WO2003004704A2 - Method of selecting dna sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity - Google Patents

Method of selecting dna sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity Download PDF

Info

Publication number
WO2003004704A2
WO2003004704A2 PCT/NL2002/000390 NL0200390W WO03004704A2 WO 2003004704 A2 WO2003004704 A2 WO 2003004704A2 NL 0200390 W NL0200390 W NL 0200390W WO 03004704 A2 WO03004704 A2 WO 03004704A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
star
sequence
gene
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/NL2002/000390
Other languages
English (en)
French (fr)
Other versions
WO2003004704A3 (en
Inventor
Arie Pieter Otte
Arthur Leo Kruckeberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chromagenics BV
Original Assignee
Chromagenics BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP01202581A external-priority patent/EP1273666A1/en
Priority to IL15967402A priority Critical patent/IL159674A0/xx
Priority to DK05076209T priority patent/DK1600510T3/da
Priority to AU2002314629A priority patent/AU2002314629B2/en
Priority to JP2003510461A priority patent/JP4500044B2/ja
Priority to MXPA03011801A priority patent/MXPA03011801A/es
Priority to KR1020037017168A priority patent/KR100951759B1/ko
Application filed by Chromagenics BV filed Critical Chromagenics BV
Priority to HK05100936.2A priority patent/HK1068652B/xx
Priority to CA2450020A priority patent/CA2450020C/en
Priority to BRPI0210771A priority patent/BRPI0210771B8/pt
Priority to DE60215502T priority patent/DE60215502T2/de
Priority to EP02741531A priority patent/EP1404872B1/en
Priority to NZ530218A priority patent/NZ530218A/en
Priority to DK02741531T priority patent/DK1404872T3/da
Publication of WO2003004704A2 publication Critical patent/WO2003004704A2/en
Publication of WO2003004704A3 publication Critical patent/WO2003004704A3/en
Priority to IL159674A priority patent/IL159674A/en
Priority to NO20040011A priority patent/NO338477B1/no
Anticipated expiration legal-status Critical
Priority to AU2007234619A priority patent/AU2007234619B2/en
Priority to IL193374A priority patent/IL193374A/en
Priority to IL193373A priority patent/IL193373A/en
Priority to AU2011202193A priority patent/AU2011202193B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • the invention relates to the fields of medicine and cellular biology.
  • the invention in particular relates to means and methods for regulation of gene transcription.
  • the invention further relates to means and methods for determining whether a DNA sequence comprises a gene transcription modulating quality and/or a gene transcription repressing quality.
  • foreign nucleic acid is typically introduced into cells to obtain expression of coding sequences.
  • integration of the foreign nucleic acid into the genome of the cell is required for prolonged function of the introduced sequences.
  • integration of sequences into the genome leads to unpredictability of expression because the surrounding DNA influences the transcription of the integrated sequences. This unpredictability is in part due to the fact that introduced sequences cannot be provided yet with sufficient genetic information to functionally isolate the integrated sequences from the transcription influencing effects of the surrounding DNA. In another part this is due to the fact that not enough is known about the transcription influencing effects of surrounding DNA.
  • the present invention is concerned with DNA sequences that comprise a capacity to influence transcription of genes in cis.
  • the investigated sequences do not code by themselves for a functional protein.
  • a method of detecting, and optionally selecting, a DNA sequence with a gene transcription- modulating quality comprising providing a transcription system with a variety of a fragment-comprising vectors, said vectors comprising i) an element with a gene-transcription repressing quality, and ii) a promoter directing transcription of a reporter gene, the method further comprising performing a selection step in said transcription system in order to identify said DNA sequence with said gene transcription modulating quality.
  • said fragments are located between i) said element with a gene-transcription repressing quality, and ii) said promoter directing transcription of said reporter gene.
  • RNA polymerase initiates the transcription process after binding to a specific sequence, called the promoter, that signals where RNA synthesis should begin.
  • a modulating quality can enhance transcription from said promoter in cis, in a given cell type and/or a given promoter.
  • the same DNA sequence can comprise an enhancing quality in one type of cell or with one type of promoter, whereas it can comprise another or no gene transcription modulating quality in another cell or with another type of promoter.
  • Transcription can be influenced through a direct effect of the regulatory element (or the protein(s) binding to it) on the transcription of a particular promoter. Transcription can however, also be influenced by an indirect effect, for instance because the regulatory element affects the function of one or more other regulatory elements.
  • a gene transcription modulating quality can also comprise a stable gene transcription quality.
  • stable is meant that the observed transcription level is not significantly changed over at least 30 cell divisions.
  • a stable quality is useful in situations wherein expression characteristics should be predictable over many cell divisions. Typical examples are cell lines transfected with foreign genes. Other examples are transgenic animals and plants and gene therapies. Very often, introduced expression cassettes function differently after increasing numbers of cell divisions or plant or animal generations.
  • a stable quality comprises a capacity to maintain gene transcription in subsequent generations of a transgenic plant or animal.
  • said quality comprises the quality to maintain inducibility of expression in subsequent generations of a transgenic plant or animal. Frequently, expression levels drop dramatically with increasing numbers of cell divisions.
  • said gene transcription modulating quality comprises a stable gene transcription quality. Strikingly, fragments comprising a DNA sequence with said stable gene transcription quality can be detected and optionally selected with a method of the invention, in spite of the fact that said method does not necessarily measure long term stability of transcription.
  • said gene transcription modulating quality comprises a stable gene transcription enhancing quality.
  • the present invention also provides a method for increasing the number of cells expressing a more than a certain level of a gene product of a gene of interest upon providing said gene of interest to the genome of said cells, comprising providing said cell with a DNA sequence comprising a gene transcription modulating quality together with said gene of interest.
  • the chances of detecting a fragment with a gene transcription- modulating quality vary with the source from which the fragments are derived. Typically, there is no prior knowledge of the presence or absence of fragments with said quality. In those situations many fragments will not comprise a DNA sequence with a gene transcription-modulating quality. In these situations a formal selection step for DNA sequences with said quality is introduced. This is done by selection vectors comprising said sequence on the basis of a feature of a product of said reporter gene, that can be selected for or against. For instance, said gene product may induce fluorescence or a color deposit (e.g. green fluorescent protein and derivatives, luciferase, or alkaline phosphatase) or confer antibiotic resistance or induce apoptosis and cell death.
  • a color deposit e.g. green fluorescent protein and derivatives, luciferase, or alkaline phosphatase
  • a method of the invention is particularly suited for detecting and optionally selecting a DNA sequence comprising a gene transcription- enhancing quality. It has been observed that at least some of the selected DNA sequences, when incorporated into an expression vector comprising a gene of interest, can dramatically increase gene transcription of said gene of interest in a host cell even when the vector does not comprise an element with a gene- transcription repressing quality. This gene transcription enhancing quality is very useful in cell lines transfected with foreign genes or in transgenic animals and plants.
  • Said transcription system can be a cell free in vitro transcription system. With the current expertise in automation such cell free systems can be accurate and quick.
  • said transcription system preferably comprises host cells. Using host cells warrants that fragments are detected and optionally selected with activity in cells.
  • An element with a gene transcription repressing quality will, in a method of the invention, repress transcription from a promoter in the transcription system used. Said repression does not have to lead to undetectable expression levels. Important is that the difference in expression levels in the absence or presence of repression is detectable and optionally selectable.
  • gene-transcription repression in said vectors results in gene -transcription repressing chromatin.
  • DNA sequences can be detected, and optionally selected that are capable of at least in part counteracting the formation of gene -transcription repressing chromatin.
  • a DNA sequence capable of at least in part counteracting the formation of gene -transcription repressing chromatin comprises a stable gene transcription quality.
  • the DNA sequence involved in gene -transcription repression is a DNA sequence that is recognized by a protein complex and wherein said transcription system comprises said complex.
  • said complex comprises a heterochromatin- binding protein comprising HP1, a Polycomb- group (Pc-G) protein, a histone deacetylase activity or MeCP2 (methyl-CpG-binding protein).
  • Pc-G Polycomb- group
  • MeCP2 methyl-CpG-binding protein
  • Many organisms comprise one or more of these proteins. These proteins frequently exhibit activity in other species as well.
  • Said complex can thus also comprise proteins from two or more species.
  • the mentioned set of known chromatin-associated protein complexes are able to convey long-range repression over many base pairs.
  • the complexes are also involved in stably transferring the repressed status of genes to daughter cells upon cell division. Sequences selected in this way are able to convey long-range anti-repression over many base pairs (van der Vlag et al., 2000).
  • the vector used can be any vector that is suitable for cloning DNA and that can be used in a transcription system.
  • the vector is an episomally replicating vector. In this way, effects due to different sites of integration of the vector are avoided. DNA elements flanking the vector at the site of integration can have effects on the level of transcription of the promoter and thereby mimic effects of fragments comprising DNA sequences with a gene transcription modulating quality.
  • said vector comprises a replication origin from the Epstein-Barr virus (EBV), OriP, and a nuclear antigen (EBNA-1).
  • EBV Epstein-Barr virus
  • EBNA-1 nuclear antigen
  • the invention provides a DNA sequence comprising i) a DNA sequence isolated from a plant or vertebrate, or derivatives thereof, or ii) a synthetic DNA sequence or one constructed by means of genetic engineering, which DNA sequence is a repression-inhibiting sequence which, by the method according to the present invention can be detected, selected and optionally cloned.
  • the invention provides a DNA sequence comprising i) a DNA sequence isolated from a plant or vertebrate, or derivatives thereof, or ii) a synthetic DNA sequence or one constructed by means of genetic engineering, which DNA sequence is detected, selected and optionally cloned by means of the method of the invention.
  • said DNA sequence comprises a sequence as depicted in Table 4A or a functional homologue thereof.
  • a functional homologue of a sequence as depicted in Table 4 is a sequence derived with the information given in Table 4 (be it table 4A or table 4B). For instance, a sequence that can be derived from a sequence in Table 4 by deleting, modifying and/or inserting bases in or from a sequence listed in Table 4, wherein said derived sequence comprises the same activity in kind, not necessarily in amount, of a sequence as depicted in Table 4.
  • a functional homologue is further a sequence comprising a part from two or more sequences depicted in Table 4.
  • a synthetic DNA sequence is a sequence that is not derived directly or indirectly from a sequence present in an organism. For instance a sequence comprising a drosophila scs or scs' sequence is not a synthetic sequence, even when the scs or scs' sequence was artificially generated.
  • the invention is concerned with increasing knowledge of higher order gene regulation and with means and methods for utilizing this knowledge.
  • elements such as classical promoters and enhancers
  • higher order regulatory elements that govern the gene transcription capabilities of entire chromosome regions have as yet received little attention.
  • Much of our knowledge regarding such higher order elements comes from the study of embryogenesis. During embryogenesis cells become committed to different developmental pathways. Once committed, cells rarely change their fates, even after many cell divisions.
  • chromatin DNA and associated proteins
  • Gene regulation at the chromosomal level involves modifications of DNA (e.g. methylation), histones, (e.g. acetylation and/or methylation), and long-range interactions between distant chromosomal elements.
  • the chromatin template is a highly condensed complex of DNA, histones, and non-histone proteins, which is able to package the entire genome into the nucleus and simultaneously allow the appropriate transcription of specific genes.
  • the eukaryotic chromosome is not a uniform template for the activation of gene transcription.
  • chromatin and chromatin regions can be distinguished, which differentially affect gene transcription.
  • the so-called heterochromatin regions identify 'closed' chromatin structures whereas euchromatin is associated with a more diffuse and 'open' chromatin structure.
  • the euchromatin region can be subject to structural changes, resulting in more or less condensed structures, referred to as facultative heterochromatin and euchromatin.
  • facultative heterochromatin or heterochromatin is believed to represent the underlying mechanism of chromatin-mediated gene regulation, keeping genes in an active or a repressed state, in a cell type specific manner.
  • chromatin-associated protein complexes In all eukaryotes several chromatin-associated protein complexes have been identified that are involved in the maintenance of cell type specificity, one of which is the Polycomb group (PcG) complex.
  • the PcG complex is involved in the stable repression of genes, in which changes in chromatin structure are believed to play an important role.
  • a second class of proteins named the trithorax group (TrG)
  • TrG proteins are involved in the maintenance of gene gene transcription. Based on their respective modes of action, PcG and TrG proteins therefore represent a cellular memory system that is important for the heritable transmission of gene transcription patterns. How PcG and TrG complexes are associated with their target genes is still unclear.
  • the invention provides means and methods for systematically detecting such sequences in DNA.
  • the invention provides a method for identifying a DNA sequence with a gene transcription repressing quality comprising, - providing a collection of test nucleic acids,
  • Said identified test nucleic acid comprises the capacity to repress said promoter function and thus comprises a gene transcription repressing quality.
  • said identified test nucleic acid is also retreived and cloned.
  • Said quality comprises at least in part, the capacity to reduce the level of transcription from said promoter when physically linked to said promoter, compared to the level in the absence of the DNA sequence with said quality.
  • said gene transcription repressing quality comprises a gene transcription repressing chromatin quality. I.e. wherein said reduction of the level of transcription is the result of chromatin having a gene transcription repressing configuration. This configuration preferably encompasses said promoter.
  • said configuration encompasses an enhancer or the like thereby at least in part inactivating the transcription enhancing effect of said enhancer on said promoter.
  • said DNA sequence with a gene transcription repressing chromatin quality comprises a polycomb- group-like responsive element.
  • nucleic acid sequences comprising the capacity to reduce the level of transcription from a promoter and thus nucleic acid sequences comprising a gene transcription repressing quality.
  • Sequences with analogous function can be compared with each other for sequence similarities such that one or more consensus sequences for elements with a gene transcription repressing quality such as polycomb-group-like responsive elements, can be deduced.
  • Knowledge of the occurrence and localization of DNA sequences comprising gene transcription- modulating qualities and/or gene transcription repressing qualities in the genome will greatly increase our knowledge of higher order regulation of gene transcription in the genome.
  • a Polycomb -group response element is an element that is capable of repressing the transcription from a promoter in response to the direct and/or indirect interaction of one or more Polycomb group proteins with said element.
  • a polycomb-group-like response element is a Polycomb-group response element or alternatively it is an element capable of repressing the transcription of a promoter upon the direct and/or indirect interaction of one or more proteins with said element, wherein said one or more proteins do not belong to the Polycomb-group, but wherein as a result of said interaction gene transcription repressing chromatin is formed.
  • chromatin-associated proteins such as heterochromatin proteinl (HP1) (Eisenberg et al., 1990)
  • HP1 Hexadextrin proteinl
  • MeCP2 methyl- CpG-binding protein
  • a polycomb-group-like responsive element of the invention comprises the capacity to repress transcription of a promoter over long distances, preferably over more than 2000 base pairs (van der Vlag et al., 2000).
  • test nucleic acids can be generated in many ways. Using artificial sequences as test nucleic acids it is possible to obtain a consensus sequence for a gene transcription repressing quality. Different qualities can comprise different consensus sequences. Preferably said collection is generated from chromosomal DNA. In this way a gene transcription repressing quality comprising a sequence occurring naturally in the chromosome is found. This has the advantage that the location of these qualities in the chromosome can be determined whereupon their influence on higher order gene transcription in said location can be resolved.
  • a reporter gene is a gene encoding an expression product of which the presence can be detected directly or indirectly in a cell.
  • the transfer of an expression vector into a cell will lead to expression of said reporter gene.
  • test nucleic acid comprises a gene transcription repressing quality, such as a polycomb-group-like responsive element
  • expression will be repressed in said cell thereby leading to an at least in part reduced expression of said reporter gene.
  • the presence or absence of a nucleic acid capable of repressing transcription of said promoter can thus be detected by detecting said expression product in said cell, whereby reduced detection or no detection indicates the presence of a gene transcription repressing quality.
  • a reporter gene can encode a fluorescent reporter protein.
  • Reduced expression can then be detected by fluorometric means for instance in a flow cytometer.
  • Cells displaying no or low fluorescence can be sorted using a fluorescence activated cell sorter and the expression vector and/or the test nucleic acid isolated, for instance by means of an amplification reaction.
  • said first reporter gene comprises a selectable reporter gene, the expression of which directly or indirectly provides said cell with at least a growth disadvantage over cells not expressing or expressing low levels of said first reporter gene.
  • expression of said first reporter gene is, preferably, directly or indirectly toxic to said cell.
  • Non-limiting examples of such a toxic expression product is ricin or toxic variants thereof .
  • said first reporter gene encodes an apoptosis inducing gene product.
  • said apoptosis inducing gene product comprises adenovirus 13S ElA or a functional equivalent thereof (Breckenridge and Shore, 2000).
  • said apoptosis inducing gene product comprises apoptin or a functional equivalent thereof (Pietersen and Noteborn, 2000).
  • Another example is a gene encoding a so-called suicide product such as the herpes simplex virus thymidine kinase (HSV-tk). Addition of gancyclovir to cultures of cells expressing HSV-tk will result in the formation of a toxic substance in these cells and therefore kill these cells.
  • said suicide gene comprises cytosine deaminase.
  • Cytosine deaminase converts cytosine to uracil. This enzyme activity is found in prokaryotes and lower eukaryotes, but is absent in higher eukaryotes. The gene is used as a metabolic suicide gene in combination with the prodrug 5- fluorocytosine (5-FC). Cytosine deaminase is able to convert the non-toxic 5-FC into 5-fluorouracil, which kills cells by disrupting DNA synthesis, thereby triggering apoptosis (Mullen et al., 1992; Wei and Huber, 1996).
  • a promoter controlling transcription of said first reporter gene can be any promoter that is active, or can be activated in said cells.
  • a gene transcription repressing quality such as a polycomb-group-like responsive element capable of repressing transcription of said particular promoter.
  • said promoter comprises a promoter of which the activity can be induced upon providing a cell comprising said promoter with a signal.
  • Such an inducible promoter preferably comprises a tetracycline responsive promoter. The signal here being tetracycline, doxycycline and equivalent compounds.
  • Such promoters can also be adapted for tetracycline. responsiveness in eukaryotic cells (Yin et al., 1996). Promoters and transacting molecules are available that either induce or repress expression of a gene, upon the addition of tetracycline or equivalents thereof.
  • Cells transfected with an expression vector of the invention can, with a typically low frequency and for reasons not associated with the presence of a DNA sequence with a gene transcription repressing quality, not express detectable amounts of expression product of said first reporter gene. This can for instance be due to a recombination event disrupting the coding sequence of said first reporter gene.
  • said collection of expression vectors further comprises a second reporter gene. Expression of said second reporter gene is preferably under the control of a second promoter. Methods for the detection of expression of an expression product of said second reporter gene can be used to confirm the expression repressing activity of said test nucleic acid, thereby at least in part reducing the number of cells falsely not expressing said first reporter gene.
  • said second reporter gene is used to select for cells comprising an expression cassette.
  • said expression product of said second reporter gene preferably comprises a positive dominant selectable reporter gene.
  • said positive dominant selectable reporter gene encodes an expression product capable of conferring resistance to an otherwise toxic compound.
  • Non-limiting examples ' are G418 resistance and hygromycin resistance.
  • an expression vector further comprises at least one DNA sequence with a gene transcription modulating quality, capable of counteracting transcription repressing effects of a DNA sequence with a gene transcription repressing quality.
  • the placement of said transcription counteracting element in the expression vector is preferably such that it effectively interferes with a reducing effect of said gene transcription repressing quality could have on the level of transcription of said second reporter gene.
  • said DNA sequence with a gene transcription modulating quality functionally separates the expression cassettes comprising said first and said second reporter gene.
  • said second reporter gene (and promoter controlling transcription of said second reporter gene) is flanked by DNA sequences with a gene transcription modulating quality. Examples of DNA sequences with a gene transcription modulating quality are the so-called STAR elements listed in Tables 1 and 2.
  • Methods of the invention result in the cloning and identification of a number of elements comprising a gene transcription modulating and/or a gene transcription repressing quality.
  • Such an element may contain irrelevant nucleic acid that is not instrumental in performing said quality, for instance not involved in the formation of gene-transcription repressing chromatin.
  • Functional sequences in such elements can be delineated by various methods known in the art.
  • deletions and/or substitutions are made in a DNA sequence with a gene transcription modulating or a gene transcription repressing quality.
  • DNA that is modified in such a way is tested for activity in a method of the invention. This can be done using a single modified nucleic acid or by generating a collection of test nucleic acids comprising said modified nucleic acid.
  • Elucidation of functional sequences within DNA sequences of the invention enables the elucidation of consensus sequences for elements with a gene transcription modulating and/or a gene transcription repressing quality.
  • consensus sequences for elements with a gene transcription modulating and/or a gene transcription repressing quality.
  • the invention thus further provides a library of isolated and/or recombinant nucleic acids comprising gene transcription modulating and/or gene transcription repressing qualities such as polycomb-group-like response elements.
  • said library comprises isolated and/or recombinant nucleic acids comprising the same consensus sequence. In a preferred embodiment said library comprises more than one type of consensus sequence. Said library can be used for instance for determining whether a given DNA molecule comprises a DNA modulating quality. In a preferred embodiment said library comprises essentially all elements with a gene transcription enhancing function, elements comprising a stable gene transcription quality and/or elements with a gene transcription repressing quality such as polycomb-group-like response elements, of a chromosome.
  • a person skilled in the art to generate a prediction for higher order regulation of gene expression of genes naturally present on said chromosome and for genes (foreign nucleic acid) introduced into said chromosome by recombinant means.
  • Such a prediction can be used for example to select a suitable candidate location on said chromosome for the insertion of foreign DNA.
  • a suitable location can be a location expected to be specifically expressed in a certain cell, cell type and or tissue.
  • said chromosome comprises chromosome 21 or chromosome 22.
  • all DNA sequences comprising a gene transcription modulating or a gene transcription repressing quality in a cell are in the library.
  • the entire genome can be used for the prediction of a suitable candidate location.
  • said library has been generated in different cell lines of species ranging from plants to human.
  • different proteins or protein complexes capable of interacting with DNA sequences with a gene transcription repressing quality, will be expressed, resulting in different DNA elements with a gene transcription repressing quality.
  • different proteins that interact directly or indirectly with DNA sequences comprising a gene transcription modulating quality will be expressed. Therefore the make-up of the library is cell-type dependent and dependent on the presence of the relevant proteins. This is also the case with polycomb-group-like response elements. If HPl is expressed in cell type one, elements depending on HPl will be detected by method of invention. If HPl is not expressed in cell type two, method of invention will not detect the element that has been retrieved from cell type one.
  • said library comprises at least one element capable of at least in part counteracting the formation of gene- transcription repressing chromatin.
  • knowledge of the location of DNA sequences with a gene transcription repressing quality on a chromosome or genome knowledge of the location of such counteracting elements allows more accurate prediction of higher order regulation of gene transcription of (inserted) genes in said chromosome or genome.
  • said library further comprises other transcription regulatory elements such as enhancers and silencers. Although such sequences have limited influence on higher order gene regulation, information on the location of such other sequences further increases the accuracy of the prediction on suitable locations in the genome for the expression of foreign sequences introduced therein.
  • said library comprises essentially all DNA sequences comprising a gene transcription modulating quality and/or all other regulatory sequences of a chromosome.
  • chromosome typically consists of several tens of millions of bases
  • information that the library can give on higher order gene regulation is incorporated into an at least partially automated system.
  • Another use of a library of the invention is the generation of a prediction on transcription of genes upon targeted modification of sequences on a chromosome such that "higher order" regulatory sequences are mutated. For instance, one or more polycomb-group-like responsive elements of the invention, and/or other regulatory elements on said chromosome can be mutated. This is expected to change the transcription levels of the genes that are in the vicinity of the polycomb-group-like responsive elements and/or other expression modulating elements.
  • Yet another use of a library or system of the invention is the prediction of gene expression resulting from mutations in the genome. In cases where a mutation results in altered gene transcription, detection of such altered gene transcription can indicate the presence of said naturally occurring mutation.
  • This approach is useful for instance in limiting the number of sequences or proteins to be tested in a diagnostic assay. This is particularly important in microarray approaches because in these approaches the number of expressed sequences to be tested for, is limited by the number of sequences that an array can maximally hold. With means and methods of the invention it is possible to limit the number of sequences to be tested in microarray approaches. Yet another use of a system or library of the invention is the discovery of drug targets. Regulatory elements, be they "higher order" elements or not, function because of the protein (complexes) that can bind to them. A system of the invention can be used to determine whether targeting of drugs to interfere with the binding or function of a particular' protein (complex) holds promise for the alteration of expression of a particular gene.
  • the invention further provides a DNA sequence comprising a gene- transcription repressing quality obtainable by a method of the invention.
  • said DNA sequence comprising a gene-transcription repressing quality is derived from a vertebrate of a plant. More preferably, said DNA sequence comprising a gene -transcription repressing quality comprises a sequence according to table 4 B, or a functional homologue thereof. It is also possible to provide a DNA construct with a DNA sequence of the invention, or to modify such a DNA sequence. In a preferred embodiment a DNA construct is providid comprising a promoter operably linked with a nucleic acid of interest.
  • the amount of activity of a quality of said DNA sequence with a gene transcription modulating and/or repressing quality is dependent on the orientation of said DNA sequence in said construct, compared to said promoter.
  • said gene transcription modulating and/or repressing quality is dependent on the presence of a signal.
  • said signal comprises a DNA binding protein.
  • said signal comprises a human immuno-deficiency virus TAT protein.
  • DNA sequence comprising a gene transcription modulating quality or a gene transcription repressing quality is of course the regulation of transcription of a gene of interest. Transcription of a gene of interest can be altered by altering sequences in the vicinity of said gene such that a DNA sequence with said quality is provided or removed. Specific expression characteristics can be designed by combining (parts of) DNA sequences with a gene transcription modulating and/or a gene transcription repressing quality. For instance, duplication of a sequence with a stable gene transcription quality in an expression vector will lead to improved stability of expression in a target cell or progeny upon introduction of said vector in said target cell. By combining DNA sequences with gene transcription modulating qualities altered gene transcription modulating qualities can be generated either in kind or amount or both.
  • DNA binding proteins together with other proteins and DNA sequences determine qualities of the DNA sequence. It is possible to insert one or more other protein binding DNA sequences into a DNA sequence with a quality. By allowing binding of the binding protein(s) it is possible to interfere with, or direct, the quality, thus allowing the generation of DNA sequences with designer qualities. It is of course also possible to remove protein binding sites from a DNA sequence with a particular gene transcription modulating and/or a gene transcription repressing quality thereby altering the quality of the resulting DNA sequences. The combination of addition and removal is also possible.
  • Particular gene transcription modulating and/or gene transcription repressing qualities can be selected for by tuning detection methods described in the present invention. It is for instance possible to synthesize DNA sequences with inducible gene transcription modulating and/or gene transcription repressing qualities. By for instance including TAT-binding elements in a DNA sequence comprising a gene-transcription repressing quality, it is possible to at least in part inactivate the gene-transcription repressing quality in a cell comprising TAT. Similarly there are DNA binding proteins available that only bind to their target sequence in the absence or presence of a signal.
  • Non-limiting examples of such proteins are the TET-repressor and the various mutations thereof, the lac-repressor, steroid hormone receptors, the retinoic acid receptor, and derivatives. It is possible for instance to design a DNA sequence with a cell type specific gene transcription modulating and/or gene transcription repressing quality. For instance, in case of the above mentioned TAT example.
  • the referred to DNA sequence can be made specific for HIV infected cells that express TAT.
  • the DNA sequence can be made specific for a protien complex that is expressed in a cell type specific fashion.
  • Expression constructs comprising a DNA sequence comprising a gene transcription modulating and/or gene transcription repressing quality are suitable for obtaining expression from said construct in cells comprising more than one copy of said expression construct. Also when the expression construct is present in the genome of said cell and, also when the expression cassette is present in more than one copy in said cell. Moreover, they even work when integrated into the same position in more than one copy.
  • said DNA sequence with a gene transcription modulating quality comprises a so-called STAR (Stabilizing Anti-Repression) sequence.
  • a STAR sequence as used herein refers to a DNA sequence comprising one or more of the mentioned gene transcription modulating qualities.
  • sequence identifiers can be extracted from a family of DNA sequences sharing a certain common feature. Such sequence identifiers can subsequently be used to identify sequences that share one or more identifiers. Sequences sharing such one or more identifiers are likely to be a member of the same family of sequences, i.e are likely to share the common feature of the family. In the present application a large number of sequences comprising STAR activity (so-called STAR sequences) were used to obtain sequence identifiers ( patterns) which are characteristic for sequences comprising STAR activity. These patterns can be used to determine whether a test sequence is likely to contain STAR activity.
  • STAR sequences sequence identifiers
  • the invention thus provides a method for detecting the presence of a STAR sequence within a nucleic acid sequence of about 50-5000 base pairs, comprising determining the frequency of occurrence in said sequence of at least one sequence pattern and determining that said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least one sequence comprising a STAR sequence.
  • any method is suited for determining whether a sequence pattern is representative of a STAR sequence. Many different methods are available in the art.
  • the step of determining that said occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least one sequence comprising a STAR sequence comprises, determining that the frequency of occurrence of said at least one sequence pattern significantly differs between said at least one STAR sequence and at least one control sequence. In principle any significant difference is discriminative for the presence of a STAR sequence. However, in a particularly preferred embodiment the frequency of occurrence of said at least one sequence pattern is significantly higher in said at least one sequence comprising a STAR sequence compared to said at least one control sequence.
  • a considerable number of sequences comprising a STAR sequence have been identified in the present invention. It is possible to use these sequences to test how efficient a pattern is in discriminating between a control sequence and a sequence comprising a STAR sequence. Using so-called discriminant analysis it is possible to determine on the basis of any set of STAR sequences in a species, the most optimal discriminative sequence patterns or combination thereof. Thus, preferably, at least one of said patterns is selected on the basis of a desired, and preferably an optimal discrimination between said at least one sequence comprising a STAR sequence and a control sequence. A desired discrimination can be a certain significance factor associated with the pattern through bioinformatics.
  • the frequency of occurrence of a sequence pattern in a test nucleic acid is compared with the frequency of occurrence in a sequence known to contain a STAR sequence.
  • a pattern is considered representative for a sequence comprising a STAR sequence if the frequencies of occurrence are similar.
  • another criterion is used.
  • the frequency of occurrence of a pattern in a sequence comprising a STAR sequence is compared to the frequency of occurrence of said pattern in a control sequence.
  • a sequence pattern is considered to be representative of a sequence comprising a STAR sequence, if the frequency of occurrence of the pattern in at least one sequence comprising a STAR sequence is significantly different from the frequency of occurrence of the same pattern in a control sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 2 sequences comprising a STAR sequence, more preferably in at least 5 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 20 sequences comprising a STAR sequence. In a particularly preferred embodiment said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 50 sequences comprising a STAR sequence.
  • the patterns that are indicative for a sequence comprising a STAR sequence are also dependent on the type of control nucleic acid used. The type of control sequence used is preferably selected on the basis of the sequence in which the presence of a STAR sequence is to be detected. In a preferred embodiment said control sequence comprises a random sequence comprising a similar AT/CG content as said at least one sequence comprising a STAR sequence.
  • control sequence is derived from the same species as said sequence comprising said STAR sequence. For instance, if a test sequence is scrutinized for the presence of a STAR sequence, active in a plant cell, then preferably the control sequence is also derived from a plant cell. Similarly, for testing for STAR activity in a human cell, the control nucleic acid is preferably also derived from a human genome. In a preferred embodiment the control sequence comprises between 50% and 150% of the bases of said at least one sequence comprising a STAR sequence. In a particularly preferred embodiment said control sequence comprises between 90% and 110% of the bases of said at least one sequence comprising a STAR sequence. More preferably, between 95% and 105%.
  • a pattern can comprise any number of bases larger than two.
  • at least one sequence pattern comprises at least 5, more preferably at least 6 bases.
  • at least one sequence pattern comprises at least 8 bases.
  • said at least one sequence pattern comprises a pattern listed in table 9 and/or table 10.
  • a pattern may consist of a consecutive list of bases. However, the pattern may also comprise bases that are interrupted one or more times by a number of bases that are not or only partly discriminative. A partly discriminative base is for instance indicated as a p urine.
  • the presence of STAR activity is verified using a functional assay.
  • a sequence comprises STAR activity.
  • STAR activity is confirmed if the sequence is capable of performing at least one of the following functions: (i) at least in part inhibiting the effect of sequence comprising a gene transcription repressing element of the invention, (ii) at least in part blocking chromatin-associated repression, (iii) at least in part blocking activity of an enhancer, (iv) conferring upon an operably linked nucleic acid encoding a transcription unit compared to the same nucleic acid alone, (iv-a) a higher predictability of transcription, (iv- b) a higher transcription, and/or (iv-c) a higher stability of transcription over time.
  • sequences comprising STAR activity identified in the present invention opens up a wide variety of possibilities to generate and identify sequences comprising the same activity in kind not necessarily in amount. For instance, it is well within the reach of a skilled person to alter the sequences identified in the present invention and test the altered sequences for STAR activity. Such altered sequences are therefore also part of the present invention. Alteration can include deletion, insertion and mutation of one or more bases in the sequences.
  • Sequences comprising STAR activity were identified in stretches of 400 bases. However, it is expected that not all of these 400 bases are required to retain STAR activity. Methods to delimit the sequences that confer a certain property to a fragment of between 400 and 5000 bases are well known. The minimal sequence length of a fragment comprising STAR activity is estimated to be about 50 bases.
  • Table 9 and table 10 list patterns of 6 bases that have been found to be over represented in nucleic acid molecules comprising STAR activity. This over representation is considered to be representative for a STAR sequence.
  • the tables were generated for a family of 65 STAR sequences. Similar tables can be generated starting from a different set of STAR sequences, or from a smaller or larger set of STAR sequences.
  • a pattern is representative for a STAR sequence if it is over represented in said STAR sequence compared to a sequence not comprising a STAR element. This can be a random sequence. However, to exclude a non relevant bias, the sequence comprising a STAR sequence is preferably compared to a genome or a significant part thereof.
  • a genome of a vertebrate or plant more preferably a human genome.
  • a significant part of a genome is for instance a chromosome.
  • the sequence comprising a STAR sequence and said control sequence are derived from nucleic acid of the same species.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 2 sequences comprising a STAR sequence, more preferably in at least 5 sequences comprising a STAR sequence. More preferably in at least 10 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 20 sequences comprising a STAR sequence.
  • said frequency of occurrence is representative of the frequency of occurrence of said at least one sequence pattern in at least 50 sequences comprising a STAR.
  • said sequences comprising a STAR sequence comprises at least one of the sequences depicted in figure 26.
  • STAR activity is feature shared by the sequences listed in figure 26. However, this does not mean that they must all share the same identifier sequence. It is very well possible that different identifiers exist. Identifiers may confer this common feature onto a fragment containing it, though this is not necessarily so.
  • At least one of said sequence patterns for detecting a STAR sequence comprises a sequence pattern GGACCC, CCCTGC, AAGCCC, CCCCCA and/or AGCACC.
  • at least one of said sequence patterns for detecting a STAR sequence comprises a sequence pattern CCCN ⁇ 16 ⁇ AGC, GGCN ⁇ 9 ⁇ GAC, CACN ⁇ 13 ⁇ AGG, CTGN ⁇ 4 ⁇ GCC.
  • a list of STAR sequences can also be used to determine one or more consensus sequences therein.
  • the invention therefore also provides a consensus sequence for a STAR element. This consensus sequence can of course be used to identify candidate STAR elements in a test sequence.
  • sequences comprising a STAR element can be used by means of sequence homology to identify sequences comprising a STAR element in other species belonging to vertebrate.
  • a mammalian STAR sequence is used to screen for STAR sequences in other mammalian species.
  • STAR sequence has been identified in a plant species it can be used to screen for homologous sequences with similar function in other plant species.
  • the invention in one aspect provides a STAR sequence obtainable by a method according to the invention. Further provided is a collection of STAR sequences.
  • said STAR sequence is a vertebrate or plant STAR sequence.
  • said STAR sequence is a mammalian STAR sequence or an angiosperm (monocot, such as rice or dicot such as Arabidopsis). More preferably, said STAR sequence is a primate and/or human STAR sequence.
  • a list of sequences comprising STAR activity can be used to determine whether a test sequence comprises a STAR element.
  • the invention provides a method for determining whether a nucleic acid sequence of about 50-5000 base pairs comprises a STAR sequence said method comprising, generating a first table of sequence patterns comprising the frequency of occurrence of said patterns in a collection of STAR sequences of the invention, generating a second table of said patterns comprising the frequency of occurrence of said patterns in at least one reference sequence, selecting at least one pattern of which said frequency of occurrence differs between the two tables, determining, within said nucleic acid sequence of about 50-5000 base pairs, the frequency of occurrence of at least one of said selected patterns, and determining whether the occurrence in said test nucleic acid is representative of the occurrence of said selected pattern in said collection of STAR sequences.
  • said determining comprises determining whether the frequency of occurrence in said test nucleic acid is representative of the frequency of occurrence of said selected pattern in said collection of STAR sequences.
  • said method further comprises determining whether said candidate STAR comprises a gene transcription modulating quality using a method of the invention.
  • said collection of STARS comprises sequence as depicted in figure 26.
  • the invention provides an isolated and/or recombinant nucleic acid sequence comprising a STAR sequence obtainable by a method of the invention.
  • a STAR sequence can exert its activity in a directional way, i.e. more to one side of the fragment containing it than to the other.
  • STAR activity can be amplified in amount by multiplying the number of STAR elements. The latter suggests that a STAR element may comprise one or more elements comprising STAR activity.
  • Another way of identifying a sequence capable of conferring STAR activity on a fragment containing it comprises selecting from a vertebrate or plant sequence, a sequence comprising STAR activity and identifying whether sequences flanking the selected sequence are conserved in another species.
  • the invention therefore provides a method for identifying a sequence comprising a STAR element comprising selecting a sequence of about 50 to 5000 base pairs from a vertebrate or plant species comprising a STAR element and identifying whether sequences flanking said selected sequence in said species are conserved in at least one other species.
  • the invention therefore further provides a method for detecting the presence of a STAR sequence within a nucleic acid sequence of about 50-5000 base pairs, comprising identifying a sequence comprising a STAR sequence in a part of a chromosome of a cell of a species and detecting significant homology between said sequence and a sequence of a chromosome of a different species.
  • said species comprises a plant or vertebrate species, preferably a mammalian species.
  • the invention also provides a method for detecting the presence of a STAR element within a nucleic acid sequence of about 50-5000 base pairs of a vertebrate or plant species, comprising identifying whether a flanking sequence of said nucleic acid sequence is conserved in at least one other species.
  • the term quality in relation to a sequence refers to an activity of said sequence.
  • SINC or SINC element as listed below refers to a DNA sequence comprising one or more of the mentioned gene transcription repressing qualities.
  • the term "DNA sequence” as used herein does, unless otherwise specified, not refer to a listing of specific ordering of bases but rather to a physical piece of DNA.
  • a transcription quality with reference to a DNA sequence refers to an effect that said DNA sequence has on transcription of a gene of interest.
  • “Quality” as used herein refers to detectable properties or attributes of a nucleic acid or protein in a transcription system.
  • the selection vector for STAR elements pSelect-SV40- zeo ("pSelect", Figure 1) is constructed as follows: the pREP4 vector
  • the vector contains four consecutive LexA operator sites between Xbal and Nhel restriction sites (Bunker and Singer, 1994).
  • a polylinker consisting of the following restriction sites: H dlll- Ascl-BamHl-Ascl-Hin ⁇ UI.
  • H dlll- Ascl-BamHl-Ascl-Hin ⁇ UI a restriction site between the iVTiel site and a Sail site.
  • zeocin resistance gene with the SV40 promoter and polyadenylation site, derived from pSV40/Zeo (Invitrogen V502-20); this is the selectable marker for the STAR screen.
  • the pSDH vector ( Figure 2) is constructed as follows: The luciferase reporter gene from pGL3-Control (Promega E1741) is amplified by PCR and inserted into S ⁇ cII B ⁇ mHI-digested pUHD10-3 (Gossen and Bujard, 1992). This places luciferase under control of the Tet-Off promoter, and upstream of the SV40 polyadenylation signal. Multiple cloning sites are introduced by PCR, upstream of the Tet-Off promoter (MCSI, XhoI-Notl-Eco ⁇ l-Sal ⁇ ) and downstream of the polyadenylation signal (MCSII, Nhel-Bglll- EcoRY- Malawi! .
  • MCSI Tet-Off promoter
  • MCSII XhoI-Notl-Eco ⁇ l-Sal ⁇
  • Gene libraries are constructed by SauSAI digestion of human genomic DNA, either purified from placenta (Clontech 6550-1) or carried in bacterial/Pi (BAC/PAC) artificial chromosomes.
  • the BAC/PAC clones contain genomic DNA from the lql2 cytogenetic region (clones RP1154H19 and RP3328E19) or from the HOX cluster of homeotic genes (clones RP1167F23, RP1170019, and RP11387A1).
  • the DNAs are size-fractionated, and the 0.5 - 2 kb size fraction is ligated into .B ⁇ m-HI-digested pSelect vector, by standard techniques (Sambrook et al., 1989).
  • the construction of the host strains has been described (van der Vlag et al., 2000). Briefly, they are based on the U-2 OS human osteosarcoma cell line
  • U-2 OS is stably transfected with the pTet-Off plasmid (Clontech K1620-A), encoding a protein chimera consisting of the Tet-repressor DNA binding domain and the VP16 transactivation domain.
  • the cell line is subsequently stably transfected with fusion protein genes containing the LexA DNA binding domain, and the coding regions of either HPl or HPC2 (two Drosophila Polycomb group proteins that repress gene expression when tethered to DNA).
  • the LexA-repressor genes are under control of the Tet-Off transcriptional regulatory system (Gossen and Bujard, 1992). Library screening and STAR element characterization.
  • the gene libraries in pSelect are transfected into the U-2 OS/Tet-Off/LexA-repressor cell line by calcium phosphate precipitation (Graham and van der Eb, 1973; Wigler et al., 1978) as recommended by the supplier of the transfection reagent (Life Technologies).
  • Transfected cells are cultured under hygromycin selection (25 ⁇ g/ml) and tetracycline repression (doxycycline, 10 ng/ml) for 1 week (50% confluence). Then the doxycycline concentration is reduced to 0.1 ng/ml to induce the LexA-repressor genes, and after 2 days zeocin is added to 250 ⁇ g/ml.
  • the cells are cultured for a further 4-5 weeks, until the control cultures (transfected with empty pSelect) are killed by the zeocin.
  • Zeocin-resistant colonies from the library transfection are propagated, and plasmid DNA is isolated and rescued into E. coli by standard techniques (Sambrook et al., 1989).
  • the candidate STAR elements in the rescued DNA are analyzed by restriction endonuclease mapping (Sambrook et al., 1989), DNA sequence analysis (Sanger et al., 1977), and for STAR activity (zeocin resistance) after re-transfection to U-2 OS/Tet-Off/LexA-repressor and lowering the doxycycline concentration.
  • Candidate STAR elements that have DNA sequence corresponding to known sequence in the human genome are identified by BLAST searches (Altschul et al., 1990) of the human genome database (http://www.ncbi.nlm.nih.gov/genome/seq/HsBlast.html 20 June 2001). The chromosomal locations of the elements are recorded, along with the proportion of repetitive DNA and the identity of adjacent genes. Those candidates that show STAR activity upon re-transfection are characterized further by subcloning the STAR fragment into the pSDH plasmid and stable integration in U-2 OS chromosomal DNA.
  • pSDH plasmids are co-transfected into U-2 OS cells with pBABE-puro (Morgenstern and Land, 1990), and selected for puromycin resistance.
  • Per STAR element populations of approximately 30 individual clones are isolated and cultured. The clones are periodically assayed for luciferase activity according to the manufacturer's instructions (Roche 1669893). Results
  • STAR element functional characterization The screens of human genomic DNA and of the HOX and lql2 loci yielded 17 bona fide STAR elements.
  • the criteria are that (1) the elements displayed STAR activity upon re-transfection of the pSelect-based clones into the host U-2 OS human osteosarcoma cell line (indicating that the anti-repressor activity expressed in the initial screen is plasmid-specific and not due to artefactual changes in the host cells); (2) the elements contain DNA sequence that matches sequence in the human genome sequence database (indicating that the clone does not contain contaminating DNA sequence, from e.g. bacterial or vector sources).
  • the STAR elements are sub-cloned into the pSDH plasmid and integrated into the host cell genome. Expression of the reporter genes is assayed in populations of stable transfectants to demonstrate the ability of the STAR elements to protect reporter genes from silencing after integration at random into the genome. This provides information (1) on the proportion of clones which display high expression, and (2) on the degree of over-expression elicited by the STAR elements.
  • Expression of the luciferase reporter gene by a clone is considered significant if it is two-fold above the average level for the plasmids containing no STAR elements (the reference level). For all plasmids a distribution in expression level is observed among the clones: from no expression to expression significantly above the reference level, and from few over-expressers to many over-expressers. Superior STAR activity is manifested by plasmids that result in many over-expressing clones, including some highly over-expressing clones. Results from a representative experiment are shown in Table 1, and in Figures 3 - 5:
  • the plasmid for the SINC screen, pSINC-Select (“pSS", Figure 6) is constructed as follows: the pREP4 vector (Invitrogen V004-50) is used as the plasmid backbone. It provides the Epstein Barr oriP origin of replication and EBNA-1 nuclear antigen for high-copy episomal replication in primate cell lines; the hygromycin resistance gene with the thymidine kinase promoter and polyadenylation site, for selection in mammalian cells; and the ampicillin resistance gene and colEl origin of replication for maintenance in Escherichia coli.
  • the pREP4 vector Invitrogen V004-50
  • EBNA-1 nuclear antigen for high-copy episomal replication in primate cell lines
  • the hygromycin resistance gene with the thymidine kinase promoter and polyadenylation site for selection in mammalian cells
  • the ampicillin resistance gene and colEl origin of replication for maintenance in Escherichia
  • the vector contains a Tet-Off promoter, consisting of tandem Tet Responsive Elements (TREs) from plasmid pUDHlO-3 (Gossen and Bujard, 1992), for regulation by the Tet-Off transcriptional regulatory system.
  • the TREs regulate expression of the codA::upp gene encoding a fusion protein (cyotsine deaminase/uracil phosphoribosyltransferase; Invivogen porf- codaupp).
  • the pREP4 DNA is separated from the genomic DNA and suicide gene by STAR elements in order to prevent silencing of essential plasmid elements in the pREP4 component by cloned SINC elements.
  • Genomic DNA from a library of BAG clones comprising human chromosome 22 is partially digested with SauSA ⁇ and ligated into Bg/ ⁇ -digested pSS (Sambrook et al., 1989).
  • the library of recombinant plasmids is transfected into the U-2 OS/Tet-Off cell line by calcium phosphate precipitation (Graham and van der Eb, 1973; Wigler et al., 1978) as recommended by the supplier of the transfection reagent (Life Technologies).
  • Transfected cells are cultured under hygromycin selection (25 ⁇ g/ml) and tetracycline repression (doxycycline, 10 ng/ml) for 3 weeks. Then 5- FC is added to a concentration of 1 ⁇ g/ml and the cells are cultured for a further 3 weeks to select for SINC elements.
  • Candidate SINC-containing colonies are harvested and used in a polymerase chain reaction with primers PCR1 and PCR2 ( Figure 6); the PCR products are digested with Hwidlll and Xhol restriction endonucleases and cloned into pBluescript II SK(+) (Stratagene 212207) by conventional techniques
  • the elements are recovered by PCR and subcloned into a standard cloning vector, pBluescript.
  • the DNA sequences of the elements are determined, and compared with the human genome sequence (Table 3). In all cases, the sequenced elements are found on chromosome 22, as expected.
  • Example 2 Expression characteristics of the transgene that are due to the STAR, the SINC, or the combined STAR/SINC.
  • the activity of the recombinase then catalyzes the precise excision of the DNA region from the chromosome.
  • the recombinase resolves its two recognition sequences to a single site, deleting the sequence between them. Thus, a span of DNA must be flanked by target sites to be subsequently deleted in vivo upon introduction or activation of recombinase (Schwenk et al., 1995; Dymecki, 1996).
  • the Cre and Flp recombinases catalyze recombination between two 13-base-pair inverted repeats, separated by a spacer with a minimum of 6 (loxP) or 8 (FRT) base pairs (Senecoff et al., 1985).
  • the loxP sequence is ATAACTTCGTATA and the FRT sequence is GAAGTTCCTATAC.
  • a reporter gene encoding a reporter protein, for example green fluorescent protein (GFP) (Bierhuizen et al., 1997) or luciferase (Himes and Shannon, 2000) is constructed that is flanked in a plasmid by a pair of STAR elements, by a pair of SINC elements, or by a pair of STAR/SINC combination elements.
  • GFP green fluorescent protein
  • the elements are themselves flanked by recombinase target sites.
  • One element is flanked by a pair of loxP sites, and the other is flanked by a pair of FRT sites ( Figure 1).
  • the plasmid integrates into the host chromosome in a small percentage of cells, and the integrants are selected by antibiotic resistance. Similar constructs are made for each of the three test elements (STAR, SINC, STAR/SINC).
  • these plasmids are transfected into the U-2 OS human osteosarcoma cell line, and selected for hygromycin resistance.
  • Hygromycin-resistant isolates have the plasmid stably integrated in the genome of the cell line.
  • Individual isolates are propagated in cell culture medium, and the expression of the transgenic reporter gene is assayed, for example by flow cytometry (Stull et al., 2000). Then using conventional techniques (transfection, or hormone stimulation), the stable isolates from above are treated so as to introduce or activate recombinase activity.
  • DNA fragments containing STAR or SINC elements are isolated by genetic selection using the pSelect ( Figure 1) or pSS ( Figure 6) plasmids, respectively. This section describes the approach to characterize the DNA sequences within those fragments that have STAR or SINC activity. Protocols:
  • Oligonucleotides are designed based on the sequence of the pSelect and pSS selection plasmids for sequencing the DNA fragments. The fragments are sequenced using the dideoxy chain termination technique
  • STAR or SINC elements are truncated and tested for functionality. This is done using the polymerase chain reaction (PCR) to clone sub-fragments of the STAR- or SINC- containing fragments into pSelect or pSS by standard techniques (Sambrook et al., 1989). The plasmids containing the sub-fragments are transfected into U-2 OS cells and tested for functionality by assaying for antibiotic resistance (STAR elements) or pro-drug resistance (SINC elements).
  • PCR polymerase chain reaction
  • the STAR and SINC elements are tested for their directionality using the pSelect and pSS plasmids, respectively.
  • the direction of STAR elements isolated by the pSelect screen is referred to as 5'3' orientation.
  • the orientation of the element is reversed by conventional recombinant DNA techniques (Sambrook et al., 1989).
  • the resulting plasmids are transfected into the U-2 OS cell line and expression of the reporter gene is assayed (Bierhuizen et al., 1997; Himes and Shannon, 2000).
  • the level of expression from the plasmid with the reverse -orientation element is compared to that with the 5'3' orientation. If the reverse-orientation plasmid has similar expression levels, then the STAR element does not display directionality.
  • Combinations and multiples of elements To determine whether STAR elements are able to function in mixed pairs, different elements are combined and tested. The analysis is performed in the pSDH plasmid by inserting one STAR element in MCSI and a different STAR in MCSII by recombinant DNA techniques (Sambrook et al., 1989). The resulting plasmids are transfected, and the expression of the reporter gene is assayed (Bierhuizen et al., 1997; Himes and Shannon, 2000); the results are compared with the expression from plasmids containing the same element at MCSI and MCSII; if the expression is similar for the two types of plasmids, then it is concluded that different STAR elements do not interfere with each other.
  • the strength of single STAR or SINC elements is compared with tandem repeats of elements. This is done by concatamerization of the STAR or SINC elements of interest with DNA ligase and insertion of the ligation product into the pSDH or pSS plasmids by recombinant DNA techniques (Sambrook et al., 1989). The resulting plasmids are transfected into U-2 OS cells, and the expression of the reporter gene is assayed (Bierhuizen et al., 1997; Himes and Shannon, 2000); the results are compared with the expression from plasmids containing single STAR or SINC elements.
  • Example 4 Determination of the distance over which a STAR, a SINC, or a combination thereof functions.
  • STAR elements are used to optimize expression of single and multiple transgenes. To determine if a single pair of STAR elements can protect large or multiple transgenes from silencing it is necessary to determine the range over which STAR elements act. Similar information is determined for SINC elements and STAR/SINC combinations.
  • STAR and SINC elements are tested for their functionality over distance using derivative plasmids based on pSelect or pSS respectively, as follows.
  • a library of random DNA fragments from 500bp to lOkb is assembled by standard DNA cloning techniques (Sambrook et al., 1989). Fragments are selected from this library that do not possess STAR or SINC activity, by testing in the pSelect and pSS plasmids as described above.
  • STAR elements and STAR/SINC combinations these fragments are inserted between the cloning site and the promoter of the reporter gene in the appropriate pSelect plasmid ( Figure 1).
  • This set of plasmids is transfected into the U-2 OS cell line, and expression measured as described above.
  • the strength of reporter gene expression is correlated with the length of the random DNA fragment separating the STAR element from the promoter.
  • SINC elements are assessed in an analogous fashion: random DNA fragments are inserted between the SINC element and the promoter of the appropriate pSS plasmid, and the degree of repression of the reporter gene is correlated with the length of the random DNA fragment.
  • Example 5 Use of a naturally occurring SINC element ' in the genetic selection for STAR elements.
  • STAR elements use chimeric lexA-PcG proteins to provide repression of the selectable marker in the selection plasmid.
  • STAR elements are identified that are specific to the repressive activity due to these naturally occurring SINC elements.
  • the SINC element screen is based on the ability of genetic selection to identify randomly generated fragments of genomic DNA that are able to silence a "tet- off" promoter and block the expression of the codA::upp suicide gene.
  • the SINC elements recovered from this selection represent a random sampling of genomic silencing elements, and different classes of elements are recovered. For this protocol, these diverse SINC elements are used to recover different classes of STAR elements than those recovered in the aforementioned lexA- PcG based selections. Protocol: SINC elements from the current selection are characterized and sorted into classes on the basis of of functional and DNA sequence features (functional features include strength of repression; sequence features include identifiable conserved motifs; see example 3).
  • Representative elements from each class are used to replace the lexA binding sites in the pSelect plasmid via standard DNA cloning techniques (Sambrook et al., 1989).
  • a gene bank is made with each of these new plasmids, and used to identify new, SINC-specific STAR elements as described (van der Vlag et al., 2000). This is done with whole genomic DNA, and with DNA from the BAG clone that also contains the SINC element being used.
  • STAR elements are cloned as fragments of DNA recovered using the pSelect plasmid, which is done with genomic DNA fragments less than 2 kb. However, these might be portions of a more extended STAR element. Extended STAR activity is examined by the following experiments. Protocol: STAR elements cloned in pSelect are mapped to the human genome sequence. In order to determine if they are portions of a more extended STAR element, regions of 4 kb that encompass the clones are amplified by PCR and cloned into the pSelect and/or pSDH plasmid by standard recombinant DNA techniques (Sambrook et al., 1989).
  • the resulting plasmids are transfected into U-2 OS cells and assayed for reporter gene expression as described above; plasmids containing the original 2 kb STAR element are included as a control.
  • Three possible results can be expected: (1) similar expression by the control and extended STAR isolates, demonstrating that the STAR element is confined to the original 2 kb fragment; (2) lower expression by the extended STAR isolates, suggesting that the STAR element is contained within the 2 kb fragment and does not act effectively over a distance or that the extended fragment contains a SINC element; (3) higher expression by the extended
  • STAR isolates suggesting that the extended region contains a more complete STAR element.
  • the exercise is reiterated with a larger PCR fragment of 6 kb.
  • a STAR element may also be a composite of sites to which various proteins bind. Therefore large DNA fragments with STAR activity could be divisible into smaller fragments with STAR activity (see example 3).
  • Elements that are greater than 2 kb are recognized as STAR elements if they still display STAR activity after truncation to less than 2 kb (including by internal deletion).
  • Example 6 Methylation and histone acetylation states of STAR elements, SINC elements, or combinations thereof and of the adjacent transgenes.
  • STAR and SINC elements are associated with the local chromatin structure, which is determined by the DNA itself and by DNA-associated proteins. Changes in chromatin structure that are associated with changes in gene expression are often produced by secondary modifications of the macromolecules, especially methylation of DNA or acetylation of histone proteins. Identifying the secondary modifications occurring at STAR and SINC elements and at adjacent transgenes provides hallmarks for these elements.
  • DNA methylation STAR or SINC elements or combinations thereof are cloned into the pSelect plasmid by standard techniques (Sambrook et al., 1989).
  • U-2 OS cells are stably transfected with these plasmids, and with pSelect lacking a STAR or SINC element as a control to determine basal DNA methylation at the reporter gene.
  • Cells are harvested and the chromatin purified by standard procedures (Thomas, 1998).
  • the DNA is digested with the Hpall and Mspl restriction endonucleases in separate reactions (Sambrook et al., 1989). Both of these restriction enzymes are able to cut the non-methylated sequence CCGG.
  • both Mspl and Hp ll cannot cleave.
  • Mspl can cleave the sequence when the internal C is methylated.
  • the DNA is subjected to Southern blotting and the blot is analyzed by indirect end-labeling (Pazin and Kadonaga, 1998).
  • the corresponding pSelect plasmid as naked, unmethylated DNA is also cut with the described enzymes and subjected to Southern blotting. Comparison of the different sizes of the DNA fragments reveals whether the DNA is methylated in vivo or not.
  • Histone acetylation The same transfected cell lines used for DNA methylation analysis are used for these experiments. The method described below yields a high resolution map of the histone acetylation pattern on the STAR and SINC elements and the reporter gene (Litt et al., 2001). Micrococcal nuclease digests of nuclei are fractionated on sucrose gradients, and purified nucleosome monomers and dimers are enriched for acetylated histones by immunoprecipitation with anti-acetylhistone antibodies.
  • the nucleosome fraction and immunoprecipitates are subjected to analysis, for example by real-time PCR (Jung et al., 2000) using primers and a Taqman probe that anneal to the reporter gene or to the STAR or SINC element to yield 0.2 kb products, with a moving window of 0.1 kb.
  • the rate of increase of the Taqman probe fluorescent signal during the PCR (which is proportional to the abundance of the template DNA in the sample) is then measured.
  • the ratio of the abundance of the template DNA in the nucleosome fraction and the immunoprecipitates provides a fine-map of the pattern of histone acetylation for each 0.1 kb on the reporter gene and STAR or SINC element (or on the reporter gene in the absence of an element).
  • Chromatin is comprised of DNA, histones, and non-histone proteins.
  • the histones form a core particle that is wrapped by ⁇ 150 bp of DNA to make a nucleosome.
  • Nucleosomes are separated by 50-75 bp of linker DNA.
  • Stably positioned nucleosomes on chromosomal DNA repress gene expression, and factors that exclude nucleosomes or otherwise remodel chromatin can overcome this repression.
  • the positioning of nucleosomes in a chromosomal region is analyzed by micrococcal nuclease (MNase) assay; MNase cuts chromatin preferentially in the linker DNA.
  • MNase micrococcal nuclease
  • MNase Protocol To determine the position of nucleosomes on the reporter gene and on either the STAR or SINC elements, MNase is used (Saluz and Jost, 1993). Nuclei are purified from cultured U-2 OS cells and digested with MNase as described above (histone acetylation). To search for DNase I hypersensitive sites in the STAR and SINC elements or the reporter gene, purified nuclei are treated with DNase I at an appropriate concentration (e.g. 100 ⁇ g/ml genomic DNA and 20-100 U/ml DNasel), as described (Wallrath et al., 1998). Naked DNA is digested with DNase I as a control.
  • an appropriate concentration e.g. 100 ⁇ g/ml genomic DNA and 20-100 U/ml DNasel
  • the reporter gene and STAR or SINC elements are fine-mapped using primer extension or indirect end-labelling and Southern blotting, as described (Tanaka et al., 1996; van der Vlag et al., 2000).
  • the MNase assay reveals a ladder of discrete bands on an autoradiogram corresponding to the positions of nucleosomes on the STAR or SINC elements or the reporter gene. DNase I hypersensitive sites are manifested as discrete bands in the resulting autoradiogram that are absent or less prominent in the naked DNA control.
  • Example 8 Cell-type, tissue dependence, and promoter dependence of STAR and SINC elements.
  • insulators or boundary elements may display tissue specificity (Takada et al., 2000).
  • STAR elements have many features in common with insulators and boundary elements. Both promiscuous and tissue-specific STAR and SINC elements have biotechnological value in transgenic applications.
  • the assay described below is performed to assess cell- type dependence. Cell and tissue specificity of the elements are examined further by examining the expression of genes in the vicinity of the elements in the human genome, using public databases of DNA microarray (http://arrays.rockefeller.edu/xenopus/links.html) and SAGE (Serial Analysis of Gene Expression; http://bioinfo.amc.uva.nl/HTM-bin/index.cgi) data.
  • Promoter specficity STAR and SINC elements are currently selected and tested in the context of function with two promoters, the entire cytomegalovirus (CMV) promoter or the Tetracycline Response Element and minimal CMV promoter (in combination with the tTA transcriptional activator).
  • CMV cytomegalovirus
  • TMV Tetracycline Response Element
  • minimal CMV promoter in combination with the tTA transcriptional activator.
  • STAR and SINC function are tested with other commonly used viral promoters, namely the simian virus type 40 (SV40) early and late promoters, the adenoviral E1A and major late promoters, and the Rous sarcoma virus (RSV) long terminal repeat (Doll et al., 1996; Smith et al., 2000; Weaver and Kadan, 2000; Xu et al., 1995).
  • SV40 simian virus type 40
  • RSV Rous sarcoma virus
  • Each of these promoters are cloned separately into the pSelect and pSS plasmids by standard techniques (Sambrook et al., 1989) along with STAR or SINC elements, respectively.
  • the resulting plasmids are transfected into the U-2 OS cell line and assayed for reporter gene expression, as described above.
  • the ability of SINC elements to silence these promoters, or STAR elements to protect against silencing, is determined by comparison with plasmids lacking STAR or SINC elements.
  • Example 9 Methods for improvement of STAR and SINC elements
  • Error prone PCR (Cherry et al., 1999; Henke and Bornscheuer, 1999) is used to introduce an average of one to two point mutations per element.
  • the mutagenized elements are screened using pSelect (or pSS) plasmids containing reporter-selectable marker fusion proteins by for example fluorescence activated cell sorting and antibiotic resistance (Bennett et al., 1998). Subsequent rounds of error prone PCR and selection are carried out to derive elements with further improvements in activity. Tandem and heterologous combinations: As described above, tandem and heterologous combinations of elements are tested for activity in comparison with the single elements (example 3).
  • the relative dominance of STAR and SINC elements is tested on a case by case basis. It is used to test the strength of an element; for example, if a new STAR element is dominant to a known, strong SINC element, then the STAR is classified as very strong.
  • the possibility that the dominance relationship between a STAR and a SINC is cell type-, tissue-, or promoter-specific is also considered (example 8).
  • the dominance test utilizes the pSelect plasmid, with individual SINC elements placed upstream of individual STAR elements by standard recombinant DNA techniques (Sambrook et al., 1989). The plasmids are transfected to U-2 OS cells and reporter gene expression is assayed.
  • SINC dominance is manifested by lower expression than the plasmid with only a STAR element, while STAR dominance is manifested by higher expression than the plasmid with only a SINC element.
  • GRE glucocorticoid response element
  • glucocorticoid receptor Upon stimulation, the naturally occurring glucocorticoid receptor binds to the GRE and interferes with STAR or SINC function.
  • Protocol Using conventional DNA cloning (Sambrook et al., 1989), a GRE is introduced into the pSelect or pSS vector adjacent to STAR or SINC elements, respectively. The plasmid is transfected into U-2 OS cells as described above. Cells are divided into two cultures; one is treated with glucocorticoid (10 ⁇ M). Expression of the reporter gene is measured and compared between the two cultures. Differences in expression demonstrate the ability to regulate STAR and SINC function by action of a signal-dependent DNA-binding protein.
  • Promiscuous STAR and SINC elements Testing or enhancing these characteristics involves cultivation in different cell lines, and long term cultivation without antibiotic selection (examples 8 and 10).
  • Example 10 STAR and SINC elements obviate the need for continuous selection for maintenance of the transgene.
  • STAR elements function to block the effect of transcriptional repression influences on transgene expression units. These repression influences can be due to heterochromatin ("position effects", (Boivin & Dura, 1998)) or to adjacent copies of the transgene ("repeat-induced gene silencing", (Garrick et al., 1998)).
  • position effects (Boivin & Dura, 1998)
  • repeat-induced gene silencing (Garrick et al., 1998).
  • Two of the benefits of STAR elements for heterologous protein production are increased predictability of finding high-expressing primary recombinant host cells, and increased yield during production cycles. These benefits are illustrated in this example.
  • the pSDH-Tet vector was constructed by polymerase chain reaction amplification (PCR) of the luciferase open reading frame from plasmid pREP4-HSF-Luc (van der Vlag et al., 2000) using primers C67 and C68 (all PCR primers and mutagenic oligonucleotides are listed in Table 5), and insertion of the SacII/BamHI fragment into SacII/BamHI-digested pUHD10-3 (Gossen & Bujard, 1992).
  • PCR polymerase chain reaction amplification
  • the luciferase expression unit was re-amplified with primers C65 and C66, and re-inserted into pUHD10-3 in order to flank it with two multiple cloning sites (MCSI and MCSII).
  • An Ascl site was then introduced into MCSI by digestion with EcoRI and insertion of a linker (comprised of annealed oligonucleotides D93 and D94).
  • the CMV promoter was amplified from plasmid pCMV-Bsd (Invitrogen K510-01) with primers D90 and D91, and used to replace the Tet-Off promoter in pSDH-Tet by Sall/SacII digestion and ligation to create vector pSDH-CMV.
  • the luciferase open reading frame in this vector was replaced by SEAP (Secreted Alkaline Phosphatase) as follows: vector pSDH-CMV was digested with SacII and BamHl and made blunt; the SEAP open reading frame was isolated from pSEAP-basic (Clontech 6037-1) by EcoRI/Sall digestion, made blunt and ligated into pSDH-CMV to create vector pSDH-CS.
  • the puromycin resistance gene under control of the SV40 promoter was isolated from plasmid pBabe-Puro (Morgenstern & Land, 1990) by PCR, using primers C81 and C82.
  • STAR elements were inserted into MCSI and MCSII in two steps, by digestion of the STAR element and the pSDH-CSP vector with an appropriate restriction enzyme, followed by ligation.
  • the orientation of STAR elements in recombinant pSDH vectors was determined by restriction mapping. The identity and orientation of the inserts were verified by DNA sequence analysis. Sequencing was performed by the dideoxy method (Sanger et al, 1977) using a Beckman CEQ2000 automated DNA sequencer, according to the manufacturer's instructions. Briefly, DNA was purified from E. coli using QIAprep Spin Miniprep and Plasmid Midi Kits (QIAGEN 27106 and 12145, respectively). Cycle sequencing was carried out using custom oligonucleotides C85, E25, and E42 (Table 5), in the presence of dye terminators (CEQ Dye Terminator Cycle Sequencing Kit, Beckman 608000).
  • Hamster Ovary cell line CHO-K1 (ATCC CCL-61) was cultured in HAMS-F12 medium + 10% Fetal Calf Serum containing 2 mM glutamine, 100 U/ml penicillin, and 100 micrograms/ml streptomcyin at 37 C/5% C02. Cells were transfected with the pSDH-CSP vector, and its derivatives containing STAR6 or STAR49 in MCSI and MCSII, using SuperFect (QIAGEN) as described by the manufacturer. Briefly, cells were seeded to culture vessels and grown overnight to 70-90% confluence.
  • SuperFect reagent was combined with plasmid DNA (linearized in this example by digestion with Pvul) at a ratio of 6 microliters per microgram (e.g. for a 10 cm Petri dish, 20 micrograms DNA and 120 microliters SuperFect) and added to the cells. After overnight incubation the transfection mixture was replaced with fresh medium, and the transfected cells were incubated further. After overnight cultivation, 5 micrograms/ml puromycin was added. Puromycin selection was complete in 2 weeks, after which time individual puromycin resistant CHO/pSDH-CSP clones were isolated at random and cultured further.
  • SEAP activity (Berger et al., 1988, Henthorn et al., 1988, Kain, 1997, Yang et al., 1997) in the culture medium of CHO/pSDH-CSP clones was determined as described by the manufacturer (Clontech Great EscAPe kit #K2041). Briefly, an aliquot of medium was heat inactivated at 65 C, then combined with assay buffer and CSPD chemiluminescent substrate and incubated at room temperature for 10 minutes. The rate of substrate conversion was then determined in a luminometer (Turner 20/20TD). Cell density was determined by counting trypsinized cells in a Coulter ACT10 cell counter.
  • Luciferase assay Luciferase activity (Himes & Shannon, 2000) was assayed in resuspended cells according to the instructions of the assay kit manufacturer (Roche 1669893), using a luminometer (Turner 20/20TD). Total cellular protein concentration was determined by the bicinchoninic acid method according to the manufacturer's instructions (Sigma B-9643), and used to normalize the luciferase data.
  • the recombinant U-2 OS clones with STAR elements flanking the expression units had higher yields than the STAR-less clones: the highest expression observed from STAR8 clones was 2-3 fold higher than the expression from STAR-less clones.
  • STAR6 clones had maximal expression levels 5 fold higher than the STAR-less clones.
  • the STAR elements conferred greater predictability as well: for both STAR elements, 15 to 20% of the clones displayed luciferase expression at levels comparable to or greater than the STAR-less clone with the highest expression level.
  • STAR elements increase the yield of heterologous proteins (luciferase and SEAP). All three of the STAR elements introduced in this example provide elevated yields. The increased predictability conferred by the STAR elements is manifested by the large proportion of the clones with yields equal to or greater than the highest yields displayed by the STAR-less clones.
  • STAR elements improve the stability of transgene expression During cultivation of recombinant host cells, it is common practice to maintain antibiotic selection. This is intended to prevent transcriptional silencing of the transgene, or loss of the transgene from the genome by processes such as recombination. However it is undesirable for production of heterologous proteins, for a number of reasons. First, the antibiotics that are used are quite expensive, and contribute significantly to the unit cost of the product. Second, for biopharmaceutical use, the protein must be demonstrably pure, with no traces of the antibiotic in the product.
  • One advantage of STAR elements for heterologous protein production is that they confer stable expression on transgenes during prolonged cultivation, even in the absence of antibiotic selection; this property is demonstrated in this example.
  • the U-2 OS cell line was transfected with the plasmid pSDH-Tet-STAR6 and cultivated as described in Example 11. Individual puromycin-resistant clones were isolated and cultivated further in the absence of doxycycline. At weekly intervals the cells were transferred to fresh culture vessels at a dilution of 1:20. Luciferase activity was measured at periodic intervals as described in Example 11. After 15 weeks the cultures were divided into two replicates; one replicate continued to receive puromycin, while the other replicate received no antibiotic for the remainder of the experiment (25 weeks total).
  • Table 7 presents the data on luciferase expression by an expression unit flanked with STAR6 during prolonged growth with or without antibiotic.
  • the expression of the reporter transgene, luciferase remains stable in the U-2 OS host cells for the duration of the experiment. After the cultures were divided into two treatments (plus antibiotic and without antibiotic) the expression of luciferase was essentially stable in the absence of antibiotic selection.
  • STAR elements are isolated from the genetic screen described in Example 1.
  • the screen uses libraries constructed with human genomic DNA that was size- fractionated to approximately 0.5 - 2 kilobases (supra).
  • the STAR elements range from 500 to 2361 base pairs (Table 6). It is likely that, for many of the STAR elements that have been isolated, STAR activity is conferred by a smaller DNA fragment than the initially isolated clone. It is useful to determine these minimum fragment sizes that are essential for STAR activity, for two reasons. First, smaller functional STAR elements would be advantageous in the design of compact expression vectors, since smaller vectors transfect host cells with higher efficiency. Second, determining minimum essential STAR sequences permits the modification of those sequences for enhanced functionality. Two STAR elements have been fine- mapped to determine their minimal essential sequences.
  • STAR10 (1167 base pairs) and STAR27 (1520 base pairs) have been fine- mapped. They have been amplified by PCR to yield sub-fragments of approximately equal length (FIG 10 legend). For initial testing, these have been cloned into the pSelect vector at the BamHl site, and transfected into U-2 OS/Tet-Off/LexA-HPl cells as described in Example 1. After selection for hygromycin resistance, LexA-HPl was induced by lowering the doxycycline concentration. Transfected cells were then incubated with zeocin to test the ability of the STAR fragments to protect the SV40-Zeo expression unit from repression due to LexA- HPl binding. Results
  • STAR elements function in diverse strains of cultured mammalian cells
  • the choice of host cell line for heterologous protein expression is a critical parameter for the quality, yield, and unit cost of the protein. Considerations such as post-translational modifications, secretory pathway capacity, and cell line immortality dictate the appropriate cell line for a particular biopharmaceutical production system. For this reason, the advantages provided by STAR elements in terms of yield, predictability, and stability should be obtainable in diverse cell lines. This was tested by comparing the function of STAR6 in the human U-2 OS cell line in which it was originally cloned, and the CHO cell line which is widely applied in biotechnology. Materials and Methods:
  • Example 11 The experiments of Example 11 are referred to.
  • STAR elements function in the context of various transcriptional promoters
  • Transgene transcription is achieved by placing the transgene open reading frame under control of an exogenous promoter.
  • the choice of promoter is influenced by the nature of the heterologous protein and the production system. In most cases, strong constitutive promoters are preferred because of the high yields they can provide.
  • Some viral promoters have these properties; the promoter/enhancer of the cytomegalovirus immediate early gene (“CMV promoter”) is generally regarded as the strongest promoter in common biotechnological use (Boshart et al., 1985, Doll et al., 1996, Foecking & Hofstetter, 1986).
  • CMV promoter cytomegalovirus immediate early gene
  • the simian virus SV40 promoter is also moderately strong (Boshart et al., 1985, Foecking & Hofstetter, 1986) and is frequently used for ectopic expression in mammalian cell vectors.
  • the Tet-Off promoter is inducible: the promoter is repressed in the presence of tetracycline or related antibiotics (doxycycline is commonly used) in cell-lines which express the tTA plasmid (Clontech K1620-A), and removal of the antibiotic results in transcriptional induction (Deuschle et al., 1995, Gossen & Bujard, 1992, Izumi & Gilbert, 1999, Umana et al., 1999).
  • pSDH-SV40 was constructed by PCR amplification of the SV40 promoter (primers D41 and D42) from plasmid pSelect-SV40-Zeo (Example 1), followed by digestion of the PCR product with SacII and Sail.
  • the pSDH-CMV vector was digested with SacII and Sail to remove the CMV promoter, and the vector and SV40 fragment were ligated together to create pSDH-SV40.
  • STAR6 was cloned into MCSI and MCSII as described in Example 11.
  • the plasmids pSDH-Tet, pSDH-Tet-STAR6, pSDH-Tet-STAR7, P SDH-SV40 and pSDH- SV40-STAR6 were co-transfected with pBabe-Puro into U-2 OS using SuperFect as described by the manufacturer. Cell cultivation, puromycin selection, and luciferase assays were carried out as described in Example 11.
  • FIGS 9, 11, and 12 compare the expression of the luciferase reporter gene from 3 different promoters: two strong and constitutive viral promoters (CMV and SV40), and the inducible Tet-Off promoter. All three promoters were tested in the context of the STAR6 element in U-2 OS cells. The results demonstrate that the yield and predictability from all 3 promoters are increased by STAR6. As described in Examples 11 and 14, STAR6 is beneficial in the context of the CMV promoter (FIG 9).
  • STAR6 In the context of the Tet-Off promoter under inducing (low doxycycline) concentrations, STAR6 also improves the yield and predictability of transgene expression (FIG 12): the highest-expressing STAR6 clone has a 20-fold higher yield than the best pSDH-Tet clone, and 9 STAR6 clones (35% of the population) have yields higher than the best STAR-less clone. It is concluded that this STAR element is versatile in its transgene-protecting properties, since it functions in the context of various biotechnologically useful promoters of transcription.
  • STAR element function can be directional
  • nucleic acid sequences can be symmetrical (e.g. palindromic), longer naturally-occurring sequences are typically asymmetrical.
  • information content of nucleic acid sequences is directional, and the sequences themselves can be described with respect to their 5' and 3' ends.
  • the directionality of nucleic acid sequence information affects the arrangement in which recombinant DNA molecules are assembled using standard cloning techniques known in the art (Sambrook et al., 1989).
  • STAR elements are long, asymmetrical DNA sequences, and have a directionality based on the orientation in which they were originally cloned in the pSelect vector.
  • the STAR66 element was cloned into pSDH-Tet as described in Example 11.
  • U-2 OS cells were co-transfected with plasmids pSDH-Tet-STAR66-native and pSDH-Tet-STAR66-opposite, and cultivated as described in Example 11. Individual clones were isolated and cultivated; the level of luciferase expression was determined as described (supra).
  • Transgene expression units for heterologous protein expression are generally integrated into the genome of the host cell to ensure stable retention during cell division. Integration can result in one or multiple copies of the expression unit being inserted into the genome; multiple copies may or may not be present as tandem arrays.
  • the increased yield demonstrated for transgenes protected by STAR elements (supra) suggests that STAR elements are able to permit the transgene expression units to function independently of influences on transcription associated with the site of integration in the genome
  • U-2 OS cells were co-transfected with pSDH-Tet-STARlO and cultivated under puromycin selection as described (supra). Eight individual clones were isolated and cultivated further. Then cells were harvested, and one portion was assayed for luciferase activity as described (supra). The remaining cells were lysed and the genomic DNA purified using the DNeasy Tissue Kit (QIAGEN 69504) as described by the manufacturer. DNA samples were quantitated by UV spectrophotometry. Three micrograms of each genomic DNA sample were digested with PvuII and Xhol overnight as described by the manufacturer (New England Biolabs), and resolved by agarose gel electrophoresis.
  • DNA fragments were transferred to a nylon membrane as described (Sambrook et al., 1989), and hybridized with a radioactively labelled probe to the luciferase gene (isolated from BamHI/SacII-digested pSDH-Tet). The blot was washed as described (Sambrook et al., 1989) and exposed to a phosphorimager screen (Personal F/X, BioRad). The resulting autoradiogram (FIG 15) was analyzed by densitometry to determine the relative strength of the luciferase DNA bands, which represents the transgene copy number. Results
  • the enzyme activities and copy numbers (DNA band intensities) of luciferase in the clones from the pSDH-Tet-STARlO clone population is shown in FIG 16.
  • STAR elements function as enhancer blockers but not enhancers
  • Enhancers are characteristically able to affect promoters even when they are located far away (many kilobase pairs) from the promoter.
  • Negative influences that act by heterochromatin formation e.g. Polycomb group proteins
  • the biochemical basis for enhancer function and for heterochromatin formation is fundamentally similar, since they both involve binding of proteins to DNA. Therefore it is important to determine whether STAR elements are able to block positive influences as well as negative influences, in other words, to shield transgenes from genomic enhancers in the vicinity of the site of integration.
  • STAR elements in an enhancer-blocking assay. Another feature of STAR activity that is important to their function is the increased yield they confer on transgenes (Example 11). STARs are isolated on the basis of their ability to maintain high levels of zeocin expression when heterochromatin-forming proteins are bound adjacent to the candidate STAR elements. High expression is predicted to occur because STARs are anticipated to block the spread of heterochromatin into the zeocin expression unit.
  • a second scenario is that the DNA fragments in zeocin-resistant clones contain enhancers.
  • Enhancers have been demonstrated to have the ability to overcome the repressive effects of Polycomb-group proteins such as those used in the method of the STAR screen (Zink & Paro, 1995). Enhancers isolated by this phenomenon would be considered false positives, since enhancers do not have the properties claimed here for STARs. In order to demonstrate that STAR elements are not enhancers, they have been tested in an enhancer assay.
  • the enhancer-blocking assay and the enhancer assay are methodologically and conceptually similar.
  • the assays are shown schematically in FIG 17.
  • the ability of STAR elements to block enhancers is performed using the E47/E-box enhancer system.
  • the E47 protein is able to activate transcription by promoters when it is bound to an E-box DNA sequence located in the vicinity of those promoters (Quong et al., 2002).
  • E47 is normally involved in regulation of B and T lymphocyte differentiation (Quong et al., 2002), but it is able to function in diverse cell types when expressed ectopically (Petersson et al., 2002).
  • the E-box is a palindromic DNA sequence, CANNTG (Knofler et al., 2002).
  • an E-box is placed upstream of a luciferase reporter gene (including a minimal promoter) in an expression vector.
  • a cloning site for STAR elements is placed between the E-box and the promoter.
  • the E47 protein is encoded on a second plasmid.
  • the assay is performed by transfecting both the E47 plasmid and the luciferase expression vector into cells; the E47 protein is expressed and binds to the E-box, and the E47/E-box complex is able to act as an enhancer.
  • the E47/E-box complex enhances luciferase expression (FIG 17 A, situation 1).
  • STAR elements When STAR elements are inserted between the E-box and the promoter, their ability to block the enhancer is demonstrated by reduced expression of luciferase activity (FIG 17A, situation 2); if STARs cannot block enhancers, luciferase expression is activated (FIG 17A, situation 3).
  • the ability of STAR elements to act as enhancers utilizes the same luciferase expression vector. In the absence of E47, the E-box itself does not affect transcription. Instead, enhancer behaviour by STAR elements will result in activation of luciferase transcription.
  • the assay is performed by transfecting the luciferase expression vector without the E47 plasmid.
  • luciferase expression When the expression vector does not contain STAR elements, luciferase expression is low (FIG 17B, situation 1). If STAR elements do not have enhancer properties, luciferase expression is low when a STAR element is present in the vector (FIG 17B, situation 2). If STAR elements do have enhancer properties, luciferase expression will be activated in the STAR-containing vectors (FIG 17B, situation 3).
  • the luciferase expression vector was constructed by inserting the E-box and a human alkaline phosphatase minimal promoter from plasmid mu-E5+E2x6- cat(x) (Ruezinsky et al., 1991) upstream of the luciferase gene in plasmid pGL3-basic (Promega E1751), to create pGL3-E-box-luciferase ( gift of W. Romanow).
  • the E47 expression plasmid contains the E47 open reading frame under control of a beta-actin promoter in the pHBAPr-1-neo plasmid; E47 in constitutively expressed from this plasmid (gift of W. Romanow).
  • STAR elements 1, 2, 3, 6, 10, 11, 18, and 27 have been cloned into the luciferase expression vector.
  • Clones containing the Drosophila scs element and the chicken beta-globin HS4-6x core ("HS4") element have been included as positive controls (they are known to block enhancers, and to have no intrinsic enhancer properties (Chung et al, 1993, Kellum & Schedl, 1992)), and the empty luciferase expression vector has been included as a negative control. All assays were performed using the U-2 OS cell line. In the enhancer-blocking assay, the E47 plasmid was co-transfected with the luciferase expression vectors (empty vector, or containing STAR or positive-control elements).
  • the E47 plasmid was co-transfected with STARless luciferase expression vector as a positive control for enhancer activity; all other samples received a mock plasmid during co-transfection.
  • the transiently transfected cells were assayed for luciferase activity 48 hours after plasmid transfection (supra).
  • the luciferase activity expressed from a plasmid containing no E-box or STAR/control elements was subtracted, and the luciferase activities were normalized to protein content as described (supra).
  • FIG 18 shows the results of the enhancer-blocking assay. In the absence of
  • STAR elements or the known enhancer-blocking elements scs and HS4
  • the E47/E-box enhancer complex activates expression of luciferase ("vector"); this enhanced level of expression has been normalized to 100. Enhancer activity is blocked by all STAR elements tested. Enhancer activity is also blocked by the HS4 and scs elements, as expected (Bell et al., 2001, Gerasimova & Corces, 2001).
  • the level of luciferase expression due to enhancement by the E47/E-box complex is set at 100 ("E47").
  • E47 The level of luciferase expression due to enhancement by the E47/E-box complex.
  • none of the STAR elements bring about significant activation of luciferase expression.
  • the scs and HS4 elements also do not bring about activation of the reporter gene. Therefore it is concluded that at least the tested STAR elements do not possess enhancer properties.
  • pSS-cocLA::upp (FIG 20). It consists of the suicide gene expression unit, flanked by two STAR6 elements. The expression unit, consisting of the codA::upp suicide gene under control of the Tet-Off promoter, is downstream of a Bglll restriction site.
  • pSS-hrGFP (FIG 21) was created by replacement of one STAR6 element with STAR8, and replacement of the suicide gene with the hrGFP gene, encoding green fluorescent protein (Stratagene 240059).
  • Transfected cells were selected for hygromycin resistance (25 mg/ml) over a 3 week period at high doxycycline (10 ng/ml), and 1800 hygromycin-resistant colonies were recovered from the library transfection. These colonies were then incubated with the pro-drug 5-fluorocytosine (5-FC) at 1 mg/ml, with a boost of 5 mg/ml for 4 days, at a doxycycline concentration of 10 ng/ml. After 3 weeks all but 3 weakly- rowing control colonies (transfected with empty pSS- codA::upp) had died; 58 of the library-transfected colonies survived. These colonies were allowed to recover from pro-drug treatment, and cultivated further.
  • pro-drug 5-fluorocytosine 5-FC
  • the 5-FC-resistant isolates were harvested, the cells were lysed, and a portion of the DNA was subjected to PCR amplification using primers D30 and D51 to recover the SINC elements.
  • the PCR products from six 5-FC-resistant colonies were cloned between the Hindlll and Xhol sites of pBluescript II SK(+) plasmid (Stratagene 212207) by conventional methods (Sambrook et al., 1989).
  • the DNA sequences of the candidate SINC elements were determined as described (supra) using commercially available primers for the pBluescript vector (Stratagene 300301 and 300302). The sequences of these SINC elements are presented in Table 4B.
  • the 6 candidate SINC elements were cloned into plasmid pSS-hrGFP in their native orientations, and the resulting plasmids were transfected into U-2 OS/Tet-Off cells. After selection for hygromycin resistance, the populations of pSS-hrGFP-SINC transfectants were cultivated further at a high doxycycline concentration (10 ng/ml). Total cellular RNA was extracted using the RNeasy Mini Kit (QIAGEN 74104) as described by the manufacturer. Northern blot analysis of GFP mRNA abundance in these populations was assessed using standard techniques (Sambrook et al., 1989).
  • the GFP probe was a BamHI- EcoRI fragment encompassing base pairs 690 to 1419 in phrGFP-1.
  • the blots were also probed for hygromycin mRNA as a control for PSS-hrGFP-derived plasmid copy number, and for beta-actin as a control for genomically-encoded mRNA quantity.
  • the hygromycin probe was an Sful-Sal I fragment extending from 8219-10144 in pREP4 (Invitrogen), and the beta-actin probe was from Clontech, #9800-1. After hybridization and washing, the blots were exposed to phosphorimager screens, and the radioactive signals were visualized and quantitated using a BioRad Personal F/X phosphorimager.
  • SINC elements cloned adjacent to the GFP reporter gene will induce silencing of reporter gene transcription, but will not affect transcription of other genes. Accurate measurement of SINC activity takes advantage of this fact by determining the expression of GFP relative to the expression of two reference genes, rather than simply measuring absolute GFP expression.
  • One reference gene is the hygromycin resistance gene on the pSS-hrGFP plasmid (outside the domain defined by the STAR elements; FIG 21), and the other is the genomic beta-actin gene.
  • SINC activity is quantified by RNA blot analysis as a reduction in the ratio of the GFP signal to the hygromycin and beta-actin signals.
  • SINC35 has the strongest activity of these candidates. It brings about a 69% reduction in the GFP/hygromycin ratio, and a 75% reduction in the GFP/beta-actin signal.
  • STAR elements are conserved between mouse and human BLAT analysis of the STAR DNA sequence against the human genome database (http://genome.ucsc.edu/cgi-bin/hgGateway) reveals that some of these sequences have high sequence conservation with other regions of the human genome. These duplicated regions are candidate STAR elements; if they do show STAR activity, they would be considered paralogs of the cloned STARs (two genes or genetic elements are said to be paralogous if they are derived from a duplication event (Li, 1997)).
  • BLAST analysis of the human STARs against the mouse genome http://www.ensembl.org/Mus_musculus/blastview) also reveals regions of high sequence conservation between mouse and human.
  • a cloned human STAR has a paralog within the human genome, and its ortholog has been identified in the mouse genome.
  • STAR3a is a fragment of the 15qll.2 region of human chromosome 15. This region is 96.9% identical (paralogous) with a DNA fragment at 5q33.3 on human chromosome 5, which is near the IL12B interleukin gene.
  • These human DNAs share approximately 80% identity with a fragment of the 11B2 region on mouse chromosome 11.
  • the 11B2 fragment is also near the (mouse) IL12B interleukin gene. Therefore STAR3a and the mouse 11B2 fragment can be strictly defined as paralogs.
  • the region of mouse/human sequence conservation around STAR 18 was recovered from human BAG clone RP11-387A1 by PCR amplification, in three fragments: the entire region (primers E93 and E94), the leftward half (primers E93 and E92), and the rightward half (primers E57 and E94).
  • the corresponding fragments from the homologous mouse region were recovered from BAC clone RP23-400H17 in the same fashion (primers E95 and E98, E95 and E96, and E97 and E98, respectively). All fragments were cloned into the pSelect vector and transfected into a U-2 OS/Tet-Off/LexA-HPl cell line (supra).
  • hygromycin selection was carried out to select for transfected cells.
  • the LexA-HPl protein was induced by lowering the doxycycline concentration, and the ability of the transfected cells to withstand the antibiotic zeocin (a measure of STAR activity) was assessed by monitoring cell growth.
  • the original STAR18 clone was isolated from Sau3AI digested human DNA ligated into the pSelect vector on the basis of its ability to prevent silencing of a zeocin resistance gene. Alignment of the human STAR18 clone (497 base pairs) with the mouse genome revealed high sequence similarity (72%) between the orthologous human and mouse STAR18 regions. It also uncovered high similarity (73%) in the region extending for 488 base pairs immediately leftwards of the Sau3AI site that defines the left end of the cloned region (FIG 22). Outside these regions the sequence similarity between human and mouse DNA drops below 60%.
  • both the human and the mouse STAR18 elements confer survival on zeocin to host cells expressing the lexA-HPl repressor protein.
  • the original 497 base pair STAR18 clone and its mouse ortholog both confer the ability to grow (FIG 22, a and d).
  • the adjacent 488 base pair regions of high similarity from both genomes also confer the ability to grow, and in fact their growth phenotype is more vigorous than that of the original STAR18 clone (FIG 22, b and e).
  • FIG 22, c and f the entire region of sequence similarity was tested, these DNAs from both mouse and human confer growth, and the growth phenotype is more vigorous than the two sub-fragments.
  • STAR elements are isolated on the basis of their anti-repression phenotype with respect to transgene expression.
  • This anti-repression phenotype reflects underlying biochemical processes that regulate chromatin formation which are associated with the STAR elements. These processes are typically sequence- specific and result from protein binding or DNA structure. This suggests that STAR elements will share DNA sequence similarity. Identification of sequence similarity among STAR elements will provide sequence motifs that are characteristic of the elements that have already been identified by functional screens and tests. The sequence motifs will also be useful to recognize and claim new STAR elements whose functions conform to the claims of this patent. The functions include improved yield and stability of transgenes expressed in eukaryotic host cells.
  • sequence motifs that characterize STAR elements include: (1) provision of search motifs for prediction and identification of new STAR elements in genome databases, (2) provision of a rationale for modification of the elements, and (3) provision of information for functional analysis of STAR activity. Using bio-informatics, sequence similarities among STAR elements have been identified; the results are presented in this example.
  • Regulatory DNA elements typically function via interaction with sequence-specific DNA-binding proteins.
  • Bio- informatic analysis of DNA elements such as STAR elements whose regulatory properties have been identified, but whose interacting proteins are unknown, requires a statistical approach for identification of sequence motifs. This can be achieved by a method that detects short DNA sequence patterns that are over-represented in a set of regulatory DNA elements (e.g. the STAR elements) compared to a reference sequence (e.g. the complete human genome). The method determines the number of observed and expected occurrences of the patterns in each regulatory element. The number of expected occurrences is calculated from the number of observed occurrences of each pattern in the reference sequence.
  • the DNA sequence patterns can be oligonucleotides of a given length, e.g. six base pairs.
  • the actual frequency of each hexamer in the reference sequence is typically different than this due to biases in the content of G:C base pairs, etc. Therefore the frequency of each oligonucleotide in the reference sequence is determined empirically by counting, to create a "frequency table" for the patterns.
  • the pattern frequency table of the reference sequence is then used to calculate the expected frequency of occurrence of each pattern in the regulatory element set.
  • the expected frequencies are compared with the observed frequencies of occurrence of the patterns. Patterns that are "over-represented" in the set are identified; for example, if the hexamer ACGTGA is expected to occur 5 times in 20 kilobase pairs of sequence, but is observed to occur 15 times, then it is three-fold over-represented.
  • a significance index is calculated for each pattern.
  • the significance index is derived from the probability of occurrence of each pattern, which is estimated by a binomial distribution. The probability takes into account the number of possible patterns (4096 for hexamers). The highest sig values corespond to the most overrepresented oligonucleotides (van Helden et al., 1998).
  • the patterns that are significantly over-represented in the regulatory element set are used to develop a model for classification and prediction of regulatory element sequences. This employs Discriminant Analysis, a so-called "supervised” method of statistical classification known to one of ordinary skill in the art (Huberty, 1994).
  • sets of known or classified items are used to "train" a model to recognize those items on the basis of specific variables (e.g. sequence patterns such as hexamers).
  • the trained model is then used to predict whether other items should be classified as belonging to the set of known items (e.g. is a DNA sequence a STAR element).
  • the known items in the training set are STAR elements (positive training set). They are contrasted with sequences that are randomly selected from the genome (negative training set) which have the same length as the STAR elements.
  • Discriminant Analysis establishes criteria for discriminating positives from negatives based on a set of variables that distinguish the positives; in this example, the variables are the significantly over-represented patterns (e.g.
  • Stepwise Discriminant Analysis is to select the minimum number of variables that provides maximum discrimination between the positives and negatives.
  • the model is trained by evaluating variables one- by-one for their ability to properly classify the items in the positive and negative training sets. This is done until addition of new variables to the model does not significantly increase the model's predictive power (i.e. until the classification error rate is minimized). This optimized model is then used for testing, in order to predict whether "new" items are positives or negatives (Huberty, 1994).
  • the first step reduces a large set of sequence patterns (e.g. all 4096 hexamers) to a smaller set of significantly over-represented patterns (e.g. 100 hexamers); in the second step, Stepwise Discrimant Analysis reduces the set of over- represented patterns to the subset of those patterns that have maximal discriminative power (e.g. 5-10 hexamers). Therefore this approach provides simple and robust criteria for identifying regulatory DNA elements such as STAR elements.
  • DNA-binding proteins can be distinguished on the basis of the type of binding site they occupy. Some recognize contiguous sequences; for this type of protein, patterns that are oligonucleotides of length 6 base pairs (hexamers) are fruitful for bio-informatic analysis (van Helden et al., 1998). Other proteins bind to sequence dyads: contact is made between pairs of highly conserved trinucleotides separated by a non-conserved region of fixed width (van Helden et al., 2000).
  • BAC/PAC bacterial/Pi
  • the BAC/PAC clones contain genomic DNA from regions of chromosome 1 (clones RP1154H19 and RP3328E19), from the HOX cluster of homeotic genes (clones RP1167F23, RP1170019, and RP11387A1), or from human chromosome 22 (Research Genetics 96010-22).
  • the DNAs were size- fractionated, and the 0.5 - 2 kb size fraction was ligated into BamHI-digested pSelect vector, by standard techniques (Sambrook et al., 1989).
  • pSelect plasmids containing human genomic DNA that conferred resistance to zeocin at low doxycycline concentrations were isolated and propagated in Escherichia coli.
  • the screens that yielded the STAR elements of Table 6 have assayed approximately 1-2% of the human genome.
  • the human genomic DNA inserts in these 66 plasmids were sequenced by the dideoxy method (Sanger et al., 1977) using a Beckman CEQ2000 automated DNA sequencer, using the manufacturer's instructions. Briefly, DNA was purified from E. coli using QIAprep Spin Miniprep and Plasmid Midi Kits (QIAGEN 27106 and 12145, respectively). Cycle sequencing was carried out using custom oligonucleotides corresponding to the pSelect vector (primers D89 and D95, Table 5), in the presence of dye terminators (CEQ Dye Terminator Cycle Sequencing Kit, Beckman 608000).
  • Assembled STAR DNA sequences were located in the human genome (database builds August and December 2001) using BLAT (Basic Local Alignment Tool (Kent, 2002); http://genome.ucsc.edu/cgi-bin/hgGateway ; Table 6).
  • the combined STAR sequences comprise 85.6 kilobase pairs, with an average length of 1.3 kilobase pairs.
  • Sequence motifs that distinguish STAR elements within human genomic DNA were identified by bio-informatic analysis using a two-step procedure, as follows (see FIG 23 for a schematic diagram). The analysis has two input datasets: (1) the DNA sequences of the STAR elements (STAR1 - STAR65 were used; Table 6); and (2) the DNA sequence of the human genome (except for chromosome 1, which was not feasible to include due to its large size; for dyad analysis a random subset of human genomic DNA sequence (-27 Mb) was used). Pattern Frequency Analysis.
  • the first step in the analysis uses RSA-Tools software (Regulatory Sequence Analysis Tools; http://www.ucmb.ulb.ac.be/bioinformatics/rsa-tools/ ; references (van Helden et al., 1998, van Helden et al., 2000, van Helden et al., 2000)) to determine the following information: (1) the frequencies of all dyads and hexameric oligonucleotides in the human genome; (2) the frequencies of the oligonucleotides and dyads in the 65 STAR elements; and (3) the significance indices of those oligonucleotides and dyads that are over-represented in the STAR elements compared to the genome.
  • a control analysis was done with 65 sequences that were selected at random from the human genome (i.e. from 2689 x 10 ⁇ 3 kilobase pairs) that match the length of the STAR elements of Table 6.
  • the over-represented oligonucleotides and dyads were used to train models for prediction of STAR elements by Linear Discriminant Analysis (Huberty, 1994).
  • a pre-selection of variables was performed by selecting the 50 patterns with the highest individual dicriminatory power from the over-represented oligos or dyads of the frequency analyses. These preselected variables were then used for model training in a Stepwise Linear Discriminant Analysis to select the most discriminant combination of variables (Huberty, 1994).
  • Variable selection was based on minimizing the classification error rate (percentage of false negative classifications).
  • the expected error rate was estimated by applying the same discriminant approach to the control set of random sequences (minimizing the percentage of false positive classifications).
  • the predictive models from the training phase of Discriminant Analysis were tested in two ways. First, the STAR elements and random sequences that were used to generate the model (the training sets) were classified. Second, sequences in a collection of 19 candidate STAR elements (recently cloned by zeocin selection as described above) were classified. These candidate STAR elements are listed in Table 11 (SEQ ID:67-84).
  • Pattern frequency analysis was performed with RSA- Tools on 65 STAR elements, using the human genome as the reference sequence.
  • the most significantly over-represented oligonucleotide, CCCCAC occurs 107 times among the 65 STAR elements, but is expected to occur only 49 times. It has a significance coefficient of 8.76; in other words, the probability that its over-representation is due to random chance is 1 / 10 ⁇ 8.76, i.e. less than one in 500 million.
  • Table 9 also presents the number of STAR elements in which each over- represented oligonucleotide is found. For example, the most significant oligonucleotide, oligo 1 (CCCCAC), occurs 107 times, but is found in only 51 STARs, i.e. on average it occurs as two copies per STAR.
  • oligonucleotide number 166 (AATCGG)
  • AATCGG The least abundant oligonucleotide
  • AATCGG The least abundant oligonucleotide, number 166 (AATCGG)
  • AATCGG The least abundant oligonucleotide
  • CAGCCC oligo 4
  • CAGCCC oligo 4
  • CGTCGC The most widespread oligonucleotide is number 120 (CCCAGG), which occurs on 58 STARs (on average twice per STAR), and the least widespread oligonucleotide is number 114 (CGTCGC), which occurs on only 6 STARs (and on average only once per STAR).
  • the oligonucleotides and dyads found to be over-represented in STAR elements by pattern frequency analysis were tested for their discriminative power by Linear Discriminant Analysis. Discriminant models were trained by step-wise selection of the best combination among the 50 most discriminant oligonucleotide (Table 9) or dyad (Table 10) patterns.
  • the models achieved optimal error rates after incorporation of 4 (dyad) or 5 variables.
  • the discriminative variables from oligo analysis are numbers 11, 30, 94, 122, and 160 (Tables 9); those from dyad analysis are numbers 73, 194, 419, and 497 (Table 10).
  • the discriminant models were then used to classify the 65 STAR elements in the training set and their associated random sequences.
  • the model using oligonucleotide variables classifies 46 of the 65 STAR elements as STAR elements (true positives); the dyad model classifies 49 of the STAR elements as true positives.
  • the models classify 59 of the 65 STAR elements as STAR elements (91%; FIG 24).
  • the false positive rates were 7 for the dyad model, 8 for the oligonucleotide model, and 13 for the combined predictions of the two models (20%).
  • the STAR elements of Table 6 that were not classified as STARs by LDA are STARs 7, 22, 35, 44, 46, and 65. These elements display stabilizing anti-repressor activity in functional assays, so the fact that they are not classified as STARs by LDA suggests that they represent another class (or classes) of STAR elements.
  • the models were then used to classify the 19 candidate STAR elements in the testing set listed in Table 11.
  • the dyad model classifies 12 of these candidate STARs as STAR elements, and the oligonucleotide model classifies 14 as STARs.
  • the combined number of the candidates that are classified as STAR elements is 15 (79%). This is a lower rate of classification than obtained with the training set of 65 STARs; this is expected for two reasons.
  • the discriminant models were trained with the 65 STARs of Table 6, and discriminative variables based on this training set may be less well represented in the testing set.
  • the candidate STAR sequences in the testing set have not yet been fully characterized in terms of in vivo function, and may include elements with only weak anti-repression properties.
  • the STAR sequences contain a number of dyad and hexameric oligonucleotide patterns that are significantly over-represented in comparison with the human genome as a whole. These patterns may represent binding sites for proteins that confer STAR activity; in any case they form a set of sequence motifs that can be used to recognize STAR element sequences.
  • Transgene silencing occurs in transgenic plants at both the transcriptional and post-transcriptional levels (Meyer, 2000, Vance & Vaucheret, 2001). In either case, the desired result of transgene expression can be compromised by silencing; the low expression and instability of the transgene results in poor expression of desirable traits (e.g. pest resistance) or low yields of recombinant proteins. It also results in poor predictability: the proportion of transgenic plants that express the transgene at biotechnologically useful levels is low, which necessitates laborious and expensive screening of transformed individuals for those with beneficial expression characteristics.
  • This example describes the isolation of STAR elements from the genome of the dicot plant Arabidopsis thaliana for use in preventing transcriptional transgene silencing in transgenic plants.
  • Arabidopsis was chosen for this example because it is a well-studied model organism: it has a compact genome, it is amenable to genetic and recombinant DNA manipulations, and its genome has been sequenced (Bevan et al., 2001, Initiative, 2000, Meinke et al., 1998). Materials and Methods:
  • Genomic DNA was isolated from Arabidopsis thaliana ecotype Columbia as described (Stam et al., 1998) and partially digested with Mbol. The digested DNA was size-fractionated to 0.5 - 2 kilbase pairs by agarose gel electrophoresis and purification from the gel (QIAquick Gel Extraction Kit, QIAGEN 28706), followed by ligation into the pSelect vector (supra). Transfection into the U-2 OS/Tet-Off/LexA-HPl cell line and selection for zeocin resistance at low doxycycline concentration was performed as described (supra). Plasmids were isolated from zeocin resistant colonies and re- transfected into the U-2 OS/Tet-Off/LexA-HPl cell line.
  • STAR activity was tested further by measuring mRNA levels for the hygromycin- and zeocin-resistance genes in recombinant host cells by reverse transcription PCR (RT-PCR).
  • RT-PCR reverse transcription PCR
  • Cells of the U-2 OS/Tet-Off/lexA-HPl cell line were transfected with pSelect plasmids containing Arabidopsis STAR elements, the Drosophila scs element, or containing no insert (supra). These were cultivated on hygromycin for 2 weeks at high doxycycline concentration, then the doxycycline concentration was lowered to 0.1 ng/ml to induce the lexA-HPl repressor protein.
  • First- strand cDNA synthesis was carried out using the RevertAid First Strand cDNA Synthesis kit (MBI Fermentas 1622) using oligo(dT)18 primer as described by the manufacturer.
  • An aliquot of the cDNA was used as the template in a PCR reaction using primers D58 and D80 (for the zeocin marker), and D70 and D71 (for the hygromycin marker), and Taq DNA polymerase (Promega M2661). The reaction conditions were 15-20 cycles of 94C for 1 minute, 54C for lminute, and 72C for 90 seconds.
  • RNA and PCR product DNA were resolved by agarose gel electrophoresis, and the zeocin and hygromycin bands were detected by Southern blotting as described (Sambrook et al., 1989), using PCR products produced as above with purified pSelect plasmid as template.
  • the ratio of the zeocin and hygromycin signals corresponds to the normalized expression level of the zeocin gene.
  • the library of Arabidopsis genomic DNA in the pSelect vector comprised 69,000 primary clones in E. coli, 80% of which carried inserts. The average insert size was approximately 1000 base pairs; the library therefore represents approximately 40% of the Arabidopsis genome. A portion of this library (representing approximately 16% of the Arabidopsis genome) was transfected into the U-2 OS/Tet-Off/LexA-HPl cell line.
  • Hygromycin selection was imposed to isolate transfectants, which resulted in 27,000 surviving colonies. These were then subjected to zeocin selection at low doxycycline concentration. Putative STAR-containing plasmids from 56 zeocin- resistant colonies were rescued into E. coli and re-transfected into U-2 OS/Tet- Off/LexA-HPl cells. Forty-four of these plasmids (79% of the plasmids tested) conferred zeocin resistance on the host cells at low doxycycline concentrations, demonstrating that the plasmids carried STAR elements. This indicates that the pSelect screen in human U-2 OS cells is highly efficient at detection of STAR elements from plant genomic DNA.
  • the strength of the cloned Arabidopsis STAR elements was tested by assessing their ability to prevent transcriptional repression of the zeocin-resistance gene, using an RT-PCR assay. As a control for RNA input among the samples, the transcript levels of the hygromycin-resistance gene for each STAR transfection were assessed too. This analysis has been performed for 12 of the Arabidopsis STAR elements. The results (FIG 25) demonstrate that the Arabidopsis STAR elements are superior to the Drosophila scs element (positive control) and the empty vector ("SV40"; negative control) in their ability to protect the zeocin- resistance gene from transcriptional repression.
  • STAR-A28 and STAR-A30 enable 2-fold higher levels of zeocin-resistance gene expression than the scs element (normalized to the internal control of hygromycin- resistance gene mRNA) when the lexA-HPl repressor is expressed.
  • Figure 1 The pSelect family of plasmids for selecting and characterizing STAR elements.
  • a resistance marker zeocin or puromycin
  • reporter gene GFP or luciferase
  • a resistance marker zeocin or puromycin
  • reporter gene GFP or luciferase
  • BamHl cloning site flanked by Ascl and Hindlll sites. Upstream of the cloning site are lexA operators to which lexA protein can bind. Binding of chimeric lexA-Polycomb group proteins to the operators causes repression of the marker or reporter gene. DNA fragments inserted at the cloning site that block repression are identified by the persistent expression of the marker or reporter gene.
  • the plasmid replicates episomally in cultured mammalian cells due to the oriP seqeunce.
  • FIG. 1 The pSDH family of plasmids for testing STAR elements.
  • Two multiple cloning sites (MCSI and MCSII) flank a reporter gene (GFP or luciferase) whose expression is driven by an upstream promoter (CMV, Tet-off, or SV40).
  • STAR elements to be tested are inserted at MCSI and MCSII. These contain unique restriction sites (MCSI: Xhol, Notl, EcoRI, and Sail; MCSII, Hindlll, EcoRV, Bglll, and Nhel).
  • MCSI unique restriction sites
  • FIG. 3 Proportion of clones over-expressing luciferase.
  • U-2 OS human osteosarcoma cells were stably transfected with pSDH plasmids (containing the luciferase reporter gene under control of the tet-off promoter), and individual transfected clones were isolated and cultivated. Luciferase expression was measured enzymatically. The average luciferase expression by clones containing the STARless pSDH ("reference level”) was determined. Clones from the sets for all plasmids were scored as "over-expressing" if their luciferase activity was more than 2-fold higher than the reference level. The percentage of over-expressing clones in each plasmid set in plotted.
  • FIG. 5 Fold over-expression by over-expressing clones.
  • the range of over-expression in STAR-containing pSDH plasmids integrated into genomic DNA was determined by dividing the luciferase activities of each clone by the reference level. For those displaying significant expression (more than 2-fold above the reference level), the actual fold increases were noted; the maximum values of these data are plotted for each plasmid.
  • the pSS (SINC-Select) plasmid for selecting and characterizing SINC elements.
  • the codA::upp suicide gene encodes a protein that converts the pro-drug 5-fluorocytosine to the toxic drug 5-fluorouracil.
  • host cells Upon induction by lowered tetracycline concentration, host cells become sensitive to the pro-drug.
  • Genomic DNA fragments inserted at the cloning site (Bglll-Xhol) that have silencing activity will prevent expression of the suicide gene and allow formation of pro-drug resistant colonies.
  • STAR elements flank the selection components to prevent spreading of silenced chromatin to the functional components of the plasmid.
  • the plasmid replicates episomally in cultured mammalian cells due to the oriP seqeunce.
  • FIG 7. The pSDH-CSP plasmid used for testing STAR activity.
  • the Secreted Alkaline Phosphatase (SEAP) reporter gene is under control of the CMV promoter, and the puromycin resistance selectable marker (puro) is under control of the SV40 promoter. Flanking these two genes are multiple cloning sites into which STAR elements can be cloned.
  • the plasmid also has an origin of replication (ori) and ampicillin resistance gene (ampR) for propagation in Escherichia coli
  • FIG 8. STAR6 and STAR49 improve predictability and yield of transgene expression. Expression of SEAP from the CMV promoter by CHO cells transfected with pSDH-CSP, pSDH-CSP-STAR6, or pSDH-CSP-STAR49 was determined. The STAR-containing constructs confer greater predictability and elevated yield relative to the pSDH-CSP construct alone.
  • FIG 9. STAR6 and STAR8 improve predictability and yield of transgene expression. Expression of luciferase from the CMV promoter by U-2 OS cells transfected with pSDH-CMV, pSDH-CMV-STAR6, or pSDH-CMV-STAR8 was determined. The STAR-containing constructs confer greater predictability and elevated yield relative to the pSDH-CMV construct alone.
  • FIG 10. Minimal essential sequences of STARIO and STAR27. Portions of the STAR elements were amplified by PCR: STARIO was amplified with primers E23 and E12 to yield fragment 10A, E13 and E14 to yield fragment 10B, and E15 and E16 to yield fragment IOC. STAR27 was amplified with primers E17 and E18 to yield fragment 27A, E19 and E20 to yield fragment 27B, and E21 and E22 to yield fragment 27C. These sub-fragments were cloned into the pSelect vector. After transfection into U-2 OS/Tet-Off/LexA-HPl cells, the growth of the cultures in the presence of zeocin was monitored. Growth rates varied from vigorous (+++) to poor (+/-), while some cultures failed to survive zeocin treatment (-) due to absence of STAR activity in the DNA fragment tested.
  • pSDH- SV40 and pSDH-SV40-STAR6 were transfected into the human osteosarcoma U-2 OS cell line, and expression of luciferase was assayed with or without protection from gene silencing by STAR6 in puromycin-resistant clones.
  • pSDH- Tet and pSDH-Tet-STAR6 were transfected into the human osteosarcoma U-2 OS cell line, and expression of luciferase was assayed with or without protection from gene silencing by STAR6 in puromycin-resistant clones.
  • FIG 13 Schematic diagram of the orientation of STAR elements as they are cloned in the pSelect vector (panel A), as they are cloned into pSDH vectors to preserve their native orientation (panel B), and as they are cloned into pSDH vector in the opposite orientation (panel C).
  • FIG 14. Directionality of STAR66 function.
  • the STAR66 element was cloned into pSDH-Tet in either the native (STAR66 native) or the opposite orientation (STAR66 opposite), and transfected into U-2 OS cells. Luciferase activity was assayed in puromycin resistant clones.
  • FIG 15. Copy number-dependence of STAR function. Southern blot of luciferase expression units in pSDH-Tet-STARlO, integrated into U-2 OS genomic DNA. Radioactive luciferase DNA probe was used to detect the amount of transgene DNA in the genome of each clone, which was then quantified with a phosphorimager.
  • FIG 16. Copy number-dependence of STAR function. The copy number of pSDH-Tet-STA lO expression units in each clone was determined by phosphorimagery, and compared with the activity of the luciferase reporter enzyme expressed by each clone.
  • FIG 17. Enhancer-blocking and enhancer assays. The luciferase expression vectors used for testing STARs for enhancer-blocking and enhancer activity are shown schematically. The E-box binding site for the E47 enhancer protein is upstream of a cloning site for STAR elements. Downstream of the STAR cloning site is the luciferase gene under control of a human alkaline phosphatase minimal promoter (mp). The histograms indicate the expected outcomes for the three possible experimental situations (see text). Panel A: Enhancer-blocking assay. Panel B: Enhancer assay.
  • enhancer-blockers scs, HS4
  • STAR elements STAR elements 1, 2, 3, 6, 10, 11, 18, and 27
  • FIG 19. Enhancer assay. Luciferase expression from a minimal promoter is activated by the E47/E-box enhancer in the empty vector (E47). Insertion of the scs and HS4 elements or various STAR elements (STARs 1, 2, 3, 6, 10, 11, 18, and 27) do not activate transcription of the reporter gene.
  • FIG 20 The pSS-codA::upp vector used for isolation of SINC elements.
  • the codA::upp suicide gene encodes a protein that converts the pro-drug 5- fluorocytosine to the toxic drug 5 -fluoro uracil.
  • host cells Upon induction by lowered doxycycline concentration, host cells become sensitive to the pro-drug.
  • Genomic DNA fragments inserted at the Bglll cloning site that have silencing activity will prevent expression of the suicide gene and allow formation of pro- drug resistant colonies.
  • STAR elements flank the selection components to prevent spreading of silenced chromatin to the functional components of the plasmid.
  • the plasmid is selected after transfection into mammalian cells with the hygromycin-resistance gene, and after transformation into E. coli with the ampicillin-resistance gene. It replicates episomally in cultured mammalian cells due to the oriP and EBNA-1 sequences, and in E. coli due to the ori sequence.
  • FIG 21 The pSS-hrGFP plasmid is identical to the pSS-codA::upp plasmid, except for replacement of the suicide gene with hrGFP (encoding green fluorescent protein) and of STAR6 with STAR8 downstream of the GFP reporter gene.
  • FIG 22 STAR18 sequence conservation between mouse and human.
  • the region of the human genome containing 497 base pair STAR18 is shown (black boxes); the element occurs between the HOXD8 and HOXD4 homeobox genes on human chromosome 2. It is aligned with a region in mouse chromosome 2 that shares 72% sequence identity.
  • the region of human chromosome 2 immediately to the left of STAR18 is also highly conserved with mouse chromosome 2 (73% identity; gray boxes); beyond these region, the identity drops below 60%.
  • the ability of these regions from human and mouse, either separately or in combination, to confer growth on zeocin is indicated: -, no growth; +, moderate growth; ++, vigorous growth; +++, rapid growth.
  • FIG 23 Schematic diagram of bio-informatic analysis workflow. For details, see text.
  • FIG 24 Results of discriminant analysis on classification of the training set of 65 STAR elements.
  • STAR elements that are correctly classified as STARs by Stepwise Linear Discriminant Analysis (LDA) are shown in a Venn diagram.
  • the variables for LDA were selected from frequency analysis results for hexameric oligonucleotides ("oligos") and for dyads. The diagram indicates the concordance of the two sets of variables in correctly classifying STARs.
  • FIG 25 U-2 OS/Tet-Off/lexA-HPl cells were transfected with candidate Arabidopsis STAR elements and cultivated at low doxycycline concentrations.
  • Sequences comprising STAR1 - STAR65 (SEQ ID:1 - 65) Sequences comprising STAR66 and testing set (SEQ ID:66 - 84), Sequences comprising Arabidopsis STAR A1-A35 (SEQ ID:85-119).
  • a 5' element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila Cell 74, 505-14.
  • a human osteosarcoma cell line secretes a growth factor structurally related to a homodimer of PDGF A-chains. Nature, 319, 511-514.
  • Pseudomonas fluorescens Random mutagenesis by error-prone PCR or a mutator strain and identification of mutants showing enhanced enantioselectivity by a resorufin-based fluorescence assay. Biol Chem, 380, 1029-1033.
  • Chromatin structure of the yeast URA3 gene at high resolution provides insight into structure and positioning of nucleosomes in the chromosomal context. J Mol Biol, 257, 919-934.
  • Expression of the luciferase reporter gene is measured in cell lines containing integrated pSDH plasmids, without ("empty,” the negative control) or containing STAR elements (including the positivie control element, SCS from Drosophila).
  • the mean expression level of the negative control is defined as the reference level, and clones are considered over-expressing if their expression level is >2-fold above the reference level. The percentage of over- expressing clones for each plasmid and the fold over-expression is reported, along with the number of clones analyzed for each plasmid.
  • Chromosomal location is determined by BLAST search of DNA sequence data from the STAR clones against the human genome database. The location is given according to standard nomenclature referring to the cytogenetic ideogram of each chromosome; e.g. Ip2.3 is the third cytogenetic sub-band of the second cytogenetic band of the short arm of chromosome 1 (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Genetics/chiOmbanding.html).
  • F forward sequencing reaction result
  • R reverse sequencing reaction result.N.d., not yet determined.
  • Chromosomal location is determined by BLAST search of DNA sequence data from the STAR clones against the human genome database. The location is given according to standard nomenclature referring to the cytogenetic ideogram of each chromosome; e.g. Ip2.3 is the third cytogenetic sub-band of the second cytogenetic band of the short arm of chromosome 1 (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Genetics/chrombanding.html).
  • Table 4 A Sequence of various star elements in one strand (forward) or the opposite strand (reverse).
  • ATCGTGTCCTTTCCAGGGACATGGATGAAGCTGGAAGCCATCATCCTCAG CAAACTAACACAGGAACAGAAAACCAAATACCACATGTTCTCACTCATAAG TGGGAGCTGAACAGTGAGAACACATGGACACAGGGAGGGGAACATCACA CACCAAGGCCTGTCTGGTGTGGGGAGGGGAGGGAGAGCATCAGGACAAA TAGCTAATGCATGTGGGGCTTAAACCTAGATGACGGGTTGATAGGTGCAG CAATCCACTATGGACACATATACCTATGTAACAACCCNACCTTNTTGACAT GTATCCCAGAACTTAAAGGAAAATAAAAATTAAAAAAAAATTNCCCTGGAA TAAAAAAGAGTGTGGACTTTGGTGAGATN
  • Table 4 B the sequence of various sine elements
  • Chromosomal location is determined by BLAST search of DNA sequence data from the STAR elements against the human genome database. The location is given according to standard nomenclature referring to the cytogenetic ideogram of each chromosome; e.g. Ip2.3 is the third cytogenetic sub-band of the second cytogenetic band of the short arm of chromosome 1
  • oldSTAR ⁇ oldSTAR ⁇
  • oldSTARl4 oldSTARl ⁇
  • oldSTARl ⁇ oldSTARl ⁇
  • the cloned DNAs were chimeras from more than two chromosomal locations; in the case of oldSTAR9 and oldSTAR13, the cloned DNAs were identical to STAR4.
  • lasmid pSDH-Tet-STAR6 was transfected into U-2 OS cells, and clones were isolated and cultivated in doxycycline- free medium as described in Example 1. Cells were transferred to fresh culture vessels weekly at a dilution of 1:20.
  • the number of cell divisions is based on the estimation that in one week the culture reaches cell confluence, which represents -6 cell divisions.
  • the cells were transferred to two culture vessels; one was supplied with culture medium that contained puromycin, as for the first 60 cell divisions, and the second was supplied with culture medium lacking antibiotic.
  • the patterns are ranked according to significance coefficient. These were determined using RSA-Tools with the sequence of the human genome as reference. Patterns that comprise the most discriminant variables in Linear Discriminant Analysis are indicated with an asterisk.
  • the patterns are ranked according to significance coefficient. These were determined using RSA-Tools with the random sequence from the human genome as reference. Patterns that comprise the most discriminant variables in Linear Discriminant Analysis are indicated with an asterisk.
  • Chromosomal location is determined by BLAT search of DNA sequence data from the STAR elements against the human genome database. The location is given according to standard nomenclature referring to the cytogenetic ideogram of each chromosome; e.g. Ip2.3 is the third cytogenetic sub-band of the second cytogenetic band of the short arm of chromosome 1
  • F forward sequencing reaction result
  • R reverse sequencing reaction result
  • Arabidopsis STAR elements of the invention including chromosome location and length

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/NL2002/000390 2001-07-04 2002-06-14 Method of selecting dna sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity Ceased WO2003004704A2 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
NZ530218A NZ530218A (en) 2001-07-04 2002-06-14 DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences
DE60215502T DE60215502T2 (de) 2001-07-04 2002-06-14 Verfahren zur Selektion einer Transkription-Modulatierenden DNA-Sequenz unter Verwendung einem Vektor mit einem Transkriptions-Repressions-Aktivem Element
AU2002314629A AU2002314629B2 (en) 2001-07-04 2002-06-14 Method of selecting DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
JP2003510461A JP4500044B2 (ja) 2001-07-04 2002-06-14 遺伝子転写を調節する特性を含むdna配列及びそのようなdna配列を検出し且つ使用するための方法
MXPA03011801A MXPA03011801A (es) 2001-07-04 2002-06-14 Secuencias de acido desoxirribonucleico (adn) que comprenden cualidades reguladoras de transcripcion de genes y metodos para deteccion y uso de secuencias de acido desoxirribonucleico (adn).
KR1020037017168A KR100951759B1 (ko) 2001-07-04 2002-06-14 유전자 전사 조절 성질을 포함하는 디엔에이 서열 및이러한 디엔에이 서열을 탐지하고 이용하는 방법
DK05076209T DK1600510T3 (da) 2001-07-04 2002-06-14 DNA-sekvenser med antirepressoraktivitet
HK05100936.2A HK1068652B (en) 2001-07-04 2002-06-14 Dna sequences comprising gene transciption regulatory qualities and methods for detecting and using such dna sequences
CA2450020A CA2450020C (en) 2001-07-04 2002-06-14 Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using dna sequences
BRPI0210771A BRPI0210771B8 (pt) 2001-07-04 2002-06-14 construção de dna recombinante, método para a produção de um produto de gene em uma célula, e, uso de uma sequência de dna
EP02741531A EP1404872B1 (en) 2001-07-04 2002-06-14 Method of selecting a dna sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
IL15967402A IL159674A0 (en) 2001-07-04 2002-06-14 Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using such dna sequences
DK02741531T DK1404872T3 (da) 2001-07-04 2002-06-14 Fremgangsmåde til selektion af en DNA-sekvens med transkriptionsmodulerende aktivitet med en vektor indeholdende et element med en gentranskriptionsundertrykkende aktivitet
IL159674A IL159674A (en) 2001-07-04 2004-01-01 DNA sequences that have the ability to regulate transcription and methods for detecting and using these sequences
NO20040011A NO338477B1 (no) 2001-07-04 2004-01-02 DNA-sekvenser med gentranskripsjonsregulatoriske egenskaper samt fremgangsmåter ved påvisning og anvendelse av slike DNA-sekvenser
AU2007234619A AU2007234619B2 (en) 2001-07-04 2007-11-22 Method of selecting DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
IL193373A IL193373A (en) 2001-07-04 2008-08-11 Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using such dna sequences
IL193374A IL193374A (en) 2001-07-04 2008-08-11 Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using such dna sequences
AU2011202193A AU2011202193B2 (en) 2001-07-04 2011-05-11 DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
EP01202581.3 2001-07-04
EP01202581A EP1273666A1 (en) 2001-07-04 2001-07-04 Method of selecting a DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
US30319901P 2001-07-05 2001-07-05
US60/303,199 2001-07-05
US10/190,312 US7192741B2 (en) 2001-07-04 2002-07-05 DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences

Publications (2)

Publication Number Publication Date
WO2003004704A2 true WO2003004704A2 (en) 2003-01-16
WO2003004704A3 WO2003004704A3 (en) 2003-10-16

Family

ID=47915807

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2002/000390 Ceased WO2003004704A2 (en) 2001-07-04 2002-06-14 Method of selecting dna sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity

Country Status (21)

Country Link
US (9) US7192741B2 (https=)
EP (8) EP1806407B1 (https=)
JP (3) JP4500044B2 (https=)
KR (2) KR100942117B1 (https=)
CN (1) CN1266282C (https=)
AT (8) ATE474053T1 (https=)
AU (3) AU2002314629B2 (https=)
BR (1) BRPI0210771B8 (https=)
CA (2) CA2450020C (https=)
CY (1) CY1107678T1 (https=)
DE (8) DE60237048D1 (https=)
DK (8) DK1808488T3 (https=)
ES (8) ES2344070T3 (https=)
IL (4) IL159674A0 (https=)
MX (1) MXPA03011801A (https=)
NO (1) NO338477B1 (https=)
NZ (1) NZ530218A (https=)
PT (1) PT1600510E (https=)
SG (1) SG143066A1 (https=)
WO (1) WO2003004704A2 (https=)
ZA (1) ZA200309599B (https=)

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004009618A2 (en) 2002-07-18 2004-01-29 Crucell Holland B.V. Recombinant production of mixtures of antibodies
WO2003106674A3 (en) * 2002-06-14 2004-03-04 Chromagenics Bv Use of repression blocking sequences in methods for enhancing gene expression
WO2005033320A1 (en) 2003-10-02 2005-04-14 Crucell Holland B.V. Packaging cells for recombinant adenovirus
WO2006048459A2 (en) 2004-11-08 2006-05-11 Chromagenics B.V. Selection of host cells expressing protein at high levels
WO2005059149A3 (en) * 2003-12-12 2006-05-26 Chromagenics Bv Improved protein production
WO2006005718A3 (en) * 2004-07-08 2006-08-17 Chromagenics Bv Novel sequence for improving expression of nucleic acid
US7192741B2 (en) 2001-07-04 2007-03-20 Chromagenics B.V. DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences
US7364878B2 (en) 2002-06-14 2008-04-29 Chromagenics B.V. Method for simultaneous production of multiple proteins; vectors and cells for use therein
US7413896B2 (en) 2002-12-18 2008-08-19 Chromagenics B.V. Method for improving protein production
US7919257B2 (en) 2003-05-30 2011-04-05 Merus Biopharmaceuticals, B.V.I.O. Method for selecting a single cell expressing a heterogeneous combination of antibodies
US7968700B2 (en) 2006-03-20 2011-06-28 Chromagenics B.V. Expression augmenting DNA fragments, use thereof, and methods for finding thereof
US8039230B2 (en) 2004-11-08 2011-10-18 Chromagenics B.V. Selection of host cells expressing protein at high levels
WO2012030218A1 (en) 2010-09-01 2012-03-08 Cellagenics B.V. Nucleic acid fragments from a ribosomal protein promoter for enhancing gene expression
US8263393B2 (en) 2002-12-20 2012-09-11 Chromagenics B.V. Means and methods for producing a protein through chromatin openers that are capable of rendering chromatin more accessible to transcription factors
US8268756B2 (en) 2004-01-20 2012-09-18 Merus B.V. Mixture of binding proteins
WO2013157954A1 (en) 2012-04-20 2013-10-24 Merus B.V. Methods and means for the production of ig-like molecules
US8771984B2 (en) 2004-11-08 2014-07-08 Chromagenics B.V. Selection of host cells expressing protein at high levels
US8999667B2 (en) 2004-11-08 2015-04-07 Chromagenics B.V. Selection of host cells expressing protein at high levels
US9045776B2 (en) 2006-07-26 2015-06-02 Boehringer Ingelheim Pharma Gmbh & Co. Kg Regulatory nucleic acid elements
US9228004B2 (en) 2004-11-08 2016-01-05 Chromagenics B.V. Selection of host cells expressing protein at high levels
US9284563B2 (en) 2009-06-15 2016-03-15 Cellagenics B.V. Stringent selectable markers
US9914777B2 (en) 2015-07-10 2018-03-13 Merus N.V. Human CD3 binding antibody
US10358492B2 (en) 2012-09-27 2019-07-23 Merus N.V. Bispecific IgG antibodies as T cell engagers
USRE47770E1 (en) 2002-07-18 2019-12-17 Merus N.V. Recombinant production of mixtures of antibodies
US10844127B2 (en) 2014-02-28 2020-11-24 Merus N.V. Antibodies that bind EGFR and ErbB3
EP3772518A1 (en) 2019-08-07 2021-02-10 Merus N.V. Modified human variable domains
US11180572B2 (en) 2012-07-06 2021-11-23 Genmab B.V. Dimeric protein with triple mutations
WO2021235936A1 (en) 2020-05-21 2021-11-25 Merus N.V. Methods and means for the production of ig-like molecules
US11237165B2 (en) 2008-06-27 2022-02-01 Merus N.V. Antibody producing non-human animals
US11279770B2 (en) 2014-02-28 2022-03-22 Merus N.V. Antibody that binds ErbB-2 and ErbB-3
US11773170B2 (en) 2017-08-09 2023-10-03 Merus N.V. Antibodies that bind EGFR and cMET
US11780925B2 (en) 2017-03-31 2023-10-10 Merus N.V. ErbB-2 and ErbB3 binding bispecific antibodies for use in the treatment of cells that have an NRG1 fusion gene
US11939394B2 (en) 2015-10-23 2024-03-26 Merus N.V. Binding molecules that inhibit cancer growth
US12195551B2 (en) 2017-05-17 2025-01-14 Merus N.V. Combination of an ErbB-2/ErbB-3 bispecific antibody with endocrine therapy for breast cancer

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1786908B1 (en) * 2004-08-18 2010-03-03 Bayer CropScience AG Plants with increased plastidic activity of r3 starch-phosphorylating enzyme
US20100136616A1 (en) * 2004-11-08 2010-06-03 Chromagenics B.V. Selection of Host Cells Expressing Protein at High Levels
CA2587712C (en) * 2004-11-18 2013-02-12 National University Of Corporation Hiroshima University Method and kit for expressing protein under regulation of the expression from repeated sequence formed by gene amplification and transformant
JP2010515435A (ja) * 2007-01-08 2010-05-13 ミリポア・コーポレイション 遺伝子増幅を不要とする高発現細胞株
US8566596B2 (en) 2010-08-24 2013-10-22 Cisco Technology, Inc. Pre-association mechanism to provide detailed description of wireless services
US10417380B1 (en) 2013-12-31 2019-09-17 Mckesson Corporation Systems and methods for determining and communicating a prescription benefit coverage denial to a prescriber
US10489552B2 (en) 2014-02-14 2019-11-26 Mckesson Corporation Systems and methods for determining and communicating patient incentive information to a prescriber
US10157262B1 (en) 2015-03-10 2018-12-18 Mckesson Corporation Systems and methods for determining patient financial responsibility for multiple prescription products
US11514137B1 (en) 2016-03-30 2022-11-29 Mckesson Corporation Alternative therapy identification system
US10999224B1 (en) 2017-02-01 2021-05-04 Mckesson Corporation Method and apparatus for parsing an electronic message and constructing multiple differently prioritized messages therefrom
US10862832B1 (en) 2018-07-24 2020-12-08 Mckesson Corporation Computing system and method for automatically reversing an action indicated by an electronic message
US11043437B2 (en) 2019-01-07 2021-06-22 Applied Materials, Inc. Transparent substrate with light blocking edge exclusion zone
US12469040B1 (en) 2019-06-26 2025-11-11 Mckesson Corporation Method, apparatus, and computer program product for providing real-time pricing information
US12525327B1 (en) 2019-06-26 2026-01-13 Mckesson Corporation Method, apparatus, and computer program product for providing real-time pricing information
US11562437B1 (en) 2019-06-26 2023-01-24 Mckesson Corporation Method, apparatus, and computer program product for providing estimated prescription costs
US11636548B1 (en) 2019-06-26 2023-04-25 Mckesson Corporation Method, apparatus, and computer program product for providing estimated prescription costs
US20230104317A1 (en) * 2020-01-31 2023-04-06 The Board Of Trustees Of The Leland Stanford Junior University Systems and Methods to Identify Genetic Silencers and Applications Thereof
US12229834B1 (en) 2020-02-17 2025-02-18 Mckesson Corporation Method, apparatus, and computer program product for partitioning prescription transaction costs in an electronic prescription transaction
US12229833B1 (en) 2020-02-17 2025-02-18 Mckesson Corporation Method, apparatus, and computer program product for reformatting an electronic prescription transaction
US11610240B1 (en) 2020-02-17 2023-03-21 Mckesson Corporation Method, apparatus, and computer program product for partitioning prescription transaction costs in an electronic prescription transaction
US11587657B2 (en) 2020-09-04 2023-02-21 Mckesson Corporation Method, apparatus, and computer program product for performing an alternative evaluation procedure in response to an electronic message
US12367954B1 (en) 2021-01-08 2025-07-22 Mckesson Corporation Method, apparatus, and computer program product for estimating a target quantitative measure based upon historical electronic messages
US12518304B1 (en) 2021-01-26 2026-01-06 Mckesson Corporation Method, apparatus, and computer program product for estimating a target quantitative measure based upon historical electronic messages
CN113539357B (zh) * 2021-06-10 2024-04-30 阿里巴巴达摩院(杭州)科技有限公司 基因检测方法、模型训练方法、装置、设备及系统
US12197972B1 (en) 2022-03-28 2025-01-14 Mckesson Corporation Method, apparatus, and computer program product for generating alternative evaluation messages

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US719271A (en) * 1902-01-13 1903-01-27 Solomon P Smith Furnace.
US5610053A (en) 1993-04-07 1997-03-11 The United States Of America As Represented By The Department Of Health And Human Services DNA sequence which acts as a chromatin insulator element to protect expressed genes from cis-acting regulatory sequences in mammalian cells
US5972605A (en) 1994-07-07 1999-10-26 Geron Corporation Assays for regulators of mammalian telomerase expression
CN1184506A (zh) * 1995-03-24 1998-06-10 盐野义制药株式会社 基因表达抑制相关性dna分子和新的蛋白质
DE19539493A1 (de) * 1995-10-24 1997-04-30 Thomae Gmbh Dr K Starker homologer Promotor aus Hamster
US5773695A (en) 1996-01-26 1998-06-30 North Carolina State University Plant nuclear scaffold attachment region and method for increasing gene expression in transgenic cells
US6037525A (en) * 1996-08-01 2000-03-14 North Carolina State University Method for reducing expression variability of transgenes in plant cells
US5888809A (en) 1997-05-01 1999-03-30 Icos Corporation Hamster EF-1α transcriptional regulatory DNA
AU771111B2 (en) 1998-07-21 2004-03-11 Emd Millipore Corporation A polynucleotide comprising a ubiquitous chromatin opening element (UCOE)
ES2292251T3 (es) 1998-08-14 2008-03-01 Chromagenics B.V. Procedimiento de deteccion de una secuencia de adn, procedimiento de preparacion de una construccion de adn y uso de los mismos.
US6521419B1 (en) 1998-09-22 2003-02-18 Kanakaraju Koduri Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
US6800457B2 (en) 1998-09-22 2004-10-05 Bristol-Myers Squibb Company Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
WO2000023606A1 (en) 1998-10-22 2000-04-27 Medical College Of Georgia Institute, Inc. Long terminal repeat, enhancer, and insulator sequences for use in recombinant vectors
EP1210411B1 (en) * 1999-08-25 2006-10-18 Immunex Corporation Compositions and methods for improved cell culture
US6586205B1 (en) 2000-02-11 2003-07-01 Millennium Pharmaceuticals, Inc. 43239 a novel GPCR-like molecule and uses thereof
AU2001238178A1 (en) 2000-02-11 2001-08-20 Millennium Pharmaceuticals, Inc. Seven-transmembrane proteins/g-protein coupled receptors
KR100996016B1 (ko) 2000-09-20 2010-11-22 밀리포어 코포레이션 폴리뉴클레오티드
PT1600510E (pt) 2001-07-04 2007-06-25 Chromagenics Bv Sequências de adn com actividade anti-repressora.
EP1273666A1 (en) 2001-07-04 2003-01-08 Chromagenics B.V. Method of selecting a DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
CA2489475C (en) * 2002-06-14 2011-03-29 Chromagenics B.V. A method for simultaneous production of multiple proteins; vectors and cells for use therein
WO2003106674A2 (en) 2002-06-14 2003-12-24 Chromagenics B.V. Means and methods for regulating gene expression
ATE524559T1 (de) 2002-12-18 2011-09-15 Chromagenics Bv Methode zur verbesserung der proteinproduktion
ATE354645T1 (de) 2002-12-20 2007-03-15 Chromagenics Bv Mittel und methoden zur produktion eines proteins durch chromatin-öffner, die chromatin zugänglicher für transkriptionsfaktoren machen können

Cited By (83)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7192741B2 (en) 2001-07-04 2007-03-20 Chromagenics B.V. DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences
US7736868B2 (en) 2001-07-04 2010-06-15 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7655441B2 (en) 2001-07-04 2010-02-02 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7951586B2 (en) 2001-07-04 2011-05-31 Chromagenics B.V. DNA sequences comprising gene transcription regulatory qualities and methods for detecting and using such DNA sequences
US7662591B2 (en) 2001-07-04 2010-02-16 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7736869B2 (en) 2001-07-04 2010-06-15 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7736870B2 (en) 2001-07-04 2010-06-15 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7749733B2 (en) 2001-07-04 2010-07-06 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7659094B2 (en) 2001-07-04 2010-02-09 Chromagenics B.V. Nucleic acid sequences having gene transcription regulatory qualities
US7901908B2 (en) 2002-06-14 2011-03-08 Chromagenics B.V. Method for simultaneous production of multiple proteins; vectors and cells for use therein
US7364878B2 (en) 2002-06-14 2008-04-29 Chromagenics B.V. Method for simultaneous production of multiple proteins; vectors and cells for use therein
WO2003106674A3 (en) * 2002-06-14 2004-03-04 Chromagenics Bv Use of repression blocking sequences in methods for enhancing gene expression
US7794977B2 (en) 2002-06-14 2010-09-14 Chromagenics B.V. Means and methods for regulating gene expression
US7267965B2 (en) 2002-06-14 2007-09-11 Chromagenics B.V. Means and methods for regulating gene expression
US7960143B2 (en) 2002-06-14 2011-06-14 Chromagenics B.V. Method for simultaneous production of multiple proteins; vectors and cells for use therein
US7932360B2 (en) 2002-07-18 2011-04-26 Merus B.V. Recombinant production of mixtures of antibodies
US9303081B2 (en) 2002-07-18 2016-04-05 Merus B.V. Recombinant production of mixtures of antibodies
US7429486B2 (en) 2002-07-18 2008-09-30 Crucell Holland B.V. Recombinant production of mixtures of antibodies
WO2004009618A2 (en) 2002-07-18 2004-01-29 Crucell Holland B.V. Recombinant production of mixtures of antibodies
EP2314629A1 (en) 2002-07-18 2011-04-27 Merus B.V. Recombinant production of mixtures of antibodies
US7262028B2 (en) 2002-07-18 2007-08-28 Crucell Holland B.V. Recombinant production of mixtures of antibodies
USRE47770E1 (en) 2002-07-18 2019-12-17 Merus N.V. Recombinant production of mixtures of antibodies
US7927834B2 (en) 2002-07-18 2011-04-19 Merus B.V. Recombinant production of mixtures of antibodies
US10934571B2 (en) 2002-07-18 2021-03-02 Merus N.V. Recombinant production of mixtures of antibodies
US8173422B2 (en) 2002-12-18 2012-05-08 Chromagenics B.V. Method for improving protein production
US7413896B2 (en) 2002-12-18 2008-08-19 Chromagenics B.V. Method for improving protein production
US8263393B2 (en) 2002-12-20 2012-09-11 Chromagenics B.V. Means and methods for producing a protein through chromatin openers that are capable of rendering chromatin more accessible to transcription factors
US7919257B2 (en) 2003-05-30 2011-04-05 Merus Biopharmaceuticals, B.V.I.O. Method for selecting a single cell expressing a heterogeneous combination of antibodies
US10670599B2 (en) 2003-05-30 2020-06-02 Merus N.V. Method for selecting a single cell expressing a heterogeneous combination of antibodies
US10605808B2 (en) 2003-05-30 2020-03-31 Merus N.V. Antibody producing non-human animals
US9738701B2 (en) 2003-05-30 2017-08-22 Merus N.V. Method for selecting a single cell expressing a heterogeneous combination of antibodies
WO2005033320A1 (en) 2003-10-02 2005-04-14 Crucell Holland B.V. Packaging cells for recombinant adenovirus
US8114637B2 (en) 2003-10-02 2012-02-14 Crucell Holland B.V. Packaging cells for recombinant adenovirus
US7816104B2 (en) 2003-10-02 2010-10-19 Crucell Holland B.V. Packaging cells for recombinant adenovirus
WO2005059149A3 (en) * 2003-12-12 2006-05-26 Chromagenics Bv Improved protein production
US9012371B2 (en) 2004-01-20 2015-04-21 Merus B.V. Mixtures of binding proteins
US8268756B2 (en) 2004-01-20 2012-09-18 Merus B.V. Mixture of binding proteins
CN1981057B (zh) * 2004-07-08 2012-07-04 科罗迈吉尼科斯公司 改良核酸表达的新序列
EA011747B1 (ru) * 2004-07-08 2009-06-30 Хромагеникс Б.В. Молекула рекомбинантной нуклеиновой кислоты, обладающая антирепрессорной активностью, и способы ее применения
JP2008505626A (ja) * 2004-07-08 2008-02-28 クロマジェニックス ベー ヴェー 核酸の発現を改善するための新規配列
WO2006005718A3 (en) * 2004-07-08 2006-08-17 Chromagenics Bv Novel sequence for improving expression of nucleic acid
NO341862B1 (no) * 2004-07-08 2018-02-12 Chromagenics Bv Ny sekvens for forbedring av ekspresjon av nukleinsyre(r)
US7825232B2 (en) 2004-07-08 2010-11-02 Chromagenics B.V. Sequence for improving expression of nucleic acid
WO2006048459A2 (en) 2004-11-08 2006-05-11 Chromagenics B.V. Selection of host cells expressing protein at high levels
US9228004B2 (en) 2004-11-08 2016-01-05 Chromagenics B.V. Selection of host cells expressing protein at high levels
US8039230B2 (en) 2004-11-08 2011-10-18 Chromagenics B.V. Selection of host cells expressing protein at high levels
US8999667B2 (en) 2004-11-08 2015-04-07 Chromagenics B.V. Selection of host cells expressing protein at high levels
US8771984B2 (en) 2004-11-08 2014-07-08 Chromagenics B.V. Selection of host cells expressing protein at high levels
US7968700B2 (en) 2006-03-20 2011-06-28 Chromagenics B.V. Expression augmenting DNA fragments, use thereof, and methods for finding thereof
US9045776B2 (en) 2006-07-26 2015-06-02 Boehringer Ingelheim Pharma Gmbh & Co. Kg Regulatory nucleic acid elements
US9708626B2 (en) 2006-07-26 2017-07-18 Boehringer Ingelheim International Gmbh Regulatory nucleic acid elements
US11237165B2 (en) 2008-06-27 2022-02-01 Merus N.V. Antibody producing non-human animals
US9284563B2 (en) 2009-06-15 2016-03-15 Cellagenics B.V. Stringent selectable markers
US10106799B2 (en) 2009-06-15 2018-10-23 Cellagenics B.V. Stringent selectable markers
US9650630B2 (en) 2010-09-01 2017-05-16 Cellagenics B.V. Nucleic acid fragments from a ribosomal protein promoter for enhancing gene expression
WO2012030218A1 (en) 2010-09-01 2012-03-08 Cellagenics B.V. Nucleic acid fragments from a ribosomal protein promoter for enhancing gene expression
WO2013157954A1 (en) 2012-04-20 2013-10-24 Merus B.V. Methods and means for the production of ig-like molecules
US10337045B2 (en) 2012-04-20 2019-07-02 Merus N.V. Methods and means for the production of Ig-like molecules
WO2013157953A1 (en) 2012-04-20 2013-10-24 Merus B.V. Methods and means for the production of ig-like molecules
US10329596B2 (en) 2012-04-20 2019-06-25 Merus N.V. Methods and means for the production of Ig-like molecules
EP3594233A1 (en) 2012-04-20 2020-01-15 Merus N.V. Methods and means for the production of ig-like molecules
EP3594232A1 (en) 2012-04-20 2020-01-15 Merus N.V. Methods and means for the production of ig-like molecules
US12123043B2 (en) 2012-04-20 2024-10-22 Merus N.V. Methods and means for the production of Ig-like molecules
US9758805B2 (en) 2012-04-20 2017-09-12 Merus N.V. Methods and means for the production of Ig-like molecules
US10752929B2 (en) 2012-04-20 2020-08-25 Merus N.V. Methods and means for the production of ig-like molecules
US11926859B2 (en) 2012-04-20 2024-03-12 Merus N.V. Methods and means for the production of Ig-like molecules
US11180572B2 (en) 2012-07-06 2021-11-23 Genmab B.V. Dimeric protein with triple mutations
US12060418B2 (en) 2012-09-27 2024-08-13 Merus N.V. Bispecific IgG antibodies as T cell engagers
US10358492B2 (en) 2012-09-27 2019-07-23 Merus N.V. Bispecific IgG antibodies as T cell engagers
US10844127B2 (en) 2014-02-28 2020-11-24 Merus N.V. Antibodies that bind EGFR and ErbB3
US11279770B2 (en) 2014-02-28 2022-03-22 Merus N.V. Antibody that binds ErbB-2 and ErbB-3
US11820825B2 (en) 2014-02-28 2023-11-21 Merus N.V. Methods of treating a subject having an EGFR-positive and/or ErbB-3-positive tumor
US9914777B2 (en) 2015-07-10 2018-03-13 Merus N.V. Human CD3 binding antibody
US11739148B2 (en) 2015-07-10 2023-08-29 Merus N.V. Human CD3 binding antibody
US10266593B2 (en) 2015-07-10 2019-04-23 Merus N.V. Human CD3 binding antibody
US11939394B2 (en) 2015-10-23 2024-03-26 Merus N.V. Binding molecules that inhibit cancer growth
US11780925B2 (en) 2017-03-31 2023-10-10 Merus N.V. ErbB-2 and ErbB3 binding bispecific antibodies for use in the treatment of cells that have an NRG1 fusion gene
US12247078B2 (en) 2017-03-31 2025-03-11 Merus N.V. ERBB-2 and ERBB-3 binding bispecific antibodies for use in the treatment of cells that have an NRG1 fusion gene
US12195551B2 (en) 2017-05-17 2025-01-14 Merus N.V. Combination of an ErbB-2/ErbB-3 bispecific antibody with endocrine therapy for breast cancer
US11773170B2 (en) 2017-08-09 2023-10-03 Merus N.V. Antibodies that bind EGFR and cMET
WO2021025555A1 (en) 2019-08-07 2021-02-11 Merus N.V. Modified human variable domains
EP3772518A1 (en) 2019-08-07 2021-02-10 Merus N.V. Modified human variable domains
WO2021235936A1 (en) 2020-05-21 2021-11-25 Merus N.V. Methods and means for the production of ig-like molecules

Also Published As

Publication number Publication date
KR100942116B1 (ko) 2010-02-12
EP1829972A2 (en) 2007-09-05
DK1404872T3 (da) 2007-02-19
AU2011202193B2 (en) 2011-09-29
PT1600510E (pt) 2007-06-25
JP2010131025A (ja) 2010-06-17
BR0210771A (pt) 2004-07-13
US20070031936A1 (en) 2007-02-08
DE60236333D1 (de) 2010-06-17
DE60219221T2 (de) 2008-01-03
DK1600510T3 (da) 2007-06-25
ZA200309599B (en) 2006-05-31
DK1829972T3 (da) 2010-09-13
WO2003004704A3 (en) 2003-10-16
EP1808488B1 (en) 2010-07-14
EP1808488A3 (en) 2007-11-14
EP1404872B1 (en) 2006-10-18
KR100942117B1 (ko) 2010-02-12
IL159674A0 (en) 2004-06-20
EP1829972A3 (en) 2007-10-24
US20070026499A1 (en) 2007-02-01
US7736869B2 (en) 2010-06-15
NZ530218A (en) 2005-09-30
CA2812799A1 (en) 2003-01-16
ATE343004T1 (de) 2006-11-15
ES2274045T3 (es) 2007-05-16
BRPI0210771B1 (pt) 2015-12-22
IL159674A (en) 2009-02-11
DE60236332D1 (de) 2010-06-17
CA2812799C (en) 2016-01-26
CY1107678T1 (el) 2013-04-18
US20070031933A1 (en) 2007-02-08
EP1845162B1 (en) 2010-05-05
EP1842919B1 (en) 2010-05-05
US7655441B2 (en) 2010-02-02
DK1806407T3 (da) 2010-08-16
EP1600510B1 (en) 2007-03-28
EP1806407A3 (en) 2008-06-04
EP1600510A2 (en) 2005-11-30
DE60215502T2 (de) 2007-08-30
DE60236331D1 (de) 2010-06-17
ATE474053T1 (de) 2010-07-15
US7192741B2 (en) 2007-03-20
ES2344072T3 (es) 2010-08-17
US7736870B2 (en) 2010-06-15
EP1600510A3 (en) 2006-02-22
ATE467682T1 (de) 2010-05-15
US7659094B2 (en) 2010-02-09
EP1829971A3 (en) 2008-06-04
US20070026498A1 (en) 2007-02-01
DE60237048D1 (de) 2010-08-26
ATE466942T1 (de) 2010-05-15
DE60236379D1 (de) 2010-06-24
EP1806407B1 (en) 2010-05-05
EP1404872A2 (en) 2004-04-07
JP4500044B2 (ja) 2010-07-14
US7749733B2 (en) 2010-07-06
KR20090037485A (ko) 2009-04-15
JP2004533262A (ja) 2004-11-04
DE60236334D1 (de) 2010-06-17
EP1842919A1 (en) 2007-10-10
MXPA03011801A (es) 2005-03-07
US7951586B2 (en) 2011-05-31
ATE466941T1 (de) 2010-05-15
ES2285630T3 (es) 2007-11-16
US7736868B2 (en) 2010-06-15
US20070031935A1 (en) 2007-02-08
AU2011202193A1 (en) 2011-06-02
ES2344070T3 (es) 2010-08-17
DK1842919T3 (da) 2010-08-16
IL193373A (en) 2010-12-30
ES2344073T3 (es) 2010-08-17
ATE466943T1 (de) 2010-05-15
HK1068652A1 (en) 2005-04-29
EP1829972B1 (en) 2010-05-12
IL193374A (en) 2010-12-30
JP2010131024A (ja) 2010-06-17
NO20040011L (no) 2004-03-03
AU2007234619B2 (en) 2011-06-02
AU2002314629B2 (en) 2007-08-30
EP1808488A2 (en) 2007-07-18
US20030199468A1 (en) 2003-10-23
CN1524128A (zh) 2004-08-25
DK1829971T3 (da) 2010-08-16
ATE358183T1 (de) 2007-04-15
US7662591B2 (en) 2010-02-16
JP5014444B2 (ja) 2012-08-29
EP1829971B1 (en) 2010-05-05
CN1266282C (zh) 2006-07-26
ES2344071T3 (es) 2010-08-17
ATE466944T1 (de) 2010-05-15
DK1845162T3 (da) 2010-08-16
AU2007234619A1 (en) 2007-12-13
EP1845162A1 (en) 2007-10-17
EP1806407A2 (en) 2007-07-11
BRPI0210771B8 (pt) 2021-05-25
NO338477B1 (no) 2016-08-22
DE60219221D1 (de) 2007-05-10
ES2348174T3 (es) 2010-11-30
EP1829971A1 (en) 2007-09-05
US20070031934A1 (en) 2007-02-08
ES2344074T3 (es) 2010-08-17
JP5014443B2 (ja) 2012-08-29
DK1808488T3 (da) 2010-10-18
KR20090037960A (ko) 2009-04-16
SG143066A1 (en) 2008-06-27
CA2450020C (en) 2013-08-13
DE60215502D1 (de) 2006-11-30
US20070037256A1 (en) 2007-02-15
US20070128717A1 (en) 2007-06-07
CA2450020A1 (en) 2003-01-16

Similar Documents

Publication Publication Date Title
AU2007234619B2 (en) Method of selecting DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
AU2002314629A1 (en) Method of selecting DNA sequence with transcription modulating activity using a vector comprising an element with a gene transcription repressing activity
JP2004533262A5 (https=)
CA2812821C (en) Dna sequences comprising gene transcription regulatory qualities and methods for detecting and using such dna sequences

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ CZ DE DE DK DK DM DZ EC EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2450020

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 200309599

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: PA/a/2003/011801

Country of ref document: MX

Ref document number: 2002314629

Country of ref document: AU

Ref document number: 530218

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1020037017168

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 159674

Country of ref document: IL

Ref document number: 1/KOLNP/2004

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 20028135717

Country of ref document: CN

Ref document number: 2003510461

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002741531

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002741531

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 530218

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 530218

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 2002741531

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 193373

Country of ref document: IL

Ref document number: 193374

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020097003928

Country of ref document: KR

Ref document number: 1020097003929

Country of ref document: KR