CN113637688A

CN113637688A - Rice amylose content regulating gene OsACF1 and application thereof

Info

Publication number: CN113637688A
Application number: CN202111111365.8A
Authority: CN
Inventors: 赵国超; 李建粤; 王彤
Original assignee: Shanghai Normal University
Current assignee: Shanghai Normal University
Priority date: 2021-09-23
Filing date: 2021-09-23
Publication date: 2021-11-12
Anticipated expiration: 2041-09-23
Also published as: CN113637688B

Abstract

The invention relates to a rice amylose content gene OsACF1 and application thereof. The invention discloses a novel gene OsACF1 capable of regulating and controlling the amylose content in rice. The amino acid sequence of OsACF1 is shown as SEQ ID NO.1, and the application is as follows: by adopting a conventional method, the OsACF1 gene is knocked out, changed, inhibited or excessive, so that the expression level of the OsACF1 gene in a conventional rice variety is changed, and further rice with different amylose contents is obtained. The rice with low amylose content prepared by the invention has no abnormal phenotype in the vegetative growth period of the rice, but the amylose content of the mature rice is reduced. If the method is applied to rice breeding, the rice quality can be obviously improved, a new gene resource is provided for cultivating a novel high-quality rice variety, and the method has important application in agricultural production. On the other hand, rice germplasm with high amylose content can be obtained by over-expressing the OsACF1 gene, and a foundation is laid for cultivating high resistant starch special rice.

Description

Rice amylose content regulating gene OsACF1 and application thereof

Technical Field

The invention relates to a gene sequence capable of controlling the content of amylose in rice seed endosperm and application of the gene sequence.

Background

Rice is one of the important food crops in the world, and about 50% of the world population uses rice as staple food, and rice is also a raw material for processing many foods. Because the genome of rice is small and the rice transformation system is mature, the rice can be used as a model plant for monocotyledon research.

The ratio of amylose to total starch is called Amylose Content (AC), and the high or low content of amylose is an important factor in determining the quality of rice and its use. The amylose content of rice of different rice varieties is greatly different, wherein indica rice has 20-30% of amylose content, japonica rice has 15-22% of amylose content, and the amylose content of the glutinous rice is lower than 2%. The rice with high amylose content has relatively poor rice quality and large expansibility and is hard after cooked; glutinous rice with amylose content lower than 2% is too soft and has poor elasticity; the soft rice with low amylose content (8-12%) has a texture between glutinous and viscosity, good taste, good sweetness and refreshing taste, and is fluffy and soft when being cooked in cold or hot rice, and does not retrogradation or harden after being cooled. The current report also shows that the transparency of the rice has a certain relation with the amylose content, and the amylose content of different types of rice is as follows from high to low: the transparency of the rice is from high to low: long-shaped rice > round-grained rice > soft rice > glutinous rice (Zhangzheng Mao et al, modern food technology 2015,31(6): 190-.

The Wx gene is The key enzyme gene for amylose synthesis, and encodes Granule-Bound Starch Synthase I (GBSSI) (Wang et al, The Plant Journal,1995, 7 (4): 613-) -622). Wx has mainly two alleles Wx^aAnd Wx^bJaponica rice has Wx^bAllelic type, most indica having Wx^aAn allelic type. The mutation of Wx gene can reduce the content of amylose in rice, thereby improving the quality of riceFlexibility. When Wx is completely disabled, the amylose content of rice is less than 2%, such as glutinous rice. Weak mutations in the Wx coding sequence, e.g. Wx^mqType soft rice, rice with an amylose content of between 6 and 12% (Zhang et al, Molecular Plant,2019, 12: 1157-. In addition to the Wx gene, the Du1 gene has also been reported to be directly regulated by Wx^bSplicing of the precursor mRNA, resulting in Wx^bSplicing of the mRNA of the gene does not proceed smoothly, resulting in a decrease in the amylose content (Zeng et al, Plant Molecular Biology,2007,65: 501-.

With the rapid development of economy and the improvement of the living standard of people, the requirement of common people on the rice quality is improved year by year. Soft rice is currently favored by consumers and breeders because of its advantages of soft texture, elasticity, no retrogradation after cooling and no hardening, such as the soft rice variety Nanjing 46, etc., and has an amylose content of 8% to 12%, which is mainly of a weak allelic type of the Wx gene, such as Wx^mqAnd Wx^hpThe genotype of the plant.

People in different areas have great difference on the soft and hard degree preference of rice. In order to create rice with different amylose contents, scientists used CRISPR/Cas9 gene editing technology to accurately edit Wx gene promoter and 5' UTR region or replace key amino acids of Wx protein to obtain new rice germplasm (AC is between 0% and 12%) with different amylose contents (Zeng et al, Plant Biotechnology Journal,2020,18: 2385-.

Although the rice germplasm with different amylose contents is created at present, the rice germplasm is obtained by screening different allelic gene types of Wx or editing Wx genes, so that the identification and cloning of new amylose content genes enrich rice gene resources and lay a foundation for cultivating or creating new high-quality rice new germplasm.

The high amylose starch is the main source of natural resistant starch food, and can effectively improve the intestinal health of human bodies and prevent diabetes and cardiovascular diseases. Rice is the main food crop in China, but the content of resistant starch in conventional rice endosperm starch is low. It has been reported that the amylose content can be significantly increased by inhibiting the expression of the starch branching enzyme gene Sbel/IIb by antisense RNA technology (Qinfeng Ling, university of Yangzhou Master academic thesis, 2011, Doi: 10.7666/d.y2049980). Cloning new amylose content gene, and laying foundation for creating new high-amylose resistant starch rice new germplasm by a biotechnology method.

Disclosure of Invention

Aiming at the defects of the current rice in the aspect of amylose content control gene resources, the invention obtains the amylose content control gene OsACF1 and an application method for changing the amylose content by using the same through a large number of experiments. The characteristic that the OsACF1 gene and the protein thereof regulate the content of the amylose of rice is utilized, the content of the amylose of rice is controlled by utilizing a transgenic technology, and the novel rice with the property of the content of the amylose is generated by mutating the protein sequence and inhibiting or excessively expressing the protein, so that the OsACF1 gene has very important application in agricultural production.

According to one aspect of the invention, the amylose content regulatory gene OsACF1 is provided, wherein the amino acid sequence encoded by the amylose content gene OsACF1 is shown as SEQ ID No.1, or the amino acid sequence encoded by the amylose content gene OsACF1 is at least 90% homologous with the sequence shown as SEQ ID No. 1.

Preferably, the nucleotide sequence of the amylose content gene OsACF1 is shown as SEQ ID No.2, or the nucleotide sequence of the amylose content gene OsACF1 is at least 90% homologous with the sequence of SEQ ID No. 2.

According to a second aspect of the present invention, there is provided an application of the above-mentioned amylose content controlling gene OsACF1, wherein the application comprises: for the rice containing the amylose content regulating gene OsACF1, the rice gene is edited, and the amylose content regulating gene OsACF1 is knocked out, changed, inhibited or over-expressed, so that the OsACF1 gene expression level in the target rice variety is changed, and further the rice varieties with different amylose content characters are obtained

According to a third aspect of the invention, a method for breeding rice line germplasm with different amylose contents is provided, wherein the method comprises the following steps: selecting conventional rice varieties, processing and cultivating to obtain rice with different amylose contents, wherein the processing is that the conventional method is adopted to delete, mutate or inhibit the nucleotide sequence of the amino acid shown as SEQ ID NO.1 in the rice, and further the expression level of the polypeptide corresponding to the amino acid sequence is reduced, increased or the activity is changed.

Preferably, the rice variety is japonica rice variety "yinxiang 38" or "japan sunny" or indica rice variety "9311".

Preferably, the method further comprises: and carrying out gene editing on the target rice variety, and mutating the nucleotide sequence shown as SEQ ID NO.2 contained in the target rice seed into the nucleotide sequence shown as SEQ ID NO.3, or mutating the amino acid sequence shown as SEQ ID NO.1 in the target rice seed into the amino acid sequence shown as SEQ ID NO.4 to obtain the rice strain with low amylose content.

More specifically, the invention adopts a conventional method to mutate the nucleotide sequence shown as SEQ ID NO.2 in a conventional rice variety into SEQ ID NO.3, thereby obtaining a rice line with low amylose content, namely a natural mutant of 'Yinxiang 38' (osdaf 1-1).

The invention adopts a conventional method to mutate an amino acid sequence shown as SEQ ID NO.1 in a conventional rice variety into SEQ ID NO.4, thereby obtaining a rice strain with low amylose content character, namely a natural mutant of 'Yinxiang 38' (osdaf 1-1).

Preferably, the above method further comprises the steps of: the CRISPR-CAS9 gene editing technology is adopted to change the nucleotide sequence SEQ ID NO.2 of the amino acid sequence shown as SEQ ID NO.1 so as to lead the activity of the polypeptide corresponding to the amino acid sequence to be lost or reduced.

Preferably, the method for constructing the CRISPR-CAS9 gene editing vector in the CRISPR-CAS9 gene editing technology comprises the following steps:

(a) selecting a specific fragment of 20bp from 1 st to 20 th of a nucleotide sequence shown as SEQ ID NO.2 in an OsACF1 gene coding region sequence as a target site;

(b) the reference (Zhang et al. the CRISPR/Cas9system products specific and homozygous targeted gene editing in the one generation. plant Biotechnol J.12, 797-807 (2014)) combines a pair of primers such as SEQ ID NO.5 and SEQ ID NO.6 in a PCR apparatus at 95 ℃ -20 ℃ for 1sec minus 0.1 ℃. The vector RCKO was digested with the restriction endonuclease Bsa1 and the vector and target sequences were ligated using T4 ligase. After sequencing verification, the RCKO-OsDAF1 plasmid was successfully constructed, and Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 was transformed.

(c) Transferring Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 containing OsACF1 CRISPR-CAS9 knock-out and RCKO-OsDAF1 into the japonica rice Nipponbare, and culturing to obtain the product;

the invention adopts a CRISPR-CAS9 method to mutate the nucleotide sequence shown in SEQ ID NO.2 in the conventional rice variety into SEQ ID NO.7, thereby obtaining the rice line with low amylose content character, namely osdaf1-2 mutant.

The invention adopts a CRISPR-CAS9 method to shift the code of an amino acid sequence shown as SEQ ID NO.1 in a conventional rice variety, terminate the amino acid sequence in advance, and mutate the amino acid sequence into SEQ ID NO.8, thereby obtaining a rice strain with low amylose content, namely an osdaf1-2 mutant.

In a fourth aspect, the invention provides an application of low-amylose content rice in rice breeding, wherein a low-amylose content rice line obtained by the application is used as a parent, and is matched with other parents with the advantages of yield and resistance traits to culture high-yield high-resistance high-quality rice for conventional rice breeding.

In a fifth aspect, the present invention also relates to a method for restoring low amylose content traits to rice, comprising the steps of: the OsACF1 gene is transferred into the rice with low amylose content obtained by the application by adopting a conventional genetic means, so that the amylose content of the rice with silver aroma 38(osdaf1-1) mutated by the OsACF1 gene is recovered to normal japonica rice.

Preferably, the method comprises the steps of: transferring Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 complementarily constructed by OsACF1 into the rice with low amylose content, and culturing to obtain the rice with low amylose content; wherein the OsACF1 is complementarily constructed to contain a nucleotide sequence shown as SEQ ID NO. 9.

Preferably, the method specifically comprises the following steps:

(a) taking a Nipponbare genome as a reference sequence, synthesizing a 2673bp promoter sequence fragment and a 2172bp gene coding sequence fragment of the OsACF1 gene shown as SEQ ID NO.9 by using a chemical synthesis method;

(b) providing an Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 carrying a complementary construction vector for expressing OsACF 1;

(c) transferring Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 complementarily constructed by OsACF1 into the rice with the low amylose content character, and culturing to obtain the rice with the low amylose content character; wherein the OsACF1 is complemented to construct nucleotide with a sequence shown as SEQ ID NO. 9.

Preferably, the step (c) is specifically:

contacting rice cells or tissues or organs with the agrobacterium tumefaciens of step (b), thereby transferring the nucleotide sequence encoding the amino acid shown as SEQ ID No.9 into the rice cells and integrating it into the chromosome of the rice cells;

and (3) selecting the rice cells or tissues transferred with the nucleotide, and regenerating to obtain rice plants.

Has the advantages that:

the inventor of the invention finds a novel gene resource capable of effectively controlling the amylose content, and realizes the purpose of controlling the amylose content of rice seeds by controlling the OsACF1 gene of rice and the coded protein thereof to obtain rice variant strains with different amylose contents, and the current experimental result shows that the amylose content is adjusted to be within the range of 7% -16%. The rice mutant obtained by the invention has no obvious difference with the original parent or the corresponding complementary plant in the vegetative stage, has the main characteristics of different endosperm amylose contents of seeds in the mature stage, and has very important application in high-quality rice cultivation and special-function rice cultivation.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 shows amylose contents of OsACF1 natural mutant "Yinxiang 38" (osdaf1-1), transgenic complementation plant (pOsACF1-OsACF1 CDS/"Yinxiang 38"), "Nipponbare" and "Nipponbare" in the context of gene editing mutant osdaf1-2 brown rice, respectively, wherein: FIG. 1A shows, from left to right, OsACF1 natural mutant "Yinxiang 38" (osdaf1-1) brown rice, transgenic complementation plant (pOsACF1-OsACF1 CDS/"Yinxiang 38") brown rice, "Nipponbare" brown rice, and "Nipponbare" background gene editing mutant osdaf1-2 brown rice. FIG. 1B shows, from left to right, the amylose content of the OsACF1 natural mutant "Yinxiang 38" (osdaf1-1), the amylose content of the transgenic complementation plants (pOsACF1-OsACF1 CDS/"Yinxiang 38"), the amylose content of "Nipponbare" and the amylose content of the gene editing mutant osdaf1-2 in the background of "Nipponbare", respectively.

FIG. 2 is a schematic diagram of OsACF1 gene location, structure and mutation site; wherein, FIG. 2A is a schematic diagram of OsACF1 gene location, and the numbers marked on the vertical lines are the names, recombinants and genetic distances of the primers used; chr.6 indicates that the gene is located on chromosome 6; the red area is the interval position of the OsACF 1; FIG. 2B is a schematic diagram of the gene structure and mutation site.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. In the following examples, the experimental methods without specifying the conditions are generally referred to according to the conventional conditions, for example, molecular cloning such as Sambrook: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations. The OsACF1 gene is a nucleotide sequence which codes an amino acid sequence shown as SEQ ID NO. 1.

Example 1 cloning of amylose content controlling Gene OsACF1

1.1 screening of "Yinxiang 38" (osacf1-1) Low amylose Rice

In the embodiment, a natural mutant rice 'silver fragrant 38' and 'silver fragrant 38' with low amylose content are screened out by screening natural rice strains on a large scale, and the amylose content of the rice is 8.5%. The gene OsACF1 is located by map-based cloning, and the sequence of the coding region of the amylose content trait gene OsACF1 is shown as SEQ ID NO. 2.

1.2 genetic mapping of amylose content control Gene in Rice

A rice gene location cloning (map-based cloning or position cloning) population which consists of an amylose content control protein gene OsACF1 and a mutant gene OsACF1 thereof and is constructed by the inventor is located in 1 small genome segment, such as 100Kb, according to molecular markers. On this basis, genomic DNA clones containing this fragment were isolated by conventional methods. One of the rice amylose content control proteins OsACF1 is determined by sequencing and further hybridization identification.

The analysis result of the whole nucleotide sequence shows that: the total length of the rice amylose content regulating gene OsACF1 is 7044bp (SEQ ID NO.10, comprising a regulating region and an intron). Through software analysis and cDNA cloning, the ORF is shown as SEQ ID NO.2, the rice amylose content control protein with 723 amino acids in the total length is coded, and the amino acid sequence is shown as SEQ ID NO. 1.

1.3 Point mutation of Rice Low amylose Gene OsACF1

The OsACF1 mutant material of the embodiment is obtained by natural mutation of a conventional japonica rice variety 'Yinxiang 38' through an OsACF1 gene sequence, and by comparing the sequence of an OsACF1 mutant gene OsACF1, the amylose content of rice is reduced due to the deletion of key amino acids of the amylose content control protein of rice; in the embodiment, the OsACF1 mutant gene is subjected to base substitution (the sequence of which is shown as SEQ ID NO. 3) in 1221 base pairs of a coding region, so that a stop codon is formed in advance, key amino acid deletion and function loss of rice amylose content control protein OsACF1 are caused, and the 'silver aroma 38' rice has low amylose content, and the 'silver aroma 38' rice amylose content is 8.5%.

1.4 method for restoring the Low amylose content trait of the osacf1 mutant

The gene promoter sequence and the gene coding region sequence of the OsACF1 gene are transferred into a silver incense 38(osdaf1-1) mutant plant, so that the amylose content of the silver incense 38(osdaf1-1) mutant can be restored to the normal japonica rice level. Synthesizing a promoter sequence fragment comprising 2673bp and a gene coding sequence fragment comprising 2172bp, which are shown as SEQ ID NO.9, of an OsACF1 gene into pCAMBIA1301 by using a chemical synthesis method with a Japanese acrylonitrile genome as a reference sequence, carrying out sequencing verification to verify the correctness, introducing the vector into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by a heat shock method to obtain OsDAF1 complementation to construct Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, and transforming mature embryo callus of 'Yinxiang 38' (agar 1-1) by using a genetic transformation means so as to transfer the nucleotide coding the amino acid shown as SEQ ID NO.1 into a rice cell and integrate the nucleotide on a chromosome of the rice cell; regenerating to obtain rice plant; to see if the amylose content of the seeds of "Yinxiang 38" (osdaf1-1) was restored to normal japonica rice level.

Complementary plants were obtained from the T0 generation and T1 seeds were obtained from the T0 generation of complementary plants, and fig. 1B shows that the amylose content of T1 seeds was 15.4%, indicating that the amylose content of rice in complementary plants was restored to normal japonica rice levels (fig. 1B).

Example 2 different methods for creating Low amylose Rice

1.1 knocking out OsACF1 in rice variety by CRISPR-CAS9 means to create OsACF1-2 rice with low amylose content

In order to apply the OsACF1 protein, a CRISPR-CAS9 knockout vector of the OsACF1 gene is constructed in the embodiment, and a wild type Nipponbare plant is transformed to knock out the expression of the OsACF1, so that the purpose of changing the content of the amylose in the rice is achieved.

The process of CRISPR-CAS9 knockout was: the method in the reference (Zhang et al, the CRISPR/Cas9system products specific and homozygous targeted gene editing in the field in one generation. plant Biotechnol J.12, 797-807 (2014)) utilizes a pair of primers as shown in SEQ ID NO.5 and SEQ ID NO.6, which are annealed and bound together to form a target sequence in a PCR according to a procedure of 95 ℃ -20 ℃ for 1sec to 0.1 ℃.

OsACF1-F:5’TGTGTGGGGTCGATGACGTCAGCCAT 3’(SEQ ID NO.5)

OsACF1-R:5’AAACATGGCTGACGTCATCGACCCCA 3’(SEQ ID NO.6)

The vector RCKO (known vector, see Zhang et al, the CRISPR/Cas9system products specific and homozygous targeted gene editing in rice in one generation. plant Biotechnol J.12, 797-807 (2014)) was digested with the restriction enzyme Bsa1 and the vector and target sequences were ligated using T4 ligase. After sequencing verification, the RCKO-OsDAF1 plasmid was successfully constructed, and Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 was transformed.

Agrobacterium containing the RCKO-OsDAF1 construct was streaked on YEB plates containing Kan (50mg/ml) to obtain single colonies. Inoculating single colony into 3ml YEB liquid culture medium containing (Kan and rif) antibiotics, shaking and culturing at 28 deg.C overnight, inoculating into 50ml YEB liquid culture medium containing antibiotics at 1% inoculum size on day 2, continuing shaking and culturing at 200rpm until OD₆₀₀When the speed is about 0.3 to 0.6, fresh agrobacterium liquid is centrifuged at 5000rpm for 5 minutes, collected and resuspended in 1/3 volumes of AAM-AS liquid culture medium, and then the agrobacterium liquid can be used for transforming various receptor materials of rice.

In this example, mature seed callus of Nipponbare rice was transformed by a conventional Agrobacterium transformation method. And (3) taking mature seeds for induction, placing the seeds on an N6D2 culture medium for inducing callus, culturing the seeds at the temperature of 26 +/-1 ℃ under the condition of keeping out of the sun, subculturing after 15 days, and culturing for 8 days to be used for transformation. The callus was soaked in fresh AAM Agrobacterium solution and shaken constantly, after 20 minutes the rice material was removed, excess solution was blotted on sterile filter paper and subsequently transferred to N6D2C medium for 3 days at 26 ℃. In the co-culture, acetosyringone was added to the co-culture medium at a concentration of 100 mM/L. After 3 days, the calli were removed from the co-culture medium, the embryos excised and transferred to a selection medium containing 50mg/L hygromycin and timentin for selective culture. After 12 days the resistant calli were transferred to selection medium containing 50mg/L hygromycin and timentin for further selection. After 12 days, the vigorous resistant callus is transferred to a differentiation culture medium to be cultured for about two weeks (24 hours of illumination), and after green buds grow out, a new differentiation culture medium is replaced to continue differentiation culture until buds grow out. Regenerated plantlets were rooted and strong on 1/2M medium, and then transferred to transgenic dedicated experimental plots.

Extracting total DNA of leaves from a positive plant, and identifying by using an identifying primer to perform sequencing identification, thereby proving that a transgenic plant OsACF1-2 with OsACF1 knocked out successfully is obtained, so that a nucleotide sequence shown as SEQ ID NO.2 in a conventional rice variety is mutated into SEQ ID NO.7, an amino acid sequence shown as SEQ ID NO.1 in the conventional rice variety is subjected to frame shifting and early termination, and is mutated into SEQ ID NO.8, and further, rice with low content of OsACF1-2 amylose is obtained.

Phenotypically, the transparency of the OsACF1-2 mutant brown rice is slightly low in the maturation stage (fig. 1A), and amylose content measurement shows that the amylose content of the OsACF1-2 brown rice is 7.6% (fig. 1A), and the amylose content of the OsACF1-2 brown rice is remarkably reduced relative to that of control japonica rice (fig. 1A), which indicates that the accumulation of brown rice amylose is inhibited after the gene of the OsACF1 is knocked out, and new low-amylose rice can be obtained.

1.2 obtaining Low amylose Rice by hybridization

The osdaf1-1 mutant rice 'Yinxiang 38' is hybridized with a japonica rice variety 'Jiahua No. 1' and an indica rice variety '9311', rice plants with low amylose content appear in the F2 generation, and the separation rule is 3:1 met, so that the OsACF1 gene can also generate the plants with the low amylose content when nucleotide sequence changes occur in other rice varieties.

Example 3 creation of high amylose Rice Using modern Biotechnology

1.1 creation of high amylose Rice by overexpression of OsACF1

When OsACF1 gene is mutated or reduced in function, rice with low amylose content can be produced, and conversely, rice with high amylose content can be produced by over-expressing OsACF1 gene. The maize Ubiquitin promoter is utilized to drive the overexpression of OsACF1 in conventional rice, and the rice with high amylose content can be obtained.

In conclusion, the invention obtains variant strains with different rice amylose contents by controlling the OsACF1 gene of the transcription factor of the zinc finger protein of the rice and the coding protein thereof, thereby realizing the control of the amylose content of the rice; the rice variant strain obtained by the invention has no obvious difference with the original parent or the corresponding complementary plant in the vegetative growth period, and the content mode of the amylose of the mature seed brown rice at the later development stage is changed, thereby having very important application in agricultural production.

While the principles of the invention have been described in detail in connection with the preferred embodiments thereof, it will be understood by those skilled in the art that the foregoing embodiments are merely illustrative of exemplary implementations of the invention and are not limiting of the scope of the invention. The details of the embodiments are not to be interpreted as limiting the scope of the invention, and any obvious changes, such as equivalent alterations, simple substitutions and the like, based on the technical solution of the invention, can be interpreted without departing from the spirit and scope of the invention.

Sequence listing

<110> Shanghai university of Master

<120> rice amylose content regulating gene OsACF1 and application thereof

<130> 2021.7.24

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 723

<212> PRT

<213> Rice (Oryza sativa)

<400> 1

Met Ala Asp Val Ile Asp Pro Ala Ser Thr Glu Ala Pro Arg Ala Arg

1 5 10 15

Arg Pro Pro Pro Pro Pro Pro Asp Ser Pro Glu Gly Arg Ser Pro Pro

20 25 30

Leu Pro Pro Pro Pro Pro Gly Gly Pro Pro Gln Pro Ala Ala Thr Arg

35 40 45

Lys Arg Ser Arg Ser Pro Pro Pro Pro Pro Pro Pro Pro Ser Leu Pro

50 55 60

Pro Pro Pro Pro Leu Gly Ser Ser Arg Pro Glu Arg Tyr Arg Asp Asn

65 70 75 80

His His Arg Gly Gly Gly Gly Gly Arg Gly Gly Gly Ser Ser Ser Pro

85 90 95

Pro Pro Tyr Arg Ser Gly Arg Arg His Ser Pro Ser Arg Arg Ser Pro

100 105 110

Ser Pro Pro Phe Lys Arg Ser Arg Arg Asp Asp Gly Tyr Asp Arg Arg

115 120 125

Gly Gly Arg Gly Ser Pro Pro Pro Arg Tyr Gly Tyr Gly Asp Arg Arg

130 135 140

Tyr Gly Tyr Asp His Glu Arg Gly Gly Gly Arg Gly Gly Tyr Asp Asp

145 150 155 160

Asp Arg Tyr His Gly Arg Tyr Gln Asn Arg Ala Ala Asp Trp Ala Asp

165 170 175

Ser Gly Phe Gly Ala Ser Asn Asp Gly Pro Gly Ile Thr Gln Arg Glu

180 185 190

Gly Leu Met Thr Tyr Lys Gln Phe Ile Gln Val Leu Glu Asp Asp Ile

195 200 205

Ser Pro Ala Glu Ala Glu Lys Arg Tyr Gln Glu Tyr Arg Thr Glu Tyr

210 215 220

Ile Thr Thr Gln Lys Arg Ala Tyr Phe Asp Leu Asn Lys Asn Asp Asp

225 230 235 240

Arg Leu Lys Asp Lys Tyr His Pro Thr Asn Leu Ser Ser Val Ile Asp

245 250 255

Arg Arg Asn Asp Ser Cys Lys Ala Thr Ala Lys Asp Phe Phe His Asp

260 265 270

Leu Gln Asn Gly Thr Leu Asp Leu Gly Pro Gly Ile Thr Ala Ala Ala

275 280 285

Ala Ser Gly Ser Asp Gly Asn Ser Asp Asp Asp Gly Asp Ser Asp Lys

290 295 300

Arg Arg Lys His Gly Arg Gly Ser Ser Lys Glu Thr Asp Pro Leu Ser

305 310 315 320

Gly Ala Pro Val Ala His Pro Val Ser Ser Glu Ser Arg Arg Val Gln

325 330 335

Val Asp Ile Glu Gln Ala Leu Ala Leu Val Arg Lys Leu Asp Thr Glu

340 345 350

Lys Gly Ile Val Gly Asn Ile Leu Ser Ser Gly Asp His Asp Lys Ser

355 360 365

Asp Val Asp Lys Ser His Ile Gly Ser Met Gly Pro Ile Ile Ile Ile

370 375 380

Arg Gly Leu Thr Thr Val Lys Gly Leu Glu Gly Val Glu Leu Leu Asp

385 390 395 400

Thr Leu Leu Thr Tyr Leu Trp Arg Ile His Gly Val Asp Tyr Tyr Gly

405 410 415

Met Ser Glu Thr Asn Glu Ala Lys Gly Ser Arg His Val Arg Ala Asp

420 425 430

Asn Lys Thr Ser Asn Thr Thr Asn Ile Asn Ala Ala Asp Trp Glu Lys

435 440 445

Lys Val Asp Thr Phe Trp Gln Glu Arg Leu Arg Gly Gln Asp Pro Met

450 455 460

Val Ile Leu Ala Ala Lys Asp Lys Ile Asp Ala Ala Ala Val Glu Val

465 470 475 480

Leu Glu Pro Tyr Val Arg Lys Ile Arg Asp Glu Lys Tyr Gly Trp Lys

485 490 495

Tyr Gly Cys Gly Ala Lys Gly Cys Thr Lys Leu Phe His Ala Pro Glu

500 505 510

Phe Val His Lys His Leu Arg Leu Lys His Pro Glu Leu Val Leu Glu

515 520 525

Leu Thr Ser Lys Val Arg Glu Asp Leu Tyr Phe Gln Asn Tyr Met Asn

530 535 540

Asp Pro Asn Ala Pro Gly Gly Thr Pro Val Met Gln Gln Ser Ala Pro

545 550 555 560

Asp Lys Ser Arg Gln Arg Pro Gly Met Asp Asn Arg Leu Arg Tyr Asp

565 570 575

Arg Ala Asn Arg Arg Glu Tyr Asp Arg Ala Glu Arg Asp Gly Ser Arg

580 585 590

Tyr Gly Arg Gly Asp Arg Ser Pro Ser Leu Asp Gly Ala Asp Asp Gln

595 600 605

Met Phe Asp Ala Phe Arg Gly Arg Gly Pro Asn Ala Pro Phe Val Pro

610 615 620

Glu Leu Pro Ala Pro Pro Ile Leu Met Pro Ile Pro Gly Ala Gly Pro

625 630 635 640

Leu Gly Pro Phe Val Pro Ala Pro Pro Glu Ile Ala Met His Met Leu

645 650 655

Arg Glu Gln Gly Pro Pro Pro Pro Phe Glu Pro Asn Gly Pro Pro His

660 665 670

Ala Asn Pro Gly Val Leu Gly Pro Met Met Gly Gly Pro Ala Pro Ile

675 680 685

Ile Thr Met Pro Pro Ser Phe Arg Gln Asp Pro Arg Arg Leu Arg Ser

690 695 700

Tyr Asn Asp Leu Asp Ala Pro Asp Glu Glu Val Thr Val Leu Asp Tyr

705 710 715 720

Arg Ser Leu

<210> 2

<211> 2172

<212> DNA

<213> Rice (Oryza sativa)

<400> 2

atggctgacg tcatcgaccc cgcctccacc gaggcccccc gcgcgcgccg cccgccgccg 60

cctccgcccg acagcccgga gggccgctcg ccgccgctcc cgcccccgcc ccccggtggc 120

ccgccgcagc cggcggccac ccgcaagcgg agccgctcgc caccgccgcc tcccccgccg 180

ccctccctcc cgccgccccc gccgctcggc tcgtcgcgcc ccgagcgcta ccgcgacaac 240

caccaccggg gaggaggcgg tggccggggt gggggtagtt ccagcccccc gccgtatcgg 300

agtggccgcc gccactcccc gtcgaggaga tccccttcgc cgccgttcaa gaggtcgcgg 360

cgggacgacg ggtacgaccg ccgtggcggc cgtgggagcc cgccgccgcg gtacgggtac 420

ggcgacagga ggtatggata tgaccacgag cgtggtggag gcagaggtgg gtatgatgat 480

gaccgatacc atggcaggta tcaaaatcgc gcagcagatt gggccgattc agggtttggg 540

gcatccaatg atggtcctgg aattacccaa agggaaggac tgatgactta caaacagttc 600

atccaagttc ttgaggatga tatttcacct gctgaagctg agaaacggta tcaagaatac 660

aggacagagt acatcactac tcaaaaacgt gcttattttg accttaacaa gaatgatgat 720

cggttgaaag acaagtacca tccgaccaac ttgtcatctg ttattgacag gaggaatgat 780

agttgtaagg caacagcaaa ggatttcttt catgatttgc aaaatggaac tctggacctt 840

ggccctggaa taactgcggc tgcagcaagt ggcagtgatg gaaattctga tgatgatgga 900

gacagtgaca agagaagaaa gcatggcagg ggttcctcaa aagaaacaga ccctctttct 960

ggtgctcccg tggctcatcc agttagctct gaatctcgac gggttcaagt tgacattgaa 1020

caagctctag cccttgtgcg taagcttgac actgagaagg gtattgtggg gaatatccta 1080

tcaagtggcg atcatgacaa atcagatgta gacaagtctc atattggatc tatggggcct 1140

ataattataa tccgaggctt aaccactgtc aaaggccttg aaggtgttga gctcctagat 1200

actcttctta cctatttatg gcgtattcat ggtgttgatt actatggcat gtctgagaca 1260

aatgaagcaa aaggcagtcg ccatgtcaga gcagacaata agacgtctaa tacaaccaat 1320

attaatgccg ctgactggga aaagaaggtg gatactttct ggcaagaaag gctgagaggt 1380

caggacccca tggtaatatt agcagccaag gacaaaatcg atgcagcagc tgtggaagtt 1440

ctggaacctt atgtcaggaa gataagggat gaaaaatatg gttggaaata tggctgtgga 1500

gctaagggtt gtacgaaact tttccatgct cctgagttcg ttcacaagca tttgaggctg 1560

aagcatccag agcttgtgtt agagttgact tccaaagtcc gagaggatct ctatttccaa 1620

aattacatga atgatcctaa tgcacctggt ggaactccag ttatgcaaca gtctgcacca 1680

gacaaatcaa gacagagacc tggtatggat aatcgtctga gatatgaccg tgccaatcgt 1740

agagaatatg atagggcaga gagagatgga agcagatatg gtagaggtga tcgttctcca 1800

agtcttgatg gcgctgatga tcagatgttt gatgctttcc gtgggcgagg tccaaatgct 1860

ccttttgttc ctgaacttcc cgctccgcca attttgatgc ctattcctgg tgctggtcct 1920

ttgggtccat ttgttcctgc acctccagaa atagccatgc atatgctgag agagcaaggg 1980

ccgccacctc catttgaacc aaacggacct cctcatgcca acccaggagt gcttggacca 2040

atgatgggtg gtcctgcgcc aattataacc atgcctccat cttttcgtca agatcctcgc 2100

cgtttgcgaa gttacaatga ccttgatgct ccggacgagg aagttaccgt tcttgactac 2160

agaagtttgt ag 2172

<210> 3

<211> 2172

<212> DNA

<213> Rice (Oryza sativa)

<400> 3

atggctgacg tcatcgaccc cgcctccacc gaggcccccc gcgcgcgccg cccgccgccg 60

cctccgcccg acagcccgga gggccgctcg ccgccgctcc cgcccccgcc ccccggtggc 120

ccgccgcagc cggcggccac ccgcaagcgg agccgctcgc caccgccgcc tcccccgccg 180

ccctccctcc cgccgccccc gccgctcggc tcgtcgcgcc ccgagcgcta ccgcgacaac 240

caccaccggg gaggaggcgg tggccggggt gggggtagtt ccagcccccc gccgtatcgg 300

agtggccgcc gccactcccc gtcgaggaga tccccttcgc cgccgttcaa gaggtcgcgg 360

cgggacgacg ggtacgaccg ccgtggcggc cgtgggagcc cgccgccgcg gtacgggtac 420

ggcgacagga ggtatggata tgaccacgag cgtggtggag gcagaggtgg gtatgatgat 480

gaccgatacc atggcaggta tcaaaatcgc gcagcagatt gggccgattc agggtttggg 540

gcatccaatg atggtcctgg aattacccaa agggaaggac tgatgactta caaacagttc 600

atccaagttc ttgaggatga tatttcacct gctgaagctg agaaacggta tcaagaatac 660

aggacagagt acatcactac tcaaaaacgt gcttattttg accttaacaa gaatgatgat 720

cggttgaaag acaagtacca tccgaccaac ttgtcatctg ttattgacag gaggaatgat 780

agttgtaagg caacagcaaa ggatttcttt catgatttgc aaaatggaac tctggacctt 840

ggccctggaa taactgcggc tgcagcaagt ggcagtgatg gaaattctga tgatgatgga 900

gacagtgaca agagaagaaa gcatggcagg ggttcctcaa aagaaacaga ccctctttct 960

ggtgctcccg tggctcatcc agttagctct gaatctcgac gggttcaagt tgacattgaa 1020

caagctctag cccttgtgcg taagcttgac actgagaagg gtattgtggg gaatatccta 1080

tcaagtggcg atcatgacaa atcagatgta gacaagtctc atattggatc tatggggcct 1140

ataattataa tccgaggctt aaccactgtc aaaggccttg aaggtgttga gctcctagat 1200

actcttctta cctatttatg acgtattcat ggtgttgatt actatggcat gtctgagaca 1260

aatgaagcaa aaggcagtcg ccatgtcaga gcagacaata agacgtctaa tacaaccaat 1320

attaatgccg ctgactggga aaagaaggtg gatactttct ggcaagaaag gctgagaggt 1380

caggacccca tggtaatatt agcagccaag gacaaaatcg atgcagcagc tgtggaagtt 1440

ctggaacctt atgtcaggaa gataagggat gaaaaatatg gttggaaata tggctgtgga 1500

gctaagggtt gtacgaaact tttccatgct cctgagttcg ttcacaagca tttgaggctg 1560

aagcatccag agcttgtgtt agagttgact tccaaagtcc gagaggatct ctatttccaa 1620

aattacatga atgatcctaa tgcacctggt ggaactccag ttatgcaaca gtctgcacca 1680

gacaaatcaa gacagagacc tggtatggat aatcgtctga gatatgaccg tgccaatcgt 1740

agagaatatg atagggcaga gagagatgga agcagatatg gtagaggtga tcgttctcca 1800

agtcttgatg gcgctgatga tcagatgttt gatgctttcc gtgggcgagg tccaaatgct 1860

ccttttgttc ctgaacttcc cgctccgcca attttgatgc ctattcctgg tgctggtcct 1920

ttgggtccat ttgttcctgc acctccagaa atagccatgc atatgctgag agagcaaggg 1980

ccgccacctc catttgaacc aaacggacct cctcatgcca acccaggagt gcttggacca 2040

atgatgggtg gtcctgcgcc aattataacc atgcctccat cttttcgtca agatcctcgc 2100

cgtttgcgaa gttacaatga ccttgatgct ccggacgagg aagttaccgt tcttgactac 2160

agaagtttgt ag 2172

<210> 4

<211> 406

<212> PRT

<213> Rice (Oryza sativa)

<400> 4

Met Ala Asp Val Ile Asp Pro Ala Ser Thr Glu Ala Pro Arg Ala Arg

1 5 10 15

Arg Pro Pro Pro Pro Pro Pro Asp Ser Pro Glu Gly Arg Ser Pro Pro

20 25 30

Leu Pro Pro Pro Pro Pro Gly Gly Pro Pro Gln Pro Ala Ala Thr Arg

35 40 45

Lys Arg Ser Arg Ser Pro Pro Pro Pro Pro Pro Pro Pro Ser Leu Pro

50 55 60

Pro Pro Pro Pro Leu Gly Ser Ser Arg Pro Glu Arg Tyr Arg Asp Asn

65 70 75 80

His His Arg Gly Gly Gly Gly Gly Arg Gly Gly Gly Ser Ser Ser Pro

85 90 95

Pro Pro Tyr Arg Ser Gly Arg Arg His Ser Pro Ser Arg Arg Ser Pro

100 105 110

Ser Pro Pro Phe Lys Arg Ser Arg Arg Asp Asp Gly Tyr Asp Arg Arg

115 120 125

Gly Gly Arg Gly Ser Pro Pro Pro Arg Tyr Gly Tyr Gly Asp Arg Arg

130 135 140

Tyr Gly Tyr Asp His Glu Arg Gly Gly Gly Arg Gly Gly Tyr Asp Asp

145 150 155 160

Asp Arg Tyr His Gly Arg Tyr Gln Asn Arg Ala Ala Asp Trp Ala Asp

165 170 175

Ser Gly Phe Gly Ala Ser Asn Asp Gly Pro Gly Ile Thr Gln Arg Glu

180 185 190

Gly Leu Met Thr Tyr Lys Gln Phe Ile Gln Val Leu Glu Asp Asp Ile

195 200 205

Ser Pro Ala Glu Ala Glu Lys Arg Tyr Gln Glu Tyr Arg Thr Glu Tyr

210 215 220

Ile Thr Thr Gln Lys Arg Ala Tyr Phe Asp Leu Asn Lys Asn Asp Asp

225 230 235 240

Arg Leu Lys Asp Lys Tyr His Pro Thr Asn Leu Ser Ser Val Ile Asp

245 250 255

Arg Arg Asn Asp Ser Cys Lys Ala Thr Ala Lys Asp Phe Phe His Asp

260 265 270

Leu Gln Asn Gly Thr Leu Asp Leu Gly Pro Gly Ile Thr Ala Ala Ala

275 280 285

Ala Ser Gly Ser Asp Gly Asn Ser Asp Asp Asp Gly Asp Ser Asp Lys

290 295 300

Arg Arg Lys His Gly Arg Gly Ser Ser Lys Glu Thr Asp Pro Leu Ser

305 310 315 320

Gly Ala Pro Val Ala His Pro Val Ser Ser Glu Ser Arg Arg Val Gln

325 330 335

Val Asp Ile Glu Gln Ala Leu Ala Leu Val Arg Lys Leu Asp Thr Glu

340 345 350

Lys Gly Ile Val Gly Asn Ile Leu Ser Ser Gly Asp His Asp Lys Ser

355 360 365

Asp Val Asp Lys Ser His Ile Gly Ser Met Gly Pro Ile Ile Ile Ile

370 375 380

Arg Gly Leu Thr Thr Val Lys Gly Leu Glu Gly Val Glu Leu Leu Asp

385 390 395 400

Thr Leu Leu Thr Tyr Leu

405

<210> 5

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 5

tgtgtggggt cgatgacgtc agccat 16

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 6

aaacatggct gacgtcatcg acccca 16

<210> 7

<211> 2173

<212> DNA

<213> Rice (Oryza sativa)

<400> 7

atgggctgac gtcatcgacc ccgcctccac cgaggccccc cgcgcgcgcc gcccgccgcc 60

gcctccgccc gacagcccgg agggccgctc gccgccgctc ccgcccccgc cccccggtgg 120

cccgccgcag ccggcggcca cccgcaagcg gagccgctcg ccaccgccgc ctcccccgcc 180

gccctccctc ccgccgcccc cgccgctcgg ctcgtcgcgc cccgagcgct accgcgacaa 240

ccaccaccgg ggaggaggcg gtggccgggg tgggggtagt tccagccccc cgccgtatcg 300

gagtggccgc cgccactccc cgtcgaggag atccccttcg ccgccgttca agaggtcgcg 360

gcgggacgac gggtacgacc gccgtggcgg ccgtgggagc ccgccgccgc ggtacgggta 420

cggcgacagg aggtatggat atgaccacga gcgtggtgga ggcagaggtg ggtatgatga 480

tgaccgatac catggcaggt atcaaaatcg cgcagcagat tgggccgatt cagggtttgg 540

ggcatccaat gatggtcctg gaattaccca aagggaagga ctgatgactt acaaacagtt 600

catccaagtt cttgaggatg atatttcacc tgctgaagct gagaaacggt atcaagaata 660

caggacagag tacatcacta ctcaaaaacg tgcttatttt gaccttaaca agaatgatga 720

tcggttgaaa gacaagtacc atccgaccaa cttgtcatct gttattgaca ggaggaatga 780

tagttgtaag gcaacagcaa aggatttctt tcatgatttg caaaatggaa ctctggacct 840

tggccctgga ataactgcgg ctgcagcaag tggcagtgat ggaaattctg atgatgatgg 900

agacagtgac aagagaagaa agcatggcag gggttcctca aaagaaacag accctctttc 960

tggtgctccc gtggctcatc cagttagctc tgaatctcga cgggttcaag ttgacattga 1020

acaagctcta gcccttgtgc gtaagcttga cactgagaag ggtattgtgg ggaatatcct 1080

atcaagtggc gatcatgaca aatcagatgt agacaagtct catattggat ctatggggcc 1140

tataattata atccgaggct taaccactgt caaaggcctt gaaggtgttg agctcctaga 1200

tactcttctt acctatttat ggcgtattca tggtgttgat tactatggca tgtctgagac 1260

aaatgaagca aaaggcagtc gccatgtcag agcagacaat aagacgtcta atacaaccaa 1320

tattaatgcc gctgactggg aaaagaaggt ggatactttc tggcaagaaa ggctgagagg 1380

tcaggacccc atggtaatat tagcagccaa ggacaaaatc gatgcagcag ctgtggaagt 1440

tctggaacct tatgtcagga agataaggga tgaaaaatat ggttggaaat atggctgtgg 1500

agctaagggt tgtacgaaac ttttccatgc tcctgagttc gttcacaagc atttgaggct 1560

gaagcatcca gagcttgtgt tagagttgac ttccaaagtc cgagaggatc tctatttcca 1620

aaattacatg aatgatccta atgcacctgg tggaactcca gttatgcaac agtctgcacc 1680

agacaaatca agacagagac ctggtatgga taatcgtctg agatatgacc gtgccaatcg 1740

tagagaatat gatagggcag agagagatgg aagcagatat ggtagaggtg atcgttctcc 1800

aagtcttgat ggcgctgatg atcagatgtt tgatgctttc cgtgggcgag gtccaaatgc 1860

tccttttgtt cctgaacttc ccgctccgcc aattttgatg cctattcctg gtgctggtcc 1920

tttgggtcca tttgttcctg cacctccaga aatagccatg catatgctga gagagcaagg 1980

gccgccacct ccatttgaac caaacggacc tcctcatgcc aacccaggag tgcttggacc 2040

aatgatgggt ggtcctgcgc caattataac catgcctcca tcttttcgtc aagatcctcg 2100

ccgtttgcga agttacaatg accttgatgc tccggacgag gaagttaccg ttcttgacta 2160

cagaagtttg tag 2173

<210> 8

<211> 2

<212> PRT

<213> Rice (Oryza sativa)

<400> 8

Met Glu

1

<210> 9

<211> 4845

<212> DNA

<213> Artificial Sequence

<400> 9

ggtaaatcaa gttatggtcc attgccaggg gattaaaaaa ctgtggctct agctattcca 60

ttctaaattt gaggatatta gatagtgtga tatactgata ttgtttcctg ttatactggt 120

cactggtgtg actggttgac tttcaatcca tagttgtaaa cttaaaatca tgacacataa 180

ttggtttagc tatgggaaga tttaatgctg acggttgggc atctttgcat gttattttct 240

tctctccttg gtattcaaaa tatgaaagct gtcctataac tgtggctttt gtttactgcc 300

ggttaaatat gaacttgttt tcctttattt gcactggcag cctgaggcta gcttcagcat 360

caatatactg tagtttacat ttgtttctga cggcagtatg gcttataatg atgtggccat 420

ttaagaattt taggggttgt tttgttttga ggaattggat ggccaatgga ccatcagata 480

ctcccaagtc tcactttttt gttcggttcg aggaatggaa tgtgttggtc cataaccacc 540

tcatccctcg atatgtgatt gattcctcga aagaaacagc ctaagttatg gcccatttca 600

ggcatcaagt ataatgtcct aaaagtttct gtatcctgtt acaaccaaca aattctcttt 660

tccggtctct gtagcttctt caatatgcct tgatatttca aacaaatcaa tttttgaagc 720

ttctgctact tttcctccac agaatggaag tgctgcagca cctaccaccg agcaagaaat 780

tcctgcacca gccactgtca atggccacga atcatcaacg tgagtatagc gatgtttgtc 840

ttgtggagga tcgcgaacat catgccggca ttatatccat gtagtttaac tgtctgtact 900

ataacttgat gagaacctgt taggtaccta ggccatttct ttaccatcat ttagggtttg 960

aatgttgttc tgcatatgtt gtaagccatg aaaaatcatg cttccggtca ttatggccgt 1020

agcaatttta tttcttgtta gactcttggg tggaagtgag aacagagaag gtgatgaagt 1080

gaatatttta cttgtgtctt gtagttattt atatttatct caaaattgat ttatcccata 1140

cagctgtttc gtttgttacc gttttgctgg ccaaccgttg gaagtttcca aaaatataaa 1200

gggctccttt ggaacgaaat aattttacac gaaccagttc aattctcgtg aaaaatcgtt 1260

gatcaaatga tagtaaaagt ttaccggaga aaatactcaa atccactttg aagaataccc 1320

cttgaagagg tccccctttg tcgttcaaga tgccgttcgg ttatttggat ataaagatac 1380

ttgcgagaaa caagagcgat cccgggtgtg tttgtttact ttgttgaaga aaaaagaaat 1440

taaaaaaagt tactttctcc attctataat ataagacgca taagtatttt aatatttaac 1500

ttttaaaaca tctaactaat aattagtata atataaatat acattttatt tgttgaaaat 1560

gatattattt gattgtcact caaatttact tttatattgc tatagttttg ttatagcata 1620

cgagaaatta taagccaaac attagtatta aactaataaa gattatgtta agtatgattg 1680

tcttatatta tttatattat gggataaaga gattgctttg ttgaagaaaa aaatatcaaa 1740

aaagcagaag tactactttc tatatcctaa aatatactac tgttatgaga gtaagacata 1800

atcatttttt tcttatatct cataatataa tgtacatgca tacatacatt aactatcact 1860

tcttaattct ttgtatttgg tttattttaa atcttccaca agtcccttaa taatcatata 1920

gtcgagtctt atggtatcga gggagtacta cgagatgaat cttaatttta aaagtaaaac 1980

aatacgagat gaatcttaat ttaaaaagta aaataatacg atgggacgaa ttaagccctg 2040

attagttttt acgtaaaaac ttttcacctt atcatatcga atgtttgaat acatgcatgg 2100

agtattaaat atagaaaaaa aaaataacta cacagattat gtaaatacaa tacgaatctt 2160

ttaagcctaa tcgcgccatg atttgacaat gggtgggttc ggatgagatt gccgtggctt 2220

cagcttcaca gcacaacaac tacagcacta gcagtaaatt ttgtgctgct agtactgttg 2280

atatagccaa cagcagttca acagctgcaa tatgtagctc aagtgaacac ggccaatgtg 2340

gtcatacagt aaacatttgc taatgacgaa ttaattaggc ttaataaaaa cgtctcacag 2400

tttatatgta taatatgatg tttaataatt taaatgtgtg tccgtatatc ctatgatagg 2460

gctacacaca aacagggaac ccgatcagca gccgtgcacg tgtcccatac gccgtttcac 2520

actttttttc tagacgcttc cttcccttgc cgctaccgcc tcgtgcgccg cagcccgcag 2580

cctagcctac cctctctctc tcccccctcc tcaagctgtg cgcgattcgc ttcctcactc 2640

ccaaacccta accccaccgc gacgctcccc cccatggctg acgtcatcga ccccgcctcc 2700

accgaggccc cccgcgcgcg ccgcccgccg ccgcctccgc ccgacagccc ggagggccgc 2760

tcgccgccgc tcccgccccc gccccccggt ggcccgccgc agccggcggc cacccgcaag 2820

cggagccgct cgccaccgcc gcctcccccg ccgccctccc tcccgccgcc cccgccgctc 2880

ggctcgtcgc gccccgagcg ctaccgcgac aaccaccacc ggggaggagg cggtggccgg 2940

ggtgggggta gttccagccc cccgccgtat cggagtggcc gccgccactc cccgtcgagg 3000

agatcccctt cgccgccgtt caagaggtcg cggcgggacg acgggtacga ccgccgtggc 3060

ggccgtggga gcccgccgcc gcggtacggg tacggcgaca ggaggtatgg atatgaccac 3120

gagcgtggtg gaggcagagg tgggtatgat gatgaccgat accatggcag gtatcaaaat 3180

cgcgcagcag attgggccga ttcagggttt ggggcatcca atgatggtcc tggaattacc 3240

caaagggaag gactgatgac ttacaaacag ttcatccaag ttcttgagga tgatatttca 3300

cctgctgaag ctgagaaacg gtatcaagaa tacaggacag agtacatcac tactcaaaaa 3360

cgtgcttatt ttgaccttaa caagaatgat gatcggttga aagacaagta ccatccgacc 3420

aacttgtcat ctgttattga caggaggaat gatagttgta aggcaacagc aaaggatttc 3480

tttcatgatt tgcaaaatgg aactctggac cttggccctg gaataactgc ggctgcagca 3540

agtggcagtg atggaaattc tgatgatgat ggagacagtg acaagagaag aaagcatggc 3600

aggggttcct caaaagaaac agaccctctt tctggtgctc ccgtggctca tccagttagc 3660

tctgaatctc gacgggttca agttgacatt gaacaagctc tagcccttgt gcgtaagctt 3720

gacactgaga agggtattgt ggggaatatc ctatcaagtg gcgatcatga caaatcagat 3780

gtagacaagt ctcatattgg atctatgggg cctataatta taatccgagg cttaaccact 3840

gtcaaaggcc ttgaaggtgt tgagctccta gatactcttc ttacctattt atggcgtatt 3900

catggtgttg attactatgg catgtctgag acaaatgaag caaaaggcag tcgccatgtc 3960

agagcagaca ataagacgtc taatacaacc aatattaatg ccgctgactg ggaaaagaag 4020

gtggatactt tctggcaaga aaggctgaga ggtcaggacc ccatggtaat attagcagcc 4080

aaggacaaaa tcgatgcagc agctgtggaa gttctggaac cttatgtcag gaagataagg 4140

gatgaaaaat atggttggaa atatggctgt ggagctaagg gttgtacgaa acttttccat 4200

gctcctgagt tcgttcacaa gcatttgagg ctgaagcatc cagagcttgt gttagagttg 4260

acttccaaag tccgagagga tctctatttc caaaattaca tgaatgatcc taatgcacct 4320

ggtggaactc cagttatgca acagtctgca ccagacaaat caagacagag acctggtatg 4380

gataatcgtc tgagatatga ccgtgccaat cgtagagaat atgatagggc agagagagat 4440

ggaagcagat atggtagagg tgatcgttct ccaagtcttg atggcgctga tgatcagatg 4500

tttgatgctt tccgtgggcg aggtccaaat gctccttttg ttcctgaact tcccgctccg 4560

ccaattttga tgcctattcc tggtgctggt cctttgggtc catttgttcc tgcacctcca 4620

gaaatagcca tgcatatgct gagagagcaa gggccgccac ctccatttga accaaacgga 4680

cctcctcatg ccaacccagg agtgcttgga ccaatgatgg gtggtcctgc gccaattata 4740

accatgcctc catcttttcg tcaagatcct cgccgtttgc gaagttacaa tgaccttgat 4800

gctccggacg aggaagttac cgttcttgac tacagaagtt tgtag 4845

<210> 10

<211> 7020

<212> DNA

<213> Rice (Oryza sativa)

<400> 10

gtgcgccgca gcccgcagcc tagcctaccc tctctctctc ccccctcctc aagctgtgcg 60

cgattcgctt cctcactccc aaaccctaac cccaccgcga cgctcccccc catggctgac 120

gtcatcgacc ccgcctccac cgaggccccc cgcgcgcgcc gcccgccgcc gcctccgccc 180

gacagcccgg agggccgctc gccgccgctc ccgcccccgc cccccggtgg cccgccgcag 240

ccggcggcca cccgcaagcg gagccgctcg ccaccgccgc ctcccccgcc gccctccctc 300

ccgccgcccc cgccgctcgg ctcgtcgcgc cccgagcgct accgcgacaa ccaccaccgg 360

ggaggaggcg gtggccgggg tgggggtagt tccagccccc cgccgtatcg gagtggccgc 420

cgccactccc cgtcgaggag atccccttcg ccgccgttca agaggtcgcg gcgggacgac 480

gggtacgacc gccgtggcgg ccgtgggagc ccgccgccgc ggtacgggta cggcgacagg 540

aggtgagggg tttcttcttg gtcatttggt cgaaatctgt actggattgg tggttagttc 600

ttcgaggctc tgcggtttca tcgcgtgtgc ttgggtgatg tgttgggtag gtatggatat 660

gaccacgagc gtggtggagg cagaggtggg tatgatgatg accgatacca tggcaggtat 720

caaaatcgcg cagcaggtga ggattcttct cctcgggcaa agtttcgttt cgatctcaga 780

agtaagctgt ttgagtagca cagcatgagc gaaccccaaa tggtatgagg gaaattgatt 840

atttgcctgt agttagttcc ccaccaaatt agattggttt tgatgatcta caacatagtt 900

tagtgaaaac tatcagatcc tttgctccat agtcagtatg agtttactga attcaagtga 960

acagcatggg gctgttctac ttggtaaaca ttagcaacct tgctttgtta gcacttgcta 1020

atgtactccc tgcggtcata aatatttgac gtttagaaca aaattcggtt gaattttcaa 1080

aattccgact gtaatttccc aaatgcttag ttttaaaaca aaataaaatg ttgtatatag 1140

attttccttg aaaagtacta tcataatata aaaagttatt agattttata aacttatttc 1200

tactacaaaa ttgatggttg taattttaaa ttttgaccaa atcttgtcct aaatgttaaa 1260

tatttatggc agggaggttc aggatttcag atctgtagat gttgggtgtt agggctatta 1320

gctctttgat ttgtttggtg tgttatagtt gtagtaagaa ttttaccact atcttctaat 1380

ttgttcctgc ttcgaatcat tctagtcggg atgaagacaa agtatatgca tggctgtttt 1440

tttttacttt agctagcact tacactcctc atttagaaca tagattcttg atacttgtga 1500

atatgttctg acaattcgat ttcaatgtca gattgggccg attcagggtt tggggcatcc 1560

aatgatggtc ctggaattac ccaaaggtac ttattccttt accatgttta ctctttctga 1620

ttgttaggca ctttgatgtt gtctcctggg tactgtaact atgtagcgat cgacaatact 1680

ggagctaatt gccactacta ttgggaaatg caaattaagc cttctatgct agatgctgta 1740

aggcatcgtt aacagataga gaatcttctc agaaaattct ccaaatttga tgtttgaaat 1800

ctgactgatt ctttgagaac tgtgagcctg tagttaagct atcagcttga aatcctttac 1860

tgcagcacta catactccgg aaccttgtta ctgttattag ccaccagcaa gccagctcaa 1920

tttacagtta gtgccaccac aaaaggactc ttcccagtta tatgtaagct ataccaccca 1980

gatattcagc tacaccttga aggcataaga agcatatgct tttggataca atcaaatgga 2040

gaatctgatg ggaatattct ttatctgtta acaacaaaca aaggctcaga ggctttattt 2100

gaatctctag tagtggattt ctttttcttt ctttttttta attctatacc atgttatctt 2160

aaatatacat tgataactcc atggaacaca acacttccaa tgctaatttg cataagtaga 2220

tgttatcatg ttaacactat gcatttttgt cctattgatg gtagactgtt agattgtgtt 2280

aacattgtta acaggaaaaa ggtgagggat tcttgttttc ttctcttgta tatcttcttt 2340

tgccactatt tagttgctga aatatgttca tcaatttatg atacttgttc agaggaacga 2400

aatggatgaa ttgcttccta tgtaacatga aatcattgaa gcatgatcac gcttgttagg 2460

agtagttgat gcttgggctt ttcattagaa aattataatt tagtgttttt agtgttaatt 2520

ctctataata ctgggcttgc taatcaattt tgtattctgt tgaattgtag ccttttattt 2580

tagtgatgct attaataaac ctgagggtct tttcttggat ttggttgctg gcattgagaa 2640

attagattcg ttctccttat ctttgcttcc cgtagttgtc atctgaagga attctagaat 2700

tttcttggac aaaaacaata gcggaaagat agtaattgga atcagctgat ggatgggcag 2760

aagttattgg tataccccat caaccatcac atggttgtaa tgacttcttc aagtttttaa 2820

gaaataacaa ttattctatg ctgataatac ttttggtggc aacgcatgta attagcaaat 2880

gtttattcag ttgtttcctc tagttatgtg tatgtcacat ttacatttat cattgagtgt 2940

tattgtgtgc ttaaggtgtc ttagttagga agaacatgaa atgttagaga aggtagacca 3000

tgttgctaag gaagataata tttagttagt tattggtcag gatttttttt aattaggaga 3060

atcttttgcc cgaccaatgc agttgttcct ggtgaccgat ttgcataaaa cattgtaatg 3120

agtggcagtt catatgaagg ccacatgtta gatgacatct ctgtagggag aggtggattg 3180

ccttcttttt tgttatttgt aaaaaaatat tcaacatgca taccttttaa actgatcttt 3240

gaactgttga aacagattta tgaaaacttc tattgcagat taaagaaatc tgaactgttg 3300

tcacatttaa acttgttttc aaatattgtt ccctccattc attttgacga gctaaccgtt 3360

ctaacatatt gagcagagga ttgggatata gtttcatgag tttctcttag tgtatttctg 3420

ttatcttata tgattatgca tcttttcagg gaaggactga tgacttacaa acagttcatc 3480

caagttcttg aggatgatat ttcacctgct gaagctgaga aacggtaaat gcacaacact 3540

tactgattat atctttgtgc taccttttta gtattgatgg gctatgtctg tttaaaaagg 3600

tatcaagaat acaggacaga gtacatcact actcaaaaac gtgcttattt tgaccttaac 3660

aagaatgatg atcggtaagt caaaatgatt tagctgtaca caactaggaa caaaaatggt 3720

ccacttgctt taactgacat ttcatttgct ttcacttgca ggttgaaaga caagtaccat 3780

ccgaccaact tgtcatctgt tattgacagg tggagttgaa ttccttttta ttgagcctgt 3840

tcccttatgc attcataaac attattatgt tgtggaaaaa attttcttgc agaacaatac 3900

cctttatact gctcatctta actcctttta catttttgtt aagtaaattt cagaaaacta 3960

caggtgcttt gaccaaatta tcacaaaagt atagatttaa ggcgctgtat cacaaaacta 4020

catatttgat ttcgaagtta tcacaaaact gcagatatta caatttaaat ccctagtact 4080

actgttatgt tagagttata aatgttgtag tttcgtctaa ctgcaacttt tccatataat 4140

gcaggaggaa tgatagttgt aaggcaacag caaaggattt ctttcatgat ttgcaaaatg 4200

gaactctgga cctgtgagtt atatctgcac agcttgtgtt atgatgatct tctggacttc 4260

ttgtttatac cttgattttt tactgagcag tggccctgga ataactgcgg ctgcagcaag 4320

tggcagtgat ggaaattctg atgatgatgg agacagtgac aagagaagaa agcatggcag 4380

gggttcctca aaagaaacag accctctttc tggtgctccc gtggctcatc cagttagctc 4440

tgaatctcga cgggttcaag ttgacattga acaagctcta gcccttgtgc gtaagcttga 4500

cactgagaag ggtattgtgg ggaatatcct atcaagtggc gatcatgaca aatcagatgt 4560

agacaagtct catattggat ctatggggcc tataattata atccgaggct taaccactgt 4620

caaaggcctt gaaggtgttg agctcctaga tactcttctt acctatttat ggcgtattca 4680

tggtgttgat tactatggca tgtctgagac aaatgaagca aaaggcagtc gccatgtcag 4740

agcagacaat aagacgtcta atacaaccaa tattaatgcc gctgactggg aaaagaaggt 4800

ggatactttc tggcaagaaa ggctgagagg tcaggacccc atggtaatat tagcagccaa 4860

ggacaaaatc gatgcagcag ctgtggaagt tctggaacct tatgtcagga agataaggga 4920

tgaaaaatat ggttggaaat atggctgtgg agctaagggt tgtacgaaac ttttccatgc 4980

tcctgagttc gttcacaagc atttgaggct gaagcatcca gagcttgtgt tagagttgac 5040

ttccaaagtc cgagaggatc tctatttcca aaattacatg aagtatgtac atatgatttt 5100

ctgcctgtgc tacttttttt taaggaggtg ttactgatct ggatgtttct ttatgaacag 5160

tgatcctaat gcacctggtg gaactccagt tatgcaacag tctgcaccag taagaacctc 5220

atactctatt acttgcttaa ataaaacaga acaattctac aagtgaattc catgcataat 5280

tacataccag tatatcacat atgtgctata cacatgttac attataactt cgaataaaag 5340

ttccctgcaa aaaagaactt caaataaaat ttgcttttgc ttttatccca gctgcttcct 5400

gtaggttgtt tctttttcat ttgtcagtaa accccagctc ccttttaaga ataatttgta 5460

tgcctgtgcc ttttggttac tagtttgtgt acacatggac catataccat tccacccctt 5520

tgttccttct acagattttt ccttttaggt gctaagccta cattagatga actatacggt 5580

atcagtcaga cagtcactta tgtggcctaa ccggtgacgt gagagttaaa ggagggttgg 5640

cttatttgag ggaatgatca ggcctggaca gaatcagtgg aaggaatctg actaaagctt 5700

ttagtgatgg gtcaataccc tactgaagaa tttagctgac acttctctaa gtatcattaa 5760

tggataaata cattgagtgc aggtggaaac tgcagttaca tggattcatt gaaatccttg 5820

acaaatattt atacttctga tttgcaggac aaatcaagac agagacctgg tatggataat 5880

cgtctgagat atgaccgtgc caatcgtaga gaatatgata gggcagagag agatggaagc 5940

agatatggta gaggtgatcg ttctccaagt cttgatggcg ctgatgatca gatgtttgat 6000

gctttccgtg ggcgaggtcc aaatgctcct tttgttcctg aacttcccgc tccgccaatt 6060

ttgatgccta ttcctggtgc tgggtaggtg ctgtgagaag atatgatttc aatttttgtt 6120

ctgatagtat aaaagactgc taatgagcgt ggctggtttt attttcagtc ctttgggtcc 6180

atttgttcct gcacctccag aaatagccat gcatatgctg agagagcaag ggccgccacc 6240

tccatttgaa ccaaacggac ctcctcatgc caacccagga gtgcttggac caatgatggg 6300

tggtcctgcg ccaattataa ccatgcctcc atcttttcgt caagatcctc gccgtttgcg 6360

aaggttagta attattcatt cataccattg aattccatga tgtctattct cctattttgc 6420

ttggattggc ttgattatgc cacattctga ccaacaattt ggccacctag ggcttgccac 6480

caagccttac accttgcttt agtttgtata tgattacttc tactcgaggg cttaaccata 6540

ctgtctttat tatcatagag gcaaaaatag tatgttgatt tactgtgcca ttgtactata 6600

ttttacaacc ggcaacttaa cccatccatg atgacgattc ttctgcagtt acaatgacct 6660

tgatgctccg gacgaggaag ttaccgttct tgactacaga agtttgtaga gcttgccctg 6720

gtgtaattgt aatttgccaa tcacaactct agcatctccg gtctagtcta ggttggtgat 6780

gtattctttt tcagacatag gggatgtcat gaacaataga gcattttttg aggtgtaatg 6840

cgtcagaaac tactgttgta atttcaaatg gcaacatctg ttattgaact gtgcaccacg 6900

tgcacttgta gtcccaagaa gtgttgaacg cagtttgata aaatgtaatt tttgagactt 6960

tatatgacaa cgttttagct gacaacattt tacttctcca ttggaagtaa ttaatttatt 7020

Claims

1. An amylose content regulatory gene OsACF1, wherein the amino acid sequence encoded by the amylose content gene OsACF1 is shown as SEQ ID No.1, or the amino acid sequence encoded by the amylose content gene OsACF1 is at least 90% homologous with the sequence shown as SEQ ID No. 1.

2. The amylose content regulating gene OsACF1 according to claim 1, wherein the nucleotide sequence of the amylose content gene OsACF1 is shown as SEQ ID No.2, or the nucleotide sequence of the amylose content gene OsACF1 is at least 90% homologous with the sequence of SEQ ID No. 2.

3. The application of the amylose content regulatory gene OsACF1 as claimed in claim 1, wherein the application comprises the following steps: for the rice containing the amylose content regulating gene OsACF1, the rice gene is edited, and the amylose content regulating gene OsACF1 is knocked out, changed, inhibited or over-expressed, so that the OsACF1 gene expression level in a target rice variety is changed, and further rice varieties with different amylose content characters are obtained.

4. A method for cultivating rice line germplasm with different amylose contents comprises the following steps: selecting conventional rice varieties, processing and cultivating to obtain rice with different amylose contents, wherein the processing is that the conventional method is adopted to delete, mutate or inhibit the nucleotide sequence of the amino acid shown as SEQ ID NO.1 in the rice, and further the expression level of the polypeptide corresponding to the amino acid sequence is reduced, increased or the activity is changed.

5. The method according to claim 4, wherein the rice variety is japonica rice variety "Yinxiang 38" or "Nipponbare" or indica rice variety "9311".

6. The method of claim 4, wherein the method further comprises: and carrying out gene editing on the target rice variety, and mutating the nucleotide sequence shown as SEQ ID NO.2 contained in the target rice seed into the nucleotide sequence shown as SEQ ID NO.3, or mutating the amino acid sequence shown as SEQ ID NO.1 in the target rice seed into the amino acid sequence shown as SEQ ID NO.4 to obtain the rice strain with low amylose content.

7. The method of claim 4, wherein the method further comprises: the CRISPR-CAS9 gene editing technology is adopted to change the nucleotide sequence SEQ ID NO.2 of the amino acid sequence shown as SEQ ID NO.1 so as to lead the activity of the polypeptide corresponding to the amino acid sequence to be lost or reduced.

8. The method of claim 4, wherein,

the construction method of the CRISPR-CAS9 gene editing vector in the CRISPR-CAS9 gene editing technology comprises the following steps:

(b) a pair of primers such as SEQ ID NO.5 and SEQ ID NO.6 are used in combination. The vector RCKO was digested with the restriction endonuclease Bsa1 and the vector and target sequences were ligated using T4 ligase. After sequencing verification, the RCKO-OsDAF1 plasmid was successfully constructed, and Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 was transformed.

(c) Transferring the Agrobacterium tumefaciens EHA105 containing the OsACF1 CRISPR-CAS9 knock-out RCKO-OsDAF1 into the seeds of the japonica rice Nipponbare, and culturing the seeds.

9. A method for recovering the low amylose content character of rice comprises the following steps: transferring the OsACF1 gene into the rice with low amylose content obtained by the method of claim 6 to obtain the silver fragrance 38OsACF1 gene complementary rice, wherein the amylose content is recovered to normal japonica rice.

10. The method of claim 9, wherein the method comprises:

(b) providing agrobacterium tumefaciens EHA105 carrying a complementary construction vector for expressing OsACF 1;

(c) transferring agrobacterium tumefaciens EHA105 complementarily constructed by OsACF1 into the rice with the low amylose content character for cultivation; wherein the OsACF1 is complemented to construct nucleotide with a sequence shown as SEQ ID NO. 9.