WO2021104542A1

WO2021104542A1 - Use of rice gene osatl15 in adjusting pesticide absorption and transport

Info

Publication number: WO2021104542A1
Application number: PCT/CN2021/073421
Authority: WO
Inventors: 徐汉虹; 林菲; 肖钰艳; 张汉林; 李志伟
Original assignee: 华南农业大学
Priority date: 2019-11-25
Filing date: 2021-01-22
Publication date: 2021-06-03
Also published as: CN110818784A; CN110818784B

Abstract

A use of the rice gene OsATL15. The gene OsATL15, which controls absorption and transport of pesticides by rice, is obtained from isolation and cloning from rice variety Zhonghua 11. The nucleotide sequence and encoded protein thereof, and a recombinant vector, expression cassette, transgenic cell line and a recombinant strain containing gene OsATL15 can improve absorption and transport of a pesticide by rice, causing the pesticide to reach a part damaged by a pest, and reducing the use amount of the pesticide in a rice paddy. Pesticide delivery performance of a rice variety can also be improved by inheritance, selectively breeding rice varieties having efficient pesticide utilization. In addition, the OsATL15 gene can participate in regulating rice height, thus having an effect of improving rice germplasm resources.

Description

Application of rice gene OsATL15 in regulating the absorption and transportation of pesticides

Technical field

The invention belongs to the field of plant genetic engineering, and particularly relates to the application of rice gene OsATL15 in regulating the absorption and transportation of pesticides.

Background technique

Rice is the main food crop in my country and the world. Approximately 2.2 billion people in the world feed on rice, and 60% of the population in China feed on rice. However, the excessive use of pesticides in the rice production process has caused tremendous pressure on the ecological environment. It is estimated that in the current use of pesticides, only 2% of the pesticides will actually stay on the surface of the plant, and only 0.1% will actually reach the target (Wang et al., 2007). This means that more than 99.9% of pesticides will enter the environment, chemical fertilizers and pesticides are inefficiently used, and most of them are lost to the soil and rivers, resulting in a decline in soil quality, water pollution and soil ecological diversity (Pimentel et al., 1992) . Therefore, enhancing the targeting of pesticides and increasing the effective utilization rate of pesticides are the main goals of current pesticide research and the necessary way to reduce the amount of pesticides and increase the efficiency.

It has been shown that the absorption of glyphosate can be carried out through phosphate transporters on the cell membrane (Denis et al., 1993); Paraquat can also enter plant cells through diamine transporters (Hart et al., 1992); 2,4- D can be transduced by the amino acid transporter ANT1 (Aromatic and Neutral amino acid Transporter 1) (Chen et al., 2001). At present, the functional identification of pesticide transporters is mainly focused on herbicides, and most of them are researched and utilized from the perspective of herbicide resistance. There are few reports on the transfer genes of pesticides, and there are no reports about the use of pesticide transfer genes to achieve targeted accumulation of pesticides and improve the effective use of pesticides.

The systemic insecticide has the characteristics of high efficiency, low toxicity and broad spectrum, and has a good control effect on piercing and sucking pests. However, traditional spraying methods have caused a large amount of pesticides to be released into the environment, which not only affects pollinators, but also causes economic waste. Therefore, the use of isolated and cloned rice insecticide transport genes and proteins is expected to achieve targeted accumulation and regulation of systemic pesticides, reduce environmental release, and also benefit rice breeding.

Pesticide transfer genes can achieve targeted accumulation of pesticides and improve the effective use of pesticides. Therefore, the use of isolated and cloned rice pesticide transfer genes and proteins is expected to achieve targeted accumulation and regulation of systemic pesticides, reduce environmental release, and at the same time be beneficial to rice breeding, and has important economic value.

Summary of the invention

The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art, and to provide the application of rice gene OsATL15 in regulating the absorption and transportation of pesticides.

Another object of the present invention is to provide a molecular marker detection primer for rice gene OsATL15.

The above objectives of the present invention are achieved through the following technical solutions:

The application of the rice gene OsATL15 in regulating the absorption and transportation of pesticides is based on the inventor’s discovery that the OsATL15 gene can increase the absorption and transportation of pesticides by rice, increase the absorption and transportation of pesticides by rice, and reach the pests infested parts and reduce the amount of pesticides in rice fields. Usage amount; it is also possible to genetically improve the conductivity of rice varieties to pesticides, and to breed rice varieties that use pesticides efficiently.

The pesticide is preferably a systemic pesticide; more preferably a systemic pesticide; even more preferably a neonicotinoid insecticide, an amide insecticide, an organophosphorus insecticide, and a silkworm toxin One of insecticides or carbamate insecticides; most preferably one of thiamethoxam, chlorantraniliprole, omethoate, trimethoprim or methomyl.

The amino acid sequence of the protein encoded by the rice gene OsATL15 is the following A) or B):

A. The amino acid sequence shown in SEQ ID NO: 1;

B. The amino acid sequence of a derivative protein with the same function obtained by the substitution and/or deletion and/or addition of one or several amino acid residues in the above A.

The nucleotide sequence of the rice gene OsATL15 is any one of the following A) to E):

A. The nucleotide sequence shown in SEQ ID NO: 2;

B. The nucleotide sequence shown in SEQ ID NO: 3;

C. Under stringent conditions, it hybridizes with the nucleotides defined by A or B, and encodes a nucleotide sequence of the amino acid shown in SEQ ID NO:1;

D. It has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence defined by A, and the encoding is as follows SEQ ID NO: the nucleotide sequence of the amino acid shown in 1;

E. It has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence defined by B, and the encoding is as follows SEQ ID NO: The nucleotide sequence of the amino acid shown in 1.

The application of recombinant vectors, expression cassettes, transgenic cell lines and recombinant bacteria containing the rice gene OsATL15 in regulating the absorption and transportation of pesticides also belongs to the protection scope of the present invention.

A molecular marker detection primer for rice gene OsATL15, consisting of the upstream primer and the downstream primer shown in SEQ ID NO: 4 and SEQ ID NO: 5:

F: 5’-TACTCGCCGCCGCCGTCATA-3’;

R: 5'-CGAGGTTGAGCGTGTTGCTGTTCC-3'.

The application of the molecular marker detection primer of the rice gene OsATL15 in identifying rice varieties that efficiently use pesticides includes the following steps: using the molecular marker detection primer to amplify the germplasm genomic DNA or RNA of the rice variety to be tested , Judge the sensitivity of the target gene in response to pesticide treatment through the change of gene expression.

A molecular marker detection kit for rice gene OsATL15 includes the above-mentioned molecular marker detection primer.

The molecular marker detection kit for the rice gene OsATL15 also includes at least one of an enzyme for PCR, water for PCR and a buffer for PCR.

The application of the rice gene OsATL15 in cultivating transgenic rice that efficiently utilizes pesticides includes the following steps: constructing the rice gene OsATL15 on a plant expression vector, and transferring the obtained recombinant expression vector into rice for expression to obtain the efficient use of pesticides Varieties of rice.

The plant expression vector is preferably pCAMBIA2300-35S.

The recombinant plant expression vector obtained can be transformed into plant cells or tissues by conventional biological methods such as Agrobacterium-mediated, plant virus vector, direct DNA transformation, and electrical conduction transformation. in.

The application of the above-mentioned rice gene OsATL15 in the regulation of rice plant height.

Compared with the prior art, the present invention has the following beneficial effects:

(1) The present invention uses polymerase chain reaction (PCR) to isolate and clone a gene OsATL15 from rice variety Zhonghua 11 that controls the absorption and transport of pesticides in rice. The application of this gene can increase the absorption and transport of pesticides by rice, and make pesticides more effective. Reach the pest-infested parts and reduce the use of pesticides in paddy fields.

(2) Increasing the expression of the gene OsATL15 in rice can genetically improve the transportability of rice varieties to pesticides, select varieties with efficient use of pesticides, and realize the reduction of pesticides in rice fields and increase efficiency.

(3) The present invention confirms the role of the gene OsATL15 in pesticide absorption and transportation, and provides new clues for studying the mechanism of pesticide utilization by rice.

(4) The molecular marker detection primer of the gene OsATL15 provided by the present invention can quickly determine the sensitivity of the target gene in response to pesticide treatment through the change of the gene expression level, and breed new varieties with high efficiency and transportability.

Description of the drawings

Figure 1 shows the results of real-time quantitative fluorescent PCR detection of OsATL15 gene expression in OsATL15 overexpression rice lines.

Figure 2 is a diagram showing the comparison of the OsATL15 gene sequence of a mutant plant in which the OsATL15 gene was knocked out by CRISPR and a wild-type plant.

Figure 3 shows the results of detecting the content of thiamethoxam in the root and upper part of the OsATL15 mutant rice.

Figure 4 shows the results of detecting the content of chlorantraniliprole in the roots and upper parts of OsATL15 mutant rice.

Figure 5 is a graph showing the results of detecting omethoate content in the roots and upper parts of OsATL15 mutant rice.

Fig. 6 is a graph showing the results of detecting the content of dimehypo in the root and upper part of the OsATL15 mutant rice.

Figure 7 is a graph showing the results of detecting methomyl content in the root and upper part of the OsATL15 mutant rice.

Figure 8 is a graph showing the results of detecting the content of thiamethoxam in rice lines overexpressing the OsATL15 gene.

Figure 9 is a diagram showing the results of detecting chlorantraniliprole in rice strains overexpressing the OsATL15 gene.

Figure 10 is a graph showing the results of detecting omethoate in rice strains overexpressing the OsATL15 gene.

Figure 11 is a diagram showing the results of detecting Dimehypo in rice lines overexpressing the OsATL15 gene.

Figure 12 is a graph showing the results of detecting methomyl in rice lines overexpressing the OsATL15 gene.

Figure 13 shows the results of subcellular localization of OsATL15 protein-GFP in rice protoplasts; Figures A, B, C and D are the results of subcellular localization of protein GFP; Figures E, F, G and H are fusion proteins The results of subcellular localization of OsATL15-GFP; Figures A and E are the results under the bright field; Figures B and F are the green fluorescence under the dark field; Figures C and G are the red fluorescence of the membrane localization protein mCherry-1008; D and H are overlapping fields of view; scale bar = 10 μm.

Figure 14 shows the real-time fluorescent quantitative PCR detection result of the OsATL15 gene under the condition of 100 μmol/L thiamethoxam (THX) treatment for 24 hours.

Figure 15 shows the phenotype of the mutant rice line of OsATL15 gene (scale bar = 10cm); where A is wild-type rice Zhonghua 11, B is mutant Crispr-10, C is mutant Crispr-9, and D is mutant Crispr-17.

Figure 16 is a statistical diagram of plant height of mutant rice of OsATL15 gene.

Figure 17 is a statistical diagram of the root length of mutant rice of OsATL15 gene.

Figure 18 is a phenotype map of OsATL15 mature transgenic line

Figure 19 is a phenotypic statistical diagram of plant height, number of tillers, number of ears, and number of empty shells in the OsATL15 transgenic line at the mature stage.

Detailed ways

The present invention will be further described below with reference to the drawings and specific embodiments of the specification, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

In the examples, Escherichia coli DH5α and Agrobacterium EHA105 are commonly used strains, which are stored in most molecular biology laboratories; the rice variety is wild-type Zhonghua 11 (a publicly used rice variety, commercially available).

The chemical reagents used in the examples are all imported or domestically produced analytically pure.

The primers used in the examples were synthesized by Shenzhen Huada Gene Company, and sequencing was performed at Shenzhen Huada Gene Company.

Example 1 Cloning of OsATL15 gene and its encoded protein

Extract the RNA (OMEGA R6827-01) from the seedlings of Hua 11 in the wild-type japonica rice variety, and reverse transcription (Takara cat#6210A) to obtain gDNA-free cDNA (with the nucleotides shown in SEQ ID NO: 2), and then As a template, the forward primer F1 and the reverse primer R1 were used for PCR amplification. A PCR product of 1896bp was obtained.

After sequencing, the 1896bp PCR product has the nucleotides shown in SEQ ID NO: 3. Use (http://web.expasy.org/translate/) to perform amino acid translation of the coding sequence CDS to obtain the amino acid sequence of OsATL15, which encodes 631 amino acids. The encoded protein is named OsATL15, and the amino acid sequence of the protein is shown in SEQ ID NO:1.

F1: 5’-ATGGCAGATCAGAAGGTG-3’;

R1: 5'-TCATAGGTGACGAGACTGAGGTG-3'.

Example 2 Construction of overexpressing OsATL15 plants

1. Overexpression of OsATL15 gene

1. Construction of recombinant expression vector pCAMBIA1300-35S-OsATL15

Extract RNA from wild-type Zhonghua 11 seedlings, reverse transcription to obtain cDNA as a template (the extraction and reverse transcription methods are the same as in Example 1), and use primer 1 (ACCCGGGGATCCTCTAGAGTCGAATGGCAGATCAGAAGGTG) and primer 2 (ATGATACGAACGAAAGCTCTGCATCATAGGTGACGAGACTGAGGTG) for PCR amplification (Takara cat #R045), the reaction conditions are: 1 cycle: 98°C, 3min; 32 cycles: 98°C, 30s, 58°C, 30s, 72°C, 1min; 1 cycle: 72°C, 5min; 16°C, get the belt OsATL15 gene with 15 base homologous recombination arms.

The above PCR product was gel-recovered, and the pCAMBIA2300-35S vector backbone (provided by Wuhan Boyuan Company), which was digested with Sal I and Pst I, was homologously recombined with the In-fusion kit (Takara cat#639648) to obtain recombination Plasmid. The recombinant plasmid was sent for sequencing and named pCAMBIA1300-35S-OsATL15, which was a recombinant expression vector.

2. Preparation of transgenic rice overexpressing OsATL15

1) The recombinant expression vector pCAMBIA1300-35S-OsATL15 was electroporated into Agrobacterium EHA105 (Olivia et al., 2019) to obtain recombinant strain AGL1/pCAMBIA1300-35S-OsATL15 (plasmid was extracted from the positive clone and verified by sequencing).

2) The recombinant strain AGL1/pCAMBIA1300-35S-OsATL15 was transformed into Zhonghua 11 rice callus by Agrobacterium-mediated method, as follows:

Pick a single colony of AGL1/pCAMBIA1300-35S-OsATL15 and inoculate it in 10mL of Agrobacterium culture medium (containing kanamycin 50mg/L, rifampicin 50mg/L), culture at 28℃, 180rpm shaker for 2-3 days . Take 4mL of the bacterial solution, centrifuge at 4000rpm for 3min, pour the supernatant, add a small amount of AAM medium to resuspend the cells, then add 20mL of AAM medium (containing 0.1mM acetosyringone As), culture at 28℃, 150rpm shaker in the dark 1-2h, cultivate until OD ₆₀₀ =0.4. Pick out the callus of rice in good growth condition and granular Zhonghua 11 (hereinafter also called wild-type rice) and immerse it in the Agrobacterium culture solution, shake at 28°C, 150-200rpm for 20 minutes, pour out the callus, and use sterile filter paper Absorb the excess bacterial liquid, spread the callus in a sterile plate with multiple filter papers, and blow dry on the ultra-clean table (the callus is dispersed and not agglomerated), and then the callus is transferred to the co-cultivation medium , Cultivate for 2-3 days under dark conditions. The calli were transferred to NB minimal medium containing 100 mg/L hygromycin and 400 mg/L cephalosporin for selection for 3-4 weeks (one sieve). The surviving callus was transferred to a second-screen medium (NB minimal medium containing 100 mg/L hygromycin and 200 mg/L cephalosporin) for selection for 3 weeks. Transfer the resistant callus to differentiation medium (containing 100mg/L hygromycin) for differentiation, and transfer the regenerated plants after rooting on the vigorous seedling medium containing 100mg/L hygromycin (about 3-4 weeks) In the greenhouse, _{OsATL15 rice with T 0} generation was obtained.

The medium used in the above transformation is as follows:

Co-cultivation medium: callus induction and subculture medium + As (0.1mM/L) + glucose (10g/L), pH 5.2.

Agrobacterium infection of rice callus AAM medium: AA macronutrients + AA trace elements + AA amino acids + MS vitamins + hydrolyzed casein (500mg/L) + sucrose (68.5g/L) + glucose (36g/L)+ As (0.1mM), pH 5.2.

NB basic medium: N6 macroelement + B5 trace element + B5 organic component + iron salt + hydrolyzed casein (300mg/L) + proline (500mg/L) + sucrose (30g/L) + agar (8g/L) ), pH 5.8.

Induction of callus and subculture medium: NB minimal medium + 2,4-D (2mg/L).

Differentiation medium: NB minimal medium + 6-BA (3 mg/L) + NAA (1 mg/L).

Strong seedling medium: 1/2MS inorganic salt + NAA (0.5 mg/L) + MET (0.25 mg/L).

Agrobacterium medium (YEP): 10g/L tryptone+10g/L yeast extract+5g/L sodium chloride+15g/L agar.

3. Molecular identification of OsATL15 rice

1) PCR preliminary identification

Extraction T ₀ generation of genomic DNA transfection OsATL15 rice (OMEGA cat # D2485-02), identified PCR with primers F2 and R2 (primer sequences below), the reaction conditions were: 1 cycle: 98 ℃, 3min; 32 cycles: 98°C, 30s, 60°C, 30s, 72°C, 30s; 1 cycle: 72°C, 5min; 16°C. The PCR-positive ( _{340bp) T 0} generation transgenic OsATL15 rice plants #1, #2, and #3 were screened.

F2: 5’-ACGGTGTCGTCCATCACAGTTTGCC-3’;

R2: 5'-TTCCGGAAGTGCTTGACATTGGGGA-3'.

2) Transcription level analysis

Extract the total RNA of PCR-positive T ₀ -transformed OsATL15 rice lines #1, #2, and #3, reverse transcription, and use the resulting cDNA as a template. Perform real-time quantitative fluorescent PCR with the following primers to detect the transcription of OsATL15 gene in each material The level of expression. The experiment was repeated 3 times, and the results were averaged. Take wild-type rice as a control.

Real-time quantitative fluorescent PCR was performed using Bio-Rad CFX96. The PCR reaction system (20μL) is carried out in accordance with the product instruction manual SYBR Green Real-Time PCR Master Mix reagent (Takara). The specific system is as follows: 10μL SYBR Green Real-Time PCR Master Mix, 2μL upstream and downstream primer mixture (both upstream and downstream primer concentrations are 10μM), 7μL RNase-free water, 1μL cDNA template. The specific reaction procedure is as follows: enzyme heat activation at 95°C, 30s, 1 cycle; denaturation at 95°C, 5s, extension 60°C, 30s, a total of 40 cycles.

Among them, the primer sequence for amplifying the OsATL15 gene is:

OsATL15 upstream primer F: 5'-TACTCGCCGCCGCCGTCATA-3' (SEQ ID NO: 4);

OsATL15 downstream primer R: 5'-CGAGGTTGAGCGTGTTGCTGTTCC-3' (SEQ ID NO: 5).

Using UBQ2 as the internal reference gene, the primer sequence for amplifying the internal reference UBQ2 is:

UBQ2 upstream primer: 5’-GCATCTCTCAGCACATTCCA-3’;

UBQ2 downstream primer: 5'-ACCACAGGTAGCAATAGGTA-3'.

Data processing adopts the method of Comparative Ct, that is, the Ct value is the number of cycles experienced when the fluorescent signal in the PCR tube reaches the set threshold, ΔCt=Ct(OsATL15)-Ct(ACTIN1), with the value of 2- ^△△Ct The value measures the level of gene transcription, and the expression of OsATL15 gene in each material is analyzed and compared.

The real-time quantitative fluorescent PCR detection results of the OsATL15 gene expression in each experimental material are shown in Figure 1. The expression of the OsATL15 gene is relative. It can be seen that compared with the wild-type rice japonica rice Zhonghua 11 (WT), which is not genetically modified, The expression of OsATL15 gene in OsATL15 rice lines #1, #2 and #3 with PCR-positive T _{0 generation was significantly increased at the transcription level.} PCR-positive T ₀ generation transgenic OsATL15 rice lines #1, #2 and #3 are positive T0 transgenic OsATL15 rice lines, named OsATL15-OX1, OsATL15-OX2 and OsATL15-OX3.

Example 3 Construction of OsATL15 Mutant Plants by CRISPR Knockout

1. Use the CRISPR/Cas9 system to select the target sequence based on the exon sequence of OsATL15

Use simple and efficient CRISPR/Cas9 system to select specific target sequence according to OsATL15 exon sequence, target sequence: GAGGCACGTCCTGGAGAAGGAGG. The target sequence is for the OsATL15 gene and specifically inactivates the OsATL15 protein.

2. Construct a pCRISPR/Cas9 recombinant vector containing the above target sequence fragments

1) According to the target sequence, design adaptor primers with sticky ends

The designed target sequence was added to the pCRISPR/Cas9 system's specific sticky end adapter (F: GGCA; R: AAAC), and the complete adapter primer was synthesized.

F3: 5’-GGCA-GAGGCACGTCCTGGAGAAGG-3’;

R3: 5'-AAAC-CCTTCTCCAGGACGTGCCTC-3'.

2) Anneal the adaptor primers with sticky ends to complement each other to form small double-stranded fragments with sticky ends

Dilute F3 primer and R3 primer into a solution with a concentration of 10μM, take 10μL of each and mix well, and perform annealing reaction in a PCR machine from 98°C to 22°C to make F3 primer and R3 primer complementary to form a double strand with sticky ends Small snippet.

3) Enzyme digestion of the original vector pOs-sgRNA containing sg-RNA (TAKARA Cat#632640)

The original vector pOs-sgRNA containing sg-RNA was digested with restriction endonuclease Bsa Ⅰ to produce sticky ends complementary to the sticky ends of the target sequence. The system for digesting the original pOs-sgRNA vector with Bsa Ⅰ: 10×buffer Bsa Ⅰ 2 μL, Bsa Ⅰ enzyme 1 μL, pOs-sgRNA vector 4 μg, ddH ₂ O to make up to 20 μL, and digestion at 37°C for 12 hours. After the digested product was checked with 1% agarose gel electrophoresis, the kit (OMEGA Cat#D2500-02) was used to recover and purify the digested product through the column to obtain the digested pOs-sgRNA vector, and add sterilized ddH ₂ O dissolves, and it is ready to use after measuring the concentration.

4) Connect the small double-stranded fragment with sticky ends to the digested pOs-sgRNA vector to form a recombinant vector containing the target sequence and sg-RNA

T4 ligase is used to connect the small double-stranded fragment in step 2) and the pOs-sgRNA vector digested in step 3) to form a complete recombinant vector containing the target sequence for the OsATL15 protein and sg-RNA. The 15μL ligation system is: 10×T4ligation buffer 1.5μL, double-stranded small fragment 4μL, digested pOs-sgRNA vector 3μL, T4 DNA ligase 1μL, ddH ₂ O make up to 15μL, 16 ℃ ligation for 12 hours. The ligation product was transformed into Escherichia coli DH5α, kana-resistant LB plate was cultured overnight, and positive strains were selected for sequencing to obtain a correctly sequenced recombinant vector containing target sequence and sg-RNA.

5) Use LRmix to recombine the recombinant vector containing the target sequence and sg-RNA and the vector pH-Ubicas9-7 containing Cas9 by LR reaction to form a complete recombinant vector containing the target sequence -sg-RNA+Cas9

Use LR mix to recombine the recombinant vector obtained in step 4) and the vector containing Cas9 pH-Ubi-cas9-7 (provided by Wuhan Boyuan Company) for LR reaction. LR reaction system: recombinant vector containing target sequence and sg-RNA 25 -50ng, pH-Ubi-cas9-7 carrier 75ng, 5×LR ClonaseTM buffer 1μL, TE Buffer (pH8.0) supplemented to 4.5μL, LRClonaseTM 0.5uL. Incubate the system at 25℃ for 2h, add 2μL 2μg/μL of Proteinase K after the reaction, treat at 37℃ for 10min, then transfer 2μL of the reaction product into E. coli DH5α, gentamicin-resistant LB plate overnight at 37℃ Culture, select positive strains for sequencing, and obtain a complete pCRISPR/Cas9 recombinant vector containing the OsATL15 protein target sequence-sg-RNA+Cas9 correctly sequenced.

3. Introduce the obtained pCRISPR/Cas9 recombinant vector into rice callus to obtain transgenic plants

According to the method of transferring OsATL15 rice by recombinant vector in Example 2, the complete recombinant vector containing OsATL15 protein target sequence-sg-RNA+Cas9 obtained in step 5) was introduced into rice callus to prepare transgenic rice, which can be used in T0 generation plants. A transgenic plant with completely inactivated OsATL15 protein was obtained.

4. Screen the transgenic positive plants among the transgenic plants

DNA was extracted from the transplanted transgenic plants (T ₀ generation), and the target sequence was detected. A total of 32 positive plants were detected.

5. Obtain mutant plants from transgenic positive plants

1) Identification of mutation sites

Extract DNA from the transplanted positive plants, design specific primers F4 and R4 for DNA fragments within 500 bp containing the target site to amplify the DNA fragments containing the target site, and the amplified 360 bp PCR product will be sent after purification The company sequenced, the sequencing results were compared with the wild-type plant sequence, and the mutant plants were screened out. The results of partial mutation analysis are shown in Figure 2.

F4: 5’-ATGGCAGATCAGAAGGTGATT-3’;

R4: 5’-TGGAGCTGGTAGCCAAGAATCT-3’.

2) The mutant plants were propagated, and the plants without hygromycin, Cas9 and other transgenic elements were tested in the T1 generation transgenic segregation population. The seeds were harvested from a single plant, and the loss-of-function mutants without transgenic components were obtained, and they were named Crispr. -10, Crispr-9 and Crispr-17.

Example 4 The effect of OsATL15 mutant plants on the absorption and transportation of pesticides

The following pesticides were selected for the experiment: the neonicotinoid insecticide thiamethoxam, the amide insecticide chlorantraniliprole, the organophosphorus insecticide omethoate, the sandworm toxin insecticide dimethicone, amino Methomyl, a formate insecticide. The Crispr-10, Crispr-9 and Crispr-17 rice strains obtained in Example 3 and the content of pesticides in the rice roots, stems and leaves of the wild-type rice Zhonghua 11 were tested.

(1) The thiamethoxam original drug was dissolved in DMSO to prepare a 40 mM mother liquor and stored at 4°C for later use. Pick out the rice seedlings grown in the rice incubator for 14 days, carefully rinse the root nutrient solution, and make a group of 10 rice seedlings. Afterwards, the rice seedling roots were placed in 0.5mM calcium chloride buffer solution for pre-incubation for 2h; the drug mother solution was diluted to 100μM with 0.5mM calcium chloride buffer solution, adjusted to pH=5.8, and then added to a 50mL centrifuge tube, each tube was 40mL, Transfer rice seedlings into it and fix it with a constant value cup to ensure that the stems of the rice are in contact with the liquid surface, and place it in an artificial climate incubator for 24 hours. After 24 hours, the rice was taken out, and the roots were washed 4 times with 0.5mM (pH=5.8) calcium chloride buffer to ensure that the drug attached to the root surface was completely removed. Dry the surface water with filter paper, and then use a blade to cut 1cm below and 1cm above the junction of rhizomes, and divide the rice into roots, stems and leaves. After weighing and recording separately, add liquid nitrogen in a mortar to grind, add 10mL chromatography grade acetonitrile for extraction, ultrasonic for 30min, 14000g centrifugation for 10min, aspirate 1mL of supernatant, pass 0.22μm to get a needle microporous membrane to remove impurities, load In the liquid phase bottle, the sample is stored at a low temperature of -80°C for testing. Each treatment was repeated in 3 groups. Chlorantraniliprole, omethoate, dimethoate, and methomyl were used to do the same treatment on rice seedlings, and each treatment was repeated in 3 groups.

The results showed that the contents of thiamethoxam (THX), chlorantraniliprole, dimethoate, dimehypo, and methomyl in the upper part of the roots of the Crispr-10, Crispr-9 and Crispr-17 rice strains were lower than those of the wild type , And the content in the root has no significant difference compared with the wild type (Figure 3, Figure 4, Figure 5, Figure 6, Figure 7).

Example 5 The effect of OsATL15 overexpression plants on the absorption and transportation of pesticides

The following pesticides were selected for the experiment: the neonicotinoid insecticide thiamethoxam, the amide insecticide chlorantraniliprole, the organophosphorus insecticide omethoate, the sandworm toxin insecticide dimethicone, amino Methomyl, a formate insecticide. The OX-1, OX-2 and OX-3 rice lines obtained in Example 3 and the wild-type rice Zhonghua 11 rice roots, stems and leaves were tested for pesticide content. The processing method is similar to that in Example 4.

The results showed that the contents of thiamethoxam (THX), chlorantraniliprole, omethoate, dimethan and methomyl in the roots and upper parts of the OX-1, OX-2 and OX-3 rice strains were higher than those in the wild Model height (Figure 8, Figure 9, Figure 10, Figure 11, Figure 12). It shows that the rice gene OsATL15 can regulate the absorption and transportation of pesticides in plants. Increasing the expression of the OsATL15 gene can increase the absorption and transfer of pesticides by rice, increase the absorption and transfer of pesticides by rice, and reach the pests infested parts, and reduce the use of pesticides in rice fields.

Example 6 Subcellular localization of OsATL15 protein

The total RNA of 15-day-old rice seedlings of Hua11 was extracted, the cDNA was obtained by reverse transcription as a template, and PCR amplification was performed to amplify the full-length ORF of OsATL15 (removing the stop codon). The primers used were:

F5: 5’-TCAGATCTCGAGCTCAAGCTTC ATGGCAGATCAGAAGGTG-3’;

R5: 5'-CCTTGCTCACCATCAGGATCCCTAGGTGACGAGACTGAGGTG-3'.

The amplified target fragments were digested and recovered, and ligated with the empty vector 322-d1-eGFPn (Beijing Huayueyang) to fuse OsATL15 with GFP. After the sequencing and identification were correct, the fusion vectors 322-d1-eGFPn-OsATL15 and The empty vector was transferred into rice protoplasts and cultured at room temperature for 16 hours. The subcellular localization of the fusion protein OsATL15-GFP and protein GFP in rice protoplasts was observed under a laser confocal microscope. The results are shown in Figure 13, which proves that the OsATL15 protein is specifically located in the rice cell membrane.

Example 7 Development of OsATL15 molecular probe

Take the neonicotinoid insecticide thiamethoxam as an example.

100 μmol/L thiamethoxam was used to treat seedlings of wild-type Zhonghua 11 grown for 14 days, and solvent water treatment was used as a control (Control). After the treatment, the RNA was extracted, and after reverse transcription, the expression of the OsATL15 gene was detected by quantitative PCR technology. The method was the same as that in Example 2, and the experiment was set to be repeated three times.

The results are shown in Figure 14. Under the conditions of thiamethoxam treatment, the specific expression of OsATL15 gene in rice roots, stems and leaves was strongly induced. Therefore, using the primer as a molecular probe to analyze the expression of the OsATL15 gene in rice germplasm can quickly determine the ability of the target gene to respond to thiamethoxam treatment, and can be used to breed new varieties with high absorption of thiamethoxam.

Example 8 The effect of OsATL15 gene mutation on plant height

The OsATL15 rice Crispr-10, Crispr-9 and Crispr-17 mutants and wild-type rice Zhonghua 11 obtained in Example 3 were planted in a rice incubator, and the phenotype was observed two weeks later. 15 strains per strain, the experiment was repeated 3 times, and the results were averaged.

Observing the phenotype, compared with wild-type rice Zhonghua 11, the plant height of Crispr-10, Crispr-9 and Crispr-17 rice lines was reduced, but the root length did not change significantly (Figure 15). Measured the height and root length of each rice plant. Compared with wild-type rice Zhonghua 11, the plant heights of Crispr-10, Crispr-9 and Crispr-17 rice lines all decreased (Figure 16), but the root length did not change (Figure 17). ).

The OsATL15 mutant Crispr-9, Crispr-10 and overexpressing OX-1, OX-2 obtained in Examples 3 and 5 were planted in pots, and the phenotype was observed at the mature stage (Figure 18). Compared with the wild type, there was no significant change in plant height in the OsATL15 transgenic line, but the number of tillers, the percentage of panicles and the number of empty shells were significantly reduced compared to the wild type phenotype, but there was no significant difference in overexpression (Figure 19). It shows that the overexpression strains can enhance the transportation of pesticides and will not affect the changes of their phenotypes.

The above-mentioned embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above-mentioned embodiments, and any other changes, modifications, substitutions, combinations, etc. made without departing from the spirit and principle of the present invention Simplified, all should be equivalent replacement methods, and they are all included in the protection scope of the present invention.

Claims

The application of the rice gene OsATL15 in regulating the absorption and transportation of pesticides is characterized in that the protein encoded by the rice gene OsATL15 has the following amino acid sequence A) or B):

A. The amino acid sequence shown in SEQ ID NO: 1;

B. The amino acid sequence of the derivative protein with the same function obtained by the substitution and/or deletion and/or addition of one or several amino acid residues above A;

The pesticides are systemic pesticides.
The application of the rice gene OsATL15 in regulating the absorption and transportation of pesticides according to claim 1, wherein the nucleotide sequence of the rice gene OsATL15 is any one of the following A) to E):

A. The nucleotide sequence shown in SEQ ID NO: 2;

B. The nucleotide sequence shown in SEQ ID NO: 3;

C. Under stringent conditions, it hybridizes with the nucleotides defined by A or B, and encodes a nucleotide sequence of the amino acid shown in SEQ ID NO:1;

D. It has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence defined by A, and the encoding is as follows SEQ ID NO: the nucleotide sequence of the amino acid shown in 1;

E. It has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with the nucleotide sequence defined by B, and the encoding is as follows SEQ ID NO: the nucleotide sequence of the amino acid shown in 1;

The pesticides are systemic pesticides.
The application of the rice gene OsATL15 in regulating the absorption and transportation of pesticides according to claim 1 or 2, characterized in that the pesticides are neonicotinoid insecticides, amide insecticides, organophosphorus insecticides One of the insecticides, sandworm toxin insecticides or carbamate insecticides.
Use of the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the rice gene OsATL15 of claim 1 or 2 in regulating the absorption and transportation of pesticides.
A molecular marker detection primer for rice gene OsATL15, which is characterized in that it consists of an upstream primer and a downstream primer as shown in SEQ ID NO: 4 and SEQ ID NO: 5:

F: 5’-TACTCGCCGCCGCCGTCATA-3’;

R: 5'-CGAGGTTGAGCGTGTTGCTGTTCC-3'.
The application of the molecular marker detection primer of the rice gene OsATL15 in the identification of rice varieties that efficiently use pesticides according to claim 5, which is characterized in that it comprises the following steps: using the molecular marker detection primers to detect the germplasm genome of the rice variety to be tested Amplify DNA or RNA, and judge the sensitivity of the target gene in response to pesticide treatment based on the change in gene expression;

The selected pesticides are systemic pesticides.
A molecular marker detection kit for rice gene OsATL15, characterized by comprising the molecular marker detection primer of claim 5;

The molecular marker detection kit for rice gene OsATL15 also includes at least one of PCR enzyme, PCR water and PCR buffer.
The application of the rice gene OsATL15 of claim 1 or 2 in the cultivation of transgenic rice that efficiently utilizes pesticides, characterized in that it comprises the following steps: constructing the rice gene OsATL15 on a plant expression vector, and combining the obtained recombinant expression vector Transformed into rice for expression to obtain rice varieties that efficiently use pesticides.
The application of the rice gene OsATL15 in cultivating transgenic rice that efficiently utilizes pesticides according to claim 8, characterized in that:

The pesticide is a systemic pesticide;

The plant expression vector is pCAMBIA2300-35S;

Said transfer of the obtained recombinant expression vector into rice for expression is to transform the obtained recombinant plant expression vector into plant cells or tissues by a biological method of Agrobacterium-mediated, plant virus vector, direct DNA transformation, and electrical conduction transformation .
Application of the rice gene OsATL15 of claim 1 or 2 in regulating rice plant height.