CN111560055A

CN111560055A - Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat

Info

Publication number: CN111560055A
Application number: CN202010396017.9A
Authority: CN
Inventors: 徐汉虹; 陈荣华; 林菲; 余迪雅
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-05-12
Filing date: 2020-05-12
Publication date: 2020-08-21
Anticipated expiration: 2040-05-12
Also published as: CN111560055B

Abstract

The invention discloses application of a rice gene OsLAT3 in regulating absorption and accumulation of diquat. The inventor finds that the knock-out rice gene OsLAT3 can inhibit the rapid absorption and accumulation of the rice to the enemy grass, reduce the content of the enemy grass in the rice and improve the resistance of the rice to the enemy grass; and the fast absorption and accumulation of the enemy weed of the rice variety can be adjusted genetically to breed the fast-resistance enemy weed rice variety.

Description

Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a rice gene OsLAT3 in regulation of absorption and accumulation of diquat.

Background

Rice, as a major economic crop, is the major food for the global population, and about 22 million people all over the world eat it. China has a long history of planting rice and wide regions, and is one of the world major rice producing countries. In rice fields in rice growing areas in China, the harm of weeds is very serious, the weeds not only interfere the normal growth of rice, but also induce and spread rice diseases and insect pests, and the yield and the quality of the rice are influenced. The traditional manual weeding mode is time-consuming, labor-consuming and low in efficiency, and is not suitable for weeding in large-area paddy fields; the application of the herbicide is still the most time-saving and labor-saving method for effectively preventing and killing the weeds in the paddy field at present. Therefore, the cultivation of herbicide-resistant rice has huge application space, and at present, the acquisition of herbicide-resistant crops is mainly realized by exogenously introducing herbicide-resistant genes, but the problems of long research and development period, low efficiency and gene pollution exist.

The diquat is one of very important varieties in the field of biocidal herbicides and is widely applied to weeding in fields, orchards and uncultivated areas. The diquat absorption and transport genes and proteins of the rice are separated, cloned and controlled, a diquat resistant rice variety with a diquat absorption function loss is obtained through a gene editing technology, the characteristics of the diquat broad-spectrum effect taking speed can be utilized to reduce weeding cost, improve weeding simplicity and prolong weeding suitable period, the characteristics of the diquat in soil passivation can be utilized to reduce pollution to environment and underground water, the defects of transgenic herbicide-resistant crops can be avoided, more importantly, the residual quantity of the diquat in the rice is reduced while the weeding effect is ensured, and the health risk to organisms is reduced. Therefore, the method has important economic value.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention mainly aims to provide the application of the rice gene OsLAT3 in regulating the absorption and accumulation of diquat.

The invention also aims to provide application of the rice gene OsLAT3 in cultivating a diquat resistant rice variety.

The purpose of the invention is realized by the following technical scheme: the application of the rice gene OsLAT3 in regulating the absorption and accumulation of diquat is based on the discovery that knocking out the OsLAT3 gene can inhibit the absorption and accumulation of the diquat by rice, reduce the content of the diquat in the rice and improve the resistance of the rice to the diquat.

The protein coded by the rice gene OsLAT3 has an amino acid sequence of A, B or C:

A. as shown in SEQ ID NO: 1 or SEQ ID NO: 2;

B. the amino acid sequence of the derivative protein with the same function obtained by the above A through the substitution and/or deletion and/or addition (no more than 10) of one or more amino acid residues;

C. the amino acid sequence of the fusion protein obtained by connecting the N segment and/or the C end of the A or B protein with a label.

The nucleotide sequence of the rice gene OsLAT3 is any one of the following D, E or F:

D. as shown in SEQ ID NO: 3 or SEQ ID NO: 4;

E. has at least more than 70 percent of homology with the nucleotide sequence defined by the D and codes the nucleotide sequence shown as SEQ ID NO: 1 or SEQ ID NO: 2;

F. hybridizes under stringent conditions to a nucleotide as defined by D and encodes the amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or a nucleotide sequence of an amino acid shown in the specification.

Application of rice gene OsLAT3 in cultivating diquat resistant rice variety.

A. as shown in SEQ ID NO: 1 or SEQ ID NO: 2;

D. as shown in SEQ ID NO: 3 or SEQ ID NO: 4;

The rice gene OsLAT3 is applied to cultivation of a diquat resistant rice variety, and the diquat resistant rice variety is obtained by inhibiting the expression quantity and/or activity of protein OsLAT3 in starting plant rice.

The method for inhibiting the expression quantity and/or activity of the protein OsLAT3 in the starting plant rice is a conventional method in the field, such as gene site-directed editing, RNA interference, homologous recombination, gene knockout and the like.

The gene knockout specifically can enable the starting plant to contain a CRISPR-Cas9 system, wherein the system contains sgRNA of OsLAT3 gene which can identify the target as the starting plant.

The sequence of the target is shown as SEQ ID NO: 5, respectively.

Compared with the prior art, the invention has the following advantages and effects:

1. the rice gene OsLAT3 is knocked out, so that the absorption and accumulation of herbicide diquat in rice can be inhibited, the diquat content in rice plants can be reduced, and the health risk to human bodies can be reduced.

2. The knock-out rice gene OsLAT3 can regulate the rapid absorption and accumulation of the rice to the enemy grass in the genetics, improve the rapid resistance of the rice to the enemy grass and breed the enemy grass resistant rice variety.

3. The method combines the absorption accumulation and resistance mechanism of the diquat to provide a good choice for the research of herbicide-resistant crops.

Drawings

FIG. 1 is a diagram showing the results of sequence alignment of mutants of the mid-flower 11 and OsLAT3 genes.

FIG. 2 is a phenotypic view of leaves of mutants of Zhonghua 11 and OsLAT3 genes after being soaked in diquat in vitro.

FIG. 3 is a graph showing the results of measuring the total chlorophyll content in leaves of a mutant of Zhonghua 11 and OsLAT3 genes.

FIG. 4 is a graph showing the results of measuring the amount of diquat in leaves of a mutant of Zhonghua 11 and OsLAT3 genes.

FIG. 5 is a graph showing the results of real-time fluorescent quantitative PCR detection of OsLAT3 gene at different times after flower 11 was sprayed with 5mmol/L diquat.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources. The chemical reagents used in the examples were all imported or domestic analytical grade.

In the examples, Escherichia coli DH 5. alpha. and Agrobacterium EHA105 were commonly used strains and commercially available; the rice variety is wild type medium flower 11 (publicly used rice variety, commercially available). The primers used in the examples were synthesized by Shenzhen Huamao Gene Co, and the sequencing was performed by Shenzhen Huamao Gene Co.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1: construction of OsLAT3 mutant plant by CRISPR knockout

1. Selection of target sequences based on exon sequences of OsLAT3 using CRISPR/Cas9 system

Selecting a specific target sequence according to OsLAT3 exon sequences by utilizing a simple and efficient CRISPR/Cas9 system, wherein the target sequence comprises the following steps: 5'-GCGCCGAGCAGGCCGTGAGCG-3' are provided. The target sequence is specific to OsLAT3 gene and inactivates OsLAT3 protein.

2. Construction of pCRISPR/Cas9 recombinant vector containing the target sequence fragment

1) Design of adaptor primer with cohesive end according to target sequence

The designed target sequence is added to the specific sticky-end linker of the pCRISPR/Cas9 system and the complete linker primer is synthesized.

F1：5’-TGTGTGCGCCGAGCAGGCCGTGAGC-3’；

R1：5’-AAACGCTCACGGCCTGCTCGGCGCA-3’。

2) Annealing and complementing the adaptor primer with the cohesive end to form a double-stranded small fragment with the cohesive end

Diluting the F1 primer and the R1 primer into 10 mu M solutions, uniformly mixing 10 mu L of each solution, carrying out annealing reaction in a PCR instrument, reducing the temperature from 98 ℃ to 22 ℃, and enabling the F1 primer and the R1 primer to be complementary to form a double-stranded small fragment with a sticky end.

3) Cleavage of the original vector pOs-sgRNA containing sg-RNA (TAKARA Cat #632640)

The restriction enzyme BsaI was used to cleave the sgRNA-containing original vector pOs-sgRNA, resulting in a cohesive end complementary to the cohesive end of the target sequence, and the BsaI was used to cleave the pOs-sgRNA original vector in a10 × buffer 2. mu. L, Bsa I enzyme 1. mu. L, pOs-sgRNA vector 4. mu.g, ddH₂The amount of O is up to 20. mu.L, and the enzyme is cleaved at 37 ℃ for 12 h. Checking the size of the cut enzyme product with 1% agarose gel electrophoresis, purifying the cut enzyme product with a column chromatography kit (OMEGA Cat # D2500-02) to obtain pOs-sgRNA vector, adding sterilized ddH₂Dissolving O, and measuring the concentration for later use.

4) Ligating double-stranded small fragments with cohesive ends to the digested pOs-sgRNA vector to form a recombinant vector comprising the target sequence and sg-RNA

Connecting the double-stranded small fragment in the step 2) with the cut pOs-sgRNA vector in the step 3) by using T4 ligase to form a complete recombinant vector containing a target sequence aiming at the OsLAT3 protein and sg-RNA, wherein the 15 mu L of a connecting system is 10 × T4ligation buffer 1.5 mu L, the double-stranded small fragment 4 mu L, and the cut pOs-sgRNA vector 3 mu L, T4 DNA ligation 1 mu L, ddH₂O to 15 mu L, connecting for 12 hours at 16 ℃, transforming the connecting product into escherichia coli DH5 α, culturing the kanamycin-resistant LB plate overnight (containing 10mg/L of kanamycin), selecting positive strains and sequencing to obtain a recombinant vector which is correctly sequenced and contains a target sequence and sg-RNA.

5) LR reaction recombination of a recombinant vector comprising a target sequence and sg-RNA with LR mix, vector pH-Ubicas9-7 comprising Cas9, to form a complete recombinant vector comprising the target sequence-sg-RNA + Cas9

LR mix (North Noro Biotech Co., Ltd, Shanghai) was used to recombine the recombinant vector obtained in step 4) with LR reaction using pH-Ubi-Cas9-7 (supplied by Baige Gene science Co., Ltd) which is a vector containing Cas 9. LR reaction system: 25-50ng of recombinant vector containing target sequence and sg-RNA, 75ng of pH-Ubi-cas9-7 vector, 1. mu.L of 5 xlR clone TM Buffer, TE Buffer (pH8.0) were supplemented to 4.5. mu.L, LR clone TM 0.5. mu.L. The system is incubated for 2h at 25 ℃,2 mu L of 2 mu g/mu L of protease K is added after reaction, the reaction product is treated for 10min at 37 ℃, then 2 mu L of reaction product is transferred into Escherichia coli DH5 alpha, gentamicin resistance LB plate is cultured overnight at 37 ℃, positive strains are selected for sequencing, and the complete pCRISPR/Cas9-OsLAT3 recombinant expression vector containing OsLAT3 protein target sequence-sg-RNA + Cas9 with correct sequencing is obtained.

3. The obtained complete recombinant vector containing the OsLAT3 protein target sequence-sg-RNA + Cas9 is introduced into rice callus to obtain a transgenic plant

1) And (3) transferring the recombinant expression vector pCRISPR/Cas9-OsLAT3 obtained in the step (2) into agrobacterium EHA105 (Olivia C.D,2019) by electric shock to obtain a recombinant bacterium AGL1/pCRISPR/Cas9-OsLAT 3.

2) The recombinant strain AGL1/pCRISPR/Cas9-OsLAT3 is used for transforming medium flower 11 rice callus by an agrobacterium-mediated method, and the specific steps are as follows:

a single colony of AGL1/pCRISPR/Cas9-OsLAT3 was picked, inoculated into 10mL of Agrobacterium culture medium (containing 50mg/L kanamycin and 50mg/L rifampicin), and shake-cultured at 28 ℃ and 180rpm for 2-3 days. Centrifuging 4mL of bacterial solution at 4000rpm for 3min, pouring out the supernatant, adding a small amount of AAM culture medium to reconstitute the suspended cells, adding 20mL of AAM culture medium (containing 0.1mM acetosyringone As), performing shake cultivation at 28 deg.C and 150rpm in the dark for 1-2h, and culturing to OD₆₀₀About 0.4. Selecting rice callus of granular Zhonghua 11 (hereinafter also referred to as wild type rice) with good growth state, soaking in Agrobacterium culture solution (YEP without agar), shaking at 28 deg.C and 150rpm for 20min, pouring out callus, sucking excess bacteria solution with sterile filter paper, spreading callus in sterile plate containing multiple layers of filter paper, and blow-drying on ultra-clean bench (callus is dispersed without agglomeration)Block), then the callus was transferred to the co-culture medium and cultured in the dark for 2-3 days. The calli were transferred to NB minimal medium containing 100mg/L hygromycin and 400mg/L cefamycin for 3-4 weeks (one screen). The surviving calli were transferred to a secondary screening medium (NB minimal medium containing 100mg/L hygromycin and 200mg/L cefuroxime) for 3 weeks. Transferring the resistant callus to a differentiation medium (containing 100mg/L hygromycin) for differentiation, transferring a regenerated plant to a greenhouse after rooting (about 3-4 weeks) on a strong seedling medium containing 100mg/L hygromycin, and obtaining a transgenic plant with the OsLAT3 protein completely inactivated in T0 generation plants.

The media used in the above transformation were as follows:

coculture medium (beijing huayuyo biotechnology limited): the callus and subculture medium was induced + As (0.1mmol/L) + glucose (10g/L), pH 5.2.

Agrobacterium infection rice callus culture medium (AAM medium, Beijing Huayuyang Biotech Co., Ltd.): AA macroelement, AA microelement, AA amino acid, MS vitamin, hydrolyzed casein (500mg/L), sucrose (68.5g/L), glucose (36g/L), As (0.1mM) and pH 5.2.

NB minimal medium (bio-technologies ltd, waryo, beijing): macroelement N6 + trace element B5 + organic component B5 + iron salt + hydrolyzed casein (300mg/L) + proline (500mg/L) + sucrose (30g/L) + agar (8g/L), pH 5.8.

Induction of callus and subculture medium: NB minimal medium +2, 4-D (2 mg/L).

Differentiation medium: NB minimal medium +6-BA (3mg/L) + NAA (1 mg/L).

Strong seedling culture medium: 1/2MS medium + NAA (0.5mg/L) + MET (0.25 mg/L).

Agrobacterium culture medium (YEP): 10g/L tryptone +10g/L yeast extract +5g/L sodium chloride +15g/L agar.

4. Screening transgenic positive plants in transgenic plants

The transgenic plant (T) transplanted in the step 3₀Generation) to extract DNA (OMEGA Cat # D3485-02), and detecting target sequence locus to obtain 15 positive plants.

5. Obtaining mutant plants using transgenic positive plants

1) Identification of the site of mutation

And (3) extracting DNA (OMEGA Cat # D3485-02) from the transplanted positive plant in the step (4), designing specific primers F2 and R2 aiming at the DNA fragment within 500bp containing the target site, amplifying the DNA fragment containing the target site, purifying the obtained 283bp PCR product, sending the purified product to a company for sequencing, comparing the sequencing result with the sequence of a wild plant, and screening out a mutant plant.

F2:5’-AGATGATGAACAGCAAGGGC-3’；

R2:5’-GACGAAGCCGCCGTTCCCCG-3’。

2) And (3) breeding the mutant plants, detecting that the plants without the transgenic elements such as hygromycin, Cas9 and the like in a T1 generation transgenic segregation population and harvesting seeds of the individual plants to obtain the functional deletion mutants which are named as Crispr-1, Crispr-2 and Crispr-3 respectively. The results of mutation analysis of the loss-of-function mutants and wild-type plants are shown in FIG. 1.

Example 2: resistance test of rice to diquat

In order to test the resistance of the deletion mutant rice obtained in example 1 to dichlord, plants growing in a rice incubator for 30 days were selected, leaves of the same length were cut out and soaked in 20mL of 0.1% (v/v) Silwet L-77 (Beijing Bootouda technologies Co., Ltd.) solution (containing 5mmol/L of dichlord), and the solution was left to stand in an artificial climate incubator for 36 hours. After 36h, the rice is taken out, the leaves are washed for 4 times by pure water to ensure that the medicine attached to the surfaces of the leaves is completely removed, the surface moisture is wiped by filter paper, and the rice is used for subsequent tests after phenotype observation and photographing.

Experimental conditions and methods for measuring chlorophyll content were according to literature (brave, naughty, Lin champion, Chenhao. (2018). determination of chlorophyll content of rice Bio-101e 1010147.).

Measuring the content of diquat: weighing, recording, grinding in a mortar, adding liquid nitrogen, adding 5mL of extract (methanol and 1mol/L formic acid solution in a volume ratio of 1: 9), extracting, vortexing for 5min, performing ultrasonic treatment for 10min, centrifuging at 4000rpm for 10min, sucking supernatant, filtering with 0.22 μm needle microporous membrane to remove impurities, concentrating 500 μ L, diluting to constant volume (using 100 μ L of a mixture of 1:9 methanol and 1mol/L formic acid solution), loading into a sample bottle, and detecting with Waters ACQUITY TQD tandem quadrupole liquid chromatograph-mass spectrometer.

The results show that mutant plant leaves were normal after soaking diquat, whereas wild type leaves gradually became greenish and yellow (FIG. 2), the chlorophyll content of mutant leaves was higher than that of wild type medium flower 11 (FIG. 3), and the diquat content was significantly lower than that of wild type medium flower 11 (FIG. 4).

Example 3 real-time fluorescent quantitation assay after treatment of Rice with diquat

0.1% (v/v) Silwet L-77 (Beijing Bootouda technologies Co., Ltd.) solution (containing 5mmol/L of paraquat) is prepared, spray treatment is carried out on 11 plants of the wild type variety growing for 25 days, and 0.1% (v/v) Silwet L-77 solution (containing no medicine) is used as a control. After treatment, 0, 2, 4, and 9h of aerial (stem and leaf) RNA (OMEGA Cat # R6827-02) was extracted, and after reverse transcription (Takara, PrimeScript RT reagent Kit with gDNA Eraser), real-time fluorescent quantitative PCR was performed to detect the expression of OsLAT3 gene. The experiment was repeated three times and the results averaged.

Real-time fluorescent quantitative PCR was performed using Bio-Rad CFX 96. The PCR reaction system (20. mu.L) was carried out according to the product instruction SYBR Green Real-Time PCR Master Mix reagent (Takara) as follows: 10 μ L LSYBR Green Real-Time PCR Master Mix, 2 μ L upstream and downstream primer mixture (both upstream and downstream primer concentrations are 10 μ M), 7 μ L RNase-free water, 1 μ L cDNA template. The specific reaction procedure is as follows: enzymatic heat activation at 95 deg.C for 30s for 1 cycle; denaturation at 95 ℃ for 5s, extension at 60 ℃ for 30s for 40 cycles.

The primer sequence for amplifying the OsLAT3 gene is as follows:

F3：5’-TGATGAACAGCAAGGGCACC-3’；

R3：5’-AGAAGACGAGCGGGAGTAGC-3’。

the primer sequence for amplifying the internal reference UBQ2 by using UBQ2 as an internal reference gene is as follows:

F4：5’-TGCTATGTACGTCGCCATCCAG-3’；

R4：5’-AATGAGTAACCACGCTCCGTCA-3’。

the data is processed by using a complementary Ct method, i.e., the Ct value is the cycle number which is passed when the fluorescence signal in the PCR tube reaches a set threshold value, and the delta Ct is Ct (OsLAT3) -Ct (ACTIN1) and is calculated by 2^－△△CtThe expression of OsLAT3 gene in the sample was analyzed and compared.

As a result, as shown in FIG. 5, the expression of the OsLAT3 gene was specifically induced in the aerial parts (stems and leaves) of rice under the diquat treatment condition, and was up-regulated more strongly with the passage of time.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>526

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ser Glu Leu Thr Met Asp Gln Glu Ile Gln Leu Asn Gln Arg Pro

1 5 10 15

Ser Pro Gln Arg Gln Gln Gln Ala Gln Glu His Gly Gly Ala Thr Ala

20 25 30

Pro Ala Pro Ala Pro Ala Thr Pro Gln Asp Asp Glu Gln Gln Gly His

35 40 45

Gln Ala Ala Val Ala Arg His Gly Cys Gly Gly Ala Thr Ala Glu Arg

50 55 60

His His Gln Thr Lys Leu Thr Leu Leu Pro Leu Val Phe Phe Ile Tyr

65 7075 80

Phe Glu Val Ala Gly Gly Pro Tyr Gly Ala Glu Gln Ala Val Ser Ala

85 90 95

Ala Gly Pro Leu Phe Ala Leu Leu Gly Phe Leu Ala Phe Pro Phe Ala

100 105 110

Trp Gly Val Pro Val Ser Leu Val Thr Ala Glu Leu Ala Ala Ala Leu

115 120 125

Pro Gly Asn Gly Gly Phe Val Val Trp Ala Asp Arg Ala Phe Gly Pro

130 135 140

Leu Ala Gly Ser Leu Leu Gly Thr Trp Lys Tyr Leu Ser Cys Val Ile

145 150 155 160

Asn Leu Ala Ala Phe Pro Ala Leu Val Ala Asp Tyr Leu Gly Arg Val

165 170 175

Ala Pro Ala Val Ala Val Pro Gly Ser Arg Ala Arg Thr Gly Thr Val

180 185 190

Leu Gly Met Thr Val Phe Leu Ser Phe Leu Asn Leu Gly Gly Leu Ser

195 200 205

Ile Val Gly Trp Gly Ala Val Ala Leu Gly Phe Val Ser Leu Ala Pro

210 215 220

Phe Val Leu Met Thr Ala Met Ala Ala Pro Arg Thr Arg Pro Arg Arg

225 230235 240

Trp Ala Ala Arg Val Gln Val Lys Gly Lys Arg Asp Trp Arg Leu Phe

245 250 255

Phe Asn Thr Leu Phe Trp Asn Leu Asn Tyr Trp Asp Ser Ala Ser Thr

260 265 270

Met Ala Gly Glu Val Glu Arg Pro Glu Arg Thr Phe Pro Arg Ala Leu

275 280 285

Ala Val Ala Val Val Leu Ile Ala Val Ser Tyr Leu Leu Pro Leu Met

290 295 300

Ala Ala Val Gly Ala Thr Asp Ala Pro Pro Glu Ala Trp Glu Asn Gly

305 310 315 320

Tyr Leu Ala Asp Ala Ala Gly Ile Ile Gly Gly Arg Trp Leu Lys Tyr

325 330 335

Trp Thr Glu Ala Gly Ala Val Leu Ser Ser Val Gly Leu Phe Glu Ala

340 345 350

Gln Leu Ser Ser Gly Ala Phe Gln Leu Leu Gly Met Ala Glu Leu Gly

355 360 365

Leu Leu Pro Ser Val Phe Ala Arg Arg Gly Pro Gly Arg Ser Ala Thr

370 375 380

Pro Trp Val Ala Val Ala Ala Ser Ala Ala Val Ser Val Ala Val Ser

385 390 395400

Phe Leu Gly Phe Asp Asp Val Val Ala Thr Ala Asn Leu Leu Tyr Ser

405 410 415

Leu Gly Ala Leu Leu Glu Phe Ala Ala Phe Leu Arg Leu Arg Ala Arg

420 425 430

Glu Glu Ser Pro Ser Ser Leu Lys Arg Pro Tyr Arg Val Pro Leu Pro

435 440 445

Leu Pro Ala Leu Ala Ala Met Cys Leu Val Pro Ser Ala Phe Leu Ala

450 455 460

Tyr Val Val Ala Val Ala Gly Trp Arg Val Ser Ala Val Ala Ala Ala

465 470 475 480

Leu Thr Ala Leu Gly Val Gly Trp His Gly Ala Met Arg Val Cys Arg

485 490 495

Ser Arg Lys Trp Leu Arg Phe Asn Thr Ala Val Ala Ala Asp His Arg

500 505 510

Leu Gln Leu Gln Asp Ala Pro Pro Pro Pro Ala Gly Arg Val

515 520 525

<210>2

<211>547

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Ser Glu Leu Thr Met Asp Gln Glu Ile Gln Leu Asn Gln Arg Pro

1 5 10 15

Ser Pro Gln Arg Gln Gln Gln Ala Gln Glu His Gly Gly Ala Thr Ala

20 25 30

Pro Ala Pro Ala Pro Ala Thr Pro Gln Asp Asp Glu Gln Gln Gly His

35 40 45

Gln Ala Ala Val Ala Arg His Gly Cys Gly Gly Ala Thr Ala Glu Arg

50 55 60

His His Gln Thr Lys Leu Thr Leu Leu Pro Leu Val Phe Phe Ile Tyr

65 70 75 80

Phe Glu Val Ala Gly Gly Pro Tyr Gly Ala Glu Gln Ala Val Ser Ala

85 90 95

Ala Gly Pro Leu Phe Ala Leu Leu Gly Phe Leu Ala Phe Pro Phe Ala

100 105 110

Trp Gly Val Pro Val Ser Leu Val Thr Ala Glu Leu Ala Ala Ala Leu

115 120 125

Pro Gly Asn Gly Gly Phe Val Val Trp Ala Asp Arg Ala Phe Gly Pro

130 135 140

Leu Ala Gly Ser Leu Leu Gly Thr Trp Lys Tyr Leu Ser Cys Val Ile

145 150 155 160

Asn Leu Ala Ala Phe Pro Ala Leu Val Ala Asp Tyr Leu Gly Arg Val

165 170 175

Ala Pro Ala Val Ala Val Pro Gly Ser Arg Ala Arg Thr Gly Thr Val

180 185 190

Leu Gly Met Thr Val Phe Leu Ser Phe Leu Asn Leu Gly Gly Leu Ser

195 200 205

Ile Val Gly Trp Gly Ala Val Ala Leu Gly Phe Val Ser Leu Ala Pro

210 215 220

Phe Val Leu Met Thr Ala Met Ala Ala Pro Arg Thr Arg Pro Arg Arg

225 230 235 240

Trp Ala Ala Arg Val Gln Val Lys Gly Lys Arg Asp Trp Arg Leu Phe

245 250 255

Phe Asn Thr Leu Phe Trp Asn Leu Asn Tyr Trp Asp Ser Ala Ser Thr

260 265 270

Met Ala Gly Glu Val Glu Arg Pro Glu Arg Thr Phe Pro Arg Ala Leu

275 280 285

Ala Val Ala Val Val Leu Ile Ala Val Ser Tyr Leu Leu Pro Leu Met

290 295 300

Ala Ala Val Gly Ala Thr Asp Ala Pro Pro Glu Ala Trp Glu Asn Gly

305 310 315 320

Tyr Leu Ala Asp Ala Ala Ala Thr Lys Leu Val Arg Asn Leu Lys Gly

325 330 335

Pro Ala Thr Ser Ile Pro Leu Tyr Gln Asn Tyr Asn Ser Leu His His

340 345 350

Arg Arg Ala Val Ala Gln Val Leu Asp Gly Gly Arg Arg Gly Ala Leu

355 360 365

Leu Arg Arg Val Val Arg Ser Ala Ala Glu Gln Arg Arg Val Pro Ala

370 375 380

Pro Arg His Gly Gly Ala Gly Pro Pro Pro Leu Arg Leu Arg Pro Pro

385 390 395 400

Arg Pro Arg Thr Ile Arg His Pro Val Gly Arg Arg Arg Arg Leu Arg

405 410 415

Arg Arg Leu Gly Arg Arg Leu Leu Pro Arg Leu Arg Arg Arg Arg Arg

420 425 430

His Arg Gln Pro Ala Leu Gln Pro Arg Arg Ala Ala Arg Val Arg Arg

435 440 445

Leu Pro Pro Ala Pro Arg Glu Gly Gly Glu Pro Leu Leu Ala Gln Ala

450 455 460

Pro Leu Pro Arg Pro Ala Ala Ala Pro Arg Ala Arg Arg His Val Pro

465 470 475 480

Arg Ala Val Gly Val Pro Gly Val Arg Gly Arg Arg Arg Arg Val Glu

485 490 495

Gly Leu Arg Arg Arg Arg Arg Ala His Gly Pro Arg Arg Arg Leu Ala

500 505 510

Arg Arg His Glu Gly Val Gln Val Gln Glu Val Ala Gln Val Gln His

515 520 525

Arg Gly Cys Arg Arg Pro Ser Ser Ala Thr Thr Arg Cys Ser Ser Ser

530 535 540

Ser Cys Trp

545

<210>3

<211>1581

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgagtgagc tcaccatgga ccaagaaatc caactgaacc agaggccatc gccgcagcga 60

cagcaacaag cacaagaaca tggcggcgcc accgcaccgg cgccggcgcc ggcgacgcca 120

caagatgatg aacagcaagg gcaccaagca gctgtcgcca ggcatggctg cggcggcgcg 180

acagccgaac gccaccacca gaccaagctc acgctactcc cgctcgtctt cttcatctac 240

ttcgaggtgg ccggcggccc gtacggcgcc gagcaggccg tgagcgcggc gggcccgctg 300

ttcgcgctgc tcggcttcct cgccttcccc ttcgcgtggg gcgtcccggt gtcgctcgtc 360

accgcagagc tcgccgccgc gctcccgggg aacggcggct tcgtcgtctg ggccgaccgc 420

gccttcggcc cgctcgccgg ctccctgctc ggcacgtgga agtacctcag ctgcgtcatc 480

aacctcgccg cgttcccggc cctcgtcgcc gactacctcg gccgcgtcgc cccggcggtc 540

gccgtcccgg gaagcagggc gcgcacgggc acggtgctcg gcatgaccgt cttcctctcc 600

ttcctcaact tgggcggcct aagcattgtc gggtggggcg cggtggccct ggggttcgtg 660

tcgctggcgc cgttcgtgct gatgacggcg atggcggcgc cgaggacgcg gccgcggcgg 720

tgggcggcgc gggtgcaggt gaaggggaag agagactgga ggctcttctt caacacgctc 780

ttctggaacc tcaactactg ggacagcgcg agcaccatgg ccggcgaggt ggagcggccg 840

gagcggacgt tcccgcgggc gctcgcggtg gcggtggtgc tcatcgccgt cagctacctg 900

ctgccgctca tggcggcggt cggcgccacg gacgcgccgc cggaggcgtg ggagaacggc 960

tacttggctg acgcagcagg catcatcggc gggcggtggc tcaagtactg gacggaggcc 1020

ggcgcggtgc tctcctccgt cgggttgttc gaagcgcagc tgagcagcgg cgcgttccag 1080

ctcctcggca tggcggagct gggcctcctc ccctccgtct tcgcccgccg cggccccgga 1140

cgatccgcca ccccgtgggt cgccgtcgcc gcctccgccg ccgtctcggt cgccgtctcc 1200

ttcctcggct tcgacgacgt cgtcgccacc gccaacctgc tctacagcct cggcgcgctg 1260

ctcgagttcg ccgccttcct ccggctccgc gcgagggagg agagcccctc ctcgctcaag 1320

cgcccctacc gcgtcccgct gccgctcccc gcgctcgccg ccatgtgcct cgtgccgtcg 1380

gcgttcctgg cgtacgtggt cgccgtcgcc gggtggaggg tctccgccgt cgccgccgcg 1440

ctcacggccc tcggcgtcgg ctggcacggc gccatgaggg tgtgcaggtc caggaagtgg 1500

ctcaggttca acaccgcggt tgccgccgac catcgtctgc aactacaaga tgctcctcct 1560

cctcctgctg gtagagtctg a 1581

<210>4

<211>1644

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgagtgagc tcaccatgga ccaagaaatc caactgaacc agaggccatc gccgcagcga 60

cagcaacaag cacaagaaca tggcggcgcc accgcaccgg cgccggcgcc ggcgacgcca 120

caagatgatg aacagcaagg gcaccaagca gctgtcgcca ggcatggctg cggcggcgcg 180

acagccgaac gccaccacca gaccaagctc acgctactcc cgctcgtctt cttcatctac 240

ttcgaggtgg ccggcggccc gtacggcgcc gagcaggccg tgagcgcggc gggcccgctg 300

ttcgcgctgc tcggcttcct cgccttcccc ttcgcgtggg gcgtcccggt gtcgctcgtc 360

accgcagagc tcgccgccgc gctcccgggg aacggcggct tcgtcgtctg ggccgaccgc 420

gccttcggcc cgctcgccgg ctccctgctc ggcacgtgga agtacctcag ctgcgtcatc 480

aacctcgccg cgttcccggc cctcgtcgcc gactacctcg gccgcgtcgc cccggcggtc 540

gccgtcccgg gaagcagggc gcgcacgggc acggtgctcg gcatgaccgt cttcctctcc 600

ttcctcaact tgggcggcct aagcattgtc gggtggggcg cggtggccct ggggttcgtg 660

tcgctggcgc cgttcgtgct gatgacggcg atggcggcgc cgaggacgcg gccgcggcgg 720

tgggcggcgc gggtgcaggt gaaggggaag agagactgga ggctcttctt caacacgctc 780

ttctggaacc tcaactactg ggacagcgcg agcaccatgg ccggcgaggt ggagcggccg 840

gagcggacgt tcccgcgggc gctcgcggtg gcggtggtgc tcatcgccgt cagctacctg 900

ctgccgctcatggcggcggt cggcgccacg gacgcgccgc cggaggcgtg ggagaacggc 960

tacttggctg acgcagcagc gacgaagctt gtgaggaatc tcaagggacc agctacaagt 1020

attccactct accaaaacta caattcactg catcatcggc gggcggtggc tcaagtactg 1080

gacggaggcc ggcgcggtgc tctcctccgt cgggttgttc gaagcgcagc tgagcagcgg 1140

cgcgttccag ctcctcggca tggcggagct gggcctcctc ccctccgtct tcgcccgccg 1200

cggccccgga cgatccgcca ccccgtgggt cgccgtcgcc gcctccgccg ccgtctcggt 1260

cgccgtctcc ttcctcggct tcgacgacgt cgtcgccacc gccaacctgc tctacagcct 1320

cggcgcgctg ctcgagttcg ccgccttcct ccggctccgc gcgagggagg agagcccctc 1380

ctcgctcaag cgcccctacc gcgtcccgct gccgctcccc gcgctcgccg ccatgtgcct 1440

cgtgccgtcg gcgttcctgg cgtacgtggt cgccgtcgcc gggtggaggg tctccgccgt 1500

cgccgccgcg ctcacggccc tcggcgtcgg ctggcacggc gccatgaggg tgtgcaggtc 1560

caggaagtgg ctcaggttca acaccgcggt tgccgccgac catcgtctgc aactacaaga 1620

tgctcctcct cctcctgctg gtag 1644

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> target sequence

<400>5

gcgccgagca ggccgtgagc g 21

<210>6

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>F1

<400>6

tgtgtgcgcc gagcaggccg tgagc 25

<210>7

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>R1

<400>7

aaacgctcac ggcctgctcg gcgca 25

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>F2

<400>8

agatgatgaa cagcaagggc 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>R2

<400>9

gacgaagccg ccgttccccg 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>F3

<400>10

tgatgaacag caagggcacc 20

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>R3

<400>11

agaagacgag cgggagtagc 20

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>F4

<400>12

tgctatgtac gtcgccatcc ag 22

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>R4

<400>13

aatgagtaac cacgctccgt ca 22

Claims

1. The application of the rice gene OsLAT3 in regulating the absorption and accumulation of diquat is characterized in that the amino acid sequence of the protein coded by the rice gene OsLAT3 is A, B or C as follows:

A. as shown in SEQ ID NO: 1 or SEQ ID NO: 2;

2. The use of the rice gene OsLAT3 in regulating the absorption and accumulation of diquat as claimed in claim 1, wherein the nucleotide sequence of the rice gene OsLAT3 is any one of D, E or F:

D. as shown in SEQ ID NO: 3 or SEQ ID NO: 4;

E. has at least 70% homology with the nucleotide sequence defined by D, and codes the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2;

3. The application of the rice gene OsLAT3 in cultivating the fast-growing rice variety of the resistance to the aquacide is characterized in that,

the amino acid sequence of the protein coded by the rice gene OsLAT3 is as defined in claim 1;

the nucleotide sequence of the rice gene OsLAT3 is as claimed in claim 2.

4. The application of the rice gene OsLAT3 in breeding of diquat resistant rice varieties according to claim 3, wherein the diquat resistant rice varieties are obtained by inhibiting the expression level and/or activity of protein OsLAT3 in starting plant rice.

5. The application of the rice gene OsLAT3 in breeding of diquat resistant rice varieties according to claim 4, wherein the method for inhibiting the expression level and/or activity of protein OsLAT3 in starting plant rice is gene site-directed editing, RNA interference, homologous recombination and gene knockout by a conventional method in the field.

6. The application of the rice gene OsLAT3 in breeding of diquat resistant rice varieties according to claim 5, wherein the gene knockout specifically comprises that a starting plant contains a CRISPR-Cas9 system, and the system contains sgRNA of an OsLAT3 gene which is used as a recognition target of the starting plant.

7. The application of the rice gene OsLAT3 in breeding of diquat resistant rice varieties according to claim 6, wherein the sequence of the target is shown in SEQ ID NO: 5, respectively.