CN117660523A - Application of GhTSD7 gene in improving drought stress tolerance of plants - Google Patents

Abstract

The invention disclosesGhTSD7Use of a gene for increasing drought stress tolerance, said gene comprising a gene sequence thatGhTSD7The nucleotide sequence of the gene is shown as SEQ ID NO. 1. Construction of the inventionGhTSD7Is an over-expression vector of (2)p35S‑GhTSD7‑GFPTransformation of wild type Arabidopsis thaliana (Clo-0, WT) by Agrobacterium inflorescence infection to obtain overexpressed plants, analysis results showed that over-expression was relative to wild type under drought conditionsGhTSD7Can reduce leaf loss of Arabidopsis thalianaThe water ratio is increased, the thickness of the horny layer is increased, and the tolerance of arabidopsis under drought stress is enhanced. And then obtained by gene silencingGhTSD7The result of the silenced cotton plant shows that the leaf of the gene silencing plant is seriously dehydrated and withered under drought stress, and the gene silencing plant is more sensitive to the drought stress, so that gene resources are provided for crop drought-tolerant molecular breeding.

Description

Application of GhTSD7 gene in improving drought stress tolerance of plants

Technical Field

The invention belongs to the field of biotechnology, in particular toGhTSD7The application of the gene in improving drought stress tolerance of plants.

Background

Drought resistance adaptation mechanisms of plants are one of the hot spots of research, as drought is an important stress affecting crop yield and plant growth and development. Drought creates a great challenge for agriculture and plant growth in the context of current global climate change. Plants, as an important component of the ecosystem, have a significant impact on the sensitivity and adaptability to drought conditions. Under drought conditions, plants are severely affected, resulting in a range of growth and physiological problems.

First, the effect of drought on plants is apparent. The lack of water makes the plant grow limited, leaves wither, stems wither, and root system development blocked. Insufficient water can seriously affect photosynthesis of plants, so that chlorophyll content is reduced, photosynthesis activity is inhibited, and synthesis and accumulation of nutrients are affected. In addition, under drought conditions, plants are at risk of oxidative damage and cellular dehydration, further affecting plant growth and development.

However, plants develop a variety of adaptive mechanisms to cope with drought during a lengthy evolution process. Expansion of plant root systems to find deeper water sources, regulation of stomata opening and closing to reduce water evaporation, accumulation and synthesis of specific proteins, lipids and compounds to protect cellular structures from dehydration and oxidative damage are self-protection mechanisms of plants under drought conditions. These adaptive strategies help plants survive and maintain basic growth requirements under limited water resource conditions. Among many crops, cotton is an important commercial crop, which has an irreplaceable position in the textile industry. However, cotton growth and yield are severely affected by environmental factors such as drought. Under drought conditions, cotton growth is limited, fiber quality is reduced, overall yield is reduced, and textile production is seriously affected.

Scientists and agricultural professionals are continually striving to study and take action in response to the vulnerability of cotton to drought conditions. Countermeasures against drought resistance in cotton include, but are not limited to:

1. breeding drought-resistant varieties: through genetic improvement or gene editing and other techniques, cotton varieties with drought resistance are cultivated.

2. An improved irrigation system: the irrigation mode is optimized, the waste of water resources is reduced, and the water utilization efficiency is improved.

3. The biotechnology means: the biotechnological means is utilized to improve the drought resistance of cotton, such as gene transformation, application of growth regulator and the like.

Drought resistance is of self-evident importance to cotton. Under the conditions of global climate change and unpredictable natural disaster frequency, improving the drought resistance of cotton is a key factor for ensuring the yield and quality of cotton. The drought-resistant measures for cotton can reduce the loss caused by drought to cotton production and maintain the stable supply of textile industry.

In a word, the influence of plants on drought and the adaptation response mechanism of plants under drought are important directions of current research, especially for important crops such as cotton, improvement of drought resistance is of great significance to agriculture and industry, and research of genes related to drought can provide a new approach for drought-tolerant breeding of plants through a molecular breeding method.

Disclosure of Invention

The invention aims to provideGhTSD7The application of the gene in improving drought stress tolerance of plants.

In order to achieve the above purpose, the technical scheme adopted by the invention is summarized as follows:

the invention adoptsGhTSD7The gene Sequence number (Sequence ID) of the gene in NCBI is XM_016859597.2, saidGhTSD7The nucleotide sequence of the gene is shown as SEQ ID NO.1,GhTSD7the length of the messenger RNA (mRNA) sequence of the gene is 1461bp,GhTSD7the coding sequence of the gene is 1152 bp, which comprises 383 amino acids.

The invention also constructs a series of plant expression vectors, expression vectors containing the genes, transgenic plant lines and host cells containing the vectors, and the functions of improving the drought stress of plants also fall into the protection scope of the invention. The functions of the gene protected by the present invention include not only the aboveGhTSD7Genes, also includingGhTSD7The gene has the function of homologous genes with higher homology (homology is as high as 96.7%) in drought stress.

The invention disclosesGhTSD7The biological function of the gene in plant drought stress is specifically expressed in the following steps: under drought conditionsGhTSD7The over-expression strain can reduce the water loss rate of arabidopsis leaves, improve the thickness of horny layer, enhance the tolerance of arabidopsis under drought stress, andGhTSD7the loss of water and wilting of leaves under drought stress are more serious in gene silencing lines.

According to its function, drought stress tolerant plants can be obtained by means of transgenesis, in particular by means of the expression of the geneGhTSD7The gene is introduced into a target plant to obtain a transgenic plant, and the drought stress resistance of the plant is higher than that of the target plant.

In particular, the method comprises the steps of,GhTSD7the gene can be specifically introduced into the target plant through the recombinant expression vector. In the method, the recombinant expression vector may be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium mediation, etc., and the transformed plant tissues are cultivated into plants.

In order to improve the excellent properties of plants, the invention also protects a novel plant breeding method, which can be realized by' regulating and controlling plantsGhTSD7Method of "expression of genes" for growing new plants, in particular "regulating in plantsGhTSD7The method of "expression of a gene" is overexpression, silencing or directed mutationGhTSD7And (3) a gene.

More specifically, the plant breeding method is as follows (1) or (2) or (3):

(1) By increasing the number of target plantsGhTSD7The activity of the protein, and obtaining plants with drought stress tolerance stronger than that of target plants;

(2) By promoting the growth of the target plantsGhTSD7The expression of the gene can obtain a plant with drought stress tolerance stronger than that of the target plant;

(3) By inhibition in plants of interestGhTSD7And expressing the gene to obtain a plant with drought stress tolerance lower than that of the target plant.

"promotion in plants of interestGhTSD7Gene expression "The implementation manner of (2) or (3) can be as follows:

(1) Will beGhTSD7Introducing a gene into a target plant;

(2) Introducing strong promoters and/or enhancers;

(3) Other methods are common in the art.

Wherein the target plant is cotton or Arabidopsis thaliana.

Genes of interest, also known as target genes, are used in genetic engineering design and manipulation to recombine genes, alter receptor cell traits and obtain desired expression products. May be of the organism itself or from a different organism.

Regulating the level of gene expression includes regulating the expression of the gene using DNA homologous recombination techniques, virus-mediated gene silencing techniques, and Agrobacterium-mediated transformation systemsGhTSD7And (3) expressing to obtain a transgenic plant line. In the present invention, the plant suitable for the present invention is not particularly limited as long as it is suitable for performing a gene transformation operation such as various crops, flower plants, forestry plants, or the like. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous or gymnosperm plants.

As a preferred mode, the "plant" includes, but is not limited to: cotton, arabidopsis thaliana, especially upland cottonGossypium hirsutum) Any gene having the same gene or a gene homologous thereto is suitable.

As used herein, the term "plant" includes whole plants, parent and progeny plants thereof, and various parts of plants, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, in which the gene or nucleic acid of interest is found. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises the gene/nucleic acid of interest.

The present invention includes any plant cell, or any plant obtained or obtainable by a method therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the sub-representations exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The invention also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. And further to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starches or proteins.

The invention has the advantages that:

(1) The invention adopts a method of comparing transcriptomics, innovatively applies to upland cottonGossypium hirsutum) Middle proteinGhTSD7Cloning was performed. ConstructionGhTSD7Is an over-expression vector of (2)p35S-GhTSD7-GFPWild arabidopsis thaliana (Clo-0, WT) is transformed by using an agrobacterium inflorescence infection method to obtain an over-expression plant, and analysis results show that under drought conditionsGhTSD7The over-expression plant can reduce the water loss rate of the arabidopsis leaves, increase the thickness of the horny layer and enhance the tolerance of the arabidopsis under drought stress. Further constructionGhTSD7Gene silencing vector TRV2-GhTSD7A method for infecting cotton leaves by utilizing agrobacterium tumefaciens contains TRV2-GhTSD7The agrobacteria injection cotton leaves of (C) are obtainedGhTSD7The results of the silenced cotton plants show that the leaf loss and withering of the gene silenced plants under drought stress are more serious, and the gene silenced plants are more sensitive to the drought stress. Providing gene resources for crop drought-enduring molecular breeding.

(2) Drought tolerant plants can be obtained by transgenic means, in particular by combiningGhTSD7The gene is introduced into a target plant to obtain a transgenic plant, the drought tolerance of the plant is higher than that of the target plant, and a new way is provided for drought tolerance breeding of the plant.

Drawings

FIG. 1 is a graph of drought stress conditionsGhTULP30AndGhTSD7analysis of gene expression level;

FIG. 2A isGhTSD7Transgenic Arabidopsis expression levelSeparating out; FIG. 2B isGhTSD7Fluorescence detection results of transgenic arabidopsis;

FIG. 3 is an overexpression ofGhTSD7Analyzing the water loss rate of the arabidopsis plants;

FIG. 4A, FIG. 4B, FIG. 4C, FIG. 4D is overexpression under drought stressGhTSD7Growth conditions of Arabidopsis seedlings on MS culture media with different concentrations of PEG; FIG. 4E is overexpression under drought stressGhTSD7Root elongation statistics of Arabidopsis seedlings on MS culture media with different concentrations of PEG; FIG. 4F is overexpression under drought stressGhTSD7Fresh weight statistics of Arabidopsis seedlings on MS culture media with different concentrations of PEG;

FIG. 5A isGhTSD7The wax content of the epidermis of the transgenic arabidopsis thaliana; FIG. 5B isGhTSD7Counting specific values of wax content of the epidermis of the transgenic Arabidopsis thaliana;

FIG. 6A is a normal whitening plot for a control CLA; FIG. 6B isGhTSD7In gene silencing plantsGhTSD7Analysis of expression level;

FIG. 7 is cottonGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV::00) Is determined by the water loss rate analysis;

FIG. 8A and FIG. 8B are diagrams of cotton under drought stressGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV:: 00) Phenotype comparison; FIG. 8C is cotton under drought stressGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV:: 00) Ion leakage rate statistics of (2); FIG. 8D is cotton under drought stressGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV::00) Counting the malondialdehyde content;

FIG. 9A is cotton under drought stressGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV::00) DAB dyeing; FIG. 9B Cotton under drought stressGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV::00) Calculating specific numerical values of DAB dyeing conditions; FIGS. 9C,9D, 9E, 9F,9G and 9H are cotton after 5 days of drought stress, respectivelyGhTSD7Silencing plantTRV::GhTSD7) And normal plants [ ]TRV::00) Hydrogen peroxide content, superoxide anion content, malondialdehyde content, and catalase activitySuperoxide dismutase activity, proline content;

in the above figures, CK is the case of growth under normal conditions (control).

Detailed Description

The present invention will be described in detail with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials employed, unless otherwise indicated, are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botanicals, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to one of skill in the art. These techniques are fully explained in the published literature, and the methods of DNA extraction, phylogenetic tree construction, gene editing method, gene editing vector construction, gene editing plant acquisition, etc. used in the present invention can be realized by the methods disclosed in the prior art except the methods used in the examples described below.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-or double-stranded structures. Such nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in genomic sequences, and/or coding sequences in cDNA, and/or cDNA and regulatory sequences thereof. In particular embodiments, for example in relation to isolated nucleic acid sequences, it is preferred that they are cDNA.

Biological material

Cotton TM-1 seeds were stored for laboratory; the arabidopsis Col-0 seeds are preserved in a laboratory;

overexpression vectorpSuper-1300-GFPFor laboratory preservation；Gene silencing vector empty vector and positive control vectorTRV::GhCLAIs preserved for a laboratory;

coli bacteriumDH5αAnd AgrobacteriumGV3101Is preserved for a laboratory;

primer synthesis and sequencing were performed by zheng state qing department of biology.

Experimental reagent

RNA extraction kits, reverse transcription kits, and fluorescent quantification kits were purchased from nuuzan biotechnology limited;

common reagents such as PEG are purchased from soribao corporation;

hygromycin is purchased from soribao biosystems;

MS media was purchased from beijing cool pacing technologies limited;

various endonucleases were purchased from monate biotechnology limited;

one-step cloning enzyme was purchased from nuuzan biotechnology limited;

plasmid miniprep and gel recovery kits were purchased from beijing tiangen biotechnology limited.

Experimental equipment

PCR apparatus was purchased from Bio-rad company;

the refrigerated centrifuge is purchased from Eppendorf corporation;

quantitative PCR instrument was purchased from Bio-rad company;

confocal laser microscopy was purchased from zeiss corporation;

the autoclave MLS-3750 was purchased from Sanyang, japan;

nucleic acid detector Nanodrop 2000C was purchased from Thermo Scientific company;

normal temperature centrifuge and microplate reader SpectraMax iD5 were purchased from Thermo Scientific.

Example 1GhTSD7Cloning of Gene and amino acid sequence analysis thereof

Extracting RNA of upland cotton TM-1 growing for 15 days, taking cDNA obtained by reverse transcription reaction as a template, designing a specific Primer by using a Primer premier5.0 from a gene sequence obtained in NCBI database, and cloningGhTSD7The coding sequence of this gene.

Can be obtained in a cottonMDGhTSD7The coding sequence of the gene (shown as SEQ ID NO. 1) comprises 1152 bp bases. The encoded protein comprises 383 amino acids.

For analysis ofGhTSD7Whether the cotton is involved in the drought stress response process is determined by analyzing the drought stress conditionGhTSD7Is a pattern of expression of (a). Wild cotton plants TM-1 grown for 23 days with 18% PEG solution were soaked, leaves were sampled at 0 h,2 h,4 h,8 h,12 h,24 h and 48h, respectively, and detected by real-time fluorescent quantitative PCR (qRT-PCR)GhTSD7Is a target expression level.

As a result, it was found that a marker gene for drought stress-induced expressionGhTULP30The expression level of (2) is increased to about 6 times during drought stress treatment of 8h, which indicates that cotton seedlings are indeed subjected to drought stress treatment; during drought stress treatment for 2h, 4 h, 8h and 12h,GhTSD7the expression level of (a) was increased by 5-fold or more at 8h (FIG. 1). This result also suggests that the use of a single-phase plasma,GhTSD7may be involved in regulating cotton response to drought stress. The following is an experiment on this gene expansion around this aspect.

EXAMPLE 2 construction of the overexpression vector p 35S-GhTSD 7-GFP

For analysis ofGhTSD7The inventors constructedGhTSD7Is an over-expression vector of (2)p35S- GhTSD7-GFPOver-expressed Arabidopsis plants were obtained. Simple concrete processThe description will be given below.

First, primers with restriction enzyme pst1 and kpn1 cleavage sites were designed, the sequences were as follows:

1300-GhTSD7-F:5' - GGGGCCCGGGCTGCAGATGTCGTGTTCTTCG-3'；

1300-GhTSD7-R:5'- GTATTTAAATGGTACCCTCACAAGCCAGTTT-3'；

secondly, performing PCR amplification by using the cDNA sample prepared in the example 1 as a template, and purifying and recovering an amplification product;

third, pair of1300-GFPThe vector adopts pst1 and kpn1 double enzyme digestion, and the enzyme digestion product is purified;

fourth, the PCR amplified product and the carrier after enzyme digestion are subjected to homologous recombination connection to construct1300- GhTSD7An over-expression vector;

fifthly, converting the connection product into escherichia coli by adopting a heat shock conversion methodDH5αK is performed ⁺ Screening (kanamycin, 50 mug/mL) resistance, selecting positive colonies for PCR detection, amplifying and sequencing correct colonies identified by the PCR detection, and extracting plasmids from bacterial liquid with correct sequencing for later use;

sixth, the extracted plasmid is transformed into Agrobacterium competent cellsGV3101Storing at-80 ℃ for standby;

seventh, transforming wild type Arabidopsis thaliana (Clo-0, WT) by Agrobacterium inflorescence infection, screening the harvested seeds on MS medium containing hygromycin, harvesting seeds from a single plant of potential transgenic plants, screening again on medium containing hygromycin until T ₃ And obtaining the potential homozygous transgenic plant by generation screening.

Analysis of potentially transgenic plants Using qRT-PCRGhTSD7Is a target expression level. As a result, found thatGhTSD7In the case of a potential transgenic plant,GhTSD7the expression level of (a) was up-regulated about 400-1200 fold in 3 different strains (FIG. 2A). The result of observing GFP fluorescence of the root of the over-expressed arabidopsis thaliana by a laser confocal microscope shows that the screened arabidopsis thalianaGhTSD7GFP fluorescence was detected in the roots of the transgenic plants (FIG. 2B). These results indicate that the constructedGhTSD7Transgenic Arabidopsis thalianaGhTSD7- GFPAnd (5) over-expressing plants.

Example 3 overexpression Arabidopsis thaliana verificationGhTSD7Function of gene in drought stress tolerance of arabidopsis thaliana

Plants with a slower rate of water loss under drought stress are described to be more drought-resistant to some extent for preliminary analysisGhTSD7Whether or not to participate in regulating plants under drought stress we will express WT (wild type), over-expressedGhTSD7The arabidopsis seeds are respectively sown in soil for three weeks or so (not bolting) to carry out a water loss experiment. WT and overexpression at nine points in the morningGhTSD7The arabidopsis plants are respectively put into balances of a water loss platform, the time interval is set to be thirty minutes, and the detection is carried out for six hours. Overexpression was found by analysis after 3 days of co-detectionGhTSD7Leaf loss rates of Arabidopsis plants were lower than WT (FIG. 3), initially demonstrating overexpressionGhTSD7The drought resistance of the arabidopsis plants is higher.

At the same time, for further analysis of overexpressionGhTSD7Whether transgenic plants participate in the process of regulating and controlling drought stress to inhibit seedling growth or not, we will overexpress wild WTGhTSD7Arabidopsis seedlings (grown vertically on MS medium for 5 days) were placed on MS medium containing different concentrations of PEG (0, 10%, 15% and 20%), respectively, and then placed in a 12h light/12 h dark greenhouse (21 ℃) and the growth of the seedlings was observed. After seedlings were grown for 20 days in medium of different concentrations we can clearly observe WT and overexpression on MS medium of 0% PEGGhTSD7Arabidopsis seedlings grew substantially consistently (FIG. 4A), whereas WT root length and root hair density were significantly lower on 10% PEG MS medium than over-expressedGhTSD7Arabidopsis thaliana (FIG. 4B), for which statistics of specific values were consistent with observations using imageJ and Prism9 (FIG. 4E); and the leaves of WT were significantly smaller than over-expressed on MS medium of 15% PEG and 20% PEGGhTSD7Is shown (fig. 4c,4 d). The fresh weight statistics can also be more intuitively reflected (fig. 4F).

For further analysisGhTSD7Whether to participate in regulating and controlling the plant under drought stress and the reason of water loss, we used TB (toluidine blue) dye liquor to grow on MS culture medium for 10 daysIs soaked in the seedlings of the plant and is found to be over expressedGhTSD7Arabidopsis plants were stained to a lower degree than WT (FIG. 5A), and also stained area was counted (FIG. 5B). Description of overexpressionGhTSD7The leaves of Arabidopsis plants have higher wax content and also laterally verify the overexpressionGhTSD7The water loss rate of Arabidopsis plants was lower.

These results indicate that overexpression in Arabidopsis thalianaGhTSD7Can enhance tolerance under drought stress.

EXAMPLE 4 silencingGhTSD7Gene verification of its function in cotton drought stress tolerance

To go deep intoGhTSD7Function in upland cotton response to drought stress, directed toGhTSD7The inventors constructed using a virus-induced gene silencing (VIGS) systemGhTSD7Is a gene silencing vector of (2)TRV2-GhTSD7ObtainingGhTSD7Silencing cotton plantsGhTSD7Higher homology, constructedTRV2-GhTSD7Carrier capable of simultaneous silencingGhTSD7The gene is homologous to the gene. ). The specific procedure is briefly described as follows.

First, a primer with restriction enzyme BamHI and KpnI cleavage sites was designed as follows:

TRV2-GhTSD7-F：GCCTCCATGGGGATCCAGTCCCAGCCGGCAATT

TRV2-GhTSD7-R：CGCGTGAGCTCGGTACCTGGGTCTACAGTAGCAGACAG

secondly, performing PCR amplification by using the cDNA sample prepared in the example 1 as a template, and purifying and recovering an amplification product;

third, pair ofTRV2The vector adopts BamHI and KpnI to carry out double enzyme digestion, and the enzyme digestion product is purified;

fourth, the PCR amplified product and the carrier after enzyme digestion are subjected to homologous recombination connection to constructTRV2-GhTSD7An expression vector;

fifthly, converting the connection product into escherichia coli by adopting a heat shock conversion methodDH5αK is performed ⁺ (kanamycin, 50. Mu.g/mL) resistance screening, selecting positive colonies for PCR detection, and identifying correct colonies for PCR detectionAmplifying, sequencing, extracting plasmid from correct sequencing bacterial liquid for later use;

sixth, the extracted plasmid is transformed into Agrobacterium competent cellsGV3101Storing at-80 ℃ for standby;

seventh, the method of infecting cotton leaves with Agrobacterium will containTRV2-GhTSD7、TRV2、TRV-CLA、TRV1The agrobacteria injection cotton leaves of (C) are obtainedGhTSD7A silenced plant.

The results showed transformation as positive control group 7 days after Agrobacterium infectionTRV::GhCLA（TRV::00) The plants developed a leaf albino phenotype (FIG. 6A), indicating that the gene silencing system was functioning. Detection of VIGS System creation by qRT-PCR experimentsGhTSD7In different plants with silencingGhTSD7The results showed that of the 3 cotton seedlings tested, plants No.1 and No. 2 were expressed at the same levelGhTSD7The expression level of (3) was 1/5 of that of the control group, and in plant No. 3GhTSD7The expression level of (C) was less than 1/10 of that of the control group (FIG. 6B), and these results indicate that the successful creation was achievedGhTSD7Silencing plants.

Based on the analysis of the results of the foregoing example 3, preliminary analysisGhTSD7Whether or not cotton involved in drought stress regulation is to be usedTRV::00And gene silencing plantsTRV::GhTSD7And respectively sowing the seeds in vermiculite to grow for about three weeks for a water loss experiment. Will be at nine points in the morningTRV::00And gene silencing plantsTRV::GhTSD7Respectively placing the materials into balances of a water loss platform, setting the time interval to be thirty minutes, and detecting for six hours. After 3 days of total detection, it can be found by analysisTRV::00Is lower than that of gene silencing plantTRV::GhTSD7(FIG. 7), preliminary descriptionTRV::00The drought resistance of the plants is higher.

At the same time, toTRV::00And gene silencing plantsTRV::GhTSD7Drought treatment for 20 days after maintaining the same water uptake state, it was observed thatTRV::00Plant leaf wilting slightly，WhileTRV::GhTSD7Plant leaf wilting was severe and death occurred (fig. 8a,8 b). This result indicatesGhTSD7Positively regulate the tolerance of cotton to drought stress.

To analyze under drought treatmentTRV::GhTSD7AndTRV::00the damage degree of plant leaves, we detected the ion leakage rate of the leaves. As a result, it was found that, in the control group (H ₂ O-watering) in the following mannerTRV::GhTSD7AndTRV::00the ion leakage rate in the plant leaves is basically consistent, and under drought treatment conditions,TRV::GhTSD7andTRV::00the ion leakage rate in the plant leaves is increased, andTRV::00in contrast to this, the method comprises,TRV::GhTSD7the ion leakage rate in the leaf is higher (fig. 8C). This result indicatesTRV::GhTSD7The plants are more damaged.

To further analyze the stress resistance of plants under drought stress, we examined the Malondialdehyde (MDA) content in leaves, and the results show that drought stress causes more MDA to accumulate in leaves, rather than in leavesTRV::00In contrast to this, the method comprises,TRV::GhTSD7more MDA is accumulated in the leaf (fig. 8D). MDA is one of the common indexes for measuring the degree of oxidative stress, can reflect the degree of peroxidation of plant membrane lipid, and excessively accumulates MDA, which shows that under drought stress conditions,GhTSD7gene silencing results in a higher degree of lipid peroxidation of leaf cell membranes.

Finally we analyzed under drought stressTRV::GhTSD7AndTRV::00the level of active oxygen in plant leaves after 20 days of drought treatmentTRV::GhTSD7AndTRV::00DAB (3, 3-diaminobenzidine tetrahydrochloride) staining was performed on the second true leaves of (B), and as a result, it was found that the tan deposit in the leaves after drought treatment was significantly higher than that in the control group (H) ₂ O-watering) and, moreover,TRV::GhTSD7the leaves are brown with large area, and the dyeing degree is higherTRV::00Deeper (FIG. 9A), indicating drought stressTRV::GhTSD7The leaves accumulate more H ₂ O ₂ . The quantitative result of the staining degree of the leaves by taking the same parts of different leaves respectively by Image J also shows that the high salt stress is causedTRV::GhTSD7Excess H in the blade ₂ O ₂ Is shown (fig. 9B). To analyze in leaves under drought stressTRV::GhTSD7AndTRV::00h in plant leaves ₂ O ₂ And levels of superoxide anions, we examined drought hypochondriacForced downward H ₂ O ₂ And the content of superoxide anions. As a result, it was found that H in leaf under drought stress ₂ O ₂ And the content of superoxide anions is increased, and thenTRV::00In contrast to this, the method comprises,TRV::GhTSD7h in blade ₂ O ₂ And higher levels of superoxide anions (FIGS. 9C, 9D), consistent with DAB staining results.

To further analyze the intracellular active oxygen levels under drought stress, we examined Malondialdehyde (MDA) levels in leaves, and the results showed that drought stress resulted in more MDA accumulating in leaves, rather than in leavesTRV::00In contrast to this, the method comprises,TRV:: GhTSD7more MDA is accumulated in the leaf (fig. 9E). MDA is one of the common indexes for measuring the degree of oxidative stress, can reflect the degree of peroxidation of plant membrane lipid, and excessively accumulates MDA, which shows that under drought stress conditions,TRV::GhTSD7gene silencing results in a higher degree of lipid peroxidation of leaf cell membranes. In addition, to analyze the effect of other active oxygen scavenging enzymes on intracellular active oxygen levels, we examined the activities of Catalase (CAT) and superoxide dismutase (SOD) in the leaves, respectively. The results show that drought stress reduced Catalase (CAT) and superoxide dismutase (SOD) activity compared to the control group, and,GhTSD7gene silencing results in a higher in-leaf superoxide dismutase (SOD) and superoxide dismutase (SOD) activityTRV::00The enzyme activity in the leaves was lower (FIGS. 9F, 9G). This result indicates that, under drought stress conditions,TRV::GhTSD7the leaves accumulate excess active oxygen, on the one hand, due toGhTSD7The down-regulation of the expression level results in, on the other hand, a decrease in the activities of Catalase (CAT) and superoxide dismutase (SOD) in the leaf. Finally, we also examined the content of Proline (PRO) in leaves, and the results showed that drought stress resulted in more Proline (PRO) accumulated in leaves, as compared withTRV::00In contrast to this, the method comprises,TRV::GhTSD7more Proline (PRO) is accumulated in the leaves (fig. 9E). Excessive accumulation of proline, indicative of the presence of a high level of proline in drought stress,GhTSD7gene silencing results in a higher degree of damage to the leaf.

In conclusion, after the arabidopsis is overexpressed, drought stress tolerance is improved, which indicates thatGhTSD7The gene positively regulates the tolerance of arabidopsis thaliana to drought stress; while silencingGhTSD7The drought stress tolerance of cotton is reduced after the gene, which also shows thatGhTSD7The gene positively regulates the tolerance of cotton to drought stress. It can be seen that the light source is,GhTSD7the gene plays an important role in regulating and controlling plant drought stress, and has important significance for cultivating cotton varieties capable of resisting external stress conditions.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.

Claims (4)

1.GhTSD7Use of a gene for increasing drought stress tolerance in plants, characterized in that the gene comprisesGhTSD7The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the plant is cotton or Arabidopsis thaliana.

2. The use according to claim 1, characterized by the fact that by constructionGhTSD7And (3) over-expressing the vector to obtain a transgenic plant with high drought stress tolerance.

3. A plant breeding method characterized in that the method is (1) or (2) or (3) below:

(1) By increasing the number of target plantsGhTSD7The activity of the protein, and obtaining plants with drought stress tolerance stronger than that of target plants;

(2) By promoting the growth of the target plantsGhTSD7The expression of the gene can obtain a plant with drought stress tolerance stronger than that of the target plant;

(3) By inhibition in plants of interestGhTSD7Expression of the gene, low drought stress tolerance is obtainedPlants in the plant of interest; the saidGhTSD7The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the target plant is cotton or Arabidopsis thaliana.

4. A plant breeding method according to claim 3 wherein inhibition in the plant of interestGhTSD7The method of gene expression is silencingGhTSD7And (3) a gene.