CN108130328B - Application of male sterility gene OsDPW3 and rice fertility restoration method - Google Patents

Abstract

The invention discloses an application of a male sterile gene OsDPW3 and a fertility restoration method; the OsDPW3 gene is knocked out, changed or inhibited by adopting a conventional genetic engineering method or based on a CRISPR/Cas9 system, the OsDPW3 gene expression water is reduced in japonica rice background wild rice, and further the rice male sterile line is obtained. The invention also relates to a method for restoring rice fertility, which can restore the mutant to the wild phenotype by amplifying the OsDPW3 gene by using a primer and transforming the mutant plant by using a genetic transformation method. The rice male sterile line prepared by the invention has no abnormal phenotype in the vegetative growth period of rice, but has abnormality in the anther development process in the reproductive growth period. If the method is applied to crossbreeding, the castration of female parents can be avoided, the production efficiency is greatly improved, the labor cost is reduced, and the method has important application in agricultural production.

Description

Application of male sterility gene OsDPW3 and rice fertility restoration method

Technical Field

The invention relates to a method for creating a rice line in the technical field of bioengineering, in particular to application of a male sterile gene OsDPW3 and a method for restoring rice fertility.

Background

Rice is an important food crop worldwide, and about 50% of the world population uses rice as staple food, and rice is also a raw material for processing many foods. Because the genome of rice is small and the rice transformation system is very mature, the rice can be used as a model plant for monocotyledon research, and people have to understand the rice reproductive development mechanism. The discovery and the utilization of the rice male sterile line open a new era of rice cross breeding and play a great role in improving the rice yield. Because the sterile line used in the rice hybridization process at present has the defects of unstable fertility, negative cytoplasmic effect and the like, the research on the rice male sterility regulation mechanism is deeply carried out, and the method has important significance for obtaining a novel rice sterile line, improving the agricultural yield and the like. Meanwhile, the method has important theoretical significance for the aspects of revealing the molecular regulation mechanism of plant reproductive development and the like.

Male sterile line: the female rice is male degenerated (mainly pollen degenerated) but normal pistil, cannot self-pollinate and fruit due to the weak life of pollen, and can fertilize and fruit only by foreign pollen, so that a large amount of hybrid seeds can be generated by using the female rice as a genetic tool and through a method of artificial supplementary pollination. From the breeding strategy, the development of hybrid rice can be divided into three development stages, namely a three-line method, a two-line method and a one-line method. Every time a new stage is entered, the method is a breakthrough in breeding, so that the yield of the rice can be improved to a new step. The hybrid rice used in the production at present belongs to the category of heterosis utilization between three-line varieties, the yield of the three-line hybrid rice is increased by about 20 percent compared with the conventional rice, and the three-line hybrid rice is still in the prosperous period at present. However, the three-line hybrid rice seeds have complex dominance expression and are limited by the relationship between the restorer line and the maintainer line, so that the screening of excellent combinations is difficult. Therefore, scientists are always screening and breeding new sterile lines to expand the cytoplasmic background and lay the foundation for distant hybridization and heterosis utilization.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides an application of a male sterility gene OsDPW3 and a method for restoring rice fertility (namely restoring rice male sterility). The invention utilizes the characteristics of the OsDPW3 gene and the protein thereof participating in regulation and control of rice male reproduction, utilizes a transgenic technology to control rice male reproduction development, generates a new rice male sterile line by mutating the protein sequence or inhibiting the expression of the protein, and has very important application in agricultural production.

The purpose of the invention is realized by the following technical scheme:

in a first aspect, the invention relates to an application of a male sterile gene OsDPW3, wherein an amino acid sequence coded by the male sterile gene OsDPW3 is shown as SEQ ID NO.1, and the application comprises the following steps: knocking out, changing or inhibiting an OsDPW3 gene by a conventional method or based on a CRISPR/Cas9 system, so that the expression level of the OsDPW3 gene in a conventional rice variety is reduced, and a rice male sterile line is obtained.

In a second aspect, the invention also relates to a method for creating a rice sterile line, which comprises the following steps: selecting a conventional rice variety, processing and cultivating to obtain the rice male sterile line; the treatment is that the nucleotide sequence of the amino acid shown as SEQ ID No.1 in the rice is deleted, mutated or inhibited by adopting a conventional method or based on a CRISPR/Cas9 system, so that the expression level of the polypeptide corresponding to the amino acid sequence is reduced or the activity is lost.

Preferably, the rice variety is japonica rice variety 9522.

Preferably, the nucleotide sequence is shown as SEQ ID No. 2.

Preferably, the method for creating the rice male sterile line comprises the following steps: the nucleotide sequence shown as SEQ ID No.2 in the conventional rice variety is mutated into SEQ ID No.9 by adopting a physical mutagenesis method, and then the rice male sterile line, namely osdpw3-1 mutant is obtained.

Preferably, the method for creating the rice male sterile line comprises the following steps: the physical mutagenesis method is adopted to mutate the amino acid sequence shown as SEQ ID No.1 in the conventional rice variety into SEQ ID No.10, and then the rice male sterile line, namely osdpw3-1 mutant is obtained.

Preferably, the CRISPR/Cas9 system-based treatment specifically comprises: the OsDPW3 gene is knocked out by a CRISPR/Cas9 system site-directed knockout method, and the expression of a nucleotide sequence encoding an amino acid sequence shown as SEQ ID No.1 is inhibited.

More preferably, the method for site-directed knockout of CRISPR/Cas9 system comprises the following steps:

a) the synthetic single nucleotide sequence primers are shown as SEQ ID No.3 and SEQ ID No. 4;

OsDPW3CRISPRUP(SEQ ID No.3):TGGCGTAACATCGGGGGGAGTCTA

OsDPW3CRISPRDOWN(SEQ ID No.4):AAACTAGACTCCCCCCGATGTTAC

b) forming a synthesized mononucleotide sequence into a dimer structure through annealing reaction, and carrying out ligation reaction with a vector fragment (the vector is from Baige corporation, the cargo number BGK03) to construct an OsDPW3-BGK03 plasmid containing a rice OsDPW3 gene target sequence (shown as SEQ ID No. 5);

c) infecting a rice variety with agrobacterium tumefaciens containing OsDPW3-BGK03 plasmid;

d) the specific primers of the OsDPW3 gene shown as SEQ ID No.11 and SEQ ID No.12 are utilized to amplify genome segments for sequencing and screening mutant plants.

Identify-F(SEQ ID No.11):TCGTAGGTGACCTCGTACTC

Identify-R(SEQ ID No.12):TGGTGGCAAGTGCCTATTCCTC

The rice OsDPW3 gene target sequence is shown as follows:

SEQ ID No.5:GTAACATCGGGGGGAGTCTA

in a third aspect, the invention also relates to an application of the rice male sterile line obtained by the method for creating the rice male sterile line in rice seed production, wherein the application comprises the following steps: and carrying out cross breeding by taking the rice male sterile line as a female parent.

In a fourth aspect, the present invention also relates to a method for restoring the male sterility trait of a rice male sterile line, comprising the steps of: the OsDPW3 gene is transferred into the rice male sterile line obtained by the application by adopting a conventional genetic method, and the wild type phenotype is restored in the mutant.

Preferably, the method comprises the steps of: transferring Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 complementarily constructed by OsDPW3 into the rice male sterile line, and culturing to obtain the rice male sterile line; wherein the OsDPW3 is complementarily constructed and contains a nucleotide sequence shown as SEQ ID NO. 6.

More preferably, the method specifically comprises the steps of:

(a) extracting genome DNA from wild 9522 seedling leaves as a template, and amplifying a genome sequence fragment of the OsDPW3 gene as shown in SEQ ID NO.6 by using primers with base sequences as shown in SEQ ID NO.7 and SEQ ID NO. 8;

(b) providing an Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 carrying a complementary construction vector for expressing OsDPW 3;

(c) contacting cells or tissues or organs of the male sterile line of rice with the agrobacterium in step (b), thereby transferring the nucleotide encoding the amino acid shown as SEQ ID No.1 into the rice cells and integrating the nucleotide into the chromosome of the rice cells;

(d) and (3) selecting the rice cells or tissues transferred with the nucleotide, and regenerating to obtain rice plants with restored fertility.

Preferably, the nucleotide encoding the amino acid shown in SEQ ID NO.1 is shown in SEQ ID NO. 2.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention obtains variant strains of rice male reproductive development by controlling rice pollen integrin OsDPW3 gene and encoding protein thereof, thereby realizing the control of rice reproductive process;

2. the rice male sterile plant line prepared by the invention has no abnormal phenotype in the rice vegetative growth period, has no obvious difference with the original parent, but has abnormality in the anther development process in the reproductive growth period, pollen abortion, and a completely sterile plant is obtained.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a schematic representation of morphological observations of osdpw3-1 mutant plants; wherein, FIG. 1A is wildThe phenotype of the entire plant of the generative 9522 and osdpw3-1 mutants; FIG. 1B shows wild-type 9522 and osdpw3-1 mutant spikelets; FIG. 1C shows the internal structure of wild-type 9522 and osdpw3-1 mutant florets; FIG. 1D mature pollen I of wild type 9522 and osdpw3-1 mutant₂KI staining results; FIG. 1E shows wild-type 9522 and osdpw3-1 mutant spikelets;

FIG. 2 is a schematic representation of morphological observations of osdpw3-2 mutant plants; wherein, FIG. 2A is the entire phenotype of wild-type 9522; FIG. 2B shows the overall phenotype of osdpw3-2 mutant; FIG. 2C shows the internal structure of a floret of wild type 9522; FIG. 2D shows the internal structure of the florets of osdpw3-2 mutant; FIG. 2E shows the single stamen phenotype of wild-type 9522; FIG. 2F is the single stamen phenotype of osdpw3-2 mutant; FIG. 2G mature pollen I of wild type 9522₂KI staining results; FIG. 2H mature pollen I of osdpw3-1 mutant₂KI staining results; FIG. 2I shows ears of wild-type 9522; FIG. 2J shows ears of osdpw3-2 mutant;

FIG. 3 is a schematic diagram of the wild type phenotype obtained by complementation of osdpw3-1 mutants; wherein, FIG. 3A is the internal structure diagram of wild type 9522 florets; FIG. 3B is a diagram of the internal structure of a floret of osdpw3-1 mutant; FIG. 3C is a diagram of the internal structure of the florets of the progeny of the complementary osdpw3-1 mutant; FIG. 3D shows wild type mature pollen I₂KI staining results; FIG. 3E shows osdpw3-1 mutant pollen I₂KI staining results; FIG. 3F shows mature pollen I of progeny of the complementary osdpw3-1 mutant₂KI staining results; FIG. 3G is a diagram of wild type 9522 spikelet seeds, osdpw3-1 mutant and progeny of the complementary osdpw3-1 mutant when fertility is restored.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that variations and modifications can be made by persons skilled in the art without departing from the spirit of the invention. All falling within the scope of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

The OsDPW3 gene is a nucleotide sequence SEQ ID NO.2 which codes an amino acid sequence shown as SEQ ID NO. 1.

Example 1 method for creating Rice Male sterile line

1.1 creation of osdpw3 Rice Male sterile line by conventional Breeding means

The osdpw3-1 mutant material of the embodiment is obtained by mutating the Wuyujing No.7 (also known as 9522) of the conventional japonica rice variety through a conventional genetic engineering method.

As known in the art, conventional varieties of rice can be mutated by other means such as radiation, and if osdpw3-1 mutant is mutated, the frame shift and early termination of the encoded protein can be caused, and the anther of the male reproductive organ of rice can not normally develop. The mutant subjected to mutagenesis is backcrossed for three generations to obtain an osdpw3-1 mutant which is controlled by a recessive nuclear single gene and is stably inherited. The osdpw3-1 mutant was backcrossed to 9522, and the phenotype of all F1 generations was consistent with 9522, indicating fertility. In the F2 population generated after selfing of the mutant and wild-type crossed F1, the segregation ratio of fertile to sterile plants was about 3:1, indicating a phenotype of mutant sterility caused by recessive monogenic mutations.

1.2 cloning of Rice fertility control protein Gene OsDPW3

A rice gene location cloning (map-based cloning or position cloning) population which is composed of a fertility control protein gene OsDPW3 (the nucleotide sequence of which is shown in SEQ ID No. 2) and a mutant gene osDPw3-1 (the nucleotide sequence of which is shown in SEQ ID No. 9) and is clear to a person skilled in the art is located in a 1-small genome segment, such as 100Kb, according to molecular markers. On this basis, genomic DNA clones containing this fragment were isolated by conventional methods. One of the rice male reproductive development control protein OsDPW3 is determined to contain the complete rice male reproductive development control protein through sequencing and further hybridization identification.

The analysis result of the whole nucleotide sequence shows that: the rice male fertility OsDPW3 gene has a full length of 2572bp (SEQ ID NO.13, comprising a regulatory region and an intron). Through software analysis and cDNA cloning, the ORF is shown as SEQ ID NO.2, the coded full length rice male reproductive development control protein with 701 amino acids is shown as SEQ ID NO. 1.

1.3 Point mutation of Rice fertility control protein Gene OsDPW3

The OsDPW3-1 mutant material of the embodiment is obtained by sequence variation of an OsDPW3 gene of a conventional japonica rice variety Wuyujing No.7 (named 9522), and by sequence comparison of an OsDPW3 mutant gene OsDPW3, the frame shift and early termination of a rice male reproductive development control protein can prevent a rice male reproductive organ from normally developing, so that a plant is sterile; in the embodiment, the OsDPW3 mutant gene is characterized in that 6 base pairs of the coding region are deleted (the sequence is shown as SEQ ID NO. 9) to cause early termination of translation and loss of function of the rice male reproductive development control protein.

1.4 reduction of expression level of OsDPW3 in rice variety by CRISPR means (based on CRISPR/Cas9 system)

In order to apply the OsDPW3 protein, a vector of OsDPW3 gene CRISPR (the vector is from Baige corporation, the cargo number is BGK03) is constructed, and a wild 9522 plant is transformed, so that the expression of OsDPW3 is reduced, and the purpose of changing rice fertility is achieved.

Synthesis of Single nucleotide sequence primers

OsDPW3CRISPRUP(SEQ ID No.3):TGGCGTAACATCGGGGGGAGTCTA

OsDPW3CRISPRDOWN(SEQ ID No.4):AAACTAGACTCCCCCCGATGTTAC

Forming a dimeric structure of the synthesized mononucleotide sequence through annealing reaction, and carrying out ligation reaction with a vector fragment (the vector is from Baige corporation, the cargo number BGK03) to construct a plasmid containing a rice OsDPW3 gene target sequence OsDPW3-BGK 03; the rice OsDPW3 gene target sequence is shown as follows:

SEQ ID No.5:GTAACATCGGGGGGAGTCTA

agrobacterium containing the OsDPW3-BGK03 construct was streaked onto YEB plates containing Kan (50. mu.g/. mu.l) to obtain single colonies.Selecting single colony, inoculating into 3ml YEB liquid culture medium containing antibiotic, shaking and culturing at 28 deg.C overnight, inoculating into 50ml YEB liquid culture medium containing antibiotic at 2 days according to 1% inoculum size, continuing shaking and culturing at 200rpm to OD₆₀₀When the speed is about 0.4 to 0.6, fresh agrobacterium liquid is centrifuged at 5000rpm for 5 minutes, collected and resuspended in 1/3 volumes of AAM liquid culture medium, and then the agrobacterium liquid can be used for transforming various receptor materials of rice.

This example used conventional Agrobacterium transformation methods to transform young embryogenic calli of rice 9522. Soaking 9522 immature seeds 12-15 days after pollination in 70% ethanol for 1 min, sterilizing in sodium hypochlorite solution (mixed with water 1:3, adding 2-3 drops of Tween 20) for more than 90 min, washing with sterile water for 4-5 times, picking out young embryos with a scalpel and a forceps, transferring to N6D2 culture medium to induce callus, culturing at 26 + -1 deg.C in the dark, and allowing for transformation after 4 days. The young embryo callus was soaked in fresh AAM Agrobacterium solution and shaken constantly, after 20 minutes the rice material was removed, excess solution was blotted on sterile filter paper and then transferred to N6D2C medium for 3 days at 26 ℃. In the co-culture, acetosyringone was added to the co-culture medium at a concentration of 100. mu.M. After 3 days, the calli were removed from the co-culture medium, the embryos excised and transferred to a selection medium containing 25mg/L hygromycin for selection. After 7-12 days, the resistant calli were transferred to selection medium containing 50mg/L Hyg for further selection. After 10-12 days, the vigorous resistant callus is transferred to a pre-differentiation culture medium to be cultured for about one week, and then transferred to a differentiation culture medium to be differentiated (12 hours of light/day). Regenerated plantlets were rooted and strong on 1/2MSH medium and subsequently transferred to phytotron nutrient solution for cultivation.

And extracting total DNA of leaves from the positive plants, and further identifying the transformed plants by PCR. Sequencing and detecting the gene sequence of the target site, amplifying genome segments by using specific primers of OsDPW3 genes shown as SEQ ID No.11 and SEQ ID No.12 for sequencing, and screening mutant plants. The OsDPW3 gene knockout plant osDPW3-2 is obtained by the method.

Identify-F(SEQ ID No.11):TCGTAGGTGACCTCGTACTC

Identify-R(SEQ ID No.12):TGGTGGCAAGTGCCTATTCCTC

1.5 loss or reduction of OsDPW3 protein Activity

Morphological observation of osdpw3-1 mutant plants obtained by conventional breeding. As shown in FIG. 1, the phenotype of wild type and mutant osdpw3-1 was not significantly different in vegetative growth stage, and the panicle shape and panicle number of wild type and mutant osdpw3-1 were not significantly different in reproductive growth stage, but the comparison showed that anthers of wild type 9522 were normally developed, while osdpw3-1 mutant anthers were less whitened (FIG. 1C); wild-type 9522 was stained normally with iodine and mutant osdpw3-1 anthers were not stained with mature pollen grains (FIG. 1D), resulting in failure to set normally (FIG. 1E).

Morphological observation of osdpw3-2 mutant plants obtained by the CRISPR system. As in fig. 2, the phenotypes of wild-type and CRISPR knockout mutant osdpw3-2 did not differ significantly during vegetative growth (fig. 2A, 2B); during reproductive growth, the anthers became less white than wild-type anthers (FIGS. 2C-2F), and their pollen grains became iodine-stained with mature pollen grains (FIG. 2H), resulting in failure to set fruit normally (FIG. 2J).

1.6 application of OsDPW3 gene in creating male sterile line of other rice line

The OsDPW3-1 mutant is hybridized with indica rice variety 9311, Longtefu or Guangdong short No.4 rice line, male sterile lines appear in plants with indica type characteristics in the F2 generation, the separation rule of 3:1 is met, and then the fact that the OsDPW3 gene can also generate male sterile plants when nucleotide sequence changes in other rice varieties is proved.

Example 2 use of osdpw3 mutant in Rice seed production

The osdpw3-1 mutant is used as a male parent to be hybridized with a sterile parent in a three-line or two-line hybridization combination to obtain an F1 generation. Plants with both male sterility and sterility characteristics were selected in generation F2 and crossed with the maintainer line corresponding to the original sterile parent. And (4) crossing the plant with male sterility and sterility characteristics with the maintainer line in the F2 generation, and obtaining a new male sterile line after multi-generation crossing screening, wherein the new male sterile line is suitable for being used as a female parent in a crossing combination.

Example 3 method for restoring the Male sterility trait of osdpw3 mutant

The genome nucleotide sequence of the gene coding the OsDPW3 is transferred into an osDPW3-1 mutant plant, so that the mutant can be restored to a wild type phenotype.

Genomic DNA was extracted from wild-type 9522 seedling leaves as template with primers:

70025gDNAF (the sequence of which is shown in SEQ ID NO. 7):

CCATGATTACGAATTCTATTGCCTGTTTGTGGCTGGAC；

70025gDNAR (the sequence of which is shown in SEQ ID NO. 8):

ATTCGAGCTGGTCACCGCCGCTTACACGTTACTGTATTGG；

a 9120bp genome sequence fragment shown as SEQ ID NO.6 of the OsDPW3 gene is amplified;

inserting the amplified DNA fragment into a binary vector pCAMBIA1301 vector for transforming rice by an In-Fusion transformation system of Dalibao biology company; the sequencing verification is correct, the vector is introduced into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 by electric shock to obtain OsDPW3 complementary Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, and the genetic transformation means is used for transforming scion callus of OsDPW3-1 mutant in vegetative reproductive growth phase, so that the nucleotide coding the amino acid shown as SEQ ID NO.1 is transferred into rice cells and integrated on chromosomes of the rice cells; regenerating to obtain rice plant; to see if the mutant reverted to the wild type phenotype.

T₀Generation of complementary plants, FIG. 3 shows T₀Generation of complementary plants can produce pollen, and is represented by₂KI staining, i.e.the wild type phenotype exhibited.

In conclusion, the mutant strain with abnormal male reproductive development of the rice is obtained by controlling the rice integrin OsDPW3 gene and the encoding protein thereof, so that the male reproductive development and fertility of the rice are controlled; the rice mutant obtained by the invention has no obvious difference with the original parent in the vegetative growth period, and after entering the reproductive growth stage, the male reproductive organ is abnormal in development, and pollen abortion causes plant sterility, thus the invention has very important application in agricultural production.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

Sequence listing

<110> Shanghai university of transportation

Application of <120> male sterility gene OsDPW3 and rice fertility restoration method

<130> 2017

<141> 2017-11-28

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 701

<212> PRT

<213> Oryza sativa

<400> 1

Met Arg Lys Arg Asp Leu Gly Ile Leu Leu Leu Ala Ala Phe Ala Val

1 5 10 15

Phe Phe Ser Leu Gln His Asp Gly Asp Leu Ser Phe Arg Glu Ala Trp

20 25 30

Tyr His Leu Ser Asp Ala Asp Tyr Pro Ile Lys His Asp Ala Asp Arg

35 40 45

Leu Pro Ser Pro Leu Val Ala Asp Leu Asn Gly Asp Gly Lys Pro Glu

50 55 60

Val Leu Ile Pro Thr His Asp Ala Lys Ile Gln Val Leu Gln Pro His

65 70 75 80

Pro Arg Pro Ser Pro Asp Asp Ala Ser Phe His Asp Ala Arg Leu Met

85 90 95

Ala Asp Val Ser Leu Leu Pro Ser Asn Val Arg Leu Ser Ser Gly Arg

100 105 110

Arg Pro Val Ala Met Ala Val Gly Thr Val Asp Arg His Tyr Ala His

115 120 125

Ala Pro Ser Pro Ser Lys Gln Leu Leu Val Val Val Thr Ser Gly Trp

130 135 140

Ser Val Met Cys Phe Asp His Asn Leu Lys Lys Leu Trp Glu Ala Asn

145 150 155 160

Leu Gln Asp Asp Phe Pro His Ala Ala His His Arg Glu Val Ala Ile

165 170 175

Ser Ile Thr Asn Tyr Thr Leu Lys His Gly Asp Ala Gly Leu Val Ile

180 185 190

Val Gly Gly Arg Met Glu Met Gln His His Ser Ala Glu Leu Phe Asp

195 200 205

Glu Phe Met Val Ser Glu His Asn Arg Glu Glu His Arg Arg Ser Ala

210 215 220

Ser Glu Lys Gln Ala Ser Glu Thr Gly Asn Thr Asp Leu Arg His Phe

225 230 235 240

Ala Leu Tyr Ala Phe Ala Gly Arg Thr Gly Glu Leu Arg Trp Ser Arg

245 250 255

Lys Asn Glu Asn Ile Pro Ser Gln Pro Ser Asp Ala Ser Val Leu Ile

260 265 270

Pro Gln His Asn Tyr Lys Leu Asp Ala His Ala Leu Asn Ser Arg His

275 280 285

Pro Gly Gln Phe Glu Cys Arg Glu Phe Arg Glu Ser Val Leu Gly Val

290 295 300

Met Pro His His Trp Asp Arg Arg Glu Asp Thr Phe Leu Gln Leu Ala

305 310 315 320

His Phe Arg Arg His Lys Arg Lys Ala Leu Lys Lys Thr Pro Gly Lys

325 330 335

Ala Val Val Asn Asn Val His Lys Pro Ser Glu His Asn Pro Pro Gly

340 345 350

Lys Asp Val Ser Asn Arg Leu Ala Asn Val Ile Gly Lys Ala Ala Asp

355 360 365

Met Ala Asn Ser Asn Lys Ile Lys Lys Ser Gln Arg Thr Leu Tyr Val

370 375 380

Pro Thr Ile Thr Asn Tyr Thr Gln Val Trp Trp Val Pro Asn Val Val

385 390 395 400

Val Ala His Glu Lys Glu Gly Ile Glu Ala Val His Leu Ala Ser Gly

405 410 415

Arg Thr Ile Cys Lys Leu His Leu Thr Glu Gly Gly Leu His Ala Asp

420 425 430

Ile Asn Gly Asp Gly Val Leu Asp His Val Gln Val Val Gly Ala Asn

435 440 445

Gly Ile Glu Gln Thr Val Val Ser Gly Ser Met Glu Val Leu Lys Pro

450 455 460

Cys Trp Ala Val Ala Thr Ser Gly Val Pro Val Arg Glu Gln Leu Phe

465 470 475 480

Asn Val Ser Ile Cys His Tyr Asn Asn Phe Asn Leu Phe His His Gly

485 490 495

Asp Phe Ser Arg Ser Phe Gly Arg Thr Phe Asp Thr Thr Gly Leu Glu

500 505 510

Val Ala Thr Pro Ile Leu Leu Gln Arg Asp Asp Gly His Lys His Arg

515 520 525

Arg Gly Ser His Gly Asp Ile Ile Phe Leu Thr Ser Arg Gly Glu Val

530 535 540

Thr Ser Tyr Ser Pro Gly Leu Leu Gly His Asp Ala Ile Trp Arg Trp

545 550 555 560

Gln Leu Ser Thr Gly Ala Thr Trp Ser Asn Leu Pro Ser Pro Ser Gly

565 570 575

Met Met Glu Asn Ile Val Val Pro Thr Leu Lys Ala Phe Ser Leu Arg

580 585 590

Ala Tyr Asp Pro Lys Gln Val Ile Ile Ala Gly Gly Asp Leu Glu Ala

595 600 605

Val Val Ile Ser Pro Ser Gly Gly Leu Leu Ala Ser Ile Glu Leu Pro

610 615 620

Ala Pro Pro Thr His Ala Leu Val Leu Glu Asp Phe Asn Gly Asp Gly

625 630 635 640

Leu Thr Asp Ile Ile Leu Val Thr Ser Gly Gly Val Tyr Gly Phe Val

645 650 655

Gln Thr Arg His Pro Gly Ala Leu Phe Phe Ser Thr Leu Val Gly Cys

660 665 670

Leu Ile Val Val Ile Gly Val Ile Phe Val Ser Leu His Leu Asn Ser

675 680 685

Ser Asn Ser Gly Lys Pro Arg Ala Ser Thr Asp Tyr Arg

690 695 700

<210> 2

<211> 2106

<212> DNA

<213> Oryza sativa

<400> 2

atgcggaagc gggatctggg catcctcctc ctcgccgcct tcgccgtctt cttctcgctc 60

cagcacgacg gcgacctctc cttccgcgag gcctggtacc acctctccga tgccgactac 120

cccatcaagc acgacgccga ccgcctcccc tctcccctag tcgccgacct caacggcgac 180

ggcaaacccg aggtcctcat ccccacccac gacgccaaga tccaggtcct ccagccccac 240

cccaggccct cccccgacga tgcctccttc cacgacgccc gcctcatggc tgatgtctcc 300

ctcctcccct ccaacgttcg cctctcctcc gggaggcgcc ccgtcgccat ggccgttggc 360

accgtcgacc gccactacgc ccacgccccc tccccctcca agcagctcct cgtcgtcgtc 420

acctccggat ggtccgtcat gtgcttcgac cacaacctca aaaagctctg ggaggctaat 480

ctccaggacg atttccccca cgccgcccac catcgcgagg ttgccatttc cattaccaac 540

tacactctca agcatgggga tgcaggtttg gtcatcgtcg gaggaaggat ggaaatgcaa 600

catcattcag cagagctttt cgatgaattt atggtgtcag aacacaacag ggaagagcac 660

cgtagaagcg ccagtgagaa gcaggcttct gagacaggca acacagacct gcgtcatttt 720

gccctttatg cttttgctgg ccgcactggt gaattaagat ggagccgaaa gaatgagaat 780

atcccatcgc aaccatccga tgcttcagtg ctgataccac aacacaatta caagcttgat 840

gcccatgccc ttaatagtcg tcatcctggt cagttcgaat gtcgggaatt tagagaatca 900

gttcttgggg tcatgcctca tcattgggat aggagagagg atacttttct gcaacttgcc 960

cattttagga ggcataaaag gaaagcactg aagaaaacac ctggaaaagc tgttgtaaat 1020

aacgtgcaca agcccagtga acataatcca cctggaaagg atgtttccaa taggttagca 1080

aatgtgattg ggaaagctgc agatatggct aattcaaata aaatcaagaa gtcacaaagg 1140

acgctttatg ttccgacaat caccaactat actcaagttt ggtgggttcc taatgttgtt 1200

gttgcccacg aaaaagaagg gatagaggct gttcatctag cttctggacg tacaatctgc 1260

aagcttcatt taacagaagg aggccttcat gcagatatta atggagatgg ggttctagac 1320

catgttcagg ttgttggtgc aaatggcatc gagcaaacag ttgttagtgg ttcaatggaa 1380

gtgctgaaac cttgttgggc agtagctaca tctggtgtgc cagtgcggga gcaacttttt 1440

aatgtttcta tctgccatta caacaatttc aatttgtttc atcatggtga cttttcaaga 1500

agttttggga ggacatttga tacaactggc ttagaggtgg cgactcctat tctgctccag 1560

agagatgatg gtcataaaca caggagagga agccacgggg atatcatctt tcttacgagt 1620

cgtggggagg tgacctcgta ctctccaggt ctacttggtc atgatgcaat atggagatgg 1680

caactgtcaa caggtgcaac atggtccaac cttccgtctc catcagggat gatggaaaac 1740

attgtagttc caactttgaa ggctttctct ctgcgagcct atgacccaaa acaggtaatc 1800

atcgcgggtg gtgatctgga ggctgtggtg atttctcctt ctggtggttt attggcatcc 1860

attgaactcc ctgcacctcc aacccatgcg ctggtacttg aagatttcaa tggtgatggt 1920

ttaactgata ttattctggt aacatcgggg ggagtctatg ggtttgtgca gacaagacat 1980

cctggggctc ttttcttcag cacgcttgtg ggttgcttga tagttgttat cggagtgata 2040

tttgtttcac tgcacctcaa ctcctcgaac agcggtaaac ctagggcttc aaccgactat 2100

aggtga 2106

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

tggcgtaaca tcggggggag tcta 24

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

aaactagact ccccccgatg ttac 24

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gtaacatcgg ggggagtcta 20

<210> 6

<211> 9120

<212> DNA

<213> Oryza sativa

<400> 6

tgttttatta cccgtgtctc ttgagagtgt tagtggctct agctaattaa ttcccactac 60

tgagtgctaa taactcccgc taaagctaag ctaagctaag ctagctgcat ctttgtgcat 120

atactgtctg cgtctcctat tgttggcaac gtcgtaatta actttagcat cttatgatgg 180

tgcctgtctg cctgctcgaa atcgaaacgg atggatggca aattggcaat atggcatggc 240

taagcaagct agcttgatgc agcagcaaga aagcaataat tacttattta aggtggttgg 300

atatcctcct atattcttat cgtgcttgga tctgctctca gaatatccaa cctagctagc 360

ctgcaagcaa gagagtgtag ctactcgatc cgatccaatg tctctcatca cggatgagtc 420

tcctagggat tgctcctcct acaagcatca gcatcatcat cgcgccatcc atggtcgccg 480

aattagccgc cgcactctgg tggtggcgtc ctcagcggtg gtgtctctgg catcgctgtc 540

gctcatcctg tggctcgtcc tccgcccatc ccccccgcgc ttctcgctgc tcgccgccac 600

caccaccgcc aacgactctg cctctgtcgt cgccatcaac gccgccttcg ccgcccgcaa 660

ccccaactcc cacaccgccg ttctctacga ccgcctccag gctagcgcct cctacgccgg 720

gctccctctc accgccccct cgccgctgat cccgcccttc ttgccgcagc agggccaggg 780

cgacgccatg ctctccgcgt cgctcacgtc gccaccggca gcggctgctg tggcgggagg 840

gcgggcgctg ctgaggctgc gcgtggaggg gcagctccgc tggaaggtgg cggcgtgggt 900

caccggacgc cacgcgctca ccgtcgactg catcgccgtt gtggagctgc agccgacgcc 960

gacgccgtcg ccgagcgcga tcgtcggcgt cctccagccc caagatcagg ccggctcccg 1020

ctgctccacc accgtcgcct aataatataa tatccatcaa aaccaacacc acaaaccatg 1080

caaactgatc gatggatgca tggaggaaca gtcctagttc ttgtacatgt acatgtattc 1140

tctctcgcgt tatgtatgta tattgtcctg taccgcgcgc ggtaaacaag taataaatca 1200

aagcaatctg aatcgtacaa cgtatttcat gtgttgcttt gatttttttg gctttcagct 1260

gtggtgctct gtgtcccaaa agtaggagtg ccgtacttgc attttggttt taatttcttt 1320

tgttcaccac aggtctggtc tggtcactct cactcactct aattaaatcg attttttatt 1380

attactccag ttcattcggt gtgtgaatgt gaatctgcct gtgttgtgta tgcgactatg 1440

tgcttatgaa atttcctgga gtacacttaa gggcggccga ttttcgtcgt cataaggaac 1500

ggcgcaaagg aaatttcggc ccatacatat ggcccatcca taggccatct cagtgtctag 1560

gccagtccag tccagtccag tccaggacgg tccagtccgg tcccgtagag cgccggcgcg 1620

tgtagcttcc tcctccgctc caggctccag cgagggaggg agggagacca ccgtctccgc 1680

cggctttgag agagaaagag aaagagagag agagagagcg gcgagatgcg gaagcgggat 1740

ctgggcatcc tcctcctcgc cgccttcgcc gtcttcttct cgctccaggt cagtcctagc 1800

ttcttccttc cttggtacca aaccctaacc ctaaccctaa cccgcttgaa ttgatccatg 1860

gccacagcac gacggcgacc tctccttccg cgaggcctgg taccacctct ccgatgccga 1920

ctaccccatc aagcacgacg ccgaccgcct cccctctccc ctagtcgccg acctcaacgg 1980

cgacggcaaa cccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc 2040

ccaccccagg ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt 2100

ctccctcctc ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt 2160

tggcaccgtc gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt 2220

cgtcacctcc ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc 2280

taatctccag gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac 2340

caactacact ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat 2400

gcaacatcat gtaattatgc ttacttttcc tctttatacc actgctgctc atctacatgt 2460

tgtaaaacac acatcatact tcttttttta catgtgccca aatgattcga aaataataac 2520

catattacta gtttgtaatt caagttgcat tccagaataa ctcagggcca ccagcataga 2580

accatccctc gtttgtaatt caggcaaggc tacgcaaaaa tcgttttcct cctttgcagt 2640

aggatttatt cttttataga atttgctgtt atgtgtggat gcctttattt tttttgctac 2700

atttctacaa aattaatttt agatacttca aagttctaat tctatcatat aatgcttgac 2760

catcttgttg aatccttact gataataaca tcttattttc aaactttctc ttttggcttg 2820

aatatgttaa cttacggtag ttacttgttt gtcagtcagc agagcttttc gatgaattta 2880

tggtgtcaga acacaacagg gaagagcacc gtagaagcgc cagtgagaag caggttatct 2940

tgtatttgta agcttatcag ttagtttata ttctctgtgc cccatgaaaa aataaaactg 3000

tgggcaatat tttatatcga gaaaacaaca accagagtac gttgttgtat ccttgctcct 3060

tcacctgatg aaggcctaac ctgcgctggt attgcgcttt gatgtcatgc aggcttctga 3120

gacaggcaac acagacctgc gtcattttgc cctttatgct tttgctggcc gcactggtga 3180

attaagatgg agccgaaaga atgaggtgca cccatcctgt agtccatgac ttttacttta 3240

tagtttatac tactatttat ttcaaggatg ttgccacttc tgtgcatttt gtgtcatgca 3300

ttagcatgca caggacatga atagcttgga aagcttgcca tacattattc atgtgtttct 3360

gttttgacaa aacagaatat cccatcgcaa ccatccgatg cttcagtgct gataccacaa 3420

cacaattaca agcttgatgc ccatgccctt aatagtcgtc atcctggtca ggtgagaatt 3480

gtgcctagca ctcttgataa tggtatattt gccaacagaa gtcacagtta catacttaaa 3540

tctgagcaag tgttatgttt ctgttgatat ttgttctttg ttagcttggt ttaattatca 3600

tgatgtcgat catcttcagc cagtataggt ggctgtcttg actctttagc atattcagca 3660

ttcccactta tgtacaccag aatgatttgc gtgtgttcta caggaatgta ctttcaaatc 3720

catttgttct ttgttagcat ctttagccac gtttccttca attccttact cattctctgc 3780

atgttgctgc tgctaatatt tctgattgat gaaccaatag cctgaacatc tttgaacaaa 3840

atttagtgga ttggtaaata tcaaattctg ctgccatgtt gcttttgatt tggatttcaa 3900

tgtcaaatgt gctgttattt taccacaaga tgctacacag ttggttcttg tagtaaatat 3960

gatctcatta caagctaaca tggcatatat ggtttcagtt cgaatgtcgg gaatttagag 4020

aatcagttct tggggtcatg cctcatcatt gggtaagaat agatattaga taactactat 4080

atcatatttc tctaatttaa ttttttggga tgatcaactc agattgattt ttttttcctt 4140

ttcaggatag gagagaggat acttttctgc aacttgccca ttttaggagg cataaaagga 4200

aagcactgaa gaaaacacct ggaaaagctg ttgtaaataa cgtgcacaag cccagtgaac 4260

ataatccacc tggaaaggat gtttccaata ggttagcaaa tgtgattggg aaagctgcag 4320

atatggctaa ttcaaataaa atcaagaagg tataatgcat gcagacacaa acacatagtt 4380

cttacgcact agcatgttga ctgtgttgtt ctttttgtgt ttggtgtttt ggggaggggg 4440

gaggggggag ggggagttgc atgaacgcag tagtggtaac gtgcatgggc caacgtaggc 4500

accaggagca ggagcactcg tgattgcacg gcgcacagag ctactcaaga tggagaggat 4560

ggtggcgtgg ggaggggaga ggataggatt tgaaatgagg cagatcagtg gaggcagtgg 4620

tgctggcagt tactgggcca agatgacatt gtaggtggtc gggtagaagg aaaaagagaa 4680

gatggcaggg gcagtcgagg gttcttaaga gtggatttgg tgttcaccca gtaggaaatg 4740

ggtgaagatt tgcccagtag ggcctccctt actctcattt caaaatgtat cctctcaatt 4800

tatctgcaag tgtgttcgtc ttgaagatac tgtatacttt ccgatccatt tactgtactc 4860

tcaaaattag tgttaaattg tatccctgga actatattct aaataagtaa gaacagtcaa 4920

actttgaacc aaacatactt acctaacaag ttcatgtctc gtcctcagct ctacttatct 4980

gcatgattat gagactatgg gcacgtccta actggttgat tgtatagatt acggatagaa 5040

aaaaatgctc atttttggaa gtagcttaga aaaagttacc taagcaatgc tgatgtagaa 5100

agttttggga gaaatcatac tttgctggaa gcctggtatg aataatccat acctcacatt 5160

agctgtttag gacgcacact atatatactc atgagaacag atgcattatt tttctataga 5220

aatcaacgaa taacacacgt gtccatgtat ttgcactcaa aatatcgtga gtgggagtgg 5280

gtggagaata tgccatcgcc cccaattccc tattttgaag tgtataagat ataagataag 5340

attagattgg tgattggatt tactttcatc aatgatctgt gatctctagt acttaagtag 5400

tgtctctagc tttttttgat tggtacgtct ttcctggttc attttttgat tagtgtatgt 5460

ctttcctggt tcagtggtgt gaggtaggta ggtgatgtta atagcttgat gttggatgta 5520

ctttgtttat ggcattccat gttagtgtac ttcatgccta tgtgagtttg gcccttacta 5580

ttaaaatcgt tgcctctgat tagtgatcta atgcataaca atctaaagac tcactcggta 5640

attcattaag atacatctga tatcttttat gtgcatagtg cagtcctcct tcaattattg 5700

gcattcatca cttattcagg cgattcttac ataaattgca tgttgtttct ttgctgcatc 5760

ataattcttt ttcccccaat acaatcacag tggtctcaca ccaaaatttt atttacatat 5820

atcgtgttac tttatcatga aatgtaacat ctttcctcta ctgcagtcac aaaggacgct 5880

ttatgttccg acaatcacca actatactca agtttggtgg gttcctaatg ttgttgttgc 5940

ccacgaaaaa gaagggatag aggctgttca tctagcttct ggacgtacaa tctgcaaggt 6000

tgcaagatat atctcagtga tatttgtgtt ttcacgtccc tgccaaagct tgtctaatta 6060

gttcattgta aattatttat ttgtttatag aattttcatt gcctggtcca ctggctgaca 6120

tcaagctaca aatagtgttg aatactacct gaatggtcac taaaatcaat ctatgtttgc 6180

acttgcatat gtacacatta tgcatatatt ttttagcaat cattttcctt ctaaggaaat 6240

cataattcac gtgtgcgcat aatttacatg tctgtaatcc catcatacaa cttttctgtc 6300

tttgttttct gatttttttt tccatttcca gcttcattta acagaaggag gccttcatgc 6360

agatattaat ggagatgggg ttctagacca tgttcaggtg tgttgagcgt tgagattaga 6420

gagcaattta cacttttcat ttccattttt ttagaataca agtcttcatg ccactatatt 6480

ttgtctgcaa cttcaaggag aactgtggaa gtgtggatta gtccattaag cgagttagct 6540

gcttgagtca tgaggtgtta tggtgtactt tacatcttat aaagtcaatg aaaaaaataa 6600

ggggcaattg caaatttacc actgctttga atcgttattg caaggctacc actagaaaat 6660

tgcaaaaatg ccactagaac tgtcattcaa gtggcatcct tacaaaattg aaaaaactgg 6720

tggcaaattt gcaaatgccc caaaaaataa atgtttcagg attttcactt agttcaatta 6780

atcaatatga cctttagtga cactgaaatg ttcttttttt ctctcactag ttttgctatc 6840

ttttcacact agtatatact ttttaataaa gtgttagtta tgttatatgt atgccttttc 6900

tcataaatga ctgcaaaaaa aaaggtatgc aatgtccaaa caaaaatgtg aacaagaaca 6960

cccccttgtc actttgcaat aaataatcta ttttcatgtt taccacagga tgtgtactga 7020

attagatata caggtacaca agtccataat catatttctt tgctttcaat gtgcattcaa 7080

atttattgta gttgttttct ttagtagctt cacttgtgcc ctacttgtta ttgttatctt 7140

ccagtgtaaa actgagtgat aatgtcttct gtaggttgtt ggtgcaaatg gcatcgagca 7200

aacagttgtt agtggttcaa tggaagtgct gaaaccttgt tgggcagtag ctacatctgg 7260

tgtgccagtg cgggagcaac tttttaatgt ttctatctgc cattacaaca atttcaattt 7320

gtttcatcat ggtgactttt caagaagttt tgggaggaca tttgatacaa ctggcttaga 7380

ggtggcgact cctattctgc tccagagaga tgatggtcat aaacacagga gaggaagcca 7440

cggggatatc atctttctta cgagtcgtgg ggaggtcagc acatcactgt ttttccttgg 7500

aaattcctat cattaatgat aattatacat tgttgtcctt gttccacatg tgcatttctt 7560

ttcaactttc catacctccc tcttgtaatc tgcaatacac tgactttctt tattatcgta 7620

ggtgacctcg tactctccag gtctacttgg tcatgatgca atatggagat ggcaactgtc 7680

aacaggtgca acatggtcca accttccgtc tccatcaggg atgatggaaa acattgtagt 7740

tccaactttg aaggctttct ctctgcgagc ctatgaccca aaacaggtaa tcatcgcggg 7800

tggtgatctg gaggctgtgg tgatttctcc ttctggtggt ttattggcat ccattgaact 7860

ccctgcacct ccaacccatg cgctggtact tgaagatttc aatggtgatg gtttaactga 7920

tattattctg gtaacatcgg ggggagtcta tgggtttgtg cagacaagac atcctggggc 7980

tcttttcttc agcacgcttg tgggttgctt gatagttgtt atcggagtga tatttgtttc 8040

actgcacctc aactcctcga acagcggtaa acctagggct tcaaccgact ataggtgacg 8100

acattatgtc agtcgacaga attccttgtc aatattgagg tgttgttata gcatttgatt 8160

tagatttttc atataatcaa ctgccaactg ggttatgtaa acttgtgcgg cgaatgcatt 8220

tttggcgtaa catgttgtat gatttgggat gtatttctgg cttagctcat atttaaagag 8280

gaataggcac ttgccaccat gacatatcgt gctctgatcc ctaggacaat aaccagtgat 8340

ttttcgtgtg gttttggata ctatgtttgg tggttatatt attagtgtgg ttgtagttat 8400

cctgaaacca agtagcagat ggaacgaatt aagatttttc taatggaagc tatgagcttt 8460

ttattcatta attcttccca tcactcgtgt gctggataca cgtgagaacg ctaaccatga 8520

aaaaagaagg gttaatttga tccatgaagg ttccatttgc tgcgttcatc aattccgttt 8580

tgtgactatg ttgatgctgg ctccatcaac atgaatgaat catggctatg gcaagtcagc 8640

tacataatac gtactacgaa gtactccctc cattccaaaa tacaatgcat aaccacccat 8700

aatccaaaga ccaagaaata attatcatct tgtagtttgg atcatcctaa taaatacaat 8760

gcatatatcc aatagaatta gagaagaatt agagaacatg agagtggatg atttaaaaag 8820

gtaataattt aatggagaaa ggggtcatag ttaattgcct acatgcatac atgccttata 8880

ctattatgga acatctaaaa aaaagtggtt gtgccttata ttatgtaatt atattatgta 8940

atggagggag tagctatgta tccagtgcca ataaaagcat aataaggtaa aaaaaaattc 9000

cagcacatgc ctgttcaaga ggaccatgat cgactggaac aagaatagct tttgcaaatt 9060

gggctcatgc tgatgaacta gtctcaggga atatcaaact aacaaattta atacctcata 9120

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence

<400> 7

ccatgattac gaattctgtt ttattacccg tgtctcttga 40

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence

<400> 8

attcgagctg gtcaccttgc tcatatatct ttggtttcgt 40

<210> 9

<211> 2100

<212> DNA

<213> Oryza sativa

<400> 9

atgcggaagc gggatctggg catcctcctc ctcgccgcct tcgccgtctt cttctcgctc 60

cagcacgacg gcgacctctc cttccgcgag gcctggtacc acctctccga tgccgactac 120

cccatcaagc acgacgccga ccgcctcccc tctcccctag tcgccgacct caacggcgac 180

gccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc ccaccccagg 240

ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt ctccctcctc 300

ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt tggcaccgtc 360

gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt cgtcacctcc 420

ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc taatctccag 480

gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac caactacact 540

ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat gcaacatcat 600

tcagcagagc ttttcgatga atttatggtg tcagaacaca acagggaaga gcaccgtaga 660

agcgccagtg agaagcaggc ttctgagaca ggcaacacag acctgcgtca ttttgccctt 720

tatgcttttg ctggccgcac tggtgaatta agatggagcc gaaagaatga gaatatccca 780

tcgcaaccat ccgatgcttc agtgctgata ccacaacaca attacaagct tgatgcccat 840

gcccttaata gtcgtcatcc tggtcagttc gaatgtcggg aatttagaga atcagttctt 900

ggggtcatgc ctcatcattg ggataggaga gaggatactt ttctgcaact tgcccatttt 960

aggaggcata aaaggaaagc actgaagaaa acacctggaa aagctgttgt aaataacgtg 1020

cacaagccca gtgaacataa tccacctgga aaggatgttt ccaataggtt agcaaatgtg 1080

attgggaaag ctgcagatat ggctaattca aataaaatca agaagtcaca aaggacgctt 1140

tatgttccga caatcaccaa ctatactcaa gtttggtggg ttcctaatgt tgttgttgcc 1200

cacgaaaaag aagggataga ggctgttcat ctagcttctg gacgtacaat ctgcaagctt 1260

catttaacag aaggaggcct tcatgcagat attaatggag atggggttct agaccatgtt 1320

caggttgttg gtgcaaatgg catcgagcaa acagttgtta gtggttcaat ggaagtgctg 1380

aaaccttgtt gggcagtagc tacatctggt gtgccagtgc gggagcaact ttttaatgtt 1440

tctatctgcc attacaacaa tttcaatttg tttcatcatg gtgacttttc aagaagtttt 1500

gggaggacat ttgatacaac tggcttagag gtggcgactc ctattctgct ccagagagat 1560

gatggtcata aacacaggag aggaagccac ggggatatca tctttcttac gagtcgtggg 1620

gaggtgacct cgtactctcc aggtctactt ggtcatgatg caatatggag atggcaactg 1680

tcaacaggtg caacatggtc caaccttccg tctccatcag ggatgatgga aaacattgta 1740

gttccaactt tgaaggcttt ctctctgcga gcctatgacc caaaacaggt aatcatcgcg 1800

ggtggtgatc tggaggctgt ggtgatttct ccttctggtg gtttattggc atccattgaa 1860

ctccctgcac ctccaaccca tgcgctggta cttgaagatt tcaatggtga tggtttaact 1920

gatattattc tggtaacatc ggggggagtc tatgggtttg tgcagacaag acatcctggg 1980

gctcttttct tcagcacgct tgtgggttgc ttgatagttg ttatcggagt gatatttgtt 2040

tcactgcacc tcaactcctc gaacagcggt aaacctaggg cttcaaccga ctataggtga 2100

<210> 10

<211> 699

<212> PRT

<213> Oryza sativa

<400> 10

Met Arg Lys Arg Asp Leu Gly Ile Leu Leu Leu Ala Ala Phe Ala Val

1 5 10 15

Phe Phe Ser Leu Gln His Asp Gly Asp Leu Ser Phe Arg Glu Ala Trp

20 25 30

Tyr His Leu Ser Asp Ala Asp Tyr Pro Ile Lys His Asp Ala Asp Arg

35 40 45

Leu Pro Ser Pro Leu Val Ala Asp Leu Asn Gly Asp Ala Glu Val Leu

50 55 60

Ile Pro Thr His Asp Ala Lys Ile Gln Val Leu Gln Pro His Pro Arg

65 70 75 80

Pro Ser Pro Asp Asp Ala Ser Phe His Asp Ala Arg Leu Met Ala Asp

85 90 95

Val Ser Leu Leu Pro Ser Asn Val Arg Leu Ser Ser Gly Arg Arg Pro

100 105 110

Val Ala Met Ala Val Gly Thr Val Asp Arg His Tyr Ala His Ala Pro

115 120 125

Ser Pro Ser Lys Gln Leu Leu Val Val Val Thr Ser Gly Trp Ser Val

130 135 140

Met Cys Phe Asp His Asn Leu Lys Lys Leu Trp Glu Ala Asn Leu Gln

145 150 155 160

Asp Asp Phe Pro His Ala Ala His His Arg Glu Val Ala Ile Ser Ile

165 170 175

Thr Asn Tyr Thr Leu Lys His Gly Asp Ala Gly Leu Val Ile Val Gly

180 185 190

Gly Arg Met Glu Met Gln His His Ser Ala Glu Leu Phe Asp Glu Phe

195 200 205

Met Val Ser Glu His Asn Arg Glu Glu His Arg Arg Ser Ala Ser Glu

210 215 220

Lys Gln Ala Ser Glu Thr Gly Asn Thr Asp Leu Arg His Phe Ala Leu

225 230 235 240

Tyr Ala Phe Ala Gly Arg Thr Gly Glu Leu Arg Trp Ser Arg Lys Asn

245 250 255

Glu Asn Ile Pro Ser Gln Pro Ser Asp Ala Ser Val Leu Ile Pro Gln

260 265 270

His Asn Tyr Lys Leu Asp Ala His Ala Leu Asn Ser Arg His Pro Gly

275 280 285

Gln Phe Glu Cys Arg Glu Phe Arg Glu Ser Val Leu Gly Val Met Pro

290 295 300

His His Trp Asp Arg Arg Glu Asp Thr Phe Leu Gln Leu Ala His Phe

305 310 315 320

Arg Arg His Lys Arg Lys Ala Leu Lys Lys Thr Pro Gly Lys Ala Val

325 330 335

Val Asn Asn Val His Lys Pro Ser Glu His Asn Pro Pro Gly Lys Asp

340 345 350

Val Ser Asn Arg Leu Ala Asn Val Ile Gly Lys Ala Ala Asp Met Ala

355 360 365

Asn Ser Asn Lys Ile Lys Lys Ser Gln Arg Thr Leu Tyr Val Pro Thr

370 375 380

Ile Thr Asn Tyr Thr Gln Val Trp Trp Val Pro Asn Val Val Val Ala

385 390 395 400

His Glu Lys Glu Gly Ile Glu Ala Val His Leu Ala Ser Gly Arg Thr

405 410 415

Ile Cys Lys Leu His Leu Thr Glu Gly Gly Leu His Ala Asp Ile Asn

420 425 430

Gly Asp Gly Val Leu Asp His Val Gln Val Val Gly Ala Asn Gly Ile

435 440 445

Glu Gln Thr Val Val Ser Gly Ser Met Glu Val Leu Lys Pro Cys Trp

450 455 460

Ala Val Ala Thr Ser Gly Val Pro Val Arg Glu Gln Leu Phe Asn Val

465 470 475 480

Ser Ile Cys His Tyr Asn Asn Phe Asn Leu Phe His His Gly Asp Phe

485 490 495

Ser Arg Ser Phe Gly Arg Thr Phe Asp Thr Thr Gly Leu Glu Val Ala

500 505 510

Thr Pro Ile Leu Leu Gln Arg Asp Asp Gly His Lys His Arg Arg Gly

515 520 525

Ser His Gly Asp Ile Ile Phe Leu Thr Ser Arg Gly Glu Val Thr Ser

530 535 540

Tyr Ser Pro Gly Leu Leu Gly His Asp Ala Ile Trp Arg Trp Gln Leu

545 550 555 560

Ser Thr Gly Ala Thr Trp Ser Asn Leu Pro Ser Pro Ser Gly Met Met

565 570 575

Glu Asn Ile Val Val Pro Thr Leu Lys Ala Phe Ser Leu Arg Ala Tyr

580 585 590

Asp Pro Lys Gln Val Ile Ile Ala Gly Gly Asp Leu Glu Ala Val Val

595 600 605

Ile Ser Pro Ser Gly Gly Leu Leu Ala Ser Ile Glu Leu Pro Ala Pro

610 615 620

Pro Thr His Ala Leu Val Leu Glu Asp Phe Asn Gly Asp Gly Leu Thr

625 630 635 640

Asp Ile Ile Leu Val Thr Ser Gly Gly Val Tyr Gly Phe Val Gln Thr

645 650 655

Arg His Pro Gly Ala Leu Phe Phe Ser Thr Leu Val Gly Cys Leu Ile

660 665 670

Val Val Ile Gly Val Ile Phe Val Ser Leu His Leu Asn Ser Ser Asn

675 680 685

Ser Gly Lys Pro Arg Ala Ser Thr Asp Tyr Arg

690 695

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

tcgtaggtga cctcgtactc 20

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence

<400> 12

tggtggcaag tgcctattcc tc 22

<210> 13

<211> 2572

<212> DNA

<213> Oryza sativa

<400> 13

agtgtctagg ccagtccagt ccagtccagt ccaggacggt ccagtccggt cccgtagagc 60

gccggcgcgt gtagcttcct cctccgctcc aggctccagc gagggaggga gggagaccac 120

cgtctccgcc ggctttgaga gagaaagaga aagagagaga gagagagcgg cgagatgcgg 180

aagcgggatc tgggcatcct cctcctcgcc gccttcgccg tcttcttctc gctccagcac 240

gacggcgacc tctccttccg cgaggcctgg taccacctct ccgatgccga ctaccccatc 300

aagcacgacg ccgaccgcct cccctctccc ctagtcgccg acctcaacgg cgacggcaaa 360

cccgaggtcc tcatccccac ccacgacgcc aagatccagg tcctccagcc ccaccccagg 420

ccctcccccg acgatgcctc cttccacgac gcccgcctca tggctgatgt ctccctcctc 480

ccctccaacg ttcgcctctc ctccgggagg cgccccgtcg ccatggccgt tggcaccgtc 540

gaccgccact acgcccacgc cccctccccc tccaagcagc tcctcgtcgt cgtcacctcc 600

ggatggtccg tcatgtgctt cgaccacaac ctcaaaaagc tctgggaggc taatctccag 660

gacgatttcc cccacgccgc ccaccatcgc gaggttgcca tttccattac caactacact 720

ctcaagcatg gggatgcagg tttggtcatc gtcggaggaa ggatggaaat gcaacatcat 780

tcagcagagc ttttcgatga atttatggtg tcagaacaca acagggaaga gcaccgtaga 840

agcgccagtg agaagcaggc ttctgagaca ggcaacacag acctgcgtca ttttgccctt 900

tatgcttttg ctggccgcac tggtgaatta agatggagcc gaaagaatga gaatatccca 960

tcgcaaccat ccgatgcttc agtgctgata ccacaacaca attacaagct tgatgcccat 1020

gcccttaata gtcgtcatcc tggtcagttc gaatgtcggg aatttagaga atcagttctt 1080

ggggtcatgc ctcatcattg ggataggaga gaggatactt ttctgcaact tgcccatttt 1140

aggaggcata aaaggaaagc actgaagaaa acacctggaa aagctgttgt aaataacgtg 1200

cacaagccca gtgaacataa tccacctgga aaggatgttt ccaataggtt agcaaatgtg 1260

attgggaaag ctgcagatat ggctaattca aataaaatca agaagtcaca aaggacgctt 1320

tatgttccga caatcaccaa ctatactcaa gtttggtggg ttcctaatgt tgttgttgcc 1380

cacgaaaaag aagggataga ggctgttcat ctagcttctg gacgtacaat ctgcaagctt 1440

catttaacag aaggaggcct tcatgcagat attaatggag atggggttct agaccatgtt 1500

caggttgttg gtgcaaatgg catcgagcaa acagttgtta gtggttcaat ggaagtgctg 1560

aaaccttgtt gggcagtagc tacatctggt gtgccagtgc gggagcaact ttttaatgtt 1620

tctatctgcc attacaacaa tttcaatttg tttcatcatg gtgacttttc aagaagtttt 1680

gggaggacat ttgatacaac tggcttagag gtggcgactc ctattctgct ccagagagat 1740

gatggtcata aacacaggag aggaagccac ggggatatca tctttcttac gagtcgtggg 1800

gaggtgacct cgtactctcc aggtctactt ggtcatgatg caatatggag atggcaactg 1860

tcaacaggtg caacatggtc caaccttccg tctccatcag ggatgatgga aaacattgta 1920

gttccaactt tgaaggcttt ctctctgcga gcctatgacc caaaacaggt aatcatcgcg 1980

ggtggtgatc tggaggctgt ggtgatttct ccttctggtg gtttattggc atccattgaa 2040

ctccctgcac ctccaaccca tgcgctggta cttgaagatt tcaatggtga tggtttaact 2100

gatattattc tggtaacatc ggggggagtc tatgggtttg tgcagacaag acatcctggg 2160

gctcttttct tcagcacgct tgtgggttgc ttgatagttg ttatcggagt gatatttgtt 2220

tcactgcacc tcaactcctc gaacagcggt aaacctaggg cttcaaccga ctataggtga 2280

cgacattatg tcagtcgaca gaattccttg tcaatattga ggtgttgtta tagcatttga 2340

tttagatttt tcatataatc aactgccaac tgggttatgt aaacttgtgc ggcgaatgca 2400

tttttggcgt aacatgttgt atgatttggg atgtatttct ggcttagctc atatttaaag 2460

aggaataggc acttgccacc atgacatatc gtgctctgat ccctaggaca ataaccagtg 2520

atttttcgtg tggttttgga tactatgttt ggtggttata ttattagtgt gg 2572

Claims (10)

1. Male sterile geneOsDPW3The use of (a), wherein the male sterility gene isOsDPW3The coded amino acid sequence is shown as SEQ ID NO.1, and the application is as follows: knocking out, changing or inhibiting by using conventional genetic engineering method or based on CRISPR/Cas9 systemOsDPW3The gene can make the activity of the polypeptide corresponding to the amino acid sequence lose, so as to obtain the rice male sterile line.

2. A method for creating a rice male sterile line is characterized by comprising the following steps: selecting a conventional rice variety, processing and cultivating to obtain the rice male sterile line; the treatment is that the nucleotide sequence of the amino acid shown as SEQ ID number 1 in the rice is deleted, mutated or inhibited by adopting a conventional genetic engineering method or based on a CRISPR/Cas9 system, so that the activity of the polypeptide corresponding to the amino acid sequence is lost.

3. The method of creating a male sterile line of rice as claimed in claim 2, wherein said rice variety is japonica rice variety 9522.

4. The method for creating a male sterile line of rice as claimed in claim 2, wherein said nucleotide sequence is as shown in SEQ ID No. 2.

5. The method for creating rice male sterile lines as claimed in claim 2, wherein the CRISPR/Cas9 system-based treatment specifically comprises: site-directed knockdown using CRISPR/Cas9 systemOsDPW3Gene, suppressionExpression of the nucleotide sequence encoding the amino acid sequence shown as SEQ ID No. 1.

6. The method for creating the rice male sterile line as claimed in claim 5, wherein the method for site-directed knockout of the CRISPR/Cas9 system comprises the following steps:

a) the synthetic single nucleotide sequence primers are shown as SEQ ID No.3 and SEQ ID No. 4;

b) the synthesized mononucleotide sequence forms a dimer structure through annealing reaction, and is connected with a carrier fragment to construct a rice-containing riceOsDPW3OsDPW3-BGK03 plasmid of gene target sequence; the target sequence is shown as SEQ ID No. 5;

c) infecting a rice variety with agrobacterium tumefaciens containing OsDPW3-BGK03 plasmid;

d) by using the compounds shown as SEQ ID No.11 and SEQ ID No.12OsDPW3Specific primers of the gene amplify genome segments for sequencing and screening mutant plants.

7. Use of the rice male sterile line obtained by the method for creating a rice male sterile line according to claim 2 in rice seed production, comprising: and carrying out cross breeding by taking the rice male sterile line as a female parent.

8. A method for recovering the male sterility character of a rice male sterile line is characterized by comprising the following steps: the method adopts conventional genetic means to carry out the steps ofOsDPW3A gene transferred into a rice male sterile line obtained by the method of claim 2, so that the mutant restores a wild-type phenotype; the above-mentionedOsDPW3The amino acid sequence of the gene code is shown in SEQ ID NO. 1.

9. The method for restoring the male sterility trait of a male sterile line of rice as claimed in claim 8 comprising the steps of: will containOsDPW3Agrobacterium tumefaciens of complementarily constructed vector (A)Agrobacterium tumefaciens) Transfer of EHA105 into the waterCultivating male sterile rice line; whereinOsDPW3The complementary construct contains a nucleotide sequence encoding the sequence shown in SEQ ID number 6.

10. The method for restoring the male sterility trait of a male sterile line of rice as claimed in claim 9, said method comprising the steps of:

(a) extracting genome DNA from wild 9522 seedling leaves as template, and amplifying with primers with base sequences shown in SEQ ID No.7 and SEQ ID No.8OsDPW3A 9120bp genome sequence segment of the gene as shown in SEQ ID NO. 6;

(b) providing carrier expressionOsDPW3Agrobacterium tumefaciens of complementary construction of vector: (Agrobacterium tumefaciens）EHA105；

(c) Contacting rice cells or tissues or organs with the agrobacterium of step (a), thereby transferring the nucleotide encoding the amino acid shown as SEQ ID No.1 into the rice cells and integrating it into the chromosome of the rice cells;

(d) and (3) selecting the rice cells or tissues transferred with the nucleotide, and regenerating to obtain rice plants with restored fertility.

Images