US20210355497A1 - Compounds and methods for reducing fxi expression - Google Patents

Compounds and methods for reducing fxi expression Download PDF

Info

Publication number
US20210355497A1
US20210355497A1 US16/466,957 US201916466957A US2021355497A1 US 20210355497 A1 US20210355497 A1 US 20210355497A1 US 201916466957 A US201916466957 A US 201916466957A US 2021355497 A1 US2021355497 A1 US 2021355497A1
Authority
US
United States
Prior art keywords
certain embodiments
less
modified
pharmaceutical composition
oligomeric compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/466,957
Other languages
English (en)
Inventor
Huynh-Hoa Bui
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of US20210355497A1 publication Critical patent/US20210355497A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21027Coagulation factor XIa (3.4.21.27)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/345Spatial arrangement of the modifications having at least two different backbone modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • FXI Factor XI
  • Such compounds, methods, and pharmaceutical compositions are useful to treat or prevent a thromboembolic condition.
  • the compounds, methods, and pharmaceutical compositions are useful to treat or prevent a thromboembolic condition without increasing bleeding risk.
  • Such thromboembolic conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • ESRD end-stage renal disease
  • coagulation comprises a cascade of reactions culminating in the conversion of soluble fibrinogen to an insoluble fibrin gel.
  • the steps of the cascade involve the conversion of an inactive zymogen to an activated enzyme.
  • the active enzyme then catalyzes the next step in the cascade.
  • the coagulation cascade may be initiated through two branches, the tissue factor pathway (also “extrinsic pathway”), which is the primary pathway, and the contact activation pathway (also “intrinsic pathway”).
  • tissue factor pathway also “extrinsic pathway”
  • contact activation pathway also “intrinsic pathway”.
  • TF cell surface receptor tissue factor
  • factor III cell surface receptor tissue factor
  • extravascular cells pericytes, cardiomyocytes, smooth muscle cells, and keratinocytes
  • vascular monocytes and endothelial cells upon induction by inflammatory cytokines or endotoxin.
  • TF is the high affinity cellular receptor for coagulation factor VIIa, a serine protease. In the absence of TF, VIIa has very low catalytic activity, and binding to TF is necessary to render VIIa functional through an allosteric mechanism.
  • the TF-VIIa complex activates factor X to Xa.
  • Xa in turn associates with its co-factor factor Va into a prothrombinase complex which in turn activates prothrombin, (also known as factor II or factor 2) to thrombin (also known as factor IIa, or factor 2a).
  • prothrombin also known as factor II or factor 2
  • thrombin also known as factor IIa, or factor 2a
  • Thrombin activates platelets, converts fibrinogen to fibrin and promotes fibrin cross-linking by activating factor XIII, thus forming a stable plug at sites where TF is exposed on extravascular cells.
  • thrombin reinforces the coagulation cascade response by activating factors V and VIII.
  • the contact activation pathway is triggered by activation of factor XII to XIIa.
  • Factor XIIa converts XI to XIa
  • XIa converts IX to IXa.
  • IXa associates with its cofactor Villa to convert X to Xa.
  • the two pathways converge at this point as factor Xa associates with factor Va to activate prothrombin (factor II) to thrombin (factor IIa).
  • Factor XI enhances both the formation and stability of clots in vitro, but is not thought to be involved in the initiation of clotting.
  • Factor XI is important in the propagation phase of clot growth (von de Borne, et al., Blood Coagulation and Fibrinolysis, 2006, 17:251-257). Additionally, Factor XI-dependent amplification of thrombin formation leads to activation of TAFI (thrombin activatable fibrinolysis inhibitor), which renders clots less sensitive to fibrinolysis (Bouma et al, J Thromb Haemost 1999; 82: 1703-1708).
  • TAFI thrombin activatable fibrinolysis inhibitor
  • Activated protein C is a serine protease that degrades cofactors Va and VIIIa. Protein C is activated by thrombin with thrombomodulin, and requires coenzyme Protein S to function.
  • Antithrombin is a serine protease inhibitor (serpin) that inhibits serine proteases: thrombin, Xa, XIIa, XIa and IXa. Tissue factor pathway inhibitor inhibits the action of Xa and the TF-VIIa complex. (Schwartz A L et al., Trends Cardiovasc Med. 1997; 7:234-239.)
  • Thrombosis is the pathological development of blood clots, and an embolism occurs when a blood clot migrates to another part of the body and interferes with organ function. Thromboembolism may cause conditions such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Significantly, thromboembolism is a major cause of morbidity affecting over 2 million Americans every year. (Adcock et al. American Journal of Clinical Pathology. 1997; 108:434-49).
  • Warfarin is typically used to treat patients suffering from atrial fibrillation.
  • the drug interacts with vitamin K-dependent coagulation factors which include factors II, VII, IX and X.
  • Anticoagulant proteins C and S are also inhibited by warfarin.
  • Drug therapy using warfarin is further complicated by the fact that warfarin interacts with other medications, including drugs used to treat atrial fibrillation, such as amiodarone. Because therapy with warfarin is difficult to predict, patients must be carefully monitored in order to detect any signs of anomalous bleeding.
  • Treatment with heparin may cause an immunological reaction that makes platelets aggregate within blood vessels that can lead to thrombosis. This side effect is known as heparin-induced thrombocytopenia (HIT) resulting in increased bleeding and requires patient monitoring. Prolonged treatment with heparin may also lead to osteoporosis.
  • LMWH can also inhibit Factor II, but to a lesser degree than unfractioned heparin (UFH). LMWH has been implicated in the development of HIT.
  • FIG. 1 shows pharmacodynamic results over time for single dose cohorts receiving Compound No. 957943, as measured by relative plasma FXI protein activity.
  • FIG. 1A shows levels of plasma FXI protein activity.
  • FIG. 1B shows percent change in plasma FXI protein activity relative to baseline.
  • FIG. 2 shows pharmacodynamic results over time for single dose cohorts receiving Compound No. 957943, as measured by ELISA.
  • FIG. 2A shows concentrations of plasma FXI protein.
  • FIG. 2B shows percent change in plasma FXI protein concentrations relative to baseline.
  • FIG. 3 shows pharmacodynamic results over time for multiple dose cohorts receiving Compound No. 957943, as measured by relative plasma FXI protein activity.
  • FIG. 3A shows levels of plasma FXI protein activity.
  • FIG. 3B shows percent change in plasma FXI protein activity relative to baseline.
  • FIG. 4 shows pharmacodynamic results over time for multiple dose cohorts receiving Compound No. 957943, as measured by ELISA.
  • FIG. 4A shows concentrations of plasma FXI protein.
  • FIG. 4B shows change in plasma FXI protein concentrations relative to baseline.
  • FIG. 5 shows pharmacodynamic results over time for multiple dose cohorts receiving 80 mg Compound No. 957943 every four weeks for thirteen weeks, as measured by relative plasma FXI protein activity.
  • FIG. 5A shows levels of plasma FXI protein activity.
  • FIG. 5B shows mean percent change in plasma FXI protein activity.
  • FIG. 6 shows pharmacodynamic results over time for multiple dose cohorts receiving 80 mg Compound No. 957943 every four weeks for thirteen weeks, as measured by ELISA.
  • FIG. 6A shows plasma FXI protein concentrations.
  • FIG. 6B shows percent change in plasma FXI protein concentrations.
  • kits for reducing an amount of FXI RNA, and in certain embodiments reducing the amount of FXI protein in a cell or animal reduce FXI protein activity in the blood of an animal.
  • the animal has or is at risk for a thromboembolic condition.
  • the animal has or is at risk for deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • ESRD end-stage renal disease
  • compounds useful for reducing a FXI RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing a FXI RNA are modified oligonucleotides. In certain embodiments, compounds useful for reducing a FXI RNA are oligomeric compounds comprising a conjugate group and a modified oligonucleotide. In certain embodiments, compounds useful for reducing a FXI RNA are oligomeric compounds consisting of a conjugate group and a modified oligonucleotide.
  • the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • ESRD end-stage renal disease
  • the individual is at risk for a thromboembolic condition, including, but not limited to infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • thromboembolic condition including, but not limited to infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common.
  • Certain risk factors and causes for development of a thromboembolic condition include immobility, surgery (particularly orthopedic surgery), dialysis, malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, inherited or acquired prothrombotic clotting disorders and thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD).
  • Certain outcomes associated with development of a thromboembolic condition include decreased blood flow through an affected vessel, death of tissue, and death.
  • 2′-deoxynucleoside means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2′-substituted nucleoside means a nucleoside comprising a 2′-substituted sugar moiety.
  • 2′-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to an animal.
  • animal means a human or non-human animal. In certain embodiments, the animal is a human.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell or an animal.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
  • conjugate group means a group of atoms that is directly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • a conjugate linker comprises a cleavable moiety.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • a conjugate moiety comprises a cell-targeting moiety.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are oligomeric compounds disclosed herein.
  • the oligomeric compounds are antisense compounds.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • dosage unit means a formulation of an oligomeric compound, or pharmaceutical composition thereof, for administration, wherein the oligomeric compound is provided at a quantity of a single selected dose.
  • dosage unit may comprise packaging or a container that contains the pharmaceutical composition, such as a vial or syringe.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • “gapmer” refers to a sugar motif.
  • the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2′-deoxyribosyl.
  • the term “MOE gapmer” indicates a gapmer having a sugar motif of 2′-MOE nucleosides in both wings and a gap of 2′-deoxynucleosides.
  • a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • identifying an animal at risk for developing a thromboembolic condition means identifying an animal having been diagnosed with a thromboembolic condition or identifying an animal predisposed to develop a thromboembolic condition.
  • Individuals predisposed to develop a thromboembolic condition include those having one or more risk factors for thromboembolic conditions including immobility, surgery (particularly orthopedic surgery), dialysis, malignancy, pregnancy, older age, use of oral contraceptives, inherited or acquired prothrombotic clotting disorders, chronic kidney disease, and end-stage renal disease (ESRD).
  • risk factors for thromboembolic conditions including immobility, surgery (particularly orthopedic surgery), dialysis, malignancy, pregnancy, older age, use of oral contraceptives, inherited or acquired prothrombotic clotting disorders, chronic kidney disease, and end-stage renal disease (ESRD).
  • ESRD end-stage renal disease
  • internucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage.
  • Phosphorothioate internucleoside linkage is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • linker region in reference to a conjugate moiety refers that part of a conjugate linker that is not a cleavable moiety.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • MOE means methoxyethyl.
  • 2′-MOE or “2′-MOE modified sugar” means a 2′-OCH 2 CH 2 OCH 3 group in place of the 2′-OH group of a ribosyl sugar moiety.
  • 2′-MOE nucleoside means a nucleoside comprising a 2′-MOE modified sugar.
  • monthly means every 28 to 31 days.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
  • nucleoside means a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by an animal.
  • a pharmaceutically acceptable carrier or diluent is sterile water, distilled water for injection, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to an animal.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • reducing or inhibiting the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • the term RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide that at least partially hybridizes to itself.
  • stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • thromboembolic condition means any disease or condition involving an embolism caused by a thrombus.
  • diseases and conditions include the categories of thrombosis, embolism, and thromboembolism.
  • diseases and conditions include deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • thromboembolic conditions may also be referred to as thromboembolic events or thrombotic events.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
  • a therapeutically effective amount of a pharmaceutical agent treats, prevents, or ameliorates a thromboembolic condition.
  • week means every six to eight days.
  • Embodiment 1 An oligomeric compound according to the following formula:
  • Embodiment 2 An oligomeric compound according to the following formula:
  • Embodiment 3 An oligomeric compound comprising a modified oligonucleotide according to the following formula:
  • Embodiment 4 An oligomeric compound comprising a modified oligonucleotide according to the following formula:
  • (THA-GalNAc 3 )o Aes mCeo Geo Geo mCeo Ads Tds Tds Gds Gds Tds Gds mCds Ads mCds Aeo Geo Tes Tes Te (SEQ ID NO: 3); wherein, (THA-GalNAc3)o is represented by the following structure:
  • A an adenine nucleobase
  • mC a 5′-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2′-MOE modified sugar
  • d a 2′-deoxyribose sugar
  • s a phosphorothioate internucleoside linkage
  • o a phosphodiester internucleoside linkage
  • Embodiment 5 The oligomeric compound of any one of embodiments 1, 3 or 5, which is a sodium salt.
  • Embodiment 6 A chirally enriched population of the oligomeric compound of any of embodiments 1-5 wherein the population is enriched for oligomeric compounds having a modified oligonucleotide comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.
  • Embodiment 7 The chirally enriched population of embodiment 6, wherein the population is enriched for oligomeric compounds having a modified oligonucleotide comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) configuration.
  • Embodiment 8 The chirally enriched population of embodiment 6 or 7, wherein the population is enriched for oligomeric compounds having a modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Rp) configuration.
  • Embodiment 9 The chirally enriched population of embodiment 6, wherein the population is enriched for oligomeric compounds having a modified oligonucleotide having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 10 The chirally enriched population of embodiment 9, wherein the population is enriched for oligomeric compounds having a modified oligonucleotide having the (Sp) configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 11 The chirally enriched population of embodiment 9, wherein the population is enriched for oligomeric compounds having a modified oligonucleotide having the (Rp) configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 12 The chirally enriched population of embodiment 6 or 9 wherein the population is enriched for oligomeric compounds having a modified oligonucleotide having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp-Sp-Rp configurations, in the 5′ to 3′ direction.
  • Embodiment 13 A population of oligomeric compounds having a modified oligonucleotide of any of embodiments 1-5, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 14 A pharmaceutical composition comprising the oligomeric compound of any one of embodiments 1-5, the chirally enriched population of any one of embodiments 6-12, or the population of embodiment 13, and a pharmaceutically acceptable carrier or diluent.
  • Embodiment 15 The pharmaceutical composition of embodiment 14, wherein the pharmaceutically acceptable diluent is phosphate buffered saline.
  • Embodiment 16 The pharmaceutical composition of embodiment 14, wherein the pharmaceutical composition consists or consists essentially of the oligomeric compound and phosphate buffered saline.
  • Embodiment 17 The pharmaceutical composition of any one of embodiments 14-16, wherein the concentration of the oligomeric compound in the pharmaceutically acceptable carrier or diluent is selected from:
  • Embodiment 18 The pharmaceutical composition of any one of embodiments 14-16, wherein the concentration of the oligomeric compound in the pharmaceutically acceptable carrier or diluent is selected from 20 mg/ml to 180 mg/ml, 20 mg/ml to 170 mg, 20 mg/ml to 160 mg/ml, 20 mg/ml to 150 mg/ml, 20 mg/ml to 140 mg/ml, 20 mg/ml to 130 mg/ml, 20 mg/ml to 120 mg/ml, 20 mg/ml to 110 mg/ml, 20 mg/ml to 100 mg/ml, 20 mg/ml to 90 mg/ml, 20 mg/ml to 80 mg/ml, 20 mg/ml to 70 mg/ml, 20 mg/ml to 60 mg/ml, 20 mg/ml to 50 mg/ml, 20 mg/ml to 40 mg/ml, 20 mg/ml to 30 mg/ml, 30 mg/ml to 180 mg/ml, 30 mg/ml to 170 mg
  • Embodiment 19 The pharmaceutical composition of any one of embodiments 14-18, wherein the pharmaceutical composition is in a form of a dosage unit.
  • Embodiment 20 The pharmaceutical composition of embodiment 19, wherein the oligomeric compound is present in the dosage unit at an amount selected from:
  • Embodiment 21 The pharmaceutical composition of embodiment 17, wherein the oligomeric compound is present in the dosage unit at an amount selected from: less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg
  • Embodiment 22 The pharmaceutical composition of embodiment 19, wherein the oligomeric compound is present in the dosage unit at an amount selected from:
  • Embodiment 23 The pharmaceutical composition of embodiment 19, wherein the oligomeric compound is present in the dosage unit at an amount selected from:
  • Embodiment 24 The pharmaceutical composition of any one of embodiments 19-23, wherein the dosage unit has a volume selected from:
  • Embodiment 25 The pharmaceutical composition of any one of embodiments 14-24, wherein the pharmaceutical composition is packaged in a pre-filled syringe.
  • Embodiment 26 A method comprising contacting a cell with the oligomeric compound of any of embodiments 1-5.
  • Embodiment 27 A method comprising administering to an animal a pharmaceutical composition comprising a therapeutically effective amount of an oligomeric compound according to the following formula:
  • Embodiment 28 A method comprising administering to an animal a therapeutically effective amount of the oligomeric compound of any of embodiments 1-5 in the form of a pharmaceutical composition.
  • Embodiment 29 The method of embodiment 27 or 28, wherein the pharmaceutical composition consists or consists essentially of the oligomeric compound and phosphate buffered saline.
  • Embodiment 30 A method comprising administering to an animal the pharmaceutical compositions of any one of embodiments 14-25, wherein the pharmaceutical composition comprises a therapeutically effective amount of the oligomeric compound.
  • Embodiment 31 The method of embodiment 30, wherein the therapeutically effective amount does not significantly alter platelet levels or platelet activity in the animal or does not cause bleeding in the animal compared to an animal not administered the pharmaceutical composition.
  • Embodiment 32 The method of any one of embodiments 27 to 31, comprising administering an amount of the oligomeric compound selected from:
  • Embodiment 33 The method of any one of embodiments 27 to 31, comprising administering an amount of the oligomeric compound selected from: less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135
  • Embodiment 34 The method of any one of embodiments 27 to 31, comprising administering an amount of the oligomeric compound selected from:
  • Embodiment 35 The method of any one of embodiments 27 to 31, comprising administering an amount of the oligomeric compound selected from:
  • Embodiment 36 The method of any one of embodiments 27 to 35, wherein the concentration of the oligomeric compound in the pharmaceutically acceptable carrier or diluent is selected from:
  • Embodiment 37 The method of any one of embodiments 27 to 35, wherein the concentration of the oligomeric compound in the pharmaceutically acceptable carrier or diluent is selected from: 20 mg/ml to 180 mg/ml, 20 mg/ml to 170 mg, 20 mg/ml to 160 mg/ml, 20 mg/ml to 150 mg/ml, 20 mg/ml to 140 mg/ml, 20 mg/ml to 130 mg/ml, 20 mg/ml to 120 mg/ml, 20 mg/ml to 110 mg/ml, 20 mg/ml to 100 mg/ml, 20 mg/ml to 90 mg/ml, 20 mg/ml to 80 mg/ml, 20 mg/ml to 70 mg/ml, 20 mg/ml to 60 mg/ml, 20 mg/ml to 50 mg/ml, 20 mg/ml to 40 mg/ml, 20 mg/ml to 30 mg/ml, 30 mg/ml to 180 mg/ml, 30 mg/ml to 170
  • Embodiment 38 The method of any one of embodiments 27 to 37, wherein the pharmaceutical composition is a form of a dosage unit, wherein the dosage unit is characterized by a volume selected from:
  • Embodiment 39 The method of any one of embodiments 27-38, comprising administering a first dose and a second dose of the pharmaceutical composition.
  • Embodiment 40 The method of embodiment 39, wherein the first dose and the second dose are separated by 5, 10, 15, 20, 25, 30, 35, or 40 days.
  • Embodiment 41 The method of embodiment 39, wherein the first dose and the second dose are separated by 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 days.
  • Embodiment 42 The method of embodiment 39, wherein the first dose and the second dose are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.
  • Embodiment 43 The method of embodiment 39, wherein the first dose and the second dose are separated by 1, 2, 3, 4, 5, or 6 months.
  • Embodiment 44 The method of embodiment 39, comprising administering the pharmaceutical composition monthly or about monthly.
  • Embodiment 45 The method of embodiment 44, comprising administering the pharmaceutical composition for at least two months, at least three months, at least four months, at least five months, or at least six months.
  • Embodiment 46 The method of embodiment 39, comprising administering the pharmaceutical composition weekly or about weekly.
  • Embodiment 47 The method of embodiment 46, comprising administering the pharmaceutical composition to the animal weekly or about weekly for less than 2 weeks, less than 3 weeks, less than 4 weeks, less than 5 weeks, less than 6 weeks, less than 8 week, less than 12 weeks, less than 16 weeks, or less than 20 weeks.
  • Embodiment 48 The method of any one of embodiments 27-47, wherein administering comprises performing a subcutaneous injection on the animal.
  • Embodiment 49 The method of any one of embodiments 27-48, wherein administering comprises self-administration.
  • Embodiment 50 The method of any one of embodiments 27-47, wherein administering comprises performing an intravenous injection on the animal.
  • Embodiment 51 The method of any one of embodiments 27-50, comprising administering the pharmaceutical composition at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 8, or at least 10 times.
  • Embodiment 52 The method of any one of embodiments 27-50, comprising administering the pharmaceutical composition less than 20 times, less than 15 times, less than 10 times, or less than 5 times.
  • Embodiment 53 The method of any one of embodiments 27-52, wherein the animal has been identified as having a thromboembolic condition or has been identified as being at risk of having a thromboembolic condition.
  • Embodiment 54 The method of embodiment 53, further comprising identifying the animal as having the thromboembolic condition or at risk for having the thromboembolic condition.
  • Embodiment 55 The method of any one of embodiments 27-54, wherein the animal has been identified as having a disease selected from end stage renal disease (ESRD), chronic kidney disease (CKD), and coronary artery disease (CAD), or has been identified as being at risk for a disease selected from ESRD, CKD, and CAD.
  • ESRD end stage renal disease
  • CKD chronic kidney disease
  • CAD coronary artery disease
  • Embodiment 56 The method of embodiment 55, further comprising identifying the animal as having the disease, or identifying the animal as being at risk for having the disease.
  • Embodiment 57 A method comprising administering a first dose and a second dose of an oligomeric compound according to the following formula:
  • the oligomeric compound is in the form of a dosage unit consisting or consisting essentially of about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of the oligomeric compound and about 0.4 ml, about 0.5 ml, about 0.6 ml, about 0.7 ml, about 0.8 ml, about 0.9 ml, or about 1 ml of a pharmaceutically acceptable carrier or diluent.
  • Embodiment 58 The method of embodiment 57, wherein the first dose and the second dose are separated by 27 to 32 days, and wherein the dosage unit consists or consists essentially of 75 mg to 85 mg of the oligomeric compound and 0.7 ml to 0.9 ml of the pharmaceutically acceptable carrier or diluent.
  • Embodiment 59 The method of embodiment 57, wherein the dosage unit consists or consists essentially of about 80 mg of the oligomeric compound and about 0.8 ml of the pharmaceutically acceptable carrier or diluent.
  • Embodiment 60 A method comprising administering a dosage unit to an animal monthly, wherein the dosage unit consists or consists essentially of the oligomeric compound of any one of embodiments 1-5 and a pharmaceutically acceptable carrier or diluent, and wherein the concentration of the oligomeric compound is 80 mg/ml to 120 mg/ml.
  • Embodiment 61 A method comprising administering a dosage unit to an animal monthly, wherein the dosage unit consists or consists essentially of the oligomeric compound of any one of embodiments 1-5 and a pharmaceutically acceptable carrier or diluent, and wherein the concentration of the oligomeric compound is about 100 mg/ml.
  • Embodiment 62 The method of any one of embodiments 57 to 61, wherein the pharmaceutically acceptable carrier or diluent is phosphate buffered saline.
  • Embodiment 63 A lyophilized powder comprising the oligomeric compound of any one of claims 1 - 5 .
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions.
  • one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
  • 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH 3 (“OMe” or “O-methyl”), and 2′-O(CH 2 ) 2 OCH 3 (“MOE”).
  • 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, O—C 1 -C 10 alkyl, O—C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or
  • these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.).
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH ⁇ CH 2 , OCH 2 CH ⁇ CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamide (OCH 2 C( ⁇ O)—N(R m )(R n )), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.
  • a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“NMA”).
  • a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C( ⁇ O)—N(H)CH 3 (“
  • a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms.
  • 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH 2 -2′, 4′-(CH 2 ) 2 -2′, 4′-(CH 2 ) 3 -2′, 4′-CH 2 —O-2′ (“LNA”), 4′-CH 2 -5-2′, 4′-(CH 2 ) 2 —O-2′ (“ENA”), 4′-CH(CH 3 )—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH 2 —O—CH 2 -2′, 4′-CH 2 —N(R)-2′, 4′-CH(CH 2 OCH 3 )—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or C 1 -C 12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).
  • such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R a )(R b )] n —, —[C(R a )(R b )] n —O—, —C(R a ) ⁇ C(R b )—, —C(R a ) ⁇ N—, C( ⁇ —NR a )—, —C( ⁇ O)—, —C( ⁇ S)—, —O—, —Si(R a ) 2 —, —S( ⁇ O) x —, and —N(R a )—;
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • each R a and R b is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C( ⁇ O)—H), substituted acyl, CN, sulfonyl (S( ⁇ O) 2 -J 1 ), or sulfoxyl (S( ⁇ O)-J 1 ); and
  • each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C( ⁇ O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl, or a protecting group.
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the ⁇ -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg . & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
  • Bx is a nucleobase moiety
  • each of R 1 and R 2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 , SJ 1 , N 3 , OC( ⁇ X)J 1 , OC( ⁇ X)NJ 1 J 2 , NJ 3 C( ⁇ X)NJ 1 J 2 , and CN, wherein X is O, S or NJ 1 , and each J 1 , J 2 , and J 3 is, independently, H or C 1 -C 6 alkyl.
  • modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C ⁇ C—CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyla
  • nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No.
  • nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.
  • the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters (“P ⁇ O”) (also referred to as unmodified or naturally occurring linkages or phosphate linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P ⁇ S”), and phosphorodithioates (“HS—P ⁇ S”).
  • Non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH 2 —N(CH 3 )—O—CH 2 —), thiodiester, thionocarbamate (—O—C( ⁇ O)(NH)—S—); siloxane (—O—SiH 2 —O—); and N,N′-dimethylhydrazine (—CH 2 —N(CH 3 )—N(CH 3 )—).
  • Modified internucleoside linkages compared to naturally occurring phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH 2 —N(CH 3 )—O-5′), amide-3 (3′-CH 2 —C( ⁇ O)—N(H)-5′), amide-4 (3′-CH 2 —N(H)—C( ⁇ O)-5′), formacetal (3′-O—CH 2 —O-5′), methoxypropyl, and thioformacetal (3′-S—CH 2 —O-5′).
  • Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research ; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-5 nucleosides.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least one nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least two nucleosides of each wing of a gapmer are modified nucleosides.
  • at least three nucleosides of each wing of a gapmer are modified nucleosides.
  • at least four nucleosides of each wing of a gapmer are modified nucleosides.
  • the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxy nucleoside.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
  • each nucleoside of the gap is an unmodified 2′-deoxy nucleoside.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
  • each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified comprises the same 2′-modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]—[# of nucleosides in the gap]—[# of nucleosides in the 3′-wing].
  • a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleoside sugars.
  • a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif
  • the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each internucleoside linking group is a phosphodiester internucleoside linkage (P ⁇ O).
  • each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P ⁇ S).
  • each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
  • each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified.
  • some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages.
  • the terminal internucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer
  • the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom.
  • all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates
  • the gap comprises at least one Sp, Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
  • modified oligonucleotides are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif.
  • such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moieties and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached to the 3′ and/or 5′ end of oligonucleotides.
  • conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, car
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with particular site on a parent compound and the other is selected to react with a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2′-deoxy nucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2′-deoxyadenosine.
  • a conjugate group comprises a cell-targeting conjugate moiety.
  • a conjugate group has the general formula:
  • n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.
  • each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.
  • each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.
  • each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactosamine (GalNAc), mannose, glucose, glucosamine and fucose.
  • GalNAc N-acetyl galactosamine
  • each ligand is N-acetyl galactosamine (GalNAc).
  • the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises 1 GalNAc ligand.
  • each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative.
  • the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J.
  • each ligand is an amino sugar or a thio sugar.
  • amino sugars may be selected from any number of compounds known in the art, such as sialic acid, ⁇ -D-galactosamine, ⁇ -muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl- ⁇ -neuraminic acid.
  • thio sugars may be selected from 5-Thio- ⁇ -D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl- ⁇ -D-glucopyranoside, 4-thio- ⁇ -D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio- ⁇ -D-gluco-heptopyranoside.
  • conjugate groups comprise a cell-targeting moiety having the formula:
  • conjugate groups comprise a cell-targeting moiety having the formula:
  • conjugate groups comprise a cell-targeting moiety having the formula:
  • compounds described herein comprise a conjugate group described herein as “THA-GalNAac 3 ”.
  • THA-GalNAc 3 is shown below without the optional cleavable moiety at the end of the linker region:
  • compounds described herein comprise THA-GalNAc 3 -phosphate, also represented as (THA-GalNAc 3 )o, having the formula:
  • compounds described herein comprise modified oligonucleotides comprising a gapmer or fully modified motif and a conjugate group comprising at least one, two, or three GalNAc ligands.
  • compounds described herein comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5′-phosphate.
  • Stabilized 5′-phosphates include, but are not limited to 5′-phosphanates, including, but not limited to 5′-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2′-linked nucleosides.
  • the 2′-linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • antisense compounds described herein are sufficiently “DNA-like”to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid.
  • hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is a mature mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • the target nucleic acid is the RNA transcriptional product of a retrogene.
  • the target nucleic acid is a non-coding RNA.
  • the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is FXI.
  • FXI nucleic acid has the sequence set forth in SEQ ID NO: 1 (the complement of GENBANK Accession No: NT 022792.17 truncated from nucleobase 19598000 to Ser. No. 19/624,000) and SEQ ID NO: 2 (GENBANK Accession No: NM_000128.3).
  • methods comprise contacting a cell with an oligomeric compound disclosed herein. In certain embodiments, methods comprise administering an oligomeric compound disclosed herein to an animal, thereby contacting a cell in the animal. In certain embodiments, contacting a cell with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of FXI RNA, and in certain embodiments reduces the amount of FXI protein. In certain embodiments, the oligomeric compound consists of a conjugate group attached to the 5′ end of a modified oligonucleotide.
  • contacting a cell in an animal with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 treats, prevents, or ameliorates a thromboembolic condition.
  • the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • the oligomeric compound consists of a conjugate group attached to the 5′ end of a modified oligonucleotide.
  • contacting a cell in an animal with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 treats, prevents, or ameliorates a thromboembolic condition without increasing bleeding risk.
  • the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • the oligomeric compound consists of a conjugate group attached to the 5′ end of a modified oligonucleotide.
  • a FXI RNA may be quantified, e.g., by quantitative PCR.
  • FXI proteins may be quantified with standard protein quantification tests, e.g., ELISA.
  • the FXI protein may be an inactive form (zymogen).
  • the FXI protein may be an active form (FXIa).
  • the active form of FXI may promote converting FIX from its inactive form (FIX) to its active form (FIXa).
  • FXI activity may be assessed with a blood test that characterizes coagulation of blood. Non-limiting examples of such blood tests are a partial thromboplastin time (PTT) test or activated partial thromboplastin time test (aPTT or APTT).
  • PTT partial thromboplastin time
  • aPTT or APTT activated partial thromboplastin time test
  • FXI activity in a test plasma sample may be assayed by adding the test plasma sample to a plasma sample that is immunodepleted of FXI and comparing clotting of the resulting combined sample to a reference sample with a reference amount of FXI.
  • contacting a cell in an animal with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 treats, prevents, or ameliorates a thromboembolic condition.
  • the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • the oligomeric compound consists of a conjugate group attached to the 5′ end of a modified oligonucleotide.
  • contacting a cell in an animal with an oligomeric compound comprising a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 treats, prevents, or ameliorates a thromboembolic condition without increasing bleeding risk.
  • the thromboembolic condition is deep vein thrombosis, venous or arterial thrombosis, pulmonary embolism, myocardial infarction, stroke, thrombosis associated with chronic kidney disease or end-stage renal disease (ESRD), including thrombosis associated with dialysis, or other procoagulant condition.
  • the oligomeric compound consists or consists essentially of a conjugate group attached to the 5′ end of a modified oligonucleotide.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the alimentary and/or excretory system. Such cells and tissues include the liver, kidney, and pancreas.
  • compositions described herein comprise one or more oligomeric compounds.
  • the one or more oligomeric compounds each comprise a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds.
  • a pharmaceutical composition consists or consists essentially of a sterile saline solution and one or more oligomeric compounds.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises one or more oligomeric compounds and sterile water.
  • a pharmaceutical composition consists or consists essentially of one or more oligomeric compounds and sterile water.
  • the sterile water is pharmaceutical grade water.
  • the pharmaceutically acceptable diluent or carrier is distilled water for injection.
  • a pharmaceutical composition comprises one or more oligomeric compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • a pharmaceutical composition consists or consists essentially of one or more oligomeric compounds and PBS.
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises one or more oligomeric compound and artificial cerebrospinal fluid.
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition consists or consists essentially of artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compounds disclosed herein and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound disclosed herein encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions disclosed herein comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver oligomeric compounds described herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions disclosed herein are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Aqueous injection suspensions may contain.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, in ionized (anion) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium.
  • oligonucleotide is intended to include all such forms.
  • Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms.
  • a structure depicting the free acid of a compound followed by the term “or salts thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
  • oligomeric compounds disclosed herein are in aqueous solution with sodium. In certain embodiments, oligomeric compounds are in aqueous solution with potassium. In certain embodiments, oligomeric compounds are in PBS. In certain embodiments, oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
  • a dose may be in the form of a dosage unit.
  • a dose (or dosage unit) of an oligomeric compound in milligrams indicates the mass of the free acid form of the oligomeric compound.
  • the free acid is in equilibrium with anionic and salt forms.
  • the oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, conjugated free acid.
  • the oligomeric compound may be partially or fully de-protonated and in association with Na + ions.
  • a dose, or dosage unit, of 80 mg of Compound No. 957943 equals the number of fully protonated molecules that weighs 80 mg. This would be equivalent to 84 mg of solvent-free, sodium-acetate free, anhydrous sodiated Compound No. 957943.
  • the mass of conjugate is included in calculating the dose of such oligomeric compound.
  • compositions described herein are administered in the form of a dosage unit.
  • the dosage unit may be prepared for injection.
  • the dosage unit may be prepared for infusion.
  • the dosage unit comprises an oligomeric compound disclosed herein and a pharmaceutically acceptable carrier or diluent.
  • the dosage unit consists or consists essentially of an oligomeric compound disclosed herein and a pharmaceutically acceptable carrier or diluent.
  • the oligomeric compound comprises a modified oligonucleotide having the nucleobase sequence of SEQ ID NO: 3.
  • the oligomeric compound is Compound No. 957943.
  • the oligomeric compound is present in the dosage unit at an amount selected from 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.
  • the oligomeric compound is present in the dosage unit at an amount selected from about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 2
  • the oligomeric compound is present in the dosage unit at an amount selected from 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89
  • the oligomeric compound is present in the dosage unit at an amount selected from about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 26 mg, about 27 mg, about 28 mg, about 29 mg, about 30 mg, about 31 mg, about 32 mg, about 33 mg, about 34 mg, about 35 mg, about 36 mg, about 37 mg, about 38 mg, about 39 mg, about 40 mg, about 41 mg, about 42 mg, about 43 mg, about 44 mg, about 45 mg, about 46 mg, about 47 mg, about 48 mg, about 49 mg, about 50 mg, about 51 mg, about 52 mg, about 53 mg, about 54 mg, about 55 mg, about 56 mg, about 57 mg, about 58 mg, about 59 mg, about 60 mg, about 61 mg, about 62 mg, about 63 mg, about 64 mg, about 65 mg, about 66 mg, about 67 mg, about 68 mg, about 69 mg, about 70 mg, about 71 mg, about 72 mg, about 73 mg, about 74 mg,
  • the oligomeric compound is present in the dosage unit at an amount selected from 75.0 mg, 75.1 mg, 75.2 mg, 75.3 mg, 75.4 mg, 75.5 mg, 75.6 mg, 75.7 mg, 75.8 mg, 75.9 mg, 76.0 mg, 76.1 mg, 76.2 mg, 76.3 mg. 76.4 mg, 76.5 mg, 76.6 mg, 76.7 mg, 76.8 mg, 76.9 mg, 77.0 mg, 77.1 mg, 77.2 mg, 77.3 mg, 77.4 mg, 77.5 mg, 77.6 mg, 77.7 mg, 77.8 mg, 77.9 mg, 78.0 mg, 78.1 mg, 78.2 mg, 78.3 mg.
  • the oligomeric compound is present in the dosage unit at an amount selected from about 75.0 mg, about 75.1 mg, about 75.2 mg, about 75.3 mg, about 75.4 mg, about 75.5 mg, about 75.6 mg, about 75.7 mg, about 75.8 mg, about 75.9 mg, about 76.0 mg, about 76.1 mg, about 76.2 mg, about 76.3 mg.
  • about 80.4 mg about 80.5 mg, about 80.6 mg, about 80.7 mg, about 80.8 mg, about 80.9 mg, about 81.0 mg, about 81.1 mg, about 81.2 mg, about 81.3 mg, about 81.4 mg, about 81.5 mg, about 81.6 mg, about 81.7 mg, about 81.8 mg, about 81.9 mg, about 82.0 mg, about 82.1 mg, about 82.2 mg, about 82.3 mg.
  • the oligomeric compound is present in the dosage unit at an amount that falls within a range.
  • the range is selected from 10 mg to 140 mg, from 10 mg to 130 mg, from 10 mg to 120 mg, from 10 mg to 110 mg, from 10 mg to 100 mg, from 10 mg to 90 mg, from 10 mg to 80 mg, from 10 mg to 70 mg, from 10 mg to 60 mg, from 10 mg to 50 mg, from 10 mg to 40 mg, from 10 mg to 30 mg, from 10 mg to 20 mg, from 20 mg to 140 mg, from 20 mg to 130 mg, from 20 mg to 120 mg, from 20 mg to 110 mg, from 20 mg to 100 mg, from 20 mg to 90 mg, from 20 mg to 80 mg, from 20 mg to 70 mg, from 20 mg to 60 mg, from 20 mg to 50 mg, from 20 mg to 40 mg, from 20 mg to 30 mg, from 30 mg to 140 mg, from 30 mg to 130 mg, from 30 mg to 120 mg, from 30 mg to 110 mg, from 30 mg to 100 mg, from 30 mg to 90 mg, from 30 mg, from 30 mg to 140
  • the oligomeric compound is present in the dosage unit at an amount that is less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about
  • the oligomeric compound is present in the dosage unit at an amount that is less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg
  • the oligomeric compound is present in the dosage unit at an amount that is at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg of an oligomeric compound disclosed herein.
  • the oligomeric compound is present in the dosage unit at an amount that is at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, or at least 150 mg of an oligomeric compound disclosed herein
  • compositions disclosed herein are provided as a volume of a solution comprising an oligomeric compound and a pharmaceutically acceptable carrier or diluent.
  • the solution consists or consists essentially of an oligomeric compound disclosed herein and a pharmaceutically acceptable carrier or diluent.
  • the volume may be provided in a suitable container, such as a vial or syringe. Since pharmaceutical compositions disclosed herein may be amenable to self-administration, the syringe may be a pre-filled syringe, an auto-injector syringe, or a combination thereof.
  • a dosage unit described herein may be provided as a fixed volume in a syringe for convenient administration.
  • the volume of the solution is 0.1 ml, 0.2 ml, 0.3 ml, 0.4 ml, 0.5 ml, 0.6 ml, 0.7 ml, 0.8 ml, 0.9 ml, 1.0 ml, 1.1 ml, 1.2 ml, 1.3 ml, 1.4 ml, 1.5 ml, 1.6 ml, 1.7 ml, 1.8 ml, 1.9 ml, or 2.0 ml.
  • the volume of the solution is about 0.1 ml, about 0.2 ml, about 0.3 ml, about 0.4 ml, about 0.5 ml, about 0.6 ml, about 0.7 ml, about 0.8 ml, about 0.9 ml, about 1.0 ml, about 1.1 ml, about 1.2 ml, about 1.3 ml, about 1.4 ml, about 1.5 ml, about 1.6 ml, about 1.7 ml, about 1.8 ml, about 1.9 ml, or about 2.0 ml.
  • the volume of the solution is less than 1.0 ml, less than 1.5 ml, or 2.0 ml.
  • the volume of the solution is less than 1.0 ml.
  • a volume of less than 2.0 ml may be useful to reduce or avoid injection pain, adverse events at the injection site, and injection site leakage.
  • compositions disclosed herein are provided as a volume of a solution comprising an oligomeric compound and a pharmaceutically acceptable carrier or diluent, wherein the volume of the solution is 0.1 ml to 1.5 ml, 0.1 ml to 1.4 ml, 0.1 ml to 1.3 ml, 0.1 ml to 1.2 ml, 0.1 ml to 1.1 ml, 0.1 ml to 1.0 ml, 0.1 ml to 0.9 ml, 0.1 ml to 0.8 ml, 0.1 ml to 0.7 ml, 0.1 ml to 0.6 ml, 0.1 ml to 0.5 ml, 0.1 ml to 0.4 ml, 0.1 ml to 0.3 ml, 0.1 ml to 0.2 ml, 0.2 ml to 1.5 ml, 0.2 ml to 1.4 ml, 0.2 ml to 1.3 ml, 0.2 ml to 1.5
  • ml to 1.2 ml 0.5 ml to 1.1 ml, 0.5 ml to 1.0 ml, 0.5 ml to 0.9 ml, 0.5 ml to 0.8 ml, 0.5 ml to 0.7 ml, 0.5 ml to 0.6 ml, 0.6 ml to 1.5 ml, 0.6 ml to 1.4 ml, 0.6 mo to 1.3 ml, 0.6 ml to 1.2 ml, 0.6 ml to 1.1 ml, 0.6 ml to 1.0 ml, 0.6 ml to 0.9 ml, 0.6 ml to 0.8 ml, 0.6 ml to 0.7 ml, 0.7 ml, to 1.5 ml, 0.7 ml to 1.4 ml, 0.7 ml to 1.3 ml, 0.7 ml to 1.2 ml, 0.7 ml to 1.1 ml, 0.6 ml to 0.8
  • compositions comprise a solution of an oligomeric compound disclosed herein in a pharmaceutically acceptable carrier or diluent at a concentration of 5 mg/ml, 10 mg/ml, 15 mg/ml, 20 mg/ml, 25 mg/ml, 30 mg/ml, 35 mg/ml, 40 mg/ml, 45 mg/ml, 50 mg/ml, 55 mg/ml, 60 mg/ml, 65 mg/ml, 70 mg/ml, 75 mg/ml, 80 mg/ml, 85 mg/ml, 90 mg/ml, 95 mg/ml, 100 mg/ml, 105 mg/ml, 110 mg/ml, 115 mg/ml, 120 mg/ml, 125 mg/ml, 130 mg/ml, 135 mg/ml, 140 mg/ml, 145 mg/ml, 150 mg/ml, 155 mg/ml, or 160 mg/ml.
  • compositions comprise a solution of an oligomeric compound disclosed herein in a pharmaceutically acceptable carrier or diluent at a concentration of about 5 mg/ml, about 10 mg/ml, about 15 mg/ml, about 20 mg/ml, about 25 mg/ml, about 30 mg/ml, about 35 mg/ml, about 40 mg/ml, about 45 mg/ml, about 50 mg/ml, about 55 mg/ml, about 60 mg/ml, about 65 mg/ml, about 70 mg/ml, about 75 mg/ml, about 80 mg/ml, about 85 mg/ml, about 90 mg/ml, about 95 mg/ml, about 100 mg/ml, about 105 mg/ml, about 110 mg/ml, about 115 mg/ml, about 120 mg/ml, about 125 mg/ml, about 130 mg/ml, about 135 mg/ml, about 140 mg/ml, about 145 mg/ml, about 150 mg/ml,
  • compositions comprise a solution of an oligomeric compound disclosed herein in a pharmaceutically acceptable carrier or diluent at a concentration of 20 mg/ml, 21 mg/ml, 22 mg/ml, 23 mg/ml, 24 mg/ml, 25 mg/ml, 26 mg/ml, 27 mg/ml, 28 mg/ml, 29 mg/ml, 30 mg/ml, 31 mg/ml, 32 mg/ml, 33 mg/ml, 34 mg/ml, 35 mg/ml, 36 mg/ml, 37 mg/ml, 38 mg/ml, 39 mg/ml, 40 mg/ml, 41 mg/ml, 42 mg/ml, 43 mg/ml, 44 mg/ml, 45 mg/ml, 46 mg/ml, 47 mg/ml, 48 mg/ml, 49 mg/ml, 50 mg/ml, 51 mg/ml, 52 mg/ml, 53 mg/ml, 54 mg/ml, 55 mg/ml,
  • the oligomeric compound is present in the dosage unit at an amount selected from about 20 mg/ml, about 21 mg/ml, about 22 mg/ml, about 23 mg/ml, about 24 mg/ml, about 25 mg/ml, about 26 mg/ml, about 27 mg/ml, about 28 mg/ml, about 29 mg/ml, about 30 mg/ml, about 31 mg/ml, about 32 mg/ml, about 33 mg/ml, about 34 mg/ml, about 35 mg/ml, about 36 mg/ml, about 37 mg/ml, about 38 mg/ml, about 39 mg/ml, about 40 mg/ml, about 41 mg/ml, about 42 mg/ml, about 43 mg/ml, about 44 mg/ml, about 45 mg/ml, about 46 mg/ml, about 47 mg/ml, about 48 mg/ml, about 49 mg/ml, about 50 mg/ml, about 51 mg/ml, about 52 mg/ml, about 53
  • compositions comprise a solution of an oligomeric compound disclosed herein in a pharmaceutically acceptable carrier or diluent at a concentration of 20 mg/ml to 180 mg/ml, 20 mg/ml to 170 mg, 20 mg/ml to 160 mg/ml, 20 mg/ml to 150 mg/ml, 20 mg/ml to 140 mg/ml, 20 mg/ml to 130 mg/ml, 20 mg/ml to 120 mg/ml, 20 mg/ml to 110 mg/ml, 20 mg/ml to 100 mg/ml, 20 mg/ml to 90 mg/ml, 20 mg/ml to 80 mg/ml, 20 mg/ml to 70 mg/ml, 20 mg/ml to 60 mg/ml, 20 mg/ml to 50 mg/ml, 20 mg/ml to 40 mg/ml, 20 mg/ml to 30 mg/ml, 30 mg/ml to 180 mg/ml, 30 mg/ml to 170 mg, 30 mg/m/
  • compositions disclosed herein comprise a sterile lyophilized oligomeric compound that can be reconstituted with a suitable diluent for injection.
  • pharmaceutical compositions disclosed herein consist or consist essentially of a sterile lyophilized oligomeric compound that can be reconstituted with a suitable diluent for injection.
  • the reconstituted product is administered as a subcutaneous injection after dilution.
  • a sterile lyophilized oligomeric compound may consist of the oligomeric compound which has been prepared in distilled water for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized.
  • the sterile lyophilized oligomeric compound may be packaged in a Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum FLIP-OFF® overseal.
  • the sterile lyophilized oligomeric compound comprises Compound No. 957943.
  • the sterile lyophilized oligomeric compound consists or consists essentially of Compound No. 957943.
  • compositions disclosed herein may be suitable for acute treatment, temporary treatment, ongoing (prophylactic) treatment, chronic treatment, or a combination thereof.
  • methods comprise continually administering a pharmaceutical composition disclosed herein as a prophylactic measure.
  • methods comprise temporarily administering a pharmaceutical composition disclosed herein.
  • methods may comprise administering a pharmaceutical composition disclosed herein to an animal within 24 hours of the animal experiencing a thromboembolic event.
  • methods comprise administering a pharmaceutical composition disclosed herein to an animal before surgery, during surgery, after surgery, or a combination thereof.
  • methods comprise prophylactically administering a pharmaceutical composition disclosed herein on a monthly basis to an animal with a FXI associated disease or condition who is at risk for a thrombotic event.
  • the pharmaceutical composition comprises Compound No. 957943.
  • the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • compositions disclosed herein are useful for treating an animal with a FXI associated disease or condition.
  • methods comprise administering a pharmaceutical composition disclosed herein to an animal only once.
  • methods comprise administering a pharmaceutical composition disclosed herein to an animal at least twice.
  • methods comprise administering a pharmaceutical composition disclosed herein at least 3, at least 4, at least 5, at least 6, at least 8, or at least 10 times.
  • methods comprise administering a pharmaceutical composition disclosed herein less than 20 times, less than 15 times, less than 10 times, or less than 5 times.
  • methods comprise administering to an animal a first dose and a second dose of an oligomeric compound disclosed herein.
  • the first dose and the second dose are the same.
  • the first dose and the second dose are different.
  • the first dose is greater than the second dose.
  • the second dose is greater than the first dose.
  • the first dose is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater than the second dose.
  • the second dose is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater than the first dose.
  • the first dose and the second dose are separated by 5, 10, 15, 20, 25, 30, 35, or 40 days.
  • the first dose and the second dose are separated by 1, 2, 3, 4, 5, or 6 months.
  • the first dose and the second dose are separated by 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 days.
  • the first dose and the second dose are separated by 20 to 40 days, 22 to 38 days, 24 to 36 days, 26 to 34 days, 27 to 32 days, 28 to 32 days, or 29 to 31 days. In certain embodiments, the first dose and the second dose are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In certain embodiments, the first dose and the second dose are separated by 1 to 2 days, 2 to 4 days, 3 to 5 days, 4 to 6 days, 5 to 7 days, 6 to 8 days, 7 to 9 days, 8 to 10 days, 9 to 11 days, 10 to 12 days, 11 to 13 days, 12 to 14 days, 13 to 15 days, 14 to 16 days, 15 to 17 days, 16 to 18 days, 17 to 19 days, or 18 to 20 days.
  • methods comprise administering a pharmaceutical composition disclosed herein monthly or about monthly. In certain embodiments, methods comprise administering a composition disclosed herein to an animal monthly or about monthly for at least two months, at least three months, at least four months, at least five months, or at least six months. In certain embodiments, methods comprise administering a pharmaceutical composition disclosed herein weekly or about weekly. In certain embodiments, methods comprise administering a composition disclosed herein to an animal weekly or about weekly for less than 2 weeks, less than 3 weeks, less than 4 weeks, less than 5 weeks, less than 6 weeks, less than 8 week, less than 12 weeks, less than 16 weeks, or less than 20 weeks.
  • methods comprise administering an oligomeric compound according to a first dosing regimen and subsequently administering the oligomeric compound according to a second dosing regimen.
  • the first dosing regimen comprises administering the oligomeric compound at a first dose and at a first frequency
  • the second dosing regimen comprises administering the oligomeric compound at a second dose and at a second frequency.
  • the first frequency is greater than the second frequency.
  • the first frequency may be greater than once monthly (2 times, 3 times or 4 times per month) and the second frequency may be once monthly. In certain embodiments, the first frequency is less than the second frequency.
  • the first dose is greater than the second dose and the first frequency is greater than the second frequency. In certain embodiments, the first dose is less than the second dose and the first frequency is greater than the second frequency. In certain embodiments, the first dose is greater than the second dose and the first frequency is less than the second frequency. In certain embodiments, the first dose is less than the second dose and the first frequency is less than the second frequency. In certain embodiments, the first dose and the second dose are the same, and the first frequency is greater than the second frequency. In certain embodiments, the first dose and the second dose are the same and the first frequency is less than the second frequency. In certain embodiments, the first dose is greater than the second dose, and the first frequency and the second frequency are the same.
  • the first dose is less than the second dose and the first frequency and the second frequency are the same. In certain embodiments, at least one of the first frequency and the second frequency are selected from about every 5, about every 10, about every 15, about every 20, about every 25, about every 30, about every 35, or about every 40 days. In certain embodiments, at least one of the first frequency and the second frequency is monthly. In certain embodiments, at least one of the first frequency and the second frequency is weekly. In certain embodiments, the first dose is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater than the second dose. In certain embodiments, the second dose is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% greater than the first dose.
  • methods comprise a human subject self-administering a pharmaceutical composition disclosed herein.
  • methods disclosed herein comprise a human subject self-administering a pharmaceutical composition disclosed herein by subcutaneous injection.
  • methods disclosed herein comprise self-administering monthly.
  • pharmaceutical compositions disclosed herein are prepared for subcutaneous administration and a single dose can be provided with a single injection, which makes these pharmaceutical compositions amenable to self-administration.
  • a single injection is possible because oligomeric compounds disclosed herein are highly potent and only a small amount needs to be dissolved in a small volume of a carrier or diluent to provide a dosage unit.
  • the animal may only need to receive a dose on a monthly basis to experience therapeutic effects.
  • Such dosing regimens that allow for self-administration on a monthly basis are desirable to patients when compared to dosing regimens of other therapies aimed to treat subjects with FXI associated conditions and diseases, the latter of which may require in-clinic intravenous injection and more frequent administration.
  • administration of a therapeutically effective amount of a pharmaceutical composition as described herein is accompanied by monitoring an amount of a FXI RNA, an amount of a FXI protein, and/or FXI activity in the plasma or serum of an animal, to determine the animal's response to administration of the pharmaceutical composition.
  • An animal's response to administration of the pharmaceutical composition may be used by a physician to determine the amount and duration of therapeutic intervention.
  • methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions described herein.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions described herein.
  • methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents to treat an undesired effect of the other pharmaceutical composition.
  • methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents to produce a combinational effect. In certain embodiments, methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents to produce a synergistic effect.
  • the pharmaceutical composition comprises Compound No. 957943. In certain embodiments, the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents at the same time. In certain embodiments, methods comprise co-administering one or more pharmaceutical compositions described herein with one or more other pharmaceutical agents at different times. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions described herein and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include anticoagulant or antiplatelet agents.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include NSAID/Cyclooxygenase inhibitors, such as, aspirin.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include adenosine diphosphate (ADP) receptor inhibitors, such as, clopidogrel (PLAVIX) and ticlopidine (TICLID).
  • ADP adenosine diphosphate
  • PLAVIX clopidogrel
  • TICLID ticlopidine
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include phosphodiesterase inhibitors, such as, cilostazol (PLETAL).
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, glycoprotein IIB/IIIA inhibitors, such as, abciximab (REOPRO), eptifibatide (INTEGRILIN), tirofiban (AGGRASTAT), and defibrotide.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, adenosine reuptake inhibitors, such as, dipyridamole (PERSANTINE).
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition described herein include, but are not limited to, warfarin (and related coumarins), heparin, direct thrombin inhibitors (such as lepirudin, bivalirudin), apixaban, LOVENOX (enoxaparin), and small molecular compounds that interfere directly with the enzymatic action of particular coagulation factors (e.g. rivaroxaban, which interferes with Factor Xa).
  • the anticoagulant or antiplatelet agent is administered prior to administration of a pharmaceutical composition described herein.
  • the anticoagulant or antiplatelet agent is administered following administration of a pharmaceutical composition described herein.
  • the anticoagulant or antiplatelet agent is administered at the same time as a pharmaceutical composition described herein.
  • the dosage unit of a co-administered anticoagulant or antiplatelet agent is the same as the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • the dosage unit of a co-administered anticoagulant or antiplatelet agent is lower than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • the dosage unit of a co-administered anticoagulant or antiplatelet agent is greater than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • methods may comprise co-administering a pharmaceutical composition described herein with an anti-inflammatory agent.
  • the anti-inflammatory agent modifies a symptom of the inflammatory disease or condition.
  • the anti-inflammatory agent modifies progression of the inflammatory disease or condition.
  • inflammatory diseases and conditions are autoimmune diseases (e.g. arthritis, colitis or diabetes), trauma, surgery, sepsis, allergic inflammation, and asthma.
  • Non-limiting examples of anti-inflammatory agents include, but are not limited to, methotrexate, abatacept, infliximab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and tumor necrosis factor-alpha (TNFalpha), and other cytokine blockers or antagonists.
  • the anti-inflammatory agent comprises a non-steroidal anti-inflammatory drug (NSAID).
  • NSAIDs reduce inflammatory reactions in an animal.
  • NSAIDS include, but are not limited to, acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam and tramadol.
  • methods comprise administering a pharmaceutical composition disclosed herein and an anti-inflammatory agent concomitantly or sequentially. In certain embodiments, methods comprise administering the anti-inflammatory agent prior to administering the pharmaceutical composition described herein. In certain embodiments, methods comprise administering the anti-inflammatory agent after administering a pharmaceutical composition described herein. In certain embodiments, methods comprise administering the anti-inflammatory agent and a pharmaceutical composition described herein at the same time. In certain embodiments, the dosage unit of a co-administered anti-inflammatory agent is the same as the dosage unit that would be administered if the anti-inflammatory agent was administered alone.
  • the dosage unit of a co-administered anti-inflammatory agent is lower than the dosage unit that would be administered if the anti-inflammatory agent was administered alone. In certain embodiments the dosage unit of a co-administered anti-inflammatory agent is greater than the dosage unit that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • the co-administration of a second pharmaceutical agent enhances the anticoagulant or anti-inflammatory effect of a pharmaceutical composition described herein, such that co-administration of the two results in an anticoagulant or anti-inflammatory effect that is greater than the effect of administering the pharmaceutical composition described herein.
  • the co-administration results in anticoagulant or anti-inflammatory effects that are additive of the effects of the two when administered alone.
  • the co-administration results in anticoagulant or anti-inflammatory effects that are supra-additive of the effects of the two when administered alone.
  • co-administration of a second pharmaceutical agent increases an antithrombotic activity or anti-inflammatory activity of the pharmaceutical composition relative to that provided by the pharmaceutical composition alone, without increased bleeding risk.
  • methods comprise co-administering a pharmaceutical composition described herein and an antiplatelet therapy to an animal in need thereof.
  • the animal in need thereof may be an animal having a condition selected from thromboembolism, atrial fibrillation, a heart valve disorder, valvular heart disease, stroke, coronary artery disease (CAD), and a mechanical heart valve, and a combination thereof.
  • administering a pharmaceutical composition described herein in combination with an antiplatelet therapy results in little to no detectable increase in risk of bleeding as compared to antiplatelet therapy alone.
  • the risk profile or risk indications are unchanged over antiplatelet therapy alone.
  • methods comprise administering a pharmaceutical composition described herein to a dialysis patient, including but not limited to an animal with end stage renal disease (ESRD) or chronic kidney disease (CKD), wherein the animal is co-administered at least one pharmaceutical agent selected from heparin, erythropoietin, darbopoetin, iron, Vitamin D or analogues thereof, phosphate binders, and a combination thereof.
  • ESRD end stage renal disease
  • CKD chronic kidney disease
  • the animal receives dialysis.
  • the pharmaceutical agent is administered at a dose that does not differ from a comparative dose that would be prescribed in the absence of administering the pharmaceutical composition.
  • methods comprise administering a pharmaceutical composition described herein to an animal with a thromboembolic condition. In certain embodiments, methods comprise administering a pharmaceutical composition described herein to an animal at risk for a thromboembolic condition.
  • Thromboembolic conditions include, but are not limited to, thrombosis, embolism, thromboembolism, infarct, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, and coronary artery disease (CAD).
  • Risk factors for developing a thromboembolic condition include, a genetic, situational, disease, or environmental factor, or a combination thereof.
  • such factors may include, but are not limited to, surgery, cancer, malignancy, pregnancy, older age, use of oral contraceptives, immobility, including travel-related immobility, sepsis, having a mechanical heart valve, valvular heart disease, atrial fibrillation, atherosclerosis atrial fibrillation, genetic predisposition, antiphospholipid syndrome, and inherited or acquired prothrombotic clotting disorders, such as Factor V Leiden. Identifying an animal at risk for developing a thromboembolic condition may be accomplished by any method including evaluating an animal's medical history and standard clinical tests or assessments.
  • the pharmaceutical composition comprises Compound No. 957943.
  • the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • methods comprise administering a pharmaceutical composition described herein to an animal with a disease or condition of the kidney.
  • the condition is nephrotoxic drug exposure.
  • the condition is a genetic or developmental malformation of the kidney, such as that caused by a cystic kidney disease.
  • cystic kidney diseases are autosomal dominant polycystic kidney disease, autosomal recessive polycystic kidney disease, medullary cystic kidney disease and glomerulocystic kidney disease.
  • the condition is primary or secondary vesicoureteral reflux.
  • the condition is a urethral stricture.
  • the condition is a primary or secondary nephrotic syndrome.
  • the condition is a primary or secondary glomerulonephritis. In certain embodiments, the condition is lupus nephritis, giant cell arteritis, chronic urinary outflow obstruction, or nephrolithiasis. In certain embodiments, the condition is kidney failure. In certain embodiments, the disease is chronic kidney disease (CKD). In certain embodiments, the disease is end stage renal disease (ESRD). In certain embodiments, the animal is a human subject at risk for CKD or ESRD. Subjects at risk for CKD or ESRD include human subjects who smoke, are obese (e.g., body mass index greater than 30), have hypertension, have diabetes mellitus, receive dialysis, or a combination thereof.
  • CKD chronic kidney disease
  • ESRD end stage renal disease
  • the animal is a human subject at risk for CKD or ESRD. Subjects at risk for CKD or ESRD include human subjects who smoke, are obese (e.g., body mass index greater than 30), have hyper
  • the human subject is a dialysis patient.
  • the dialysis patient may have previously received dialysis, undergoes dialysis, will receive dialysis, or a combination thereof.
  • the human subject is a dialysis patient with ESRD or CKD.
  • Dialysis patients may be at high risk for thrombotic events. Dialysis patients may also be at risk for bleeding events. For example, blood vessels of ESRD patients may be compromised resulting in an increased risk of a thrombotic event or a hemorrhagic event. Thus, dialysis patients may benefit from therapeutic agents that are anti-coagulatory, but do not increase risk of bleeding, such as pharmaceutical compositions described herein.
  • the pharmaceutical composition comprises Compound No. 957943.
  • the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • methods comprise administering a pharmaceutical composition described herein to an animal who has been identified as in need of anticoagulation therapy.
  • animals include, but are not limited to, those undergoing major orthopedic surgery (e.g., hip/knee replacement or hip fracture surgery) and patients in need of chronic treatment, such as those suffering from arterial fibrillation to prevent stroke.
  • methods comprise administering an oligomeric compound described herein, thereby prophylactically reducing a FXI RNA or protein in an animal.
  • Certain embodiments include treating an animal in need thereof by administering to an animal a therapeutically effective amount of a pharmaceutical composition comprising a modified oligonucleotide complementary to a nucleic acid encoding human FXI.
  • the pharmaceutical composition comprises Compound No. 957943.
  • the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • methods comprise administering one or more pharmaceutical compositions described herein to an animal who has an inflammatory condition.
  • an inflammatory condition means any disease or condition related to an inflammatory response to injury or stimulus characterized by clinical signs of increased redness (rubor), temperature (calor), swelling (tumor), pain (dolor) and/or loss of function (functio laesa) in a tissue.
  • examples of such diseases, disorders, and conditions include, but are not limited to, arthritis, colitis, diabetes, sepsis, allergic inflammation, asthma, immunoproliferative disease, antiphospholipid syndrome, graft-related disorder, trauma, autoimmune diseases, vasculitis, or surgery-related disorders.
  • arthritis examples include, but are not limited to, rheumatoid arthritis, juvenile rheumatoid arthritis, arthritis uratica, gout, chronic polyarthritis, periarthritis humeroscapularis, cervical arthritis, lumbosacral arthritis, osteoarthritis, psoriatic arthritis, enteropathic arthritis and ankylosing spondylitis.
  • colitis examples include, but are not limited to, ulcerative colitis, Inflammatory Bowel Disease (IBD) and Crohn's Disease.
  • graft-related disorders include, but are not limited to, graft versus host disease (GVHD), disorders associated with graft transplantation rejection, chronic rejection, and tissue or cell allografts or xenografts.
  • GVHD graft versus host disease
  • immunoproliferative diseases include, but are not limited to, cancers (e.g., lung cancers) and benign hyperplasias.
  • autoimmune diseases include, but are not limited to, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g.
  • insulin dependent diabetes mellitus type I diabetes mellitus, type II diabetes mellitus
  • good pasture's syndrome myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma, psoriasis, and mixed connective tissue disease.
  • such animal has been identified as at risk for developing an inflammatory condition.
  • the animal has a protein C deficiency or a protein S deficiency.
  • such animals are at risk of developing an inflammatory condition due to various genetic, situational, disease, or environmental factors.
  • factors may include, but are not limited to, familial history of inflammatory disease such as diabetes, colitis or arthritis, exposure to allergens such as pollen, exposure to material such as asbestos or environmental pollutants. Identifying an animal at risk for developing an inflammatory condition may be accomplished by any method including evaluating the animal's medical history and standard clinical tests or assessments. In certain embodiments, the animal has been identified as in need of anti-inflammatory therapy.
  • the pharmaceutical composition comprises Compound No. 957943.
  • the pharmaceutical composition consists or consists essentially of Compound No. 957943 and a pharmaceutically acceptable carrier or diluent.
  • compositions disclosed herein are sufficiently potent to reduce FXI RNA, FXI protein, FXI activity, or a combination thereof in an animal.
  • a single dosage unit of a pharmaceutical composition disclosed herein is sufficiently potent to reduce FXI RNA, FXI protein, FXI activity, or a combination thereof in an animal.
  • potency can be determined by determining a first amount of a FXI RNA, FXI protein, or FXI activity before administering a pharmaceutical composition comprising an oligomeric compound disclosed herein and determining a second amount of the FXI RNA, FXI protein, or FXI activity at a relative timepoint after administering, and comparing the first amount to the second amount.
  • the relevant timepoint after administering is 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, or 24 hours.
  • the relevant timepoint after administering is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days.
  • the relevant timepoint after administering is greater than 30 days. In certain embodiments, the relevant timepoint after administering is after a final dosage unit of the oligomeric compound is administered to an animal. In certain embodiments, the relevant timepoint is after an intermediate dosage unit of the oligomeric compound is administered to the animal.
  • An amount of reduction in the second amount relative to the first amount may serve as an indication of potency. The amount of reduction may be expressed as percent reduction as demonstrated herein.
  • methods comprise reducing a FXI RNA in an animal.
  • methods comprise reducing a FXI protein in an animal.
  • FXI is expressed in the liver but secreted to the blood where it is active.
  • FXI RNA, FXI protein, and FXI activity levels may be measured in plasma or serum.
  • methods disclosed herein reduce a FXI RNA, a FXI protein, and/or a FXI activity.
  • FXI activity may cause a change in blood clotting activity in the animal.
  • the FXI activity may cause a reduction in blood clotting activity in the animal.
  • Blood clotting may be measured by a standard test, for example, but not limited to, activated partial thromboplastin time (aPTT) test, prothrombin time (PT) test, thrombin time (TCT), bleeding time, or presence of D-dimer in a blood sample of the animal.
  • aPTT activated partial thromboplastin time
  • PT prothrombin time
  • TCT thrombin time
  • a FXI RNA is reduced in a liver or in plasma/serum of an animal by 1-100%, or a range defined by any two of these values.
  • a FXI RNA, FXI protein, or FXI activity is reduced by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
  • compositions and methods described herein are efficacious because they improve a cardiovascular outcome in an animal.
  • pharmaceutical compositions and methods improve a cardiovascular outcome in a population treated with a pharmaceutical composition disclosed herein and/or according to a method disclosed herein relative to a population that is not treated with the pharmaceutical composition and/or according to the method.
  • the improved cardiovascular outcome is a reduction of the risk of developing a thromboembolic condition.
  • the improved cardiovascular outcome is a reduction in the occurrence of one or more major cardiovascular events. Cardiovascular events include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia.
  • the cardiovascular event is an ischemic stroke.
  • the cardiovascular event is a peripheral arterial ischemic event, e.g., amputation ischemia or limb ischemia.
  • the improved cardiovascular outcome is evidenced by improved carotid intimal media thickness.
  • improved carotid intimal media thickness is a decrease in thickness.
  • improved carotid intimal media thickness is a prevention an increase of intimal media thickness.
  • Compound No: 416858 a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) ACGGCATTGGTGCACAGTTT (incorporated herein as SEQ ID NO: 3), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5′-methyl cytosine, and each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modified sugar, which was previously described in WO 2010/045509, incorporated herein by reference, is a comparator compound.
  • Compound No. 957943 described herein is superior relative to Compound No. 416858 because it demonstrates one or more improved properties, such as, potency and tolerability.
  • Compound No. 957943 may be dosed at lower amounts than Compound No. 416858.
  • Compound No. 957943 may be dosed less frequently than Compound No. 416858.
  • individuals were administered Compound No. 957943 once every four weeks.
  • Compound No. 957943 demonstrated an ED 50 for FXI RNA reduction of 0.41 mg/kg in hFXI transgenic mice.
  • Comparator Compound No. 416858 demonstrated an ED 50 for RNA reduction of 8.35 mg/kg in the same study. Therefore, Compound No. 957943 is demonstrably more potent than comparator Compound No. 416858 in hFXI transgenic mice for RNA reduction.
  • Compound No. 957943 demonstrated greater FXI protein reduction at each dosage level as compared to Compound No. 416858 when Compound No. 957943 was dosed at one-tenth the amount of Compound No. 416858.
  • Example 2 Compound No. 957943 demonstrated lack of platelet reduction in cynomolgus monkeys.
  • Compound No. 957943 demonstrated lack of platelet reduction in human subjects.
  • Compound No. 957943 demonstrated an EC 50 for FXI RNA reduction of 0.02 ⁇ M with primer probe set RTS2966 and 0.03 ⁇ M with primer probe set RTS36807 in HepatoPac® cells.
  • Comparator Compound No. 416858 demonstrated an EC 50 for FXI RNA reduction of 0.98 ⁇ M with primer probe set RTS2966 and 1.07 ⁇ M with primer probe set RTS36807 in the same study. Therefore, Compound No. 957943 is demonstrably more potent than comparator Compound No. 416858 in this study.
  • Compound No. 957943 effectively reduced plasma concentrations of FXI protein and FXI activity in human subjects at all doses and time points tested when administered weekly and monthly.
  • Compound No. 957943 is characterized as an oligomeric compound consisting of a conjugate group and a modified oligonucleotide, wherein the conjugate group is a THA-GalNAc 3 that is directly attached to the 5′ end of the modified oligonucleotide through a phosphodiester linkage, (THA-GalNAc 3 )o; wherein (THA-GalNAc 3 )o is represented by the following structure:
  • the modified oligonucleotide is a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) ACGGCATTGGTGCACAGTTT (incorporated herein as SEQ ID NO: 3), wherein each of nucleosides 1-5 and 16-20 (from 5′ to 3′) comprise a 2′-MOE modification and each of nucleosides 6-15 are 2′-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5′-methyl cytosine.
  • Compound No. 957943 is characterized by the following chemical notation: (THA-GalNAc 3 )o Aes mCeo Geo Geo mCeo Ads Tds Tds Gds Gds Tds Gds mCds Ads mCds Aeo Geo Tes Tes Te; wherein,
  • TAA-GalNAc 3 (THA-GalNAc 3 )o is represented by the following structure:
  • A an adenine nucleobase
  • mC a 5′-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2′-MOE modified sugar
  • d a 2′-deoxyribose sugar
  • s a phosphorothioate internucleoside linkage
  • o a phosphodiester internucleoside linkage
  • Compound No. 957943 is represented by the following chemical structure:
  • the sodium salt of Compound No. 957943 is represented by the following chemical structure:
  • Oligomeric compounds No. 416858 and 957943 were tested in a Factor XI PAC transgenic mouse model which uses bacterial P1 artificial chromosome (PAC) containing the entire WT human Factor XI gene.
  • the mouse model was generated from a human FXI gene fragment containing the entire ⁇ 24 Kb human FXI transgene as well as 9 Kb upstream and 6 Kb downstream.
  • the gene fragment was microinjected into the pronucleus of fertilized mouse eggs, and the complete BAC integration of the transgene was confirmed by PCR using human specific primer probe sets.
  • the established founder has predominate liver expression of human FXI RNA and circulating human FXI in plasma.
  • cytosine residues throughout each gapmer are 5'-methyl cytosines, represented by a superscript ‘m'.
  • the internucleoside linkages are represented by subscript ‘o' or ‘s', wherein 'o' represents a phosphodiester internucleoside linkage and ‘s' represents a phosphorothioate internucleoside linkage.
  • Transgenic hFXI mice were divided into groups of 8 mice each, 4 male and 4 female. Five groups of mice were administered 1.0, 2.5, 5.0, 10.0, or 25.0 mg/kg of Compound No. 416858. Five groups of mice were administered 0.1, 0.25, 0.50, 1.00, or 2.50 mg/kg of Compound No. 957943. Mice were administered oligomeric compounds twice a week for two weeks by subcutaneous injection and sacrificed at the end of the study. A group of 6 mice (3 male and 3 female) was administered PBS twice a week for two weeks and sacrificed at the end of the study. The PBS-injected group served as the control group to which oligomeric compound treated groups were compared.
  • mice were sacrificed and RNA was extracted from liver for real-time PCR analysis of measurement of RNA expression of human Factor XI using primer probe set RTS2965 (forward sequence ACGGTGTTTGCAGACAGCAA, designated herein as SEQ ID NO: 4; reverse sequence TGCAGATTCGGCCACAGA, designated herein as SEQ ID NO: 5; probe sequence ACAGTGTCATGGCTCCCGATGCTTTT, designated herein as SEQ ID NO: 6.).
  • Results are presented as percent change of RNA, relative to PBS control, normalized to total RNA levels determined with Ribogreen®.
  • Compound No. 416858 achieved an ED 50 of 8.35 mg/kg and Compound No. 957943 achieved an ED 50 of 0.41 mg/kg.
  • ED 50 values reported in Table 2 are an average of ED 50 values that were calculated based on data from a single daily dosing.
  • FXI plasma protein Reduction of FXI plasma protein was demonstrated by ELISA.
  • blood was collected under anesthesia via cardiac puncture into sample tubes coated with citric acid. Blood was centrifuged at 4000 g for 15 minutes and platelet poor plasma was collected and stored at ⁇ 80° C. prior to analysis. Pooled plasma samples from all groups were analyzed by VisuLize FXI Antigen Kit (Affinity Biologicals INC). Data are presented as the mean of the individual samples.
  • Compound No. 416858 was administered to cynomolgus monkeys at 4, 8, 12, and 40 mg/kg/week by subcutaneous injection for 13 weeks, as described in Husam, et. al., “Antisense inhibition of coagulation factor XI prolongs APTT without increased bleeding risk in cynomolgus monkeys”, Blood, 2012, 119: 2401-2408, incorporated by reference herein in its entirety.
  • Compound No. 957943 was administered to groups of 14-18 cynomolgus monkeys, half male and half female, at 1, 6, and 25 mg/kg once a month or 1.5 mg/kg weekly by subcutaneous injection. Platelet levels were measured during routine CBC measurements.
  • the HepatoPac® kit is a commercially-available in vitro liver model system available from BIOIVT that consists of micropatterned hepatocyte “islands” co-cultured with supportive stromal cells.
  • a 96-well HepatoPac plate was equilibrated for 48 hours at 37° C. and 10% CO 2 in fresh maintenance medium prior to treatment. Oligomeric compounds were diluted into maintenance medium at 0.0002, 0.0020, 0.0200, 0.2000, 2.0000, or 20.0000 ⁇ M for 48 hours. After 48 hours, medium was replaced with fresh maintenance medium without additional compound.
  • IC 50 was calculated using a linear regression on a log/linear plot of the data in excel.
  • Compound No. 416858 exhibited an IC 50 of 0.98 ⁇ M and Compound No. 957943 exhibited an IC 50 of 0.02 ⁇ M.
  • IC 50 was calculated as described above.
  • Compound No. 416858 exhibited an IC 50 of 1.07 ⁇ M and Compound No. 957943 exhibited an IC 50 of 0.03 ⁇ M.
  • Varying doses of Compound No. 957943 were evaluated in a randomized, double-blind, placebo-controlled study to evaluate the safety, tolerability, pharmacokinetics and pharmacodynamics of single doses of Compound No. 957943 in healthy volunteers.
  • FXI protein concentrations in plasma were measured at baseline, 8 days after treatment, 15 days after treatment, 30 days after treatment and 60 days after treatment.
  • Plasma FXI protein concentrations were measured by a standard ELISA assay.
  • FXI activity plasma samples from test subjects were added to plasma samples that were immunodepleted of FXI and clotting time for each sample was assayed. Clotting time is proportional to the level of FXI activity in the patient plasma since all other factors are initially present at normal levels.
  • the FXI content of the patient plasma was determined from a reference curve prepared with the FXI deficient plasma and varying dilutions of standard human plasma. The reference value, which was derived from control plasma, was 1.0 unit per milliliter.
  • Table 9-10 and FIGS. 1A-1B , and FIGS. 2A-2B Results of the single dose study are presented in Tables 9-10 and FIGS. 1A-1B , and FIGS. 2A-2B .
  • Table 9 and FIGS. 1A-1B show results of the activity assay.
  • Table 10 and FIGS. 2A-2B show the results of the ELISA assays.
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • all doses reduced plasma FXI protein concentration and activity by an average of at least 30% at 8 days after receiving the single dose, including the lowest dose of 40 mg. Also, it is noted that plasma FXI protein concentration and activity was reduced by an average of at least 50% at 8 days after receiving the single dose of 120 mg. Plasma FXI protein concentration and activity were further reduced by an average of at least 30% of baseline levels by 15 days after receiving the 120 mg dose. This reduction was maintained at 30 days after dosing. These data suggest that a monthly dosing regimen is sufficient to obtain therapeutic effects of a single dose of Compound No. 957943.
  • Safety and tolerability evaluations included: physical examination, vital signs (HR, BP, orthostatic changes, weight), ECG, adverse events and concomitant medications, plasma laboratory tests (clinical chemistry, hematology), urinalysis, and complete blood counts (CBC). Platelet levels were measured during routine CBC measurements. Overall, Compound No. 975943 was well-tolerated. There were no safety concerns in vital signs including heart rate and blood pressure, and no clinically relevant changes in liver chemistry, renal function, or platelet values. There were no deaths, no serious adverse events or spontaneous bleeding events.
  • Varying doses of Compound No. 957943 were evaluated in a randomized, double-blind, placebo-controlled study to evaluate the safety, tolerability, pharmacokinetics and pharmacodynamics of multiple doses of Compound No. 957943 in healthy volunteers.
  • Subjects received doses according to Table 11.
  • Healthy volunteers enrolled in the weekly multiple-dose treatment cohorts (AA, BB, and CC) received six subcutaneous doses of Study Drug (Compound No. 957943 or placebo) starting on Week 1, Day 1 followed by once-weekly subcutaneous administration during Weeks 2 to 6 (Days 8, 15, 22, 29, and 36).
  • Healthy volunteers enrolled in the multiple-dose treatment cohort (DDD) received four subcutaneous doses of Study Drug starting on Week 1, Day 1 followed every four weeks with SC administration during Week 5 (Day 29), Week 9 (Day 57), and Week 13 (Day 85).
  • Plasma FXI concentrations for cohorts AA, BB and CC were measured by a standard ELISA assay at various time points. Results of the ELISA assay are presented in Table 12, FIG. 3A and FIG. 3B . Plasma FXI activity was also measured (as described in Example 4) at various time points. Results of the activity assay are presented in Table 13, FIG. 4A and FIG. 4B .
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • Plasma FXI concentrations for cohort DDD were measured by a standard ELISA assay at various time points. Results of the ELISA assay are presented in Table 14 and FIG. 5A and FIG. 5B . Plasma FXI activity was measured with an assay conducted in FXI-depleted plasma as described in Example 4 at various time points. FXI activity is presented in Table 15, FIG. 6A and FIG. 6B .
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • Baseline is defined as the last non-missing measurement prior to the first dose of study drug.
  • FXI plasma protein and activity was reduced in all subjects receiving Compound No. 957943 at all doses at all time points. Results of these studies support a monthly dosing regimen.
  • Safety and tolerability evaluations included: physical examination, vital signs (HR, BP, orthostatic changes, weight), ECG, adverse events and concomitant medications, plasma laboratory tests (clinical chemistry, hematology), urinalysis, and complete blood counts (CBC). Platelet levels were measured during routine CBC measurements. Overall, Compound No. 975943 was well-tolerated. There were no safety concerns in vital signs including heart rate and blood pressure, and no clinically relevant changes in liver chemistry, renal function, or platelet values. No deaths, spontaneous bleeding, or serious adverse events were observed.
  • Compound No. 957943 Multiple doses of Compound No. 957943 are evaluated in a Phase 2 multicenter, randomized, placebo-controlled study in ESRD patients receiving hemodialysis. Patients are randomized to receive subcutaneous treatment (low, mid, high dose) with either Compound No. 957943 or placebo. All standard of care hemodialysis therapies as prescribed by their providers are continued, except anticoagulants or antiplatelet medications other than acetylsalicylic acid (e.g., aspirin) up to 150 mg daily.
  • anticoagulants or antiplatelet medications other than acetylsalicylic acid (e.g., aspirin) up to 150 mg daily.
  • All cohorts consist of a screening and approximately 6 months treatment period followed by a post-treatment follow-up period.
  • Pharmacodynamics and efficacy are assessed at multiple time points. Patient safety is monitored closely during the study. Safety and tolerability evaluations may include e.g. physical examination, vital signs, adverse events, concomitant medications, and plasma laboratory tests.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
US16/466,957 2018-05-09 2019-05-08 Compounds and methods for reducing fxi expression Abandoned US20210355497A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201862669280P 2018-05-09 2018-05-09
US201862699572P 2018-07-17 2018-07-17
PCT/US2019/031277 WO2019217527A1 (en) 2018-05-09 2019-05-08 Compounds and methods for reducing fxi expression

Publications (1)

Publication Number Publication Date
US20210355497A1 true US20210355497A1 (en) 2021-11-18

Family

ID=68468320

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/466,957 Abandoned US20210355497A1 (en) 2018-05-09 2019-05-08 Compounds and methods for reducing fxi expression
US17/091,891 Active US11021710B2 (en) 2018-05-09 2020-11-06 Compounds and methods for reducing FXI expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
US17/091,891 Active US11021710B2 (en) 2018-05-09 2020-11-06 Compounds and methods for reducing FXI expression

Country Status (23)

Country Link
US (2) US20210355497A1 (https=)
EP (1) EP3799604A4 (https=)
JP (2) JP7438135B2 (https=)
KR (1) KR20210008498A (https=)
CN (1) CN112041446B (https=)
AU (1) AU2019266261A1 (https=)
BR (1) BR112020020957B1 (https=)
CA (1) CA3098136A1 (https=)
CL (2) CL2020002811A1 (https=)
CO (1) CO2020013942A2 (https=)
CR (1) CR20200605A (https=)
CU (1) CU20200082A7 (https=)
EC (1) ECSP20071129A (https=)
IL (1) IL277970B2 (https=)
JO (1) JOP20200280A1 (https=)
MX (1) MX2020011913A (https=)
MY (1) MY204000A (https=)
NI (1) NI202000079A (https=)
PE (1) PE20210393A1 (https=)
PH (1) PH12020551875A1 (https=)
SG (1) SG11202010012PA (https=)
TW (1) TWI853812B (https=)
WO (1) WO2019217527A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11376273B2 (en) 2008-10-15 2022-07-05 Ionis Pharmaceuticals, Inc. Modulation of factor 11 expression
WO2024073363A3 (en) * 2022-09-26 2024-05-23 Sirius Therapeutics, Inc. Polynucleic acid molecules for inhibiting expression of fxi, pharmaceutical compositions, and uses thereof

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3164050A1 (en) 2019-12-09 2021-06-17 Empirico Inc. Oligonucleotides for treatment of angiopoietin like 4 (angptl4) related diseases
WO2022133278A2 (en) * 2020-12-18 2022-06-23 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating factor xii
JP2024514887A (ja) * 2021-04-13 2024-04-03 サーナオミクス インコーポレイテッド 産物及び組成物
US11879125B2 (en) 2022-03-16 2024-01-23 Empirico Inc. GalNAc compositions for improving siRNA bioavailability
CN118272372A (zh) * 2022-12-30 2024-07-02 北京福元医药股份有限公司 用于抑制凝血因子xi基因表达的双链核糖核酸及其修饰物、缀合物和用途
UY40743A (es) * 2023-05-19 2024-12-13 Shanghai Argo Biopharmaceutical Co Ltd COMPOSICIONES Y MÉTODOS PARA INHIBIR LA EXPRESIÓN DEL factor de coagulación XI (FXI)
WO2025201156A1 (zh) * 2024-03-28 2025-10-02 施能康生物医药(苏州)有限公司 靶向凝血因子xi的核酸及其用途

Family Cites Families (249)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US4751219A (en) 1985-02-05 1988-06-14 Nederlandse Centrale Organisatie Voor Toegepast-Natuur-Wetenschappelijk Onderzoek Synthetic glycolipides, a process for the preparation thereof and several uses for these synthetic glycolipides
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
EP0260032B1 (en) 1986-09-08 1994-01-26 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
EP0366685B1 (en) 1987-06-24 1994-10-19 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
JPH03503894A (ja) 1988-03-25 1991-08-29 ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション オリゴヌクレオチド n‐アルキルホスホラミデート
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
DE69034150T2 (de) 1989-10-24 2005-08-25 Isis Pharmaceuticals, Inc., Carlsbad 2'-Modifizierte Oligonukleotide
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
JPH0874B2 (ja) 1990-07-27 1996-01-10 アイシス・ファーマシューティカルス・インコーポレーテッド 遺伝子発現を検出および変調するヌクレアーゼ耐性、ピリミジン修飾オリゴヌクレオチド
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
MY107332A (en) 1990-08-03 1995-11-30 Sterling Drug Inc Compounds and methods for inhibiting gene expression.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
JPH06505704A (ja) 1990-09-20 1994-06-30 ギリアド サイエンシズ,インコーポレイテッド 改変ヌクレオシド間結合
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
FR2676231A1 (fr) 1991-05-07 1992-11-13 Aetsrn Concentre de facteur xi de la coagulation sanguine a haute activite specifique, approprie a usage therapeutique et son procede de preparation.
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
CA2159631A1 (en) 1993-03-30 1994-10-13 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
HU9501974D0 (en) 1993-03-31 1995-09-28 Sterling Winthrop Inc Oligonucleotides with amide linkages replacing phosphodiester linkages
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
DE733059T1 (de) 1993-12-09 1997-08-28 Univ Jefferson Verbindungen und verfahren zur ortsspezifischen mutation in eukaryotischen zellen
WO1995017420A1 (en) 1993-12-22 1995-06-29 Temple University - Of The Commonwealth System Of Higher Education Peptide analogs of the activated platelet binding site on factor xi
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US6908903B1 (en) 1994-12-07 2005-06-21 Aletheon Pharmaceuticals, Inc. Cluster clearing agents
US6172045B1 (en) 1994-12-07 2001-01-09 Neorx Corporation Cluster clearing agents
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
CN1120707C (zh) 1995-11-22 2003-09-10 约翰斯·霍普金斯大学 增强生物分子的细胞摄取的配体
US20030119724A1 (en) 1995-11-22 2003-06-26 Ts`O Paul O.P. Ligands to enhance cellular uptake of biomolecules
CN1231675A (zh) 1996-09-26 1999-10-13 味之素株式会社 修饰的生理活性蛋白及含有该蛋白的药物组合物
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
JP4236812B2 (ja) 1997-09-12 2009-03-11 エクシコン エ/エス オリゴヌクレオチド類似体
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
WO1999064622A1 (en) 1998-06-08 1999-12-16 University Of Vermont And State Agriculture College Inhibition of coagulation in blood and blood products
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
MXPA01009363A (es) 1999-03-18 2002-06-04 Merck Patent Gmbh Proteina para bloquear la adhesion de plaquetas.
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6383812B1 (en) 1999-05-28 2002-05-07 Academia Sinica Anti liver disease drug R-YEEE and method of synthesizing branched galactose-terminal glycoproteins
US8541548B2 (en) 1999-06-07 2013-09-24 Arrowhead Madison Inc. Compounds and methods for reversible modification of biologically active molecules
US20080281041A1 (en) 1999-06-07 2008-11-13 Rozema David B Reversibly Masked Polymers
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
CN100406065C (zh) 2000-12-01 2008-07-30 细胞工厂治疗公司 糖基化/半乳糖基化肽、双官能接头和核苷酸单体/多聚体的缀合物以及相关的组合物和使用方法
DE10111925A1 (de) 2001-03-13 2002-10-02 Ogham Gmbh Herzchip
WO2002087541A1 (en) 2001-04-30 2002-11-07 Protiva Biotherapeutics Inc. Lipid-based formulations for gene transfer
CA2452458A1 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20030040480A1 (en) 2001-07-20 2003-02-27 Rasmus Rojkjaer Pharmaceutical composition comprising factor VII polypeptides and factor XI polypeptides
WO2003013423A2 (en) 2001-08-05 2003-02-20 Gvg, Inc. Antithrombotic agent
US20040142325A1 (en) 2001-09-14 2004-07-22 Liat Mintz Methods and systems for annotating biomolecular sequences
US7176303B2 (en) 2003-11-06 2007-02-13 Isis Pharmaceuticals, Inc. Modulation of STAT5 expression
US20100240730A1 (en) 2002-02-20 2010-09-23 Merck Sharp And Dohme Corp. RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA)
CA2498772A1 (en) 2002-09-11 2004-03-25 Santaris Pharma A/S Modified pna molecules
WO2004041889A2 (en) 2002-11-05 2004-05-21 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
AU2003291755A1 (en) 2002-11-05 2004-06-07 Isis Pharmaceuticals, Inc. Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use
AU2003295600A1 (en) 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US7144999B2 (en) 2002-11-23 2006-12-05 Isis Pharmaceuticals, Inc. Modulation of hypoxia-inducible factor 1 alpha expression
US20040180855A1 (en) 2003-02-19 2004-09-16 Schumacher William A. Methods of treating thrombosis with reduced risk of increased bleeding times
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
ES2702942T3 (es) 2003-04-17 2019-03-06 Alnylam Pharmaceuticals Inc Agentes de ARNi modificados
US7851615B2 (en) 2003-04-17 2010-12-14 Alnylam Pharmaceuticals, Inc. Lipophilic conjugated iRNA agents
WO2004101619A1 (ja) 2003-05-15 2004-11-25 Shionogi Co., Ltd. 機能的糖ペプチドの合理的設計および合成
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
US7888497B2 (en) 2003-08-13 2011-02-15 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
CA2538252C (en) 2003-09-18 2014-02-25 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
US20050181978A1 (en) 2003-11-20 2005-08-18 Rasmus Rojkjaer Therapeutic use of factor XI
EP2460811A1 (en) 2004-04-22 2012-06-06 Regado Biosciences, Inc. Improved modulators of coagulation factors
WO2005116204A1 (ja) 2004-05-11 2005-12-08 Rnai Co., Ltd. Rna干渉を生じさせるポリヌクレオチド、および、これを用いた遺伝子発現抑制方法
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
EP1791567B1 (en) 2004-08-10 2015-07-29 Alnylam Pharmaceuticals Inc. Chemically modified oligonucleotides
US20090203132A1 (en) 2004-09-09 2009-08-13 Swayze Eric E Pyrrolidinyl groups for attaching conjugates to oligomeric compounds
US7919472B2 (en) 2004-09-17 2011-04-05 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
EP1815021A2 (en) 2004-11-03 2007-08-08 Almac Diagnostics Limited Transcriptome microarray technology and methods of using the same
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20080206869A1 (en) 2005-01-24 2008-08-28 Avaris Ab Nucleic Acid Complex
EP1931780B1 (en) 2005-08-29 2016-01-06 Regulus Therapeutics Inc. Antisense compounds having enhanced anti-microrna activity
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
JP2009536222A (ja) 2006-05-05 2009-10-08 アイシス ファーマシューティカルズ, インコーポレーテッド Pcsk9の発現を調節するための化合物および方法
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
CN101500548A (zh) 2006-08-18 2009-08-05 弗·哈夫曼-拉罗切有限公司 用于体内递送多核苷酸的多缀合物
US8658211B2 (en) 2006-08-18 2014-02-25 Arrowhead Madison Inc. Polyconjugates for in vivo delivery of polynucleotides
ES2526295T5 (es) 2006-10-18 2021-05-04 Ionis Pharmaceuticals Inc Compuestos antisentido
CA2670563A1 (en) 2006-11-27 2008-06-05 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
US7521213B2 (en) 2006-12-01 2009-04-21 Quest Diagnostics Investments Incorporated Sample processing for nucleic acid amplification
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
US9216228B2 (en) 2007-02-16 2015-12-22 KTB Tumorforschungsgesellschaft MBM Receptor and antigen targeted prodrug
CA2685127C (en) 2007-04-23 2019-01-08 Alnylam Pharmaceuticals, Inc. Glycoconjugates of rna interference agents
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
DK2173760T4 (en) 2007-06-08 2016-02-08 Isis Pharmaceuticals Inc Carbocyclic bicyclic nukleinsyreanaloge
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
KR101654007B1 (ko) 2007-08-15 2016-09-05 아이오니스 파마수티컬즈, 인코포레이티드 테트라하이드로피란 핵산 유사체
JP2011504371A (ja) 2007-11-21 2011-02-10 オレゴン ヘルス アンド サイエンス ユニバーシティー 抗第xi因子モノクローナル抗体およびその使用方法
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009073809A2 (en) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
CA2713379A1 (en) 2008-01-31 2009-11-05 Alnylam Pharmaceuticals, Inc. Optimized methods for delivery of dsrna targeting the pcsk9 gene
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2009151691A2 (en) 2008-03-13 2009-12-17 Celera Corporation Genetic polymorphisms associated wiith venous thrombosis, methods of detection and uses thereof
US20110130440A1 (en) 2008-03-26 2011-06-02 Alnylam Pharmaceuticals, Inc. Non-natural ribonucleotides, and methods of use thereof
FR2929292A1 (fr) 2008-03-28 2009-10-02 Exonhit Therapeutics S A Sa Procede et methodes de diagnostic de la maladie d'alzheimer
CA2721183C (en) 2008-04-11 2019-07-16 Alnylam Pharmaceuticals, Inc. Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
WO2009134418A2 (en) 2008-04-30 2009-11-05 Fox Chase Cancer Center Assay for identifying agents that modulate epigenetic silencing, and agents identified thereby
AU2009298802A1 (en) 2008-09-23 2010-04-08 Alnylam Pharmaceuticals, Inc. Chemical modifications of monomers and oligonucleotides with cycloaddition
DK2356129T3 (da) 2008-09-24 2013-05-13 Isis Pharmaceuticals Inc Substituerede alpha-L-bicykliske nukleosider
KR101773551B1 (ko) 2008-10-15 2017-08-31 아이오니스 파마수티컬즈, 인코포레이티드 인자 11 발현의 조정
CN111808084A (zh) 2008-11-10 2020-10-23 阿布特斯生物制药公司 用于递送治疗剂的新型脂质和组合物
EP3243504A1 (en) 2009-01-29 2017-11-15 Arbutus Biopharma Corporation Improved lipid formulation
MX2011010930A (es) 2009-04-15 2012-04-30 Isis Pharmaceuticals Inc Modulacion de respuestas inflamatorias a través de factor xi.
SG10201911942UA (en) 2009-05-05 2020-02-27 Muthiah Manoharan Lipid compositions
KR101766408B1 (ko) 2009-06-10 2017-08-10 알닐람 파마슈티칼스 인코포레이티드 향상된 지질 조성물
JP5894913B2 (ja) 2009-06-15 2016-03-30 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. Pcsk9遺伝子を標的とする、脂質で製剤化されたdsrna
US9012421B2 (en) 2009-08-06 2015-04-21 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
TWI458493B (zh) 2009-09-25 2014-11-01 Iner Aec Executive Yuan 新穎肝標靶藥劑與合成方法
TWI388338B (zh) 2009-10-26 2013-03-11 Iner Aec Executive Yuan 對聚合醣鏈進行放射標誌以作為肝受體造影劑之方法
TWI391144B (zh) 2009-10-26 2013-04-01 Iner Aec Executive Yuan 一種定量肝殘餘功能的檢驗方法與其新穎肝受體造影檢驗藥劑
WO2011072290A2 (en) 2009-12-11 2011-06-16 The Regents Of The University Of Michigan Targeted dendrimer-drug conjugates
US9198972B2 (en) 2010-01-28 2015-12-01 Alnylam Pharmaceuticals, Inc. Monomers and oligonucleotides comprising cycloaddition adduct(s)
SI2539451T1 (sl) 2010-02-24 2016-04-29 Arrowhead Research Corporation Sestavki za ciljano dostavo sirna
US20130109817A1 (en) 2010-03-26 2013-05-02 Mersana Therapeutics, Inc. Modified Polymers for Delivery of Polynucleotides, Method of Manufacture, and Methods of Use Thereof
EP2553019A1 (en) 2010-03-26 2013-02-06 Mersana Therapeutics, Inc. Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof
US9102938B2 (en) 2010-04-01 2015-08-11 Alnylam Pharmaceuticals, Inc. 2′ and 5′ modified monomers and oligonucleotides
US10913767B2 (en) 2010-04-22 2021-02-09 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
US20130236968A1 (en) 2010-06-21 2013-09-12 Alnylam Pharmaceuticals, Inc. Multifunctional copolymers for nucleic acid delivery
CA2812046A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. Modified irna agents
WO2012068187A1 (en) 2010-11-19 2012-05-24 Merck Sharp & Dohme Corp. Poly(amide) polymers for the delivery of oligonucleotides
US8501930B2 (en) 2010-12-17 2013-08-06 Arrowhead Madison Inc. Peptide-based in vivo siRNA delivery system
AU2011343664B2 (en) 2010-12-17 2015-10-08 Arrowhead Pharmaceuticals, Inc. Galactose cluster-pharmacokinetic modulator targeting moiety for siRNA
CA3131967A1 (en) 2010-12-29 2012-07-05 F. Hoffman-La Roche Ag Small molecule conjugates for intracellular delivery of nucleic acids
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
MX390699B (es) 2011-06-21 2025-03-21 Alnylam Pharmaceuticals Inc Composiciones y metodos para inhibicion de genes para apolipoproteina c-iii (apoc3).
WO2013032829A1 (en) 2011-08-26 2013-03-07 Arrowhead Research Corporation Poly(vinyl ester) polymers for in vivo nucleic acid delivery
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013070771A1 (en) * 2011-11-07 2013-05-16 Isis Pharmaceuticals, Inc. Administration of factor xi antisense oligonucleotides
EP3730618A1 (en) 2011-11-18 2020-10-28 Alnylam Pharmaceuticals, Inc. Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
TW201808342A (zh) 2012-05-02 2018-03-16 喜納製藥公司 包含四galnac之新穎結合物及傳送寡核苷酸之方法
US20150299696A1 (en) 2012-05-02 2015-10-22 Sirna Therapeutics, Inc. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
CN104837996A (zh) 2012-11-15 2015-08-12 罗氏创新中心哥本哈根有限公司 抗apob反义缀合物化合物
DK2992098T3 (da) 2013-05-01 2019-06-17 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af hbv- og ttr-ekspression
US10119136B2 (en) 2014-01-09 2018-11-06 Alnylam Pharmaceuticals, Inc. RNAi agents modified at the 4′-C position
US9382540B2 (en) * 2014-05-01 2016-07-05 Isis Pharmaceuticals, Inc Compositions and methods for modulating angiopoietin-like 3 expression
WO2015179693A1 (en) * 2014-05-22 2015-11-26 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
EP3151839A4 (en) * 2014-06-06 2018-02-28 Ionis Pharmaceuticals, Inc. Compositions and methods for enhanced intestinal absorption of conjugated oligomeric compounds
MA41271A (fr) * 2014-12-26 2017-10-31 Celgene Alpine Invest Company Ii Llc Méthodes d'utilisation d'oligonucléotides antisens ciblant smad7
IL320434A (en) 2015-07-22 2025-06-01 Wave Life Sciences Ltd Oligonucleotide preparations and methods
BR112020018902A2 (pt) 2018-03-20 2021-01-26 Tokyo Institute Of Technology oligonucleotídeo antissenso com toxicidade reduzida

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11376273B2 (en) 2008-10-15 2022-07-05 Ionis Pharmaceuticals, Inc. Modulation of factor 11 expression
WO2024073363A3 (en) * 2022-09-26 2024-05-23 Sirius Therapeutics, Inc. Polynucleic acid molecules for inhibiting expression of fxi, pharmaceutical compositions, and uses thereof

Also Published As

Publication number Publication date
IL277970B2 (en) 2025-03-01
JP2024056830A (ja) 2024-04-23
NI202000079A (es) 2021-08-24
PE20210393A1 (es) 2021-03-02
MX2020011913A (es) 2021-01-29
CN112041446A (zh) 2020-12-04
JP7438135B2 (ja) 2024-02-26
PH12020551875A1 (en) 2021-05-31
TW202016303A (zh) 2020-05-01
US20210087569A1 (en) 2021-03-25
SG11202010012PA (en) 2020-11-27
BR112020020957A2 (pt) 2021-03-02
CO2020013942A2 (es) 2020-11-20
WO2019217527A1 (en) 2019-11-14
MY204000A (en) 2024-07-31
KR20210008498A (ko) 2021-01-22
JP2021522804A (ja) 2021-09-02
AU2019266261A1 (en) 2020-11-05
BR112020020957B1 (pt) 2022-05-10
EP3799604A4 (en) 2022-09-07
IL277970A (en) 2020-11-30
NZ768832A (en) 2021-11-26
CL2020002811A1 (es) 2021-04-30
CR20200605A (es) 2021-01-29
CL2021002716A1 (es) 2022-07-22
CN112041446B (zh) 2022-08-30
TWI853812B (zh) 2024-09-01
EP3799604A1 (en) 2021-04-07
IL277970B1 (en) 2024-11-01
CA3098136A1 (en) 2019-11-14
ECSP20071129A (es) 2021-01-29
CU20200082A7 (es) 2021-06-08
US11021710B2 (en) 2021-06-01
JOP20200280A1 (ar) 2020-11-05

Similar Documents

Publication Publication Date Title
US11021710B2 (en) Compounds and methods for reducing FXI expression
JP7289347B2 (ja) Pcsk9発現のモジュレーター
US12409188B2 (en) Modulators of HSD17B13 expression
US11781143B2 (en) Modulators of PNPLA3 expression
TWI841564B (zh) Apol1表現之調節劑
US11447521B2 (en) Compounds and methods for modulating angiotensinogen expression
US12018261B2 (en) Compounds and methods for modulating factor XII
NZ768832B2 (en) Compounds and methods for reducing fxi expression
HK40087191B (en) Compounds and methods for modulating angiotensinogen expression
HK40087191A (en) Compounds and methods for modulating angiotensinogen expression

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

ZAAA Notice of allowance and fees due

Free format text: ORIGINAL CODE: NOA

ZAAB Notice of allowance mailed

Free format text: ORIGINAL CODE: MN/=.

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION