US20150045413A1 - RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy - Google Patents

RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy Download PDF

Info

Publication number
US20150045413A1
US20150045413A1 US14/444,244 US201414444244A US2015045413A1 US 20150045413 A1 US20150045413 A1 US 20150045413A1 US 201414444244 A US201414444244 A US 201414444244A US 2015045413 A1 US2015045413 A1 US 2015045413A1
Authority
US
United States
Prior art keywords
seq
oligonucleotide
nucleotides
fragment
represented
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/444,244
Other languages
English (en)
Inventor
Peter Christian De Visser
Judith Christina Theodora Van Deutekom
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biomarin Technologies BV
Original Assignee
PROSENSA TECHNOLOGIES BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=48873711&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20150045413(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by PROSENSA TECHNOLOGIES BV filed Critical PROSENSA TECHNOLOGIES BV
Priority to US14/444,244 priority Critical patent/US20150045413A1/en
Assigned to PROSENSA TECHNOLOGIES B.V. reassignment PROSENSA TECHNOLOGIES B.V. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DE VISSER, PETER CHRISTIAN, VAN DEUTEKOM, JUDITH CHRISTINA THEODORA
Publication of US20150045413A1 publication Critical patent/US20150045413A1/en
Assigned to BIOMARIN TECHNOLOGIES B.V. reassignment BIOMARIN TECHNOLOGIES B.V. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: PROSENSA TECHNOLOGIES B.V.
Priority to US15/232,493 priority patent/US10179912B2/en
Priority to US16/201,951 priority patent/US10913946B2/en
Priority to US17/131,130 priority patent/US20210108204A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3233—Morpholino-type ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/331—Universal or degenerate base
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/335—Modified T or U
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the invention relates to the field of human genetics, more specifically neuromuscular disorders.
  • the invention in particular relates to the use of an oligonucleotide with improved characteristics enhancing clinical applicability as further defined herein.
  • Neuromuscular diseases are characterized by impaired functioning of the muscles due to either muscle or nerve pathology (myopathies and neuropathies).
  • myopathies include genetic muscular dystrophies that are characterized by progressive weakness and degeneration of skeletal, heart and/or smooth muscle.
  • Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy. DMD is a severe, lethal neuromuscular disorder resulting in a dependency on wheelchair support before the age of 12 and patients often die before the age of thirty due to respiratory- or heart failure.
  • BMD is also caused by mutations in the DMD gene, but these maintain the open reading frame, yield semi-functional dystrophin proteins, and result in a typically much milder phenotype and longer lifespan.
  • oligonucleotides are currently being developed for skipping most relevant exons of the dystrophin pre-mRNA such as exons 2, 8, 9, 17, 29, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60-63, 71-78 as described in WO 02/024906, WO2004/083446, WO2006/112705, WO2007/135105, WO 2009/139630, WO 2010/050801 or WO 2010/050802.
  • the skipping of one specific exon may be therapeutic for many patients with different mutations.
  • the skipping of exon 51 applies to the largest subset of patients ( ⁇ 13%), including those with deletions of exons 45 to 50, 48 to 50, 50, or 52.
  • the AONs applied are chemically modified to resist endonucleases, exonucleases and RNaseH, and to promote RNA binding and duplex stability.
  • oligonucleotide chemistry affects the delivery of an AON to the target transcript: administration route, biostability, biodistribution, intra-tissue distribution, and cellular uptake and trafficking.
  • further optimization of oligonucleotide chemistry is conceived to enhance binding affinity and stability, enhance activity, improve safety, and/or to reduce cost of goods by reducing length or improving synthesis and/or purification procedures.
  • Multiple chemical modifications have become generally and/or commercially available to the research community (such as 2′-O-methyl RNA and 5-substituted pyrimidines and 2,6-diaminopurines), whereas most others still present significant synthetic effort to obtain.
  • 2′-O-methyl phosphorothioate RNA containing modifications on the pyrimidine and purine bases as identified herein.
  • the invention provides an oligonucleotide comprising a 2′-O-methyl RNA monomer and a phosphorothioatc backbone or consisting of 2′-O-methyl RNA monomers linked by phosphorothioate backbones, and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • the invention provides an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • the invention also provides an oligonucleotide consisting of 2′-O-methyl RNA monomers and a phosphorothioate backbone and comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • RNA monomer as present in an oligonucleotide of the invention may also be identified as being “an RNA nucleotide residue”. Both terms may be used interchangeably throughout the application.
  • a in each of the following expressions means “at least one”: a 2′-O-methyl RNA monomer, a 2′-O-methyl RNA nucleotide residue, a 2′-O-methyl phosphorothioate RNA monomer, a 5-methylpyrimidine base, a 2,6-diaminopurine base.
  • an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone could be replaced by “an oligonucleotide comprising a 2′-O-methyl RNA monomer linked by phosphorothioate backbones”.
  • an oligonucleotide consisting of 2′-O-methyl RNA monomers and a phosphorothioate backbone that could be replaced by “an oligonucleotide consisting of 2′-O-methyl RNA monomer linked by phosphorothioate backbones”.
  • the expression “for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy” could be replaced by the expression “for use in the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.”
  • an oligonucleotide is an oligonucleotide with less than 34 nucleotides.
  • Said oligonucleotide may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
  • Such oligonucleotide may also be identified as an oligonucleotide having from 10 to 33 nucleotides.
  • an oligonucleotide of the invention comprises a 2′-O-methyl RNA monomer and a phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).
  • an oligonucleotide of the invention consists of 2′-O-methyl RNA monomers linked by phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides)
  • an oligonucleotide of the invention comprises a 2′-O-methyl RNA monomer, a phosphorothioate backbone, comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.
  • an oligonucleotide of the invention consists of 2′-O-methyl RNA monomers linked by phosphorothioate backbone, and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.
  • Each of these oligonucleotides is for use or may be for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • An oligonucleotide of the invention comprises or consists of a 2′-O-methyl phosphorothioate RNA monomer.
  • Such oligonucleotide comprises a 2′-O-methyl RNA monomer connected through or linked by a phosphorothioate backbone or consists of 2′-O-methyl phosphorothioate RNA.
  • Preferably, such oligonucleotide consists of a 2′-O-methyl phosphorothioate RNA.
  • Such chemistry is known to the skilled person.
  • an oligonucleotide comprising a 2′-O-methyl RNA monomer and a phosphorothioate backbone may be replaced by an oligonucleotide comprising a 2′-O-methyl phosphorothioate RNA.
  • an oligonucleotide consisting of 2′-O-methyl RNA monomers linked by or connected through phosphorothioate backbones may be replaced by an oligonucleotide consisting of 2′-O-methyl phosphorothioatc RNA.
  • backbone is used to identify the linkage between two sugar units or modified versions of a sugar unit or moiety as later defined herein (i.e. internucleoside linkage).
  • the words “backbone”, “internucleoside linkage” and “linkage” may be used interchangeably.
  • an oligonucleotide having 10 nucleotides contains 9 backbones, linking the 10 sugar units or modified versions of a sugar unit or moiety as later defined herein together.
  • At least one of the backbones of the oligonucleotide according to the invention consists of a phosphorothioate moiety, linking two sugar units or modified versions of a sugar unit or moiety as later defined herein.
  • at least one phosphodiester backbones present in RNA is replaced by phosphorothioate moiety.
  • a naturally occurring internucleoside linkage or backbone is the 3′ to 5′ phosphodiester linkage.
  • an oligonucleotide of the invention may comprise a base modification that increases binding affinity to target strands, increases melting temperature of the resulting duplex of said oligonucleotide with its target, and/or decreases immunostimulatory effects, and/or increases biostability, and/or improves biodistribution and/or intra-tissue distribution, and/or cellular uptake and trafficking.
  • an oligonucleotide of the invention comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base.
  • a 5-methylpyrimidine base is selected from a 5-methylcytosine and/or a 5-methyluracil and/or a thymine, in which thymine is identical to 5-methyluracil.
  • the expression “comprises a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base” in the context of the modified oligonucleotide of the invention may be replaced by “comprises a base modification selected from the group consisting of: a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine base”.
  • an oligonucleotide of the invention has two or more such base modifications
  • said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5-methylcytosines and one or more 5-methyluracils. ‘Thymine’ and ‘5-methyluracil’ may be interchanged throughout the document.
  • 2,6-diaminopurine is identical to 2-aminoadenine and these terms may be interchanged throughout the document. The use of 2,6-diaminopurine has been disclosed in another context in U.S. Pat. No. 7,745,420.
  • base modification refers to the modification of an existing base (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as “modified” by comparison to an existing base.
  • An oligonucleotide of the invention comprising a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base means that at least one of the cytosine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group, i.e.
  • a 5-substituted cytosine and/or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5-methyluracil), and/or that at least one of the adenine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 2-position with an amino group (i.e. a 2,6-diaminopurine), respectively.
  • the expression “the substitution of a proton with a methyl group in position 5 of the pyrimidine ring” may be replaced by the expression “the substitution of a pyrimidine with a 5-methylpyrimidine,” with pyrimidine referring to only uracil, only cytosine or both.
  • the expression “the substitution of a proton with an amino group in position 2 of adenine” may be replaced by the expression “the substitution of an adenine with a 2,6-diaminopurine.” If said oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils, and/or adenines, at least one, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils and/or adenines respectively have been modified this way.
  • cytosines, uracils and/or adenines have been modified this way or substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively.
  • this aspect of the invention could only be applied to oligonucleotides comprising at least one cytosine, uracil, or adenine, respectively, in their sequence.
  • An oligonucleotide comprising at least one 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine may be called a modified oligonucleotide by reference to its non-modified counterpart comprising no 5-methylcytosine, no 5-methyluracil and no 2,6-diaminopurine.
  • a non-modified counterpart may also be identified as being an oligonucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines.
  • Preferred non-modified sequences are represented by one of the following base or nucleotide sequences comprising or consisting of SEQ ID NO:91, 93-170.
  • parameters may include: binding affinity and/or kinetics, exon skipping activity, biostability, (intra-tissue) distribution, cellular uptake and/or trafficking, and/or immunogenicity of said oligonucleotide, as explained below. Said positive effect may be correlated with the number or percentage of base modifications incorporated.
  • Binding affinity and kinetics depend on the AON's thermodynamic properties. These are at least in part determined by the melting temperature of said oligonucleotide (Tm; calculated with e.g. the oligonucleotide properties calculator (http://www.unc.edu/ ⁇ cail/biotool/oligo/index.html or http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) for single stranded RNA using the basic Tm and the nearest neighbor model), and/or the free energy of the oligonucleotide-target exon complex (using RNA structure version 4.5 or RNA mfold version 3.5).
  • Tm melting temperature of said oligonucleotide
  • Tm the exon skipping activity typically increases, but when a Tm is too high, the AON is expected to become less sequence-specific.
  • An acceptable Tm and free energy depend on the sequence of the oligonucleotide. Therefore, it is difficult to give preferred ranges for each of these parameters.
  • Exon skipping activity is preferably measured by analysing total RNA isolated from AON-treated muscle cell cultures or muscle tissue by reverse transcriptase polymerase chain reaction (RT-PCR) using DMD gene-specific primers flanking the targeted exon as described (Aartsma-Rus et al., 2003). RT-PCR products are analyzed on 1-2% agarose gels or with the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). The ratio of shorter transcript fragments, representing transcripts in which the targeted exon is skipped, to the total of transcript products is assessed (calculated as percentage of exon skipping induced by an AON). Shorter fragments may also be sequenced to determine the correctness and specificity of the targeted exon skipping.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • An increase in percentage of exon skipping may be detected for a modified oligonucleotide of the invention (i.e. an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base) compared to its non-modified counterpart (i.e. an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and not comprising any 5-methylpyrimidine and any 2,6-diaminopurine base).
  • Said increase is preferably a detectable increase assessed as explained above using RT-PCR.
  • Said increase is preferably an increase of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times higher, or even 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times higher or more.
  • Biodistribution and biostability are preferably at least in part determined by a validated hybridization ligation assay adapted from Yu et al., 2002.
  • plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe. After separation, a DTG-labeled oligonucleotide is ligated to the complex and detection followed using an anti-DIG antibody-linked peroxidase.
  • Non-compartmental pharmacokinetic analysis is performed using WINNONLIN software package (model 200, version 5.2, Pharsight, Mountainview, Calif.).
  • AUC area under the curve
  • C max peak concentration
  • T max time to peak concentration
  • t lag terminal half life and absorption lag time
  • AONs may stimulate an innate immune response by activating the Toll-like receptors (TLR), including TLR9 and TLR7 (Krieg et al., 1995).
  • TLR9 Toll-like receptors
  • ODNs oligodeoxynucleotides
  • TLR7 has been described to recognize uracil repeats in RNA (Diebold et al., 2006).
  • TLR9 and TLR7 result in a set of coordinated immune responses that include innate immunity (macrophages, dendritic cells (DC), and NK cells)(Krieg et al., 1995; Krieg, 2000).
  • innate immunity macrophages, dendritic cells (DC), and NK cells
  • chemo- and cytokines such as IP-10, TNF ⁇ , IL-6, MCP-1 and IFN ⁇ (Wagner, 1999; Popovic et al., 2006) have been implicated in this process.
  • the inflammatory cytokines attract additional defensive cells from the blood, such as T and B cells. The levels of these cytokines can be investigated by in vitro testing.
  • a decrease in immunogenicity preferably corresponds to a detectable decrease of concentration of at least one of the cytokines mentioned above by comparison to the concentration of corresponding cytokine in an assay in a cell treated with an oligonucleotide comprising at least one 5-methylcytosine compared to a cell treated with a corresponding oligonucleotide having no 5-methylcytosines.
  • a preferred oligonucleotide of the invention has an improved parameter, such as an acceptable or a decreased immunogenicity and/or a better biodistribution and/or acceptable or improved RNA binding kinetics and/or thermodynamic properties by comparison to a corresponding oligonucleotide consisting of a 2′O-methyl phosphorothioate RNA without a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine (i.e. so called non-modified oligonucleotide).
  • an improved parameter such as an acceptable or a decreased immunogenicity and/or a better biodistribution and/or acceptable or improved RNA binding kinetics and/or thermodynamic properties by comparison to a corresponding oligonucleotide consisting of a 2′O-methyl phosphorothioate RNA without a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine (i.e
  • Said non-modified oligonucleotide may also be identified as being an oligonucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines. Each of these parameters could be assessed using assays known to the skilled person or preferably as disclosed herein.
  • oligonucleotide of the invention a compound having a 5-methylcytosine, a 5-methyluracil and/or a 2,6-diaminopurine, and the oligonucleotide comprising or consisting of a 2′-O-methyl phosphorothioate RNA.
  • additional chemistries and modifications may be present in combination with the chemistry already defined for said oligonucleotide, i.e. the presence of a 5-methylcytosine, a 5-methyluracil and/or a 2,6-diaminopurine, and the oligonucleotide comprising or consisting of a 2′-O-methyl phosphorothioate RNA.
  • a preferred oligonucleotide of the invention comprises or consists of an RNA molecule or a modified RNA molecule.
  • an oligonucleotide is single stranded.
  • a single stranded oligonucleotide may form an internal double stranded structure.
  • this oligonucleotide is still named a single stranded oligonucleotide in the context of this invention.
  • the oligonucleotide of the invention may comprise further modifications such as different types of nucleic acid monomers or nucleotides as described below. Different types of nucleic acid monomers may be used to generate an oligonucleotide of the invention. Said oligonucleotide may have at least one backbone, and/or sugar modification and/or at least one base modification compared to an RNA-based oligonucleotide.
  • a base modification includes a modified version of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g.
  • adenine, uracil, guanine, cytosine, and thymine such as hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g.
  • 5-halouracil 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N 2 -cyclopentylguanine (cPent-G), N 2 -cyclopentyl-2-aminopurine (cPent-AP), and N 2 -propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like
  • a pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N-glycoside as in uridine.
  • Pseudouridine-containing synthetic mRNA may have an improved safety profile compared to uridine-containing mRNA (WO 2009127230, incorporated here in its entirety by reference).
  • an oligonucleotide of the invention comprises an abasic site or an abasic monomer.
  • such monomer may be called an abasic site or an abasic monomer.
  • An abasic monomer or abasic site is a monomer or building block that lacks a nucleobase by comparison to a corresponding monomer comprising a nucleobase.
  • an abasic monomer is thus a building block part of an oligonucleotide but lacking a nucleobase.
  • Such abasic monomer may be present or linked or attached or conjugated to a free terminus of an oligonucleotide.
  • an oligonucleotide of the invention comprises 1-20 or more abasic monomers. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more abasic monomers may be present in an oligonucleotide of the invention.
  • An abasic monomer may be of any type known and conceivable by the skilled person, non-limiting examples of which are depicted below:
  • R 1 and R 2 are independently H, an oligonucleotide or other abasic site(s), provided that not both R 1 and R 2 are H and R 1 and R 2 are not both an oligonucleotide.
  • An abasic monomer(s) can be attached to either or both termini of the oligonucleotide as specified before.
  • an oligonucleotide attached to one or two an abasic site(s) or abasic monomer(s) may comprise less than 10 nucleotides.
  • the oligonucleotide according to the invention may comprise at least 10 nucleotides, optionally including one or more abasic sites or abasic monomers at one or both termini.
  • an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 base modifications. It is also encompassed by the invention to introduce more than one distinct base modification in said oligonucleotide.
  • a sugar modification includes a modified version of the ribosyl moiety, such as 2′-O-modified RNA such as 2′-O-alkyl or 2′-O-(substituted)alkyl e.g. 2′-O-methyl, 2′-O-(2-cyanoethyl), 2′-O-(2-methoxy)ethyl (2′-MOE), 2′-O-(2-thiomethyl)ethyl, 2′-O-butyryl, 2′-O-propargyl, 2′-O-allyl, 2′-O-(3-amino)propyl, 2′-O-(3-(dimethylamino)propyl), 2′-O-(2-amino)ethyl, 2′-O-(2-(dimethylamino)ethyl); 2′-deoxy (DNA); 2′-O-(haloalkoxy)methyl (Arai K.
  • BNA bicylic nucleic acid
  • BNA e.g. locked nucleic acid (LNA), xylo-LNA, ⁇ -L-LNA, ⁇ -D-LNA, cEt (2′-O,4′-C constrained ethyl) LNA, cMOEt (2′-O,4′-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), tricyclo DNA (tcDNA, tc-PS-DNA e.g. US patent application 20120149756); 3′-S-phosphorothiolate DNA (e.g. Org. Biol. Chem.
  • tri-NA doubly constrained nucleic acid
  • UNA unlocked nucleic acid
  • CeNA cyclohexenyl nucleic acid
  • ANA altriol nucleic acid
  • HNA hexitol nucleic acid
  • F-HNA fluorinated HNA
  • p-RNA pyranosyl-RNA
  • p-DNA 3′-deoxypyranosyl-DNA
  • molpholino as e.g. in PMO, PPMO, PMOPlus, PMO-X
  • an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 sugar modifications. It is also encompassed by the invention to introduce more than one distinct sugar modification in said oligonucleotide.
  • an oligonucleotide as defined herein comprises or consists of an LNA or a derivative thereof. BNA derivatives are for example described in WO 2011/097641, which is incorporated in its entirety by reference.
  • an oligonucleotide of the invention is fully 2′-O-methyl modified. Examples of PMO-X are described in WO2011150408, which is incorporated here in its entirety by reference.
  • a backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives.
  • PS phosphorothioate
  • PS2 chirally pure phosphorothioate
  • Another modification includes phosphoramidite, phosphoramidate, N3′ ⁇ P5′ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, triazole, oxalyl, carbamate, methyleneimino (MMI), 3′-S-phosphorothiolate ( Org. Biol. Chem. 2013, 11, 966) and thioacetamido nucleic acid (TANA); and their derivatives.
  • MMI methyleneimino
  • TANA thioacetamido nucleic acid
  • an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 backbone modifications. It is also encompassed by the invention to introduce more than one distinct backbone modification in said oligonucleotide.
  • an oligonucleotide of the invention comprises at least one phosphorothioate modification. In a more preferred embodiment, an oligonucleotide of the invention is fully phosphorothioate modified.
  • oligonucleotide of the invention include peptide-base nucleic acid (PNA), boron-cluster modified PNA, pyrrolidine-based oxy-peptide nucleic acid (POPNA), glycol- or glycerol-based nucleic acid (GNA), threose-based nucleic acid (TNA), acyclic threoninol-based nucleic acid (aTNA), morpholino-based oligonucleotide (PMO, PPMO, PMO-X), cationic morpholino-based oligomers (PMOPlus), oligonucleotides with integrated bases and backbones (ONIBs), pyrrolidine-amide oligonucleotides (POMs); and their derivatives.
  • PNA peptide-base nucleic acid
  • POPNA boron-cluster modified PNA
  • GAA glycol- or glycerol-based nucleic acid
  • TAA th
  • an oligonucleotide comprises a peptide nucleic acid and/or a morpholino phosphorodiamidate or a derivative thereof.
  • an oligonucleotide comprises a monothiophosphate moiety at the 5′ position of the 5′ terminal residue and/or a monothiophosphate moiety at the 3′ position of the 3′ terminal residue.
  • monothiophosphate groups have been shown to improve oligonucleotide stability (e.g. US patent application 20120148664—miRagen).
  • nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridization characteristics in kind not necessarily in amount as nucleic acid itself.
  • Such functional equivalents are of course also suitable for use in the invention.
  • each sugar, base, and/or backbone may be modified the same way.
  • Several distinct modified sugars, bases and/or backbones may be combined into one single oligonucleotide of the invention.
  • a backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives.
  • PS phosphorothioate
  • PS2 chirally pure phosphorothioate
  • Another modification includes phosphoramidite, phosphoramidate, N3′ ⁇ P5′ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, and thioacetamido nucleic acid (TANA); and their derivatives.
  • said oligonucleotide comprises RNA, as RNA/RNA duplexes are very stable. It is preferred that an RNA oligonucleotide comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, increased activity, reduced toxicity, increased intracellular transport, tissue-specificity, etc.
  • the mRNA complexed with the oligonucleotide of the invention is preferably not susceptible to RNaseH cleavage. Preferred modifications have been identified above.
  • the invention provides an oligonucleotide comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base.
  • this oligonucleotide consists of 2′-O-methyl RNA monomers connected through a phosphorothioate backbone and all of its cytosines and/or all of its uracils and/or all of its adenines, independently, have been substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively.
  • Preferred modified and non-modified oligonucleotides encompassed by the invention and disclosed herein comprises or consists of one of a base or nucleotide sequence selected from one of SEQ ID NO: 14-90 as identified in table 1.
  • the expression “oligonucleotide represented by a nucleotide or base sequence selected from SEQ ID NO:14-90” could be replaced by the expression “oligonucleotide represented by a nucleotide or base sequence selected from one of SEQ ID NO:14-90” or by the expression “oligonucleotide represented by a nucleotide or base sequence selected from the list of SEQ ID NO:14-90”.
  • Preferred non-modified oligonucleotides are derived from one of SEQ ID NO:14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 91, 93-170.
  • Modified oligonucleotides are preferably derived from one of SEQ ID NO:14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 92, 171-213, 215.
  • SEQ ID NO:91 is identical with SEQ ID NO: 132.
  • SEQ ID NO: 92 is identical with SEQ ID NO:199.
  • an oligonucleotide of the invention may have:
  • At least one and preferably all cytosines substituted with 5-methylcytosines are substituted with 5-methylcytosines
  • At least one and preferably all adenines substituted with 2,6-diaminopurines At least one and preferably all adenines substituted with 2,6-diaminopurines.
  • an oligonucleotide may also have at least one or at least two or at least half or all its cytosines substituted with 5-methylcytosines. If a non-modified oligonucleotide of the invention preferably based on SEQ ID NO:14-90 has x cytosines, x being an integer ranged from 1 to 33, a corresponding modified oligonucleotide of the invention may have 1, 2, 3, . . . (x ⁇ 2), (x ⁇ 1), x 5-methylcytosines.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2 or 3.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3 or 4.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4 or 5.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5 or 6.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6 or 7.
  • the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6, 7, or 8.
  • an oligonucleotide of the invention is for use as a medicament for DMD, more preferably said oligonucleotide is for use in therapeutic RNA modulation. Therefore, an oligonucleotide is an antisense oligonucleotide (AON).
  • An antisense oligonucleotide is an oligonucleotide which is reverse complementary to a specific sequence of the DMD or dystrophin pre-mRNA derived from the coding sense strand of a DNA of an individual.
  • RNA modulation for DMD is to skip one or more specific exons in the DMD or dystrophin pre-mRNA in order to restore the open reading frame of the transcript and to induce the expression of a shorter but (more) functional dystrophin protein, with the ultimate goal to be able to interfere with the course of the disease
  • an oligonucleotide of the invention is thus used for inducing exon-skipping in the DMD or dystrophin pre-mRNA in a cell, in an organ, in a tissue and/or in an individual.
  • Exon-skipping results in a mature DMD or dystrophin mRNA that does not contain a skipped exon and thus, when said exon codes for amino acids, can lead to the expression of a shorter protein product.
  • the skipping of an exon is preferably induced by the binding of an AON to specific exon-internal sequences comprising splicing regulatory elements, the splice sites and/or intronic branchpoint sequences.
  • a DMD pre-mRNA preferably means a pre-mRNA of a DMD gene coding for a dystrophin protein.
  • a mutated DMD pre-mRNA corresponds to a pre-mRNA of a BMD or DMD patient with a mutation when compared to a wild type DMD pre-mRNA of a non-affected person, resulting in (reduced levels of) an aberrant protein (BMD), or the absence of functional dystrophin (DMD).
  • BMD aberrant protein
  • DMD functional dystrophin
  • a DMD pre-mRNA is also named a dystrophin pre-mRNA.
  • a DMD gene may also be named a dystrophin gene. Dystrophin and DMD may be used interchangeably throughout the application.
  • a patient is preferably intended to mean a patient having DMD or BMD as later defined herein or a patient susceptible to develop DMD or BMD due to his or her genetic background.
  • an oligonucleotide used will preferably correct one mutation as present in the DMD gene of said patient and create a protein that will look like a BMD protein: said protein will preferably be a functional or semi-functional dystrophin as later defined herein.
  • an oligonucleotide as used will preferably correct one mutation as present in the BMD gene of said patient and create a dystrophin which will be more functional than the dystrophin which was originally present in said BMD patient.
  • a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1.
  • a semi-functional dystrophin is preferably a BMD-like dystrophin corresponding to a protein having an acting binding domain in its N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person.
  • the amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO:1.
  • a functional or a semi-functional dystrophin is a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. “At least to some extent” preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of a corresponding activity of a wild type functional dystrophin.
  • an activity of a functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC or DAPC) (Ehmsen J et al, 2002).
  • Binding of dystrophin to actin and to the DGC or DAPC complex may be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross-sections using various antibodies reacting with the different members of the complex, from a control (non-DMD) biopsy of one from a muscle suspected to be dystrophic, pre- and/or post-treatment, as known to the skilled person.
  • Duchenne muscular dystrophy typically have a mutation in the gene encoding dystrophin (the DMD or dystrophin gene) that prevents synthesis of the complete protein, i.e a premature stop codon prevents the synthesis of the C-terminus.
  • the dystrophin gene also comprises a mutation compared to the wild type but the mutation does typically not result in a premature stop codon and the C-terminus is typically synthesized.
  • a functional or semi-functional dystrophin protein is synthesized that has at least the same activity in kind as the wild type protein, although not necessarily the same amount of activity.
  • the genome of a BMD patient typically encodes a dystrophin protein comprising the N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C-terminal domain (last 325 amino acids at the C-terminus) but in the majority of cases its central rod shaped domain is shorter than the one of a wild type dystrophin (Monaco et al., 1988).
  • Antisense oligonucleotide-induced exon skipping for the treatment of DMD is typically directed to overcome a premature stop in the pre-mRNA by skipping an exon, preferably in the central rod-domain shaped domain, to correct the open reading frame and allow synthesis of remainder of the dystrophin protein including the C-terminus, albeit that the protein is somewhat smaller as a result of a smaller rod domain.
  • an individual having DMD and being treated by an oligonucleotide as defined herein will be provided a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin.
  • a functional or a semi-functional dystrophin is a dystrophin of an individual having BMD: typically said dystrophin is able to interact with both actin and the DGC or DAPC, but its central rod shaped domain may be shorter than the one of a wild type dystrophin (Monaco et al., 1988).
  • the central rod domain of wild type dystrophin comprises 24 spectrin-like repeats.
  • a central rod shaped domain of a dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin-like repeats as long as it can bind to actin and to DGC.
  • Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual using an oligonucleotide of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-metre walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life.
  • Assays is known to the skilled person. As an example, the publication of Manzur et al (2008) gives an extensive explanation of each of these assays.
  • Detectable improvement or prolongation is preferably a statistically significant improvement or prolongation as described in Hodgetts et al. (2006).
  • the alleviation of one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber function, integrity and/or survival.
  • one or more symptom(s) of a DMD or a BMD patient is/are alleviated and/or one or more characteristic(s) of one or more muscle cells from a DMD or a BMD patient is/are improved.
  • symptoms or characteristics may be assessed at the cellular, tissue level or on the patient self.
  • An alleviation of one or more characteristics of a muscle cell from a patient may be assessed by any of the following assays on a myogenic cell or muscle cell from a patient: reduced calcium uptake by muscle cells, decreased collagen synthesis, altered morphology, altered lipid biosynthesis, decreased oxidative stress, and/or improved muscle fiber function, integrity, and/or survival. These parameters are usually assessed using immunofluorescence and/or histochemical analyses of cross sections of muscle biopsies.
  • the improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic.
  • a detectable decrease of creatine kinase in blood a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic
  • a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic are known to the skilled person.
  • Creatine kinase may be detected in blood as described in Hodgetts et al. (2006).
  • a detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a same DMD or BMD patient before treatment.
  • a detectable decrease of necrosis of muscle fibers is preferably assessed in a muscle biopsy, more preferably as described in Hodgetts et al. (2006), using biopsy cross-sections.
  • a detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein necrosis has been identified using biopsy cross-sections. The decrease is measured by comparison to the necrosis as assessed in a same DMD or BMD patient before treatment.
  • a detectable increase of the homogeneity of the diameter of a muscle fiber is preferably assessed in a muscle biopsy cross-section, more preferably as described in Hodgetts et al. (2006). The increase is measured by comparison to the homogeneity of the diameter of a muscle fiber in a same DMD or BMD patient before treatment
  • an oligonucleotide of the invention provides said individual with a functional or a semi-functional dystrophin protein (typically in the case of DMD) and is able to, for at least in part decrease the production of an aberrant dystrophin protein in said individual (typically in the case of BMD).
  • a functional or a semi-functional dystrophin protein typically in the case of DMD
  • an aberrant dystrophin protein in said individual typically in the case of BMD
  • Decreasing the production of an aberrant dystrophin mRNA, or aberrant dystrophin protein preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of aberrant dystrophin mRNA, or aberrant dystrophin protein, is still detectable by RT PCR (mRNA) or immunofluorescence or western blot analysis (protein).
  • mRNA RT PCR
  • protein immunofluorescence or western blot analysis
  • An aberrant dystrophin mRNA or protein is also referred to herein as a less functional (compared to a wild type functional dystrophin protein as earlier defined herein) or a non-functional dystrophin mRNA or protein.
  • a non functional dystrophin protein is preferably a dystrophin protein which is not able to bind actin and/or members of the DCC protein complex.
  • a non-functional dystrophin protein or dystrophin mRNA does typically not have, or does not encode a dystrophin protein with an intact C-terminus of the protein.
  • the detection of a functional or semi-functional dystrophin mRNA or protein may be done as for an aberrant dystrophin mRNA or protein.
  • the enhanced skipping frequency also increases the level of functional or a semi-functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
  • Exons contain one or more specific sequences comprising splicing regulatory elements which have shown to be effective targets for antisense oligonucleotides (Aartsma-Rus et al, 2010).
  • One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding, targeting and/or hybridizing with and/or blocking these splicing regulatory elements in a dystrophin pre-mRNA exon.
  • Such oligonucleotide is also able to bind and/or target and/or hybridize with and/or block these splicing regulatory elements in a dystrophin pre-mRNA.
  • splice sites are other targets for an oligonucleotide of the invention.
  • One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding and/or targeting and/or hybridizing with, and/or blocking one of or both the splice sites of an exon of a dystrophin pre-mRNA.
  • Such oligonucleotide is also able to bind and/or target, hybridize with and/or block one or both of these splice sites of an exon of a dystrophin pre-mRNA.
  • a splice site of an exon comprises 1, 2, 3, or more nucleotides present in said exon and 1, 2, 3, or more nucleotides present in an adjacent or neighboring intron.
  • an oligonucleotide is used which is solely binding to and/or targeting and/or hybridizing with an intron region of a dystrophin pre-mRNA.
  • Such oligonucleotide is able to bind and/or able to target and/or able to hybridize with said intron region.
  • an oligonucleotide which targets and/or binds and/or hybridizes with and/or is able to target and/or is able to binds and/or is able to hybridizes with an intron-specific sequence as well as exon-specific sequence.
  • an oligonucleotide is not necessarily binding to and/or targeting and/or hybridizing with the entire sequence of a dystrophin exon or intron.
  • Such oligonucleotide is also not necessary able to bind to and/or able to target and/or able to hybridize with the entire sequence of a dystrophin exon or intron.
  • Oligonucleotides which are specifically binding, targeting and/or hybridizing with and/or which are specifically able to bind and/or able to target and/or able to hybridize part of such exon or intron are preferred.
  • An oligonucleotide is used, said oligonucleotide is preferably reverse complementary to, and/or binds to, and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least part of a dystrophin exon and/or intron, said part having at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
  • an oligonucleotide is used for exon skipping, wherein said oligonucleotide comprises a sequence which is binding to and/or targeting and/or hybridizing with or is able to bind to and/or is able to target and/or is able to hybridize with such branch point and/or splice site.
  • said splice site and/or branch point is present in a dystrophin pre-mRNA.
  • oligonucleotide part or a functional equivalent thereof comprising a sequence which is capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binds to and/or target and/or hybridizes with a splice site involves the risk of promiscuous hybridization. Hybridization of said oligonucleotide to other splice sites than the sites of the exon to be skipped could easily interfere with the accuracy of the splicing process.
  • an oligonucleotide which is binding and/or hybridizing and/or targeting and/or is able to bind to and/or is able to target and/or is able to hybridize a splice site
  • most preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof, binding to and/or hybridizing with and/or targeting and/or is able to bind to and/or is able to hybridize and/or is able to target a specific part of a dystrophin pre-mRNA exon.
  • Exons contain coding sequences which are typically more specific that the non-coding intron sequences.
  • said oligonucleotide binding to and/or hybridizing with and/or targeting and/or able to bind to and/or able to hybridize with and/or able to target a specific part of a dystrophin pre-mRNA exon is capable of specifically blocking, interfering and/or inhibiting a splicing regulatory sequence and/or structure of the anticipated exon(s) in said dystrophin pre-mRNA. Interfering with such splicing regulatory sequence and/or structure has the advantage that such elements are located within the exon. The risk for sequence-related off-target effects is therefore limited.
  • an oligonucleotide capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binding to and/or hybridizing with and/or targeting an exon at any point may be able to induce the skipping of said exon.
  • an oligonucleotide of the invention may comprise a functional equivalent or an equivalent of an oligonucleotide.
  • a functional equivalent or an equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent or equivalent is retained to at least some extent.
  • an activity of said oligonucleotide comprising a functional equivalent or equivalent of an oligonucleotide is providing a functional or a semi-functional dystrophin protein.
  • Said activity of said oligonucleotide comprising a functional equivalent or an equivalent of an oligonucleotide is therefore preferably assessed by quantifying the amount of a functional or a semi-functional dystrophin protein.
  • a functional or semi-functional dystrophin is herein preferably defined as being a dystrophin able to bind actin and members of the DCC (or DAPC) protein complex.
  • the assessment of said activity of said functional equivalent of an oligonucleotide is preferably done by RT-PCR and sequencing (on RNA level; for detection of specific exon skipping), or by immunofluorescence and Western blot analyses (on protein level: for detection of protein restoration).
  • Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent or equivalent derives from.
  • oligonucleotide when used it may be replaced by a functional equivalent thereof or an equivalent thereof as defined herein.
  • an equivalent or a functional equivalent of an oligonucleotide of the invention comprises a modification.
  • an oligonucleotide or a functional equivalent thereof, or an equivalent thereof comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base and being represented by a nucleotide sequence comprising or consisting of a sequence which is reverse complementary to, and/or binds to and/or targets and/or hybridizes and/or is able to bind to and/or is able to target and/or is able to hybridize with a dystrophin pre-mRNA exon is assumed to have a positive effect on at least one of the parameters of said oligonucleotide, as has already been defined herein, when compared to their counterparts which do not comprise any 5-methylcytosine, 5-methyluracil and 2,6-diaminopurine (i.e.
  • non-modified oligonucleotide so called non-modified oligonucleotide as indicated earlier herein, and is therefore assumed to exhibit an improved therapeutic result in a DMD or a BMD cell of a patient and/or in a DMD or a BMD patient.
  • a therapeutic result may be characterized by:
  • an oligonucleotide is represented by a nucleotide sequence which comprises or consists of a sequence which is binding to and/or targeting and/or being reverse complementary to and/or is hybridizing with and/or which is able to bind to and/or is able to target and/or is able to hybridize with and/or is reverse complementary to at least a part of dystrophin pre-mRNA exons 44 to 55, said oligonucleotide having a length of at least 10 nucleotides.
  • the length of said oligonucleotide may be at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
  • said sequence representing the oligonucleotide may also be called a base or a nucleotide sequence.
  • an oligonucleotide of the invention is represented by a nucleotide sequence or a base sequence comprising or consisting of a sequence that is capable of binding to, and/or targeting and/or being reverse complementary to and/or hybridizing with and/or being able to bind to and/or being able to hybridize with and/or being able to target a part of an exon of dystrophin pre-mRNA.
  • Said binding or targeted part may be at least 50% of the length of the oligonucleotide of the invention, or at least 60%, or at least 70%, or at least 80%, or at least 90% or at least 95%, or 98% and up to 100%.
  • An oligonucleotide may be represented by a nucleotide or a base sequence, said nucleotide or base sequence comprising a sequence that binds and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind to and/or is able to hybridize with and/or is able to target at least a part of an exon selected from the group consisting of exons 44 to 55 of dystrophin pre-mRNA as defined herein and additional flanking sequences.
  • the length of said binding or targeted part of said oligonucleotide is of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.
  • flanking sequences are used to modify the binding of a protein to said oligonucleotide, or to modify a thermodynamic property of said oligonucleotide, more preferably to modify target RNA binding affinity.
  • additional flanking sequences are reverse complementary to sequences of the dystrophin pre-mRNA which are not present in said exon.
  • flanking sequences are preferably capable of binding to and/or targeting sequences comprising or consisting of the branchpoint and/or the splice site acceptor or donor consensus sequences of said exon.
  • such flanking sequences are capable of binding to and/or targeting sequences comprising or consisting of sequences of an intron of the dystrophin pre-mRNA which is adjacent to said exon.
  • One preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, said oligonucleotide or a functional equivalent thereof or an equivalent thereof, being represented by a sequence or a base sequence which comprises:
  • RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA.
  • an oligonucleotide is capable of interfering with the structure of the exon and therefore capable of interfering with the splicing apparatus of said exon, masking the exon from the splicing apparatus and thereby inducing the skipping of said exon. It has been found that many oligonucleotides indeed comprise this capacity, some more efficient than others. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon.
  • reverse complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. Hybridization conditions are later defined herein. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing an antisense oligonucleotide, one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridizing to the complementary part.
  • a reverse complementary part of an antisense oligonucleotide (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides.
  • the reverse complementary regions are preferably designed such that, when combined, they are specific for an exon in a pre-mRNA. Such specificity may be created with various lengths of reverse complementary regions as this depends on the actual sequences in other (pre-)mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to an oligonucleotide decreases with increasing size of said oligonucleotide.
  • an antisense oligonucleotide comprising mismatches in the region of reverse complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention.
  • at least the reverse complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity than oligonucleotide having such mismatches in one or more reverse complementary regions.
  • higher hybridisation strengths, i.e. increasing number of interactions with the opposing strand
  • the reverse complementarity is from 90 to 100%.
  • this allows for 1 or 2 mismatch(es) in an oligonucleotide of 20 nucleotides or 1 to 4 mismatches in an oligonucleotide of 40 nucleotides. Therefore, we may have 1, 2, 3, 4, 5 mismatches in an oligonucleotide of 10 to 50 nucleotides. Preferably, 0, 1 or 2 mismatches are present in an oligonucleotide of 10 to 50 nucleotides.
  • the structure i.e. open and closed structures
  • Such structure may be analyzed in the actual RNA.
  • Non-limiting examples of a suitable program are RNA structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003).
  • a person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of an exon, given a nucleotide sequence. Best predictions are obtained when providing such modeling programs with both said exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.
  • the open and closed structure to which the oligonucleotide of an oligonucleotide is directed are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal or splicing regulatory sequence, element, structure, or signal is generated defining a different (neo) exon, i.e. with a different 5′ end, a different 3′ end, or both.
  • This type of activity is within the scope of the present invention as the targeted exon is excluded from the mRNA.
  • the presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded.
  • the inclusion of a neo-exon can be seen as a side effect which occurs only occasionally.
  • exon skipping is used to restore (part of) an open reading frame of dystrophin that is disrupted as a result of a mutation.
  • One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored.
  • an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof or an equivalent thereof comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising a sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with a binding site for a serine-arginine (SR) protein in RNA of an exon of a dystrophin pre-mRNA.
  • SR serine-arginine
  • an oligonucleotide comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing a corresponding compound comprising oligonucleotide that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with said RNA and that at least partly overlaps said (putative) binding site.
  • the term “at least partly overlaps” is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site.
  • This embodiment preferably further comprises determining from a secondary structure of said RNA, a region that is hybridized to another part of said RNA (closed structure) and a region that is not hybridized in said structure (open structure), and subsequently generating an oligonucleotide that at least partly overlaps said (putative) binding site and that overlaps at least part of said closed structure and overlaps at least part of said open structure.
  • a first selected SR-binding region does not have the requested open-closed structure in which case another (second) SR protein binding site is selected which is then subsequently tested for the presence of an open-closed structure.
  • This process is continued until a sequence is identified which contains an SR protein binding site as well as a(n) (partly overlapping) open-closed structure. This sequence is then used to design an oligonucleotide which is reverse complementary to said sequence.
  • Such a method for generating an antisense oligonucleotide is also performed by reversing the described order, i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is reverse complementary to said closed structure and of which at least another part of said oligonucleotide is reverse complementary to said open structure.
  • This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083446 is improved.
  • the selections are performed simultaneously.
  • oligonucleotide directed to or targeting an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.
  • an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.
  • exons Besides consensus splice site and branchpoint intronic sequences, many (if not all) exons contain splicing regulatory sequences such as but not limited to exonic splicing enhancer (ESE) sequences to facilitate the recognition of genuine splice sites by the spliceosome (Cartegni et al., 2002; and Cartegni et al., 2003).
  • ESE exonic splicing enhancer
  • a subgroup of splicing factors, called the SR proteins can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF to (weakly defined) splice sites.
  • the invention thus provides an oligonucleotide as described above, which is reverse complementary to and/or targets and/or binds to and/or hybridizes with and/or is able to target and/or is able to bind and/or is able to hybridize with a binding site for a SR protein.
  • said SR protein is SF2/ASF or SC35 or SRp40.
  • a DMD patient is provided with a functional or a semi-functional dystrophin protein by using an oligonucleotide or a functional equivalent thereof or an equivalent thereof comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e.
  • RNA sequence which is required for the correct splicing of a dystrophin exon in a transcript.
  • ESE exonic splicing enhancer
  • ERS exon recognition sequence
  • ESS exonic splicing silencer
  • sequence-specific antisense oligonucleotide or a base-specific antisense oligonucleotide that binds to and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind and/or is able to hybridize with and/or is able to target the elements, their regulatory function is disturbed so that the exon is skipped, as shown for DMD.
  • an oligonucleotide or a functional equivalent thereof or an equivalent thereof is used which is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with an exonic splicing enhancer (ESE), an exon recognition sequence (ERS), and/or an exonic splicing silencer (ESS).
  • ESE exonic splicing enhancer
  • ERS exon recognition sequence
  • ESS exonic splicing silencer
  • an oligonucleotide of the invention comprises or consists of a sequence or a base sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least a part of dystrophin pre-mRNA exon 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, said part having at least 10 nucleotides.
  • said part may also have at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or, 33 nucleotides.
  • a preferred oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil and/or a 2,6-diaminopurine base and binds to and/or is reverse complementary to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with a continuous stretch of at least 10 and up to 33 nucleotides within one of the following exon nucleotide sequences selected from SEQ ID NO: 2 to 13.
  • oligonucleotides are also defined as follows:
  • such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein.
  • More preferred oligonucleotides comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90.
  • SEQ ID NO:14-90 are identified in Table 1.
  • a 5-methylpyrimidine means at least one 5-methylpyrimidine.
  • at least one 5-methylpyrimindine means at least one 5-methylcytosine and/or at least one 5-methyluracile.
  • Each of these non-modified oligonucleotides comprises no 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and no 2,6-diaminopurine.
  • SEQ ID NO:91 is identical with SEQ ID NO: 132.
  • SEQ ID NO: 92 is identical with SEQ ID NO: 199.
  • a fragment of SEQ ID NO:14-90, or a fragment of SEQ ID NO:91-219 preferably means a nucleotide or a base sequence comprising or consisting of at least 10 contiguous nucleotides from said SEQ ID NO:14-90 or from said SEQ ID NO:91-219.
  • Such more preferred oligonucleotides are also defined as follows:
  • such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein.
  • oligonucleotides comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90, 92, 171-215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO:14-90, 92, 171-215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Preferred sequences i.e.
  • SEQ ID NO:14-90, 92, and 171-215, 217, 218, 219 include SEQ ID NO: 15, 21, 31, 40, 43, 52, 57, 59, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 more preferably SEQ ID NO: 40, 43, 52, 57, 59, 208, 207, 200, 210, 206, 171, 173, 199, 213, 185, 187.
  • such modified oligonucleotides are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 92, 171-213, 215, 217, 218, 219 and have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • modified oligonucleotides are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of.
  • Preferred oligonucleotides for inducing the skipping of exon 44 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 14 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:14 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:14.
  • SEQ ID NO:94 a non-modified oligonucleotide derived from SEQ ID NO:14 is represented by SEQ ID NO:94 and a preferred fragment of SEQ ID NO:94 is represented by SEQ ID NO:143.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 94 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:94 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:94.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:14 comprises SEQ ID NO: 63 and a preferred fragment of SEQ ID NO:94 comprises SEQ ID NO: 143, and each of said preferred fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 15 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:15 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:15.
  • oligonucleotide derived from SEQ ID NO:15 is represented by SEQ ID NO:95.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 95 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:95 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:95.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:15 comprises SEQ ID NO: 64 and a preferred fragment of SEQ ID NO:95 comprises SEQ ID NO:144 and each of said fragments has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or base sequence comprising SEQ ID NO: 16 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:16 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:16.
  • oligonucleotide derived from SEQ ID NO:16 is represented by SEQ ID NO:96.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 96 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:96 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:96.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 17 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:17 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:17.
  • SEQ ID NO:97 a non-modified oligonucleotide derived from SEQ ID NO:17 is represented by SEQ ID NO:97 and a preferred fragment of SEQ ID NO:97 is represented by SEQ ID NO:145.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 97 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:97 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:97.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:17 comprises SEQ ID NO: 65 and a preferred fragment of SEQ ID NO: 97 comprises SEQ ID NO: 145, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base i.e. a 2,6-diaminopurine base.
  • said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 18 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:18 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:18.
  • SEQ ID NO:98 a non-modified oligonucleotide derived from SEQ ID NO:18 is represented by SEQ ID NO:98 and a preferred fragment of SEQ ID NO:98 is represented by SEQ ID NO:146.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:18 comprises SEQ ID NO: 66 and a preferred fragment of SEQ ID NO: 98 comprises SEQ ID NO: 146, each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 98 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:98 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:98.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 19 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:19 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:19.
  • oligonucleotide derived from SEQ ID NO:19 is represented by SEQ ID NO:99.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 99 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:99 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:99.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 20 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:20 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:20.
  • a non-modified oligonucleotide derived from SEQ ID NO:20 is represented by SEQ ID NO:100 and a preferred fragment of SEQ ID NO:100 is represented by SEQ ID NO:147, 148 or 149.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 100 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:100 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:100.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 67 and a preferred fragment of SEQ ID NO:100 comprises SEQ ID NO:147, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 68 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 148, each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 69 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 149, each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Preferred oligonucleotides for inducing the skipping of exon 45 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:21 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and
  • a non-modified oligonucleotide derived from SEQ ID NO:21 is represented by SEQ ID NO:101 and a preferred fragment of SEQ ID NO:101 is represented by SEQ ID NO:150, 151 or 152.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 101 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:101 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:101.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 70 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:150, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 71 and another preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:151, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 72 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:152, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • said oligonucleotide is particularly represented by a nucleotide or a base sequence comprising SEQ ID NO: 200 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:200 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:200.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 22 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:22 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:22.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 22
  • oligonucleotide derived from SEQ ID NO:22 is represented by SEQ ID NO:102.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 102 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:102 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:102.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 23 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:23 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:23.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 23 and
  • oligonucleotide derived from SEQ ID NO:23 is represented by SEQ ID NO:103.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 103 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:103 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:103.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 24 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:24 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:24.
  • oligonucleotide derived from SEQ ID NO:24 is represented by SEQ ID NO:104.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 104 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:104 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:104.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 25 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:25 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:25.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 25
  • oligonucleotide derived from SEQ ID NO:25 is represented by SEQ ID NO:105.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 105 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:105 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:105.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioatc RNA monomer or consists of 2′-O-methyl phosphorothioatc RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 26 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:26 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:26.
  • oligonucleotide derived from SEQ ID NO:26 is represented by SEQ ID NO:106.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 106 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:106 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:106.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 27 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:27 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:27.
  • oligonucleotide derived from SEQ ID NO:27 is represented by SEQ ID NO:107.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioatc RNA monomer or consists of 2′-O-methyl phosphorothioatc RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 107 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:107 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:107.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base i.e. a 2,6-diaminopurine base.
  • said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 28 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:28 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:28.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 28 and
  • SEQ ID NO:108 a non-modified oligonucleotide derived from SEQ ID NO:28 is represented by SEQ ID NO:108.
  • SEQ ID NO:28 and SEQ ID NO:108 identified in table 1 comprises an hypoxanthine base at position 7.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 108 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:108 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:108.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 29 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:29 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:29.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 29 and
  • oligonucleotide derived from SEQ ID NO:29 is represented by SEQ ID NO:109.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 109 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:109 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ NO:109.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 30 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:30 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:30.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 30 and has a length of 30,
  • oligonucleotide derived from SEQ ID NO:30 is represented by SEQ ID NO:110.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 110 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:110 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:110.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Preferred oligonucleotides for inducing the skipping of exon 51 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 31 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:31 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:31.
  • a non-modified oligonucleotide derived from SEQ ID NO:31 is represented by SEQ ID NO:111 and a preferred fragment of SEQ ID NO:111 is represented by SEQ ID NO:153 or 154.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 111 and has a length 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:111 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:111.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 73 and a preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 153, and each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 74 and another preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 154, and each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 32 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:32 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:32.
  • oligonucleotide derived from SEQ ID NO:32 is represented by SEQ ID NO:112.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 112 and has a length 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:112 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:112.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 33 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:33 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:33.
  • oligonucleotide derived from SEQ ID NO:33 is represented by SEQ ID NO:113.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 113 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:113 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:113.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34.
  • oligonucleotide derived from SEQ ID NO:34 is represented by SEQ ID NO:114.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide sequence comprising SEQ ID NO: 114 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:114 comprising or consisting of at least 10 contiguous nucleotides of SEQ ID NO:114.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO: 34 comprises or consists of SEQ ID NO: 93 (PS1116: 5′-CAACAUCAAGGAAGAUGGCAUUUCU-3′).
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 35 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:35 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:35.
  • oligonucleotide derived from SEQ ID NO:35 is represented by SEQ ID NO:115.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 115 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:115 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:115.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 36 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:36 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:36.
  • a non-modified oligonucleotide derived from SEQ ID NO:36 is represented by SEQ ID NO:116 and a preferred fragment of SEQ ID NO:116 is represented by SEQ ID NO:155 or 156 or 157.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 116 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:116 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:116.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 75 or a preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 155, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 76 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 156, and each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 77 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 157, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 37 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:37 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:37.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 37 and has a length of 30,
  • oligonucleotide derived from SEQ ID NO:37 is represented by SEQ ID NO:117.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 117 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:117 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:117.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 38 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:38 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:38.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 38 and
  • oligonucleotide derived from SEQ ID NO:38 is represented by SEQ ID NO:118.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 118 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:118 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:118.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Preferred oligonucleotides for inducing the skipping of exon 52 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 39 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:39 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:39.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 39 and
  • oligonucleotide derived from SEQ ID NO:39 is represented by SEQ ID NO:119.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 119 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:119 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:119.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 40 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:40 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:40. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a non-modified oligonucleotide derived from SEQ ID NO:40 is represented by SEQ ID NO:120 and a preferred fragment of SEQ ID NO:120 is represented by SEQ ID NO:158 or 159 or 160.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 120 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:120 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:120.
  • a preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 78 and a preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:158, and each fragment has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 79 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:159, and each fragment has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 80 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:160, and each fragment has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide sequence or a base comprising SEQ ID NO: 41 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:41 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:41.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide sequence or a base comprising SEQ ID NO: 41
  • a non-modified oligonucleotide derived from SEQ ID NO:41 is represented by SEQ ID NO:121.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 121 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:121 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:121.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 42 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:42 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:42.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 42 and
  • oligonucleotide derived from SEQ ID NO:42 is represented by SEQ ID NO:122.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 122 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:122 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:122.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:43 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:43.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Such preferred oligonucleotide is also defined as follows:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 123 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:123 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:123.
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • a preferred fragment of SEQ ID NO:43 comprises SEQ ID NO: 81 and a preferred fragment of SEQ ID NO:123 comprises SEQ ID NO:161, each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • Preferred oligonucleotides for inducing the skipping of exon 53 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 44 and has a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:44 comprising or consisting of at least 10 contiguous or bases nucleotides of SEQ ID NO:44.
  • oligonucleotide derived from SEQ ID NO:44 is represented by SEQ ID NO:124.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 124 and has a length 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:124 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:124.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 45 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:45 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:45.
  • oligonucleotide derived from SEQ ID NO:45 is represented by SEQ ID NO:125.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 125 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:125 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:125.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 46 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:46 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:46.
  • oligonucleotide derived from SEQ ID NO:46 is represented by SEQ ID NO:126.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 126 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:126 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:126.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 47 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:47 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:47.
  • oligonucleotide derived from SEQ ID NO:47 is represented by SEQ ID NO:127.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 127 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:127 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:127.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 48 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:48 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:48.
  • oligonucleotide derived from SEQ ID NO:48 is represented by SEQ ID NO:128.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 128 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:128 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:128.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 49 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:49 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:49.
  • oligonucleotide derived from SEQ ID NO:49 is represented by SEQ ID NO:129.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 129 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:129 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:129.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 50 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:50 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:50.
  • oligonucleotide derived from SEQ ID NO:50 is represented by SEQ ID NO:130.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 130 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:130 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:130.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 51 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:51 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:51.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 51
  • oligonucleotide derived from SEQ ID NO:51 is represented by SEQ ID NO:131.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 131 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:131 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:131.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 52 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:52 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:52.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 52
  • SEQ ID NO: 91 a non-modified oligonucleotide derived from SEQ ID NO:52 is represented by SEQ ID NO: 91 and a preferred fragment of SEQ ID NO:91 is represented by SEQ ID NO:162, 163 or 164.
  • SEQ ID NO: 91 is identical with SEQ ID NO: 132.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 91 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:191 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:91.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • a preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 82 and a preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:162, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 83 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:163, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 84 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:164, each of said fragments has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 91 (PS229L: 5′-GUUGCCUCCGGUUCUGAAGGUGUUC-3′).
  • Another most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 92 (PS524: 5′-GUUGXXUXXGGUUXUGAAGGUGUUX-3′; wherein X is 5-methylcytosine).
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 53 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:53 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:53.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 53
  • oligonucleotide derived from SEQ ID NO:53 is represented by SEQ ID NO:133.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 133 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:133 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:133.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 54 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:54 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:54.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 54 and has a length of
  • oligonucleotide derived from SEQ ID NO:54 is represented by SEQ ID NO:134.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 134 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:134 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:134.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioatc RNA monomer or consists of 2′-O-methyl phosphorothioatc RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 55 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:55 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:55.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 55 and has a
  • oligonucleotide derived from SEQ ID NO:55 is represented by SEQ ID NO:135.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 135 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:135 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:135.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 56 and has a length of 33, 34 or 35 nucleotides or by a fragment of SEQ ID NO:56 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:56.
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 56 and has a length of 33
  • oligonucleotide derived from SEQ ID NO:56 is represented by SEQ ID NO:136.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioatc RNA monomer or consists of 2′-O-methyl phosphorothioatc RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 136 and has a length 33, 34 or 35 nucleotides, or by a fragment of SEQ ID NO:136 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:136.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Preferred oligonucleotides for inducing the skipping of exon 55 from the dystrophin pre-mRNA are as follows below.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:57 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:57.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Such preferred oligonucleotide is also defined as follows:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 137 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:137 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:137.
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 185 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:185 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:185. It is also encompassed that not all the 8 cytosines of SEQ ID NO:57 are modified as represented in SEQ ID NO:185. It is encompassed that 1, 2, 3, 4, 5, 6, or 7 of these cytosines are modified.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 85 and a preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 165, each of said fragments has a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 86 and another preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 166, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 58 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:58 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:58.
  • oligonucleotide derived from SEQ ID NO:58 is represented by SEQ ID NO:138.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 138 and has a length 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:138 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:138.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • Such preferred oligonucleotide is also defined as follows:
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein
  • a 5-methylpyrimidine i.e. a 5-methylcytosine, and/or a 5-methyluracil
  • 2,6-diaminopurine base as earlier defined herein
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:59 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:59. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Such preferred oligonucleotide is also defined as follows:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 139 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:139 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:139.
  • such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.
  • said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide More preferably, an oligonucleotide:
  • said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 192 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:192 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:192. It is also encompassed that not all the 5 cytosines of SEQ ID NO:59 are modified as represented in SEQ ID NO:192. It is encompassed that 1, 2, 3 or 4 of these cytosines are modified.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • a preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 87 and a preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:167, each of said fragments has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 88 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:168, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 89 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:169, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 90 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:170, each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide More preferably, an oligonucleotide:
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 60 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:60 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:60.
  • oligonucleotide derived from SEQ ID NO:60 is represented by SEQ ID NO:140.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 140 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:140 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:140.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 61 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:61 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:61.
  • oligonucleotide derived from SEQ ID NO:61 is represented by SEQ ID NO:141.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 141 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:141 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:141.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e.
  • a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base is represented by a nucleotide or a base sequence comprising SEQ ID NO: 62 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:62 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:62.
  • oligonucleotide derived from SEQ ID NO:62 is represented by SEQ ID NO:142.
  • an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 142 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:142 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:142.
  • Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.
  • said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.
  • composition comprising an oligonucleotide as described in the previous section entitled “Oligonucleotide”.
  • This composition preferably comprises or consists of an oligonucleotide as described above.
  • composition is for use as a medicament.
  • Said composition is therefore a pharmaceutical composition.
  • a pharmaceutical composition usually comprises a pharmaceutically accepted carrier, diluent and/or excipient.
  • a composition of the current invention comprises a compound as defined herein and optionally further comprises a pharmaceutically acceptable formulation, filler, preservative, solubilizer, carrier, diluent, excipient, salt, adjuvant and/or solvent.
  • Such pharmaceutically acceptable carrier, filler, preservative, solubilizer, diluent, salt, adjuvant, solvent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000.
  • the compound as described in the invention may possess at least one ionizable group.
  • An ionizable group may be a base or acid, and may be charged or neutral.
  • An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charge(s).
  • Examples of cationic counterions are sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium.
  • anionic counterions are chloride, bromide, iodide, lactate, mesylate, acetate, trifluoroacetate, dichloroacetate, and citrate. Examples of counterions have been described [e.g. Kumar, 2008, which is incorporated here in its entirety by reference].
  • a composition comprises the oligonucleotide of the invention and sodium as counterion.
  • Said oligonucleotide present in said composition may also be named as an oligonucleotide in its sodium form.
  • a composition comprises the oligonucleotide of the invention and calcium and/or magnesium as counterion.
  • Said oligonucleotide present in said composition may also be named as an oligonucleotide in its calcium or magnesium or mixed calcium/magnesium form.
  • composition comprising an oligonucleotide of the invention and a counterion may be obtained through either formulating the counterion salt of the oligonucleotide or by adding appropriate amounts of said salt to an oligonucleotide.
  • a positive effect of calcium salts present in composition comprising an oligonucleotide with respect to immunostimulatory effects of said oligonucleotides has been described (e.g. patent application WO 2012021985 (Replicor), incorporated here in its entirety by reference).
  • a pharmaceutical composition may comprise an aid in enhancing the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics and cellular uptake of said compound, in particular an excipient capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and/or liposomes.
  • nanoparticles include polymeric nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles.
  • a preferred composition comprises at least one excipient that may further aid in enhancing the targeting and/or delivery of said composition and/or said oligonucleotide to a tissue and/or a cell and/or into a tissue and/or a cell.
  • a preferred tissue or cell is a muscle tissue or cell.
  • first type of excipients include polymers (e.g. polyethyleneimine (PEI), poly-2-hydroxypropylcneimine (pHP), polypropyleneimine (PPI), dextran derivatives, butylcyanoacrylate (PBCA), hexylcyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g.
  • spermine spermidine, putrescine, cadaverine
  • chitosan poly(amido amines) (PAMAM), poly(ester amine), polyvinyl ether, polyvinyl pyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrins, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g. poly(amidoamine)), lipids ⁇ e.g.
  • DODAP 1,2-dioleoyl-3-dimethylammonium propane
  • DODAC dioleoyldimethylammonium chloride
  • DPPC dioleoyldimethylammonium chloride
  • DPPC phosphatidylcholine derivatives
  • DSPC 1,2-distearoyl-sn-glycero-3-phosphocholine
  • lyso-phosphatidylcholine derivaties e.g.
  • 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt DPPG-Na
  • phosphaticid acid derivatives 1,2-distearoyl-sn-glycero-3-phosphaticid acid, sodium salt (DSPA)
  • DSPA phosphatidylethanolamine derivatives
  • DOPE dioleoyl-L-R-phosphatidylethanolamine
  • DSPE 1,2-distearoyl-sn-glycero-3-phosphoethanolamine
  • DPhyPE 2-diphytanoyl-sn-glycero-3-phosphoethanolamine
  • DOPE 1,2-distearoyl-sn-glycero-3-phosphoethanolamine
  • DPhyPE 2-diphytanoyl-sn-glycero-3-phosphoethanolamine
  • DOTAP N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
  • DOTMA 1,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid
  • DOSPER 1,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid
  • DMRIE 1,2-dimyristyolxypropyl
  • DSDMA 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane
  • DoDMA 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane
  • DoDMA 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane
  • DLinDMA 1,2-Dilinoleyloxy-N,N-3-dimethylaminopropane
  • DLin-K-DMA 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane
  • DOPS phosphatidylserine derivatives [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)]
  • cholesterol ⁇ proteins e.g. albumin, gelatins, atellocollagen
  • peptides e.g. protamine, PepFects, NickFects
  • compositions may comprise at least one excipient categorized as a second type of excipient.
  • a second type of excipient may comprise or contain a conjugate group as described herein to enhance targeting and/or delivery of the composition and/or of the oligonucleotide of the invention to a tissue and/or cell and/or into a tissue and/or cell, as for example muscle tissue or cell. Both types of excipients may be combined together into one single composition as identified herein.
  • the skilled person may select, combine and/or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver a compound for use in the present invention.
  • Such a pharmaceutical composition of the invention may be administered in an effective concentration at set times to an animal, preferably a mammal. More preferred mammal is a human being.
  • An oligonucleotide or a composition as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing a disease or condition as identified herein, and may be administered directly in vivo, ex vivo or in vitro.
  • Administration may be via topical, systemic and/or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracavernous, intracerebral, intrathecal, epidural or oral route.
  • parenteral routes for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracavernous, intracerebral, intrathecal, epidural or oral route.
  • such a pharmaceutical composition of the invention may be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or soft-gel for oral delivery, or in the form of aerosol or dry powder for delivery to the respiratory tract and lungs.
  • an oligonucleotide of the invention may be used together with another compound already known to be used for the treatment of said disease.
  • Such other compounds may be used for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival and/or improve, increase or restore cardiac function.
  • a steroid preferably a (gluco)corticosteroid, an ACE inhibitor (preferably perindopril), an angiotensin II type 1 receptor blocker (preferably losartan), a tumor necrosis factor-alpha (TNF ⁇ ) inhibitor, a TGF ⁇ inhibitor (preferably decorin), human recombinant biglycan, a source of mIGF-1, a myostatin inhibitor, mannose-6-phosphate, an antioxidant, an ion channel inhibitor, a protease inhibitor, a phosphodiesterase inhibitor (preferably a PDE5 inhibitor, such as sildenafil or tadalafil), a histone deacetylase inhibitor (HDAC inhibitor, androgen receptor modulator, creatine, creatine phosphate, and/or L-arginine.
  • a steroid preferably a (gluco)corticosteroid, an ACE inhibitor (preferably perindopril), an angiotensin II type 1 receptor blocker (preferably losartan),
  • compositions or an oligonucleotide as described in the previous sections for use as a medicament or part of therapy, or applications in which said oligonucleotide exerts its activity intracellularly.
  • an oligonucleotide or composition of the invention is for use as a medicament or part of a therapy for preventing, delaying, curing, ameliorating and/or treating DMD or BMD.
  • the method comprising administering an oligonucleotide or a composition of the invention to said individual or a subject in the need thereof.
  • an oligonucleotide or a composition as defined herein may be suitable for administration to a cell, tissue and/or an organ in vivo of individuals affected by any of the herein defined diseases, and may be administered in vivo, ex vivo or in vitro.
  • An individual or a subject in need is preferably a mammal, more preferably a human being.
  • a method for diagnosis wherein the oligonucleotide of the invention is provided with a radioactive label or fluorescent label.
  • a concentration of an oligonucleotide or composition is ranged from 0.01 nM to 1 ⁇ M. More preferably, the concentration used is from 0.05 to 500 nM, or from 0.1 to 500 nM, or from 0.02 to 500 nM, or from 0.05 to 500 nM, even more preferably from 1 to 200 nM.
  • Dose ranges of an oligonucleotide or composition according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist.
  • An oligonucleotide as defined herein may be used at a dose which is ranged from 0.01 to 200 mg/kg or 0.05 to 100 mg/kg or 0.1 to 50 mg/kg or 0.1 to 20 mg/kg, preferably from 0.5 to 10 mg/kg.
  • oligonucleotide or composition as given above are preferred concentrations or doses for in vitro or ex vivo uses.
  • concentration or dose of oligonucleotide used may further vary and may need to be optimised any further.
  • the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
  • the verb “to consist” may be replaced by “to consist essentially of” meaning that an oligonucleotide or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
  • reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.
  • the indefinite article “a” or “an” thus usually means “at least one”.
  • binds oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein.
  • able to bind could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein and for which conditions could be found wherein said oligonucleotide could bind, target or hybridize with said part of said pre-mRNA.
  • hybridization refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
  • nucleobases complementary nucleoside or nucleotide bases
  • the natural base adenine is nucleobase complementary to the natural nucleobases thymine and uracil which pair through the formation of hydrogen bonds.
  • the natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methylcytosine. Hybridization can occur under varying circumstances.
  • “specifically hybridizes” refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.
  • an anti sense oligonucleotide specifically hybridizes to more than one target site.
  • hybridizes is used under physiological conditions in a cell, preferably a muscular cell unless otherwise indicated.
  • nucleoside refers to a compound comprising a heterocyclic base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA), abasic nucleosides, modified nucleosides, and sugar-modified nucleosides. Nucleosides may be modified with any of a variety of substituents.
  • sugar moiety means a natural (furanosyl), a modified sugar moiety or a sugar surrogate.
  • modified sugar moiety means a chemically-modified furanosyl sugar or a non-furanosyl sugar moiety. Also, embraced by this term are furanosyl sugar analogs and derivatives including tricyclic sugars, bicyclic sugars, tetrahydropyrans, morpholinos, 2′-modified sugars, 4′-modified sugars, 5′-modified sugars, and 4′-substituted sugars.
  • sugar-modified nucleoside means a nucleoside comprising a modified sugar moiety.
  • sugar surrogate refers to a structure that is capable of replacing the furanose ring of a naturally occurring nucleoside.
  • sugar surrogates are non-furanose (or 4′-substituted furanose) rings or ring systems or open systems.
  • Such structures include simple changes relative to the natural furanose ring, such as a six membered ring or may be more complicated as is the case with the non-ring system used in peptide nucleic acid.
  • Sugar surrogates includes without limitation morpholinos and cyclohexenyls and cyclohexitols. In most nucleosides having a sugar surrogate group the heterocyclic base moiety is generally maintained to permit hybridization.
  • nucleotide refers to a nucleoside further comprising a modified or unmodified phosphate linking group or a non-phosphate internucleoside linkage.
  • linked nucleosides may or may not be linked by phosphate linkages and thus includes “linked nucleotides”.
  • nucleobase refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or may be modified and therefore include, but are not limited to adenine, cytosine, guanine, uracil, thymine and analogues thereof such as 5-methylcytosine. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.
  • modified nucleoside refers to a nucleoside comprising at least one modification compared to naturally occurring RNA or DNA nucleosides. Such modification may be at the sugar moiety and/or at the nucleobases.
  • T m means melting temperature which is the temperature at which the two strands of a duplex nucleic acid separate. T m is often used as a measure of duplex stability or the binding affinity of an antisense compound toward a complementary RNA molecule.
  • 2′-modified or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH.
  • 2′-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2′ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2′-substituents, such as allyl, amino, azido, thio, O-allyl, O—C 1 -C 10 alkyl, —OCF 3 , O—(CH 2 ) 2 —O—CH 3 , 2′-O(CH 2 ) 2 SCH 3 , O—(CH 2 ) 2 —O—N(R m )(R n ), or O—CH 2 —C( ⁇ O)—N(R m )(R n ), where
  • 2′-OMe or “2′-OCH 3 ” or “2′-O-methyl” each refers to a nucleoside comprising a sugar comprising an —OCH 3 group at the 2′ position of the sugar ring.
  • MOE or “2′-MOE” or “2′-OCH 2 CH 2 OCH 3 ” or “2′-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a —OCH 2 CH 2 OCH 3 group at the 2′ position of the sugar ring.
  • adenine analogue means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a thymine or uracil of a complementary strand of RNA or DNA.
  • uracil analogue means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a adenine of a complementary strand of RNA or DNA.
  • thymine analogue means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with an adenine of a complementary strand of RNA or DNA.
  • cytosine analogue means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a guanine of a complementary strand of RNA or DNA.
  • cytosine analogue can be a 5-methylcytosine.
  • guanine analogue means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a cytosine of a complementary strand of RNA or DNA.
  • guanosine refers to a nucleoside or sugar-modified nucleoside comprising a guanine or guanine analog nucleobase.
  • uridine refers to a nucleoside or sugar-modified nucleoside comprising a uracil or uracil analog nucleobase.
  • thymidine refers to a nucleoside or sugar-modified nucleoside comprising a thymine or thymine analog nucleobase.
  • cytidine refers to a nucleoside or sugar-modified nucleoside comprising a cytosine or cytosine analog nucleobase.
  • adenosine refers to a nucleoside or sugar-modified nucleoside comprising an adenine or adenine analog nucleobase.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • oligonucleoside refers to an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom.
  • oligonucleotides include oligonucleosides.
  • modified oligonucleotide or “chemically-modified oligonucleotide” refers to an oligonucleotide comprising at least one modified sugar, a modified nucleobase and/or a modified internucleoside linkage or backbone.
  • nucleoside linkage or “backbone” refers to a covalent linkage between adjacent nucleosides.
  • naturally occurring internucleoside linkage refers to a 3′ to 5′ phosphodiester linkage.
  • modified internucleoside linkage refers to any internucleoside linkage other than a naturally occurring internucleoside linkage.
  • oligomeric compound refers to a polymeric structure comprising two or more sub-structures.
  • an oligomeric compound is an oligonucleotide.
  • an oligomeric compound is a single-stranded oligonucleotide.
  • an oligomeric compound is a double-stranded duplex comprising two oligonucleotides.
  • an oligomeric compound is a single-stranded or double-stranded oligonucleotide comprising one or more conjugate groups and/or terminal groups.
  • conjugate refers to an atom or group of atoms bound to an oligonucleotide or oligomeric compound.
  • conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to the parent compound such as an oligomeric compound.
  • conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • conjugates are terminal groups.
  • conjugates are attached to a 3′ or 5′ terminal nucleoside or to an internal nucleosides of an oligonucleotide.
  • conjugate linking group refers to any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
  • Linking groups or bifunctional linking moieties such as those known in the art are amenable to the present invention.
  • antisense compound refers to an oligomeric compound, at least a portion of which is at least partially complementary to a target nucleic acid to which it hybridizes and modulates the activity, processing or expression of said target nucleic acid.
  • expression refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.
  • antisense oligonucleotide refers to an antisense compound that is an oligonucleotide.
  • antisense activity refers to any detectable and/or measurable activity attributable to the hybridization of an anti sense compound to its target nucleic acid.
  • such activity may be an increase or decrease in an amount of a nucleic acid or protein.
  • such activity may be a change in the ratio of splice variants of a nucleic acid or protein.
  • Detection and/or measuring of antisense activity may be direct or indirect.
  • antisense activity is assessed by observing a phenotypic change in a cell or animal.
  • target nucleic acid refers to any nucleic acid molecule the expression, amount, or activity of which is capable of being modulated by an antisense compound.
  • the target nucleic acid is DNA or RNA.
  • the target RNA is mRNA, pre-mRNA, non-coding RNA, pri-microRNA, pre-microRNA, mature microRNA, promoter-directed RNA, or natural antisense transcripts.
  • the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
  • target nucleic acid is a viral or bacterial nucleic acid.
  • target mRNA refers to a pre-selected RNA molecule that encodes a protein.
  • targeting refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule.
  • An anti sense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
  • target site refers to a region of a target nucleic acid that is bound by an antisense compound.
  • a target site is at least partially within the 3′ untranslated region of an RNA molecule.
  • a target site is at least partially within the 5′ untranslated region of an RNA molecule.
  • a target site is at least partially within the coding region of an RNA molecule.
  • a target site is at least partially within an exon of an RNA molecule.
  • a target site is at least partially within an intron of an RNA molecule.
  • a target site is at least partially within a microRNA target site of an RNA molecule.
  • a target site is at least partially within a repeat region of an RNA molecule.
  • target protein refers to a protein, the expression of which is modulated by an antisense compound.
  • a target protein is encoded by a target nucleic acid.
  • expression of a target protein is otherwise influenced by a target nucleic acid.
  • complementary nucleobase refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobases at a certain position of an antisense compound are capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
  • non-complementary in reference to nucleobases refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • complementary in reference to linked nucleosides, oligonucleotides, or nucleic acids, refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity.
  • an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the anti sense compound and the target.
  • nucleobases that can bond with each other to allow stable association between the anti sense compound and the target.
  • antisense compounds may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target).
  • the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches.
  • the remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases).
  • One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.
  • modulation refers to a perturbation of amount or quality of a function or activity when compared to the function or activity prior to modulation.
  • modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.
  • modulation of expression can include perturbing splice site selection of pre-mRNA processing, resulting in a change in the amount of a particular splice-variant present compared to conditions that were not perturbed.
  • modulation includes perturbing translation of a protein.
  • motif refers to a pattern of modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
  • nucleoside motif refers to a pattern of nucleoside modifications in an oligomeric compound or a region thereof.
  • the linkages of such an oligomeric compound may be modified or unmodified.
  • motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
  • linkage motif refers to a pattern of linkage modifications in an oligomeric compound or region thereof.
  • the nucleosides of such an oligomeric compound may be modified or unmodified.
  • motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
  • the same modifications refer to modifications relative to naturally occurring molecules that are the same as one another, including absence of modifications.
  • two unmodified DNA nucleoside have “the same modification,” even though the DNA nucleoside is unmodified.
  • nucleoside having a modification of a first type may be an unmodified nucleoside.
  • “separate regions” refers to a portion of an oligomeric compound wherein the nucleosides and internucleoside linkages within the region all comprise the same modifications; and the nucleosides and/or the internucleoside linkages of any neighboring portions include at least one different modification.
  • pharmaceutically acceptable salts refers to salts of active compounds that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.
  • cap structure or “terminal cap moiety” refers to chemical modifications incorporated at either terminus of an anti sense compound.
  • each repetitive variable can be selected so that (i) each of the repetitive variables are the same, (ii) two or more are the same, or (iii) each of the repetitive variables can be different.
  • alkyl refers to a saturated straight or branched hydrocarbon substituent or radical, typically containing up to twenty four carbon atoms.
  • alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like.
  • Alkyl groups typically include from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms (C 1 -C 12 alkyl) with from 1 to 6 carbon atoms (C 1 -C 6 alkyl) being more preferred.
  • the term “lower alkyl” as used herein includes from 1 to 6 carbon atoms (C 1 -C 6 alkyl).
  • Alkyl groups as used herein may optionally include one or more further substituent groups.
  • alkenyl refers to a straight or branched hydrocarbon chain radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon double bond.
  • alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadienyl and the like.
  • Alkenyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred.
  • Alkenyl groups as used herein may optionally include one or more further substituent groups.
  • alkynyl refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon triple bond.
  • alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like.
  • Alkynyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred.
  • Alkynyl groups as used herein may optionally include one or more further substituent groups.
  • aminoalkyl refers to an amino substituted alkyl radical or substituent. This term is meant to include C 1 -C 12 alkyl groups having an amino substituent at any position and wherein the aminoalkyl group is attached to the parent molecule via its alkyl moiety. The alkyl and/or amino portions of the aminoalkyl group can be further substituted with substituent groups.
  • aliphatic refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, wherein the saturation between any two carbon atoms is a single, double or triple bond.
  • An aliphatic group preferably contains from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms with from 1 to 6 carbon atoms being more preferred.
  • the straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus.
  • Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
  • alicyclic or “alicyclyl” refers to a cyclic radical or substituent, wherein the ring system is aliphatic.
  • the ring system can comprise one or more rings wherein at least one ring is aliphatic.
  • Preferred alicyclic moieties include rings having from 5 to 9 carbon atoms in the ring.
  • Alicyclic groups as used herein may optionally include further substituent groups.
  • alkoxy refers to a radical or substituent comprising an alkyl group and an oxygen atom, wherein the alkoxy group is attached to a parent molecule via its oxygen atom.
  • alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like.
  • Alkoxy groups as used herein may optionally include further substituent groups.
  • halo refers to an atom, radical or substituent selected from fluorine, chlorine, bromine and iodine.
  • aryl and aromatic refer to a radical or substituent comprising a mono- or polycyclic carbocyclic ring system having one or more aromatic rings.
  • aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
  • Preferred aryl ring systems have from 5 to 20 carbon atoms in one or more rings.
  • Aryl groups as used herein may optionally include further substituent groups.
  • aralkyl and arylalkyl refer to a radical or substituent comprising an alkyl group and an aryl group, wherein the aralkyl or arylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical or substituent.
  • heterocyclyl refers to a radical or substituent comprising a mono- or polycyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclyl is also meant to include fused ring system moieties wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms.
  • a heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen.
  • heterocyclic groups include [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like.
  • Heterocyclic groups as used herein may optionally include further substituent groups.
  • heteroaryl and “heteroaromatic” refer to a radical or substituent comprising a mono- or polycyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatom. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen.
  • heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like.
  • Heteroaryl radicals or substituents can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or a heteroatom.
  • Heteroaryl groups as used herein may optionally include further substituent groups.
  • heteroarylalkyl refers to a radical or substituent comprising a heteroaryl group as previously defined and an alkyl moiety, wherein the heteroarylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the like. Heteroarylalkyl groups as used herein may optionally include further substituent groups on one or both of the heteroaryl or alkyl portions.
  • mono or polycyclic refers to any ring systems, such as a single ring or a polycyclic system having rings that are fused or linked, and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl.
  • Such mono and polycyclic structures can contain rings that have a uniform or varying degree of saturation, including fully saturated, partially saturated or fully unsaturated rings.
  • Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms.
  • Heterocyclic and all-carbon rings can be present in a mixed motif, such as for example benzimidazole wherein one ring of the fused ring system has only carbon ring atoms and the other ring has two nitrogen atoms.
  • the mono or polycyclic structures can be further substituted with substituent groups such as for example phthalimide which has two oxo groups ( ⁇ O) attached to one of the rings.
  • mono or polycyclic structures can be attached to a parent molecule directly through a ring atom, through a substituent group or a bifunctional linking moiety.
  • acyl refers to a radical or substituent comprising a carbonyl moiety (C ⁇ O or —C(O)—) and a further substituent X, wherein the acyl group is attached to a parent molecule via its carbonyl moiety.
  • an acyl group is formally obtained by removal of a hydroxyl group from an organic acid and has the general formula —C(O)—X, wherein X is typically aliphatic, alicyclic or aromatic.
  • acyl is also meant to include heteroacyl radicals or substituents with general formula —Y(O) n —X, wherein X is as defined above and Y(O) n is typically sulfonyl, sulfinyl or phosphate.
  • acyl groups include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like.
  • Acyl groups as used herein may optionally include further substituent groups.
  • substituted and substituteduent group include groups that are typically added to other substituents or parent compounds to enhance desired properties or give desired effects. Substituent groups can be protected or unprotected and can be attached to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
  • hydrocarbyl refers to any group comprising C, O and H. Included are straight, branched and cyclic groups having any degree of saturation.
  • Such hydrocarbyl groups can include one or more heteroatoms selected from N, O and S and can be further substituted with one or more substituent groups.
  • substituted or “optionally substituted” refers to the optional presence of any of the following substituents: halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (—C(O)R aa ), carboxyl (—C(O)O—R aa ), aliphatic groups, alicyclic groups, alkoxy, substituted oxo (—O—R aa ), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino (—NR bb R cc ), imino ( ⁇ NR bb ), amido (—C(O)NR bb R cc or —N(R bb )C(O)R aa ), azido (—N 3 ), nitro (—NO 2 ), cyano (—CN), carbamido (—OC(O)NR bb R cc or —N(R bb
  • each R aa , R bb and R cc is, independently, H, an optionally linked chemical functional group or a further substituent group, preferably but without limitation chosen from the group consisting of H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
  • recursive substituent means that a substituent may recite another instance of itself. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim.
  • One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by way of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties such as activity against the intended target and practical properties such as ease of synthesis.
  • Recursive substituents are an intended aspect of the invention.
  • One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the invention, the total number will be determined as set forth above.
  • stable compound and “stable structure” as used herein are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein.
  • a zero (0) in a range indicating number of a particular unit means that the unit may be absent.
  • an oligomeric compound comprising 0-2 regions of a particular motif means that the oligomeric compound may comprise one or two such regions having the particular motif, or the oligomeric compound may not have any regions having the particular motif.
  • the portions flanking the absent portion are bound directly to one another.
  • the term “none” as used herein indicates that a certain feature is not present.
  • analogue or derivative means either a compound or moiety similar in structure but different in respect to elemental composition from the parent compound regardless of how the compound is made. For example, an analogue or derivative compound does not need to be made from the parent compound as a chemical starting material.
  • TNF ⁇ A, B
  • MCP-1 D, E
  • IP-10 E, F
  • IL6 G, H
  • AON sequences (5′ to 3′) and base modifications are shown in the table underneath.
  • AON sequences (5′ to 3′) and base modifications are shown in the table underneath.
  • A Activity comparisons of AONs with 2,6-diaminopurines with corresponding AONs without this base modification.
  • A Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS403, corresponding to SEQ ID NO: 206, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 31), exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS897: corresponding to SEQ ID NO: 173, wherein all adenines have been modified.
  • FIG. 4 UX 1 AGX 1 UUX 1 UGUUAGX 1 X 1 AX 1 UG 208 PS658 Y 1 X 1 AGX 1 Y 1 Y 1 X 1 Y 1 GY 1 Y 1 AGX 1 X 1 AX 1 Y 1 G 205 PS1107
  • FIG. 4 UCZ 1 GCUUCUGUUZ 1 GCCZ 1 CUG 207 PS733
  • FIG. 5 45 YYYGXXGXYGXXXZZYGXXZYXXYG 21 UUUGCCGCUGCCCAAUGCCAUCCUG 101 PS220 FIG.
  • FIG. 4 5 Y 1 CAAGGAAGAY 1 GGCAY 1 Y 1 Y 1 CY 1 202 PS559
  • FIG. 4 Y 1 X 1 AAGGAAGAY 1 GGX 1 AY 1 Y 1 Y 1 X 1 Y 1 203 PS1106
  • FIG. 4 UCZ 1 Z 1 GGZ 1 Z 1 GZ 1 UGGCZ 1 UUUCU 206 PS403
  • FIG. 5 UX 1 AAGGAAGAUGGX 1 AUUUX 1 U 215 PS401 52 GGYZZYGZGYYXYYXXZZXYGG 40 GGUAAUGAGUUCUUCCAACUGG 120 PS235
  • FIG. 4 5 GGUAAUGAGUUX 1 UUX 1 X 1 AAX 1 UGG 171 PS650 GGY 1 AAY 1 GAGY 1 Y 1 CY 1 Y 1 CCAACY 1 GG 172 PS786 FIG. 4 GGUZ 1 Z 1 UGZ 1 GUUCUUCCZ 1 Z 1 CUGG 173 PS897 FIG. 5 GGY 1 AAY 1 GAGY 1 Y 1 X 1 Y 1 Y 1 X 1 X 1 AAX 1 Y 1 GG 174 PS1110 53 GYYGXXYXGGYYXYGZZGGYGYYX 52 GUUGCCUCCGGUUCUGAAGGUGUUC 91 PS229L FIG.
  • FIG. 1a 2 GUUGX 1 X 1 UX 1 X 1 GGUUX 1 UGAAGGUGUUX 1 92 PS524 FIG. 1a, c, 2 GUUGX 1 X 1 UCCGGUUX 1 UGAAGGUGUUX 1 217 PS1317 FIG. 1c GUUGX 1 X 1 UCCGGUUCUGAAGGUGUUC 218 PS1318 FIG. 1c GUUGCX 1 UCCGGUUX 1 UGAAGGUGUUX 1 219 PS1319 FIG.
  • Preferred non modified oligonucleotides are more preferably derived from each of the oligonucleotide basis sequence (SEQ ID NO:14-90) and are represented by a nucleotide or base sequence SEQ ID NO:91, 93-170
  • Preferred modified oligonucleotides derived from one of the nucleotide or base sequences SEQ ID NO:14-90 and comprising at least one X is m 5 C and/or at least one Y is m 5 U and/or at least one Z is a 2 A are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219.
  • modified oligonucleotides are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219.
  • SEQ ID NO:15, 21, 31, 40, 52, and 57 are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219.
  • the most preferred modified oligonucleotides are disclosed in Table 3.
  • All oligonucleotides (PS220/PS399, based on SEQ ID NO:21 corresponding to SEQ ID NO:101 for the non-modified sequence (PS220) and to SEQ ID NO:200 wherein all cytosines are modified (PS399); PS229L/PS524/PS1317/PS1318/PS1319, based on SEQ ID NO:52 corresponding to SEQ ID NO:91 for the non-modified sequence (PS229L), to SEQ ID NO:92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified; PS232/PS648, based on SEQ ID NO: 39 corresponding to SEQ ID NO:119 for the non-modified sequence (PS232)
  • Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH 4 OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized.
  • FIG. 1 a Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a triplo AON concentration series of 0-100-200-400 nM ( FIG. 1 a , PS229L/PS524, SEQ ID NO:91/92) or 0-50-100-200-400-800 nM ( FIG. 1 b , PS220/PS399, SEQ ID NO: 101/200) or with an in duplo concentration of 400 nM ( FIG. 1 c , PS524/PS1317/PS1318/PS1319, SEQ ID NO:92/217/218/219), according to non-GLP standard operating procedures.
  • RT reverse transcriptase
  • RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described (Aartsma-Rus et al., 2003). RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent).
  • the data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007.
  • the ratio of the smaller transcript product (containing the exon 45(PS220/PS399) or 53 skip (PS229L/PS524/PS1317/PS1318/PS1319)) to the total amount of transcript products was assessed (representing the exon 45 or 53 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.
  • mice at 5 weeks of age were obtained from Jackson Laboratory (Maine USA).
  • the AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) were administered in physiological saline at a dose of 100 mg/kg by subcutaneous injections three times per week for two weeks.
  • plasma samples were taken from 2 animals per time-point (per AON group) at the following times for the animals: 15 min, 1 h, 2 h, 6 h and 24 hours after dosing.
  • venous whole blood was collected into Li-Heparin tubes, centrifuged and kept at ⁇ 80° C. until analysis.
  • 7 organs (heart, kidney cortex, liver, diaphragm, gastrocnemius, quadriceps & triceps) were harvested upon sacrifice of the animals. The tissues were snap frozen and stored at ⁇ 80° C. until analysis.
  • tissues were homogenized, using a MagNaLyzer (Roche) to a concentration of 60 mg/ml in protK buffer (100 mmol/l Tris-HCl pH8.5, 200 mmol/l NaCl, 5 mmol/l EDTA, 0.2% SDS) containing 2 mg/ml proteinase K, followed by a 2 hours incubation (liver) or 4 hours incubation (all other organs) in a rotating hybridization oven at 55° C. and then stored ⁇ 20° C. until use. All tissue homogenates and calibration curves were diluted (fit to criteria of the assay) in 60 times diluted pooled mdx control tissue homogenate (kidney, liver, several muscle groups).
  • protK buffer 100 mmol/l Tris-HCl pH8.5, 200 mmol/l NaCl, 5 mmol/l EDTA, 0.2% SDS
  • protK buffer 100 mmol/l Tris-HCl pH8.5, 200 mmol/
  • a template probe specific for each AON (5′ gaatagacg-anti-AON-biotin 3′, DNA phosphate oligonucleotide) and a ligation probe (p-cgtctattc-DIG DNA phosphate oligonucleotide) were used in the hybridization assay.
  • the homogenates were incubated for 1 h at 37° C. with template probe (50 nmol/l) and the hybridized samples were transferred to streptavidin coated 96-well plates and incubated for 30 min at 37° C. Subsequently, the plate was washed 4 times and the digoxigenin-labeled ligation (2 nmol/l) was added and incubated for 30 min at ambient temperature.
  • the DIG-label was detected using an anti-DIG-POD (1:7,500-1:30,000; Roche Diagnostics), which was visualized with a 3,3′,5,5′-tetramethylbenzidine substrate (Sigma Aldrich, the Netherlands), and the reaction was stopped using an acidic solution (Sigma Aldrich).
  • the absorption was measured at 450 nm using a BioTek Synergy HT plate reader (Beun de Ronde, Abcoude, The Netherlands). Plasma samples were analyzed according to the same protocol, using 100 times diluted pooled mdx plasma.
  • cytokine stimulation induced by selected AONs PS232/PS648 corresponding to SEQ ID NO: 119/201 and PS534/PS653 corresponding to SEQ ID NO: 139/192
  • whole blood (anticoagulant CPD) from healthy human volunteers was used.
  • Varying AON concentrations ranging from 0 to 50 ⁇ g/ml, in a dilution of approximately 1:0.01 (v/v)) were added to the blood and the samples were incubated for 4 hours at 37° C. under 5% CO 2 atmosphere. After incubation, the samples were centrifuged at 3200 ⁇ g for 15 minutes at 4° C. and plasma supernatants were collected and stored at ⁇ 20° C. until cytokine quantification.
  • MCP-1, IL-6, TNF- ⁇ , and IP-10 concentrations were determined by sandwich ELISA (human MCP-1, IL-6, TNF- ⁇ , IP-10 ELISA kits (R&D Systems). The experiments with human whole blood were repeated three to four times. FIG. 3 is based on one experiment only, but considered representative.
  • PS524 was clearly more efficient than PS229L at 200 and 400 nM (1.9-fold higher exon 53 skipping levels) ( FIG. 1 a ).
  • PS220 and PS399 PS220-m5C
  • PS524 (SEQ ID NO:92) all 6 cytosines are substituted with 5-methylcytosines (m5C) which had a positive effect on the exon skipping activity when compared to the non-modified counterpart oligonucleotide PS229L (SEQ ID NO:91) ( FIG. 1 a ).
  • PS1317, PS1318, and PS1319 with respectively 4, 2, and 3 of the 6 cytosines substituted with 5-methylcytosines (m5C) were tested and directly compared to PS524 in cultured, differentiated, healthy muscle cells in vitro.
  • PS1317, PS1318, and PS1319 were all effective in inducing exon 53 skipping (47%, 37%, and 45% respectively) ( FIG. 1 c ).
  • these results indeed suggest that reducing the number of 5-methylcytosines (m5C), from 6 to 4, 3, or 2 5-methylcytosines, leads to a reduced positive effect on exon skipping activity of the AON.
  • mdx mice To investigate whether 5-methylcytosines affect bio-stability, -distribution, and/or -availability, a pharamacokinetic study was performed both in wild type (control) and mdx mice.
  • the mdx mouse model for DMD has a natural nonsense mutation in exon 23 and is therefore dystrophin-deficient.
  • the lack of dystrophin at the membranes increases the permeability of the muscle fibers for relatively small molecules as AONs, and has indeed been demonstrated to enhance 2′-O-methyl phosphorothioate RNA AON uptake by muscle up to 10-fold (Heemskerk et al., 2010).
  • mice were injected subcutaneously with 100 mg/kg of either 5-methylcytosine-containing AONs (PS524, PS652 corresponding to SEQ ID NO: 92, 185) or their counterparts with unmodified cytosines (PS229L, PS531 corresponding to SEQ ID NO: 91, 137), three times per week for two weeks.
  • the mice were sacrificed and different muscle groups (heart, diaphragm, gastrocnemius, quadriceps, and triceps) and liver and kidney were isolated to determine AON concentrations therein ( FIG. 2A ).
  • the concentrations in mdx muscles was higher than those in control mice.
  • the ratio mdx to control AON levels appeared relatively higher for the AONs with 5-methylcytosines. More specifically, in the mdx mice, the levels of PS524 and PS652 were 2- to 3-fold higher than that of PS229L and PS531. ( FIG. 2A ). When monitoring the levels of AON in kidney and liver (known toxicity organs), the ratios between muscle tissue and toxicity tissues remained similar, or were even favorable for PS524. These results suggest that AONs with 5-methylcytosine are taken up better by or more stable in muscle than AONs with unmodified cytosines. Indeed the half life in muscle was longer for PS524 (>20 days) and PS652 (25 days) when compared to PS229L (7 days) and PS531 (10 days).
  • the Cmaxvalues of the AONs injected were similar, which confirms that the mice received equal doses ( FIG. 2B ).
  • the AUC values (as indicator for bioavailability) were 1.5 to 2.3-fold higher for the 5-methylcytosine containing AONs. This was associated with a lower clearance which supports their higher muscle tissue levels. The results from this pharmacokinetic study thus demonstrate that the presence of 5-methylcytosines has a positive effect on the bio-stability, -distribution, and/or -availability of the AONs, while the muscle/toxicity organ ratios were similar to those with the AONs with unmodified cytosines.
  • AONs may stimulate an innate immune response by activating the Toll-like receptors (including TLR7, TLR8, TLR9), which results in set of coordinated immune responses that include innate immunity.
  • Toll-like receptors including TLR7, TLR8, TLR9
  • chemo- and cytokines such as IP-10, TNF ⁇ , TL-6 and MCP-1 play a role in this process, and were therefore monitored in human whole blood incubated with 0 to 50 ⁇ g/ml of each AON (using commercially available ELISA kits).
  • PS232 and PS534 both have unmodified cytosines and induced the release of TNF- ⁇ ( FIG. 3A , B), MCP-1 ( FIG. 3C , D), IP-10 ( FIG. 3E , F), and IL-6 ( FIG. 3G , H) at increasing doses.
  • PS648 and PS653 did not have any effect on TNF- ⁇ , IP-10 and IL-6.
  • the presence of 5-methylcytosines improved the safety profile of these AONs in vitro.
  • Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH 4 OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized.
  • Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 286.1 g obtained product, purity 93%), PS785, PS786, PS1106, and PS1107 (ChemGenes, 200 nmol synthesis scale, used as received), PS43 (Prosensa, 1 ⁇ mol synthesis scale, purity 90%), PS559 (ChemGenes, 1 ⁇ mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%).
  • PS188 Girindus, 286.1 g obtained product, purity 93%)
  • PS785, PS786, PS1106, and PS1107 ChemGenes, 200 nmol synthesis scale, used as received
  • PS43 Prosensa, 1 ⁇ mol synthesis scale, purity 90%
  • PS559 ChemGenes, 1 ⁇ mol synthesis scale, used as received
  • a DMD gene specific reverse primer in exon 53 (PS43/PS559/PS1106, SEQ ID NO: 111, 202, 203), exon 46 (PS188/PS785/PS1107 SEQ ID NO: 95, 204, 205) or exon 54 (PS235/PS786, SEQ ID NO: 120, 172) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA.
  • RT reverse transcriptase
  • RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent).
  • the data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007.
  • the ratio of the smaller transcript product (containing the exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107), or exon 52 skip (PS235/PS786) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.
  • mice per group were anaesthetized using isoflurane and then injected intramuscularly in both gastrocnemius muscles, with 20 ug PS49 (SEQ ID NO: 216) or PS959 (SEQ ID NO:214), diluted in sterile saline to a total volume of 50 ⁇ l per injection, on two consecutive days. Animals were sacrificed 1 week after the last injection by cervical dislocation and muscles were isolated and snap frozen in magnalyzer greenbead tubes (Roche).
  • RNA pellets were airdried and solved in DEPC treated water.
  • cDNA was generated using 400 ng total RNA with random hexamer primers using Transcriptor reverse transcriptase (RT) (Roche Diagnostics) according to the manufacturer's instructions.
  • PCRs were performed by 30 cycles of 94 degrees for 30 s, 60 degrees for 30 s and 72 degrees for 30 s in a 50 ⁇ l reaction using 1.5 ⁇ l cDNA as template using primers specific for mouse exon 22 and exon 24.
  • PCR products were visualized on 2% agarose gels quantified the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, Calif., USA).
  • the AONs with 5-methyluracils increased the exon skipping efficiencies 1.3- to 3-fold when compared to their counterparts with unmodified uracils.
  • the skipping levels were further increased (PS1106 versus PS559, SEQ ID NO: 203 versus 202) or similar (PS1107 versus PS785, SEQ ID NO: 205 versus 204).
  • the effect on AON activity i.e.
  • All oligonucleotides (PS43/PS403, based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) for the non-modified and SEQ ID NO: 206 (PS403) for the sequence wherein all adenines have been modified; PS188/PS733, based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) for the non-modified and SEQ ID NO: 207 (PS733) for the sequence wherein all adenines have been modified; PS235/PS897, based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) for the non-modified and SEQ ID NO: 173 (PS897) for the sequence wherein all adenines have been modified) were 2′-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/ ⁇ KTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in
  • Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by cone. NH 4 OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized.
  • Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 151 g obtained, purity 92%), PS733 (TriLink or ChemGenes, 200 nmol/1 mg synthesis scale, used as received, PS43 (Prosensa, 10 ⁇ mol synthesis scale, purity 86%), PS403 (ChemGenes, 1 ⁇ mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%), PS897 (ChemGenes, 200 nmol synthesis scale, used as received).
  • dystrophin-specific cDNA a DMD gene specific reverse primer in exon 53 (PS43/PS403, SEQ ID NO: 111/206), exon 46 (PS188/PS733, SEQ ID NO: 95/207) or exon 54 (PS235/PS897, SEQ ID NO: 120/173) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA.
  • the PCR analysis was subsequently done on 3 ⁇ l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS403), exon 44 (PS188/PS733) or exon 52 (PS235/PS897).
  • RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14].
  • RT-PCR products were analyzed by gel electrophoresis (2% agarose gels).
  • the resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007.
  • the ratio of the smaller transcript product (containing the exon 51 (PS43/PS403), exon 44 (PS188/PS733), or exon 52 skip (PS235/PS897) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.
  • Antisense oligonucleotides may activate the alternative complement pathway, which contains several split factors, such as C3a and factor Bb (the latter is unique to the alternative pathway).
  • C3a and factor Bb the latter is unique to the alternative pathway.
  • the ability of AONs to possibly activate the complement pathway was assessed in plasma from Cynomolgus monkeys (LiHe plasma, CIT, France). Increasing concentrations (from 0 to 300 ⁇ g/mL) of PS188 (SEQ ID NO: 95) and PS733 (PS207), in a dilution of 1:10 (v/v)), were added to the plasma and incubated at 37° C. for 30 min. The reaction was terminated by transferring the samples to ice and making dilutions in ice-cold diluent. Bb and C3a concentrations were determined by ELISA (Quidel, San Diego, Calif.).

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Liquid Crystal Substances (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US14/444,244 2012-01-27 2014-07-28 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy Abandoned US20150045413A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US14/444,244 US20150045413A1 (en) 2012-01-27 2014-07-28 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy
US15/232,493 US10179912B2 (en) 2012-01-27 2016-08-09 RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US16/201,951 US10913946B2 (en) 2012-01-27 2018-11-27 RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
US17/131,130 US20210108204A1 (en) 2012-01-27 2020-12-22 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201261591354P 2012-01-27 2012-01-27
EP12152934 2012-01-27
EP12152934.1 2012-01-27
US201261612467P 2012-03-19 2012-03-19
PCT/NL2013/050045 WO2013112053A1 (en) 2012-01-27 2013-01-28 Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US14/444,244 US20150045413A1 (en) 2012-01-27 2014-07-28 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2013/050045 Continuation WO2013112053A1 (en) 2012-01-27 2013-01-28 Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/232,493 Continuation US10179912B2 (en) 2012-01-27 2016-08-09 RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy

Publications (1)

Publication Number Publication Date
US20150045413A1 true US20150045413A1 (en) 2015-02-12

Family

ID=48873711

Family Applications (4)

Application Number Title Priority Date Filing Date
US14/444,244 Abandoned US20150045413A1 (en) 2012-01-27 2014-07-28 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy
US15/232,493 Active US10179912B2 (en) 2012-01-27 2016-08-09 RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US16/201,951 Active US10913946B2 (en) 2012-01-27 2018-11-27 RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
US17/131,130 Pending US20210108204A1 (en) 2012-01-27 2020-12-22 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Family Applications After (3)

Application Number Title Priority Date Filing Date
US15/232,493 Active US10179912B2 (en) 2012-01-27 2016-08-09 RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US16/201,951 Active US10913946B2 (en) 2012-01-27 2018-11-27 RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
US17/131,130 Pending US20210108204A1 (en) 2012-01-27 2020-12-22 RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Country Status (12)

Country Link
US (4) US20150045413A1 (de)
EP (2) EP4043039A1 (de)
JP (4) JP2015509922A (de)
CN (2) CN112251436A (de)
AU (3) AU2013212758A1 (de)
BR (1) BR112014018427B1 (de)
CA (2) CA2862628C (de)
ES (1) ES2907250T3 (de)
HK (1) HK1203835A1 (de)
IL (1) IL233809B (de)
NZ (1) NZ627896A (de)
WO (1) WO2013112053A1 (de)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140315977A1 (en) * 2013-03-14 2014-10-23 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US9175286B2 (en) 2004-06-28 2015-11-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9217148B2 (en) 2013-03-14 2015-12-22 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US9228187B2 (en) 2009-11-12 2016-01-05 The University Of Western Australia Antisense molecules and methods for treating pathologies
US9234198B1 (en) 2008-10-24 2016-01-12 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US20160201089A1 (en) * 2013-06-05 2016-07-14 Duke University Rna-guided gene editing and gene regulation
US9506058B2 (en) 2013-03-15 2016-11-29 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US9840706B2 (en) 2014-06-17 2017-12-12 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US9890379B2 (en) 2006-08-11 2018-02-13 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
US10179912B2 (en) 2012-01-27 2019-01-15 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US10246707B2 (en) 2008-05-14 2019-04-02 Biomarin Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US10421969B2 (en) 2011-10-04 2019-09-24 Royal Holloway And Bedford New College Oligomers
US10626396B2 (en) 2005-02-09 2020-04-21 Sarepta Therapeutics, Inc. Antisense composition and method for treating muscle atrophy
US10676735B2 (en) 2015-07-22 2020-06-09 Duke University High-throughput screening of regulatory element function with epigenome editing technologies
US10676726B2 (en) 2015-02-09 2020-06-09 Duke University Compositions and methods for epigenome editing
US10711256B2 (en) 2012-04-27 2020-07-14 Duke University Genetic correction of mutated genes
US10876114B2 (en) 2007-10-26 2020-12-29 Biomarin Technologies B.V. Methods and means for efficient skipping of at least one of the following exons of the human Duchenne muscular dystrophy gene: 43, 46, 50-53
US11015200B2 (en) 2015-03-18 2021-05-25 Sarepta Therapeutics, Inc. Antisense-induced exon exclusion in myostatin
EP3858993A1 (de) 2015-10-09 2021-08-04 Sarepta Therapeutics, Inc. Zusammensetzungen und verfahren zur behandlung von duchenne-muskeldystrophie und damit assoziierten erkrankungen
CN113913426A (zh) * 2015-09-15 2022-01-11 日本新药株式会社 反义核酸
US11427817B2 (en) 2015-08-25 2022-08-30 Duke University Compositions and methods of improving specificity in genomic engineering using RNA-guided endonucleases
US11781140B2 (en) 2020-02-28 2023-10-10 Nippon Shinyaku Co., Ltd. Antisense nucleic acid inducing skipping of exon 51
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1191097A1 (de) * 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induktion von "exon-skipping" in eukaryotischen Zellen
TWI541024B (zh) 2010-09-01 2016-07-11 日本新藥股份有限公司 反義核酸
RU2674600C2 (ru) * 2012-07-03 2018-12-11 Просенса Текнолоджиз Б.В. Олигонуклеотид для лечения пациентов с мышечной дистрофией
AU2014317961B2 (en) 2013-09-05 2020-07-30 Murdoch University Antisense-induced exon2 inclusion in acid alpha-glucosidase
ES2739850T3 (es) 2013-09-11 2020-02-04 Synthena Ag Acidos nucleicos y procedimientos para el tratamiento de la enfermedad de Pompe
US10517898B2 (en) 2014-11-20 2019-12-31 The Regents Of The University Of California Compositions and methods related to hematologic recovery
EP3302497A4 (de) 2015-06-01 2019-01-16 Sarepta Therapeutics, Inc. Antisense-induszierte exonexklusion in typ-vii-kollagen
MA43072A (fr) 2015-07-22 2018-05-30 Wave Life Sciences Ltd Compositions d'oligonucléotides et procédés associés
WO2017062862A2 (en) * 2015-10-09 2017-04-13 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
EP3411480A4 (de) 2016-02-02 2020-01-22 Olix Pharmaceuticals, Inc. Behandlung von atopischer dermatitis und asthma mit auf ll4r , trpa1 oder f2rl1 abzielenden rna-komplexen
EP3445405A4 (de) 2016-04-18 2019-12-18 Sarepta Therapeutics, Inc. Antisense-oligomere und verfahren zur verwendung davon zur behandlung von erkrankungen in zusammenhang mit dem saure-alpha-glucosidase-gen
BR112018072279A2 (pt) 2016-04-29 2019-02-12 Sarepta Therapeutics, Inc. análogos de oligonucleotídeo tendo como alvo lmna humana
CA3025575A1 (en) 2016-06-30 2018-01-04 Sarepta Therapeutics, Inc. Exon skipping oligomers for muscular dystrophy
CN109757108A (zh) * 2016-07-05 2019-05-14 比奥马林技术公司 具有治疗遗传疾病的改善特征的包含双环支架部分的前体mRNA剪接转换或调节寡核苷酸
WO2018017814A1 (en) 2016-07-20 2018-01-25 President And Fellows Of Harvard College Peptidoglycan glycosyltransferase inhibitors of sed proteins for treating bacterial infections
WO2018053142A2 (en) 2016-09-14 2018-03-22 President And Fellows Of Harvard College Methods and compositions for modulating erythropoiesis
CN110267970A (zh) 2016-11-16 2019-09-20 比奥马林技术公司 用于靶向各种选定器官或组织的物质
WO2018112032A1 (en) 2016-12-13 2018-06-21 President And Fellows Of Harvard College Methods and compositions for targeting tumor-infiltrating tregs using inhibitors of ccr8 and tnfrsf8
NZ755416A (en) 2016-12-19 2023-05-26 Sarepta Therapeutics Inc Exon skipping oligomer conjugates for muscular dystrophy
KR102639633B1 (ko) 2016-12-19 2024-02-26 사렙타 쎄러퓨틱스 인코퍼레이티드 근육 이상증에 대한 엑손 스킵핑 올리고머 결합체
IL267246B2 (en) 2016-12-19 2023-03-01 Sarepta Therapeutics Inc Exon-skipping oligomer conjugates for muscular dystrophy
EP3612215A4 (de) 2017-04-20 2021-05-26 aTyr Pharma, Inc. Zusammensetzungen und verfahren zur behandlung von lungenentzündungen
GB201711809D0 (en) * 2017-07-21 2017-09-06 Governors Of The Univ Of Alberta Antisense oligonucleotide
EA201991450A1 (ru) 2017-09-22 2019-12-30 Сарепта Терапьютикс, Инк. Конъюгаты олигомеров для пропуска экзона при мышечной дистрофии
EP3684933A4 (de) * 2017-09-22 2021-06-23 The Regents of the University of Colorado, A Body Corporate Thiomorpholino-oligonukleotide zur behandlung von muskeldystrophie
WO2019067981A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. POLYTHERAPIES FOR TREATING MUSCLE DYSTROPHY
WO2019067975A1 (en) 2017-09-28 2019-04-04 Sarepta Therapeutics, Inc. POLYTHERAPIES FOR TREATING MUSCLE DYSTROPHY
EP3687519A1 (de) 2017-09-28 2020-08-05 Sarepta Therapeutics, Inc. Kombinationstherapien zur behandlung von muskeldystrophie
US11555189B2 (en) 2017-10-18 2023-01-17 Sarepta Therapeutics, Inc. Antisense oligomer compounds
JPWO2019176864A1 (ja) * 2018-03-12 2021-02-25 国立大学法人 岡山大学 筋ジストロフィー関連心筋症の治療又は予防剤
JP7427608B2 (ja) * 2018-05-11 2024-02-05 ウェイブ ライフ サイエンシズ リミテッド オリゴヌクレオチド組成物及びその使用方法
US10758629B2 (en) 2018-05-29 2020-09-01 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US20220251551A1 (en) * 2018-06-13 2022-08-11 Sarepta Therapeutics, Inc. Exon skipping oligomers for muscular dystrophy
EP3806868A4 (de) 2018-06-13 2022-06-22 Sarepta Therapeutics, Inc. Exon-skipping-oligomere für muskeldystrophie
KR20210023988A (ko) * 2018-06-26 2021-03-04 니뽄 신야쿠 가부시키가이샤 안티센스 올리고뉴클레오티드를 함유하는 조성물 및 듀시엔형 근이영양증의 치료로의 그의 사용
TW202020153A (zh) 2018-07-27 2020-06-01 美商薩羅塔治療公司 用於肌肉萎縮症之外顯子跳躍寡聚物
US11273137B2 (en) 2018-09-04 2022-03-15 Board Of Trustees Of Michigan State University Methods and compositions to prevent and treat disorders associated with mutations in the ODC1 gene
EP3894558A1 (de) 2018-12-13 2021-10-20 Sarepta Therapeutics, Inc. Exon-skipping-oligomerkonjugate für muskeldystrophie
KR20210144754A (ko) 2019-03-12 2021-11-30 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 암을 치료하기 위한 방법 및 조성물
US20220193246A1 (en) 2019-04-18 2022-06-23 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US20220226269A1 (en) 2019-06-12 2022-07-21 President And Fellows Of Harvard College Methods and compositions for modulation of an interspecies gut bacterial pathway for levodopa metabolism
KR102216561B1 (ko) * 2019-09-06 2021-02-17 서울대학교산학협력단 Roquin을 표적으로 하는 사이토메갈로바이러스 감염 억제제 스크리닝 방법
IL293997A (en) * 2019-12-19 2022-08-01 Nippon Shinyaku Co Ltd Antistrand nucleic acids that allow exon skipping
WO2021178556A1 (en) 2020-03-04 2021-09-10 Regeneron Pharmaceuticals, Inc. Methods and compositions for sensitization of tumor cells to immune therapy
WO2021242826A1 (en) 2020-05-27 2021-12-02 The Regents Of The University Of California Compositions and methods for transdifferentiating cells
CN115011598A (zh) * 2020-09-02 2022-09-06 西湖大学 杜氏肌营养不良症相关的外显子剪接增强子、sgRNA、基因编辑工具及应用
WO2022056454A2 (en) 2020-09-14 2022-03-17 President And Fellows Of Harvard College Methods and compositions for treating hpv-positive cancers
IL301306A (en) 2020-09-16 2023-05-01 Harvard College Methods of treating an individual who has failed anti-PD-1/anti-PD-L1 therapy
WO2022217366A1 (en) * 2021-04-14 2022-10-20 The Royal Institution For The Advancement Of Learning/Mcgill University Modified oligonucleotides for the treatment of duchenne muscular dystrophy
WO2022232254A1 (en) 2021-04-27 2022-11-03 Research Institute At Nationwide Children's Hospital Products and methods for inducing exon 2 skipping of the dmd gene in treating muscular dystrophy
WO2023055774A1 (en) 2021-09-30 2023-04-06 Sarepta Therapeutics, Inc. Antisense oligonucleotides having one or more abasic units
WO2023070086A1 (en) 2021-10-22 2023-04-27 Sarepta Therapeutics, Inc. Morpholino oligomers for treatment of peripheral myelin protein 22 related diseases
WO2023091704A1 (en) 2021-11-18 2023-05-25 Circularis Biotechnologies, Inc. Compositions and methods for production of circular nucleic acid molecules
WO2023096847A2 (en) 2021-11-24 2023-06-01 Prime Medicine, Inc. Methods and compositions for inhibiting mismatch repair
WO2023150181A1 (en) 2022-02-01 2023-08-10 President And Fellows Of Harvard College Methods and compositions for treating cancer
WO2024026474A1 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Compositions and methods for transferrin receptor (tfr)-mediated delivery to the brain and muscle
WO2024064237A2 (en) 2022-09-21 2024-03-28 Sarepta Therapeutics, Inc. Dmd antisense oligonucleotide-mediated exon skipping efficiency
CN115806984B (zh) * 2022-10-18 2023-10-10 昆明理工大学 环状rna及载体和载体的应用
WO2024098002A1 (en) 2022-11-04 2024-05-10 Regeneron Pharmaceuticals, Inc. Calcium voltage-gated channel auxiliary subunit gamma 1 (cacng1) binding proteins and cacng1-mediated delivery to skeletal muscle
WO2024107765A2 (en) 2022-11-14 2024-05-23 Regeneron Pharmaceuticals, Inc. Compositions and methods for fibroblast growth factor receptor 3-mediated delivery to astrocytes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120270925A1 (en) * 2009-11-12 2012-10-25 The University Of Western Australia Antisense molecules and methods for treating pathologies
US20130211062A1 (en) * 2010-09-01 2013-08-15 National Center Of Neurology And Psychiatry Antisense nucleic acids
US20140298496A1 (en) * 2011-06-23 2014-10-02 Cold Spring Harbor Laboratory Phenocopy model of disease

Family Cites Families (216)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5541308A (en) 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
DE3834636A1 (de) 1988-10-11 1990-04-19 Max Planck Gesellschaft Verfahren zur analyse von laengenpolymorphismen in dna-bereichen
US5766847A (en) 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
US6867195B1 (en) 1989-03-21 2005-03-15 Vical Incorporated Lipid-mediated polynucleotide administration to reduce likelihood of subject's becoming infected
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
FR2675803B1 (fr) 1991-04-25 1996-09-06 Genset Sa Oligonucleotides fermes, antisens et sens et leurs applications.
WO1993001286A2 (en) 1991-06-28 1993-01-21 Massachusetts Institute Of Technology Localized oligonucleotide therapy
CA2082411A1 (en) 1991-06-28 1992-12-29 Robert D. Rosenberg Localized oligonucleotide therapy
US6200747B1 (en) 1992-01-28 2001-03-13 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5869252A (en) 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
US6172208B1 (en) 1992-07-06 2001-01-09 Genzyme Corporation Oligonucleotides modified with conjugate groups
US5418139A (en) 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
CA2116280A1 (en) 1993-03-05 1994-09-06 Marcy E. Macdonald Huntingtin dna, protein and uses thereof
NZ266386A (en) 1993-05-11 1997-11-24 Univ North Carolina Use of antisense rna oligonucleotides in regulating gene expression
US5695933A (en) 1993-05-28 1997-12-09 Massachusetts Institute Of Technology Direct detection of expanded nucleotide repeats in the human genome
US5741645A (en) 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5627263A (en) 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
DE4342605A1 (de) 1993-12-14 1995-06-22 Buna Gmbh Funktionalisierte Olefinhomo- und -copolymere
US5962332A (en) 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
WO1995030774A1 (en) 1994-05-05 1995-11-16 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5968909A (en) 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
US5854223A (en) 1995-10-06 1998-12-29 The Trustees Of Columbia University In The City Of New York S-DC28 as an antirestenosis agent after balloon injury
US20070173465A9 (en) 1995-10-11 2007-07-26 Monahan Sean D Expression of zeta negative and zeta positive nucleic acids using a dystrophin gene
US7034009B2 (en) 1995-10-26 2006-04-25 Sirna Therapeutics, Inc. Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US6300060B1 (en) 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
EP0882061B1 (de) 1996-02-14 2004-05-19 Isis Pharmaceuticals, Inc. Kohlenhydratmodifizierte luckenhafte oligonukleotide
AU6469896A (en) 1996-07-18 1998-02-10 Srl Inc. Method for the diagnosis of spinocerebellar ataxia type 2 and primers therefor
WO1998018920A1 (fr) 1996-10-30 1998-05-07 Srl, Inc. Fragments d'adnc du gene responsable de l'ataxie spino-cerebelleuse de type 2
US5853995A (en) 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
US20020137890A1 (en) 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO1998043993A2 (en) 1997-03-31 1998-10-08 Yale University Nucleic acid catalysts
AU7265298A (en) 1997-04-29 1998-11-24 Trustees Of Boston University Methods and compositions for targeted dna differential display
US6329501B1 (en) 1997-05-29 2001-12-11 Auburn University Methods and compositions for targeting compounds to muscle
US6514755B1 (en) 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
US6280938B1 (en) 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
AU750947C (en) 1997-09-22 2003-05-22 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Nucleic acid catalysts with endonuclease activity
US6130207A (en) 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
JP3012923B2 (ja) 1998-01-26 2000-02-28 新潟大学長 Ｃａｇリピート病の治療薬
KR100280219B1 (ko) 1998-02-26 2001-04-02 이수빈 삼핵산 반복 서열을 이용한 신경정신 질환의 진단 방법 및 진단 시약
US6683173B2 (en) 1998-04-03 2004-01-27 Epoch Biosciences, Inc. Tm leveling methods
US6322978B1 (en) 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
WO1999055857A2 (en) 1998-04-29 1999-11-04 Ribozyme Pharmaceuticals, Inc. Nucleoside triphosphates and their incorporation into ribozymes
CA2334960C (en) 1998-06-10 2012-01-03 Biognostik Gesellschaft Fur Biomolekulare Diagnostik Mbh Combination of tgf-.beta. inhibition and immune stimulation to treat hyperproliferative diseases
US20030096955A1 (en) 1998-09-01 2003-05-22 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2002525382A (ja) 1998-09-25 2002-08-13 ザ チルドレンズ メディカル センター コーポレイション プロテインキナーゼの活性を選択的に調節するショートペプチド
US6172216B1 (en) 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6210892B1 (en) 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
DE69932346T2 (de) 1998-10-26 2007-07-05 Avi Biopharma, Inc., Portland Auf Morpholin basierendes p53-Antisense- Oligonucleotid und dessen Verwendungen
US6399575B1 (en) 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US6133031A (en) 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
US20040226056A1 (en) 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US20020049173A1 (en) 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
IL145586A0 (en) 1999-04-08 2002-06-30 Oasis Biosciences Inc Antisense oligonucleotides comprising universal and/or degenerate bases
JP2000325085A (ja) 1999-05-21 2000-11-28 Masafumi Matsuo デュシェンヌ型筋ジストロフィー治療剤
US20030236214A1 (en) 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
US6656730B1 (en) 1999-06-15 2003-12-02 Isis Pharmaceuticals, Inc. Oligonucleotides conjugated to protein-binding drugs
US6355481B1 (en) 1999-06-18 2002-03-12 Emory University Hybridoma cell line and monoclonal antibody for huntingtin protein
WO2001016312A2 (en) 1999-08-31 2001-03-08 Ribozyme Pharmaceuticals, Inc. Nucleic acid based modulators of gene expression
CA2386239A1 (en) 1999-10-04 2001-04-12 University Of Medicine And Dentistry Of New Jersey Methods for identifying rna binding compounds
US6165786A (en) 1999-11-03 2000-12-26 Isis Pharmaceuticals, Inc. Antisense modulation of nucleolin expression
EP1257639A2 (de) 2000-02-08 2002-11-20 Ribozyme Pharmaceuticals, Inc. Nukleozyme mit endonuklease aktivität
WO2005019453A2 (en) 2001-05-18 2005-03-03 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
CN1311202A (zh) * 2000-02-29 2001-09-05 复旦大学 一种新的多肽——人反转录相关因子22和编码这种多肽的多核苷酸
EP1133993A1 (de) 2000-03-10 2001-09-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Verbingungen zur Behandlung der spinalen Muskelatrophie
AU4819101A (en) 2000-04-13 2001-10-30 University Of British Columbia, The Modulating cell survival by modulating huntingtin function
US6653467B1 (en) 2000-04-26 2003-11-25 Jcr Pharmaceutical Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
AU2001261063A1 (en) 2000-04-28 2001-11-12 Xiao Xiao Dna sequences encoding dystrophin minigenes and methods of use thereof
EP1278761B1 (de) 2000-05-01 2005-04-06 Hybridon, Inc. Modulation von oligonukleotid cpg-vermittelter immunstimulation durch modifikation der nucleoside
AU2001259706A1 (en) 2000-05-09 2001-11-20 Reliable Biopharmaceutical, Inc. Polymeric compounds useful as prodrugs
ATE464378T1 (de) 2000-05-31 2010-04-15 Serono Genetics Inst Sa Verwendung des globulären kopfes von acrp30 zur verstärkung der zunahme von muskelmasse und - differenzierung
CN1326990A (zh) 2000-06-07 2001-12-19 上海博德基因开发有限公司 一种新的多肽——人类dna cgg重复结合蛋白16.17和编码这种多肽的多核苷酸
US20030124523A1 (en) 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US6794192B2 (en) 2000-06-29 2004-09-21 Pfizer Inc. Target
RU2165149C1 (ru) 2000-07-03 2001-04-20 Шапошников Валерий Геннадьевич Система формования и упаковки изделий из сахарной ваты
JP4836366B2 (ja) * 2000-08-25 2011-12-14 雅文 松尾 デュシェンヌ型筋ジストロフィー治療剤
US6727355B2 (en) 2000-08-25 2004-04-27 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
EP1191097A1 (de) 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induktion von "exon-skipping" in eukaryotischen Zellen
AU3922802A (en) 2000-10-02 2002-05-27 Keck Graduate Inst Methods for identifying nucleotides at defined positions in target nucleic acidsusing fluorescence polarization
ATE400656T1 (de) 2000-10-06 2008-07-15 Univ Michigan Mini-dystrophin nukleinsäure- und peptidsequenzen
US6623927B1 (en) 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
AU2002236499A1 (en) 2000-11-30 2002-06-11 Uab Research Foundation Receptor-mediated uptake of peptides that bind the human transferrin receptor
US7001994B2 (en) 2001-01-18 2006-02-21 Genzyme Corporation Methods for introducing mannose 6-phosphate and other oligosaccharides onto glycoproteins
TW200526779A (en) 2001-02-08 2005-08-16 Wyeth Corp Modified and stabilized GDF propeptides and uses thereof
KR100408053B1 (ko) 2001-02-13 2003-12-01 엘지전자 주식회사 에스알엠의 토크리플 저감방법
AU2002256359A1 (en) 2001-04-24 2002-11-05 Epigenesis Pharmaceuticals, Inc. Antisense and anti-inflammatory based compositions to treat respiratory disorders
WO2002092763A2 (en) 2001-05-11 2002-11-21 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
US20050277133A1 (en) 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20050282188A1 (en) 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050014172A1 (en) 2002-02-20 2005-01-20 Ivan Richards RNA interference mediated inhibition of muscarinic cholinergic receptor gene expression using short interfering nucleic acid (siNA)
IL143379A (en) 2001-05-24 2013-11-28 Yissum Res Dev Co Oligonucleotide against human ache isoform r and its uses
US20030139435A1 (en) 2001-06-26 2003-07-24 Gulzar Ahmed N-heterocyclic inhibitors of TNF-alpha expression
DK1406667T3 (da) 2001-07-06 2008-06-16 Topigen Pharmaceuticals Inc Fremgangsmåder til at öge oligonukleotiders in vivo-effektivitet og hæmme inflammation hos pattedyr
CA2455424A1 (en) 2001-08-07 2003-02-20 University Of Delaware Compositions and methods for the prevention and treatment of huntington's disease
EP1419173B1 (de) 2001-08-10 2008-11-26 Novartis AG Peptide, die atherosklerotische schädigungen binden
US20060074034A1 (en) 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
US6750019B2 (en) 2001-10-09 2004-06-15 Isis Pharmaceuticals, Inc. Antisense modulation of insulin-like growth factor binding protein 5 expression
KR20030035047A (ko) 2001-10-29 2003-05-09 (주)바이오코돈 Bmp-4 유전자 발현을 이용한 편평태선 질환의 치료 및진단방법
US20030166004A1 (en) 2001-11-01 2003-09-04 Jeno Gyuris Endothelial-cell binding peptides for diagnosis and therapy
US20030134790A1 (en) 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
WO2003062258A1 (en) 2002-01-22 2003-07-31 The Cleveland Clinic Foundation Rnase l activator-antisense complexes
WO2003069330A1 (en) 2002-02-11 2003-08-21 The Trustees Of Columbia University In The City Of New York System and method for identifying proteins involved in force-initiated signal transduction
US20050096284A1 (en) 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US7771727B2 (en) 2002-03-01 2010-08-10 The Administrators Of The Tulane Educational Fund Conjugates of therapeutic or cytotoxic agents and biologically active peptides
US20040101852A1 (en) 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
ITRM20020253A1 (it) 2002-05-08 2003-11-10 Univ Roma Molecole chimeriche di snrna con sequenze antisenso per le giunzioni di splicing del gene della distrofina e applicazioni terapeutiche.
US20040102395A1 (en) 2002-11-22 2004-05-27 Isis Pharmaceuticals Inc. Modulation of IAP-like expression
EP1380644A1 (de) 2002-07-08 2004-01-14 Kylix B.V. Verwendung spezifischer TCF Zielgene zur Identifizierung von Medikamenten zur Behandlung von Krebsarten, insbesondere Colorectalkrebs, bei denen TCF/beta-catenin/WNT Signaltransduktion eine zentrale Rolle spielt
US7589059B2 (en) 2002-07-26 2009-09-15 Roche Madison Inc. Delivery of molecules and complexes to mammalian cells in vivo
US20050255086A1 (en) 2002-08-05 2005-11-17 Davidson Beverly L Nucleic acid silencing of Huntington's Disease gene
JP2005535318A (ja) 2002-08-12 2005-11-24 ユニヴェルシテ ドゥ シェルブルック プレメッセンジャーｒｎａのスプライス部位選択の再プログラミング方法
GB0219143D0 (en) 2002-08-16 2002-09-25 Univ Leicester Modified tailed oligonucleotides
US20040219565A1 (en) * 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
DK1554305T3 (da) 2002-10-23 2007-04-23 Ct For Res And Technology Hell Prionprotein-bindende peptidsekvenser
US7892793B2 (en) 2002-11-04 2011-02-22 University Of Massachusetts Allele-specific RNA interference
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
EP1560931B1 (de) 2002-11-14 2011-07-27 Dharmacon, Inc. Funktionelle und hyperfunktionelle sirna
EP2530156B1 (de) 2002-11-25 2015-11-18 Masafumi Matsuo ENA-Nukleinsäurearzneimittel, die das Splicing im mRNA-Vorläufer verändern
GB0228079D0 (en) 2002-12-02 2003-01-08 Laxdale Ltd Huntington's Disease
EP1605978B1 (de) 2003-03-07 2010-09-01 Alnylam Pharmaceuticals Inc. Therapeutische zusammensetzungen
WO2004083432A1 (en) 2003-03-21 2004-09-30 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US7514551B2 (en) 2003-04-03 2009-04-07 Enzo Life Sciences, Inc. Multisignal labeling reagents, and processes and uses therefor
CA2526893C (en) 2003-05-14 2010-10-26 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
CN1829532A (zh) 2003-06-02 2006-09-06 惠氏公司 肌肉抑制素（gdf8）抑制剂和皮质类固醇联合用于治疗神经肌肉紊乱的用途
DE60319354T2 (de) 2003-07-11 2009-03-26 Lbr Medbiotech B.V. Mannose-6-Phosphat Rezeptor vermittelter Gentransfer zu Muskelzellen
US20050048495A1 (en) 2003-08-29 2005-03-03 Baker Brenda F. Isoform-specific targeting of splice variants
US20050054752A1 (en) 2003-09-08 2005-03-10 O'brien John P. Peptide-based diblock and triblock dispersants and diblock polymers
US7355018B2 (en) 2003-09-30 2008-04-08 Regeneron Pharmaceuticals, Inc. Modified IGF1 polypeptides with increased stability and potency
US20050222009A1 (en) 2003-10-14 2005-10-06 Itschak Lamensdorf Dual phase - PNA conjugates for the delivery of PNA through the blood brain barrier
US20050191636A1 (en) 2004-03-01 2005-09-01 Biocept, Inc. Detection of STRP, such as fragile X syndrome
US20080207538A1 (en) 2004-03-11 2008-08-28 Lawrence David S Enhanced Production of Functional Proteins From Defective Genes
EP1735443A2 (de) 2004-04-14 2006-12-27 Sirna Therapeutics, Inc. Rna-interferenz-vermittelte behandlung von polyglutamin (polyq)-repeat-expansionskrankheiten unter verwendung von sina (short intefering nucleic acid)
AU2005248147A1 (en) 2004-05-11 2005-12-08 Alphagen Co., Ltd. Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same
US20050288246A1 (en) 2004-05-24 2005-12-29 Iversen Patrick L Peptide conjugated, inosine-substituted antisense oligomer compound and method
KR20070026650A (ko) 2004-05-27 2007-03-08 악셀레론 파마 인코포레이티드 케르베루스/코코 유도체 및 그의 용도
DK1766010T3 (da) 2004-06-28 2011-06-06 Univ Western Australia Antisense-oligonukleotider til induktion af exon-skipping og fremgangsmåder til anvendelse deraf
US7361468B2 (en) 2004-07-02 2008-04-22 Affymetrix, Inc. Methods for genotyping polymorphisms in humans
EP1618881A1 (de) 2004-07-20 2006-01-25 Santhera Pharmaceuticals (Schweiz) GmbH Verwendung von steroiden ohne glucocorticoid aktivität zur behandlung von muskulärer dystrophie
WO2006017522A2 (en) 2004-08-03 2006-02-16 University Of Utah Research Foundation Use of antisense oligonucleotides to effect translation modulation
US20060099612A1 (en) 2004-09-02 2006-05-11 Suntory Limited Method for analyzing genes of industrial yeasts
CA2582137A1 (en) 2004-10-05 2007-02-15 Wyeth Probe arrays for detecting multiple strains of different species
ITRM20040568A1 (it) 2004-11-18 2005-02-18 Uni Degli Studi Di Roma Tor Vergata Uso della tecnica "phage display" per l'identificazione di peptidi con capacita' di legame a cellule staminali/progenitore, peptidi cosi' ottenuti e loro usi.
US7838657B2 (en) 2004-12-03 2010-11-23 University Of Massachusetts Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
KR100663277B1 (ko) 2004-12-20 2007-01-02 삼성전자주식회사 휴대단말기의 시스템 관련 이벤트 처리 장치 및 방법
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20120122801A1 (en) 2005-01-05 2012-05-17 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
AU2006210973A1 (en) 2005-01-31 2006-08-10 University Of Iowa Research Foundation Nucleic acid silencing of Huntington's Disease gene
WO2006108052A2 (en) 2005-04-06 2006-10-12 Genzyme Corporation Peg and polysialic lysosomal enzyme conjugates via acid labile linkers for therapeutic targeting
JP2008538500A (ja) 2005-04-22 2008-10-30 アカデミス ツィーケンホイス ライデン ＳＲタンパク質の結合に対する干渉とＲＮＡ二次構造に対する干渉による、ｍＲＮＡ前駆体におけるエクソン認識の調節
US7902352B2 (en) 2005-05-06 2011-03-08 Medtronic, Inc. Isolated nucleic acid duplex for reducing huntington gene expression
EP1885854B1 (de) 2005-05-06 2012-10-17 Medtronic, Inc. Verfahren und sequenzen zur unterdrückung der expression des huntington-gens in primaten
KR100764559B1 (ko) 2005-05-09 2007-10-08 한국표준과학연구원 Ｅｐｓｐｓ 유전자 검색에 활용할 수 있는 ｆｒｅｔ형광검출용 프로브
EP3470072A1 (de) 2005-06-23 2019-04-17 Biogen MA Inc. Zusammensetzungen und verfahren zur modulation der smn2-spleissung
US20070161590A1 (en) 2005-06-28 2007-07-12 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
DE102005030704A1 (de) 2005-06-29 2007-01-04 Autoliv Development Ab Sicherheitsgurt
EP2179737B1 (de) 2005-07-01 2013-08-14 Index Pharmaceuticals AB Modulierung der Reaktion auf Steroide
WO2007051045A2 (en) 2005-10-28 2007-05-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of huntingtin gene
US7906617B2 (en) 2005-12-15 2011-03-15 E. I. Du Pont De Nemours And Company Polyethylene binding peptides and methods of use
WO2007089584A2 (en) 2006-01-26 2007-08-09 Isis Pharmaceuticals, Inc. Compositions and their uses directed to huntingtin
EP2007365A2 (de) 2006-03-30 2008-12-31 PTC Therapeutics, Inc. Verfahren zur produktion von funktionellem protein aus dna mit nonsense-mutation und behandlung von damit assoziierten erkrankungen
WO2007123391A1 (en) 2006-04-20 2007-11-01 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly expressed gene.
EP1857548A1 (de) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Mittel und Verfahren zur Induktion von Exon-skipping
US7855053B2 (en) 2006-07-19 2010-12-21 The Regents Of The University Of California Methods for detecting the presence of expanded CGG repeats in the FMR1 gene 5′ untranslated region
CA2660523C (en) 2006-08-11 2019-03-19 Prosensa Technologies B.V. Methods and means for treating dna repeat instability associated genetic disorders
US20090253744A1 (en) 2006-09-27 2009-10-08 Bakshi Raman K Acylated piperidine derivatives as melanocortin-4 receptor modulators
EP2087110A2 (de) 2006-10-11 2009-08-12 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Influenza-ziele
WO2008049078A1 (en) * 2006-10-18 2008-04-24 Nastech Pharmaceutical Company Inc. Nicked or gapped nucleic acid molecules and uses thereof
WO2008103755A1 (en) 2007-02-20 2008-08-28 Mayo Foundation For Medical Education And Research Treating cancer with viral nucleic acid
PL381824A1 (pl) 2007-02-22 2008-09-01 Instytut Chemii Bioorganicznej Pan W Poznaniu Sekwencja siRNA, wektor, cel molekularny dla reagentów siRNA i wektorów wprowadzanych do komórek i tkanek, sposób oceny specyficzności wyciszania zmutowanego transkryptu, sposób badania oddziaływań enzymów szlaku interferencji RNA z transkryptami oraz zastosowanie sekwencji siRNA i wektora
AU2008271050B2 (en) * 2007-06-29 2014-11-06 Sarepta Therapeutics, Inc. Tissue specific peptide conjugates and methods
EP2167135A2 (de) 2007-07-12 2010-03-31 Prosensa Technologies B.V. Moleküle für targeting von verbindungen auf verschiedene ausgewählte organe, gewebe oder tumorzellen
CA2693048C (en) 2007-07-12 2016-10-18 Prosensa Technologies B.V. Molecules for targeting compounds to various selected organs or tissues
US9212205B2 (en) 2007-07-26 2015-12-15 University Of Rochester Nucleic acid binding compounds and methods of use
WO2009023855A2 (en) 2007-08-15 2009-02-19 Isis Pharmaceuticals, Inc. Tetrahydropyran nucleic acid analogs
HUE028662T2 (en) 2007-10-26 2016-12-28 Academisch Ziekenhuis Leiden Preparations and methods for controlling muscle disorders
WO2009099326A1 (en) 2008-02-08 2009-08-13 Prosensa Holding Bv Methods and means for treating dna repeat instability associated genetic disorders
WO2009101399A1 (en) 2008-02-12 2009-08-20 Isis Innovation Limited Treatment of muscular dystrophy using peptide nucleic acid ( pna)
EP2105145A1 (de) 2008-03-27 2009-09-30 ETH Zürich Verfahren zur muskelspezifischen Abgabe lipidkonjugierter Oligonukleotide
WO2009127230A1 (en) 2008-04-16 2009-10-22 Curevac Gmbh MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION
US8679750B2 (en) 2008-05-09 2014-03-25 The University Of British Columbia Methods and compositions for the treatment of Huntington'S disease
EP2119783A1 (de) 2008-05-14 2009-11-18 Prosensa Technologies B.V. Verfahren für effizientes Exon (44)-Skipping bei Duchenne-Muskeldystrophie und entsprechende Mittel
WO2009144481A2 (en) 2008-05-30 2009-12-03 Isis Innovation Limited Conjugates for delivery of biologically active compounds
US20110152352A1 (en) 2008-06-10 2011-06-23 Tufts University Smad proteins control drosha-mediated mirna maturation
GB2457965B8 (en) 2008-07-01 2011-02-16 Renovo Ltd Methods and systems for determining efficacy of medicaments.
US20110218334A1 (en) 2008-07-11 2011-09-08 Alnylam Pharmaceuticals, Inc. PHOSPHOROTHIOATE OLIGONUCLEOTIDES AND NON-NUCLEOSIDIC PHOSPHOROTHIOATES AS DELIVERY AGENTS FOR iRNA AGENTS
JP2011529686A (ja) 2008-07-29 2011-12-15 ザ ボード オブ リージェンツ オブ ザ ユニバーシティー オブ テキサス システム ポリグルタミンタンパク質発現の選択的阻害
US8084601B2 (en) 2008-09-11 2011-12-27 Royal Holloway And Bedford New College Royal Holloway, University Of London Oligomers
CA2777486A1 (en) 2008-10-15 2010-04-22 4S3 Bioscience Inc. Methods and compositions for treatment of myotonic dystrophy
TR201902952T4 (tr) * 2008-10-24 2019-03-21 Sarepta Therapeutics Inc Dmd için ekson atlama bileşimleri.
ES2532634T5 (es) 2008-10-27 2018-04-30 Biomarin Technologies B.V. Procedimientos y medios para el salto eficiente del exón 45 en el pre-ARNm de la distrofia muscular de Duchenne
US20100248239A1 (en) 2009-03-24 2010-09-30 Mayo Foundation For Medical Education And Research Methods and materials for detecting fragile x mutations
CN102625840A (zh) 2009-04-10 2012-08-01 肌肉学研究协会 用于治疗疾病的三环dna反义寡核苷酸、组合物和方法
WO2010123369A1 (en) 2009-04-24 2010-10-28 Prosensa Technologies B.V. Oligonucleotide comprising an inosine for treating dmd
CN102803284B (zh) 2009-06-08 2015-11-25 米拉根医疗公司 用于miRNA抑制剂和模拟物的化学修饰基序
CN102625809B (zh) 2009-09-11 2015-06-24 Isis制药公司 亨廷顿表达的调节
US20110166081A1 (en) 2009-12-03 2011-07-07 University Of Iowa Research Foundation Alpha-dystroglycan as a Protein Therapeutic
WO2011078797A2 (en) 2009-12-22 2011-06-30 Singapore Health Services Pte. Ltd Antisense oligonucleotides and uses threreof
WO2011078672A1 (en) 2009-12-24 2011-06-30 Prosensa Technologies B.V. Molecule for treating an inflammatory disorder
WO2011097614A1 (en) 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Mehods and compositions useful in diseases or conditions related to repeat expansion
WO2011097641A1 (en) 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Methods and compositions useful in treatment of diseases or conditions related to repeat expansion
NZ603606A (en) 2010-05-28 2015-06-26 Sarepta Therapeutics Inc Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
JP5981428B2 (ja) 2010-07-19 2016-08-31 アイオーニス ファーマシューティカルズ， インコーポレーテッドＩｏｎｉｓ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ，Ｉｎｃ． 筋緊張性ジストロフィー・プロテインキナーゼ（ｄｍｐｋ）発現の調整
JP5775581B2 (ja) 2010-08-20 2015-09-09 レプリコール インコーポレーティッド オリゴヌクレオチドキレート錯体
WO2012109296A1 (en) 2011-02-08 2012-08-16 The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Medical Center Antisense oligonucleotides
EP2699269A1 (de) 2011-04-22 2014-02-26 Prosensa Technologies B.V. Neue verbindungen zur behandlung, verzögerung und/oder prävention einer menschlichen genetischen erkrankung wie myotoner dystrophie typ 1 (dm1)
CN103619356B (zh) 2011-05-05 2017-09-12 萨勒普塔医疗公司 肽寡核苷酸缀合物
IN2014DN06220A (de) 2011-12-28 2015-10-23 Nippon Shinyaku Co Ltd
CA2862628C (en) 2012-01-27 2021-08-24 Prosensa Technologies B.V. Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
SI2841578T1 (sl) 2012-04-23 2017-12-29 Biomarin Technologies B.V. Rna modulirajoči oligonukleotidi z izboljšanimi karakteristikami za zdravljenje nevromuskularnih motenj
AR091065A1 (es) 2012-05-18 2014-12-30 Replicor Inc Una formulacion farmaceutica que comprende un quelato de oligonucleotidos antiviral para el tratamiento de una infeccion antiviral
RU2674600C2 (ru) 2012-07-03 2018-12-11 Просенса Текнолоджиз Б.В. Олигонуклеотид для лечения пациентов с мышечной дистрофией

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120270925A1 (en) * 2009-11-12 2012-10-25 The University Of Western Australia Antisense molecules and methods for treating pathologies
US20130211062A1 (en) * 2010-09-01 2013-08-15 National Center Of Neurology And Psychiatry Antisense nucleic acids
US20140298496A1 (en) * 2011-06-23 2014-10-02 Cold Spring Harbor Laboratory Phenocopy model of disease

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Brolin et al (Artificial DNA: PNA & XNA 2:1, 6-15; January/February/March 2011) *
Hua et al (GENES & DEVELOPMENT 24:1634-1644, 2010) *

Cited By (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10968450B2 (en) 2004-06-28 2021-04-06 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE47769E1 (en) 2004-06-28 2019-12-17 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE47751E1 (en) 2004-06-28 2019-12-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10266827B2 (en) 2004-06-28 2019-04-23 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10227590B2 (en) 2004-06-28 2019-03-12 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9249416B2 (en) 2004-06-28 2016-02-02 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10995337B2 (en) 2004-06-28 2021-05-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9422555B2 (en) 2004-06-28 2016-08-23 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9994851B2 (en) 2004-06-28 2018-06-12 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9441229B2 (en) 2004-06-28 2016-09-13 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9447415B2 (en) 2004-06-28 2016-09-20 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
USRE47691E1 (en) 2004-06-28 2019-11-05 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10421966B2 (en) 2004-06-28 2019-09-24 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9175286B2 (en) 2004-06-28 2015-11-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10781451B2 (en) 2004-06-28 2020-09-22 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US9605262B2 (en) 2004-06-28 2017-03-28 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US10626396B2 (en) 2005-02-09 2020-04-21 Sarepta Therapeutics, Inc. Antisense composition and method for treating muscle atrophy
US9890379B2 (en) 2006-08-11 2018-02-13 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
US10689646B2 (en) 2006-08-11 2020-06-23 Biomarin Technologies B.V. Treatment of genetic disorders associated with DNA repeat instability
US11274299B2 (en) 2006-08-11 2022-03-15 Vico Therapeutics B.V. Methods and means for treating DNA repeat instability associated genetic disorders
US10876114B2 (en) 2007-10-26 2020-12-29 Biomarin Technologies B.V. Methods and means for efficient skipping of at least one of the following exons of the human Duchenne muscular dystrophy gene: 43, 46, 50-53
US11427820B2 (en) 2007-10-26 2022-08-30 Biomarin Technologies B.V. Methods and means for efficient skipping of exon 45 in Duchenne muscular dystrophy pre-mRNA
US10246707B2 (en) 2008-05-14 2019-04-02 Biomarin Technologies B.V. Method for efficient exon (44) skipping in duchenne muscular dystrophy and associated means
US9447417B2 (en) 2008-10-24 2016-09-20 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9434948B2 (en) 2008-10-24 2016-09-06 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9234198B1 (en) 2008-10-24 2016-01-12 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9453225B2 (en) 2008-10-24 2016-09-27 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9447416B2 (en) 2008-10-24 2016-09-20 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
US9758783B2 (en) 2009-11-12 2017-09-12 The University Of Western Australia Antisense molecules and methods for treating pathologies
US9228187B2 (en) 2009-11-12 2016-01-05 The University Of Western Australia Antisense molecules and methods for treating pathologies
US10781450B2 (en) 2009-11-12 2020-09-22 Sarepta Therapeutics, Inc. Antisense molecules and methods for treating pathologies
US11447776B2 (en) 2009-11-12 2022-09-20 The University Of Western Australia Antisense molecules and methods for treating pathologies
US10287586B2 (en) 2009-11-12 2019-05-14 The University Of Western Australia Antisense molecules and methods for treating pathologies
US10421969B2 (en) 2011-10-04 2019-09-24 Royal Holloway And Bedford New College Oligomers
US10947536B2 (en) 2011-10-04 2021-03-16 Royal Holloway And Bedford New College Oligomers
US10662431B2 (en) 2011-10-04 2020-05-26 Royal Holloway And Bedford New College Oligomers
US10179912B2 (en) 2012-01-27 2019-01-15 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
US10913946B2 (en) 2012-01-27 2021-02-09 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
US11976307B2 (en) 2012-04-27 2024-05-07 Duke University Genetic correction of mutated genes
US10711256B2 (en) 2012-04-27 2020-07-14 Duke University Genetic correction of mutated genes
US20210040460A1 (en) 2012-04-27 2021-02-11 Duke University Genetic correction of mutated genes
US10907154B2 (en) 2013-03-14 2021-02-02 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US20140315977A1 (en) * 2013-03-14 2014-10-23 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US9217148B2 (en) 2013-03-14 2015-12-22 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US11932851B2 (en) 2013-03-14 2024-03-19 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy
US10364431B2 (en) 2013-03-15 2019-07-30 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US10337003B2 (en) 2013-03-15 2019-07-02 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US9506058B2 (en) 2013-03-15 2016-11-29 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
US10704060B2 (en) * 2013-06-05 2020-07-07 Duke University RNA-guided gene editing and gene regulation
US20160201089A1 (en) * 2013-06-05 2016-07-14 Duke University Rna-guided gene editing and gene regulation
US10745714B2 (en) 2013-06-05 2020-08-18 Duke University RNA-guided gene editing and gene regulation
US9840706B2 (en) 2014-06-17 2017-12-12 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US11193125B2 (en) 2014-06-17 2021-12-07 Nippon Shinyaku Co., Ltd. Antisense nucleic acids
US11155796B2 (en) 2015-02-09 2021-10-26 Duke University Compositions and methods for epigenome editing
US10676726B2 (en) 2015-02-09 2020-06-09 Duke University Compositions and methods for epigenome editing
US11015200B2 (en) 2015-03-18 2021-05-25 Sarepta Therapeutics, Inc. Antisense-induced exon exclusion in myostatin
US10676735B2 (en) 2015-07-22 2020-06-09 Duke University High-throughput screening of regulatory element function with epigenome editing technologies
US11427817B2 (en) 2015-08-25 2022-08-30 Duke University Compositions and methods of improving specificity in genomic engineering using RNA-guided endonucleases
CN113913426A (zh) * 2015-09-15 2022-01-11 日本新药株式会社 反义核酸
EP3858993A1 (de) 2015-10-09 2021-08-04 Sarepta Therapeutics, Inc. Zusammensetzungen und verfahren zur behandlung von duchenne-muskeldystrophie und damit assoziierten erkrankungen
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells
US11781140B2 (en) 2020-02-28 2023-10-10 Nippon Shinyaku Co., Ltd. Antisense nucleic acid inducing skipping of exon 51

Also Published As

Publication number Publication date
IL233809B (en) 2019-05-30
US20170029818A1 (en) 2017-02-02
EP2806900B1 (de) 2021-12-15
IL233809A0 (en) 2014-09-30
AU2020257111B2 (en) 2024-03-07
US20190194656A1 (en) 2019-06-27
US20180362973A9 (en) 2018-12-20
JP2021192609A (ja) 2021-12-23
AU2018203832A1 (en) 2018-06-21
JP2023179431A (ja) 2023-12-19
US20210108204A1 (en) 2021-04-15
EP2806900A1 (de) 2014-12-03
WO2013112053A1 (en) 2013-08-01
BR112014018427A2 (pt) 2017-07-04
JP2015509922A (ja) 2015-04-02
JP6503031B2 (ja) 2019-04-17
US10179912B2 (en) 2019-01-15
CN104203289A (zh) 2014-12-10
AU2013212758A1 (en) 2014-08-14
HK1203835A1 (en) 2015-11-06
BR112014018427B1 (pt) 2021-11-03
EP4043039A1 (de) 2022-08-17
JP2018050617A (ja) 2018-04-05
ES2907250T3 (es) 2022-04-22
CN112251436A (zh) 2021-01-22
CA2862628A1 (en) 2013-08-01
CA3120918A1 (en) 2013-08-01
AU2020257111A1 (en) 2020-11-19
CN104203289B (zh) 2020-11-03
NZ627896A (en) 2016-11-25
CN111893117A (zh) 2020-11-06
CA2862628C (en) 2021-08-24
US10913946B2 (en) 2021-02-09
AU2018203832B2 (en) 2020-08-06

Similar Documents

Publication Publication Date Title
US10913946B2 (en) RNA modulating oligonucleotides with improved characteristics for the treatment of Duchenne and Becker muscular dystrophy
JP7459691B2 (ja) 神経筋障害の治療のための改善された特徴を有するｒｎａ調節オリゴヌクレオチド
KR20210091180A (ko) 디스트로핀 엑손 스키핑을 위한 이중특이적 안티센스 올리고뉴클레오타이드
JP6928025B2 (ja) デュシェンヌ型及びベッカー型筋ジストロフィーの治療のための改善された特徴を有するｒｎａ調節オリゴヌクレオチド
CN111893117B (zh) 治疗杜兴型肌营养不良症和贝克型肌营养不良症的具有改善特性的rna调节性寡核苷酸

Legal Events

Date Code Title Description
AS Assignment

Owner name: PROSENSA TECHNOLOGIES B.V., NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DE VISSER, PETER CHRISTIAN;VAN DEUTEKOM, JUDITH CHRISTINA THEODORA;REEL/FRAME:034018/0141

Effective date: 20140923

AS Assignment

Owner name: BIOMARIN TECHNOLOGIES B.V., NETHERLANDS

Free format text: CHANGE OF NAME;ASSIGNOR:PROSENSA TECHNOLOGIES B.V.;REEL/FRAME:036732/0042

Effective date: 20150908

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION