CN107903312A - A kind of paddy rice zinc finger protein and its encoding gene and application - Google Patents
A kind of paddy rice zinc finger protein and its encoding gene and application Download PDFInfo
- Publication number
- CN107903312A CN107903312A CN201711449952.1A CN201711449952A CN107903312A CN 107903312 A CN107903312 A CN 107903312A CN 201711449952 A CN201711449952 A CN 201711449952A CN 107903312 A CN107903312 A CN 107903312A
- Authority
- CN
- China
- Prior art keywords
- zinc finger
- finger protein
- osctzfp8
- paddy rice
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to biological technical field, and in particular to a kind of paddy rice zinc finger protein and its encoding gene and application.The amino acid sequence of the paddy rice zinc finger protein such as SEQ ID NO:Shown in 1.It further relates to a kind of paddy rice zinc finger protein gene OsCTZFP8 for encoding above-mentioned paddy rice zinc finger protein.It further relates to a kind of primer or probe for being used to detect above-mentioned paddy rice zinc finger protein gene OsCTZFP8.It further relates to the carrier containing above-mentioned paddy rice zinc finger protein gene OsCTZFP8 and the recombinant cell containing above-mentioned carrier.It further relates to the application of above-mentioned paddy rice zinc finger protein or paddy rice zinc finger protein gene OsCTZFP8 or carrier or recombinant cell in rice cold tolerance is improved.It can encode to form Zn For Rice lipoprotein by Zn For Rice lipoprotein gene OsCTZFP8, it can improve the cold resistance of rice, have significantly value in practical applications.
Description
Technical field
The present invention relates to biological technical field, in particular to a kind of paddy rice zinc finger protein and its encoding gene and answers
With.
Background technology
Rice is that most important cereal crops, the population for global half provide grain in the world.Rice is temperature sensitive,
Low temperature seriously affects its growth and yield.Each stage of the whole Growing season of rice is likely to that chilling injury occurs.According to low
Temperature can will damage to plants caused by sudden drop in temperature to the Influencing Mechanism of rice and be divided into 3 type of cool summer damage due to delayed growth, cool summer damage due to impotency and mixed cold harm：Delay
Type, which damages to plants caused by sudden drop in temperature, refers to that the Persistent Low Temperature in the vegetative growth of rice plants phase be subject to the long period is influenced, cause seedling development it is slow,
Plant height and tiller number reduce (Iba etc., 2002；Tian etc., 2011).Cool summer damage due to impotency refers to short-term in rice reproductive stage
Abnormal low temperature causes that infull heading delay, fringe portion, pollen sterility, kernel grouting be bad, setting percentage reduces, and ultimately results in the underproduction
(Zhang etc., 2011；Pan etc., 2015).Chilling injury frequently occurs in high latitude Temperate Region in China and the high sea of Perenniporia martius
Rise sheer from level ground area, it is especially prominent in the country such as Japan, China, Korea.Three provinces in the northeast of China of China, South Korea the north and Hokkaido, Japan etc. are regional
Average 3-4 just occur once it is larger damage to plants caused by sudden drop in temperature, small damages to plants caused by sudden drop in temperature frequently generation (Ji Zhijuan, 2009).Northeast rice workspace is China
Maximum superior rice grown place, but occurrence frequency height is damaged to plants caused by sudden drop in temperature, injured area is big, seriously affects Rice Production.Therefore, cultivate resistance to
Cold property rice varieties, have very important significance the production of high yield, stable yields and superior rice.With molecular biology and gene
The development that group is learned, modern biotechnology have been widely used for the genetic improvement of the cereal crops such as rice.
Rice cold tolerance is complex character, and cold resistance related gene and molecule machine are can reveal that by animal nutrition
Reason.Transcription factor plays vital effect in the stress response of plant, is also obtained in the genetic engineering improvement of plant
The attention of people.The Low temperature disaster of most serious is the cool summer damage due to impotency suffered from boot stage in China's Rice Production.It is resistance to
Cold property characterization and evaluation can carry out under the conditions of the constant temperature cold water irrigation of natural low temperature condition and manual control water temperature.Pollen fertility and
Seed-setting rate be Cold Tolerance at Booting Stage evaluation important indicator (Dai etc., 2002；Zhang etc., 2017).Therefore, one kind is lacked
The animal nutrition of rice cold tolerance can be improved.
The content of the invention
It is an object of the invention to provide a kind of paddy rice zinc finger protein, it can improve the cold-resistant of rice reproductive stage
Property, and participate in paddy rice low stress regulatory process.
Another object of the present invention is to provide a kind of paddy rice zinc finger protein gene OsCTZFP8, it can encode above-mentioned water
The gene of rice zinc finger protein.
Another object of the present invention is to provide the carrier containing above-mentioned paddy rice zinc finger protein gene OsCTZFP8.
Another object of the present invention is to provide the recombinant cell containing above-mentioned carrier.
Another object of the present invention is to provide above-mentioned paddy rice zinc finger protein gene OsCTZFP8 or carrier or recombinant cell
Application in rice cold tolerance is improved.
It is a kind of for detecting drawing for above-mentioned paddy rice zinc finger protein gene OsCTZFP8 another object of the present invention is to provide
Thing or probe.
What the present invention was realized in：
A kind of paddy rice zinc finger protein provided by the invention, its amino acid sequence such as SEQ ID NO:Shown in 1.
The invention further relates to a kind of paddy rice zinc finger protein gene OsCTZFP8, it encodes rice as claimed in claim 1
Zinc finger protein.
The invention further relates to a kind of primer or probe for being used to detect above-mentioned paddy rice zinc finger protein gene OsCTZFP8.
The invention further relates to the carrier containing above-mentioned paddy rice zinc finger protein gene OsCTZFP8.
The invention further relates to the recombinant cell containing above-mentioned carrier.
The invention further relates to above-mentioned paddy rice zinc finger protein or paddy rice zinc finger protein gene OsCTZFP8 or carrier or restructuring are thin
Application of the born of the same parents in rice cold tolerance is improved.
It can encode to form Zn For Rice lipoprotein by Zn For Rice lipoprotein gene OsCTZFP8, it can improve rice
Cold resistance, has significantly value in practical applications.And pass through the overexpression of Zn For Rice lipoprotein gene OsCTZFP8
Crop genetic improvement can be carried out, cultivates cold resistance genetically modified crops.
Brief description of the drawings
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it will be appreciated that the following drawings illustrate only certain embodiments of the present invention, therefore be not construed as pair
The restriction of scope, for those of ordinary skill in the art, without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the gene structure figure of paddy rice zinc finger protein gene OsCTZFP8；
Fig. 2 is the albumen homology sequence alignment analysis of the paddy rice zinc finger protein of paddy rice zinc finger protein gene OsCTZFP8 codings
Figure；
Fig. 3 is the Phylogenetic tree analysis figure of paddy rice zinc finger protein gene OsCTZFP8；
Fig. 4 is the abiotic induction assays figure of paddy rice zinc finger protein gene OsCTZFP8；
Fig. 5 builds P for paddy rice zinc finger protein gene OsCTZFP8UbiThe part-structure schematic diagram of-OsCTZFP8 carriers；
Fig. 6 is the tissue culture procedures figure that plant expression vector is imported into rice by agrobacterium-mediated transformation；
Fig. 7 is T0The testing result detected for the PCR of the bar genes of transfer-gen plant；
Fig. 8 is the Southern blot analysis charts of paddy rice zinc finger protein gene OsCTZFP8 overexpression strains；
Fig. 9 is the mrna expression amount testing result of paddy rice zinc finger protein gene OsCTZFP8 overexpression strains；
Figure 10 is schematic diagram of the basta Resistant segregations than identification；
Figure 11 is the pollen fertility qualification figure of paddy rice zinc finger protein gene OsCTZFP8 overexpression strains under cold stress；
Figure 12 is the testing result figure of the fertile pollen rate of paddy rice zinc finger protein gene OsCTZFP8 overexpression strains；
Under the conditions of Figure 13 is harvest time normal condition and cold water, the seed-setting situation of overexpression strain and check variety
Comparison diagram；
Under the conditions of Figure 14 is harvest time normal condition and cold water, the seed-setting rate pair of overexpression strain and check variety
Than figure.
Embodiment
, below will be in the embodiment of the present invention to make the purpose, technical scheme and advantage of the embodiment of the present invention clearer
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, builds according to normal condition or manufacturer
The condition of view carries out.Reagents or instruments used without specified manufacturer, is the conventional production that can be obtained by commercially available purchase
Product.
A kind of paddy rice zinc finger protein and its encoding gene to mode of the present invention and application are specifically described below.
Some embodiments of the present invention provide a kind of paddy rice zinc finger protein, its amino acid sequence such as SEQ ID NO:1
It is shown.
Zinc lipoprotein is a kind of transcription factor with finger domain, mainly by the binding domain of DNA, RNA with it is other
The expression of the interaction regulation and control target gene of protein.Rice is as important cereal crops and model plant, its zinc finger egg
The molecular mechanism research of white transcription factor regulation and control abiotic stress is still in infancy, from rice in embodiments of the present invention
It is middle to have separated a kind of new zinc finger protein gene OsCTZFP8, and identify its biological function.The zinc finger protein gene
OsCTZFP8 overexpressions transgenic line can significantly improve reproductive stage cold resistance, therefore, be obtained by the gene code
To paddy rice zinc finger protein can participate in paddy rice low stress regulatory process, improve the cold resistance of rice reproductive stage.
Some embodiments of the present invention additionally provide a kind of paddy rice zinc finger protein gene OsCTZFP8, its coding is above-mentioned
Paddy rice zinc finger protein.In some embodiments of the present invention, the nucleotide sequence such as SEQ of paddy rice zinc finger protein gene OsCTZFP8
ID NO:Shown in 2.
Zn For Rice lipoprotein gene OsCTZFP8 can be carried out by encoding the formation paddy rice zinc finger protein in rice
Express to improve the cold resistance of rice, there is significantly value in practical applications.Therefore, the overexpression of the gene can be passed through
Crop genetic improvement can be carried out, cultivates cold resistance genetically modified crops.
In some embodiments of the present invention, Zn For Rice lipoprotein gene OsCTZFP8 carries out separating in the following manner
Arrive：Cold Tolerance at Booting Stage is identified under a variety of environmental conditions using rice recombinant inbred lines, and it is fixed on No. 8 the short arm of a chromosome
One main effect QTL in position, is positioned at target QTL by finely positioning the target zone (undisclosed content) of 99.4kb, from mesh
Mark region candidate gene in filter out with the zinc finger protein gene that cold resistance is closely related, biological function is unknown, and
It is named as OsCTZFP8 (Oryza sativa Cold Tolerance Zinc Finger Protein in
chromosome8).Through bioinformatic analysis, the Zn For Rice fat egg encoded by Zn For Rice lipoprotein gene OsCTZFP8
It is made of in vain 225 amino acid, molecular weight 23.7kD, isoelectric point 10.5.Further analyzing rice zinc lipoprotein gene
The gene structure of OsCTZFP8 finds that the gene contains two extrons and an introne, and second exon region contains
One C2H2Type Zinc finger domain (http://www.prosite.expasy.org), its structure as shown in Figure 1, Fig. 1 shows
In the gene structure figure of Zn For Rice lipoprotein gene OsCTZFP8, white box represents extron, and black connecting line represents to include
Son, black box represent C2H2Zinc lipoprotein functional domain.
Some embodiments of the present invention additionally provide a kind of for detecting above-mentioned paddy rice zinc finger protein gene
The primer or probe of OsCTZFP8.
According to some embodiments, primer includes nucleotide sequence such as SEQ ID NO:3 and SEQ ID NO:Drawing shown in 4
Thing pair, probe include nucleotide sequence such as SEQ ID NO:5 and SEQ ID NO:Probe shown in 6.
Some embodiments of the present invention additionally provide the carrier containing above-mentioned paddy rice zinc finger protein gene OsCTZFP8.
Some embodiments of the present invention additionally provide the construction method of above-mentioned carrier, it includes：Utilize Superscript
III reverse transcriptase (Invitrogen, Carlsbad, USA), by 1 μ g total serum IgEs reverse transcriptions into cDNA, are obtained
The full-length cDNA of paddy rice zinc finger protein gene OsCTZFP8 is obtained, is connected to p3300-Ubi carriers, builds PUbi::OsCTZFP8 plants
Expression vector.
Some embodiments of the present invention additionally provide the recombinant cell containing above-mentioned carrier.
Some embodiments of the present invention further relate to above-mentioned paddy rice zinc finger protein or paddy rice zinc finger protein gene
OsCTZFP8 or the carrier containing paddy rice zinc finger protein gene OsCTZFP8 or the recombinant cell containing above-mentioned carrier are improving water
Application in rice cold resistance.
According to some embodiments, rice cold tolerance is the cold resistance of rice reproductive stage.It is resistance in some embodiments
The corresponding temperature of cold property is 10~20 DEG C, preferably 13~20 DEG C, more preferably 16~20 DEG C.
According to some embodiments, above application predominantly passes through Agrobacterium-mediated genetic transformation method, will contain rice
The carrier of zinc finger protein gene OsCTZFP8 is transformed into rice paddy seed, for example, can be by above-mentioned PUbi::OsCTZFP8 plant tables
It is transformed into up to carrier in japonica rice variety kitaake.
According to some embodiments, by Agrobacterium-mediated genetic transformation method, paddy rice zinc finger protein gene will be contained
The specific method that the carrier of OsCTZFP8 is transformed into rice paddy seed is：The rice paddy seed for removing glume induces after disinfection
Callus, squamous subculture, utilize the agrobacterium strains for carrying the carrier containing paddy rice zinc finger protein gene OsCTZFP8
EHA105 Jun liquid infects callus, by basta resistance screenings, breaks up, takes root, and final transplanting obtains transgenosis independent transformation
Plant.For example, the carrier containing paddy rice zinc finger protein gene OsCTZFP8 can select above-mentioned PUbi::OsCTZFP8 plants are expressed
Carrier.
The feature and performance of the present invention are described in further detail with reference to embodiments.
Embodiment 1
The separation and sequence analysis of paddy rice zinc finger protein gene OsCTZFP8
1.1 identify Cold Tolerance at Booting Stage under a variety of environmental conditions using rice recombinant inbred lines, and in No. 8 chromosome
It located a main effect QTL on galianconism, target QTL be positioned at by finely positioning the target zone of 99.4kb, from target area
Filtered out in the candidate gene of domain with the zinc finger protein gene OsCTZFP8 that cold resistance is closely related, biological function is unknown, its
Base sequence is as shown in SEQ ID NO.2.
1.2 utilize NCBI Multiple sequence alignments instruments (https://www.ncbi.nlm.nih.gov/tools/co
Balt/cobalt.cgi), with the paddy rice zinc finger protein of paddy rice zinc finger protein gene OsCTZFP8 codings, (its amino acid sequence is such as
Shown in SEQ ID NO.1) full length amino acid sequence as query carry out BLASTp, retrieve plant in homologous protein, carry out
Multiple sequence alignments.Comparison result as shown in Fig. 2, black portions be conservative amino acid residue, grey parts be conservative time
It, square frame represent C2H2Zinc lipoprotein structure domain.From figure 2 it can be seen that the C of zinc finger protein gene OsCTZFP82H2Type zinc
The relatively other plants of albumen that finger domain corresponds to coding are highly conserved such as rice, corn, sorghum, arabidopsis.
1.3 utilize Multiple sequence alignments as a result, building 14 plant C using adjacent method2H2The system of type zinc lipoprotein gene
Tree.For example, using 4.1 softwares of MEGA version, with the homologous protein of 13 paddy rice zinc finger protein OsCTZFP8,
Neighbor-Joining methods build phylogenetic tree, and bootstrap test values are 1000.The results are shown in Figure 3 for it, from figure
As can be seen that the paddy rice zinc finger protein of paddy rice zinc finger protein gene OsCTZFP8 codings and the long-grained nonglutinous rice zinc fat egg of Unknown Function in 3
White homology highest, identical big branch is in the zinc finger protein in monocotyledon.For building 14 of phylogenetic tree
Plant zinc finger protein is as follows：Rice Os CTZFP8, rice Os l_28710 (Oryza sativa L., gi | 34015350), corn
ZmZFP1 (Zea mays, gi | 242032883), arabidopsis AtZFP1 (Arabidopsis thaliana, gi | 15240742),
Soybean GsZAT10 (Glycine soja, gi | 734330588), rape ZFP1 (Brassica nupus, gi | 685279228),
Rice Os 07g0209600 (Oryza sativa Japonica, gi | 937925668), rice Os ZF1 (Oryza sativa
Japonica, gi | 34393438), rice C2H2transcription factor(Oryza sativa Japonica,gi|
323388891), rice Os J_12692 (Oryza sativa Indica, gi | 125588016), corn putative zinc
Finger protein1 (Zea mays, gi | 195640880), sorghum SbZFP1 (Sorghum bicolor, gi |
670405684), arabidopsis C2H2and C2HC zinc fingers superfamily protein(Arabidopsis
thaliana C2H2and C2HC zinc fingers superfamily protein, gi | 15229643), rape BrAZF1
(Brassica rapa,gi|923538325)。
1.4 using PLACE (http://www.dna.affrc.go.jp.com/PLACE/signalscan.html) into
Row promoter Analysis.Found by analysis result, the upstream from start codon 2000bp of paddy rice zinc finger protein gene OsCTZFP8
Sequence is rich in low-temp reaction cis-acting elements (LTR) and abscisic acid response element (ABRE).China national rice data center
(http://www.ricedata.cn.org) and Rice Genome Annotation Project funded by the
NSF(http://rice.plantbiology.msu.edu) Gene correlation show, the gene participate in abiotic stress
Response regulates and controls.Thus, it will be seen that paddy rice zinc finger protein gene OsCTZFP8 is a kind of participation rice abiotic stress response tune
The zinc lipoprotein gene of control.
Embodiment 2
The qRT-PCR analyses of paddy rice zinc finger protein gene OsCTZFP8 under abiotic stress induction
The rice seedling of 2.1 pairs of cultures two weeks carries out the environment stress of low temperature (4 DEG C), NaCl (200mM) and ABA (5 μM)
Processing, processing time for be respectively 0,1,2,5,12,24h, liquid nitrogen flash freezer after sampling, using MiniBEST Universal RNA
Extracts kit (Takara, Japan) extraction total RNA.
2.2 utilize qRT-PCR, using Elongation factor-1 α (eEF1- α) as internal reference, detect rice zinc finger egg
Transcriptional level changes of the white gene OsCTZFP8 after the processing of different abiotic stress.
For example, specific method is as follows：The total serum IgE of 800ng is taken, utilizes PrimeScriptTM RT Reagent kit
With gDNA Eraser (Takara, Japan) reverse transcription obtains cDNA.1 μ l cDNA are extracted, utilize FastStart
Universal SYBR GreenMaster kits (ROX) (Roche, Germany), in ABI7500HT instrument
QRT-PCR amplifications are carried out on (ABI, USA), using 2–ΔΔCTRelative quantitation method carries out expression quantity calculating (Livak and
Schmittgen, 2001).
According to some embodiments, primer sequence is shown in Table 1.
1 real-time quantitative primer sequence of table
| Primer | Primer sequence | Sequence identifier |
| CTZFP8-qF | ACGAGCCACCGGTTCAAG | SEQ ID NO.3 |
| CTZFP8-qR | ATTACGCGGTGAGAAGGCGA | SEQ ID NO.4 |
| eEF1α-F | TTTCACTCTTGGTGTGAAGCAGAT | |
| eEF1α-R | GACTTCCTTCACGATTTCATCGTAA |
Embodiment 3
Paddy rice zinc finger protein gene OsCTZFP8 adverse circumstances induced expression is analyzed
Expression of the gene under low temperature, ABA and high-salt stress is detected by qRT-PCR methods to change.For example, will
Rice seedling carries out qRT-PCR detections after carrying out low temperature (A), ABA (B) and high salt (C) processing.With Elongation factor1
α (eEF1 α) is used as reference gene, using 2–ΔΔCTMethod calculates relative expression quantity.Its expression of results is as shown in figure 4, from Fig. 4
As can be seen that different journeys are presented in expressions of the paddy rice zinc finger protein gene OsCTZFP8 in seedling and root under three kinds of stress
The variation tendency of degree.Under low temperature and NaCl processing, the paddy rice zinc finger protein gene OsCTZFP8 transcriptional levels in seedling are obvious
Rise, transcriptional level improves more than 6 times particularly after low-temperature treatment 5h, but transcriptional level slightly improves under ABA processing.
In root, the expression quantity of paddy rice zinc finger protein gene OsCTZFP8 Stress treatment and it is untreated between be not significantly different.More than
The result shows that the paddy rice zinc finger protein of paddy rice zinc finger protein gene OsCTZFP8 codings answers low temperature and high salt adverse circumstance in rice
Answer and play a role in reaction.
Embodiment 4
The plant expression vector construction and overexpression transgenic paddy rice of paddy rice zinc finger protein gene OsCTZFP8
4.1 separate the full-length cDNA of cloning rice zinc finger protein gene OsCTZFP8 from rice, that is, utilize
Superscript III reverse transcriptase (Invitrogen, Carlsbad, USA), 1 μ g total serum IgEs are inverted
Record into cDNA, obtain the full-length cDNA of paddy rice zinc finger protein gene OsCTZFP8, then be connected to containing Ubi promoters and
P is built in the p3300-Ubi carriers of bar marker geneUbi::OsCTZFP8 carriers, its process are as shown in Figure 5.
4.2 are imported into plant expression vector in rice using agrobacterium-mediated transformation, by callus induction, subculture,
Agrobacterium is infected, basta resistance screenings, differentiation, root induction and hardening, finally obtain 46 separate transformation events.The above process
As shown in fig. 6, in Fig. 6, rice transformation flow can be divided into the induction (a) of callus, squamous subculture (b), Agrobacterium are invaded
Basta resistance screenings (c) after dye, differentiation (d), take root (e), the process such as hardening (f).
4.3 extraction T0For transgenic paddy rice genomic DNA, PCR amplification herbicide resistance gene bar fragments, and to T0In generation, turns
The bar genes of gene plant carry out PCR detections, and testing result from Fig. 7 as shown in fig. 7, can prove T0For transgenic paddy rice
Carry bar resistance fragments, positive rate 89%.It should be noted that M is Marker 100bp Ladder in Fig. 7；PC is PUbi::
OsCTZFP8 carrier DNAs；1 is non-transgenic reference kind；2-21 is T0For independent transformation plant.
Embodiment 5
The overexpression list copy insertion homozygous line screening of paddy rice zinc finger protein gene OsCTZFP8
5.1 is whole in rice genome using southern hybridizing method analyzing rice zinc finger protein genes OsCTZFP8
Conjunction property and copy number.
Specific method is as follows：Using CTAB methods extraction plant genome DNA (Doyle and Doyle, 1987), 40 μ g are taken
DNA carries out digestion with Hind III restriction endonucleases (Takara, Japan), and digestion products separate on 0.8% Ago-Gel
After be transferred to HybondN+Nylon membrane (Amersham, UK), is hybridized with (Roche, USA) probe of digoxigenin labeled, with X- light
Film chemistry shines autography.Probe sequence includes the 3 ' partial sequences and paddy rice zinc finger protein gene of Ubi promoters
5 ' the partial sequences of OsCTZFP8.
Probe sequence is：Ubi-SF, TTTAGCCCTGCCTTCATACG (SEQ ID NO.5)；ZFP8-SR,
ATTACGCGGTGAGAAGGCGA(SEQ ID NO.6)。
For Southern blot analysis results as shown in figure 8, in Fig. 8, M is DNA molecular amount standard；NT is non-transgenic pair
According to kind；OE#1~OE#8 is overexpression strain；PC is PUbi::OsCTZFP8 carrier DNAs.
5.2 use RT-PCR method, determine paddy rice zinc finger protein gene OsCTZFP8 and are singly copying turning for insertion strain
Record is horizontal.The results are shown in Figure 9, and the paddy rice zinc finger protein gene OsCTZFP8 transcriptional levels of 6 single copy insertion strains are obvious
Higher than non-transgenic reference kind, show paddy rice zinc finger protein gene OsCTZFP8 obtained on transcriptional level overexpression,
Non- producer silence, transgenosis list copy insertion homozygous line can stablize the uniformity for keeping heredity and phenotypic character, can accelerate
Generation process, reduce workload.It should be noted that in Fig. 9, NT is non-transgenic reference kind；OE#1~OE#6 is singly to copy
Shellfish overexpression strain.
5.3 screen single copy insertion homozygous line by seed germination experiment (Jin etc., 2015).
Specific method is as follows：Rice paddy seed after disinfection is sowed in the 1/2MS (30mg/L containing basta herbicides
Basta) on culture medium, cultivated under the conditions of long-day, 28 DEG C.5th day investigation germination percentage after germination, with the long 1.5cm of bud
For normal germination identification of indicator, basta Resistant segregations can be screened than meeting the strain of mendelian inheritance and be inserted for single copy
Enter homozygous line.The results are shown in Figure 10 for it, by basta Resistant segregations than identifying, filters out segregation ratio and meets Mendelian inheritance
The single copy insertion homozygous line, that is, OE#1 of two of rule and OE#3, Tu10Zhong, T1, T2For transgenosis different generations；NT turns base to be non-
Because of check variety；OE#1, OE#3 are overexpression strain.
Embodiment 6
The Identification of Cold Tolerance of paddy rice zinc finger protein gene OsCTZFP8 overexpression transgenic lines
6.1 utilize paddy rice zinc finger protein gene OsCTZFP8 overexpressions strain and non-transgenic reference kind, artificial
Control in the Identification of Cold Tolerance garden of water temperature and carried out low temperature stress processing.
Rice cold tolerance identification carries out in the cold-resistant identification garden in Jilin Academy of Agricultural Science.On April 25th, 2017 is sowed, June 2
Day rice transplanting, rice transplanting specification is 27 × 12.5cm.Fertilization Level is N-P-K:140-80-80kg/ha, routinely cultivation technique progress
The time of infertility manages.
Low temperature stress is carried out using constant temperature deep cooling water irrigation method, and cold water irrigation period is the water from ear differentiation to boot stage
Temperature is 18.5 DEG C of constant temperature cold water, depth of water 15cm.Identification of Cold Tolerance index is pollen fertility and seed-setting rate.
6.2 cold water irrigation after treatments, pollen fertility is detected using iodine-potassium iodide pollen staining method.Utilize 1%
I2- KI solution measures pollen fertility at the florescence, and method refers to shinjyo (1969).Middle picking flower pesticide is spent to be placed in load from rice grain husk
Gently smashed to pieces on slide, add a drop I2- KI solution makes pollen fully scatter, covered, is carried out under the microscope after 5min
Observation.Fertile pollen be coloured to blueness, grain it is round and full, pollen sterile in yellowish-brown, the flat contracting of grain.5 visuals field of every observation,
And count the percentage of fertile pollen.Calculation formula is：The percentage of fertile pollen=(effective pollen number/all flowers of dyeing
Powder number) × 100%.
In normal irrigation garden, as shown in figure 11, the pollen of overexpression strain (OE#1-6, OE#3-2) and check variety
Uniform dyeing is into navy blue.As shown in figure 12, in normal irrigation garden, the fertile rate of its pollen is up to more than 98%, and in cold water irrigation garden
In, the fertile rate of pollen is decreased obviously, but the pollen fertile pollen rate of overexpression strain is significantly higher than check variety, i.e. OE#
The pollen fertile pollen rate of 1-6 and OE#3-2 is 76-81%, and check variety is only 41%.
Result above shows that influence of the cold water irrigation to pollen fertility is bigger, but paddy rice zinc finger protein gene
The overexpression of OsCTZFP8 can improve the pollen fertility under cold stress.
Seed-setting rate is investigated after 6.3 harvests.Each strain takes 5 plants, and every plant takes 5 larger fringes, after threshing, investigates per fringe
Bear fruit grains and empty grain number, and calculate setting percentage.Calculation formula is：Seed-setting rate=[bear fruit grains/(bear fruit grains+empty grain number)] ×
100%.
Seed-setting rate is the important indicator of reproduction period cold resistance evaluation.In harvest time, to low temperature stress processing or without
The rice of processing has carried out seed-setting rate comparative analysis, i.e., Phenotypic Observation is carried out in harvest time and is taken pictures.As a result such as Figure 13 institutes
Show, in normal irrigation garden, the seed-setting rate of overexpression strain and check variety (>92%) there is no difference.However, cold
Water is irrigated in garden, and the seed-setting rate of overexpression strain OE#1-6 and OE#3-2 are significantly higher than check variety (p<0.05), i.e.,
The seed-setting rate of OE#1-6 and OE#3-2 is respectively 73.3% and 72.5%, and the seed-setting rate of check variety is only
52.9%.Result above shows that cold water irrigation has a great influence seed-setting rate, but paddy rice zinc finger protein gene
The overexpression of OsCTZFP8 can improve the seed-setting rate under cold stress.
Summary is as a result, the paddy rice zinc finger protein of paddy rice zinc finger protein gene OsCTZFP8 codings can improve rice reproduction
The cold resistance in growth period, therefore, it is known that the paddy rice zinc finger protein of the gene code participates in the cold resistance regulation process of rice.
Embodiment 7
Take the economical character such as 5 plants of representative plant, measure single plant tiller number, spike length, mass of 1000 kernel, single plant yield.
The results are shown in Table 2 for it.
The economical character of 2. paddy rice zinc finger protein gene OsCTZFP8 overexpression strains of table
* is represented under the conditions of cold water treatment, in p between non-transgenic reference kind (WT) and overexpression strain (OE)<
There are pole significant difference on 0.01.
As can be seen that the lower paddy rice zinc finger protein gene OsCTZFP8 overexpressions of low temperature stress processing from the result of table 2
The seed-setting rate of strain, single plant yield are significantly higher than control (p<0.01), other characters such as tiller number, spike length do not have significance difference
It is different, show that paddy rice zinc finger protein gene OsCTZFP8 overexpressions strain can improve rice yield under low temperature stress.
It should be noted that acceptor kind in the above-described embodiments is Japanese Rice kind Kitaake, by Jilin Province's agriculture
Institute of section rice is provided.The extremely early mature japonica rice variety that the kind is cultivated for Japan, the breeding time in Changchun are 110 days, are had anti-
The features such as rice blast is sick and weak, cold resistance is weak, grain type is bigger than normal, low output.
In conclusion by a kind of new zinc finger protein gene OsCTZFP8 isolated, and identify the gene
Biological function.By Molecular Identification and phenotypic evaluation, water can be improved by finding the overexpression of zinc finger protein gene OsCTZFP8
The pollen fertility and seed-setting rate of rice, show that the gene has cold resistance in the reproductive stage of rice.Therefore, can understand
The paddy rice zinc finger protein of zinc finger protein gene OsCTZFP8 codings participates in the cold resistance regulation process of rice.In research from now on
In, it can be sequenced by transcript profile and the methods of differential genes expression analysis, further elucidate zinc finger protein gene OsCTZFP8 and compile
Molecule mechanism of the paddy rice zinc finger protein of code during various abiotic stress are resisted, reason is provided for Chilling Tolerant Mechanisms In Rice research
By basis.
The foregoing is only a preferred embodiment of the present invention, is not intended to limit the invention, for the skill of this area
For art personnel, the invention may be variously modified and varied.Within the spirit and principles of the invention, that is made any repaiies
Change, equivalent substitution, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Jilin Academy of Agricultural Science
<120>Paddy rice zinc finger protein and its encoding gene and application
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 224
<212> PRT
<213> Oryza sativa
<400> 1
Met Ala Met Ala Phe Leu Gly Gln Ser Arg Leu Tyr Asp Gly Ile Ser
1 5 10 15
Trp Asn Ser His Leu Ser Met Ala Phe Leu Val Pro Pro Val Ser Val
20 25 30
Ala Thr Ser Ala Pro Ser Leu Ser Leu Pro Pro Pro Leu Pro Ser Ser
35 40 45
Ser Leu Ser Leu Ser Leu Phe Ser Ala Ser Arg Pro Val Ala Gly Ala
50 55 60
Lys Ala Ala Arg Val Arg Arg Arg Arg Gln Val Ala Asn Gly Glu Thr
65 70 75 80
Glu Ala Leu His Ala Ala Val Leu Lys Glu Glu Glu Gln Gln His Glu
85 90 95
Val Glu Glu Ala Ala Val Val Thr Ser Ser Ser Ala Thr Ser Gly Glu
100 105 110
Glu Gly Gly His Leu Pro Gln Gly Trp Ala Lys Arg Lys Arg Ser Arg
115 120 125
Arg Gln Arg Ser Glu Glu Glu Asn Leu Ala Leu Cys Leu Leu Met Leu
130 135 140
Ala Leu Gly Gly His His Arg Val Gln Ala Pro Pro Pro Leu Ser Ala
145 150 155 160
Pro Val Gly Ala Glu Phe Lys Cys Ser Val Cys Gly Arg Ser Phe Ser
165 170 175
Ser Tyr Gln Ala Leu Gly Gly His Lys Thr Ser His Arg Phe Lys Leu
180 185 190
Pro Thr Pro Pro Ala Ser Pro Val Leu Ala Pro Ala Ser Ser Glu Val
195 200 205
Gln Ser Pro Leu Ala Phe Ser Pro Arg Asn Ser Ala Ala Ala Arg Ile
210 215 220
<210> 2
<211> 675
<212> DNA
<213> Oryza sativa
<400> 2
atggcgatgg catttttggg acaaagtcgt ttgtacgatg gcatttcttg gaactcacac 60
ttgtcgatgg catttctggt cccacctgtc agcgtggcca cgtcagcacc ctctctctct 120
cttccccctc ctctcccttc ctcatctctc tctctctcac tcttctcggc aagccggccg 180
gtggctgggg cgaaggccgc cagggtgagg cggcggcggc aggtcgcgaa tggcgagacg 240
gaagcgctcc acgccgcggt gctcaaggag gaggagcagc agcacgaggt ggaggaggcg 300
gcggtcgtga cgagcagcag cgccacaagc ggggaggagg gcgggcacct accgcagggg 360
tgggcgaagc ggaagaggtc gcgccgccag cgatcggagg aggagaacct cgcgctctgc 420
cttctcatgc tcgccctcgg cggccaccac cgcgtccagg cgccgcctcc tctctcggcg 480
ccggtaggtg cggagttcaa gtgctccgtc tgcggcaggt ccttcagctc ctaccaggcg 540
ctcggcggcc acaagacgag ccaccggttc aagctgccta ctccgcccgc atctcccgtc 600
ttggctcctg cctcctccga ggtccagagc cccctcgcct tctcaccgcg taattcagca 660
gctgcacgga tctga 675
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<400> 3
acgagccacc ggttcaag 18
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
attacgcggt gagaaggcga 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
tttagccctg ccttcatacg 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
attacgcggt gagaaggcga 20
Claims (9)
- A kind of 1. paddy rice zinc finger protein, it is characterised in that its amino acid sequence such as SEQ ID NO:Shown in 1.
- 2. a kind of paddy rice zinc finger protein gene OsCTZFP8, it is characterised in that it encodes rice zinc finger as claimed in claim 1 Albumen.
- 3. paddy rice zinc finger protein gene OsCTZFP8 according to claim 2, it is characterised in that the paddy rice zinc finger protein The nucleotide sequence of gene OsCTZFP8 such as SEQ ID NO:Shown in 2.
- A kind of 4. primer or probe for being used to detect paddy rice zinc finger protein gene OsCTZFP8 as claimed in claim 2 or claim 3.
- 5. primer according to claim 4 or probe, it is characterised in that the primer includes nucleotide sequence such as SEQ ID NO:3 and SEQ ID NO:Primer pair shown in 4, the probe include nucleotide sequence such as SEQ ID NO:5 and SEQ ID NO: Probe shown in 6.
- 6. the carrier containing the paddy rice zinc finger protein gene OsCTZFP8 described in Claims 2 or 3.
- 7. the recombinant cell containing the carrier described in claim 6.
- 8. paddy rice zinc finger protein as claimed in claim 1, or the paddy rice zinc finger protein gene described in Claims 2 or 3 OsCTZFP8, or the carrier described in claim 6, or recombinant cell described in claim 7 is in rice cold tolerance is improved Using.
- 9. application according to claim 8, it is characterised in that rice cold tolerance is the cold resistance of rice reproductive stage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711449952.1A CN107903312B (en) | 2017-12-27 | 2017-12-27 | Rice zinc finger protein and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711449952.1A CN107903312B (en) | 2017-12-27 | 2017-12-27 | Rice zinc finger protein and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107903312A true CN107903312A (en) | 2018-04-13 |
| CN107903312B CN107903312B (en) | 2020-07-10 |
Family
ID=61871561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711449952.1A Active CN107903312B (en) | 2017-12-27 | 2017-12-27 | Rice zinc finger protein and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107903312B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109251996A (en) * | 2018-11-12 | 2019-01-22 | 上海市农业科学院 | Detect dCAPS label and the application of the low temperature resistant gene C OLD1 genotype of rice |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724667A (en) * | 2004-12-31 | 2006-01-25 | 南京农业大学 | Paddy rice zinc finger protein gene and its coded protein |
| CN101182520A (en) * | 2007-11-14 | 2008-05-21 | 南京农业大学 | Paddy rice zinc finger protein gene and stress tolerance genetic engineering applications thereof |
-
2017
- 2017-12-27 CN CN201711449952.1A patent/CN107903312B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1724667A (en) * | 2004-12-31 | 2006-01-25 | 南京农业大学 | Paddy rice zinc finger protein gene and its coded protein |
| CN101182520A (en) * | 2007-11-14 | 2008-05-21 | 南京农业大学 | Paddy rice zinc finger protein gene and stress tolerance genetic engineering applications thereof |
Non-Patent Citations (1)
| Title |
|---|
| KIYOTAKA NAGAKI: "GenBank: AAQ56539.1", 《NCBI GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109251996A (en) * | 2018-11-12 | 2019-01-22 | 上海市农业科学院 | Detect dCAPS label and the application of the low temperature resistant gene C OLD1 genotype of rice |
| CN109251996B (en) * | 2018-11-12 | 2022-03-25 | 上海市农业科学院 | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107903312B (en) | 2020-07-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2648155C2 (en) | Corn object mon 87411 | |
| Abid et al. | Effect of drought stress on chlorophyll fluorescence, antioxidant enzyme activities and gene expression patterns in faba bean (Vicia faba L.) | |
| KR101856272B1 (en) | Plant having improved resistivity or sensitivity to 4-HPPD inhibitor | |
| CN112322629B (en) | Application of gene GhNHX4A in aspect of salt tolerance of plants | |
| Hu et al. | Identification of loci and candidate genes responsible for pod dehiscence in soybean via genome-wide association analysis across multiple environments | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN108359674A (en) | Rice serine/threonine protein kitase gene OsSAPK8 coded sequences and its application | |
| US10801034B2 (en) | Methods of increasing resistance of crop plants to heat stress and selecting crop plants with increased resistance to heat stress | |
| CN115612695A (en) | Application of GhGPX5 and GhGPX13 genes in improving salt stress tolerance of plants | |
| BR112018001192B1 (en) | RECOMBINANT DNA MOLECULE, METHOD FOR SELECTIVELY REGULATING THE EXPRESSION OF A PROTEIN IN A MALE REPRODUCTIVE TISSUE OF A TRANSGENIC PLANT, AND USE OF A PLANT OR SEED COMPRISING SAID RECOMBINANT DNA MOLECULE | |
| CN104903444A (en) | Nucleic acid imparting high-yielding property to plant, method for producing transgenic plant with increased yield, and method for increasing plant yield | |
| CN112280785B (en) | Application and method of Brassica napus BnMAPK2 gene | |
| CN103382476B (en) | Application of cotton P-type ATPase gene Gbpatp capable of endowing plants with cold tolerance | |
| CN106701895B (en) | Haplotype related to drought resistance of corn and molecular marker thereof | |
| CN107903312A (en) | A kind of paddy rice zinc finger protein and its encoding gene and application | |
| Liu et al. | Autumn dormancy regulates the expression of cas18, vsp and corF genes during cold acclimation of lucerne (Medicago sativa L.) | |
| He et al. | Ectopic expression of MYB repressor GmMYB3a improves drought tolerance and productivity of transgenic peanuts (Arachis hypogaea L.) under conditions of water deficit | |
| CN110029106B (en) | RNAi fragment of MSL1 and application thereof in improving cadmium stress sensitivity of plants | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| US20170067071A1 (en) | Corn genes zmspl1 and zmspl2 and uses thereof | |
| CN114231558B (en) | Application of GmREM16 gene in plant stress resistance | |
| US10858664B2 (en) | Modifying flowering time in maize | |
| CN108410829A (en) | Mongolian Ammopiptanthus mongolicus chloroplaset omega-fatty acid desaturase AmFAD7 encoding genes and application | |
| CN117986339B (en) | Transcription factor TaMYB7A-CS for improving germination resistance and drought resistance of wheat ears and application thereof | |
| CN111926024B (en) | Application of OsDNR1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |