Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/18—Carboxylic ester hydrolases (3.1.1)
  • C12N9/20—Triglyceride splitting, e.g. by means of lipase
• • C—CHEMISTRY; METALLURGY
  • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
  • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
  • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
  • C11D3/16—Organic compounds
  • C11D3/38—Products with no well-defined composition, e.g. natural products
  • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
  • C11D3/38627—Preparations containing enzymes, e.g. protease or amylase containing lipase

Definitions

• Detergent enzymes have been marketed for more than 20 years and are today well established as normal detergent ingredients in both powder and liquid detergent all over the world.
• Lipolytic enzymes i.e. enzymes classified under the Enzyme Classification number E.C. 3.1.1 (Carboxylic Ester Hydrolases) in accordance with the Recommendations (1992) of the International Union of Biochemistry and Molecular Biology (IUBMB)
• E.C. 3.1.1 Carboxylic Ester Hydrolases
• IUBMB International Union of Biochemistry and Molecular Biology
• modified lipolytic enzymes such as variants and mutants having improved properties for detergent purposes.
• lipolytic enzymes with improved washing performance have been constructed by site-directed mutagenesis resulting in substitution of specific amino acid residues which have been chosen either on the basis of their type or on the basis of their location in the secondary or tertiary structure of the mature enzyme.
• lipolytic enzymes by site-directed mutagenesis to obtain an improved performance, inparticular washing performance of lipolytic enzymes.
• the generally used concept has been to insert, delete or substitute amino acids within the structural part of the amino acid chain of the parent lipolytic enzyme in question. Lipolytic enzymes with a significantly improved washing performance have been achieved this way.
• the invention relates to a modified enzyme with lipolytic activity which as compared to its parent enzyme has one or more peptide additions in its C-terminal and/or N-terminal end.
• the term "parent" enzyme in intended to indicate the enzyme to be modified according to the invention.
• the parent enzyme may be a naturally-occuring (or wild type) enzyme or may be a variant thereof prepared by any suitable means.
• the parent enzyme may be a variant of a naturally-occurring enzyme which has been modified by substitution, deletion or truncation of one or more amino acid residues or by addition or insertion of one or more amino acid residues to the amino acid sequence of a naturally-occurring enzyme, typically in the structural part of the enzyme.
• Figure 1 shows the nucleotide and amino acid sequence of the coding region of the Hwnicola lanuginosa lipase gene as present in the yeast expression vector pJSO37.
• the signal sequence (amino acids 1 to 17) is the original signal sequence from Hwnicola lanuginosa.
• the SPIRR peptide addition is located at amino acid residue 18 to 22.
• Amino acid residue 23 (E) is the first amino acid residue of the parent lipase expressed in Aspergillus oryzae.
• Figure 2 shows the nucleotide and amino acid sequence of the coding region of the Hwnicola lanuginosa lipase gene as present in the E. coli expression vector pJSO215.
• the signal sequence (amino acids 1 to 20) is the A. lyticus protease I signal (WO 96/17943).
• the SPIRR peptide is added after amino acid residue 20.
• Amino acid residue 26 (E) is the first amino acid residue of the parent lipase expressed in Aspergillus oryzae.
• a significantly improved wash performance of lipolytic enzymes may be achieved when an appropriate peptide addition is applied to a non-structural part of the enzyme in its mature form or at the C-terminal and/or N-terminal end of the mature enzyme.
• improved wash performance is intended to indicate that the modified enzyme of the invention has a better lipid soil removing capability than the unmodified parent enzyme when tested under wash like conditions.
• the improvement is often indicated in terms of "an improvement factor” (f improve) (further reference vide the Materials and Methods section further below).
• an improvement factor (f improve) in the range of 1-5 , or even up to 10 (such as in the range of 1-10) has been obtained. It is presently believed that even higher improvement factors such as up to 20, even up 30, or even up to 50, such as between 30 and 50, or even higher may be achieved in accordance with the present invention.
• the improved wash performance effected by the peptide addition is, at least in part, due to an increased affinity of the modified lipolytic enzyme towards its lipid substrate (although this may not be the only reason).
• the term "modified enzyme" is intended to indicate a derivative or a variant of a parent enzyme, which derivative or variant as compared to the parent enzyme comprises a peptide addition at the C-terminal and/or N-terminal end (fused to the first and/or last amino acid residue of the parent enzyme) and/or within the non-structural part of the C- and/or N-teminal end of the parent enzyme.
• the modified enzyme may comprise a peptide addition at either the N-terminal or the C-terminal end or both in the N- and the C-terminal ends of the parent lipolytic enzyme.
• the peptide addition comprises at least one proline residue in order to protect the modified lipolytic enzyme against proteolytic degradation during the processing of the enzyme by the host cell of choice. It may be desirable that the proline residue occupies position two (i.e. b) and/or three (i.e. c) of the peptide addition or a position close to the desired cleavage point (i.e. the point where processing by the host cell in question is believed to occur). Accordingly, in one embodiment b and optionally c of the peptide addition is Pro In another embodiment of the invention a-b is SP (Ser-Pro), A-P or Q-P.
• peptides comprising more than 7 amino acids, such as from 8 to 15 amino acids.
• Such peptides can be generalised as:
• the peptide addition may replace one or more of the amino acid residues of said non-structural part.
• the peptide addition may replace one or more amino acid residues occupying the first, e.g. 1-5, amino acid residues of the N-terminal end and/or the last, e.g. 1-5, amino acids of the enzyme (i.e. the 1-5 amino acid residues of the C-terminal end).
• the peptide addition may replace amino acid residue(s) 1 and/or 2 and/or 3 and/or 4, and/or 5, etc. from either end of the parent enzyme.
• the term "applied to” is intended to indicate that the addition is fused to the N- and/or C-terminal end (e.g. to the first or last amino acid residue) of the mature enzyme or inserted into a non-structural part of the N-terminal and/or C-terminal end of the mature enzyme.
• the insertion/addition of a DNA sequence encoding the peptide addition can be carried out by any standard techniques known by any skilled person in the field of molecular biology, cf., e.g. Sambrook et al., 1989). This include, e.g., the polymerase chain reaction (PCR) using specific primers, for instance described in US patent 4,683,202 or R.K. Saiki et al., (1988), Science, 239, 487-491. How to provide for the expression and secretion of adjacent DNA sequence(s) will be described below.
• PCR polymerase chain reaction
• suitable expression system is intended to indicate an expression system (host cell and optionally expression vector) which allows for at least a portion of an intact desired modified enzyme to be produced, i.e. an expression system which does not, e.g. as part of the posttranslational or other processing by the host cell of choice, remove part or all of the peptide addition (and thereby produce the enzyme without the desired peptide addition).
• the expression system to be used is devoid of one or more proteolytic activities exerting the undesired posttranslational processing. The choice of expression system and thus host cell will depend on the lipolytic enzyme to be produced as wiD be discussed in detail further below.
• a modified lipolytic enzyme according to the invention may be obtained by expressing a DNA sequence encoding the parent lipolytic enzyme in question in an expression system which is incapable of processing the translated polypeptide in the normal manner, and thereby results in the production of an enzyme which comprises a part of or the entire propeptide or a similar peptide sequence associated with the mature protein prior to its processing.
• the propeptide or similar peptide sequence constitutes the peptide addition.
• the invention relates to a method for increasing the wash performance or other activity of a parent enzyme, comprising the steps of:
• the screening criteria of step c) will have to be chosen in dependence of the desired properties of the modified lipolytic enzyme. If it is desirable to construct a modified lipolytic enzyme with an improved wash performance the screening is conveniently conducted for a reduced dependency to calcium and/or an improved tolerance towards a detergent or a detergent component.
• the detergent or detergent component may be any of the specific components mentioned further below in the Detergent Composition section.
• a preferred detergent component is a non-ionic or an anionic surfactant such as an alcohol ethoxylate or LAS, a preferred detergent is the detergent PCS described in the Materials and methods section below.
• Non-ionic surfactants are of particular interest for screening of H. lanuginosa type of lipases (e.g. fungal lipases) whereas an-ionic surfactants are of interest for screening of Pseudomonas type lipases.
• a microorganism capable of expressing the modified lipolytic enzyme of interest is incubated on a suitable medium and under suitable conditions for the enzyme to be secreted, the medium being provided with a double filter comprising a first protein-binding filter and on top of that a second filter exhibiting a low protein binding capability.
• the microorganism is located on the second filter.
• the first filter comprising enzymes secreted from the microorganisms is separated from the second filter comprising the micro organisms.
• the first filter is subjected to screening for the desired enzymatic activity and the corresponding microbial colonies present on the second filter are identified.
• the filter used for binding the enzymatic activity may be any protein binding filter e.g. nylon or nitrocellulose.
• the topfilter carrying the colonies of the expression organism may be any filter that has no or low affinity for binding proteins e.g. cellulose acetate or DuraporeTM.
• the filter may be pretreated with any of the conditions to be used for screening or may be treated during the detection of enzymatic activity.
• the host cell may be of a different origin than the parent enzyme, e.g. of another genus than the one from which the parent enzyme is derived, or may have another posttranslational processing machinery than the source of the parent enzyme.
• the parent lipolytic enzyme is preferably derived from a filamentous fungus, such as a strain of a Hwnicola sp. , in particular H. lanuginosa, or a bacterium, such as a strain of a Pseudomonas sp., and the host cell is a yeast celll, such as a strain of Saccharomyces sp., in particular Saccharomyces cerevisiae, or a strain of Hansenula sp..
• a filamentous fungus such as a strain of a Hwnicola sp. , in particular H. lanuginosa
• a bacterium such as a strain of a Pseudomonas sp.
• the host cell is a yeast celll, such as a strain of Saccharomyces sp., in particular Saccharomyces cerevisiae, or a strain of Hansenula sp..
• step b) expressing the mutated DNA sequence obtained in step a) in a host cell
• Non-structural part of the C-terminus or N-terminus of the parent enzyme in its mature form, e.g. by deleting or replacing a negatively charged amino acid residue of the non-structural part with a neutral or positively charged amino acid residue or with a hydrophobic amino acid residue, or replacing a neutral amino acid residue with a positively charged amino acid residue.
• Parent lipolytic enzyme e.g. by deleting or replacing a negatively charged amino acid residue of the non-structural part with a neutral or positively charged amino acid residue or with a hydrophobic amino acid residue, or replacing a neutral amino acid residue with a positively charged amino acid residue.
• modified lipolytic enzymes of the invention may be constructed from any parent lipolytic enzymes of microbial origin, preferably of bacterial or fungal (i.e. filamentous fungal or yeast) origin.
• the enzyme of the invention may be any lipolytic enzyme including lipases, phospholipases, esterases and cutinases (according to conventional terminology).
• Examples of relevant parent lipolytic enzymes include enzymes derived from the following microorganisms:
• Humicola e.g. H. brevispora, H. lanuginosa, H. brevis var. thermoidea and H. insolens
• Pseudomonas e.g. Ps. fragi, Ps. stutzeri, Ps. cepacia and Ps. fluorescens (WO 89/04361), or Ps. plantarii or Ps. gladioli (US patent no. 4,950,417 (Solvay enzymes)) or Ps. alc ⁇ ligenes and Ps. pseudoalcaligenes (EP 218 272 or WO 94/25578) or Ps. mendocina (WO 88/09367; US 5,389,536);
• Mucor also called Rhizomucor, e.g. M. miehei (EP 238 023);
• Rhizopus e.g. R. delemar (Hass et al., (1991), Gene 109,107-113) or R. mveus (Kugimiya et al. , (1992) Biosci.Biotech. Biochem 56, 716-719) or R. oryzae; and Bacillus, e.g. B. subtilis (Dartois et al., (1993) Biochemica et Biophysica acta 1131, 253-260) or B. stearothermophilus (JP 64/7744992) or B. pwnilus (WO91/16422).
• the Entrez Browser at the NCBI (National Center for Biotechnology Information), this relates Thermomyces lanuginosus to families like Eremascaceae, Monoascaceae, Pseudoeurotiaceae and Trichocomaceae, the latter containing genera like Emericella, Aspergillus, Penicillium, Eupenicillium, Paecilomyces, Talaromyces, Thermoascus and Sclerocleista.
• lipolytic enzymes specifically contemplated according to the invention are Lumafast® (a Ps. mendocina lipase from Genencor Int. Inc); Lipomax ® (a Ps. pseudoalcaligenes lipase from Genencor Int. Inc.); a Fusarium solani lipase (cutinase) from Lumafast® (a Ps. mendocina lipase from Genencor Int. Inc); Lipomax ® (a Ps. pseudoalcaligenes lipase from Genencor Int. Inc.); a Fusarium solani lipase (cutinase) from Lumafast® (a Ps. mendocina lipase from Genencor Int. Inc); Lipomax ® (a Ps. pseudoalcaligenes lipase from Genencor Int. Inc.); a Fusarium solani lipase (cutinase) from Lumafast® (a Ps. mendocin
• the DNA sequence encoding the parent enzyme with lipolytic activity (to be processed into a modified enzyme of the invention) is the DNA sequence encoding the enzyme with lipolytic activity derived from the filamentous fungi Hwnicola lanuginosa described in EP 305 216.
• the amino acid sequence of the parent enzyme is in this case that of the secreted mature enzyme.
• pumilus xylosidase gene pumilus xylosidase gene, and the prokaryotic beta-lactamase or tryptophan gene (Villa-Kamaroflf et al., 1978, Proceedings of the National Academy of Sciences USA 75:3727-3731), as well as the tac gene (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80:21-25).
• Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook et al., 1989, supra.
• suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes encoding A.
• promoters for use in filamentous fungal host cells is the TAKA amylase and the glaA promoters.
• promoters from yeast glycolytic genes Hitzeman et al.,(1980), J. Biol. Chem. 255, 12073-12080; Alber and Kawasaki, (1982), J. Mol. Appl. Gen.
• ENO-1 cerevisiae enolase gene
• S. cerevisiae 3-phosphoglycerate kinase gene the S. cerevisiae alpha- factor
• S. cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase genes ADH2/GAP
• the nucleic acid constructs of the present invention may also comprise one or more nucleic acid sequences which encode one or more factors that are advantageous in the expression of the modified lipolytic enzyme, e.g., an activator (e.g., a trans-acting factor), a chaperone, and a processing protease.
• an activator e.g., a trans-acting factor
• a chaperone e.g., a chaperone
• processing protease e.g., a processing protease.
• the nucleic acids encoding one or more of these factors are not necessarily in tandem with the nucleic acid sequence encoding the modified lipolytic enzyme.
• the nucleic acid sequence encoding a chaperone may be obtained from the genes encoding B. subtilis GroE proteins, A. oryzae protein disulphide isomerase, S. cerevisiae calnexin, S. cerevisiae BLP/GRP78, and S. cerevisiae Hsp70.
• B. subtilis GroE proteins A. oryzae protein disulphide isomerase
• S. cerevisiae calnexin S. cerevisiae BLP/GRP78
• S. cerevisiae Hsp70 S. cerevisiae Hsp70.
• regulatory sequences which allow the regulation of the expression of the modified lipolytic enzyme relative to the growth of the host cell.
• regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
• Regulatory systems in prokaryotic systems would include the lac, tac, and trp operator systems.
• yeast the ADH2 system or GAL1 system may be used.
• filamentous fungi the TAKA alpha-amylase promoter, A. niger glucoamylase promoter, and the A. oryzae glucoamylase promoter may be used as regulatory sequences.
• Other examples of regulatory sequences are those which allow for gene amplification.
• these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals.
• the nucleic acid sequence encoding the modified lipolytic enzyme would be placed in tandem with the regulatory sequence.
• the recombinant expression vector may be any vector which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence.
• the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
• the vectors may be linear or closed circular plasmids.
• the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
• the vector may contain any means for assuring self-replication.
• the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosomes) into which it has been integrated.
• the vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.
• a selectable marker for use in a filamentous fungal host cell may be selected from the group including, but not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), and glufosinate resistance markers, as well as equivalents from other species.
• amdS acetamidase
• argB ornithine carbamoyltransferase
• bar phosphinothricin acetyltransferase
• hygB hygromycin phosphotransferase
• amdS and pyrG markers of A. nidulans or A. oryzae are preferred for use in an Aspergillus cell.
• selection may be accomplished by co-transformation, e.g., as described in WO 91/17243, where the selectable marker is on a separate vector.
• the vectors of the present invention preferably contain an element(s) that permit* stable integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome of the cell.
• the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination.
• the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
• the integrational elements may be non-encoding or encoding nucleic acid sequences.
• the vector may be integrated into the genome of the host cell by non-homologous recombination.
• These nucleic acid sequences may be any sequence that is homologous with a target sequence in the genome of the host cell, and, furthermore, may be non-encoding or encoding sequences.
• the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
• origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, pACYC184, pUB110, pE194, pTA1060, and pAMß1.
• origin of replications for use in a yeast host cell are the 2 micron origin of replication, the combination of CEN6 and ARS4, and the combination of CEN3 and ARS1.
• the origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433).
• Integration of the vector into the host chromosome may occur by homologous or non-homologous recombination as described above.
• the choice of a host cell will to a large extent depend upon the gene encoding the modified lipolytic enzyme and its source.
• the choice of host cell will often depend on the proteolytic enzyme system of the host cell and its impact on the production of a modified lipolytic enzyme of the invention. Accordingly, it may be desirable to use a host cell which is deficient in one or more proteolytic enzymes or other enzyme processing means.
• Protease deficient host cells of bacteria as well as fungal (filamentous fungal and yeast) cells are well-known in the art.
• the host cell may be a unicellular microorganism or a non-unicellular microorganism.
• Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B.circulans, B. lautus, B. megaterium, and B. thuringiensis, or a Streptomyces cell, e.g., S. lividans or S. murinus, or gram negative bacteria such as E.
• a Bacillus cell e.g., B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquef
• yeast and manipulation of yeast genetics are well known in the art (see, e.g., Biochemistry and Genetics of Yeast, Bacil, M., Horecker, B.J., and Stopani, A.O.M., editors, 2nd edition, 1987; The Yeasts, Rose, A.H., and Harrison, J.S., editors, 2nd edition, 1987; and The Molecular Biology of the Yeast Saccharomyces, Strathem et al., editors, 1981).
• yeast cells which typically have another proteolytic enzyme processing system that, e.g., bacteria and filamentous fungi, may be of particular use for preparing modified lipolytic enzymes which, as the peptide addition, comprise a part or all of the natural prosequences of the parent lipolytic enzyme in question.
• the fungal host cell is a yeast cell (e.g. to be used in applying a peptide addition (in the form of part of or the entire prosequence of the parent enzyme
• the yeast host cell may be a cell of a species of Candida, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Pichia, or Yarr ⁇ wia, such as a S.
• cerevisiae cell a S.s carlsbergensis, a S. diastaticus cell, a S. douglasii cell, a S. kluyveri cell, a S. norbensis cell, or a S. oviformis cell.
• Basidiomycota include mushrooms, rusts, and smuts.
• Representative groups of Chytridiomycota include, e.g., Allomyces, Blastocladiella, Coelomomyces, and aquatic fungi.
• Representative groups of Oomycota include, e.g., Saprolegniomycetous aquatic fungi (water molds) such as Achlya. Examples of mitosporic fungi include Aspergillus, Penicillium, Candida, and Alternaria.
• Representative groups of Zygomycota include, e.g., Rhizopus and Mucor.
• the fungal host cell is a filamentous fungal cell.
• the filamentous fungal host cell is a cell of a species of, but not limited to,
• the filamentous fungal host cell is an Aspergillus cell. In another even more preferred embodiment, the filamentous fungal host cell is a Fusarium cell. In a most preferred embodiment, the filamentous fungal host cell is an A. oryzae cell, an A. niger cell, an A.foetidus cell, or an A. japonicus cell. In another most preferred embodiment, the filamentous fungal host cell is a Fusarium oxysporum cell or a F. graminearum cell.
• Host cells used according to the invention may advantagously be protease deficient or protease minus strains (or the like), such as strains deficient of proteases, especially exoproteases, capable of cleaving the modified lipolytic enzyme at a site close to the peptide addition (in certain case being the propeptide).
• TPAP tripeptidyl-aminopeptidases
• DPAP dipeptidyl-aminopeptidases
• Kex2-like protease and therefore not capable of cleaving at di-basic site such as Arg- Arg (RR) .
• Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the modified lipolytic enzyme is secreted into the nutrient medium, the modified lipolytic enzyme can be recovered directly from the medium. If the modified lipolytic enzyme is not secreted, it is recovered from cell lysates.
• the resulting modified lipolytic enzyme may be recovered by methods known in the art.
• the modified lipolytic enzyme may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray- drying, evaporation, or precipitation.
• the recovered modified lipolytic enzyme may then be further purified by a variety of chromatographic procedures, e.g., ion exchange chromatography, gel filtration chromatography, affinity chromatography, or the like.
• a peptide addition is applied to the parent enzyme by cultivating a host cell comprising a DNA sequence encoding the pre, pro or prepro-form of the parent lipolytic enzyme, the DNA sequence optionally being present on a vector, and recovering the resulting modified lipolytic enzyme.
• the host cell, cultivation condition and/or recovery conditions being selected so that at the most a partial processing of the pre, pro or preproform of the parent enzyme has occured resulting in that at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 50% or at least 75% of the produced modified enzyme molecules comprises the desired , e.g. the entire pre- sequence or a substantial part thereof
• Enzyme composition of the invention is selected so that at the most a partial processing of the pre, pro or preproform of the parent enzyme has occured resulting in that at least 5%, such as at least 10%, such as at least 15%, such as at least 20%, such as at least 25%, such as at least 50%
• the host cell does not process all of the modified lipolytic enzyme molecules expressed by that host at the same cleavage site, resulting in a modified enzyme product consisting of a portion having the full length peptide addition and one or more other portions with only a part of the peptide addition.
• the inventors found that this does not influence the wash performance significantly. Consequently, even though not all of the lipolytic enzyme of the enzyme composition of the invention may have retained the full length peptide addition the enzyme composition is still capable of exerting the desired effect, such as an improved wash performance.
• the surfactant is preferably formulated to be compatible with enzyme components present in the composition.
• the surfactant is most preferably formulated such that it promotes, or at least does not degrade, the stability of any enzyme in these compositions.
• Nonionic detergent surfactants normally consist of a water-solubilizing polyalkoxylene or a mono- or di-alkanolamide group in chemical combination with an organic hydrophobic group derived, for example, from alkylphenols in which the alkyl group contains from about 6 to about 12 carbon atoms, dialkylphenols in which each alkyl group contains from 6 to 12 carbon atoms, primary, sedondary or tertiary aliphatic alcohols (or alkylcapped derivatives thereof), preferably having from 8 to 20 carbon atoms, monocarboxylic acids having from 10 to about 24 carbon atoms in the alkyl group and polyproxylenes.
• a polyglycoside, hydrophillic group containing from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 saccharide units.
• Any reducing saccharide containing 5 or 6 carbon atoms can be used, e.g., glucose, galactose and galactosyl moieties can be substituted for the glucosyl moieties (optionally the hydrophobic group is attached at the 2-, 3-, 4-, etc. positions thus giving a glucose or galactose as opposed to a glucoside or galactoside).
• the intersaccharide bonds can be, e.g., between the one position of the additional saccharide units and the 2-, 3-, 4-, and/or 6- positions on the preceding saccharide units.
• Another useful nonionic surfactant is a glycoside of a uronic acid, a uronic acid salt or a uronic acid lactone or polyuronic acid with a straight-chain or branced saturated or unsaturated aliphatic chain of from 6 to 24 carbon atoms, optionally containing an aromatic, cycloaliphatic, mixed aromatic-aliphatic or polyalkyloxyalkyl radical, as described in WO 95/10524.
• R 2 O(C n H 2n O) t (glycosyl) x
• R 2 is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3, preferably 2; t is from 0 to about 10, preferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7.
• the glycosyl is preferably derived from glucose.
• nonionic detergent compounds include long chain tertiary amine oxides, long chain tertiary phosphine oxides and dialkyl sulphoxides.
• alkyl alkoxylated sulfate surfactants hereof are water soluble salts or acids of the formula RO(A) m SO 3 M wherein R is an unsubstituted C 10 -C- 24 alkyl or hydroxyalkyl group having a C 10 -C 24 alkyl component, preferably a C 12 -C 20 alkyl or hydroxyalkyl, more preferably C 12 -C 18 alkyl or hydroxyalkyl, A is an ethoxy or propoxy unit, m is greater than zero, typically between about 0.5 and about 6, more preferably between about 0.5 and about 3, and M is H or a cation which can be, for example, a metal cation (e.g., sodium, potassium, lithium, calcium, magnesium, etc.), ammonium or substituted-ammonium cation.
• R is an unsubstituted C 10 -C- 24 alkyl or hydroxyalkyl group having a C 10 -C 24 alkyl component,
• Alkyl ethoxylated sulfates as well as alkyl propoxylated sulfates are contemplated herein.
• Specific examples of substituted ammonium cations include methyl-, dimethyl, trimethyl-ammonium cations and quaternary ammonium cations such as tetramethyl-ammonium and dimethyl piperdinium cations and those derived from alkylamines such as ethylamine, diethylamine, triethylamine, mixtures thereof, and the like.
• Suitable anionic surfactants to be used are alkyl ester sulfonate surfactants including linear esters of C 8 -C 20 carboxylic acids (i.e., fatty acids) which are sulfonated with gaseous SO 3 according to "The Journal of the American Oil Chemists Society", 52 (1975), pp. 323-329. Suitable starting materials would include natural fatty substances as derived from tallow, palm oil, etc.
• the preferred alkyl ester sulfonate surfactant, especially for laundry applications comprise alkyl ester sulfonate surfactants of the structural formula:
• R 3 is a C 8 -C 20 hydrocarbyl, preferably an alkyl, or combination thereof
• R 4 is a C 1 -C 6 hydrocarbyl, preferably an alkyl, or combination thereof
• M is a cation which forms a water soluble salt with the alkyl ester sulfonate.
• Suitable salt-forming cations include metals such as sodium, potassium, and lithium, and substituted or unsubstituted ammonium cations, such as monoethanolamine, diethonolamine, and triethanolamine.
• R 3 is C 10 -C 16 alkyl
• R 4 is methyl, ethyl or isopropyl.
• the methyl ester sulfonates wherein R 3 is C 10 -C 16 alkyl.
• alkylamines such as ethylamine, diethylamine, triethylamine, and mixtures thereof, and the like.
• alkyl chains of C 12 -C 16 are preferred for lower wash temperatures (e.g. below about 50°C) and C 16 -C 18 alkyl chains are preferred for higher wash temperatures (e.g. above about 50°C).
• Other anionic surfactants useful for detersive purposes can also be included in the laundry detergent compositions of the present invention.
• Resin acids and hydrogenated resin acids are also suitable, such as rosin, hydrogenated rosin, and resin acids and hydrogenated resin acids present in or derived from tall oil.
• Alkylbenzene sulfonate is highly preferred, in particular linear alkyl benzene sulfonate (LAS) where the alkyl group contains preferably from 10 to 18 carbon atoms.
• the laundry detergent compositions of the present invention may also contain cationic, ampholytic, zwitterionic, and semi-polar surfactants, as well as the nonionic and/or anionic surfactants other than those already described herein.
• Cationic detersive surfactants suitable for use in the laundry detergent compositions of the present invention are those having one long-chain hydrocarbyl group.
• cationic surfactants include the ammonium surfactants such as alkyltrimethylammonium halogenides, and those surfactants having the formula:
• R 2 is an alkyl or alkyl benzyl group having from about 8 to about 18 carbon atoms in the alkyl chain
• each R 3 is selected form the group consisting of -CH 2 CH 2 -, - CH 2 CH(CH 3 )-, -CH 2 CH(CH 2 OH)-, -CH 2 CH 2 CH 2 -, and mixtures thereof
• each R 4 is selected from the group consisting of C 1 -C 4 alkyl, C 1 -C 4 hydroxyalkyl, benzyl ring structures formed by joining the two R 4 groups, -CH 2 CHOHCHOHCOR 6 CHOHCH 2 OH wherein R 6 is any hexose or hexose polymer having a molecular weight less than about
• R 5 is the same as R 4 or is an alkyl chain wherein the total number of carbon atoms or R 2 plus R 5 is not more than about 18; each y is from 0 to about 10 and the sum of the y values is form 0 to about 15; and X is any compatible anion.
• Highly preferred cationic surfactants are the water soluble quaternary ammonium compounds useful in the present composition having the formula: R 1 R 2 R 3 R 4 N + X- (i) wherein R, is C 8 -C 16 alkyl, each of R 2 , R 3 and R 4 is independently C 1 -C 4 alkyl, C 1 -C 4 hydroxy alkyl, benzyl, and -(C 2 H 40 ) x H where x has a value from 2 to 5, and X is an anion. Not more than one of R 2 , R 3 or R 4 should be benzyl.
• the preferred alkyl chain length for R 1 is C 12 -C 15 particularly where the alkyl group is a mixture of chain lengths derived from coconut or palm kernel fat or is derived synthetically by olefin build up or OXO alcohols synthesis.
• Preferred groups for R 2 R 3 and R 4 are methyl and hydroxyethyl groups and the anion X may be selected from halide, methosulphate, acetate and phosphate ions. Examples of suitable quaternary ammonium compounds of formulae (i) for use herein are:
• the laundry detergent compositions of the present invention typically comprise from 0.2% to about 25%, preferably from about 1 % to about 8% by weight of such cationic surfactants.
• Ampholytic surfactants are also suitable for use in the laundry detergent compositions of the present invention. These surfactants can be broadly described as aliphatic derivatives of secondary or tertiary amines, or aliphatic derivatives of heterocyclic secondary and tertiary amines in which the aliphatic radical can be straight- or branched-chain.
• One of the aliphatic substituents contains at least about 8 carbon atoms, typically from about 8 to about 18 carbon atoms, and at least one contains an anionic water-solubilizing group, e.g. carboxy, sulfonate, sulfate. See US 3,929,678 (column 19, lines 18-35) for examples of ampholytic surfactants.
• the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1 % to about 10% by weight of such ampholytic surfactants.
• Semi-polar nonionic surfactants are a special category of nonionic surfactants which include water-soluble amine oxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; watersoluble phosphine oxides containing one alkyl moiety of form about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; and water-soluble sulfoxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and a moiety selected from the group consisting of alkyl and hydroxyalkyl moieties of from about 1 to about 3 carbon atoms.
• Semi-polar nonionic detergent surfactants include the amine oxide surfactants having the formula:
• R 3 is an alkyl, hydroxyalkyl, or alkyl phenyl group or mixtures thereof containing from about 8 to about 22 carbon atoms
• R 4 is an alkylene or hydroxyalkylene group containing from about 2 to about 3 carbon atoms or mixtures thereof
• x is from 0 to about 3
• each R 5 is an alkyl or hydroxyalkyl group containing from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups.
• the R 5 groups can be attached to each other, e.g., through an oxygen or nitrogen atom, to form a ring structure.
• amine oxide surfactants in particular include C 10 -C 18 alkyl dimethyl amine oxides and C 8 -C 12 alkoxy ethyl dihydroxy ethyl amine oxides.
• the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1 % to about 10% by weight of such semi-polar nonionic surfactants.
• Builder system
• Suitable builders can be an inorganic ion exchange material, commonly an inorganic hydrated aluminosilicate material, more particularly a hydrated synthetic zeolite such as hydrated zeolite A, X, B, HS or MAP.
• Another suitable inorganic buUder material is layered silicate, e.g. SKS-6 (Hoechst). SKS-6 is a crystalline layered silicate consisting of sodium silicate (Na 2 Si 2 O 5 ).
• Suitable polycarboxylates containing one carboxy group include lactic acid, glycolic acid and ether derivatives thereof as disclosed in BE 831,368, BE 821,369 and BE 821,370.
• Polycarboxylates containing two carboxy groups include the water-soluble salts of succinic acid, malonic acid, (ethylenedioxy) diacetic acid, maleic acid, diglycollic acid, tartaric acid, tartronic acid and fumaric acid, as well as the ether carboxylates described in DE 2,446,686, DE 2,446,487, US 3,935,257 and the sulfinyl carboxylates described in BE 840,623.
• Polycarboxylates containing three carboxy groups include, in particular, water-soluble citrates, aconitrates and citraconates as well as succinate derivatives such as the carboxymethyloxysuccinates described in GB 1,379,241, lactoxysuccinates described in NL application 7205873, and the oxypolycarboxylate materials such as 2-oxa-1,1,3-propane tricarboxylates described in GB 1,387,447.
• Polycarboxylates containing four carboxy groups include oxydisuccinates disclosed in GB 1,261,829, 1,1, 2,2, -ethane tetracarboxylates, 1,1,3,3-propane tetracarboxylates containing sulfo substituents include the sulfosuccinate derivatives disclosed in GB 1,398,421 and GB 1,398,422 and in US 3,936,448, and the sulfonated pyrolysed citrates described in GB 1,082,179, while polycarboxylates containing phosphone substituents are disclosed in GB 1,439,000.
• Alicyclic and heterocyclic polycarboxylates include cyclopentane-cis,cis-cis-tetracarboxylates, cyclopentadienide pentacarboxylates, 2,3,4,5-tetrahydro-furan - cis, cis, cis-tetracarboxylates, 2,5-tetrahydro-furan-cis, discarboxylates, 2,2,5,5,- tetrahydrofuran - tetracarboxylates, 1,2,3,4,5,6-hexane - hexacarboxylates and carboxymethyl derivatives of polyhydric alcohols such as sorbitol, mannitol and xylitol.
• Aromatic polycarboxylates include mellitic acid, pyromellitic acid and the phthalic acid derivatives disclosed in GB 1,425,343. Of the above, the preferred polycarboxylates are hydroxycarboxylates containing up to three carboxy groups per molecule, more particularly citrates.
• Preferred builder systems for use in the present compositions include a mixture of a water-insoluble aluminosilicate builder such as zeolite A or of a layered silicate (SKS-6), and a water-soluble carboxylate chelating agent such as citric acid.
• a suitable chelant for inclusion in the detergent compositions in accordance with the invention is ethylenediamine-N,N'-disuccinic acid (EDDS) or the alkali metal, alkaline earth metal, ammonium, or substituted ammonium salts thereof, or mixtures thereof.
• Preferred EDDS compounds are the free acid form and the sodium or magnesium salt thereof. Examples of such preferred sodium salts of EDDS include Na 2 EDDS and Na ⁇ DDS. Examples of such preferred magnesium salts of EDDS include MgEDDS and Mg 2 EDDS. The magnesium salts are the most preferred for inclusion in compositions in accordance with the invention.
• Preferred builder systems include a mixture of a water-insoluble aluminosilicate builder such as zeolite A, and a water soluble carboxylate chelating agent such as citric acid.
• Polymers of this type are disclosed in GB-A-1 ,596,756.
• Examples of such salts are polyacrylates of MW 2000-5000 and their copolymers with maleic anhydride, such copolymers having a molecular weight of from 20,000 to 70,000, especially about 40,000.
• Detergency builder salts are normally included in amounts of from 5% to 80% by weight of the composition. Preferred levels of builder for liquid detergents are from 5% to 30%. Enzymes
• Preferred detergent compositions in addition to the enzyme of the invention, comprise other enzyme(s) which provides cleaning performance and/or fabric care benefits.
• enzymes include proteases, lipases, cutinases, amylases, cellulases, peroxidases, oxidases (e.g. laccases).
• protease suitable for use in alkaline solutions can be used. Suitable proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically or genetically modified mutants are included.
• the protease may be a serine protease, preferably an alkaline microbial protease or a trypsin-like protease.
• alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtifisin 168 (described in WO 89/06279).
• trypsin-like proteases are trypsin (e.g. of porcine or bovine origin) and the Fusarium protease described in WO 89/06270.
• Preferred commercially available protease enzymes include those sold under the tradenames Alcalase, Savinase, Primase, Durazym, and Esperase by Novo Nordisk A/S (Denmark), those sold under the tradename Maxatase, Maxacal, Maxapem and Properase by Gist- Brocades/Genencor, those sold under the tradename Purafect and Purafect OXP by Genencor International, and those sold under the tradename Opticlean and Optimase by Solvay Enzymes.
• Protease enzymes may be incorporated into the compositions in accordance with the invention at a level of from 0.0001 % to 2% of enzyme protein by weight of the composition, in particular at a level of from 0.001 % to 0.1 % of enzyme protein by weight of the composition.
• Lipases Any lipase suitable for use in alkaline solutions can be used. Suitable lipases include those of bacterial or fungal origin and chemically or genetically modified lipase mutants.
• useful lipases include a Humicola lanuginosa lipase, e.g., as described in EP 258 068 and EP 305 216, and mutants thereof as described in WO 92/05249, WO 94/25577 and WO 95/22615 a Rhizomucor miehei lipase, e.g., as described in EP 238 023, a Candida lipase, such as a C. antarctica lipase, e.g., the C. antarctica lipase A or B described in EP 214 761 , a Pseudomonas lipase such as a P. alcaligenes and P.
• a Humicola lanuginosa lipase e.g., as described in EP 258 068 and EP 305 216
• mutants thereof as described in WO 92/05249, WO 94/25577 and WO 95/22615
• pseudoalcaligenes lipase e.g., as described in EP 218 272, or any mutant of said Pseudomonas lipases, a P. cepacia lipase, e.g., as described in EP 331 376, a P. stutzeri lipase, e.g., as disclosed in BP 1,372,034, a P. fluorescens lipase, a Bacillus lipase. e.g., a B. subtilis lipase (Dartois et al., (1993), Biochemica et Biophysica acta 1131, 253-260), a B. stearothermophilus lipase (JP 64/744992) and a B. pumilus lipase (WO 91/16422).
• Geotricum candidum lipase (Schimada, Y. et al., (1989), J. Biochem., 106, 383-388), and various Rhizopus lipases such as a R. delemar lipase (Hass, M.J et al., (1991), Gene
• lipolytic enzymes such as cutinases may also be useful, e.g. , a cutinase derived from Pseudomonas mendocina as described in WO 88/09367, or a cutinase derived from Fusarium solani pisi (e.g. described in WO 90/09446).
• a cutinase derived from Pseudomonas mendocina as described in WO 88/09367 or a cutinase derived from Fusarium solani pisi (e.g. described in WO 90/09446).
• lipases such as Ml LipaseTM, Luma fastTM and LipomaxTM (Gist-Brocades/Genencor), LipolaseTM and Lipolase UltraTM (Novo Nordisk A/S), and Lipase P "Amano” (Amano Pharmaceutical Co. Ltd.).
• the lipases are normally incorporated in the detergent composition at a level of from 0.0001 % to 2% of enzyme protein by weight of the detergent composition, in particular at a level of from 0.001 % to 0.1 % of enzyme protein by weight of the composition.
• Amylases Any amylase (a and/or b) suitable for use in alkaline solutions can be used. Suitable amylases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included. Amylases include, for example, a-amylases obtained from a special strain of B. licheniformis. described in more detail in GB 1,296,839. Commercially available amylases are DuramylTM, TermamylTM, FungamylTM and BANTM (available from Novo Nordisk A/S) and RapidaseTM and Maxamyl PTM (available from (Gist-Brocades/Genencor) .
• amylases are normally inco ⁇ orated in the detergent composition at a level of from 0.0001 % to 2% of enzyme protein by weight of the detergent composition, in particular at a level of from 0.001 % to 0.1 % of enzyme protein by weight of the composition.
• Peroxidases/Oxidases Peroxidases/Oxidases: Peroxidase and/or oxidase enzymes are used in combination with hydrogen peroxide or oxygen sources, e.g., percarbonate, perborate, persulfate, hydrogen peroxide, oxygen, etc. They are used for "Solution bleaching", i.e.
• Suitable peroxidases/oxidases include those of plant, bacterial or fungal origin. Chemically or genetically modified mutants are included.
• Said peroxidase and/or oxidase enzymes are normally inco ⁇ orated in the detergent composition at a level of from 0.0001 % to 2% of enzyme protein by weight of the detergent composition, in particular at a level of from 0.001 % to 0.1 % of enzyme protein by weight of the composition.
• Mixtures of the above mentioned enzymes are encompassed herein, in particular a mixture of a protease, an amylase, a lipase and/or a cellulase.
• the hydrogen peroxide releasing agents can be used in combination with bleach activators such as tetraacetylethylenediamine (TAED), nonanoyloxybenzenesulfonate (NOBS, described in US 4,412,934), 3,5-trimethylhexsanoloxybenzenesulfonate (ISONOBS, described in EP 120 591) or pentaacetylglucose (PAG), which are perhydrolyzed to form a peracid as the active bleaching species, leading to improved bleaching effect.
• bleach activators such as tetraacetylethylenediamine (TAED), nonanoyloxybenzenesulfonate (NOBS, described in US 4,412,934), 3,5-trimethylhexsanoloxybenzenesulfonate (ISONOBS, described in EP 120 591) or pentaacetylglucose (PAG), which are perhydrolyzed to form a peracid as the
• Imine quaternary salts may used as a bleach catalyst together with a peroxygen compound as described in WO 95/13352.
• the hydrogen peroxide may also be present by adding an enzymatic system (i.e. an enzyme and a substrate therefore) which is capable of generation hydrogen peroxide at the beginning or during the washing and/or rinsing process.
• an enzymatic system i.e. an enzyme and a substrate therefore
• Such enzymatic systems are disclosed in published EP Patent Application No 0537381.
• the release of peracid from a peroxygen bleach source may be activated by use of a lipase of the invention.
• the necessary components for the enzymatic hydrolysis system is the peracid precursor substrate: a diacyl peroxide R 1 -CO-O-O-CO-R, where R and R 1 may be saturated or unsaturated alkyl, an aryl group or an alkaryl.
• R and R 1 may be saturated or unsaturated alkyl, an aryl group or an alkaryl.
• the lipase reacts with the substrate and releases peracids in the wash.
• Bleaching agents other than oxygen bleaching agents are also known in the art and can be utilized herein.
• One type of non-oxygen bleaching agent of particular interest includes photoactivated bleaching agents such as the sulfonated zinc and/or aluminum phthalocyanines. These materials can be deposited upon the substrate during the washing process. Upon irradiation with light, in the presence of oxygen, such as by hanging clothes out to dry in the daylight, the sulfonated zinc phthalocynaine is activated and, consequently, the substrate is bleached.
• Preferred zinc phthalocyanine and a photoactivated bleaching process are described in US 4,033,718.
• detergent composition will contain about 0.025% to about 1.25%, by weight, of sulfonated zinc phthalocyanine.
• Bleaching agents may also comprise a manganese catalyst.
• the manganese catalyst may, e.g. , be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 369. 1994, pp. 637-639.
• Suds suppressors Another optional ingredient is a suds suppressor, exemplified by silicones, and silica-silicone mixtures.
• Silicones can be generally represented by alkylated polysiloxane materials while silica is normally used in finely divided forms exemplified by silica aerogels and xerogels and hydrophobic silicas of various types. Theses materials can be inco ⁇ orated as particulates in which the suds suppressor is advantageously releasably inco ⁇ orated in a water-soluble or waterdispersible, substantially non surface-active detergent impermeable carrier. Alternatively the suds suppressor can be dissolved or dispersed in a liquid carrier and applied by spraying on to one or more of the other components.
• Such suds suppressor system are described in published European Patent Application No. 0593841.
• Especially preferred silicone suds controlling agents are described in published European Patent Application No. 0573699.
• Said compositions can comprise a silicone/ silica mixture in combination with fumed nonporous silica such as Aerosil R .
• the suds suppressors described above are normally employed at levels of from 0.001 % to 2% by weight of the composition, preferably from 0.01 % to 1 % by weight.
• compositions may be employed such as soil-suspending agents, soil-releasing agents, optical brighteners, abrasives, bactericides, tarnish inhibitors, coloring agents, and/or encapsulated or nonencapsulated perfumes.
• encapsulating materials are water soluble capsules which consist of a matrix of polysaccharide and polyhydroxy compounds such as described in GB 1,464,616.
• Suitable water soluble encapsulating materials comprise dextrins derived from ungelatinized starch acid esters of substituted dicarboxylic acids such as described in US 3,455,838. These acid-ester dextrins are, preferably, prepared from such starches as waxy maize, waxy sorghum, sago, tapioca and potato. Suitable examples of said encapsulation materials include N-Lok manufactured by National Starch. The N-Lok encapsulating material consists of a modified maize starch and glucose. The starch is modified by adding monofunctional substituted groups such as octenyl succinic acid anhydride.
• Antiredeposition and soil suspension agents suitable herein include cellulose derivatives such as methylcellulose, carboxymethylcellulose and hydroxyethylcellulose, and homo- or co-polymeric polycarboxylic acids or their salts.
• Polymers of this type include the polyacrylates and maleic anhydride-acrylic acid copolymers, e.g Sokalan CP5, previously mentioned as builders, as well as copolymers of maleic anhydride with ethylene, methylvinyl ether or methacrylic acid, the maleic anhydride constituting at least 20 mole percent of the copolymer. These materials are normally used at levels of from 0.5 % to 10% by weight, more preferably form 0.75% to 8%, most preferably from 1 % to 6% by weight of the composition.
• polyethylene glycols particularly those of molecular weight 1000-10000, more particularly 2000 to 8000 and most preferably about 4000. These are used at levels of from 0.20% to 5% more preferably from 0.25% to 2.5% by weight. These polymers and the previously mentioned homo- or co-polymeric polycarboxylate salts are valuable for improving whiteness maintenance, fabric ash deposition, and cleaning performance on clay, proteinaceous and oxidizable soils in the presence of transition metal impurities.
• a graft polymer as described in WO 95/22593 may also be used.
• Soil release agents useful in compositions of the present invention are conventionally copolymers or terpolymers of terephthalic acid with ethylene glycol and/or propylene glycol units in various arrangements. Examples of such polymers are disclosed in US 4,116,885, US 4,711,730 and EP 0 272 033.
• a particular preferred polymer in accordance with EP 0 272 033 has the formula:
• modified polyesters as random copolymers of dimethyl terephthalate, dimethyl sulfoisophthalate, ethylene glycol and 1-2 propane diol, the end groups consisting primarily of sulphobenzoate and secondarily of mono esters of ethylene glycol and/or propane-diol.
• the target is to obtain a polymer capped at both end by sulphobenzoate groups, "primarily ,, , in the present context most of said copolymers herein will be endcapped by sulphobenzoate groups.
• some copolymers will be less than fully capped, and therefore their end groups may consist of monoester of ethylene glycol and/or propane 1-2 diol, thereof consist “secondarily” of such species.
• the selected polyesters herein contain about 46% by weight of dimethyl terephthalic acid, about 16% by weight of propane -1.2 diol, about 10% by weight ethylene gluycol about 13% by weight of dimethyl sulfobenzoic acid and about 15% by weight of sulfoisophthalic acid, and have a molecular weight of about 3.000.
• the polyesters and their method of preparation are described in detail in EP 311 342.
• Levels of smectite clay are normally in the range form 5% to 15%, more preferably form 8% to 12% by weight, with the material being added as a dry mixed component to the remainder of the formulation.
• Organic fabric softening agents such as the water-insoluble tertiary amines or dilong chain amide materials are incorporated at levels of from 0.5% to
• the detergent compositions according to the present invention may also comprise from 0.001 % to 10%, preferably from 0.01 % to 2%, more preferably form 0.05% to 1 % by weight of polymeric dye transfer inhibiting agents.
• Said polymeric dye transfer inhibiting agents are normally incorporated into detergent compositions in order to inhibit the transfer of dyes from colored fabrics onto fabrics washed therewith. These polymers have the ability to complex or adsorb the fugitive dyes washed out of dyed fabrics before the dyes have the opportunity to become attached to other articles in the wash.
• Especially suitable polymeric dye transfer inhibiting agents are polyamine N-oxide polymers, copolymers of N-vinylpyrrolidone and N-vinylimidazole, polyvinylpyrrolidone polymers, polyvinyloxazolidones and polyvinylimidazoles or mixtures thereof. Addition of such polymers also enhances the performance of the enzymes according the invention.
• the detergent composition according to the invention can be in liquid, paste, gels, bars or granular forms. Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and 4,661,452 (both to Novo Industri A/S) and may optionally be coated by methods known in the art.
• waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molecular weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids.
• PEG poly(ethylene oxide) products
• PEG polyethyleneglycol
• Granular compositions according to the present invention can also be in "compact form", i.e. they may have a relatively higher density than conventional granular detergents, i.e. form 550 to 950 g/l; in such case, the granular detergent compositions according to the present invention will contain a lower amount of "Inorganic filler salt", compared to conventional granular detergents; typical filler salts are alkaline earth metal salts of sulphates and chlorides, typically sodium sulphate; "Compact" detergent typically comprise not more than 10% filler salt.
• the liquid compositions according to the present invention can also be in "concentrated form", in such case, the liquid detergent compositions according to the present invention will contain a lower amount of water, compared to conventional liquid detergents. Typically, the water content of the concentrated liquid detergent is less than 30%, more preferably less than 20%, most preferably less than 10% by weight of the detergent compositions.
• compositions of the invention may for example, be formulated as hand and machine laundry detergent compositions including laundry additive compositions and compositions suitable for use in the pretreatment of stained fabrics, rinse added fabric softener compositions, and compositions for use in general household hard surface cleaning operations and dishwashing operations.
• laundry detergent compositions within the invention include: 1) A detergent composition formulated as a granulate having a bulk density of at least 600 g/l comprising
• a detergent composition formulated as a granulate having a bulk density of at least 600 g/l comprising
• a detergent composition formulated as a granulate having a bulk density of at least 600 g/l comprising
• An aqueous liquid detergent composition comprising
• An aqueous structured liquid detergent composition comprising
• a detergent composition formulated as a granulate having a bulk density of at least 600 g/l comprising
• a detergent composition formulated as a granulate comprising
• An aqueous liquid detergent composition comprising
• An aqueous liquid detergent composition comprising
• a granular fabric cleaning composition in accordance with the invention may be prepared as follows:
• Granular fabric cleaning compositions in accordance with the invention which are especially useful in the laundering of coloured fabrics were prepared as follows:
• Granular fabric cleaning compositions in accordance with the invention which provide "Softening through the wash” capability may be prepared as follows:
• Heavy duty liquid fabric cleaning compositions in accordance with the invention may be prepared as follows:
• a bleach containing detergent composition formulated as a granulate
• a powdered detergent composition A powdered detergent composition
• a liquid detergent composition A liquid detergent composition
• a detergent composition formulated as a non aqueous liquid detergent formulated as a non aqueous liquid detergent:
• a liquid detergent composition comprising
• the dishwashing detergent composition comprises a surfactant which may be anionic, non- ionic, cationic, amphoteric or a mixture of these types.
• the detergent will contain 0-90% of non-ionic surfactant such as low- to non-foaming ethoxylated propoxylated straight-chain alcohols.
• the detergent composition may contain detergent builder salts of inorganic and/or organic types.
• the detergent builders may be subdivided into phosphorus-containing and non-phosphorus-containing types.
• the detergent composition usually contains 1-90% of detergent builders.
• Examples of phosphorus-containing inorganic alkaline detergent builders when present, include the water-soluble salts especially alkali metal pyrophosphates, orthophosphates, polyphosphates, and phosphonates.
• Examples of non-phosphoixis-containing inorganic builders when present, include water-soluble alkali metal carbonates, borates and silicates as well as the various types of water-insoluble crystalline or amorphous alumino silicates of which zeolites are the best-known representatives.
• suitable organic builders include the alkali metal, ammonium and substituted ammonium, citrates, succinates, malonates, fatty acid sulphonates, carboxymetoxy succinates, ammonium polyacetates, carboxylates, polycarboxylates, aminopolycarboxylates, polyacetyl carboxylates and polyhydroxsulphonates.
• suitable organic builders include the higher molecular weight polymers and co-polymers known to have builder properties, for example appropriate polyacrylic acid, polymaleic and polyacrylic/polymaleic acid copolymers and their salts.
• oxygen bleaches are preferred, for example in the form of an inorganic persalt, preferably with a bleach precursor or as a peroxy acid compound.
• suitable peroxy bleach compounds are alkali metal perborates, both tetrahydrates and monohydrates, alkali metal percarbonates, persilicates and perphosphates.
• Preferred activator materials are TAED and glycerol triacetate.
• the first wash lipolytic enzyme of the invention may be incorporated in concentrations conventionally employed in detergents. It is at present contemplated that, in the detergent composition of the invention, the lipolytic enzyme may be added in an amount corresponding to 0.00001-1 mg (calculated as pure enzyme protein) of lipolytic enzyme per titer of wash liquor.
• the manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 269, 1994, pp. 637- 639.
• first wash lipolytic enzyme of the invention may be used in softening compositions:
• the lipolytic enzyme of the invention may be used in fabric softeners, e.g. as described in Surfactant and Consumer Products, Ed. by J. Falbe, 1987, pp 295-296; Tenside Surfactants Detergents, 30 (1993), 6, pp 394-399; JAOCS, Vol. 61 (1984), 2, pp 367-376; EP 517 762; EP 123 400; WO 92/19714; WO 93/19147; US 5,082,578; EP 494 769; EP 544 493; EP 543 562; US 5,235,082; EP 568 297; EP 570237.
• Plasmids pYES 2.0 (Invitrogen Corp., UK)
• pHD414 (Aspergillus expression vector being a derivative of the plasmid p775 described in
• pHD414 is further described in WO 93/11249).
• PJVi245 See Figure 9)
• pCaHj383 See Figure 9)
• pCaHj385 see Figure 9)
• pAHE2 Hobson, A. H., Buckley, C. M., Aamand, J. L., J ⁇ rgensen, S. T., Diderichsen, B., and McConnell, D. J. (1993). Activation of a bacterial lipase by its chaperone. Proc. Natl. Acad. Sci. USA, 90, p. 5682-5686).
• Saccharomyces cerevisiae YNG318 MATa Dpep4[cir + ] ura3-52, Ieu2-D2, his 4-539 Aspergillus oryzae IFO 4177
• A. oryzae JaL 125 Aspergillus oryzae IFO 4177 available from Institute for Fermention, Osaka; 17-25 Juso Hammachi 2-Chome Yodogawa-ku, Osaka, Japan, having the alkaline protease gene named "alp” (described by Murakami K et al., (1991), Agric. Biol. Chem. 55, p. 2807-2811) deleted by a one step gene replacement method (described by G.
• E. coli W3110 lacI q E. coli W3110 is an early isolate used as ancestral stock for the K-12 strain (Bachman, (1972), Bacteriol. Rev. 36). The W3110 stain has been made lacP in order to overproduce the Lac repressor, turning off expression from plac more completely.
• E. coli SJ6 Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, B. R., Sj ⁇ holm,
• Strain SJ1503 is E. coli JA221 containing plasmid pAHE2:
• Pseudomonas cepacia SB10, DSM 3959, is described in WO 89/01032.
• Bovine trypsin Bovine trypsin (Boehringer Mannheim)
• the following lipases are variants of the Hwnicola lanuginosa DSM 4109 lipase (EP 305 216) which are either used as parent enzymes in the context of the present invention or which constitute modified enzymes according to the invention.
• the following lipases are variants of the B. cepacia (formerly Pseudomonas cepacia) lipase to which an N-terminal addition has been applied in accordance with the present invention.
• the following lipases are variants of the Hwnicola insolens DSM 1800 lipolytic enzyme.
• Soy bean trypsin inhibitor (Boehringer Mannheim)
• YPD 10 g yeast extract, 20 g peptone, H 2 O to 810 ml. Autoclaved, 90 ml 20% glucose
• LB-medium 10 g Bacto-tryptone, 5 g Bacto yeast extract, 10 g NaCl in 1 litre water.
• FG4 medium 3% soy meal, 3% maltodextrin, 1% peptone, pH adjusted to 7.0 with 4 M
• BG-reagent 4 mg/ml Brilliant Green (BG) dissolved in water
• the Substrate is homogenised for 15-20 minutes.
• the expression plasmid pJSO37 is derived from pYES 2.0.
• the inducible GAL1-promoter of pYES 2.0 was replaced with the constitutively expressed TPI (triose phosphate isomerase)-promoter from Saccharomyces cerevisiae (Albert and Karwasaki, (1982), J. Mol. Appl Genet., 1, 419-434), and the URA3 promoter has been deleted.
• TPI triose phosphate isomerase
• modified lipolytic enzymes of the invention were performed either by site-directed mutagenesis or by random mutagenesis.
• Site-directed mutagenesis For the construction of variants of a H. lanuginosa lipolytic enzyme the commercial kit, Chameleon double-stranded, site-directed mutagenesis kit can be used according to the manufacturer's instructions.
• the gene encoding the lipolytic enzyme in question is inserted into the plasmid pHD414.
• the ScaI site of the Ampicillin gene of pHD414 is changed to a Mlu1 site by use of the following primer:
• Primer 3 AGAAATCGGGTATCCTTTCAG (SEQ ID No. 6)
• the pHD414 vector comprising the lipolytic gene in question is then used as a template for DNA polymerase and oligos 7258 and 7770.
• the desired mutation e.g. in the N-terminal of the lipolytic gene
• the random mutagenesis is performed by use of doped or spiked oligonucleotide probes. For larger DNA stretches PCR generated mutagenesis may be used. Low calcium filter assay
• the screening for an improved tolerance towards a detergent component is performed by use of a filter assay conesponding to that described above except for the fact that the solution defined in 5) further comprises 0.02% Dobanol®25-7 and optionally without any EGTA.
• An alternative screening assay is the following:
• SC Ura-plates Useful for selecting strains carrying an expression vector
• a protein binding filter Cellulose acetate
• the yeast cells are fermented for 5 days at 30°C. They are given a start dosage of 100 ml
• Vitamin solution 250 mg of Biotin. 3 g of Thiamin. 10 g of D-Calciumpanthetonate, 100 g of Myo-Inositol. 50 g of Cholinchlorid, 1.6 g of Pyridoxin, 1.2 g of Niacinamid, 0.4 g of
• Folicacid 0.4 g of Riboflavin. In a total volume of 1 litre.
• YPD YPD
• Methods in Yeast Genetics, Cold Spring Harbor Laboratory 100 ml of YPD (Sherman et al., (1981), Methods in Yeast Genetics, Cold Spring Harbor Laboratory) are inoculated with spores of A. oryzae and incubated with shaking for about 24 hours.
• the mycelium is harvested by filtration through miracloth and washed with 200 ml of 0.6 M MgSO 4 .
• the mycelium is suspended in 15 ml of 1.2 M MgSO 4 , 10 mM NaH 2 PO 4 , pH 5.8.
• the suspension is cooled on ice and 1 ml of buffer containing 120 mg of Novozym ® 234, batch 1687 is added.
• the suspension is filtered through miracloth, the filtrate transfened to a sterile tube and overlayed with 5 ml of 0.6 M sorbitol, 100 mM Tris-HCl, pH 7.0. Centrifugation is performed for 15 min. at 1000 g and the protoplasts are collected from the top of the MgSO 4 cushion. 2 volumes of STC (1.2 M sorbitol, 10 mM Tris-HCl, pH 7.5, 10 mM CaCy are added to the protoplast suspension and the mixture is centrifugated for 5 min. at 1000 g. The protoplast pellet is resuspended in 3 ml of STC and repelleted. This is repeated. Finally, the protoplasts are resuspended in 0.2-1 ml of STC.
• p3SR2 an A. nidulans amdS gene carrying plasmid described in Hynes et al., Mol. and Cel. Biol., Vol. 3, No. 8, 1430-1439, Aug. 1983
• STC 10 ⁇ l of STC.
• the mixture is left at room temperature for 25 min.
• 0.2 ml of 60% PEG 4000 (BDH 29576), 10 mM CaCl 2 and 10 mM Tris-HCl, pH 7.5 is added and carefully mixed (twice) and finally 0.85 ml of the same solution are added and carefully mixed.
• the mixture is left at room temperature for 25 min., spun at 2.500 g for 15 min.
• Fed batch fermentation is performed in a medium comprising maltodextrin as a carbon source, urea as a nitrogen source and yeast extract.
• the fed batch fermentation was performed by inoculating a shake flask culture of A. oryzae host cells in question into a medium comprising 3.5% of the carbon source and 0.5% of the nitrogen source. After 24 hours of cultivation at pH 5.0 and 34 °C the continuous supply of additional carbon and nitrogen sources are initiated. The carbon source is kept as the limiting factor and it is secured that oxygen is present in excess.
• the fed batch cultivation is continued for 4 days, after which the enzymes can be re- covered by centrifugation, ultrafiltration, clear filtration and germ filtration. Further purification may be done by anionexchange chromatographic methods known in the art.
• Detergent Detergent I, pH adjusted to 10.2
• K is a constant; K 2 expresses the enzyme concentration at which half of the maximum effect is obtained.
• pJSO37 For expression Humicola lanuginosa lipase in the yeast Saccharomyces cerevisiae YNG318 the yeast expression vector pJSO37 (see figure 8) was constructed as described in the Material and Methods section above.
• pJSO37 comprises the DNA sequence encoding the parent lipase and includes the DNA sequences encoding the signal peptide and propeptide (see figure 1).
• the plasmid was transformed into the yeast by standard methods (cf. Sambrooks et al., (1989), Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor). The yeast was cultivated as described in the Material and Methods section above.
• Ammonium acetate (92 g) was added to the fermentation broth (1400 ml) to give a 0.8 M solution of ammonium acetate. The solution was added onto a Toyopearl Butyl column (XK 16/10). The column was washed with 0.8 M ammonium acetate and the lipase eluted in H 2 O at a flow rate of 5 ml/min. 10 ml fractions were collected and lipase containing fractions were pooled according to activity in the standard lipase titration assay. The lipase containing pooled according to activity in the standard lipase titration assay.
• the lipase containing pool were filtered and the pH was adjusted to pH 7.6 and added onto a Q-Sepharose column (HPQ XK 26/10).
• the column was washed with 200 ml 0.1 M Tris-HCl, pH 7.25 and the lipase was eluted in a linear gradient of 0 to 0.3 M NaCl in 400 ml of 0.1 M Tris-HCl, pH 7.25 at a flow rate of 5 ml/min. 10 ml fractions were coliected and the lipase containing fractions were pooled according to activity in the standard lipase titration assay.
• the lipase containing pool was diluted with H 2 O and added onto a 1 ml MonoQ column at a flow rate of 1 ml/min.
• the column was washed with 30 ml of H 2 O and the lipase was eluted in linear gradient of 0 to 0.25 M NaCl in 40 ml.
• the lipase was manually collected according to abso ⁇ tion at 280 nm.
• N-terminal amino acid sequencing was conducted on the S. cerevisiae expressed lipase using the 473A Protein Sequencer according to the manufacturer's instructions.
• the mild trypsin treatment did not result in internal cleavages in the modified lipase as no internal amino acid sequences were observed by amino acid sequencing. Also the specific activity of the trypsin treated lipase was comparable to specific activity of the untreated lipase showing that the trypsin treatment did not affect enzyme activity in the standard assay (See Table E3).
• Humicola lanuginosa lipase Cloning of Humicola lanuginosa lipase is described in EP 305,216, which also describes expression and characterization of the lipase in Aspergillus oryzae by use of the expression plasmid p960.
• Said plasmid comprises the Humicola lanuginosa lipase encoding gene and the DNA sequence encoding the SPIRR peptide addition (which is a part of the propeptide coding part of the lipase gene).
• the expression of the wUdtype lipase in A. oryzae (strain IFO 4177) was done essentially as described in WO 95/22615 using an expression plasmid slightly modified as compared to p960 - cf WO 95/22615. Purification of wildtype H. lanuginosa lipase expressed in A. orvzae
• Fermentation supernatant from Aspergillus oryzae IFO 4177 was centrifuged and cell debris discarded. The supernatant was filtered though a 0.45 m millipore filter.
• Fractions containing enzyme activity are then pooled and conductance was adjusted too it is lower than 5 mSi and p ⁇ is adjusted to 7.5.
• the pools containing activity were then applied onto an anion exchange column (e.g. Highperformance Q Separose®) which had been pre-equilibrated with 25 mM Tris-acetate buffer, pH 7.5.
• the bound activity was eluted with linear salt gradient using same buffer and 0.5 M sodium chloride. Fractions containing high lipase activity were pooled.
• a and B were ligated together with a synthetic linker (KFN 575/576) which codes for the last 5 amino acids in the subtilisin 309 signal fused to the first four amino acids of the mature lipase.
• the last nucleotide "A" in the upper strand changed the XhoII site in the mature lipase gene to a Bgl II site.
• KFN 575/576 5'- CGATCGCATCGGCTGCTGAGGTCTCGCAA-3'
• pSX167 The resulting plasmid (pSX167) comprised the DNA sequence encoding the mature lipase.
• pSX167 was cut with Pme I and Bam H1 and the fragment containing the subtilisin 309 signal sequence-lipase fusion and the 5S terminator was isolated (1769 bp). This fragment was ligated into Hinc D-Bam H1 cut pUC19 creating pSX578.
• DNA coding for mature lipase down to Bst XI was fused to the Achromobacter lyticus protease I signal sequence (see figure 3) from Sph I using the PCR technique "Splicing by Overlap Extension", Horton et al., (1989), Gene).
• Plasmid (pSX578) (see figure 5) was cut with Sph I and Bst XI and the above mentioned PCR DNA was inserted (figure 6).
• the resulting plasmid pSX581 (see figure 7) was transformed into E. coli W3110 lacI q .
• the resulting strain produces non-glycosylated lipase with the same specific activity as the normal glycosylated parent lipase enzyme.
• the pSX581 plasmid (see figure 7) was digested with BglII/ ⁇ indIII and the vector fragment was purified from an agarose gel using standard methods.
• PCR primer Primer 2 (SEO ID NO 4):
• the resulting 300 bp fragment was purified on Spin 100 columns and digested with BglII/ ⁇ indIII and again spin 100 purified. This fragment was tigated to the above vector fragment.
• the resulting plasmid was named pJSO215 and used to transform E.coli W3110 lacI q .
• a plasmid preparation was made from a transformant and DNA sequenced to verify the introduction of the SPIRR peptide addition.
• N-terminal peptide addition was applied to the parent H. lanuginosa (DSM 4109) lipolytic enzyme having the amino acid and DNA sequence, respectively, apparent from EP 305 216, and in addition carrying the following mutations D57G, N94K, D96L, Q249R in its mature part (inserted by conventional site-directed mutagenesis) in the DNA sequence (EP 305 216).
• the peptide addition SPIRPRP was applied to the N-terminus of the parent enzymes as follows: Construction of pIVI220:
• the plasmid was constructed using the Chamelon double stranded, site-directed mutagenesis kit from Stratagene according to the described protocol.
• pHL296 was used as the plasmid template.
• Said plasmid contains the gene encoding the H. lanuginosa lipolytic enzyme with the above mentioned mutations (D57G,
• Primer no. 7770 was used as the selection primer.
• Primer no.8479 was used as the mutagenic primer.
• the plasmid was constructed using the Chameleon double-stranded, site-directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIV1220 was used as the plasmid templated and primer no.7887 as the selection primer (changing the introduced Mlu1 site found in the ampicillin resistance gene and used for cutting to a Seal site).
• primer no.7887 5'p-gaa tga ctt ggt tga gta etc ace agt cac 3' (SEQ ID NO. 77).
• the BamHl site of fragment c) was connected to the Xbal site in front bf the transcription terminator on fragment d) via the pIC19R linker (BamHl to Xbal)
• the plasmid pJVi 245 was digested with BamH I and Sal I, and the resulting 904 bp fragment encoding the HLv9s lipolytic enzyme was isolated.
• pCaHj 483 was digested with BamH I and Sal I, and the large vector fragment (6757) was ligated to the HLv9s fragment.
• the ligation mixture was used to transform E. coli DH5 ⁇ cells, and a transformant harbouring the expected plasmid was isolated.
• the plasmid was termed pCaHj485.
• Working solution 0.1 ml stock solution was mixed with 10 ml 50 mM Tris/HCl pH 7.5; 10 mM CaCl 2 .
• One transformant was selected for tank fermentation.
• the batch medium contained maltose syrup as carbon source, urea and yeast extract as nitrogen source and a mixture of trace metals and salts.
• the feed added continuously during the fed-batch phase contained maltose syrup as carbon source whereas yeast extract and urea were added in order to assure a sufficient supply of nitrogen.
• Fermentation supernatant was filtered through miliipore filter Cat. No. AP2504700 Filter type AP25. 2) Fermentation supernatant was filtered once more on through the sterile filter from Millipore membrane Type GS 0.22 micron.
• Fermenation supematent was then adjusted to 0.8 M ammonium acetate by adding solid ammonium acetate.
• Fractions were collected and assayed for Lipase activity. Fractions containing Lipase activity with a ratio of UV absorbence at A280and A260 more than 1.7 are pooled.
• a European type powder detergent composition (as described above) were used in the test.
• the detergent did not contain any enzymes prior to the addition of the modified lipase of the invention.
• the detergent was dissolved in approximately 18°dH (German Hard ness) water.
• the pH of the wash liquor was about 10.
• Six swatches were washed in 100 ml of wash liquor. Subsequent to the washing, the swatches were flushed in running tap water for 15 minutes and then air-dried overnight at room temperature.
• One cycle wash performance of modified H. lanuginosa lipases containing an addition was performed of Humicola lanuginosa lipase variants of Table Ml with and without the SPIRR-peptide addition in 5 g/l of enzyme inactivated ArielTM Futur (Procter and Gamble). The tests were performed at lipase concentrations of 0, 1250 12500 LU/1.
• the detergent was dissolved in approximately 18°dH (German Hardness) water.
• the pH of the wash liquor was about 10.3.
• the gene encoding the lipase was inserted into the plasmid p ⁇ D414.
• the ScaI site of the Ampicillin gene of pHD414 was then changed to a MluI site.
• the unique ScaI site present in the lipase gene was then removed.
• the desired mutation i.e. SPIRPRP
• SPIRPRP SPIRPRP
• D57G-f-N94K-fD96L+L97M+Q249R was performed.
• the mutations in the mature part of the parent lipolytic enzyme was performed by PCR drtven site-directed mutagenesis using the appropriate primer sequences using the procedures described in WO 95/26215 .
• the peptide addition SPIRPRP was applied as described in Example 9.
• the nucleotide doping scheme of the SPIRPRP codons was as follows:
• Oligo 1 5'- GCG TGG ACG GCC TTG GCC 86(T/A) 66(A/ T) 58(T/A) 67(T/A)
• Flask 5 80% A; 6,66% C; 6,66% G og 6,66 % T.
• Flask 6 80% C; 6,66% A; 6,66% G og 6,66 % T.
• Flask 7 80% G; 6,66% A; 6,66% C og 6,66 % T. Flask 8: 80% T; 6,66% A; 6,66% C og 6,66 % G.
• the resulting DNA fragment was purified from the agarose gel with SpinX (Costar) and ligated into the yeast expression vector pJSO37 containing the H. lanuginosa lipolytic enzyme gene from p ⁇ L296 cloed as a BamHI-Xbal fragment cut with BamHI and PvuII.
• the resulting DNA was electrotransformed into DH10/DH12 E. coli cells (Gibco/BRG Lifetechnologies) using the conventional technique.
• S. cerevisiae YNG 318 After transformation into E. coli and amplification the plasmid was purified and transformed into S. cerevisiae YNG 318. The resulting S. cerevisiae cells were screened for good performers in the alternative lipase filter assay containing detergent (3 g/l of PCS). The positives were sequenced and found to contain the peptide additions apparent from table 1 in the Materials and Methods section (identified as HLv10s1-10).
• Oligo 2 5'-GTC TCT GCG TGG ACG GCC TTG GCG GCG CCA CCT CCA 67(T/A) 66(T/A) 575 66(T/A) 67(T/A) 66(T/A) 575 66(T/A) (6/7)(7/8)(C/G) 57(C/G) C57 (5/7)5(C/G) CTG TTT AAC CAG TTC AAT CTC-3' (93-mer) (SEQ ID NO 82)
• Flask 5 80% A; 6,66% C; 6,66% G og 6,66 % T.
• Flask 6 80% C; 6,66% A; 6,66% G og 6,66 % T.
• Flask 7 80% G; 6,66% A; 6,66% C og 6,66 % T.
• Flask 8 80% T; 6,66% A; 6,66% C og 6,66 % G.
• APPP is added in the N-terminal of the randomly mutagenized RPRPRPRP and prior to the signal peptide in order to protect against proteolytic degradation of the N-terminal addition. This may not be required.
• El was deleted in order to remove one negatively charged amino acid.
• the amino acids in position 2 to 5 of the mature H. lanuginosa lipase sequence were also mutagenized in order to find improved mutants in this non-structural part of the lipase. Otherwise the procedure is as stated above for the random mutagenesis of SPIRPRP.
• the following N-terminal peptide additions were obtained:
• Ala-Pro-Pro-Pro-Arg-Pro-Arg-Leu-Leu-Pro-Ile-Ser( APPPRPRLLPIS) (in addtion to the deleted E1 residue this variant carries the additional mutation D5E in its non-structural N- terminal part of the mature enzyme).
• Ala-Pro-Pro-Pro-Thr-Arg-Gln-Arg-Gln-Ser-Pro(APPPTRQRQSP) (in addtion to the deleted E1 residue this variant carries the additional mutations V2L, S3T and D5V in its non-structural N-terminal part of the mature enzyme).
• Strain SJ1503 is E. coli JA221 containing pAHE2.
• primer LWN9476 was used in combination with each of primers LWN9470-LWN9475, with pAHE2 as template.
• Annealing temperature was 70°C, and reactions were performed in the presence of 2% DMSO; otherwise using standard conditions and TaqTM polymerase.
• Amplified fragments were purified from a 2% agarose gel, digested with BstXI and MluI, ligated to the 7.1 kb BstXI-MluI fragment obtained from pAHE2, and the ligation mixture used to transform, by electroporation, E. coli SJ6 to ampicillin resistance. Transformants were plated on LB plates with ampicillin (200 mg/ml) at 30°C.
• SJ3606 (SJ6/pSJ3606); contains the SPIRPRP encoding addition, and has also the second codon in the native, mature enzyme changed from alanine to valine.
• SJ3608 (SJ6/pSJ3608); contains a SPRP encoding addition (DNA sequence of insert TCT CCG CGC CCG. Obtained as a variant in attempts to produce a STRRPRP encoding addition.
• SJ3708 (SJ6/pSJ3708); contains the SPIRR encoding addition.
• SJ3717 (SJ6/pSJ3717); contains the SPIRPRP encoding addition.
• SJ3718 (SJ6/pSJ3718); contains the SPIRPRP encoding addition.
• SJ3719 (SJ6/pSJ3719); contains the TAIRPRK encoding addition.
• SJ3720 (SJ6/pSJ3720); contains the STRRPRP encoding addition.
• SJ3721 (SJ6/pSJ3721); contains the GPIRPRP encoding addition.
• Example 11 Cultures provide in Example 11 were grown on TY-ampicillin plates (pH 7) and used to inoculate shake flasks containing 100 ml double concentrated TY-medium with ampicillin (100 mg/ml) pH 7. The inoculum was checked for lipase productivity (as described in the Materials and Methods section) by streaking on indicator plates: all cells were found to be lipase positive (plates were incubated at 30°C for 2 days, then transferred to 40°C for 1 day).
• the shake flasks were incubated shaking at 275 ⁇ m at 30 °C for 6 hours until the cultures reached optical densities (578 nm) of 2.8 to 5.3. The cultures were then transferred to 40°C for another 17 hours.
• the culture was harvested, centrifuged (20 minutes at 9000 ⁇ m), the supernatant discarded and the pellet re-suspended in NaCl (0.5 ml 0.9% NaCl) and sonicated (2 minutes non-stop, on ice).
• the sonicated pellet was used to measure Lipase units (LU) using the titration method with tributyrate as substrate at pH 7.0.
• the lipases produced from the strains described In Example 11 were characterized with respect to activity in the presence of detergent, using the PCS plate screening assay
• One set of samples was prepared from strains SJ1503, SJ3606 and SJ3608, which had been propagated as described above, cells harvested, and lysed by sonication to liberate the lipase.
• 15 ml of samples, containing around 230 LU/ml, were applied in wells in screening plates either without detergent, or containing 1.5 and 3.5 grams/litre of detergent, respectively. Plates were incubated at 37°C overnight, and the diameter of the green zone formed around the wells measured. The following results were obtained:
• Another set of samples were prepared by plating of the strains SJ1503, SJ3708, and SJ3717-SJ3721 on cellulose acetate filters (each filter containing all 7 strains), which were placed on LB plates with ampicillin (200 mg/ml) at 37°C overnight, these plates with filters then incubated at 42°C for 5 hours, after which the filters were transferred (colony side up) to screening plates which were incubated overnight at 37°C.
• the method described for shake flask was used for the fermentation in 10 litre scale.
• the medium used was Bacto Tryptone 400g, Bacto Yeast extract 200 g, Glucose ⁇ 2 H 2 O 500g, Ampicillin 1 g, Pluronic 1 ml.
• the pH was kept constant at pH 7.1; the temperature was 30°C for 7 hours then adjusted to 40°C.
• Cells were harvested after 16 hours by centrifugation and the cells were opened using a high pressure homogenizer (800 bar). Purification of B. cepacia expressed in E.coli
• Activity containing supernatant was precipitated with addition of solid ammonium sulphate to saturation of 35 % at room temperature. Precipitation was allowed for 2 hour at room temperature and centrifuged at 350x g for 1 hour. Supernatant was decanted and discarded. Precipitate containing activity was dissolved in 30% ethanol to avoid hydrophobic biding of the lipase activity to insoluble material.
• the above sample containing activity was adjusted to 0.8 M ammonium acetate by adding solid ammonium acetate.
• 50 ml Toyopearl Butyl column (Tosho Hass, Japan) was packed and equilibrated with 0.8 M ammonium acetate.
• the samples from above step containing lipase activity was then adjusted to 0.8 M ammonium acetate and applied on the Toyopearl Butyl column. All the activity binds to the matrix. Unbound material was washed with 0.8 M ammonium acetate till Uv absorbence of the effluent was under 0.05 at 280 nm.
• Bound activity was eluted with 25 mM Tris acetate buffer containing 50 % ethanol. Fractions containing lipase activity were pooled and dialyzed against 25 mM Tris acetate buffer pH 8.5.
• the gene encoding the parent lipolytic enzyme was isolated from Humicola insolens DSM 1800 essentially as described in WO 96/13580. Three different peptide additions were applied to the N-terminus of the mature enzyme using the plasmid pIVI1303 as the plasmid template.
• pIVI303 (encoding a H. insolens lipolytic enzyme variant which contains a mutation in the region 304-369 base downstream from ATG without changes in amino acid sequence and removing a possible secondary DNA structure which might otherwise have hampered the use of the chameleon double stranded kit.)
• the plasmid was constructed using the Chameleon double-stranded, site-directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI296 was used as the plasmid template and primer no 7258 as the selection primer.
• Primer no 9349 was used as the mutagenic primer:
• the plasmid was constructed by use of the Chameleon double-stranded, site- directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI303 was used as a plasmid template.
• Primer no.7887 was used as a selection primer:
• Primer no 19473 was used as a mutagenic primer:
• HILvls containing the mutation SPPRRP instead of ELVARQ in the native H. insolens propeptide
• the plasmid was constructed by use of the Chameleon double-stranded, site-directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI303 was used as a plasmid template.
• Primer no.7887 (cf. above) was used as a selection primer.
• Primer no 21992 was used as a mutagenic primer:
• HILv2s containing the mutation SPPRP instead of ELVARQ in the native H. insolens propeptide
• the plasmid was constructed using the Chameleon double-stranded, site-directed mutage- nesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI303 was used as a plasmid template, and primer no.7887 as a selection primer.
• the following primer was used as the selection primer:
• the plasmid was constructed using the Chameleon double-stranded, site-directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI303 was used as a plasmid template and primer no 7887 as a selection primer.
• Primer no 21994 was used as a mutagenic primer:
• pA2L79 is described in Example 2 of WO 96/13580.
• the plasmid contains the
• PA2L79 was cut with the restriction enzymes HindIII and Xhol.
• the fragment containing the lipolytic enzyme encoding cDNA sequence (1088 bp) was purified from agarose gel.
• PHD414 was cut with the restriction enzymes HindIII and XhoI and the vector purified form an agarose gel.
• the purified vector fragment (pHD414) and the lipase containing fragment was ligated thus creating pIVI296.
• HILv1-4s Each of the above expression vectors were transformed into A. oryzae IFO 4177 by use of the general transformation method disclosed in the Materials and Methods section above.
• One transformant of each type was isolated as HILv1-4s, respectively.
• the H. insolens transformants were grown for 3 days in shake flaks at 30°C in 500 ml YPM medium (10 g/L bacto yeast extract,20 g/L bacto peptone, 20 g/L maltose).
• Fermentation supematent was filtered as described for modified H. lanuginosa lipolytic enzymes.
• Step 1 Batch treatment of the fermentation supematent on anion exchanger DEAE A50.
• DEAE-Sephadex A50 from Pharmacia was washed and equilibrated with 25 mM tris acetate buffer pH 8 using Scintered glass funnel with appropriate pore size. Fermentation supematent was then applied on the DEAE Sephadex A50 using the scintered glass funnel. The Lipolytic activity from H. insolence did not bind to anion exchanger at pH 8 and collected as effluent from DEAE Sephadex A50.
• Step 2 - pH of the efflent from DEAE Sephadex was adjusted to 4.5 by adding dilute Acetic acid. Condctance was also adjusted under 4 mSi by adding water.
• the N-terminal amino acid sequence of the HILvls lipolytic enzyme was determined (i.e. the variant in which the last 5 amino acid residues in the propeptide and the first amino acid residue in the mature enzyme (ELVARQ) have been substituted with
• the N-terminal amino acid sequence of the HILv2s lipolytic enzyme was also determined (i.e. in the variant in which the last 5 amino acid residues in the propeptide and the first amino acid residue in the mature enzyme (ELVARQ) have been substituted with SPPRP). The N-terminal amino acid sequence found was
• the modified lipolytic enzymes comprising peptide additions, produced by the strains HILv1s, HILv2s, HILv3s, respectively, (described in Example 21), and the wild- type strain HIL, were characterized with respect to lipase activity on PCS-plates contai- ning 0.5 g/l, 1.0 g/l and 1.5 g/l PCS-detergent.
• C-terminal peptide additions were applied to the H. lanuginosa lipolytic enzyme variant HLv12s containing the N-terminal peptide addition SPIRPRP and the internal mutations D57G,N94K,D96L,Q249R.
• the plasmid was constructed using the Chameleon double-stranded, site directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI245 was used as the plasmid template (The construction of pIVI245 is described in Example 6) and primer no.7258 as the selection primer. 7258: 5'p gaa tga ctt ggt tga cgc gtc ace agt cac 3' (Thus changing the ScaI site found in the ampicillin resistance gene and used for cutting to a MluI site).
• Primer no.20694 was used as the mutagenic primer.
• the plasmid was constructed using the Chameleon double-stranded, site-directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol.
• pIVI245 was used as the plasmid template and primer no. 7258 as the selection primer.
• Primer no. 20695 was used as the mutagenic primer:
• the enzymes were produced in an analogous manner to that described in Example 6 using the plasmid pToC 202 for the cotransformation step and A. oryzae JAL 125 as a host cell.
• a 1 mg sample of HLv12s containing the C-terminal extension Arg- Arg-Pro (RRP) was S-carboxamidomethylated using standard procedures before degradation with a lysyl-specific protease.
• the resulting peptides were separated using reversed phase HPLC and the collected fractions subjected to matrix assisted laser deso ⁇ tion ionization time-of-flight mass spectrometry.
• a fraction containing a peptide with the experimental mass of 3906.7 Da was found. This mass is within experimental error identical to the theoretical mass of the C-terminal peptide of HLv12s containing the RRP extension which is 3906.4 Da.
• Wash result 5g/l inactivated Ariel Fumr, 20 minutes, 1 cycle TOM, 30°C, 18odH.
• the en2yme was dosed as mg Enzyme Protein per litre wash solution.
• HLv14s SPIRPR + D57G,N94K,D96L,Q249R,270R,271R
• HLv15s containing the N-terminal peptide addtion SPIRPR and the foll owing mutations in the mature part of the K lanuginosa lipolytic enzyme EP, D57G. N94K, D96L, L97M, Q249R was cleaved off by prolonged incubation with Clostripain (EC 3.4.22.8; Sigma No. C-0888).
• the incubation mixture contained: HLv15s (1 mg/ml) and Clostripain (20 ⁇ g/ml) in 25 mM sodium phosphate, pH 7.4 containing 2.5 mM DTT and 1 mM calcium chloride.
• the one cycle wash performance test (described above in Materials and Methods section above) was performed with H. lanuginosa lipase variant HLv15s treated with clostripain. Wash test was made both with the clostripain treated sample and the non clostripain treated variant. The wash test was carried out in 5 g/l enzyme inactivated Ariel Fumr (Procter and Gamble). Lard stained swatches were washed for 20 minutes at 30oC. The tests were performed at lipase concentrations of 0, 5000 LU/l and 12500 LU/l.
• the detegent was dissolved in approx. 18odH (German Hardness) water.
• the pH of the wash liquor was about 10.3.
• Seven swatches were washed in 1000 ml wash liquor. Subsequent to the washing, the swatches were flushed in running tap water for 15 minutes and then air-dried overnight at room temperature.
• H. lanuginosa lipolytic enzyme containing an cysteine bridge (HLy16s)
• the modified H. lanuginosa lipolytic enzyme HLv1 ⁇ s contains the following mutations: N94K, D96L, E239C and Q249R and the peptide addition SCIRR.
• HLv16s was constructed as follows:
• the plasmid was constructed using the Chamelon double stranded, site-directed mutagenesis kit from Stratagene according to the described protocol using the pAHL (cf Fig. 6 of WO
• the plasmid was constructed using the Chameleon double-stranded.site directed mutagenesis kit from Stratagene (cat no. 200509) according to the described protocol using pIYI290 as the plasmid template and primer no 7887 as the selection primer.
• the enzymes were produced in an analogous manner to that described in Example 6 using A. oryzae JAL 125 as a host cell. Subsequently, the one cycle wash performance of the enzymes were tested (using 5 g/l of inactivated Ariel Future as detergent and an enzymew dosage of 0.25 mg enzyme protcin/l and 1.0 mg enzyme protein/l, respectively.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Health & Medical Sciences (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Genetics & Genomics (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Detergent Compositions (AREA)
• Immobilizing And Processing Of Enzymes And Microorganisms (AREA)

Priority Applications (7)

Applications Claiming Priority (14)

Related Parent Applications (1)

Related Child Applications (2)

Publications (1)

Family

ID=27561784

Family Applications (2)

Family Applications After (1)

Country Status (7)

Cited By (672)