CN108728480A - Application of the At3g16910 genes in terms of cultivating drought-resistant crops - Google Patents
Application of the At3g16910 genes in terms of cultivating drought-resistant crops Download PDFInfo
- Publication number
- CN108728480A CN108728480A CN201810399493.9A CN201810399493A CN108728480A CN 108728480 A CN108728480 A CN 108728480A CN 201810399493 A CN201810399493 A CN 201810399493A CN 108728480 A CN108728480 A CN 108728480A
- Authority
- CN
- China
- Prior art keywords
- gene
- at3g16910
- arabidopsis
- plant
- aba
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01194—Acetoacetyl-CoA synthase (2.3.1.194)
Abstract
The invention belongs to genetic engineering fields, and in particular to arabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops.The coded by said gene albumen is related to the plant root growth development that ABA regulates and controls, while related to the stomatal movement of ABA regulation and control.Made by genetic engineering meansAt3g16910Overexpression can be used for cultivating the new variety of plant with preferable drought tolerance.Existing research is thoughtAt3g16910Gene is related to the metabolism of plant lipid material.And in the present invention, inventor demonstrates arabidopsis by a series of experimentsAt3g16910Gene takes part in the lateral root system development growth and stomatal opening of ABA regulation and control, and root system development can be highly relevant with Crop Drought Resistance with stomatal opening, thus by for arabidopsisAt3g16910The overexpression of gene provides new possibility to cultivate new drought-enduring plant kind using this gene.
Description
Technical field
The invention belongs to genetic engineering fields, and in particular to arabidopsisAt3g16910Gene is in terms of cultivating drought-resistant crops
Application.
Background technology
Abscisic Acid（Abscisic acid, ABA）It is a kind of very important growth and development of plants instrumentality
Matter, the interactions such as it and other plant hormones, a variety of metabolins have the plasticity of regulation and control root system development, adjust plant gas
The functions such as hole movement, response Stress response.In plant leaf blade, osmoticum is accumulated in guard cell during stomatal opening, is increased
Add guard cell's osmotic potential, promotes stomatal opening, stomatal opening depends on the hyperpolarization of guard cell's plasma membrane, and then induces K+It is logical
Cross [K+]inChannel flows into guard cell.Therefore, research ABA is to the adjusting of Plant Root Architecture and the adjusting machine of stomatal aperture
System is of great significance to plant Stress response.
ArabidopsisAt3g16910Gene belongs to Acyl-activating enzyme family gene, and CDS length is 1710bp, encodes 569
The albumen of amino acid, existing research think that it is related to plant metabolism, the synthesis of participation regulation and control acetyl coenzyme A, but there is not yet
Research report in terms of the root system development and stomatal movement regulated and controled in relation to the gene and ABA, there are no be used to cultivate by the gene
Correlative study in terms of drought-enduring plant.
Invention content
It is considered herein that arabidopsisAt3g16910Gene regulates and controls root growth and development by ABA with plant and plant is adjusted
Stomatal movement is highly relevant, thus the main purpose of the present invention is to provide arabidopsisAt3g16910Gene is cultivating drought-resistant crops side
The new application in face.
The practical solutions that the present invention is taken are as follows.
ArabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, the coded by said gene albumen regulate and control with ABA
Plant root growth development it is related, it is furthermore, related to root system of plant lateral root development；Specifically, the gene function
Deletion mutant, when ABA simulating droughts are handled, lateral root development is bad in root system.
ArabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, the coded by said gene albumen while and ABA
The stomatal movement of regulation and control is related, specifically, the water of coded by said gene albumen malic acid out of metabolic pathway regulation and control plant body
It puts down to adjust K+Channel activity, and then influence stomatal aperture.
The arabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, it is made by technique for gene engineering
Standby arabidopsisAt3g16910Afunction mutant, i.e.,At3g16910The Arabidopsis plant of gene delection or silence, to ABA
Processing is sensitive, and when ABA is handled, lateral root development is suppressed in root system, in other words,At3g16910The mutant of afunction
Do not show characters of drought resistance.
The arabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, it is made by technique for gene engineering
Standby arabidopsisAt3g16910Mutant is overexpressed, insensitive to ABA processing, lateral root development is unaffected in root system, i.e.,At3g16910Overexpression mutant shows preferable characters of drought resistance；In other words, made by genetic engineering meansAt3g16910It is super
Expression, can cultivate the new variety of plant with preferable drought tolerance；The arabidopsisAt3g16910Overexpress mutant preferably with
Arabidopsis wild type is the plant that sets out；
Prepare the arabidopsisAt3g16910When overexpressing mutant, PCR amplificationAt3g16910When genetic fragment, primer sequence
As shown in NO.1 ~ 2 SEQ ID, specific design is as follows：
Forward primer, 5'-TAAGGTACCCAAGCGGCGATTTGGCGGTGGAT-3',
Reverse primer, 5'- CGGGTCGACGTCAATCTTTATCGCTGTTATTA-3'.
In the prior art, although having to arabidopsisAt3g16910The related report of gene functional research, and reported the base
Because related to the metabolism of plant lipid material, but the relationship of itself and ABA, and how to regulate and control lateral root growth and stomatal movement also not
It appears in the newspapers and leads.In the present invention, inventor demonstrates arabidopsis by a series of experimentsAt3g16910Gene takes part in ABA regulation and control
Lateral root system development growth and stomata aperture regulation, and root system development can be highly relevant with Crop Drought Resistance with stomatal aperture, because
And by for arabidopsisAt3g16910The overexpression of gene provides to cultivate new drought-enduring plant kind using this gene
New possibility.
Description of the drawings
Fig. 1 is arabidopsis WT, the mutant that control and ABA handle 7 days on MS culture mediumsrsa1-1, mutantrsa1-2、
Gene coverscom1And overexpressionOE1Seedlings root growth phenotype；
Fig. 2 is arabidopsis WT, the mutant for growing surroundingrsa1-1, mutantrsa1-2, gene coveringcom1And overexpressionOE1
The stomatal aperture comparison diagram and WT and mutant of plantrsa1-1The percentage of water loss comparison diagram of plant；
Fig. 3 is arabidopsis WT, mutantrsa1-1Posterior spiracle aperture statistical conditions are handled in ABA；
Fig. 4 is arabidopsis WT and mutantrsa1-1Guard cell's plasma membrane K+Channel activity comparison diagram；In figure in downlink image
Light lines arersa1-1, control is control, and malate is malic acid, and citrate is citric acid.
Specific implementation mode
With reference to embodiment the present invention will be further explained explanation.Before introducing specific embodiment, in the application
Used mutantrsa1-1, mutantrsa1-2Acquisition process is briefly discussed below.
Arabidopsis used in the present inventionAt3g16910Gene mutation bodyrsa1-1It screens and obtains from EMS mutagenesis mutant libraries
, it is EMS mutagenesis single sitesAt3g16910Gene lacks functionality mutant.
Mutantrsa1-1EMS mutagenesis mutant library used, primarily directed to arabidopsis root growth in the process to ABA
Screening system constructed by various types of mutant of reaction, main building process are：
After EMS induced mutations, mutant library seedling is handled with 5 μM of ABA first（M1Generation）Obtain potential mutant（These are prominent
Variant has notable difference compared with wild type in Root morphology）, potential mutant is planted and is cultivated, M is harvested2For seed；
To M2The phenotype that Table A BA phenotypes are carried out for plant repeats, and obtains phenotype stabilization and apparent mutant, these mutant are
It constitutes and various mutant libraries is formed by by ABA regulation and control arabidopsis Root morphology；
To ensure that phenotype is correct, these phenotypes are finally stablized into mutant and are returned with wild type to determine aobvious recessiveness, Yi Jishi
No is monogenic inheritance, and after rejecting undesirable mutant, mutant library builds and completes.
Mutant employed in the applicationrsa1-1It is that phenotype is relatively stable always in mutant library structure, screening process
Mutant strain when being detected by map-based cloning, finds mutator in the mutantRSA1One acetyl coenzyme A of coding closes
At enzyme, with AAE7/ACN1（Acyl-activating enzyme）Mutation for the same gene, the site causes amino acid by basic amino acid essence
Propylhomoserin becomes histidine, and protein sequence is changed, thus affects the normal function of gene.
Another mutant-arabidopsis used by the applicationAt3g16910Gene mutation bodyrsa1-2, from quasi- south
Mustard resource center（ABRC, Ohio State University）It obtains, identifies that the mutant is homozygote through PCR；rsa1-2For
T-DNA is inserted intoAt3g16910Gene lacks functionality mutant.
Embodiment 1
ArabidopsisAt3g16910The CDS length of gene is 1710bp, encodes the albumen of 569 amino acid, belongs to Acyl-activating enzyme
Family gene, it is existing studies have shown that the gene is related to fatty acid metabolism in peroxisome, but not yet the gene with
The lateral root development of ABA regulation and control and the research report in terms of stomatal movement.
In the present invention, it has been recognised by the inventors that arabidopsisAt3g16910Lateral root development and stomatal movement of the gene with ABA regulation and control
It is highly relevant, by arabidopsisAt3g16910Gene mutation body（Including afunction and overexpression mutant）And wild type
Comparative study, inventor thinks by using genetic engineering means, by makingAt3g16910Gene overexpresses, and can be used for cultivating
Drought-enduring plant new varieties.
The present embodiment mainly introduces arabidopsisAt3g16910Gene it is related to the plant lateral roots development height that ABA regulates and controls this
The discovery procedure of one conclusion.
By arabidopsis wild type（WT）Withrsa1-1、rsa1-2Mutant seeds dibbling 1.2% agar MS culture mediums,
Between illumination cultivation, light dark cycles 12/12h, 22 DEG C of temperature is sprouted under conditions of relative humidity 70% and growth 5 days vertically,
It is then transferred on the MS culture mediums of 1.2% agar, adds 30 μM of ABA in culture medium respectively or does not add ABA processing（One
As for, under the drought condition in adverse circumstance, ABA synthetic quantities can increase in root, to adjust the more lateral roots of growth, to enhance water suction
Drought-resistant ability, so addition ABA processing carrys out simulating drought environment）, observe lateral root development situation.
It is to be understood that previous experiments show under normal growing conditions, mutantrsa1-1Root growth and wild type
（WT）Without significant difference, but in various concentration ABA（From 1 μM, 10 μM, 15 μM until 50 μM of ABA）After processing, mutantrsa1-1The index values such as lateral root overall length, lateral root number and lateral root density compared with wild type, show different degrees of difference
It is different, and under the conditions of under 30 μM of ABA are handled, lateral root growth difference highly significant, therefore inventor uses concentration ABA processing
To observe lateral root development situation.
Specific handling result is as shown in Figure 1.
From figure 1 it appears that arabidopsis wild type（WT）With mutant（rsa1-1Withrsa1-2）Main Morphology is distinguished
It shows on lateral root length and quantity.In being not added with ABA processing groups, wild type（WT）Lateral root number and length and mutant
（rsa1-1Withrsa1-2）It compares, statistical result difference unobvious.And after ABA processing, i.e., under artificial drought conditions, wild type
（WT）With mutant（rsa1-1Withrsa1-2）It compares, wild type（WT）Lateral root length and lateral root number are substantially better than mutant
（rsa1-1Withrsa1-2）, showAt3g16910Gene and lateral root development in root system are highly relevant, while being possibly used for training
Educate drought-enduring plant.
Embodiment 2
On the basis of embodiment 1, for further verificationAt3g16910Gene function, inventor utilize technique for gene engineering hand again
Duan JiangAt3g16910Conversion enters Arabidopsis Mutants to gene again respectivelyrsa1-1And wild type（WT）In plant, construct
Transgenic homozygous body plantcom1WithOE1, building process is briefly discussed below.
Homozygote plantcom1（At3g16910Gene function covers plant）It prepares
Using round pcr from arabidopsis wild type（WT）It is cloned in plant DNAAt3g16910The promoter and gene sequence of gene
Row, i.e., according to arabidopsisAt3g16910Full length gene genomic dna sequence, in addition 1600 bp of upstream promoter area designs are special
Amplimer, amplificationAt3g16910Full length gene sequence.Specific building process is as follows.
, PCR amplificationAt3g16910Genetic fragment
Design primer sequence is as follows（As shown in NO.1 ~ 2 SEQ ID）：
Forward primer, 5'-TAAGGTACCCAAGCGGCGATTTGGCGGTGGAT-3',
Reverse primer, 5'- CGGGTCGACGTCAATCTTTATCGCTGTTATTA-3'；
Using arabidopsis thaliana genomic dna as template, PCR amplification is carried out, the setting of 50 μ L amplification reaction systems is as follows：
10 × PCR buffer, 5 μ L
2.5 mM dNTP, 5 μ L
1,2.5 μ L of primer
Primer 2,2.5 μ L
Template DNA, 3 μ L
High-fidelity DNA polymerase, 1 μ L
21 μ L of distilled water；
Amplification program：94 DEG C of 5 min of predeformation；95 DEG C, 30 s, 58 DEG C, 50 s, 72 DEG C, 3 min, 32 cycles；72 DEG C of extensions
10 min；
By pcr amplification product（Target DNA fragment）Into row agarose gel electrophoresis, the blob of viscose containing target DNA fragment is cut, is pressed
According to DNA QIAquick Gel Extraction Kits（Takaro companies）Specification, recycling target DNA fragment are spare.
, digestion and connection construction recombination plasmid expression vector
By the recycled target DNA fragment of above-mentioned steps（At3g16910Genetic fragment）It is used with pCAMBIA1300 plasmid vectorsKpn
WithSal Double digestion recycles digestion products and connects, builds recombinant expression carrier；Detailed process is as follows：
Target DNA fragment and pMBIA1300 plasmid vectors are utilized into enzyme under the conditions of 37 DEG CKpn And enzymeSalDouble enzymes are carried out respectively
It cuts 3 hours, the setting of 50 μ L digestion systems is as follows：
Kpn WithSal Each 2 μ L,
10 × connection, 5 μ L of buffer solution,
10 μ L of pMBIA1300 plasmids（Or PCR product）30 μ L,
ddH2O supplies 50 μ L.
Digestion products are recycled, digestion products are connected with construction recombination plasmid expression vector, linked system setting is as follows：
In 0.2mL centrifuge tubes, sequentially add：
2 × connection buffer solution, 4 μ L,
PMBIA1300 plasmid enzyme restriction recovery products, 1 μ L,
Target DNA fragment digestion recovery product, 3 μ L,
2 hours or 4 DEG C of connections overnight are connected in 16 DEG C of water-baths.
, recombinant plasmid expression vector convert Escherichia coliE.coilCompetent cell is identified and is expanded
Above-mentioned constructed recombinant plasmid expression vector is converted into Escherichia coli firstE.coilCompetent cell, detailed process is such as
Under：
Take 100 μ L Escherichia coli of a pipeE.coilCompetent cell solution, dissolves on ice；
Connection product is added to Escherichia coliE.coilIn competent cell solution, gently mixing stands 30 min on ice, and 42
DEG C 90 s of water-bath heat shock, 2 min of rapid cooled on ice；
It is added thereto the LB liquid medium of 800 μ L antibiotic-frees, 180 rpm, 37 DEG C of shaken cultivation 50 min, 12000
Rpm, 1 min of centrifugation, abandon supernatant, are added the LB liquid medium of proper amount of fresh, suspension cell, bacterium solution is all added to containing
On the solid LB media of antibiotic, smeared uniformly with spreading rod, 37 DEG C of inversions are incubated overnight.
Recombinant plasmid is identified after culture, correct with recombinant plasmid connection constructed by determination, identification mainly has
Bacterium colony PCR identifications, plasmid PCR identification, digestion identification, sequencing identification etc., it is specific as follows：
Bacterium colony PCR identifications, the single bacterium colony being incubated overnight after picking conversion is as DNA profiling, with target gene fragment amplimer
Colony PCR amplification is carried out, amplified production carries out gel electrophoresis, and the band that becomes clear in electrophoretic band is positive colony；
Plasmid PCR is identified, the recombinant plasmid dna of positive colony is extracted, and using it as template, carries out PCR amplification, amplified production carries out
PCR is identified；
Double digestion electroresis appraisal extracts positive colony plasmid, is addedKpn WithSal Enzyme, enzyme cutting buffering liquid, 37 DEG C of endonuclease reactions 2
H, digestion products carry out gel electrophoresis identification；
Sequencing identification, pair is sequenced with the correct recombinant plasmid of above-mentioned identification, correct positive colony is sequenced and is expanded
Onestep extraction recombinant plasmid of going forward side by side is spare.
, recombinant plasmid transformed Agrobacterium competent cell
Correct recombinant plasmid transformed Agrobacterium competent cell will be sequenced, detailed process is as follows：
100 μ L Agrobacterium competent cell solution of a pipe is taken, is dissolved on ice；
5 μ L recombinant plasmids are added, gently mixing, stand 30 min, 75 s of liquid nitrogen flash freezer on ice, 37 DEG C of shaking tables shake 5-6
min；
It is added thereto the liquid YEB culture mediums of 800 μ L antibiotic-frees, 180 rpm, 28 DEG C of 4 ~ 5 h of shaken cultivation, then 12000
Rpm, 1 min of centrifugation, abandon supernatant；
The liquid YEB culture mediums of proper amount of fresh are added, suspends again, suspension is all added to the solid containing antibiotic
On YEB culture mediums（100 μg/mL Rif+, 100 μ g/mL Kan+）, spreading rod smearing is uniform, and 28 DEG C are inverted culture 2 ~ 3 days.
, During Agrobacterium arabidopsis
Picking Agrobacterium positive colony is inoculated in the YEB fluid nutrient mediums containing antibiotic（100 μg/mL Rif+, 100 μ
g/mL Kan+）, 250 rpm, 28 DEG C of shaken cultivations to OD600It is 1.2 ~ 1.6；
200 mL bacterium solutions are taken to dispense into the sterile centrifugation tube of 100 mL, 4000 rpm, room temperature centrifuge 10 min, collect thalline
Precipitation is resuspended in dip dyeing buffer solution（1/4 MS, 5 % (W/V) sucrose, 0.03 % surfactants L-77）, adjust OD600For
0.8~1.0；
Take the mutant for growing to the florescencersa1-1, the fruit pod of the flower and development that have opened is removed, bud is immersed in above-mentioned
30s in During Agrobacterium bacterium solution；Plant after dip dyeing is wrapped up with plastic film, 24 h are placed under dim light；
Take out dip dyeing plant, illumination cultivation room culture, generally in the bud dip dyeing to newly growing again after a week；
The plant seed crossed of harvest During Agrobacterium, by harvested seed dibbling in containing hygromycin（hygromycin B）MS
On culture medium, waiting for that seed is sprouted 15 days or so in resistant plantlet of transplant to soil, will harvest seed and carries out repeating screening, directly
To the pure and mild transfer-gen plant of acquisition, i.e. homozygote plantcom1。
Homozygote plantOE1（At3g16910Gene overexpresses plant）Prepare
Homozygote plantOE1（At3g16910Gene overexpresses plant）Preparation process and homozygote plantcom1Preparation process
It is similar, i.e., it is cloned by PCRAt3g16910After gene, carried out respectively with overexpression pCAMBIA super-1300 plasmid vectors
Digestion, and reconnect and build new recombinant plasmid expression vector, constructed recombinant plasmid expression vector is quasi- by disseminating, converting
Southern mustard wild type（WT）Plant finally screens and obtains homozygote plantOE1, detailed process is not repeated to describe.
Prepared homozygote plantOE1In, shown by quantitative PCR technique detectionAt3g16910Gene expression amount with
Wild type is increased compared to significantly, and detection process is briefly described below.
By wild type（WT）With 7 pure and mild transgenosisOE1Seed dibbling is in MS culture mediums（0.6% agar）On, in illumination
Between culture, light dark cycles 12/12h, germination and growth 10 days under conditions of 22 DEG C of temperature, relative humidity 70%, then extraction is every
The RNA of a plant, reverse transcription are used at cDNAAt3g16910The detection of gene expression.
This experiment using SYBR Green fluorescent dyes method.
Primer sequence design is as follows：
Reference gene for amplificationACTIN8,
Positive sequence：5'CAGACCGTATGAGCAAAGA 3',
Reverse sequence：5' GAGGGAAGCAAGGATAGAAC 3'；
Target geneAt3g16910,
Positive sequence：5'ATCTGTGATTCACGGATC 3',
Reverse sequence：5' ATTGCTGGGATGTTAGGT 3'；
As template after diluting 4 ~ 8 times using prepared cDNA, PCR amplification, 20 μ L reactions are carried out using 20 μ L reaction systems
System setting is as follows：
2 × Premixture, 10 μ L
Primer1,1 μ L
Primer2,1 μ L
CDNA, 4 μ L
ddH2O, 5.6 μ L.
Using two-step method, amplification program is for PCR reactions：95℃,10 min；95 DEG C, 30 s, 60 DEG C, 20 s, 40 are followed
Ring；Dissolving program is：60 DEG C, 20 s, 95 DEG C, 20s.
Testing result shows relative to wild type, in 7 transgenic linesAt3g16910Gene is all shown more
Apparent overexpression situation, highest overexpression multiple are 11.094.
By above-mentioned prepared homozygote plantcom1、OE1With wild type（WT）Cultivation growth is carried out using the same manner,
Growth conditions observes root system development situation, the results are shown in Figure 1 with embodiment 1.
From figure 1 it appears thatAt3g16910Gene covers plant（Homozygote plantcom1）In normal growing conditions
Under, root system development situation and wild type（WT）It is essentially identical；At3g16910Gene overexpresses plant（Homozygote plantOE1）?
Under normal growing conditions, root system development situation and other plant also no significant difference.Further ABA simulating drought handling results
Show lateral root length and lateral root number statistically, homozygote plantOE1Other plant are substantially better than, andAt3g16910Gene
Cover plant（Homozygote plantcom1）Then with wild type（WT）Quite.
Integrated embodiment 1 and embodiment 2, it has been recognised by the inventors that arabidopsisAt3g16910Gene and lateral root growth development extreme
Correlation can enhance lateral root development in arabidopsis root system, to carry after overexpressing the gene under conditions of ABA simulating droughts
The drought-enduring performance of crop is risen, there is the potential potential for cultivating drought-enduring plant.
Embodiment 3
The present embodiment mainly introduces arabidopsisAt3g16910Relationship between gene and stomatal movement adjusting.
By arabidopsis wild type（WT）, mutant（rsa1-1Withrsa1-2）, homozygote plantcom1, homozygote plantOE1Seed distinguish dibbling on the MS culture mediums of 0.6% agar, between illumination cultivation, light dark cycles 12/12h, temperature
22 DEG C, germination and growth 10 days under conditions of relative humidity 70%, are then transplanted in the Nutrition Soil under the same terms and grow 18 days.
The blade that clip smooth expansion is distinguished when illumination starts, leveling blade is suspended in（Lower epidermis is contacted with liquid level）Gas
Then illumination 5 hours in the buffer solution of hole are carefully promptly torn with tweezers and take blade lower epidermis, taken pictures and unite under 40 power microscopes
Count stomatal aperture.
Statistical result showed mutantrsa1-1Stomata is smaller than wild type WT stomatal apertures, respectively 3.25 ± 0.01 μ
M and 4.60 ± 0.34 μm；Concrete outcome is as shown in Figure 2.
Mutant is can be seen that from the comparison diagram of the stomatal aperture in Fig. 2（rsa1-1Withrsa1-2）Stomatal aperture it is bright
It is aobvious to compare wild type（WT）Want small, and homozygote plantcom1、OE1Trepanning degree then with wild type（WT）It is similar, opening size one
It causes.
Leaves water loss rate is further measured, is briefly discussed below.
The measurement of percentage of water loss is 12：00 point or so quick clip arabidopsis wild type（WT）And mutantrsa1-1On the ground
Part is put into electronic balance and persistently measures 200 minutes, then calculates percentage of water loss.The results are shown in Figure 2.
It can be seen from the figure that wild type（WT）Percentage of water loss is apparently higher than mutantrsa1-1。
Due to stomatal aperture, percentage of water loss cultivates drought-enduring plant has indicative meaning, thus above-mentioned stomata is opened
Degree observation, statistics and percentage of water loss statistical result show stomatal aperture withAt3g16910Gene is highly relevant, simultaneous mutation body
（rsa1-1Withrsa1-2）Plant is due to lackingAt3g16910Gene in normal growth there is lower stomata to open
Degree, lower percentage of water loss.
In addition, inventor counts the stomatal aperture under foreign aid's ABA dispositions.It is added 0.5 in stomata delays liquid
μM ABA handles 0.5 h and 1 h respectively, counts stomatal aperture size.
The results show that after ABA processing 0.5h, wild type WT and mutantrsa1-1Stomatal aperture all reduces, respectively
2.88 ± 0.39 μm and 2.86 ± 0.19 μm（As previously mentioned, under normal circumstances, numerical value be respectively 4.60 ± 0.34 μm and
3.25±0.01 μm）, this result shows that, mutantrsa1-1Aperture before stomatal aperture is handled compared to itself reduces seldom,
And wild type stomatal aperture is then reduced to when simulating drought is handled and mutantrsa1-1Relatively uniform level；But continuing
Under simulating drought treatment conditions（After ABA handles 1 h）, mutantrsa1-1Stomatal aperture it is then also bigger than wild type, respectively
It is 1.73 ± 0.34 μm（Wild type）With 2.15 ± 0.18 μm（Mutant）；This result shows that, under the conditions of continuous drought, mutation
Bodyrsa1-1It dies down for the regulating power of stomatal aperture, effective drought resisting can not be formed and adjusted.
Stomatal aperture statistical result is specifically as shown in Figure 3.A figures in Fig. 3 are the statistics to stomatal aperture size, and B figures are
By the wild type and mutant in A figuresrsa1-1Stomatal aperture before being handled with ABA is respectively set to 100%, then according to respectively
In processing time point stomatal aperture compared with original aperture, the percentage of each self intersection and original aperture is calculated.It can from B figures
Go out, after ABA handles 1 h, wild type and mutantrsa1-1Stomatal aperture is respectively equivalent to 37.59% He of initial opening
66.33%, this explanation is on stomatal aperture change rate, mutantrsa1-1Stomatal aperture variation it is smaller than wild type WT, i.e., with open country
Raw type is compared, mutantrsa1-1It is insensitive that stomata closes reaction to the stomata that ABA regulates and controls.
The above results can be summarized as：Under normal circumstances,At5g61350Gene lacks functionality mutantrsa1-1Stomata
Opening ratio wild type is small, but after ABA is generated under drought stress,At5g61350Gene lacks functionality mutantrsa1-1's
Stomatal response is weaker than wild type, and performance venthole closes the inadequate phenomenon of degree, i.e., weak to drought resistence, drought tolerance is weaker than wild
Type.It is corresponding, in the case of ABA simulating droughts,At5g61350Gene lacks functionality mutantrsa1-1Root system development
It is suppressed, also shows drought susceptible phenotype, react consistent with stomatal aperture.
Further to verify arabidopsisAt5g61350Gene participate in stomatal movement adjust mechanism, inventor carried out into
The patch clamp experiments of one step, are briefly discussed below.
The experimental design is based on having reported in literatureAt5g61350Organic acid in plant body after gene lacks functionality（Including
Malic acid, citric acid, oxaloacetic acid, fumaric acid etc.）, amino acid, lipid metabolism and soluble sugar content notable change has occurred
Change (Alien et al., Evidence that ACN1 (acetate non-utilizing 1) prevents carbon
Leakage from peroxisomes during lipid mobilization in Arabidopsis seedlings,
2011, Biochemical Journal) report, wherein thinking, the adjusting of malic acid and stomatal movement is closely related.Therefore,
This experimental analysisAt5g61350Influencing each other between gene and malic acid and citric acid.
Inventor utilizes patch clamp technique（EPC-9 patch-clamp amplifier, HEKA Elektronik,
Lambrecht, Germany) the case where having detected potassium current on Guard Cell Protoplasts plasma membrane, to reflect matter with this
Film extroversion K+Channel activity situation.
The results are shown in Figure 4.
It can be seen from the figure that under normal growth state, such as Fig. 4（First row）It is shown, mutantrsa1-1It is interior to K+Electricity
Stream is compared with wild type（WT）It is small；And when applying external source malic acid, K+Electric current is restored to wild-type levels（Such as Fig. 4（Secondary series）Institute
Show）；And for applying exogenous citrate then without the effect（Such as Fig. 4（Third arranges）It is shown）.This result shows that, malic acid make
For signal stimulus mutantrsa1-1K+Channel activity, to influence stomatal opening；In other words,At5g61350Gene may
Regulate and control the level of malic acid etc. in plant body from metabolic pathway to adjust K+Channel activity, and then stomatal aperture is influenced, it adjusts and plants
The forfeiture of object moisture.
It to sum up studies, it has been recognised by the inventors that arabidopsisAt5g61350Albumen takes part in ABA tune after genetic transcription and translation expression
The lateral root growth of control is developed, and affects guard cell's plasma membrane K by malic acid+Channel activity, to have adjusted stomata fortune
It is dynamic.On this basis, using technique for gene engineering means, pass throughAt5g61350After gene overexpression, it can cultivate with preferably resistance to
The new variety of plant of drought.
SEQUENCE LISTING
<110>He'nan University
<120>Application of the At3g16910 genes in terms of cultivating drought-resistant crops
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 32
<212> DNA
<213>Engineer
<400> 1
taaggtaccc aagcggcgat ttggcggtgg at 32
<210> 2
<211> 32
<212> DNA
<213>Engineer
<400> 2
cgggtcgacg tcaatcttta tcgctgttat ta 32
Claims (7)
1. arabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that the coded by said gene albumen
It is related to the plant root growth development of ABA regulation and control.
2. arabidopsis as described in claim 1At3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that
The coded by said gene albumen is related to the growth and development of lateral root in the root system of plant that ABA regulates and controls.
3. arabidopsis as claimed in claim 2At3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that
Pass through the arabidopsis prepared by technique for gene engineeringAt3g16910Afunction mutant, i.e.,At3g16910Gene delection is heavy
Silent Arabidopsis plant, sensitive to ABA processing, when ABA is handled, lateral root development is suppressed in root system.
4. arabidopsis as claimed in claim 2At3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that
Pass through the arabidopsis prepared by technique for gene engineeringAt3g16910Mutant is overexpressed, insensitive, side in root system is handled to ABA
Root development is unaffected.
5. arabidopsis as claimed in claim 4At3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that
Prepare the arabidopsisAt3g16910When overexpressing mutant, PCR amplificationAt3g16910When genetic fragment, primer sequence design
It is as follows：
Forward primer, 5'-TAAGGTACCCAAGCGGCGATTTGGCGGTGGAT-3',
Reverse primer, 5'- CGGGTCGACGTCAATCTTTATCGCTGTTATTA-3'.
6. arabidopsisAt3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that the coded by said gene albumen
It is related to the stomatal movement of ABA regulation and control.
7. arabidopsis as claimed in claim 6At3g16910Application of the gene in terms of cultivating drought-resistant crops, which is characterized in that
The coded by said gene albumen regulates and controls the level of malic acid in plant body to adjust K by metabolic pathway+Channel activity, and then influence
Stomatal aperture.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810399493.9A CN108728480A (en) | 2018-04-28 | 2018-04-28 | Application of the At3g16910 genes in terms of cultivating drought-resistant crops |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810399493.9A CN108728480A (en) | 2018-04-28 | 2018-04-28 | Application of the At3g16910 genes in terms of cultivating drought-resistant crops |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108728480A true CN108728480A (en) | 2018-11-02 |
Family
ID=63939473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810399493.9A Pending CN108728480A (en) | 2018-04-28 | 2018-04-28 | Application of the At3g16910 genes in terms of cultivating drought-resistant crops |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728480A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029779A (en) * | 2020-09-27 | 2020-12-04 | 河南大学 | Application of Arabidopsis thaliana mediator member MED14 and/or MED16 gene in drought resistance |
| CN113122573A (en) * | 2021-06-04 | 2021-07-16 | 郑州大学 | Application of cotton GhBASS5 and Arabidopsis AtBASS5 genes in drought resistance of plants |
| CN114574499A (en) * | 2020-11-30 | 2022-06-03 | 华中农业大学 | Application of OsREP3 gene in controlling drought resistance of rice |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695488A (en) * | 2016-04-20 | 2016-06-22 | 河南大学 | New application of Arabidopsis Thaliana gene At1G21640 in plant drought resistance |
| KR20170049684A (en) * | 2015-10-27 | 2017-05-11 | 중앙대학교 산학협력단 | Method for improving the resistance to the drought stress using CaDRT1 in plants |
-
2018
- 2018-04-28 CN CN201810399493.9A patent/CN108728480A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20170049684A (en) * | 2015-10-27 | 2017-05-11 | 중앙대학교 산학협력단 | Method for improving the resistance to the drought stress using CaDRT1 in plants |
| CN105695488A (en) * | 2016-04-20 | 2016-06-22 | 河南大学 | New application of Arabidopsis Thaliana gene At1G21640 in plant drought resistance |
Non-Patent Citations (5)
| Title |
|---|
| ARINDAM GHATAK ET AL.: "Comprehensive tissue-specific proteome analysis of drought stress responses in Pennisetum glaucum(L.) R. Br. (Pearl millet)", 《JOURNAL OF PROTEOMICS》 * |
| HUAN DONG ET AL.: "Modulation of Guard Cell Turgor and Drought Tolerance by a Peroxisomal Acetate–Malate Shunt", 《MOLECULAR PLANT》 * |
| IBRAHIM KOÇ ET AL.: "Metabolite-Centric Reporter Pathway and Tripartite Network Analysis of Arabidopsis Under Cold Stress", 《FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY》 * |
| 董寰: "拟南芥AtRSA1调节植物侧根生长和气孔运动的分子机制", 《中国博士学位论文全文数据库 基础科学辑》 * |
| 魏宝祥 等: "《植物工程原理及其应用》", 31 July 2017, 云南大学出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029779A (en) * | 2020-09-27 | 2020-12-04 | 河南大学 | Application of Arabidopsis thaliana mediator member MED14 and/or MED16 gene in drought resistance |
| CN114574499A (en) * | 2020-11-30 | 2022-06-03 | 华中农业大学 | Application of OsREP3 gene in controlling drought resistance of rice |
| CN113122573A (en) * | 2021-06-04 | 2021-07-16 | 郑州大学 | Application of cotton GhBASS5 and Arabidopsis AtBASS5 genes in drought resistance of plants |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107435047B (en) | Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof | |
| CN102599052B (en) | Plant in-situ regeneration method and application thereof in genetic transformation | |
| CN110128518A (en) | The method for downgrading material using gene editing technology initiative corn | |
| CN108728480A (en) | Application of the At3g16910 genes in terms of cultivating drought-resistant crops | |
| CN108624596B (en) | Gene for regulating growth of leguminous root noduleGmSPX5And uses thereof | |
| CN104611359B (en) | The application of ZmSPL1 albumen and its encoding gene in regulation and control Maize Kernel Development | |
| CN109609527A (en) | CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor | |
| CN105349551B (en) | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance | |
| CN113372420B (en) | Application of OsSG2 in regulation and control of plant seed grain type | |
| CN106834345B (en) | Method for improving comprehensive stress resistance of rape by multi-gene superposition cotransformation | |
| US10041085B2 (en) | Plant type related protein, and coding gene and application thereof | |
| Shen et al. | Rice potassium transporter OsHAK18 mediates phloem K+ loading and redistribution | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN106636124A (en) | Seed-weight-reducing white birch gene AP2 and encoding protein thereof | |
| CN114410658B (en) | Gene OsWNK9 for reducing cadmium content of rice brown rice, encoding protein and application thereof | |
| CN113293167B (en) | Gene for controlling early and late flowering of tomato and application thereof | |
| CN108841837A (en) | Application of the encoding gene of arabidopsis splicing factor SR45a spliceosome in negative regulation plant salt stress response | |
| CN114214333A (en) | Gene for regulating and controlling development of plant leaf epidermal hair and thickness of secondary wall and application thereof | |
| CN114457106A (en) | Application of tomato gene SlCIPK7 in regulation and control of plant drought resistance | |
| CN106811448B (en) | Cotton tyrosine phosphatase GhPTP1 and its encoding gene and application | |
| CN113308489B (en) | Creation method of novel salt-tolerant oat germplasm | |
| CN110964735B (en) | Application of rice gene OsHXK9 in regulation and control of seed dormancy | |
| CN105802930A (en) | CRK5 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN107236026B (en) | GBP protein and application of coding gene thereof in regulating and controlling plant yield | |
| CN106755338B (en) | Method for detecting existence of mutant in brassinolide biosynthesis gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181102 |
|
| RJ01 | Rejection of invention patent application after publication |