctcct 3420

ccctcatatt ggactgtcat gtgtgatagc tttagatcga aaccacctaa aaaagagccc 3480

caggggggtt aagtatccgg attgaatagt ttaggggtgt ccaatatctg gtttcgtagt 3540

taaggggggt aagtcgtact tctgtgatag ttgagggggt aaatcggact tgacccaaat 3600

aattatgact gaaactaaag acattttgtg tagcgatgcc ttctcttttt ctgggtgtca 3660

cacacacaca ttagcagcac aagaaagcac aacagccatt attctggttt gcagacccca 3720

gacaggtcat ttgattaaac ccacaaatgc acctcatatt tgcctagctt cttttctcaa 3780

gtgcaatgca atacagacac tcactcacac ctgtttatgc atttgttacg tgctacgcat 3840

tctaggacta gtagaggcat agataaatgc ataatttgtc catcacctca tggagtatgg 3900

gcgtgtcctg cacttgcatg tgtgtagtat atagtgagcc atgcttgctt gacttgatgc 3960

taggattgaa cgttggcatt ttgcatgcac gattgaactg caaaacaccc aactgctgag 4020

tccagcatgc caagcttctg agatatcaaa atatttcgtg tacacccaac cattgaccct 4080

ttgctttcct tccaagttct tatgctaatt atatttgttg aattgtagtc tacatgatca 4140

tttacatgta ttttatacat ctttacagaa gagtgaggga agtgctgttc ccactccatg 4200

ggctccagga atgggtagga acatcgaaaa gtatgttttg agggaccagg tttgttcatt 4260

ctccgtataa ttattgattg atctctcgtc tatgtaaatg ctaattactg tgagttcttt 4320

gtcagcaagt aaatacattg tcggtagtgt gattaatcat aattaacaaa tatctaggcg 4380

gattttaagg ttctggatgt gcatatgtga tccgctttgt tgtatgcaca acaaaatcat 4440

ttaaatttag attgaggcag ctatgcaatt tagtgcaaag ttagattcag gtggatgaac 4500

taatcatggg atcagattct atctgaacaa gtggataggt ggcgcatgtc tagtccatta 4560

agagagattt gcaatgttct taaaattagt gaactcattt gctgacatga atgccatatt 4620

tggcatgcta atagaaatct gtccaatttt attgactatc tcatgcattc attctattta 4680

aaaatctgca tttctaattt acatgagcaa atcataaatt tggtgcaggt tgctttaagt 4740

agcttgatca ctcagtgact atcaattata tatctgtctt gttgcctttg gtgcttagta 4800

gcgatttgat tatcaattgt ttgtcttgtg atatcaggaa acccgatatc gtcaacgata 4860

tcttgatctc atggtaaacc atgaagtgag gcatatattc aagacaagat caaaagttgt 4920

ctcttttatt cggaaatttc ttgatggtct tgacttttta gaggtgggcc tgtgcaatct 4980

attctgttat tcttcttttg tatattcttc cagtccttca aatctgaata ttctatgtct 5040

tttctaggtg gagactccaa tgatgaacat gattgcaggt ggagcagctg caaggccttt 5100

tgtcacacat cataatgagt taaacatgag gctttatatg cgtattgctc ctgagctcta 5160

tctgaaggaa ttggttgttg gggggctgga tcgtgtttat gaaattggga agcagttcag 5220

gaatgaagga attgacctga cgcacaatcc tgaattcaca acatgtgaat tttatatggc 5280

atatgcagat tacaatgact tgatgaagct tactgaaacc atgttatctg gtgattatct 5340

cttgatgtct ctgaaacatc tttttttttt ctttttattt taggaagtaa tagtatcttc 5400

atgtcaattt tgtatgcaac tgcaaaatga cctaaatgca ttttccttgt tccgtaggca 5460

attcatgatt tgctattgtt ctgtcatatc atttttttgc cgtcctatct tgtttttact 5520

gaaatcaaca tgaagcagcc tgttcatttt atctaatgat ctgattttat ggttgacagg 5580

tatggttaag gagttgacag gtggctacaa gattaaatat catgctaacg gagttgagaa 5640

accaccaata gagattgatt tcacacctcc cttcaggtag agacattggg atgtatttgg 5700

attacatgta ttgctctata tgcactttta actggtaatg ttcagttgct acaatgttac 5760

tttgccttta ccttgctgca gaaagataga catgattgac caattagagg ctatggctaa 5820

actcaatata cctaaagatc tctcaagtga tgaagcaaac aagtatttga tagatgcctg 5880

tgccaaatat gatgtcaaat gcccacctcc ccagactaca acacggttgc ttgataaggt 5940

tgtttcttta cccactacac attcttttta cactgtattt tgatatgatt ttcgttaggt 6000

gattttgcta tcttataata tcttatttac atatatgata agctagccac tttgatatga 6060

agaagaatgt ccggtgtaat cctttttgtt gcttccataa tgtacagtac atttctgaac 6120

attttcacat tagctcacaa acaaataaaa gatctggggt atattgcaaa atccaacctg 6180

aagctatttg cttaaatttt aatatacctt ttgcttttgt ttcccttttg gtattcctta 6240

gccaaattaa taaggtatat gctctgctct aacagctagt tggccatttc ttggaggaga 6300

catgtgtgaa tcccacgttt attatcaacc atccagagat aatgagtcca ttggcaaagt 6360

ggcataggtc tcgacctgga ttgactgaga ggtttgagct ctttgttaac aagcatgagg 6420

tatatactaa gtcttcattg atactttcat acttgtcctc ctttctgttt ccttacagtg 6480

ttctgaaatc cattttttag gtgtgcaatg catatacaga gttaaatgat cctgttgttc 6540

agaggcaacg gtttgaggaa caactaaagg tacttgttag attttgtgaa catttgcaaa 6600

ttgtatattt ttctttggta ccagcctgct cccaagcttc gagttatttt tggtattttg 6660

gaacatctaa atagctttgc atagtatata attgttggaa accaacctac tcccatatgt 6720

ggtatatttt ggtccatcat tttaaccagc gtactcatta tgcttgggag ttttggatcc 6780

atcagatata tacacacact tgtgtttgca ttgttaaaag tagtggtaag tcattggaag 6840

ggtgggatat gaagtgtcaa acagacaaac agagtatgga cccttacacc agtggcagat 6900

ttattgttgc atggtgtttc cctagcttcc tatgtggctt gctgaaaaac tgtacatgtt 6960

cttacgtata ttatgtgcca ggatcgtcaa tctggtgatg atgaagctat ggcattggat 7020

gaaacattct gcacagccct tgagtatggc ctaccaccga ctggtggttg gggattggga 7080

attgatcgcc ttacaatgtt gctgactgat tctcagaata tcaaggtcta attatttctt 7140

catttgtact tttgttcctg gcatttttta tttggtcttt attcagttga ggtatttaaa 7200

atgctctttt gatgcaaatt caggaagttc ttctattccc ggctatgaag cctcaagatt 7260

ag 7262

<210> 2

<211> 1809

<212> DNA

<213> Rice

<220>

<223> cDNA sequence of fertility-related Gene OsLysRS

<400> 2

atggcggagt cgggctcgtc gggtctggag gagaagctgg cgggtctctc cgcgggcggc 60

ggcgaggagc cgcagcagct ctcgaagaat gccaagaaga gggaggagaa aaggaagaag 120

caggaggagg agcgccggtt gaaggaggaa gagaagaaga agaaggccgc tgcaacagca 180

gctgctagtg gagagccccc gaaggaatct gccgccgacg atgaggaaat ggatcccact 240

caatattatg agaatcgcct caaggcactt gattcactca aggccacggg tgtaaacccc 300

tatccccata agttcctggc taatattacc gtagccgatt atattgagaa atacaagagc 360

atgaatgttg gggataagct tgttgacgtc accgagtgcc tagcagggag gatcatgacc 420

aagagagcgc aatcttccaa gctcttattt tatgatcttt atggtggtgg tgagaaagtt 480

caagtttttg ctgatgccag gacctcagag ttggaagata atgaattcat taagtttcac 540

tctactctga aacgaggtga tattgttggt gtatgtggtt atccaggaaa gagcaagaga 600

ggggagctca gtatattccc aaagaaaatt gttgtgctct ccccatgcct tcatatgatg 660

cctcgacaga agagtgaggg aagtgctgtt cccactccat gggctccagg aatgggtagg 720

aacatcgaaa agtatgtttt gagggaccag gaaacccgat atcgtcaacg atatcttgat 780

ctcatggtaa accatgaagt gaggcatata ttcaagacaa gatcaaaagt tgtctctttt 840

attcggaaat ttcttgatgg tcttgacttt ttagaggtgg agactccaat gatgaacatg 900

attgcaggtg gagcagctgc aaggcctttt gtcacacatc ataatgagtt aaacatgagg 960

ctttatatgc gtattgctcc tgagctctat ctgaaggaat tggttgttgg ggggctggat 1020

cgtgtttatg aaattgggaa gcagttcagg aatgaaggaa ttgacctgac gcacaatcct 1080

gaattcacaa catgtgaatt ttatatggca tatgcagatt acaatgactt gatgaagctt 1140

actgaaacca tgttatctgg tatggttaag gagttgacag gtggctacaa gattaaatat 1200

catgctaacg gagttgagaa accaccaata gagattgatt tcacacctcc cttcagaaag 1260

atagacatga ttgaccaatt agaggctatg gctaaactca atatacctaa agatctctca 1320

agtgatgaag caaacaagta tttgatagat gcctgtgcca aatatgatgt caaatgccca 1380

cctccccaga ctacaacacg gttgcttgat aagctagttg gccatttctt ggaggagaca 1440

tgtgtgaatc ccacgtttat tatcaaccat ccagagataa tgagtccatt ggcaaagtgg 1500

cataggtctc gacctggatt gactgagagg tttgagctct ttgttaacaa gcatgaggtg 1560

tgcaatgcat atacagagtt aaatgatcct gttgttcaga ggcaacggtt tgaggaacaa 1620

ctaaaggatc gtcaatctgg tgatgatgaa gctatggcat tggatgaaac attctgcaca 1680

gcccttgagt atggcctacc accgactggt ggttggggat tgggaattga tcgccttaca 1740

atgttgctga ctgattctca gaatatcaag gaagttcttc tattcccggc tatgaagcct 1800

caagattag 1809

<210> 3

<211> 602

<212> PRT

<213> Rice

<220>

<223> amino acid sequence of fertility-related Gene OsLysRS

<400> 3

Met Ala Glu Ser Gly Ser Ser Gly Leu Glu Glu Lys Leu Ala Gly Leu

1 5 10 15

Ser Ala Gly Cys Gly Glu Glu Pro Gln Gln Leu Ser Lys Asn Ala Lys

20 25 30

Lys Arg Glu Glu Lys Arg Lys Lys Gln Glu Glu Glu Arg Arg Leu Lys

35 40 45

Glu Glu Glu Lys Lys Lys Lys Ala Ala Ala Thr Ala Ala Ala Ser Gly

50 55 60

Glu Pro Pro Lys Glu Ser Ala Ala Asp Asp Glu Glu Met Asp Pro Thr

65 70 75 80

Gln Tyr Tyr Glu Asn Arg Leu Lys Ala Leu Asp Ser Leu Lys Ala Thr

85 90 95

Gly Val Asn Pro Tyr Pro His Lys Phe Leu Ala Asn Ile Thr Val Ala

100 105 110

Asp Tyr Ile Glu Lys Tyr Lys Ser Met Asn Val Gly Asp Lys Leu Val

115 120 125

Asp Val Thr Glu Cys Leu Ala Gly Arg Ile Met Thr Lys Arg Ala Gln

130 135 140

Ser Ser Lys Leu Leu Phe Tyr Asp Leu Tyr Gly Gly Gly Glu Lys Val

145 150 155 160

Gln Val Phe Ala Asp Ala Arg Thr Ser Glu Leu Glu Asp Asn Glu Phe

165 170 175

Ile Lys Phe His Ser Thr Leu Lys Arg Gly Asp Ile Val Gly Val Cys

180 185 190

Gly Tyr Pro Gly Lys Ser Lys Arg Gly Glu Leu Ser Ile Phe Pro Lys

195 200 205

Lys Ile Val Val Leu Ser Pro Cys Leu His Met Met Pro Arg Gln Lys

210 215 220

Ser Glu Gly Ser Ala Val Pro Thr Pro Trp Ala Pro Gly Met Gly Arg

225 230 235 240

Asn Ile Glu Lys Tyr Val Leu Arg Asp Gln Glu Thr Arg Tyr Arg Gln

245 250 255

Arg Tyr Leu Asp Leu Met Val Asn His Glu Val Arg His Ile Phe Lys

260 265 270

Thr Arg Ser Lys Val Val Ser Phe Ile Arg Lys Phe Leu Asp Gly Leu

275 280 285

Asp Phe Leu Glu Val Glu Thr Pro Met Met Asn Met Ile Ala Gly Gly

290 295 300

Ala Ala Ala Arg Pro Phe Val Thr His His Asn Glu Leu Asn Met Arg

305 310 315 320

Leu Tyr Met Arg Ile Ala Pro Glu Leu Tyr Leu Lys Glu Leu Val Val

325 330 335

Gly Gly Leu Asp Arg Val Tyr Glu Ile Gly Lys Gln Phe Arg Asn Glu

340 345 350

Gly Ile Asp Leu Thr His Asn Pro Glu Phe Thr Thr Cys Glu Phe Tyr

355 360 365

Met Ala Tyr Ala Asp Tyr Asn Asp Leu Ile Glu Leu Thr Glu Thr Met

370 375 380

Leu Ser Gly Met Val Lys Glu Leu Thr Gly Gly Tyr Lys Ile Lys Tyr

385 390 395 400

His Ala Asn Gly Val Glu Lys Pro Pro Ile Glu Ile Asp Phe Thr Pro

405 410 415

Pro Phe Arg Lys Ile Asp Met Ile Glu Glu Leu Glu Ala Met Ala Lys

420 425 430

Leu Asn Ile Pro Lys Asp Leu Ser Ser Asp Glu Ala Asn Lys Tyr Leu

435 440 445

Ile Asp Ala Cys Ala Lys Tyr Asp Val Lys Cys Pro Pro Pro Gln Thr

450 455 460

Thr Thr Arg Leu Leu Asp Lys Leu Val Gly His Phe Leu Glu Glu Thr

465 470 475 480

Cys Val Asn Pro Thr Phe Ile Ile Asn His Pro Glu Ile Met Ser Pro

485 490 495

Leu Ala Lys Trp His Arg Ser Arg Pro Gly Leu Thr Glu Arg Phe Glu

500 505 510

Leu Phe Val Asn Lys His Glu Val Cys Asn Ala Tyr Thr Glu Leu Asn

515 520 525

Asp Pro Val Val Gln Arg Gln Arg Phe Glu Glu Gln Leu Lys Asp Arg

530 535 540

Gln Ser Gly Asp Asp Glu Ala Met Ala Leu Asp Glu Thr Phe Cys Thr

545 550 555 560

Ala Leu Glu Tyr Gly Leu Pro Pro Thr Gly Gly Trp Gly Leu Gly Ile

565 570 575

Asp Arg Leu Thr Met Leu Leu Thr Asp Ser Gln Asn Ile Lys Glu Val

580 585 590

Leu Leu Phe Pro Ala Met Lys Pro Gln Asp

595 600

<210> 4

<211> 423

<212> DNA

<213> Rice

<220>

<223> T-DNA flanking sequence close to left border sequence

<400> 4

agcgtcaatt tcatgacaat ttgtttaccc tagctaaacc ccccttctcc cttgcgcctc 60

cgcttcgcga gcctcatctc ctcgatctct ttcgattcag tggaaaacct aggagaccgg 120

cgcggcatgg cggagtcggg ctcgtcgggt ctggaggaga agctggcggg tctctccgcg 180

ggcggcggcg aggagccgca gcagctctcg aagaagtgcg ctttctcatc gcgcacgcag 240

ccggcatttc ttcttattgt tttttttttc ctccgtagtg tggcttttgt ttaatatgag 300

ttttgtggcg ggtgcagtgc caagaagagg gaggaaaaaa ggaagaagca ggaggaggag 360

cgccggttga aggaggaaga aaataagaag aaggtgaagc agtttgaact taacctttgc 420

cga 423

<210> 5

<211> 285

<212> DNA

<213> Rice

<220>

<223> T-DNA flanking sequence close to the right border sequence

<400> 5

ggctgccgcc gccgccgccg cgacgtcacg gaataaaaag ccctggattc tcactttctc 60

acatggacta ggcccacgaa acctgcttta aaatgggcct ggattagact acgcgggcct 120

ggcccatgaa atgcgctttg cttgggcgaa tcgcaaggcg attacgccgt ggacgagacg 180

agtgagagga ggagagcggc catggcgggg cggagtggcg gcggcggcgg cgggagctcc 240

gggaagagcg ggacggggag gatggtgtcg cgccaaggag ttaaa 285

<210> 6

<211> 27

<212> DNA

<213> artificial sequence

<220>

<223> primer LB-gsp1

<400> 6

gcatgacagc aacttgatca caccagc 27

<210> 7

<211> 29

<212> DNA

<213> artificial sequence

<220>

<223> primer LB-gsp2

<400> 7

atacacattc ttgccagtct tggttagag 29

<210> 8

<211> 28

<212> DNA

<213> artificial sequence

<220>

<223> primer RB-gsp1

<400> 8

cgtcagtgga gatatcacat caatccac 28

<210> 9

<211> 29

<212> DNA

<213> artificial sequence

<220>

<223> primer RB-gsp2

<400> 9

ttgggaccac tgtcggcaga ggcatcttc 29

<210> 10

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer SP10110

<400> 10

tggcctttcc tttatcgcaa 20

<210> 11

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> primer SP10111

<400> 11

aactcctgca gcgacaccat cctc 24

<210> 12

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer SP10112

<400> 12

atgacgcaac ccctcctctc ga 22

<210> 13

<211> 18

<212> DNA

<213> artificial sequence

<220>

<223> primer SMUBP-F

<400> 13

caggagttcg tctctcca 18

<210> 14

<211> 21

<212> DNA

<213> artificial sequence

<220>

<223> primer SMUBP-R

<400> 14

tcagctctgg tattctgatg c 21

<210> 15

<211> 15

<212> DNA

<213> artificial sequence

<220>

<223> primer LYSRS-F

<400> 15

cggagtcggg ctcgt 15

<210> 16

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> primer LYSRS-R

<400> 16

ctaatcttga ggcttcatag cc 22

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer ACTIN-F

<400> 17

gcagaaggat gcctatgttg 20

<210> 18

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> primer ACTIN-R

<400> 18

ggaccctcct atccagacac 20

<210> 19

<211> 26

<212> DNA

<213> artificial sequence

<220>

<223> OsLysRS Forward primer

<400> 19

cacgtttatt atcaaccatc cagaga 26

<210> 20

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> OsLysRS reverse primer

<400> 20

gctcaaacct ctcagtcaat ccag 24

<210> 21

<211> 29

<212> DNA

<213> artificial sequence

<220>

<223> OsLysRS Probe

<400> 21

atgagtccat tggcaaagtg gcataggtc 29

<210> 22

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> OsEF1a Forward primer

<400> 22

agcccaagag gccatcaga 19

<210> 23

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> OsEF1a reverse primer

<400> 23

gccaatacca ccgatcttgt aca 23

<210> 24

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> OsEF1a probe

<400> 24

aagcccctgc gtcttcccct tca 23

Claims

1. A method for creating male sterile rice, which comprises overexpressing a rice fertility-related gene LysRS gene having a nucleotide sequence shown in SEQ ID NO. 1 or 2 in rice.

2. A method for creating male sterile rice comprises over-expressing rice development related protein LysRS protein with an amino acid sequence shown as SEQ ID NO. 3 in rice.

3. A method for interfering fertility of transgenic pollen, which comprises overexpressing a rice fertility-related gene LysRS gene having a nucleotide sequence shown in SEQ ID NO. 1 or 2 in rice.

4. A method for interfering fertility of transgenic pollen, comprising overexpressing a rice development-related protein LysRS protein having an amino acid sequence shown in SEQ ID NO. 3 in rice.