CN106755338B - Method for detecting existence of mutant in brassinolide biosynthesis gene - Google Patents

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to a method for detecting whether a mutant exists in a brassinolide biosynthesis gene, which is characterized by comprising the following steps: comprises the steps of obtaining mutant plants, recovering dwarf and shrunken phenotypes, obtaining cDNA after reverse transcription and RT-PCR detection. The method of the invention can quickly detect the mutant site of the brassinolide main synthetic gene mutant.

Description

Method for detecting existence of mutant in brassinolide biosynthesis gene

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a screening method of a brassinolide biosynthesis gene DWF5 mutant.

Background

Plant hormones produce a very low concentration of an active substance in plant cells. They play an indispensable role in the aspects of plant cell growth and division, differentiation of tissues and organs, flowering and fructification, maturation and aging, seed dormancy and germination, environmental adaptation and resistance and the like, and regulate all aspects of plant growth and development and environmental adaptation. In recent years, people regulate and control crops by applying growth hormone externally, so that the high yield, high resistance and high quality of the crops are greatly improved. Currently, several major classes of hormones known and most widely used include auxins, gibberellins, cytokinins, abscisic acid, ethylene, brassinolide, salicylic acid, jasmonic acid, and the like. These large groups of plant hormones are simple small-molecule compounds, but their physiological effects are very important and complex. Among them, brassinolide is found later, but has been widely used for regulation of leaf size, yield, plant height and resistance of crops. As a sterol substance, brassinolide acts on various aspects of plant growth and development and environmental adaptation. Therefore, the research on brassinolide has important theoretical value and practical significance for the aspects of crop plant type regulation, high yield, high resistance and the like.

Brassinolide synthesis or signal deletion mutants display phenotypes such as dwarfism, dark-yellowing, delayed flowering, male sterility, root shortening (Clouse and Sasse 1998). The discovery of the mutant accelerates the research and wide application of the action mechanism of the brassinolide. Since the brassinolide receptor BRI1 was mutated to obtain mutants of this gene, a number of weak deletion mutants of BRI1 were discovered which exhibit a semi-dwarf phenotype, with the greatest advantage over strong mutants of being fertile and amenable to genetic manipulation (Li and Chory 1997; Noguchi et al 1999). For example, bri1-5 is the first weak mutant found in bri1, obtained by mutagenesis with Ethyl Methanesulfonate (EMS), and is one of the most widely used weak mutants in the study of brassinolide mechanism. BRI1-5 is the result of substitution of cysteine for tyrosine at amino acid 69 of the cysteine pair in the extracellular domain of the BRI1 protein (Noguchi et al 1999). Furthermore, bri1-6, bri1-7, bri1-8, bri1-9 are several additional weak mutants of bri1 that result in amino acid substitutions by EMS mutagenesis (Noguchi et al 1999). bri1-6 was a mutation of glycine 644 to aspartic acid, bri1-7 was a mutation of glycine 613 to serine, bri1-8 was a mutation of arginine 983 to asparagine, and bri1-9 was a mutation of serine 622 to phenylalanine. bri1-301 was a mutation from glycine 989 to isoleucine (Xu et al 2008). bri1-120 was due to a mutation of serine to phenylalanine at position 339 (Shang et al.2011).

Over the last two decades scientists have discovered a number of new members of the BR synthesis and signaling pathway with bri 1-related mutants in the model plant arabidopsis thaliana. For example, screening of the genetic suppressors of bri1-5 by genetic methods revealed important members of the brassinolide signal transduction pathway, BRS1, BAK1, BRL1, BSU1(Li et al 2001; Li et al 2002; Mora-Garcia et al 2004; Zhou et al 2004). bes1-D was found as a genetic repressor of br 1-119 (Yin et al 2002), and atbs-D was found in the br1-301 background (Wang et al 2009; Kang et al 2010). Through screening of the genetic suppressor of bri1-5, a transcription factor TCP1(Guo et al 2010) regulating a key rate-limiting enzyme in brassinolide synthesis and a key enzyme BEN1(Yuan et al 2007) in a brassinolide catabolic pathway are obtained.

To date, studies have found that the key regulatory enzymes DET2, DWF4, CPD, CYP90C1/ROT3, CYP90D1, BR6OX2/CYP85A2 in the brassinolide synthesis pathway catalyze the conversion of brassinolide intermediate precursors (Fujioka et al 1997; Choe et al 1998; Kim et al 1998; Shimada et al 2003; Kim et al 2005; Ohnishi et al 2012). However, only a few weak mutants were found in the model plant Arabidopsis, det2-1 was obtained in the Col background, at position 32.9 on the second chromosome (chord et al 1991), det2-28 and det2-101 are two EMS mutagenized mutants (Li et al 2001; Guo et al 2010). The brassinolide synthesis mutants br6ox2, cyp85a2-1, cyp85a2-2 and cyp85a2-3 all showed a semi-dwarf phenotype (Nomura et al 2005).

However, due to the lack of mutants of the brassinolide synthesis pathway genes, studies on brassinolide synthesis and signals have thus become relatively slow. Therefore, constructing fertile mutants of some key genes in brassinolide synthesis pathway is very important for the research of brassinolide synthesis and metabolism pathways and the wider application of brassinolide.

Disclosure of Invention

In order to solve the technical problems, the invention provides a method for detecting whether mutants exist in brassinolide biosynthesis genes, and the method can be used for quickly detecting mutant sites of brassinolide main synthesis gene mutants.

The method for detecting the presence of a mutant in a brassinolide biosynthesis gene of the present invention for solving the above technical problems is characterized in that: the method comprises the following steps:

(1) obtaining a mutant plant;

(2) spraying 1 mu M brassinolide on the mutant to restore the dwarf shrinkage phenotype, which indicates that the mutant is caused by the functional deletion of brassinolide biosynthesis genes.

(3) Extracting total RNA according to an RNA extraction kit and a specification manufactured by Qiangen company, and performing reverse transcription on 2 mu g of total RNA by using M-MLV reverse transcriptase of Invitrogen company according to the specification to obtain cDNA;

(4) RT-PCR detection, taking cDNA corresponding to 100ng of total RNA, and carrying out PCR amplification by using ExTaq enzyme produced by Baozuo according to the instruction; if the key gene in the brassinolide synthesis pathway is not expressed, the existence of the mutant is found.

The key gene is dwf5, and the unexpressed gene sequence is shown in SEQ ID NO. 1.

The detection method comprises the following steps: dwf5-8 genome DNA is extracted, primer P1 and primer P2 are used for amplification to obtain DNA fragment, the length of the DNA fragment is found to be reduced, and after sequencing and identification, a DNA sequence is found to be deleted in dwf 5-8.

The sequence of the primer P1 is as follows: 5'-CATAAAATGGGAGATTGGGAGT-3'

The sequence of the primer P2 is as follows: 5'-CATAGGTGCAACACTTAATCCA-3' are provided.

The PCR amplification conditions were as follows: at 95 ℃ for 2 min; 95 ℃ for 15 s; 30s at 55 ℃; repeating the steps 2 to 4 for 29 cycles at 72 ℃ for 2 min; extension at 72 ℃ for 10 min.

The primer sequences in the PCR amplification are as follows:

DWF5-F：5’-ATGACTCGAGCTCTGCTGCTG-3’；

DWF5-R：5’-TCATACGTATATCCCTAAAAC-3’；

using EF1a as an internal reference gene, EF1 alpha-F: 5'-CAGGCTGATTGTGCTGTCCT-3', respectively;

EF1ɑ-R：5’-TCAAGTAGCAAAATCA CGGCGCTT-3’。

according to the invention, an arabidopsis wild type Col-0 is taken as a background material, T-DNA pBIB-BASTA (Ge et al.2011) is transformed into arabidopsis Col-0 by an agrobacterium tumefaciens mediated method to obtain a transgenic plant, and in a T2 generation transgenic plant, a plant is found to have a phenotype similar to brassinolide synthesis or signal deletion mutant, and shows the phenotypes of growth retardation, reduction of the width of a rosette, reduction of the height of the plant and reduction of the length of a pod. Through molecular biological means and genetic means, the mutant plant is identified to be caused by deletion of a segment of-1213 to 376bp of a key gene DWF5 in the brassinolide synthesis pathway, and the mutant is named as DWF5 (-8).

The method screens brassinolide synthetic genes from numerous gene mutants, can quickly identify gene deletion mutation caused by T-DNA insertion, and particularly can identify function deletion mutants of nearby genes caused by T-DNA loss after the T-DNA is inserted into a plant genome.

For gene mutation caused by T-DNA loss due to some reason after the T-DNA is inserted into the plant genome, but gene segments near the insertion site are lost along with the T-DNA, the traditional method is usually used for searching mutated genes by methods such as map-based cloning and the like. The method of the invention omits the complicated steps of map-based cloning and the like, and can efficiently detect the mutation site of the brassinolide important synthetic gene mutant by combining phenotype identification.

Drawings

FIG. 1 shows the phenotype of mutant DWF5-8 of DWF5 gene in the present invention

FIG. 2 is a graph showing the expression of DWF5 gene in wild type Arabidopsis thaliana Col and in the DWF5-8 mutant plants of the present invention identified by RT-PCR

FIG. 3 is a schematic diagram of the deletion segment of the dwf5-8 mutant of the present invention

In FIG. 4, the middle plantlet is a mutant of DWF5 gene, the latter three plantlets are phenotype recovery images of the plantlets after DWF5 was transferred to the plantlet

FIG. 5 is a sequence map of pBIB-BASTAT-DNA of the present invention

Detailed Description

The present invention will be described in further detail with reference to specific embodiments below:

example 1

The specific construction and detection method of the DWF5 gene mutant DWF5-8 is as follows:

(1) obtaining a mutant plant:

A. mu.l of pBIB-BASTA at a concentration of 10 ng/. mu.l was added to 100. mu.l of Agrobacterium tumefaciens, and electric transformation was carried out on an electric transformer under conditions of 2.4 kV and 5 milliseconds. Colonies were grown on LB solid medium containing 50. mu.g/ml kanamycin and 50. mu.g/ml gentamicin at 30 ℃ for 2 days, and the next experiment was carried out until the size of the colonies became about 2 mm.

The electric excitation method is to perform electric excitation transformation on a BIO-RAD electric excitation transformation instrument under the conditions of 2.4 kilovolts and 5 milliseconds according to the instruction of the instrument.

B. The grown colonies were identified by colony PCR and then were subjected to amplification culture in LB liquid medium at 28 ℃.

C. pBIB-BASTA T-DNA was transformed into Arabidopsis thaliana wild-type Col-0 by the floral dip method, referred to the method of Clough et al (Clough and Bent 1998).

The sequence map of pBIB-BASTA T-DNA is shown in FIG. 5.

The flower soaking method comprises the following operation steps:

(1) after culturing Agrobacterium in LB liquid medium at 28 ℃ for 48 hours, when OD600 reached 0.8, the Agrobacterium was centrifuged at 6500g for 5min and the cells were collected.

(2) The bacterial cells were dissolved in 5% sucrose solution (200 ml of 5% sucrose solution was required for every 100ml of Agrobacterium solution), and 0.03% Silwet-L77 surfactant was added.

(3) The buds were immersed in the liquid from the previous step and gently shaken for 20 seconds.

(4) And (5) continuously growing the impregnated seedlings, and harvesting the seeds.

D. Collecting T0 generation seeds, planting the seeds in nutrient soil, and spraying a herbicide 1.5 per mill glyphosate solution after seedlings germinate for one week to obtain T1 generation transgenic seedlings.

E. And harvesting the seeds of the T1 transgenic seedlings, namely the T2 seeds.

F. Danish organic sphagnum matrix peat soil (0-10mm) is sprayed with 1.5 per mill glyphosate solution for transgenic seedling resistance screening after seedlings grow for 1 week. Among the surviving seedlings, a seedling was found to show a mutant similar to the brassinolide synthesis or signal-related gene, showing the phenotype of stunting, reduced width of rosette, reduced height of plant, reduced pod length (FIG. 1).

G. By RT-PCR (reverse transcription PCR) of brassinolide synthesis and signal pathway key genes, primers DWF5-F (primer sequence 5'-ATGACTCGAGCTCTGCTGCTG-3') and DWF5-R (primer sequence 5'-TCATACGTATATCCCTAAAAC-3') are used for identification, EF1a is used as an internal reference gene (reverse transcription PCR primers EF1 alpha-F: 5'-CAGGCTGATTGTGCTGTCCT-3'; EF1 alpha-R: 5'-TCAAGTAGCAAAATCA CGGCGCTT-3') to find that the key gene DWF5 in the brassinolide synthesis pathway is not expressed (figure 2), and the mutant is named as DWF 5-8.

The RT-PCR detection step specifically comprises the steps of extracting total RNA from the seedlings of the herbicide resistant BASTA in the last step after 3 weeks of growth according to an RNA extraction kit and a specification produced by Qiangen company, carrying out reverse transcription on 2 mu g of the total RNA by M-MLV reverse transcriptase of Invitrogen company according to the specification to obtain cDNA, taking cDNA corresponding to 100ng of the total RNA, and carrying out PCR amplification by ExTaq enzyme produced by Baozan according to the specification.

The PCR amplification conditions were as follows: at 95 ℃ for 2 min; 95 ℃ for 15 s; 30s at 55 ℃; 72 ℃ for 2min (steps 2 to 4 repeated for 29 cycles); extension at 72 ℃ for 10 min.

As can be seen from fig. 1, the dwf5-8 mutant plants showed a smaller rosette width, a lower plant height, and a lower pod length compared to the wild type arabidopsis thaliana Col, but the seed number of the individual pods varied insignificantly. From FIG. 2, it can be seen that the DWF5 gene was not expressed in the DWF5-8 mutant plants. The reverse transcription PCR used EF1a as an internal reference gene.

Example 2

Mutant plants were obtained directly from the market.

Extracting total RNA according to an RNA extraction kit and a specification manufactured by Qiangen company, and performing reverse transcription on 2 mu g of total RNA by using M-MLV reverse transcriptase of Invitrogen company according to the specification to obtain cDNA;

RT-PCR detection, taking cDNA corresponding to 100ng of total RNA, and carrying out PCR amplification by using ExTaq enzyme produced by Baozuo according to the instruction; if the key gene in the brassinolide synthesis pathway is not expressed, the existence of the mutant is found.

The key gene is dwf5, and the unexpressed gene sequence is shown in SEQ ID NO. 1.

And extracting dwf5-8 genome DNA, amplifying by using primers P1 and P2 to obtain a DNA fragment, finding that the length of the DNA fragment is reduced, and finding that a DNA sequence is deleted in dwf5-8 after sequencing identification.

The sequence of the primer P1 is as follows: 5'-CATAAAATGGGAGATTGGGAGT-3'

The sequence of P2 is: 5'-CATAGGTGCAACACTTAATCCA-3' are provided.

The PCR amplification conditions were as follows: at 95 ℃ for 2 min; 95 ℃ for 15 s; 30s at 55 ℃; repeating the steps 2 to 4 for 29 cycles at 72 ℃ for 2 min; extension at 72 ℃ for 10 min.

Dwf5-8 genome DNA is extracted, primer P1 and primer P2 are used for amplification to obtain DNA fragment, the length of the DNA fragment is found to be reduced, and after sequencing identification, a DNA sequence is found to be deleted in dwf5-8, and the DNA sequence is shown as SEQ ID NO. 1.

The sequence of the primer P1 is as follows: 5'-CATAAAATGGGAGATTGGGAGT-3'

The sequence of the primer P2 is as follows: 5'-CATAGGTGCAACACTTAATCCA-3'

The PCR amplification conditions were as follows:

at 95 ℃ for 2 min; 95 ℃ for 15 s; 30s at 55 ℃; 72 ℃ for 2min (steps 2 to 4 repeated for 29 cycles); extension at 72 ℃ for 10 min.

From the above experimental results, it can be seen that the deletion region of DWF5 gene in the DWF5-8 mutant plant is shown in FIG. 3.

From these deletion segments, it was confirmed that the method found the gene fragment deleted from the DWF5 gene mutant, i.e., succeeded in obtaining the detailed information desired by the present invention around the deletion segment of the whole specific gene of the mutant.

The fact that the DWF5 mutant dwarf phenotype can be recovered by complementing the DWF5 gene back in the experiment proves that the DWF5 gene is caused by mutation.

The method comprises the following specific steps: (1) the full length of DWF5CDS is amplified to construct pBIB-BASTA-35S-DWF5 overexpression vector.

(2) Transformation into Agrobacterium is carried out by electric stimulation.

(3) Agrobacterium containing pBIB-BASTA-35S-DWF5 was transformed into Arabidopsis DWF5-8 by the floral dip method to restore the dwarf phenotype.

As a result, as shown in FIG. 4, the middle plantlet was a mutant of DWF5 gene, and the phenotype of the plantlets was restored after the last three plantlets were transformed with DWF 5.

The synthesis signal path of brassinolide is clear, the mutation site of a certain gene is found from the whole genome by using TAIL-PCR and the like in the traditional method, the expression of the brassinolide synthesis related gene is directly detected, so that the brassinolide synthesis related gene is positioned in a synthesis path, and the gene mutation site is quickly determined by a method of detecting a gene sequence by sections.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

SEQUENCE LISTING

<110> Sichuan university of agriculture

<120> a method for detecting the presence of a mutant in a brassinolide biosynthesis gene

<160>7

<170>PatentIn version 3.3

<210>1

<211>1589

<212>DNA

<213> Artificial Synthesis

<220>

<223> dwf5 unexpressed Gene sequence

<400>1

aagtgtattaaacactaaaatcaaaaaaaggaaacaagtcatgtaccatctggacagaaatgaagatgaaggcatgatctctagcaaccagcagctgaaatctcaatctcaaccaccatctatcagcaggcacattggctcggagtttgaaaaaggctctacactctgtacaatgcgaaaatgcaaaaccttcctgaaacatatattgcatagaaacaaaatacacttcataagctaagtaaaccattcattcaaaagaagaagaaactttctggaaacggtgacgataatataccttggtggagcgccaattatcgagacaagatctgtgaacgtgcttttgagtacctttacaattgcacggagcaatcagatcttcccctgcaatcaaagaacaaaccaagtcgtctcattgtatcctcactcaattgagttaaggaattgcttttattatacctccaacatcaaggcaaattcgacattgtggttgatctccagaaacaagaagtgtggtttcgtcatcatcagtctcagctatttctgaaacttgtccttcctccacaacacgatctcctctttccgctgctacgatttcgtttgaggatgttgattcgtcgaataaaatctgttcctttctatcatcatcatcatcactaggcactaattgcatctcttaaacatactaaaatttctggaaatgaaaaaaaactgagaaacgcaaaagaattcaacacagcatcagaaaactagatctaggtttcgccgggagttaccaaaaacattagaaaaaatcgatacttacacgaattcaaccaattctggagaattttcttccaaggcaagccattgcttgcgagttagaagaaattggtaaactatgactgcgaatcagagtgaagagaatttgattttgttagtctcgattcatcactatgtgttgaatacagagatgacgaagatcttttgagggttgagagagaagaagctaagaagattgggatcaatcaaaaacgatggcgaagaaaagtctcaagggtaaaattggaattagaaaaaacatgtggagagcacgtgacacgtgggatttatctgagtttcacagtagacctgtgaagttcatcgtcttcatcgttaacttcgcagactctgttgattagtcaacacagatcagaatctgaggctttggccgagacgagagaagcagaagaagaaaatggcggagactgtacattctccgatcgttacttacgcatcgatgttatcgcttctcgccttctgtccacctttcgtcattctcctgtaagctcatcaatttctgattcgcaagtctttattctagttctcagatcagactcgcacacttttctggctccttaattcatagcgagaagtgcatagccgatatctttaaatcctttcccattaagtaggacttgataagagtctttaattgaaaaagcgattcaatgattctttctctggccaatgtgagtttccagatttttaggaaacaagggtagatttaaagctacaaaatcatatttagtgagttttaagtaatgctcacaagtttcatttctttatgatgc1589

<210>2

<211>22

<212>DNA

<213> Artificial Synthesis

<400>2

cataaaatgggagattgggagt 22

<210>3

<211>22

<212>DNA

<213> Artificial Synthesis

<400>3

cataggtgcaacacttaatcca 22

<210>4

<211>21

<212>DNA

<213> Artificial Synthesis

<400>4

atgactcgagctctgctgctg 21

<210>5

<211>21

<212>DNA

<213> Artificial Synthesis

<400>5

tcatacgtatatccctaaaac 21

<210>6

<211>20

<212>DNA

<213> Artificial Synthesis

<220>

<223> CDS (4 total) T2A sequence

<400>6

caggctgattgtgctgtcct 20

<210>7

<211>24

<212>DNA

<213> Artificial Synthesis

<220>

<223> CDS (4 total) T2A sequence

<400>6

tcaagtagcaaaatcacggcgctt 24

Claims (5)

1. A method for detecting the presence of a mutant in a brassinolide biosynthesis gene, comprising the steps of: the method comprises the following steps:

(1) obtaining a test sample plant; transforming T-DNA pBIB-BASTA into Arabidopsis thaliana Col-0 by using an agrobacterium tumefaciens mediated method to obtain a transgenic sample plant;

(2) spraying 1 mu M brassinolide on the sample plant to restore the dwarf and shriveling phenotype; the phenotype is hypoevolutism, the width of the rosette is reduced, the height of the plant is reduced, and the length of the pod is reduced;

(3) extracting total RNA according to an RNA extraction kit and a specification manufactured by Qiangen company, and performing reverse transcription on 2 mu g of total RNA by using M-MLV reverse transcriptase of Invitrogen company according to the specification to obtain cDNA;

(4) RT-PCR detection, taking cDNA corresponding to 100ng of total RNA, and carrying out PCR amplification by using ExTaq enzyme produced by Baozuo according to the instruction; if the key gene in the brassinolide synthesis path is not expressed, determining that a mutant exists; wherein the key gene is dwf5, and the unexpressed gene sequence is shown in SEQ ID NO. 1.

2. The method for detecting the presence or absence of a mutant in a brassinolide biosynthesis gene according to claim 1, wherein: the detection method comprises the following steps: extracting genome DNA of a detection sample plant, amplifying by using primers P1 and P2 to obtain a DNA fragment, finding that the length of the DNA fragment is reduced, and finding that a DNA sequence is deleted in the detection sample plant after sequencing identification.

3. The method for detecting the presence or absence of a mutant in a brassinolide biosynthesis gene according to claim 2, wherein: the sequence of the primer P1 is as follows: 5'-CATAAAATGGGAGATTGGGAGT-3'

The sequence of the primer P2 is as follows: 5'-CATAGGTGCAACACTTAATCCA-3' are provided.

4. The method for detecting the presence or absence of a mutant in a brassinolide biosynthesis gene according to claim 1, wherein: the PCR amplification conditions were as follows: at 95 ℃ for 2 min; 95 ℃ for 15 s; 30s at 55 ℃; repeating the steps 2 to 4 for 29 cycles at 72 ℃ for 2 min; extension at 72 ℃ for 10 min.

5. The method for detecting the presence of a mutant in a brassinolide biosynthesis gene according to claim 1, wherein: the primer sequences in the PCR amplification are as follows:

DWF5-F：5’-ATGACTCGAGCTCTGCTGCTG-3’；

DWF5-R：5’-TCATACGTATATCCCTAAAAC-3’；

using EF1a as an internal reference gene, EF1 alpha-F: 5'-CAGGCTGATTGTGCTGTCCT-3', respectively;

EF1ɑ-R：5’-TCAAGTAGCAAAATCACGGCGCTT-3’。

Images