IE902559A1 - Protein with urate oxidase activity, recombinant gene coding therefor, expression vector, micro-organisms and transformed cells - Google Patents

Abstract

The invention concerns a new urate oxidase activity protein which has the sequence (I), possibly preceeded by a methionine, or in that it may present a degree of substantial homology with this sequence. The invention is also aimed at medicines containing this protein, as well as the genetic engineering implements to obtain it.

Description

The invention relates to « novel protein possessing urate oxidase activity ; the invention also concerns the drugs containing this protein as well as the genetic engineering tools for producing that protein and notably the recombinant gene coding for that protein, the expression vector carrying that gene and the eukaryotic cells or the prokaryotic microorganisms transformed by this expres10 sion vector.

Urate oxidase (EC 1.7.3.3.), which is also called uricase, is an enzyme of the purine degradation pathway. This enzyme does not exist in primates (such as man), birds, a few reptiles or most insects. It is also non15 existent in some dogs (such as the dalmatian).

In man, the purine bases ~ adenine and guanine are converted to xanthine. The xanthine is oxidized by xanthine oxidase to form uric acid according to the following reaction: xanthine + HaO + Oa > urio acid + 0a~ The O2- radical, which is the substrate for superoxide dismutase, is converted by the latter to hydrogen peroxide.

Uric acid, a metabolite present ln blood, is normally found essentially in the form of the soluble monosodium salt. However, in certain people, it may happen that the uric acid precipitates and forms calculi.

Hyperuricemia, which is an increase in the amount of uric acid circulating in the blood, causes uric sold to deposit in the cartilaginous tissues, leading to gout. Hyperuricemia can aleo have consequences cn the kidneys: an excess of uric acid in the urine and in the kidneys can result in uric aoid nephrolithiasis, i.e. the accumulation of renal calculi, which are very painful and can damage the kidney. These calculi are composed of ur'ic acid possibly associated with phosphate and oxalate salts. Overproduction of uric acid can have a variety of origins : congenital metabolic ΑέϊάάΕέ, Lesch-Nyhan syndrome, excess ingestion o£ purine or proteins, treatments with uricosuric drugs, treatments of the hemopathies, particularly the cancerous hemopathies by cytolytic agents (chemotherapy) or by radiotherapy. (Gutman, A.B. and YU, T.F. (1968) Am. J. Med. 4S - 756-779).

Urate oxidase, the enzyme which catalyzes the degradation of uric acid to allantoin (a compound which is much more soluble than uric acid and does not crystallize at the concentrations reached in biological fluids), therefore has therapeutic value. Used in injections, it has a large number of advantages in the treatment of hyperuricemia and nephrolithiasis: speed of the hypouricemic effect (reduction of hyperuricemia of the order of 50% in less than 24 h), better protection of the kidney against lithiaeis compared with other drugs such as· allopurinol (a xanthine oxidase inhibitor), etc. At the present time, this enzyme is mainly used as adjuvant for the cytolytic agents in chemotherapy.

The urate oxidase currently need as a drug is obtained by a method comprising the culture of a mycelium of Aspergillus flavus and isolation of the urate oxidase from ths culture medium by extraction, together with several steps for purifying this protein. This method, which makes it possible to obtain urate oxidase of high purity, nevertheless has disadvantages. In fact, the physiology and especially tha genetics of A. flavus are not easy to work with (WOLOSHUK et al. (1989) Applied environ', microbiol., vol. 55, p. 86-90). It is therefore Impossible to obtain strains which produce this enzyme in substantial amounts. Furthermore, A. flavus is liable to produoe aflatoxins, which are sometimes diffioult to separate off. The purified product should consequently be checked to ensure that it is free from these toxins. - 3 There i.6 therefore a need for a purer urate oxidase of A. flaws ae well as for genetic engineering tools and techniques whereby these disadvantages can be overcome.

The Applicant purified the urate oxidase extracted from 05 A. flavus, named thereafter the urate oxidase extract, up to a purity degree higher than that already known for this protein ; the Applicant also determined'the partial sequence of that protein and built two pools of labelled probes able to hybridise with the nucleotides coding for two portions of that protein. The Applicant also built a cDNA library from the messenger RNA's of a strain of A. flavus cultivated under conditions appropriate for the production of urate oxidase, from which it isolated a cDNA coding for urate oxidase by means of these pools of two probes, and sequenced a cDNA coding for urate oxidase. j5 It then constructed an expression vector comprising this cDNA, transformed a strain of E. coli K12 with the latter, cultivated said etrain and verified that the lyzate of the cells contained a recombinant protein of the expected molecular weight, which possesses urate oxidase activity (capacity to degrade uric acid*in allantoin·).

The Applicant aleo constructed eeveral veotore for expression in eukaryotic cells, comprising a recombinant gene coding for urate oxidase whose sequence contains variations, relative to the isolated cDNA, intro25 duced for the purpose of inserting codons which are customary in eukaryotic cells, transformed different eukaryotic cells with the aid of these vectors, cultivated said cells in a small volume as well as in a larger volume (fermenter), and found that the lysates of the cells contained a substantial proportion of a rsaombinant protein of the expected molecular weight, possessing urate oxidase activity. It purified this recombinant protein and partially characterised it, comparatively toward the urate oxidase extract.

It 902559 - 4 Therefore, the present invention relates to a novel protein possessing a specific urate oxidase activity of at least 16 U/mg, which has the following sequence : SerALaVaLLysAlaALaArgTyrGly LysAspGLuLysThrGLyVa LGlnThrVaL GlyGluILeGluThrSerTyrThrLysAla IleLysAsnThrlleTyrlleThrAlaLys GLySerlLeLeuGlyThrHisPhelLeG lu AsnlleValCysHi sArgTrpThrArgMet PhelLeArgAspSerGLuGLuLysArgAsn IleAspILeLysSerSerleuSerGLyLeu TrpGlyPheLeuArgAspGluTyrThrThr ThrAspVaLAspAlaThrTrpGLnTrpLys HisVaLProLysPheAspALaThrTrpALa A LaGLuAspAsnSerAlaSerVaLGlnALa AlaArgGlnGLnleuIleGLuThrVaLG Lu IleAspLeuSerTrpHisLysGlyleuGln ProGlnSerAspProAsnGLyLeuILeLys LysLeu LysAspAsnValArgVal.TyrLysVat.Hi s TyrGLuMetThrVa LCysValLeuLeuGLu AspAsnSerVaLILeVaLAtaThrAspSer GlnAsnProValThrProPro GluLeuPh e LysTyrAsnHisIleHisALaALaHisVal AsplleAspGtyLysProHisProHisSer ValGLnValAspValValGluGlyLysGty ThrValLeuLysSerThrAsnSerGtnPhe LeulysGluThrTrpAspArglleLeuSer AsnPheSerGlyLeuGlnGluValArgSer ThrAlaArgGluVaLThrLeuLysThrPhe ThrMetTyrLysMetAlaGluGlnlleLeu TyrSerLeuProAsnLysHisTyrPheGtu AsnThrGlyLysAsnAlaGluVaLPheAla CysThrValGlyArgSerSerLeuLysSer optionally preceded by a methionine or which present a substantial degree of homology with that sequence.

Preferably the specific urate oxidase activity of the invention protein is of about 30 U/mg.

A preferred protein of that type is the protein, which, by analysis on a bidimensional gel, presents a spot of molecular mass of about 33.5 kDa and an isoelectric point around 8.0, representing at least 90 Z of the protein mass.

Preferably the purity degree of the invention protein, determined . by liquid chromatography on aC8 grafted silica column, is higher than 80 Z.

An interesting protein of that type is the protein having an isoelectric point of 8.0. Preferably the amino-terminal serine of that protein carries a blocking group, having preferably a mass around 43 units of atomic mass, such as for example the acetyl group.

The present invention also relates to the drugs which contains the invention protein in combination with a pharmaceutically acceptable carrier. The invention protein may advantageously replace, in its different uses, the urate oxidase extract possessing a specific urate oxidase activity of about 8 U/mg, which is sold in the injectable form under the trade mark Uricozyme1' (Vidal 1990).

The specific urate oxidase activity is the ratio between the urate oxidase activity measured according to the protocol disclosed in the following example 9 and the mass of the total proteins measured according to method Bradford : Anal. Biochem., 72, 248-254.

The invention also relates to a recombinant gene which comprises a DMA sequence coding for the protein having the following sequence : MetSerAtaVallysAlaAlaArgTyrGly LysAspAsnValArgValTyrLysValHis LysAspGluLysThrGlyValGlnThrVal TyrGtuMetThrVaLCysVaLLeuLeuGLu GlyGluILeGluThrSerTyrThrLysALa AspAsnSerVallleValAlaThrAspSer ItelysAsnThrlleTyrlleThrAlaLys GlnAsnProValThrProProGluLeuPhe GlySerlleleuGlyThrHisPhelleGlu LysTyrAsnHisiLeHisALaALaHisVat AsnILeVatCysHisArgTrpThrArgMet AspILeAspGlyLysProHisProHisSer PhelleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly IleAspIlelysSerSerLeuSerGlyLeu ThrValLeulysSerThrAsnSerGlnPhe TrpGLyPheLeuArgAspGluTyrThrThr LeuLysGluThrTrpAspArglteLeuSar ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGtyleuGlnGluVatArgSer HisVaIProLysPheAspAlaThrTrpAla ThrAlaArgGluVatThrleulysThrPhe AlaGluAspAsnSerAtaSerValGlnAla ThrMetTyrLysMetAlaGluGlnlleLeu AlaArgGlnGlnLeuIteGluThrValGlu TyrSerLeuProAsnlysHisTyrPheGlu IleAspLeuSerTrpHisLysGlyLeuGln AsnThrGtylysAsnAlaGluValPheAla ProG(nSerAspProAsnGlyLeuILeLys CysThrValGlyArgSerSerleuLysSer 3Q LysLeu Because of the degeneracy of the genetic code, there are a large number of DNA sequences coding for a protein whose sequence corresponds to the fotmula given above. One preferred DNA sequence, particularly appropriate for an expression in the prokaryotic microorganisms, is as follows : ATGTCTGCGG CAAGGTTCAC CCGTCTGTGT TAAAAGCAGC GCGCTACGGC AAGGACGAGA AGACCGGTGT AAGGACAATG CCAGACGGTG AGACCTCTTA TTCGCGTCTA TACGAGATGA CACCAAGGCC GCTTCTGGAG GGTGAGATTG 10 GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG ‘CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG 15 ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT 20 GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG 25 ACCCCAACGG AAATTG. TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT Another preferred DNA sequence, whioh is particularly suitable for expression in eukaryotic cells, such as yeast, is as follows : ATGTCTGCTG TTAAGGCTGC TAGATACGGT AAGGACAACG TTAGAGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAG6CC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCKACGK AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT. GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG fiffirfifTAGe AGCTCATCGA GACTCTCCAC TACTCGTTGC CTAACAAGCA ctatttcgaa atcgacctga gctggcacaa GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG tctgatcaag tgtaccgtcg gccggtcctc TCTGAAGTCT AAATTG.

Another preferred DNA sequence, which ie notably suitable Iwr expression in animal cells, is as follows : -1(-1 '-ATGTC CGCAGTAAAA GCAGCCCGCT ACGGCAAGGA CAATGTCCGC GTCTACAAGG TTCACAAGGA CGAGAAGACC GGT6TCCAGA CGGTGTACGA GATGACCGTC TGTGTGCTTC TGGAGGGTGA GATTGAGACC TCTTACACCA AGGCCGACAA CAGCGTCATT GTCGCAACCG ACTCCATTAA GAACACCATT TACATCACCG CCAAGCAGAA CCCCGTTACT CCTCCCGAGC TGTTCGGCTC CATCCTGGGC ACACACTTCA TTGAGAAGTA CAACCACATC CATGCCGCTC ACGTCAACAT TGTCTGCCAC CGCTGGACCC GGATGGACAT TGACGGCAAG CCACACCCTC ACTCCTTCAT CCGCGACAGC GAGGAGAAGC GGAATGTGCA GGTGGACGTG GTCGAGGGCA AGGGCATCGA tatcaagtcg TCTCTGTCCG GCCTGACCGT GCTGAAGAGC ACCAACTCGC AGTTCTGGGG CTTCCTGCGT 6ACGAGTACA CCACACTTAA GGAGACCTGG GACCGTATCC TGAGCACCGA CGTCGATGCC ACTTGGCAGT GGAAGAATTT CAGTGGACTC CAGGAGGTCC GCTCGCACGT GCCTAAGTTC gatgctacct GGGCCACTGC TCGCGAGGTC ACTCTGAAGA CTTTTGCTGA AGATAACAGT GCCAGCGTGC AGGCCACTAT GTACAAGATG GCAGAGCAAA TCCTGGCGCG CCAGCAGCTG ATCGAGACTG TCGAGTACTC GTTGCCTAAC AAGCACTATT TCGAAATCGA CCTGAGCTGG CACAA6GGCC TCCAAAACAC CGGCAAGAAC GCCGAGGTCT TCGCTCCTCA GTCGGACCCC AACGGTCTGA TCAAGTGTAC CGTCGGCCGG TCCTCTCTGA AGTCTAAATT G preceded by a non-translated 5' sequence favoring expression in animal cells. A preferred non-translated 5' sequence of this type is the one comprising the sequence AGCTTGCCGCCACT, located immediately upstream from the sequence described above.

It will be noticed that the protein coded for by the cDNA sequences given .above can undergo processing by methionyl aminopeptidase, which cleevas it from its amino-tertoiaal methionine residue.

The invention further relates to an expression vector carrying the above-defined recombinant gene with the means necessary for its expression.

For expression in prokaryotic microorganisms, in particular in Escherichia coli, tha coding sequence must be inserted into an expression vector containing especially an effective promoter, followed by a ribosome binding site upstream from the gens to be expressed, end also an effective transcription stop sequence downstream from the gene to be expressed. This plasmid must also contain an origin of replication and a selection marker. All these sequences must be chosen as a function of the host cell.

For expression in eukaryotic cells, the expression vector according to the invention carries the abovedefined recombinant gene with the means necessary for its expression, for its replication in eukaryotic cells and for selection of the transformed cells. Preferably, this vector carries a selection marker, chosen for example to complement a mutation of the recipient eukaryotic oells, which makes it possible to select those celle which have integrated a large number of oopies of the recombinant gene either into their genome or into a multicopy vector.

For expression in animal oells, especially in the cells of Chinese hamster ovaries, GKO, the coding sequence is inserted into a plasmid (for example derived from pBR322) containing two expression unite, a first unit, into which the recombinant gene is inserted, before an effective promoter (for example the SV40 early promoter). The sequence around the initiation ATG is preferably chosen as a function of the consensus sequence described by KOZAK (M. KOZAK (1978) Cell, 15, 1109-1123). An intron sequence, for example the intron of mouse α-globin, can be inserted upstream from the recombinant gene, and a sequence containing a polyadenylation site, for example an SV40 polyadenylation sequence, can be inserted downstream from the recombinant gene. The second expression unit contains a selection marker (for example a DNA sequence) coding for dihydrofolate reductase (an enzyme abbreviated hereafter to DHFR). The plasmid is transfected in animal cells, for example DHFR- CHO oells (inoapabls of expressing DHFR).

A line io selected for ite methotrexate resistance: it has integrated a large number of copies of the recomIE 902559 bi. n ant gene into its genome and expresses said recombinant gene at a sufficient level.

For expression in eukaryotic cells such as yeast, for example Saccharomyces eerevlaiae, the coding sequence should be inserted between, on the one hand, sequences recognized as an effective promoter and, cn the other hand, a transcription terminator. The array promoter/ coding sequence/terminator, which is called an expression cassette, is either cloned in a plasmid vector (single10 copy or multicopy) for the yeast, or integrated as a multicopy into the genome of the yeast.

The invention further relates to the eukaryotic cells transformed by the above expression vector. Of value among these eukaryotic cells are strains of the species fiaccharomyceB cerevieiae. in particular those which contain a mutation on one of the genes responsible for the synthesis of leuoins or uracil, for example the LEU2 gene or the URA3 gene.

* The invention further relates to the animal cells containing this recombinant gene with the means necessary for its expression. Said recombinant gene may, for example, have been introduced into the cells by transfection by the above expression vector, by infection with a virus or a retrovirus carrying said expression vector, or by microinjection.

The invention further relates to the process for producing a recombinant urate oxidase which comprises the steps of : 1) cultivating transformed cells as hereinabove defined ; 2) producing the lysis of that cells ; SO 3) isolating and pyrifying the urate oxidase contained in the obtained lysate · - ii The invention will be understood more clearly with the aid of the Examples below.

Many of the following techniques, which are well known'fc'b those skilled in the art, are described in detail in the work by Maniatis et al.: Moleoular cloning: a laboratory manual published in 1884 by Cold Spring Harbor Prese in New York.

EXAMPLE 1: Isolatlon-of-the messenger RNA a from Aspergillus ,flavus The strain of A. flayug which produces urate " 12 ~ oxidase was cultivated under conditions appropriate for the production of urate oxidase, i.e. in a medium containing uric acid and having the following composition: glucose 15 g/1, MgSO4.7H2O 1 g/1, KH2PO4 0.75 g/1, CaCOs 1.2 g/1, uric acid 1.2 g/1, KOH 0.5 g/1, soy bean oil 0.66 ml/1, FeS04.7H20 10 mg/1, CuS04.5H20 1 mg/1, ZnS04.7H20 3 mg/1, MnS04.H20 1 mg/1. The medium is adjusted to pH 7 with H2S04 1 M and sterilized at 120°C for 80 min.

In a 5 1 Erlenmeyer flask, 1.5 1 of medium are inoculated with about 1 to 3.107 spores.

The culture is incubated for about 40 h at 30°C, with agitation (120 rpm). The mycelium is recovered by filtration on gauze, washed with water and frozen in liquid nitrogen. g of mycelium (wet weight) are thawed, resuspended in 45 ml of lysis buffer and then, taken up in the same volume of beads (0.45 pm in diameter). The lysis buffer consists of guanidine thiocyanate 4 M, Tris-HCl mM pH 7.6, EDTA 10 mM, β-mercaptoethanol 50 ml/1. The mycelian suspension is ground in a Zellmtihle mill (vibrogenic) for 5 min.

The ground material is recovered and the beads are decanted. The supernatant is removed (about 45 ml), brought back to a final concentration of 3 M in respect of lithium chloride and stored at 0°C.

After two days, it is centrifuged for 60 min at 10,000 rpm. The supernatant is discarded and the residue is taken up in 40 ml of LiCl 3 M and centrifuged again at ,000 rpm for 1 h 30 min.

The following are added: proteinase K (SIGMA) 40 pg/ml, SDS (0.1% w/v) and EDTA 20 mM. The mixture is incubated at 37°C for 3 h. Precipitation with 2 volumes of ethanol is followed by washing with 70% ethanol. The residue is taken up in 0.5 ml of TE buffer (Tris-HCl - 13 10 mM, EDTA 1 mM pH 7.5), the mixture is extracted twice with chloroform and precipitation is carried out with ethanol. The RNA's are stored at -80‘C in alcohol. EXAMPLE 2: Purification of the poly A- fraction of the BNALs About 1 mg of RNA is precipitated for 20 min at 4°C (15,000 rpm) and then washed with 70% ethanol and dried. The residue is taken up in 1 ml of TE buffer and resuspended by agitation in a Vortex. Oligo dT-cellulose type 3 (marketed by Collaborative Research Inc., Biomedicals Product Division) is prepared according to the manufacturer's recommendations. The RNA is deposited on the oligo dT, agitated gently to resuspend the beads and then heated for 1 min at 65°C.

The suspension is adjusted to 0.5 M NaCl and then agitated gently for 10 min. It is then centrifuged for 1 min at 1000 rpm, the supernatant is removed and the residue is washed twice with 1 ml of TE buffer containing 0.5 M NaCl. The supernatants are removed. The poly20 adenylated fraction of the RNA's (consisting of the messenger RNA's) is eluted by suspending the beads in 1 ml of TE buffer, then heating this suspension at 60eC for 1 min and subsequently agitating it for 10 min on a tilting plate. It is then centrifuged for 1 min at 1000 rpm, which makes it possible to recover on the one hand the supernatant containing free mRNA's in solution, and on the other hand the residue of cellulose beads. The above series of operations (starting from elution) is repeated. The supernatants obtained in this way are pooled, the excess beads are removed by centrifugation and the supernatant is precipitated with ethanol containing NaCl in accordance with the usual techniques (Maniatis: op. cit.).

EXAMPLE 3: Building of the cDNA library The messenger RNA's isolated as described in the previous Example were used to build a cDNA library in vector pTZ19R (marketed by PHARMACIA). This vector is a plasmid comprising a polylinker containing unique restriction sites.

The cloning technique used is the one described by Caput et al. (primer-adapter technique: Caput et al., Proc. Natl. Acad. Sci. (U.S.A.) (1986) 83, 1670-1674).

It consists firstly in digesting the vector with Pstl, adding a polydC tail to the protuberant 3' end and then digesting the resulting plasmids with BamHI. The fragment corresponding to the vector is purified on a column of Sepharose CL4B (Pharmacia). It therefore comprises a polydC tail at one end, the other end being a sticky end of the BamHI type. Secondly, the messenger RNA's are subjected to reverse transcription starting from a primer having the sequence 5')<3. Thus the cDNA's have at their 5' end the sequence GATCC complementary to the BamHI sticky end. The RNA-DNA hybrids obtained by the action of reverse transcriptase are subjected to alkaline hydrolysis, enabling the RNA to be removed. The single-stranded cDNA's are then purified by 2 cycles on a column of Sepharose CL4B and subjected to a treatment with terminal transferase so as to add polydG's at the 3' end. The cDNA's are inserted in single-stranded form into the vector prepared as described above. A second oligonucleotide, the adapter, complementary to the primer, is necessary in order to generate an open BamHI site at the 5' end of the cDNA's. After hybridization of the vector, the cDNA and the adapter, the recombinant molecules are circularized by the action of the ligase of phage T4. The singlestranded regions are then repaired by means of the DNA polymerase of phage T4. The plasmid pool obtained in this way is used to transform the MC1061 strain for ampicillin resistance (Casabadan, Chou and Cohen, J. - 15 EXAMPLE 4-: Purification of nrnte oxldaee axtrwntad from A. flavus and oharaoterlaatlon tharenf 1.) Purification of urate oxidase extracted from A.flayua A preparation of urate oxidase extracted from A^ flavus (Uricozyme - Laboratoirea Clin Midy), having a epeeific urate oxidase activity of 8 U/ml (the specifics urate oxldaee activity is the ratio of tho urate oxidase activity measured by the test described in Example 9 to the weight of total proteins measured by the Bradford method: Anal. Bioehem., 72, 248-254), was repurified by chromatography on a column of Red-agarose 120 grafted agarooe (SIGMA), concentration by ultrafiltration and filtration on Ultrogel Aoa 44 (IDF), a polyacrylamideagarose gel, according to the following protocol: Stop 1: Affinity chromatography on grafted agarose Temperature: 4 * C Column: PHARMACIA K50/30 - diameter = 50 nm - length = 33 cm Resin: Red 120 Agarose (3.000 CL/R-0503 SIGMA) (volume of gel = 410 ml height of gel = 20 cm) Equilibration buffer: glycine/NaOH 20 mM pH B.3 Elution buffer: glyeine/NaOH 20 mM, NaCl 2 M pH 8.3 Conditioning flow rate: 250 ml.h-1 Operating flow rate: 160 ml.h-1 Elution flow rate: 60 ml.h-1 1) Deposit the eolution of Uricozyme on the top of tho column with the aid of a constant-flow pump. - 16 2) After adaorption, waah the column with twice ita volume of equilibration buffer. 3) Klute with an ionic otrenftth gradient having the following composition: glycine, NaOH, 20 mM pH S.3/glyoine, NaOH, 20 mM + NaCl 2 M pH Q.3 The total volume of the gradient ie equal to 10 times the volume of the column, divided up equally between the two constituents.

Chromatographic recording ie carried out at A = 200 nm; the urate oxidase pool is collected after combination of the fractions whioh have a «pacific urate oxidaee activity greater than or equal to 16 U/mg.

IS Step 2: Concentration of the urate oxidaee pool by ultrafiltration with the aid of a Blopaee aystem comprising a 10 kDa ultrafiltration membrane SteP-320 Temperature: 4·C Column: PHARMACIA K 50/100 - diameter " 50 mm - length = 100 om Resin: po ly aery lamide-agar oaa with amine and hydroxyl groups: Ultrogel ACA 44 (IBP) - volume of gel = 1-β 1 - height of gel = 00 cm Equilibration buffer: glyoine/NaOH 20 mM pH 8.3 Conditioning flow rate: 40 ml.h-1 Operating flow rate: 24 ml.h·1 1) Deposit the concentrated urate oxidase pool on the top of the column with the aid of a constant—flow pump. 2) After the aample has bean depocited, oontinu* to supply the column with the buffer glyclne/NaOH 20 mM pH 6.3 3) After chromatography, wash with NaCl 2 M until tho UV nbaorbiUiuB value (X - 2Θ0 nm) < 0.05.

Ofl Store under NaCl 2 tt at 4*c.

Chromatographio recording ie carried out at A = 2Θ0 nm; the urate oxidase pool is collected after combination of the fractions which ooniolntlv have: - a specific urate oxidase activity greater than IO or equal to 20 U/mg; and - only 2 bands in electrophoresis under denaturing conditions (presence of SDS) and with silver nitrate developing (Biorad staining kit), namely: Ifi a major band of 33-34 kDa a minor band of 70—71 kDa. 2) Characterization of purified urate oxidase extracted from A. flavu· a) Partial sequencing Direct amino-terminal sequencing of the protein was attempted in order to obtain information on the amino acid sequenoe of the purified urate oxidase extract, making it possible to synthesize the probes necessary for cloning the cDNA. This sequencing was not suooessful because of amino-terminal blocking of the protein (cf. f) below).

The following strategy was therefore developed to obtain the partial sequence of urate oxidase: - cleavage of the protein with proteolytle enzymes (using the enzymes trypaim and protease V0 of Staahy1nnoonua aureus) - ooparatlon of the resulting polypeptides by reversed - 18 phase HPLC - sequencing of the purified peptides. a) Hydrolysis Qf the ..urate oxidase with trypajn. purlfl05 cation and acquanslng of tha .pcptidpo The urate oxidase, at a concentration of 9 mg/ml in an amnioniurn carbonate buffer 100 mM pH S-9, was digested with trypsin (Worthington, TPCK), in a ratio uratu oxidaae/trypsin of 30/1 by weight, at 30*C fox· 24 h. After tryptic hydrolysis, 60 ug of digested urate oxidase were directly injected on to a reversod phase HPLC column of Brownlee Glfl grafted eilica (column: 10 x 0.2 cm) equilibrated with acetonitrile IX (v/v) and lb trifluoroaoetic acid O.iX (v/v) in water. The peptides were then eluted by a linear gradient of aoetonitrile in a solution of trifluoroaoetic acid (O.IX v/v) in water, varying from IX to 60X of acetonitrile in 60 min, at a rate of 150 μΐ/min. The peptides leaving the column were detected by measurement, of the optical density at 218 nm.

The elution profile is shown in Figure 1, in which the numbers following the letter T (trypsin) correspond to the peaks identified.

Bach peak was co1looted and stored nt -20 *C until analyzed on a protein sequencer (model 470 A from Applied Biooystema) equipped with a chromatograph (model 430 A from Applied Biosyetems), which cantinuouoly analyzes the pheny1thiohydantoic derivatives formed, after each degradation cycle. Table 1 below shows the peptide sequences of the 9 peaks identified.

P) Hydrolvaie of the urate oxidase with pyniunnft Va. purification and sequencing of .the peotldea The urate oxidase, at a concentration of 2 mg/ml •Ε 902559 in an ammonium acetate buffer 100 mM pH 6.0, was digested with the protease VO of Btaphvlnoppeug aureus (BoehrInger-Mannheim), ln a ratio urate oxidaoo/protoaoe V8 of 60/1, at 30’C lor T2 h. IftO pg of tliaeBled urate oxidase were then injected on to a reversed phase HPLC oolumn of Brownlee G18 grafted ollioa (column: 10 x 0.2 cm; particles; 7 x 0.03 pm), equilibrated with acetonitrile 1% and triflunroacetln aoid 0.1% (v/v) in water. Tho peptides were then eluted by a linear gradient of acetonitrile ln a solution of trifluoroaoetic acid in water (0.1% (ν/v)), varying from 1% to 60% of acetonitrile ln 60 min, at a rate of 150 ul/min. The peptides leaving the column were detected by measurement of the optical density at 21Θ nm.

The elution profile is shown in Figure 2, in which the numbers following Lha letter V (protease VB) correspond to the peaks identified.

Each peak was collected and stored at -20*C until analyzed on the protein sequencer already mentioned.

Table I below shows the peptide sequences of the peake identified. 38,3 *4 C o < IH H· -u S h r f Ϊ e. »a. f £ a. *3 < <3 < < H t-e HI H Hl H σ> u» ω M h* a 8 ω H 8 8 8 !5 IS F?3 yy < <3 2L.& yy F? F£ 5? σ s V H— ff 1 5 a y Ϊ I ? I 1 1 g< iii ii ii ii ii ii i i F y 1 i y £ I ss rs ii - Leu - - Ala ii i l w ii i i i y 1 s ft» I i 1 A S' I 1 ι ffs U 0 £* *"* φ P* α n 1 f M H S'? f ii £ £ i n 5* i e y A * J £ I ii ϋ i ‘ i i i s B t-M bi- ff i ft i 1 F ( i 1 it ii re y i i i i i | £ | i 1 15 n — 0 | £ I i ii ii e Ρ» X H· S3 i i i F i F A C I 5? 1—* 1 i ii ii A tr m i 1 A C* I A C i i > l-l ·» | i £ 0 Sj B | i ii ii i- i F F i i y | e H 1 i ϋ 1 J M < i i i y i X I— 03 I J F i ii I 1 yy i !T i s % i f A 5* a V « A Μ H £ > ft» i i i i 1 F 1 ii 1 1 i 1 y 1 F 1 H sr 1 hM (9 1 Ϊ OZ - 21 b) SpAciflo activity The purified urate oxidase extract has a speclflo activity of about 30 U/mg.

©) Electrophoresis under denaturing ccuditiuuo Electrophoresis of the purified urate oxidase extract on polyacrylamide gel in the presence of SDS (sodium dodacylaulfate), followed by silver developing, reveals a high intensity band of about 33-34 kDe and a very low intensity band of about 70-71 kDa. d) Determination of the isoalsctrio point Procedure - CJee of ready-to-uae gale, namely LKB Ampholinee gel platan from Pharmacia with pH ranges of (3.5 - 0.5) and (5 - S).

- Deposition of 10 yl of LKB standard proteins (range of isoelectric points of the standard proteins: 3.5 - 9.5) and 4 yg and β yg of purified urate oxidase (on two different lanes).

- Run 1 b 30 min, 12 V, C*C.

- Then staining with Coomassie blue (0,1%) in (25% ethanol, B% acetic aoid) to stain the proteins, followed by decolor iasat ion with a solution containing 25% of ethanol and 8% of aoetio acid (to eliminate the baokground).

- Keoulta-. Observation of two close bands (doublet), of isoelectric pointe 8.1 and 7.9, on each of the two lanes. e) Two-dimsneional gel analysis Ob Two-dimensional gel analysis makes it possible to separate the proteins in a first stage according to their isoelectric points and in a second stage according to their molecular weights.

Cxotpccl Sample: solution of purified urate oxidase extract in a glycine buffer 20 mM pH 8.3 Preparation □£ the. hmetoIm - Two samples of 5 pg and 10 yg of urate oxidase.

- Drying by vacuum centrifugation and taking-up in 5 μΐ of a lyeio buffer having the following composition: urea 2.6 M, 3 (3-oholsmidopropyl)dimethylaninoniopropane-leulfonato, CHAPS (Sigma), 2% (v/v), Ampholinse amphoterics (LKB) of pH ranges 6 · 8 and 3.5 - 0.5, 0.4%, and 0-mercaptoethanol 5%. ?,5 laoelectrofooualng del -· Preparation of a solution containing urea f>-5 M, CHAPS S%, LKB Ampholin·» (pH (3.5 - 9.5) 1%; pH (5 - Q) 1%), aorylamido/bisacrylamlde (28.4X/1.7X) 3.5% final concentration, HgO.

- Filtration and degassing of the solution, followed by addition of 0.075% nf tetramathylethyl «madlamfne, Temod (Pharmacia), and 0.015% of ammonium persulfate.

- Introduction of the solution into tubes (16 x 0.12 cm) polymerization overnight nt 20*C.

- Cathodic solution: NaOH 0.1 M, degasood.

Anodic: solution: ΗβΡ0< 25 mM.

- Prerun 45 min at 4 mA (voltage 300 V----* 1000 V).

- Deposition of the samples at the oathodo.

- Run 19 h at 1OOO V and at 20aC.

- Demoldlng of the gels and equilibration for 10 min at 20*C in a buffer (Tris 0.375 M pH β-β; SDS 3%s dithio15 throitol, DTT, 50 mM).

PACK/KBR dwnaturj rtff ffwl - Preparation of a solution containing aorylamide/bio20 acrylamide (30%/Ο.β%) 15% final concentration, TrisHCl (pH a.Q) 0.375 M, HaO.

- Filtration and degassing of the solution, followed by addition of SDS (0.1%), ammonium persulfate 0.05% and Temed 0.05%.

- Polymerization overnight at 4'C (gel 16 x 20 x 0.15 cm).

- After equilibration, deposition of the isoelectrofoousing gel on the surface of the PAGB/SDS gel, followed by sealing with agarose.

- Electrophoresis buffer: (Trin-HCl 25 mM pH S.3, glycine 3b 0.1H2 M, SDS 0.1%).

- Run 100 mA - 6 h at 6*C.

- Fixing of the gel in 50% methanol, 10% aoetio acid, followed by silver nitrate staining (method of Blum, H., Klectrophoresis 1907, S, p. 93-99).

- Scanning of the gel on a Visage 2000 image analyzer from Kodak for determination of the optical density and curface area of each spot and hanea for calculation of the quantitative ratio between the spots.

- Determination of the molecular weight of the protein by preparation of a two-dimensional gel in the presence of Amersham standard proteins.

Result Two spots with a molecular weight of the order of 33.5 kDa are observed, one being the majority spot with 20 an -isoelectric point of the order of S.0, intensity 5.2 (representing about 93% of the weight of proteins), and the other being the minority epot with an isoelectric point of the order of 7.4, intensity 0.41 (representing about 7% of the woight of proteins). f) Determination of the amino-terminal eequenoe and the mass of the blocking amino-terminal grnup ct) Demonetratlon of the blocked character of the 30 «niino—terminal sequence The amino-terminal sequence was analyzed with the aid of an Applied Dlosystem model 470Λ sequencer coupled with an Applied Biosystem mode) 120A analyzer of phenyl35 thiohydantoic derivatives. The purified urate oxidase (200 pmol, oheoked by amino acid analysis) was deposited on the eeguencer in the presence of 20 pmol of 0-lactoglobulln, a standard protein.

No amino—terminal sequence corresponding to a urate oxidase sequence wao detected (by contract, the amino-terminal sequence of the standard protein wao detected, showing that the sequencer was working). k- flavus urate oxidase therefore has the aminoterminal end blooked. 0) Determination of the sequence of an amineterminal peptide of 32 amino acids and the mass of the blocking amino-terminal group Method: Digestion with.oynnngftn-bromide The purified urate oxidase extract io subjected to gel filtration on Sephadex Π25 (PD10 - Pharmacia), a gel obtained by crosslinking dextran with epiohloro20 hydrin, equilibrated with a solution containing 7X of formic acid, making it possible to remove the salts and change tine buffer. The formic acid concentration is increased t-o 70% by vacuum centrifugation. Cyanogen bromide is then added to a final concentration of 0.2 M and the reaction is allowed to proceed for 20 h under argon, 1n the absence of light and at room temperature.

~ Separation hv ion exchange chromatography of the peptides derived from digestion of tho protein with SO cyanogen bromide The peptides were separated on an ion exchange column based on mono S hydrophilic resin (Pharmaoia).

Buffer A: ammonium acetate) 10 mM pH 6.2 - 26 Buffer B: ammonium acetatw 1 M pH 6.2 Flow rate: 0,6 ml/min, peak detect ion by measurement of the optical density at 270 nm Gradient: from OX of B to 100% of B in 30 min 05 collection of 1 ml fract Lone The fractions derived from the ion exchange atop were analyzed by PAGE/GDS go) according to tha method described by Schagger and Von Jagow (1087) Anal. Biochem. 166 - p. 366-379.

- Pnrifiontlon of the amino-terminal peptide bv reversed IB The peptide derived from the Ion exchange step, having n molenulan weight of about 4000 Da (on PAGK/BDS gel), was purified on a Beckman Altex CIS oolumn (260 x 2.1 mm), which is a reversed phase HPLC column based on C1B crafted silica.

Flow rate: 0.3 ml/min, peak detection by measurement of the optioal density at 218 nm Buffer A: HaO/O.lX TFA (trifluoroaoetic acid) Buffer B: aoetonitrile/0.IX TFA Gradient: from 1 to 50% of B in 60 min.

The peptide collected after a first reversed phase HPLC step was repurifled on the eame reversed phaso HPLC oolumn, but with a different gradient.

Gradient: from 1 to 50% of B in 10 min.

The peak collected was subjected to analysis by fast atom bombardment maos spectrometry (FAB/MS) with a glycerol -» thioglyoerol matrix.

- DIgoatIon of the aminn-termdnnl peptide with ohvmotrypsin and SminO aoid analysis of the chvwntrvptJn poptides oaparatad by ravnraed phase HPLC To establish the sequence of the peptide purified by reversed phase HPLC, said peptide wae digested with chymotrypsin. The chymotryptio peptides were separated by reversed phase HPLC on a Beckman. Altex C18 column (250 x 2.1 rnm).

Flow rate: 0.3 ml/min, peak detection by measurement of the optical density at 218 nm Buffer A: HaO/0.11% TFA Buffar B: aoetonitrile/0.08% TFA Gradient: from j.% of B to 50% of B in ftO min collect: i on of the peaks.

The chymotryptio peptidoe were identified by amino acid analysis on on Applied Biosystem analyzer (model 420-130A).

Rnnulta The results presented below, which were ostab25 lished after determination of the sequence of the cDNA of A. flavus urate oxidase and the deduoad amino acid sequence (of. Example 6), can only be understood in the light of the following; - Analysis of the amino-terminal peptide by mass spectrometry A difference of about 42 atomic mesa units is observed between the two molecular weights determined by mass spectrometry, 3RR4 and 3AA6, and the theoretical molecular weights determined from the following sequence (amino acid sequence deduced from the cDNA of A, flwvun urate oxidase with cloavage of the amino-terminal methionine group and peptide cleavage with cyanogen bromide after the first methionine rentdue): BarAlaVolLysAlaAlaArgTyrGly LyaAspAsnValArgValTyrLysValHio LysAspOluLynThrCliyValGlnThrVal TyrGlu (1) with a carboxy-terminal methionine residue modified by reaction with cyanogen bromide to give either homoserine, 3642, or homoeerine lactone, 3624.

There is therefore a blocking group on the aminolb terminal serine which accounts for an additional mass of about 42 atomic mass units, probably corresponding to acetylation of auld amino-terminal serine (mauu »»£ CHoCO - mass of H = 42 atomic mass units).

-- Amino acid analysis of the ohymotryptic peptides This analysis made it possible to show unambiguously that the sequence of the amino-terminal peptide obtained by digestion with cyanogen bromide comprises tho sequence (1) described above.

The complete amino acid sequence of urate oxidaee is shown hereinafter ; SerALaVa ILysAlaAlaArgTyrGly LysAiipGluLysThrG tyVa IGlnThrVal GlyGluIleGluThrSerTyrThrLysAla IlelysAsnThrlleTyrlLeThrAlaLys GlySerlleLeuGlyThrHisPhelleGlu AsnILeValCysHisArgTrpThrArgMet PheILeArgAspSerGluGluLysArgAsn IleAspIleLysSerSerleuSerGlyleu TrpGlyPheLeuArgAspGluTyrThrThr ThrAspValAspAlaThrTrpGlnTrpLys HisValProLysPheAspAlaThrTrpAla AlaGluAspAsnSerAlaSerValGlnAla AlaArgGlnGlnLeuIleGluThrValGlu IleAspLeuSerTrpHisLysGlyleuGln ProGtnSerAspProAsnGlyLeuIleLys LysLeu LysAspAsnVatArgValTyrlysValHi s TyrGluMetThrValCysValLeuLeuGlU AspAsnSerVaIILeValAlaThrAspSer GlnAsnProValThrProProGluLeuPhe LysTyrAsnHisIleHisAlaAlaHisVal AspIleAspGlyLysProHisProHisSer ValGlnValAspValValGluGlyLysGly ThrValLeuLysSerThrAsnSerGlnPhe LeuLysGluThrT rpAspArglleLeuSer AsnPheSerGlyLeuGlnGluValArgSer ThrAlaArgGluValThrLeuLysThrPhe ThrMetTyrLysMetAlaGluGlnlleLeu TyrSerLeuProAsnLysHisTyrPheGlu AsnThrGlyLysAsnAlaGluValPheAla CysThrValGlyArgSerSerleuLysSer - 30 EXAMPLE 5: Screening of the bacteria 1) Preparation of the labeled probes Two pools of probes deduced from amino acid sequences of the protein were synthesized with the aid of a Biosearch 4600 DNA synthesizer. The first pool corresponds to the sequence of residues His-Tyr-Phe-Glu-Ile-Asp (part of the sequence of T 27), i.e. from 5' to 3': A T G G G IQ TCGAT TC A A TA TG T c A A A This pool in fact consists of 24 x 3 = 48 different oligonucleotides, representing all the possible combi15 nations. The second pool corresponds to the sequence of amino acid residues Gln-Phe-Trp-Gly-Phe-Leu (part of the sequence of V 5), i.e. from 5' to 3': GG A GT A AAGCCCCA AA TG AA C AC T This pool consists of 24 x 4 = 64 combinations. The probes are labeled with terminal deoxynucleotide transferase (TdT) (marketed by IBI Inc.).

The reaction is carried out on 100 ng of a mixture of oligonucleotides in solution (100 mg/ml) in Cobalt reaction buffer (supplied as a 10-fold concen30 trate by IBI Inc.): 1.4 M potassium cacodylate - pH 7.2, 300 mM dithiothreitol, 1 pi of the enzyme terminal deoxynucleotide transferase (IBI Inc.) and 50 pCi of deoxycytidyl triphosphate, dCTP, labeled with P32. The reaction is carried out at 37’C for 10 min and is then stopped by the addition of 1 pi of EDTA 0.5 M. A phenol - 31 extraction is carried out and the extract is dialyzed on a column of Biogel P10 polyacrylamide (Biorad: 150-1050). 2) Hybridization and detection of the colonies containing urate oxidase cDNA About 40,000 colonies are screened by the in situ hybridization technique developed by Grunstein and Hogness (1975, Proc. Natl. Acad. Sci. (U.S.A.), 12, 3961). About 6000 bacteria are plated out in Petri dishes to give isolated colonies. After incubation for 24 h at 37°C, each dish is replicated on 2 filters, each filter being intended to be treated with one of the 2 pools of probes, so that all the colonies obtained are tested with the 2 pools of probes in parallel.

The filters are hybridized with one of the 2 pools of probes in a buffer containing 6 x SSC, 10 x Denhardt's solution and 100 yg/ml of sonicated and denatured salmon sperm DNA (SIGMA). The hybridization is carried out at a temperature of 42’C for 16 h. The 6 x SSC solution is obtained by diluting a 20 x SSC solution.

The preparation of the 20 x SSC buffer is described by Maniatis, Fritsch and Sambrook (op. cit.). In summary, this buffer contains 175.3 g/1 of NaCl and 88.2 g/1 of sodium citrate and is adjusted to pH 7 with a few drops of NaOH 10 N. The 10 x Denhardt's solution contains 1 g of Ficoll, 1 g of polyvinylpyrrolidone and 1 g of human serum albumin per 500 ml of final volume.

After washing in the 6 x SSC solution at 42°C (3 h with 5 changes of bath), the filters are wiped with Joseph paper and subjected to autoradiography. The filters are developed after 16 h. A fraction of about 0.5% of the colonies was found to have hybridized with the 2 pools of probes. colonies from this fraction were taken up and purified. The plasmid DNA was prepared from each of these colonies and this DNA was analyzed by digestion - 32 with either BamHI, or Hindlll, or both BamHI and Hindlll.

After analysis on agarose gel, the 5 plasmids obtained were found to have been linearized by BamHI and by Hindlll. The double digestions make it possible to release a fragment corresponding to the whole of the cloned cDNA. The size of this fragment is about 1.2 kb in 3 cases and about 0.9 kb in the other 2 cases. For the following determination, one of the 0.9 kb fragments and one of the 1.2 kb fragments were selected and re10 cloned (see Example 6 below).

EXAMPLE 6: Determination of the sequence of urate oxidase cDNA On the one hand one of the 0.9 kb fragments (clone 9A) and on the other hand one of the 1.2 kb fragments (clone 9C) were recloned in the DNA of the replicative form of single-stranded phage M13. The DNA of the M13 clones, containing the 0.9 kb fragment on the one hand and the 1.2 kb fragment on the other, was digested with exonuclease so as to generate a series of overlapping M13 clones (procedure: Cyclone I Biosystem of IBI). Said clones were sequenced by the dideoxyribonucleotide method (Sanger et al., PNAS-U.S.A. - 1977, 14, 5463-5467).

The nucleotide sequence of clone 9C is shown in Figure 3, which also indicates, with an arrow, the start of clone 9A and, with a nucleotide symbol followed by an asterisk *, the sequenced nucleotides of clone 9A which are not identical to those of clone 9C (when matching the two sequences and the AccI and BamHI restriction sites used in the subsequent constructions (cf. Example 10)).

It is found that - the nucleotide sequence of the longer fragment (clone 9C) overlaps that of the shorter fragment (clone 9A) but for two differences (see Figure 3). One of the differences is quiescent and the other corresponds to a •Ε 902559 - 33 change from a tryptophan residue to a glycine residue. These differences may be due either to differences in the messenger RNA's isolated (cf. Example 2 above) or to errors in the reverse transcriptase used when building the cDNA library (cf. Example 3 above).

In the case of the longer fragment, an ATG codon (in position 109 in Figure 3) opens an open reading frame corresponding to a polypeptide of 302 amino acids, with a molecular weight of about 34,240 Da, whose sequence cor10 responds to the partial sequence of purified A. flavus urate oxidase (cf. Example 4).

Figure 4 shows the DNA sequence opened by the ATG codon and the polypeptide coded for, and, with arrows opposite the polypeptide coded for, the sequenced pep15 tides (cf. Example 4) obtained by hydrolysis of A. flavus urate oxidase with trypsin and protease V8.

It is found that the sequence of the polypeptide terminates in the triplet Ser-Lys-Leu, which is typical of peroxisomal location enzymes (Gould S.J. et al., J.

Cell Biology 108 (1989) 1657-1664).

EXAMPLE 7: Construction of an expression vector for urate oxidase cDNA Plasmid p466, a vector for expression in E. coli, was prepared. It comprises a fragment of pBR327 in25 eluding the origin of replication and the ampicillin resistance gene; it also comprises a synthetic promoter of E. coli (R. RODRIGUEZ and M. CHAMBERLIN, Promoters Structure and function (1982), Preager), a Shine-Dalgarno sequence followed by a polylinker containing the unique 30 Ndel and Kpnl sites, a transcription terminator (derived from phage fd) and the lac i gene.

This plasmid was constructed from an expression plasmid for hGH in E. coli (p462) by replacing a fragment carrying the hGH gene with urate oxidase cDNA.

The construction of plasmid p466 will now be - 34 described in greater detail in the following account, which will refer to Figures 5, 6, 7, 8 and 9.

Figure 5 shows a restriction map of plasmid pl63,l. The different restriction segments are labeled arbitrarily according to the following legend: ________ = DNA segment derived from plasmid pBR322 Location of the origin of replication (ORI) DNA segment containing the sequence coding for a natural precursor of hGH DNA segment of phage fd containing a transcription terminator >777777.

DNA segment containing a tryptophanlactose UV5 hybrid promoter-operator DNA segment coding for β-lactamase (ApR: ampicillin resistance) Figure 6 shows the restriction map of plasmid pl60, whose Pvul-XhoI-BamHI(1) and Pvul-ORI-BamHI(2) fragments originate respectively from plasmids pl63,l and pBR327 and whose small BamHI(2)-BamHI(1) fragment is fragment 3 described below.

Figure 7 shows the restriction map of plasmid p373,2. The different restriction segments are labeled arbitrarily according to the following legend: = Pvul-BamHI sequence derived from plasmid PBR327 Pvul-Xhol sequence derived from plasmid pl63,l 7//7/// (Hindi) Clal XhoI-HincII sequence derived from plasmid pl63,l Ndel Pstl Fragment 4 described below XXXXXX = Fragment 3 described below = DNA segment of phage fd containing a transcription terminator Figure Θ shows a restriction map of plasmid p462, the synthetic Bglll-Hindlll fragment defined below being represented by: Figure 9 shows a restriction map of plasmid p466, the Ndel-Kpnl fragment, comprising the gene coding for urate oxidase, being represented by: - 36 1) Construction of plasmid p373,2 The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK, Cold Spring Harbor Laboratory (1982). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer.

Plasmid pl63,l (Figure 5), described in European patent application A-0245138 and deposited in the CNCM under the reference 1-530 on 17 February 1986, was digested with the enzymes Pvul and BamHI. This plasmid contains the gene coding for hGH. The PvuI-BamHI frag15 ment - hereafter called fragment 1 - containing the site of action of the restriction enzyme Xhol, shown in Figure 5, was purified.

Likewise, plasmid pBR327, which is well known to those skilled in the art (q.v. SOBERON, X. et al., Gene, 9 (1980) 287-305), was digested with the enzymes Pvul and BamHI. The PvuI-BamHI fragment - hereafter called fragment 2 - containing the origin of replication, was purified.

Fragment 3 was then prepared; this is a synthetic BamHI(1)-BamHI(2) fragment containing the lac i gene and its promoter and it has the following sequence, in which the two ends of the strand are identified by the numbers 1 and 2 in order to specify the orientation of the fragment in the plasmids described in Figures 6 and 7: - 37 FRAGMENT 3 BamHI(1) 5' GATCC GCGGAAGCAT AAAGTGTAAA GCCTGGGGTG CCTAATGAGT GAGCTAACTT ACATTAATTG CGTTGCGCTC ACTGCCCGCT TTCCAGTCGG GAAACCTGTC GTGCCAGCTG CATTAATGAA TCGGCCAACG CGCGGGGAGA GGCGGTTTGC GTATTGGGCG CCAGGGTGGT TTTTCTTTTC ACCAGTGAGA CGGGCAACAG CTGATTGCCC TTCACCGCCT GGCCCTGAGA GAGTTGCAGC AAGCGGTCCA CGCTGGTTTG CCCCACCACC CGAAAATCCT GTTTGATGGT GGTTAACGGC GGGATATAAC ATGAGCTGTC TTCGGTATCG TCGTATCCCA CTACCGAGAT ATCCGCACCA ACGCGCAGCC CGGACTCGGT AATGGCGCGC ATTGCGCCCA GCGCCATCTG ATCGTTGGCA ACCAGCATCG CAGTGGGAAC GATGCCCTCA TTCAGCATTT GCATGGTTTG TTGAAAACCG GACATGGCAC TCCAGTCGCC TTCCCGTTCC GCTATCGGCT GAATTTGATT GCGAGTGAGA TATTTATGCC AGCCAGCCAG ACGCAGACGC GCCGAGACAG AACTTAATGG GCCCGCTAAC AGCGCGATTT GCTGGTGACC CAATGCGACC AGATGCTCCA CGCCCAGTCG CGTACCGTCT TCATGGGAGA AAATAATACT .GTTGATGGGT GTCTGGTCAG AGACATCAAG AAATAACGCC GGAACATTAG TGCAGGCAGC TTCCACAGCA ATGGCATCCT GGTCATCCAG CGGATAGTTA ATGATCAGCC CACTGACGCG TTGCGCGAGA AGATTGTGCA CCGCCGCTTT ACAGGCTTCG ACGCCGCTTC GTTCTACCAT CGACACCACC ACGCTGGCAC CCAGTTGATC GGCGCGAGAT TTAATCGCCG CGACAATTTG CGACGGCGCG TGCAGGGCCA GACTGGAGGT GGCAACGCCA ATCAGCAACG ACTGTTTGCC CGCCAGTTGT TGTGCCACGC GGTTGGGAAT GTAATTCAGC TCCGCCATCG CCGCTTCCAC TTTTTCCCGC GTTTTCGCAG AAACGTGGCT GGCCTGGTTC ACCACGCGGG AAACGGTCTG ATAACAGACA CCGGCATACT CTGCGACATC GTATAACGTT ACTGGTTTCA CATTCACCAC CCTGAATTGA CTCTCTTCCG GGCGCTATCA TGCCATACCG CGAAAGGTTT TGCGCCATTC GATGGTGTCC G BamHI(2) Fragments 1, 2 and 3 were then ligated to give plasmid pl60, shown in Figure 6.

This plasmid was partially digested with the restriction enzymes Hindi and Pstl. The large Hindi30 - 38 Pstl fragment, containing the origin of replication and shown in Figure 6, was then ligated with fragment 4, shown below, which is a synthetic DNA fragment carrying a sequence coding for the first 44 amino acids of a natural precursor of hGH and, upstream from this sequence, regulatory signals. - 39 FRAGMENT 4 Clal v ' TCGAGCTGACTGACCTGTTGCTTATATTACATCGA ----------------------------------AGCTCGACTGACTGGACAACGAATATAATGTAGCT Δ Ndel ▼ TAGCGTATAATGTGTGGAATTGTGAGCGATAACAATrTCACACAGTTTAACTTTAAGAAGGAGATATACAT ATCGATAHACACACCHAACACTCGCCTAHGHAAAGTGTGTCAAAnGAAAHCHCCTCTATATGTA ATG GCT ACC GGA TCC CGG ACT AGT CTG CTC CTG GCT TH GGC CTG CTC TGC CTG TAC A M -26 CCC CGA TGG CCT AGG GCC TGA TCA GAC GAG GAC CGA AAA CCG GAC GAC ACG GAC A TGG T CH G CAA S GAG R GGC T AGT S GCC L TTC L CCA L ACC A ATT F CCC G HA L Xbal T TCT L r AGA C CH L TH 20 GGG ACC GAA GTT CTC CCG TCA CGG AAG GGT TGG TAA GGG AAT AGA TCT ι GAA AAA P W L Q E G S A F P T I P L S R4 L F -1 1 25 GAC AAC GCT ATG CTC CGC GCC CAT CGT CTG CAC CAG CTG GCC TH GAC ACC TAC CTG HG CGA TAC GAG GCG CGG GTA GCA GAC GTG GTC GAC CGG AAA CTG TGG ATC D N A M L R A H R L H Q L A F L T Y Pstl CAG GAG TH GAA GAA GCC TAT ATC CCA AAG GAA CAG AAG TAT TCA HC CTG CA GTC CTC AAA CH CH CGG ATA TAG GGT HC CH GTC TTC ATA AGT AAG G qefeeayipkeqkysf - 40 In this fragment, the amino acids are designated by letters according to the following code: A - Alanine C - Cysteine D = Aspartic acid E = Glutamic acid F = Phenylalanine G - Glycine H = Histidine I = Isoleucine K - Lysine L = Leucine M = Methionine N = Asparagine P = Proline Q = Glutamine R = Arginine S = Serine T = Threonine V = Valine W = Tryptophan Y = Tyrosine The sequences -35 (TTGCTT) and -10 (TATAAT) of the promoter sequence, and the Shine-Dalgarno sequence well known to those skilled in the art, are successively underlined in this fragment.

Plasmid p380,l was obtained in this way.

Plasmid p380,l was then digested with the restriction enzymes Clal and Ndel so as to remove therefrom the small Clal-Ndel fragment of fragment 4 above and to replace it with the Clal-Ndel fragment below: CLaI ' CGATAGCGTATAATGTGTGGAATTGTGAGCGGATAACA TATCGCATATTACACACCTTAACACTCGCCTATTGT Ndel ATTTCACACAGTTTTTCGCGAAGAAGGAGATATACA OU ’ TAAAGTGTGTCAAAAAGCGCTTCTTCCTCTATATGTAT 5' The resulting plasmid is plasmid p373,2 (Figure 7). - 41 2) Construction of plasmid p466 Plasmid p373,2 was subjected to a double digestion with the enzymes Bglll and Hindlll. The large fragment derived from this digestion was purified and ligated with a synthetic DNA fragment whose sequence, given below, is intended to reconstitute the end of the hGH gene, followed at the 3' end by the Kpnl and SnaBI cloning sites. - 42 05 Β I I I GATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGAT ----+---------+-------——-------+ AAGTTCGTCTGGATGTCGTTCAAGCTGTGTTTGAGTGTGTTGCTA GACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTC ---------+---------+---------+---------+---------+---------+ CTGCGTGATGAGTTCTTGATGCCCGACGAGATGACGAAGTCCTTCCTGTACCTGTTCCAG F s P I GAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGTAA ---------+---------+---------+---------+---------+---------+ CTCTGTAAGGACGCGTAGCACGTCACGGCGAGACACCTCCCGTCGACACCGAAGATCATT H i S n K n d p a I n BI I I _I_ GGTACCCTGCCCTACGTACCA ---------+---------+----CCATGGGACGGGATGCATGGTTCGA This fragment comprises the Bglll and Hindlll sticky ends. The novel plasmid formed in this way, p462 (cf. Figure 8), thus comprises a Kpnl site and an Ndel - 43 site, which will be used for cloning the fragment containing urate oxidase cDNA in the expression vector.

The hybrid plasmid derived from pT219R, carrying urate oxidase cDNA of about 1.2 kb (clone 9C) (see Example 3), comprises a unique Kpnl site. This site is located a few base pairs downstream from the cDNA cloning site. Furthermore, urate oxidase cDNA contains an AccI site situated near the 5' end.

The Accl-Kpnl fragment, comprising the greater part of this cDNA, was therefore isolated and purified.

Two complementary oligonucleotides were also synthesized, whose sequence, given below: ' -TATGTCTGCGGTAAAAGCAGCGCGCTACGGCAAGGACAATGTTCGCGT 15 ACAGACGCCATTTTCGTCGCGCGATGCCGTTCCTGTTACAAGCGCAGA-5' is intended to reconstitute the 5' end of the cDNA. This synthetic fragment obtained in this way has an Ndel end and another AccII end. The fragment and the synthetic sequence were ligated with the expression vector cut by Kpnl and by Ndel. This three-fragment ligation makes it possible to obtain the expression vector, called p466, for E. coli urate oxidase (cf. Figure 9). This plasmid was subjected to a series of enzymatic hydrolyses with restriction enzymes, which made it possible to verify the presence of the expected restriction sites, in particular those carried by the gene coding for urate oxidase.

Plasmid p466 therefore contains, by construction, a gene coding for urate oxidase, having the following sequence: - 44 05 ATGTC_TGCGG CAAGGTTCAC CCGTCTGTGT GACAACAGCG CACCGCCAAG TGGGCACACA AACATTGTCT CCCTCACTCC ACGTGGTCGA ACCGTGCTGA GTACACCACA ATGCCACTTG CACGTGCCTA GAAGACTTTT AGATGGCAGA TACTCGTTGC GGGCCTCCAA ACCCCAACGG AAATTG.

TAAAAGCAGC AAGGACGAGA GCTTCTGGAG TCATTGTCGC CAGAACCCCG CTTCATTGAG GCCACCGCTG TTCATCCGCG GGGCAAGGGC AGAGCACCAA CTTAAGGAGA GCAGTGGAAG AGTTCGATGC GCTGAAGATA GCAAATCCTG CTAACAAGCA AACACCGGCA TCTGATCAAG GCGCTACGGC AGACCGGTGT GGTGAGATTG AACCGACTCC TTACTCCTCC AAGTACAACC GACCCGGATG ACAGCGAGGA ATCGATATCA CTCGCAGTTC CCTGGGACCG AATTTCAGTG TACCTGGGCC ACAGTGCCAG GCGCGCCAGC CTATTTCGAA AGAACGCCGA TGTACCGTCG AAGGACAATG CCAGACGGTG AGACCTCTTA ATTAAGAACA CGAGCTGTTC ACATCCATGC GACATTGACG GAAGCGGAAT AGTCGTCTCT TGGGGCTTCC TATCCTGAGC GACTCCAGGA ACTGCTCGCG CGTGCAGGCC AGCTGATCGA ATCGACCTGA GGTCTTCGCT GCCGGTCCTC TTCGCGTCTA TACGAGATGA CACCAAGGCC CCATTTACAT GGCTCCATCC CGCTCACGTC GCAAGCCACA GTGCAGGTGG GTCCGGCCTG TGCGTGACGA ACCGACGTCG GGTCCGCTCG AGGTCACTCT ACTATGTACA GACTGTCGAG GCTGGCACAA CCTCAGTCGG TCTGAAGTCT (The nucleotides which are different from the nucleotides of the cDNA isolated from A. flavus are underlined in the above sequence. These differences were introduced into the synthetic Accl-Kpnl fragment so as to have, downstream from the ATG, a nucleotide sequence corresponding more closely to those normally encountered in a prokaryotic gene.) EXAMPLE 8: Expression of urate oxidase cDNA The E. coli K12 RR1 strain (Bethesda Research Lab. Inc.) was transformed for ampicillin resistance with plasmid p466 and with a negative control plasmid, pBR322. Ampicillin-resistant colonies were obtained in both cases. 1 colony of each type was cultured in a medium (LB + ampicillin 100 pg/ml). After one night at 37’C, with agitation, the two cultures were diluted 100-fold in - 45 the medium (LB + ampicillin 100 pg/ml). After culture for 1 h, IPTG (isopropyl-B-D-thiogalactoside) 1 mM is added for 3 h.

Immunodetection of the urate oxidase by Western blot 05 1) Procedure An aliquot corresponding to 0.2 ml at OD = 1 is taken from the culture medium obtained after induction with IPTG for 3 h. This aliquot is centrifuged and the supernatant is removed. The residue is then subjected to a Western blot - a technique well known to those skilled in the art - which comprises the following steps: - solubilization of the residue by boiling for 10 min in a buffer, called a loading buffer, consisting of Tris-HCl 0.125 M pH 6.8, SDS 4%, bromophenol blue 0.002%, glycerol %, {3-mercaptoethanol 10% (according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685)); - electrophoretic separation of the different proteins contained in the solubilizate, according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685); and - transfer of said proteins contained in the gel on to a nitrocellulose filter (according to the technique of H. TOWBIN et al., Proc. Natl. Acad. Sci. USA (1979) 435025 4354).

Immunodetection, performed according to the technique of BURNETTE (W.W. BURNETTE, Ana. Biochem. 112 (1981) 195203), involves the following successive operations: rinsing the nitrocellulose filter for 10 min with a buffer A (Tris-HCl 10 mM, NaCl 170 mM, KC1 1 mM); bringing the nitrocellulose filter into contact with a buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml) for 30 min at 37’C; • bringing the nitrocellulose filter into contact with an immune serum (polyclonal antibodies recognizing A. 'es°2sss - 46 flavus urate oxidase) for 1 h at 37°C; • rinsing the nitrocellulose filter with buffer B; • bringing the nitrocellulose filter into contact with a solution of protein G, labeled with iodine 125 at a rate of 0.1 microcurie/ml, for 1 h at 37°0; • rinsing the filter with buffer A; drying the filter between two absorbent sheets; bringing the filter into contact with an X-ray film; and developing the film. 2) Results It is found that the strain transformed by plasmid p466 overproduces a protein with an apparent molecular weight of about 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase and which is absent from the control strain.

EXAMPLE 9: Assay of the urate oxidase activity An aliquot corresponding to the equivalent of 0.5 ml at OD = 1 is taken from the culture medium obtained after induction with IPTG for 3 h under the culture conditions described in the previous Example. This aliquot is centrifuged and the supernatant is removed. The residues are taken up in 1 ml of TEA (triethanolamine) buffer 0.05 M pH 8.9. The cell suspension is sonicated twice for 30 s in ice with a W10 ultrasonic sonicator (set to strength 8 and intensity 4). The extracts are centrifuged at 10,000 g for 10 min and the supernatants are used for the assay.

The above operations are carried out for four colonies taken at random from E. coli K12 transformed by plasmid p466 (colonies Ai, Bi, Ci and Di) and one colony transformed by plasmid pBR322. 1) Principle The conversion of uric acid to allantoin is followed by the decrease in absorbance at 292 nm. The - 47 reaction is as follows: Uric acid (absorbs at 292 nm) Allantoin 2) Reagents a) TEA 0.05 M pH 8.9/EDTA buffer - 7.5 g of TEA (reagent for analysis - Prolabo ref. 287.46.266) are dissolved in 400 ml of distilled water; - 0.372 g of Complexon III (Merck - ref. 8418) is dissolved in 50 ml of distilled water; - the two solutions are combined and made up to 500 ml (solution 1); - the pH of this solution is adjusted to 8.9 with HCl 0.2 N; and - the volume is made up to 1000 ml with distilled water (solution 2). b) Uric acid stock solution - 100 mg of uric acid (Carbiochem - ref. 6671) are dissolved in 50 ml of solution 1; - the pH is adjusted to 8.9 with HCl 0.2 N; and - the volume is made up to 100 ml with distilled water.

The solution obtained can be stored for one week at 4°C. c) Uric acid substrate solution - 1.5 ml of uric acid stock solution (Carbiochem - ref. 6671) are taken and diluted to 100 ml with TEA buffer (reagent for analysis - Prolabo ref. 287.46.266).

This solution must be used the same day. - 48 3) Procedure The following volumes are introduced into the quartz cell of a spectrophotometer set to 292 nm and thermostated at 30°C: - 600 μΐ of uric acid substrate solution (preheated to °C) and - 100 μΐ of the above supernatants to which 200 μΐ of TEA pH 8.9 have been added (preheated to 30°C).

After mixing, the change in optical density is 10 read off every 30 s for 5 min. ΔΕ, the variation in optical density per minute, is deduced from these readings. 4) Results The urate oxidase enzymatic activity A, expressed 15 in U/ml OD 1, is calculated from the ΔΕ measurement with the aid of the formula A = ΔΕ x Vr x d ει χ vpE in which the symbols Vr, d, εΐ and Vph respectively represent the reaction volume (0.9 ml), the dilution factor (2), the extinction coefficient of uric acid at 292 nm (12.5) and the volume of the test sample (0.3 ml).

The results obtained are collated in Table II below: - 49 TABLE II E. coli K12 strain Urate oxidase activity transformed by (U/ml OD 1) PBR322 < 0.001 colony Ai 0.086 colony Bi 0.119 p466 colony Ci 0.135 colony Di 0.118 The above Table clearly shows that the E. coli cells transformed by plasmid p466 are capable of producing urate oxidase activity in the presence of IPTG. EXAMPLE 10: Construction of three expression vectors for urate oxidase cDNA in veast: plasmids pEMR469. -PEMR473 and r>EMR515 The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK in Molecular Cloning, a laboratory manual (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer.

The following description will be understood more clearly with reference to Figures 10, 11 and 12, which respectively show restriction maps of plasmids pEMR414, pEMR469 and pEMR473. The symbols used in these Figures will be specified in the description below. In the case where a site has been blunted by Klenow polymerase, it carries the index ; where the sites have been eliminated by ligation, they are indicated in brackets. 1) Construction of plasmid. .pEMR469 This plasmid was constructed from the shuttle vector E. coli-veast pEMR414, constructed by successive ligations of the following components: - the Pstl-Hindlll° fragment - symbolized by 4-+++ in Figure 10 - of plasmid pJDB207 (BEGGS, 1978: Gene cloning in yeast - p. 175-203 in: Genetic Engineering, vol. 2 - WILLIAMSON - Academic Press - London UK) comprising the upstream part of the ampicillin resistance gene AmpR of pBR322 (Sutcliffe, 1979, Cold Spring Symp. Quart. Biol. 43, 779) and an endogenous 2p fragment, B form, carrying the LEU2 gene of S. cerevisiae partially modified by the deletion of its promoter (called LEU2d), the locus STB (REP3) and the origin of replication of the 2μ fragment (HARTLEY and DONELSON, 1980, Nature, 286, 860-865). The HindiII end of this fragment has been blunted by the action of Kienow polymerase. It is denoted by Hindi11° in Figure 10. - the HindiII-Smal fragment - represented by Ilf' in Figure 10 - of chromosome V of yeast containing the URA3 gene with its promoter (ROSE et al., 1984, Gene, 29, p. 113-124). This Hindlll-Smal fragment originates from plasmid pFLl (CHEVALLIER et al., 1980, Gene 11, 11-19). The HindiII end of this plasmid has been blunted by the action of Kienow polymerase. - an Sami-BamHI fragment - symbolized by _ in Figure 10 - containing a synthetic version of the promoter of the ADH2 gene which differs from the natural version described by RUSSEL and SMITH (RUSSEL et al. (1983) J. Biol. Chem. 258, 2674-2682) only by a few base pairs intended for introducing restriction sites. (The natural sequence could be used with only slightly different results.) The sequence of this fragment is given below: - 51 S M π 1 a u I I *GGGACGCGT CT CCTC T GCCGGAACACCGGGC ATC T CC AAC T T AT AAGT TGGAG -------4---------4 ---------4---------4-------------CCCTGCGCAGAGGAGACGGCC T 7 GT GGCCCGT AG AGGT T GAAT AT IC AACCTC AAATAAGAGAATTTCAGATTGAGAGAATGAAAAAAAAAAAAAAAAAAAAGGCAGAGGAGA -------------*---------*---------♦---------♦---------4---:--10 7TTftTTCTCTTAAAGTCTAACTCTCT7ACTTT7TTT7 TTTTTTTTTTTTCCGTCTCCTCT S P h.

I GCATAGAAATGGGGTTCACTTTTTGGTAAAGCTATAGCATGCCTATCACATATAAATAGA ---4--------------------------------------------------------CGT ATCT T T ACCCCAAGTG AAAAACCAT T TCGAT ATCGT ACGGAT AG TGT AT AT T T ATCT GTGCCAGT AGCGACT T T 7 T TCACACT CGAGAT ACTCT T AC T ACTGC TC T CT TGT T GT T TT ---4---------4--------------------+-------------------4-----CACGGTCATCGCTGAAAAAAGTGTGAGCTCTATGAGAATGATGACGAGAGAACAACAAAA T ATCACT TCTTGTTTCT TCT TGGT AAAT AGAAT ATCAAGCT ACAAAAAGCAT ACAATCAA ---4---------4---------4---------4---------♦---------------AT AGT GAAGAACAAAGAAG AACCAT T TATCT T AT AGT TCGAT GT TI T TCGT ATGT T AGTT B CTATCAACTATTAACTATATCGATACCATATGGATCCGTCGACTCTAGAgTGATCGTC ---4---------4---------♦-----------------------------4--GATAGTTGATAATTGATATAGCTATGGTATACCTAGGCAGCTGAGATCTCCTAGCAG B a rn H GACTCTAGAGv — -----4CTGAGATCTCCTAG - 52 - the Bglll-HindiII fragment - symbolized by in Figure 10 - carrying the 3' end of the yeast PGK gene. This fragment originates from complete digestion with Bglll of the Hindlll fragment of the yeast chromosomal DNA, carrying the PGK gene described by HITZEMAN et al. (1982, Nucleic Acids Res., 10, 77917808), which has only one Bglll site. This digestion makes it possible to obtain two Hindlll-Bglll fragments of which the smaller, of about 0.4 kb, which carries the 3' end of the yeast PGK gene, is retained. The sequence of the latter fragment is described by HITZEMANN et al. (op. cit.). The Bglll site is cloned in the BamHI site of the previous fragment (the BamHI and Bglll sites therefore disappearing), and the Hindlll site, blunted by the action of Klenow polymerase, is cloned in the PvulI site of the PvuII-Pstl fragment of pBR322, described below. - the PvuII-Pstl fragment - symbolized by xxx in Figure 10 - of pBR322, containing the origin of replica20 tion and the downstream part of the ampicillin resistance gene AmpR.

Plasmid pEMR414 formed in this way therefore contains the following components: - an origin of replication and an ampicillin resistance gene AmpR permitting the replication and selection of the plasmid in E. coli cells. These components permit transformation in E. coli cells. - an origin of replication for the yeast (ARS), the locus STB and the LEU2 gene of S. cerevisiae without promoter and the URA3 gene of S. cerevisiae with its promoter. These components permit the replication and selection of the plasmid in S. cerevisiae cells and a sufficient partition efficacy in cells containing the endogenous 2μ plasmid.

Plasmid pEMR414 was completely digested with the restriction enzymes Nhel and Clal. The small Nhel-Clal fragment containing the URA3 gene, hereafter called fragment A, was purified.

Plasmid pEMR414 was completely digested with the enzymes Nhel and BamHl. The large Nhel-BamHI fragment containing especially the LEU2d gene and the origin of replication of plasmid pBR322, hereafter called fragment B, was purified.

The synthetic Clal-AccI fragment, containing the start of a gene coding for the protein deduced from the urate oxidase cDNA sequence (clone 9C), was also prepared. This fragment contains modifications, relative to clone 9C, introduced for the purpose of inserting codons which are customary in yeast (q.v. SHARP et al., 1986, Nucl. Ac. Res., vol. 14, 13, pp. 5125-5143) without changing the amino acids coded for. The sequence of this fragment, hereafter called fragment C, is as follows (the underlined nucleotides are those modified relative to clone 9C): I I T CGATATACACAATGTCTGCTGTTAAGGCTGCTAGATACGGTAAGGACAACGTTAGAGT ---+---------+---------+---------+---------+---------+---TATATGTGTTACAGACGACAATTCCGACGATCTATGCCATTCCTGTTGCAATCTCAGA The plasmid of clone 9C (cf. Figure 3) was digested with the enzymes AccI and BamHl. The AccI-BamHI fragment, which contains the end of urate oxidase cDNA, hereafter called fragment D, was purified. This fragment has the following sequence: - 54 05 Accl T C7ACAAGG77CACAAGGACGAGAAG --+---------+--—-----+ [TG77CCAAG7G77CC7GCTC77C ACCGG7G7CCAGACGG7GTACGAGATGACC G7C7G7G7GC77CTGGAGGGTGAGA77GAG --------- + -- ------- + -- -- -- -- -+ --------- + -- -- -- -- - + - — - — ___ + 7GGCCACAGG7C7GCCACATGC7C7AC7GG CAGACACACGAAGACC7CCCAC7CTAAC7C ACCTCTTACACCAAGGCCGACAACAGCGTC AT7GTCGCAACCGACTCCATTAAGAACACC ---------+---------+---------+---------+---------+---------+ 7GGAGAA7G7GG7TCCGGC7G7TG7CGCAG TAACAGCGT7GGCTGAGGTAATTCTTGTGG A777ACA7CACCGCCAAGCAGAACCCCGTT ACTCCTCCCGAGCTGTTCGGCTCCATCCTG ---------+---------+---------+---------+---------+---------+ TAAATGTAGTGGCGGTTCGTCTTGGGGCAA 7GAGGAGGGC7CGACAAGCCGAGGTAGGAC GGCACACAC77CAT7GAGAAG7ACAACCAC A7CCATGCCGCTCACG7CAACATTGTC7GC ---------+---------+---------+---------+---------+---------+ CCG7GTGTGAAG7AAC7C77CA7G77GGTG TAGGTACGGCGAGTGCAGTTGTAACAGACG CACCGCTGGACCCGGATGGACATTGACGGC AAGCCACACCCTCACTCCTTCATCCGCGAC ---------+---------+---------+---------+---------+---------+ GTGGCGACCTGGGCCTACCTGTAACTGCCG TTCGGTGTGGGAGTGAGGAAGTAGGCGCTG AGCGAGGAGAAGCGGAATGTGCAGGTGGAC GTGGTCGAGGGCAAGGGCATCGATATCAAG ---------+---------+---------+---------+---------+---------+ TCGCTCCTCTTCGCCTTACACGTCCACCTG CACCAGCTCCCGTTCCCGTAGCTATAGTTC TCGTCTCTGTCCGGCCTGACCGTGCTGAAG AGCACCAACTCGCAGTTCTGGGGCTTCCTG ---------+---------+---------+---------+---------+---------+ AGCAGAGACAGGCCGGACTGGCACGACTTC TCGTGGTTGAGCGTCAAGACCCCGAAGGAC CGTGACGAGTACACCACACTTAAGGAGACC TGGGACCGTATCCTGAGCACCGACGTCGAT ---------+---------+---------+---------+---------+---------+ GCACTGCTCATGTGGTGTGAATTCCTCTGG ACCCTGGCATAGGACTCGTGGCTGCAGCTA GCCACTTGGCAGTGGAAGAATTTCAGTGGA CTCCAGGAGGTCCGCTCGCACGTGCCTAAG ---------+---------+---------+---------+---------+---------+ CGGTGAACCGTCACCTTCTTAAAGTCACCT GAGGTCCTCCAGGCGAGCGTGCACGGATTC TTCGATGCTACCTGGGCCACTGCTCGCGAG GTCACTCTGAAGACTTTTGCTGAAGATAAC --- + _____ ---------+---------+-- μ AAGCTACGATGGACCCGGTGACGAGCGCTC CAGTGAGACTTCTGAAAACGACTTCTATTG AGTGCCAGCGTGCAGGCCACTATGTACAAG ATGGCAGAGCAAATCCTGGCGCGCCAGCAG ---------+---------+---------+---------+---------+---------+ TCACGGTCGCACGTCCGGTGATACATGTTC TACCGTCTCGTTTAGGACCGCGCGGTCGTC CTGATCGAGACTGTCGAGTACTCGTTGCCT aacaagcactatttcgaaatcgacctgagc -----------------------------+---------+---------+---------+ gactagctctgacagctcatgaccaacgga ttgttcgtgataaagctttagctggactcg TGGCACAAGGGCCTCCAAAACACCGGCAAG AACGCCGAGGTCTTCGCTCCTCAGTCGGAC ACCGTGTTCCCGGAGGTTTTGTGGCCGTTC TTGCGGCTCCAGAAGCGAGGAGTCAGCCTG CCCAACGGTCTGATCAAGTGTACCGTCGGC CGGTCCTCTCTGAAGTCTAAATTGTAAACC ---------+---------+---------+---------+---------+---------+ GGGTTGCCAGACTAGTTCACATGGCAGCCG GCCAGGAGAGACTTCAGATTTAACATTTGG AACATGATTCTCACGTTCCGGAGTTTCCAA GGCAAACTGTATATAGTCTGGGATAGGGTA ---------+---------+---------+---------+---------+---------+ TTGTACTAAGAGTGCAAGGCCTCAAAGGTT CCGTTTGACATATATCAGACCCTATCCCAT 7AGCA7TCA77CAC7TG7777TTAC77CCA ΑΑΑΑΛΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑΑ ---------+---------+---------+---------+---------+---------+ ATCGTAAGTAAGTGAACAAAAAATGAAGGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT r~ _ AAAAAAAAAAAAAAAAAAAAAGGGCCCG* SomHI TTTTTTTTTTTTTTTTTTTTTCCCGGGCCT AG I - 55 Fragments A, B, C and D were ligated to give plasmid pEMR469 shown in Figure 11, in which the symbols have the same meanings as in Figure 10, the novel ClalAccI and AccI-BamHI fragments being symbolized by j>;.·.·.'·.·[ . 2) Construction of plasmid pEMR473 Plasmid pEMR469 was completely digested with the enzymes Mlul and SphI. The large MluI-SphI fragment, containing the urate oxidase gene, was then ligated with the synthetic fragment, whose sequence is given below, corresponding to a part (200 bp) of the sequence upstream from the TATA component of promoter GAL7 of S*. cerevisiae. said part comprising the upstream activation sequences (UAS).

M ι u I CGCGTCT AT ACT TCGGAGCAC TG T TGAGCGAAGGC TC AT T AGATATAT T TTCTGTCAT ♦ - _ - ........ — ....... ------------------- AGATATGAAGCCTCGTGACAACTCGCTTCCGAGTAATCTATATAAAAGACAGTA TTTCCTTAACCCAAAAATAAGGGAGAGGGTCCAAAAAGCGCTCGGACAACTGTTGACCGT AAAGGAAT TGGGT T T T TAT TCCCTCTCCCAGGT T T T TCGCGAGCC TGT TGACAACTGGCA GATCCGAAGGACTGGCTATACAGTGTTCACAAAATAGCCAAGCTGAAAATAATGTGTAGC CTAGGCTTCCTGACCGATATGTCACAAGTGTTTTATCGGTTCGACTTTTATTACACATCG • s P h I CTTTAGCTATGTTCAGTTAGTTTGGCATG· GAAATCGATACAAGTCAATCAAACC* Plasmid pEMR473 obtained in this way is shown in Figure 12, in which the symbols have the same meanings as in Figure 11, the novel MluI-SphI fragment introduced being symbolized by UgS/S - 56 3) Construction of plasmid pEMR515 Plasmid pEMR473 was partially digested with the enzyme Xbal and totally digested with the enzyme Mlul.

The large Xbal-Mlul fragment was purified. This fragment contains especially the sequences of the origin of replication and the locus STB of the 2μ fragment, the LEU2d gene, the ampicillin resistance gene Amp11, the origin of replication of pBR322 and the expression cassette for urate oxidase. On the other hand, it contains neither the URA3 gene nor that part of the 2μ fragment which is between the Xbal and Nhel sites.

The large Xbal-Mlul fragment was recircularized via the following sequence adapter containing Mlul and modified Xbal sticky ends: modified Xbal ΪCTAGGCTAGCGGGCCCGCATGCA CGATCGCCCGGGCGTACGTGCGC.

A Mlul Plasmid pEMR515 obtained in this way has only one of the three components of the target FRT site of the recombinase coded for by the FLP gene of the 2μ fragment.

Plasmids pEMR469, pEMR473 and pEMR515 possess the 25 gene coding for urate oxidase, which has the following sequence: ATGTCTGCTG CAAGGTTCAC CCGTCTGTGT TTAAGGCTGC AAGGACGAGA GCTTCTGGAG TAGATACGGT AGACCGGTGT GGTGAGATTG AAGGACAACG CCAGACGGTG AGACCTCTTA TTAGAGTCTA TACGAGATGA CACCAAGGCC 05 GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG 10 ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT 15 GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG 20 ACCCCAACGG AAATTG. TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT EXAMPLE 11: Transformation of the_EMY761 yeast strain bv plasmids pEMR469. pEMR473 and pEMR515 25 Transformation of the EMY500 and GRF18 yeast Strains bv plasmid pEMR515 - Transformation with selection either for the prototrophv of uracil or for the prototrophv of leucine Three non-isogenic strains of Saccharomyces 30 cerevisiae were used as recipient strains: - the EMY761 strain (Mata, leu2, ura3, his3, gal) - the EMY500 strain (Mata, leu2, ura3, pep4) - the GRF18 strain (Mata, leu2, his3) The GRF18 strain is well known to those skilled 35 in the art (Gerry FINK, MIT, USA). The EMY761 and EMY500 - 58 strains are related to the GRF1B strain. They were obtained by successively crossing the GRF18 strain with a ura3 strain derived from the FL100 strain (deposited in the ATCC under n° 28 383) and with the 20B12 strain (Mata, tspl, pep4) described by E.W. JONES (E.W. JONES et al. (1977) Genetics, 85, 23).

The GRF18 strain can be obtained by curing plasmid pEMR515 of the GRF18 pEMR515 (leu-1·) strain deposited in the CNCM under reference η’ 1-920 on 28 December 1989, and the EMY500 strain can be obtained by curing plasmid pEMR515 of the EMY500 pEMR515 (leu·*·) strain deposited in the CNCM under reference n° 1-919 on 28 December 1989.

These strains contain mutations (leu2 and ura3~) capable of being complemented by the LEU2d defective selection marker and the URA3 selection marker, which are present in each of plasmids pEMR469 and pEMR473. 1) Transformation with selection for the prototrophv. of uracil A colony of the EMY761 strain was used to inoculate 100 ml of a medium called liquid YPG medium (cf. Table III below). When the cell density had reached 107 cells per ml, the cells were treated with lithium acetate 0.2 M for transformation by a technique well known to those skilled in the art and described by ITO et al. (ITO et al., 1983, J. Bacteriology 153, 163-168).

The EMY761 cells were transformed in parallel with about 1 pg of each of plasmids pEMR469 and pEMR473. The transformed cells are selected for the auxotrophic character of uracil (ura*) on a medium called uracil-free solid medium (cf. Table III below). An EMY761 pEMR469 (ura-*-) transformed strain and an EMY761 pEMR473 (ura*) transformed strain were thus retained. - 59 2) Transformation with selection for the prototrophy of leucine The transformation technique used is a variant of that described by Beggs et al. (Beggs et al. (1978) Nature 275, 104-109). It consists in subjecting yeasts to a protoplastization treatment in the presence of an osmotic stabilizer, namely sorbitol at a concentration of 1 M.

The precise transformation protocol is specified below: a) 200 ml of liquid YPG medium (cf. Table III) are inoculated with about 5 x 106 cells of a culture in the stationary phase, and the culture inoculated in this way is agitated overnight at 30°C. b) When the density of the culture reaches about 107 cells per ml, the cells are centrifuged at 4000 rpm for 5 min and the residue is washed with sorbitol 1 M. c) The cells are suspended in 5 ml of sorbitol solution 1 M containing 25 mM EDTA and 50 mM dithio20 threitol, and are incubated for 10 min at 30°C. d) The cells are washed once with 10 ml of sorbitol 1 M and suspended in 20 ml of sorbitol. Zymolyase-100T (a preparation obtained by partial purification of Arthobacter luteus culture supernatant on an affinity column and containing β-l,3-glucan laminaripentahydrolase, marketed by SEYKAGAKU KOGYO Co. Ltd.) is added up to a final concentration of 20 yg/ml and the suspension is incubated at room temperature for about 15 min. e) The cells are resuspended in 20 ml of a medium containing sorbitol, called sorbitol YPG medium (cf.

Table III below) and incubated for 20 min at 30°C, with gentle agitation. f) The cells are centrifuged for 3 min at 2500 rpm. g) The cells are resuspended in 9 ml of transIE 902559 - 60 formation buffer (sorbitol 1 M, Tri3-HCl 10 mM pH 7.5 and CaCla 10 mM). h) 0.1 ml of cells and 5 μΐ of DNA solution (about 5 pg) are added and the suspension obtained is □5 left for 10 to 15 min at room temperature. i) 1 ml of the following solution is added: polyethylene glycol PEG 4000 20%, Tris-HCl 10 mM pH 7.5 and CaCl2 10 mM. j) 0.1 ml of the suspension obtained in i) is 10 poured into a tube containing leucine-free solid regeneration medium (cf. Table III below) which has been melted beforehand and kept liquid at about 45°C. The suspension is poured into a Petri dish containing a solidified layer of 15 ml of leucine-free solid re15 generation medium. k) Step j) is repeated with the remainder of the cell suspension obtained in i ) .

The transformed strains start to appear after three days.

The EMY761 pEMR469 (leu*), EMY761 pEMR473 (leu*), EMY761 pEMR515 (leu*), GRF18 pEMR515 (leu*) and EMY500 pEMR515 (leu*) transformed strains were thus retained.

TABLE III 25 Principal media used in Examples 11. 12. 13 and 14 - uracil-free solid medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) .0 g of casein hydrolyzate (Casamino acids from DIFCO) 30 10 g of glucose g of agar Mix all the ingredients in distilled water and make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120oC. - uracil-free liquid medium Use the formulation of the uracil-free solid medium without the agar. Autoclave for 15 min at 120°C. - 61 leucine-free solid medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) mg of adenine 20 mg of uracil 20 mg of 1-tryptophan 20 mg of 1-histidine 20 mg of 1-arginine 20 mg of 1-methionine 30 mg of 1-tyrosine 30 mg of 1-isoleucine 30 mg of 1-lysine 50 mg of 1-phenylalanine 100 mg of 1-glutamic acid 150 mg of 1-valine 400 mg of 1-leucine g of glucose g of agar Mix all the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120°C. After autoclaving, add 200 mg of 1-threonine and 100 mg of 1-aspartic acid. - leucioe-fr.ee.. solid regeneration medium Use the formulation of the leucine-free solid medium, mixing in 30 g of agar instead of 20 g and adding 182 g of sorbitol to the mixture. - leucine-free liquid medium Use the formulation of the leucine-free solid medium without the agar. Autoclave for 15 min at 120’C.

After autoclaving, add 200 mg of 1-threonine and 100 mg of 1-aspartic acid. - liquid YP ..me dium g of yeast extract (Bacto-yeast extract from DIFCO) 25 20 g of peptone (Bacto-peptone from DIFCO) Mix the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120°C. - liquid YPG medium Use the formulation of the liquid YP medium, adding, after autoclaving, glucose at a concentration of 20 g/1. - sorbitol YPG medium Use the formulation of the liquid YPG medium, adding, after autoclaving, sorbitol at a concentration of 1 M. - 62 - ethanol-glycerol YP medium Use the formulation of the liquid YP medium. After autoclaving, add 10 ml of ethanol 100% (1% final concentration) and 30 g of glycerol. - ethanol-glycerol-galactose YP medium 05 Use the formulation of the liquid YP medium. After autoclaving, add 10 ml of ethanol 100%, 30 g of glycerol and 30 g of galactose.

EXAMPLE 12: Expression, in an Erlenmeyer flask, of urate oxidase..cDNA by the-EMYZ51 PEMR469 fura4·). EMY761 PEMR473 fura*1. EMY761 pEMR469 fleu*) and. JSMY?61.-pEMR473 fleu-*') strains.- Immunodetection by Western blot - Assay of the urate oxidase activity and the soluble proteins 1) Expression of urate oxidase cDNA a) Strains selected on uracil-free medium A colony of each of the EMY761 pEMR469 (ura*) and EMY761 pEMR473 (ura*) strains was cultured in 20 ml of uracil-free liquid medium (cf. Table III, Example 11). After one night at 30®C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium (cf. Table III, Example 11) for the EMY761 pEMR469 (ura*) strain and in 20 ml of ethanol-glycerol-galactose YP medium (cf. Table III, Example 11) for the EMY761 pEMR473 (ura+) strain.

The cultures were incubated again at 30°C for 22 h, with agitation. b) Strains selected on leucine-free medium In a first stage, a colony of each of the EMY761 pEMR469 (leu···) and EMY761 pEMR473 (leu*) strains was cultured in 20 ml of leucine-free liquid medium (cf.

Table III, Example 11). This made it possible to obtain - 63 and maintain a large number of copies of plasmids by carrying out the selection for complementation of the leu2 mutation by the LEU2d gene carried by plasmids pEMR469 and pEMR473.

After one night at 30 ®C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium for the EMY761 pEMR469 (leu···) strain and in 20 ml of ethanolglycerol-galactose YP medium (cf. Table III, Example 11) for the EMY761 pEMR473 (leu*) strain. The cultures were incubated again at 30°C for 22 h, with agitation. c) Control strain The non-transformed EMY761 strain, i.e. the EMY761 strain without plasmid, was cultivated as above.

It was subjected on the one hand to induction in 10 ml of ethanol-glycerol liquid YP medium and on the other hand to induction in 10 ml of ethanol-glycerol-galactose YP medium. 2) Preparation.of the samples a) The cells cultivated in la), lb) and lc) were centrifuged and the supernatant was removed. The resi25 dues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of triethanolamine buffer, TEA, of pH 8.9. About 300 μΐ of cells taken up in said buffer were lyzed in the presence of glass beads (from 400 to 500 um in diameter), representing about half the final volume. This mixture was agitated vigorously in a Vortex 4 times for 1 min, the samples being placed in ice for 30 s between grinding operations. The liquid was withdrawn from the tubes with a Pasteur pipette and transferred to a microtube. The - 64 glass beads were washed once with about 200 μΐ of TEA buffer of pH 8.9. The beads were agitated in a Vortex . once for 1 min and the liquid was withdrawn with a Pasteur pipette and added to the above lyzate. The 05 lyzate was then centrifuged in a microtube for 5 min at 7000 rpm. The supernatant was cautiously withdrawn and stored at -20°C for Western blot, assay of the urate oxidase activity and assay of the proteins. The residue of the lyzed cells was stored separately at -20°C for Western blot (cf. 3) below).

Furthermore, samples of the cultures prepared in la) and lb) were taken in the following manner before induction: 2 ml of culture were centrifuged for 10 min at 7000 rpm. The residues were taken up in 500 μΐ of dis15 tilled water and centrifuged again for 5 min at 7000 rpm.

The residues were taken up in about 200 μΐ of TEA buffer of pH 8.9 and lyzed as above in the presence of glass beads. The supernatants and the residues of the lyzed cells were stored separately at -20’C. 3) Immunodetection of the urate oxidase bv Western blot a) Procedure The residues and the supernatants of the different samples were subjected to a Western blot - a technique well known to those skilled in the art - which comprises the following steps: - solubilization of the residue by boiling for 10 min in a buffer, called a loading buffer, consisting of TrisHCl 0.125 M pH 6.8, SDS 4%, bromophenol blue 0.002%, glycerol 20%, β-mercaptoethanol 10% (according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685)); - electrophoretic separation of the different proteins contained in the solubilizate, according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685); and - transfer of said proteins contained in the gel on to a nitrocellulose filter (according to the technique of H. TOWBIN et al., Proc. Natl. Acad. Sci. USA (1979) 4350-4354).

Immunodetection, performed according to the technique of BURNETTE (W.W. BURNETTE, Ana. Biochem. 112 (1981) 195203), involves the following successive operations: • rinsing the nitrocellulose filter for 10 min with a buffer A (Tris-HCl 10 mM, NaCl 170 mM, KC1 1 mM); · bringing the nitrocellulose filter into contact with a buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml) for 30 min at 37°C; • bringing the nitrocellulose filter into contact with an immune serum (polyclonal antibodies recognizing /L_ . flavus urate oxidase) for 1 h at 37°C; • rinsing the nitrocellulose filter with buffer B; • bringing the nitrocellulose filter into contact with a solution of protein G, labeled with iodine 125 at a rate of 0.1 microcurie/ml, for 1 h at 37®C; · rinsing the filter with buffer A; drying the filter between two absorbent sheets; bringing the filter into contact with an X-ray film; and • developing the film. b) Results It is found that the EMY761 pEMR469 (ura+), EMY761 pEMR473 (ura*), EMY761 pEMR469 (leu*) and EMY761 pEMR473 (leu*) strains produce a protein with an apparent molecular weight of about 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase and which is absent from the control strain.

It is also found that the non-induced strains produce none or very little of the protein described above.

Comparison between the amounts of this protein for the residues and the supernatants makes it possible to deduce that about 80% of said protein is in soluble form in the lyzate. 4) Assay of the urate oxidase activity The urate oxidase activity was measured on the supernatants of the lyzed cells according to the procedure described in Example 9 above.

The results obtained are collated in Table IV below, which specifies the urate oxidase activity in U/ml for each strain induced by glycerol-ethanol, each strain induced by glycerol-ethanol-galactose and each noninduced strain.

TABLE IV Strain/Inducer Urate oxidase activity (U/ml) EMY761/YP ethanol-glycerol-galactose < 0.1 EMY761/YP ethanol-glycerol < 0.1 EMY761 pEMR469 (ura*)/(non-induced) 0.4 EMY761 pEMR469 (ura*)/YP ethanol-glycerol 12 EMY761 pEMR469 (leu*)/(non-induced) 0.17 EMY761 pEMR469 (leu*)/YP ethanol-glycerol 36 EMY761 pEMR473 (ura*)/(non-induced) < 0.1 EMY761 pEMR473 (ura*)/YP ethanol-glycerol- galactose 12.5 EMY761 pEMR473 (leu*)/(non-induced) < 0.1 EMY761 pEMR473 (leu*)/YP ethanol-glycerol- galactose 15.3 The above Table clearly shows that the yeast cells transformed by these plasmids pEMR469 and pEMR473 are capable of producing urate oxidase activity after induction.

) Assay of the total soluble proteins in the lvzates The protein assay kit from BIORAD was used for assaying the total proteins present in the supernatant of the lyzed cells. It is based on the observation that the - 67 maximum absorbance of an acid solution of Coomassie brilliant blue g-250 changes from 465 nm to 595 nm when proteins become attached thereto (q.v. Reisner et al., Anal. Biochem., 64, 509 (1975)). a) Procedure The following volumes are introduced into the cell of a spectrophotometer set to 595 nm: - 10 μΐ of sample to which 790 μΐ of distilled water have been added - 200 μΐ of concentrated Dye reagent (Biorad).

The ingredients are mixed and the optical density is read off at 595 nm. A calibration range with increasing concentrations of BSA (bovine serum albumin) was prepared in this way. The unknown concentration of the total proteins in the lyzates is read off on the calibration curve obtained. b) Results The main results obtained are collated in Table V below, which specifies the amount (in mg/ml) of total soluble proteins and the percentage of urate oxidase in the total soluble proteins for each strain induced by glycerol-ethanol, each strain induced by glycerolethanol-galactose and each non-induced strain (it is assumed here that the specific activity of the recom25 binant protein is identical to that of the urate oxidase obtained from A. flavus: 30 U/mg). - 68 TABLE V Strain/Inducer Total soluble proteins % of urate oxidase in the total soluble 05 mg/ml proteins EMY7 61/glycero1-ethano1 5.3 < 0.05 EMY761/glycerol-ethanol-galactose 5.8 < 0.05 EMY761 pEMR469 (ura*)/non-induced 8.5 0.25 EMY761 pEMR469 (ura*)/glycerol-ethanol 5.3 4.7 EMY761 pEMR469 (leu*)/non-induced 1.7 0.3 EMY761 pEMR469 (leu*)/glycerol-ethanol 5.9 20 EMY761 pEMR473 (ura*)/non-induced 10.3 < 0.05 EMY761 pEMR473 (ura*)/glycerol-ethanol- galactose 6.5 6.4 EMY761 pEMR473 (leu*)/non-induced 0.5 < 0.05 EMY761 pEMR473 (leu*)/glycerol-ethanol- galactose 3.9 13 It is found that the production rate of urate oxidase varies from 5 to 20% according to the transformants and the mode of selection of the transformed strains (leu*).

EXAMPLE 13: Expression, in a 2.5 1 fermenter, of urate oxidase cDNA bv the EMY761 pEMR473 (ura*) strain 1) Fermentation protocol a) Media Inoculum medium A colony of the ΕΜΥ761 pEMR473 (ura*) strain was cultured in 200 ml of uracil-free liquid medium (cf. Table III, Example 11). Culture is continued overnight, with agitation, until the OD is about 3. - 69 Culture, medium A for 1 1 of purified water on an apparatus of the Milli-Q type glucose 30 g glycerol 30 g casein hydrolyzate acids from DIFCO) (Casamino 30 g Yeast Nitrogen Base (from DIFCO) 15 g Yeast extract (from DIFCO) 2.5 g K2HPO4 3 g MgS0<.7H20 0.5 g Additional medium B for 100 ml of purified water on an apparatus of the Milli-Q type glycerol 30 g peptone hydrolyzate (Primatone from G. : Sheffield) 30 g Yeast Nitrogen Base (from DIFCO) 15 g Yeast extract (from DIFCO) 5 g K2HPO4 3 g MgS04.7HzO 0.5 g b) Fermentation parameters Bioreactor of total volume 2.5 1, equipped with two turbines Temperature = 30°C pH = 5 Oxygen partial pressure = 30 mm Hg Air flow rate = 1 1/min The bioreactor is filled with 1.5 1 of medium A and inoculated with 150 ml of the inoculum.

Once the glucose has been exhausted at OD 2.5 to about OD 17, induction is effected by the addition of a volume of 150 ml of galactose at 20% weight/volume.

Growth is continued and additional medium B is then added at about 0D 30.

Growth continues for about another fifteen hours and the product was harvested at 0D 104. 2) Preparation and analysis of the samples The samples were prepared as described in Example 92) a) from the culture in the fermenter. Two samples were taken: the first after 7 h of induction and the second after 22 h of induction.

The following tests, described in Example 9, were performed on these two lyzates obtained after lysis of the cells: - immunodetection by Western blot - assay of the biological activity - assay of the total proteins The following results were obtained: a) Immunodetection by Western blot It is found that the EMY761 pEMR473 (ura-*·) strain, cultivated in a 2 1 fermenter, produces a protein with an apparent molecular weight of 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase (said antibodies being prepared in rabbits by techniques well known to those skilled in the art: q.v.

VAITUKAITIS et al. (1981) Methods in Enzymology, Academic Press, New York, vol. 73, p. 46) and which is absent from the control strain. b) Assay of the biological activitv The results obtained are collated in Table VI below: TABLE VI Strain/Induction time U/ml EMY761 pEMR473 (ura*)/7 h 9 EMY761 pEMR473 (ura*)/22 h 12.5 It is found that the EMY761 pEMR473 (ura*) strain, cultivated in a fermenter, is capable of pro10 ducing urate oxidase activity after induction. c) Assay of the total soluble proteins The results are collated in Table VII below: TABLE VII Strain/Induction time Total soluble proteins mg/ml % of urate oxidase in the total soluble proteins EMY761 pEMR473 (ura*)/7 h 5.2 5.7 EMY761 pEMR473 (ura*)/21 h 6.2 6.6 These results indicate that the rate of synthesis of urate oxidase by the EMY761 pEMR473 (ura*) strain, cultivated in a fermenter, is about 5% of the total proteins of the cell after 7 h and 22 h of induction.

EXAMPLE 14: Expression, in an Erlenmeyer flask, of urate oxidase cDNA bv the EMY761 PEMR515 (leu*).

EMY500 PEMR515 (leu*) and GRF18 PEMR515 (leu*)—atrain,s A colony of each of the above three strains was cultured in 20 ml of leucine-free liquid medium.

After one night at 30°C, with agitation, the three cultures were centrifuged for 10 min at 7000 rpm.

The cell residues were taken up in 10 ml of sterile - 72 distilled water and centrifuged again for 10 min. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol-galactose YP medium (cf. Table III, example 11). The cultures were incubated again at 30°C for about 20 h, with agitation. The non-transformed host strains were each cultured as controls.

The cells of each of the six cultures are separated out again by centrifugation and the supernatant is removed. The residues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of TEA buffer of pH 8.9 and the grinding and removal of the particles by centrifugation were carried out as described in Example 9, 2). The supernatant of each culture is used, as previously, for assaying the urate oxidase and the total proteins. The main results obtained are collated in Table VIII below: TABLE VUI Strain/Culture conditions Urate oxidase activity (U/ml) Total soluble proteins (mg/ml) % of urate oxidase in the soluble proteins GRF18 pEMR515 (leu*)/a) < 0.1 2.2 < 0.05 EMY500 pEMR515 (leu*)/a) < 0.1 0.9 < 0.05 EMY761 pEMR515 (leu+)/a) < 0.1 1.8 < 0.05 GRF18 pEMR515 (leu*)/b) 38 5.4 23 EMY500 pEMR515 (leu*)/b) 20 2.5 26 EMY761 pEMR515 (leu+)/b) 33 4.2 26 a): the strains are cultivated in the presence of glucose (noninduction conditions) b): the strains are cultivated in the absence of glucose and in the presence of galactose (induction) These results show that a high level of expression of urate oxidase can be obtained with three nonIE 902559 - 73 isogenic recipient strains transformed by the expression vector according to the invention.

EXAMPLE 15: Construction of an expression vector for urate oxidase cDNA in...animal cells: plasmid psvaso This vector was obtained by - ligation of the small AccI-SnaBI fragment containing a sequence coding for urate,oxidase with the exception of the first 16 amino acids, said fragment being derived from plasmid p466 (an expression vector for A. flavus urate oxidase in E. coli. available in the laboratory and described below), with a synthetic Hindlll-AccI fragment, which made it possible to obtain a Hindlll-SnaBI fragment containing a complete sequence coding for A. flavus urate oxidase and a non-translated 5' sequence favoring expression in animal cells; and - insertion of the Hindlll-SnaBI fragment between the HindiII and SnaBI sites of the multiple cloning site (also called polylinker) of the expression vector for animal cells, namely plasmid pSEi.

The following account will successively describe the construction of plasmid p466, plasmid pSEi and plasmid pSV860. 1) Construction of plasmid p466 Plasmid p466, an expression vector for urate oxidase cDNA in E. coli, was prepared. It comprises a fragment of pBR327 including the origin of replication and the ampicillin resistance gene; it also comprises a synthetic promoter of E. coli (R. RODRIGUEZ and M.

CHAMBERLIN, Promoters - Structure and function (1982), Preager), a Shine-Dalgarno sequence followed by a polylinker containing the unique Ndel and Kpnl sites, a transcription terminator (derived from phage fd) and the lac i gene.

This plasmid was constructed from an expression - 74 plasmid for hGH in E. coli (p462) by replacing a fragment carrying the hGH gene with urate oxidase cDNA.

The construction of plasmid p466 was described in detail in Example 7 above. 2) Construction of an expression vector for animal cells: plasmid pSEi The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK in Molecular Cloning, a laboratory manual (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA syn15 thesizer.

The following description will be understood more clearly with reference to Figure 13, which shows a restriction map of plasmid pSEi, the sites which have disappeared due to ligation being indicated in brackets.

The symbols used in this Figure will be specified in the description below.

This plasmid was constructed by successive ligations of the following components: 1) - a Pvul I-Pvul I fragment - symbolized by +4-+-+++ in 25 Figure 13 - of 2525 bp, obtained by complete digestion of plasmid pTZ18R (Pharmacia) with the restriction enzyme PvulI. This fragment contains the origin of replication of phage Fl (denoted by ORI Fl in Figure 13), a gene (denoted by Amp11 in Figure 13) carrying ampicillin re30 sistance, and the origin of replication (denoted by ORI pBR322 in Figure 13) permitting the replication of this plasmid in E. coli. The first PvulI blunt site disappears on ligation with the EcoRV blunt site (which also disappears) of the fragment described in 7). 2) - a PvuII-Hpal fragment - symbolized by in - 75 Figure 13 - of 1060 bp, of type 5 adenovirus DNA between position 11299 (PvuII restriction site) and position 10239 (Hpal restriction site) (DEKKER & VAN ORMONDT, Gene 27. 1984, 115-120), containing the information for VA-I and VA-II RNA's. The Hpal blunt site disappears on ligation with the PvuII blunt site (which also disappears) of the fragment described in 3). 3) - a PvulI-HindiII fragment - symbolized by ///// in Figure 13 - of 344 bp, derived from SV40 virus DNA and obtained by complete digestion with the restriction enzymes PvuII and Hindlll. This fragment contains the origin of replication and the early promoter of SV40 virus DNA (ref. B.J. BYRNE et al., PNAS-USA (1983) 80, 721-725).

The Hindlll site disappears on ligation with the site binding to Hindlll of the fragment described in 4). 4) - a synthetic site binding to Hindlll-Hindlll fragment - symbolized by _ in Figure 13 - of 419 bp, whose sequence, given below, is similar to the non20 translated 5' sequence of the HTLV1 virus (ref. WEISS et al., Molecular Biology of Tumor Viruses - part 2 - 2nd edition - 1985 - Cold Spring Harbor Laboratory - p. 1057). site binding to Hindlll T AGCTGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCC 1 ---------+---------+---------+---------+---------+---------+ 60 CCGAGCGTAGAGAGGAAGTGCGCGGGCGGCGGGATGGACTCCGGCGGTAGGTGCGG GGTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTA 61 ---------+---------+---------+---------+---------+---------+120 CCACTCAGCGCAAGACGGCGGAGGGCGGACACCACGGAGGACTTGACGCAGGCGGCAGAT 10 GGTAGGCTCCAAGGGAGCCGGACAAAGGCCCGGTCTCGACCTGAGCTCTAAACTTACCTA 121 ---------+---------+---------+---------+---------+---------+180 CCATCCGAGGTTCCCTCGGCCTGTTTCCGGGCCAGAGCTGGACTCGAGATTTGAATGGAT GACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTT 15 181 ---------+---------+------——+---------+---------+---------+240 CTGAGTCGGCCGAGAGGTGCGAAACGGACTGGGACGAACGAGTTGAGATGCAGAAACAAA CGTTTTCTGTTCTGCGCCGTTACAACTTCAAGGTATGCGCTGGGACCTGGCAGGCGGCAT 241 ---------+---------+---------+---------+---------+---------+300 GCAAAAGACAAGACGCGGCAATGTTGAAGTTCCATACGCGACCCTGGACCGTCCGCCGTA CTGGGACCCCTAGGAAGGGCTTGGGGGTCCTCGTGCCCAAGGCAGGGAACATAGTGGTCC 301 —h360 GACCCTGGGGATCCTTCCCGAACCCCCAGGAGCACGGGTTCCGTCCCTTGTATCACCAGG CAGGAAGGGGAGCAGAGGCATCAGGGTGTCCACTTTGTCTCCGCAGCTCCTGAGCCTGCA 361 ---------+---------+---------+---------+---------+---------+420 GTCCTTCCCCTCGTCTCCGTAGTCCCACAGGTGAAACAGAGGCGTCGAGGACTCGGACGT GA CTTCGA A Hindlll - 77 5) - a synthetic HindIII-site binding to BamHI fragment - symbolized by X XXX in Figure 13 - containing the promoter of the RNA polymerase of phage T7 and also a polylinker containing the Smal cloning site. agcttgtcgactaatacgactcactatagggcggccgcgggcccctgcaggaattc ACAGCTGATTATGCTGAGTGATATCCCGCCGGCGCCCGGGGACGTCCTTAAG Hindlll Smal site binding to BamHI r V GGATCCCCCGGGTGACTGACT CCTAGGGGGCCCACTGACTGACTAG 6) - a BamHI-BcII fragment of 240 bp - represented by ΥΠΤ in Figure 13 - which is a small fragment obtained by complete digestion of the SV40 virus with the enzymes Bell and BamHI and containing the late polyadenylation site of said virus (M. FITZGERALD et al., Cell, 24, 1981, 251-260). The BamHI and Bell sites disappear on ligation respectively with the site binding to BamHI of the fragment described in 5) and the BamHI site (which also disappears) of the fragment described in 7). 7) - a BamHI-EcoRV fragment - symbolized by OQO£7 in Figure 13 - of 190 bp, which is a small fragment derived from plasmid pBR322 after complete digestion with the enzymes EcoRV and BamHI. 3) Construction of plasmid pSV860 Plasmid p466 (cf. Figure 9) was completely diges30 ted with the enzymes AccI and SnaBI. The small AcclSnaBI fragment, which contains a DNA sequence coding for urate oxidase with the exception of the first 16 aminoterminal acids, was purified and ligated with the synthetic Hindlll-AccI fragment having the following sequence: Hindlll AccI τ * AGCTTGCCGCCACTATGTCCGCAGTAAAAGCAGCCCGCTACGGCAAGGACAATGTCCGCGT ---------+---------+---------+---------+---------+---------+ ACGGCGGTGATACAGGCGTCATTTTCGTCGGGCGATGCCGTTCCTGTTACAGGCGCAGA This ligation makes it possible to obtain the Hindlll-SnaBI fragment containing a sequence, coding for urate oxidase, which is identical to that of clone 9C and a non-translated 5' sequence favoring expression in animal cells (KOZAK, M. , Nucl. Acids Res., 12, 2, 1984, 857-872).

The Hindlll-SnaBI fragment contains the following sequence : 15 ' -AGCTTGCCG CAATGTCCGC CGGTGTACGA TCTTACACCA GAACACCATT TGTTCGGCTC CATGCCGCTC TGACGGCAAG GGAATGTGCA TCTCTGTCCG CTTCCTGCGT TGAGCACCGA CAGGAGGTCC TCGCGAGGTC AGGCCACTAT ATCGAGACTG CCTGAGCTGG TCGCTCCTCA TCCTCTCTGA CCACTATGTC GTCTACAAGG GATGACCGTC AGGCCGACAA TACATCACCG CATCCTGGGC ACGTCAACAT CCACACCCTC GGTGGACGTG GCCTGACCGT GACGAGTACA CGTCGATGCC GCTCGCACGT ACTCTGAAGA GTACAAGATG TCGAGTACTC CACAAGGGCC GTCGGACCCC AGTCTAAATT CGCAGTAAAA TTCACAAGGA TGTGTGCTTC CAGCGTCATT CCAAGCAGAA ACACACTTCA TGTCTGCCAC ACTCCTTCAT GTCGAGGGCA GCTGAAGAGC CCACACTTAA ACTTGGCAGT GCCTAAGTTC CTTTTGCTGA GCAGAGCAAA GTTGCCTAAC TCCAAAACAC AACGGTCTGA G GCAGCCCGCT CGAGAAGACC TGGAGGGTGA GTCGCAACCG CCCCGTTACT TTGAGAAGTA CGCTGGACCC CCGCGACAGC AGGGCATCGA ACCAACTCGC GGAGACCTGG GGAAGAATTT GATGCTACCT AGATAACAGT TCCTGGCGCG AAGCACTATT CGGCAAGAAC TCAAGTGTAC ACGGCAAGGA GGTGTCCAGA GATTGAGACC ACTCCATTAA CCTCCCGAGC CAACCACATC GGATGGACAT GAGGAGAAGC TATCAAGTCG AGTTCTGGGG GACCGTATCC CAGTGGACTC GGGCCACTGC GCCAGCGTGC CCAGCAGCTG TCGAAATCGA GCCGAGGTCT CGTCGGCCGG - 79 The HindiII-SnaBI fragment was then inserted into vector pSEi, which had first been incubated with the enzymes HindiII and Smal. This gave plasmid pSV860 shown in Figure 14, in which the symbols have the same meanings as in Figure 13, the novel HindiII-SnaBI fragment being symbolized by /:///1 . (The SnaBI and Smal sites disappeared on ligation.) EXAMPLE 16: Transient expression of urate oxidase cDNA in COS cells - Assay of the urate oxidase activity in the cell lyzate COS cells are monkey kidney cells expressing the T-antigen of the SV40 virus (Gluzman, Y., Cell 23, 1981, 175-182). These cells, which permit the replication of vectors containing the origin of replication of SV40 virus DNA, are preferred hosts for studying the expression of genes in animal cells. 1) Transfection of COS cells and transient expression of urate oxidase cDNA 4.10B COS cells are plated out in a Petri dish of diameter 6 cm (Corning) in 5 ml of Dulbecco's modified Eagle's medium (from Gibco), hereafter called DMEM, which contains 0.6 g/1 of glutamine and 3.7 g/1 of NaHC03 and is complemented with fetal calf serum (GIBCO) at a rate of 5%. After about 16 h of culture at 37°C in an atmos25 phere containing 5% of carbon dioxide, the culture medium is sucked off and the cells are washed with 3 ml of PBS (phosphate buffered saline from GIBCO). The following mixture is then added: 1000 pi of (DMEM + 10% of fetal calf serum (GIBCO)), 110 μΐ of diethylaminoethyldextran of average molecular weight 500,000 at a concentration of 2 mg/ml (Pharmacia), 1.1 μΐ of chloroquine 100 mM (Sigma) and 3 pg of DNA of either plasmid pSV860 or plasmid pSEi (for the control). After incubation for 5 h at 37*C in an atmosphere containing 5% of carbon dioxide, the mix35 ture is withdrawn from the cells. 2 ml of PBS containing - 80 10% of dimethyl sulfoxide (spectroscopic grade, Merck) are then added. After incubation for 1 min at room temperature, the mixture is withdrawn and the cells are washed twice with PBS. 5 ml of DMEM complemented with fetal calf serum at a rate of 2% are added. Incubation is continued for 4 days at 37°C under an atmosphere containing 5% of carbon dioxide. 2) Preparation of the samples The culture medium is sucked off and the COS cells are rinsed twice with 3 ml of PBS. The cells are then collected by scratching with a rubber spatula (policeman) in 1 ml of PBS. After scratching, the dish is rinsed with 1 ml of PBS. The two cell suspensions are combined and centrifuged for 10 min at 1000 rpm. The supernatant is removed and the cell residue is resuspended in 1 ml of triethanolamine (TEA) 0.05 M of pH 8.9/ EDTA buffer.

The cells are lyzed by sonication (on ice) by means of 10 s pulses with a sonicator (Vibra Cell from Sonics and Materials Inc. USA) set to a power of 12 W.

The cell lyzate is centrifuged for 10 min at 10,000 rpm and the supernatant is recovered for assay of the urate oxidase . 3) Assay of the urate oxidase activity The urate oxidase activity was assayed as described in Example 9.

The results are collated in the Table below: COS cells transfected by Urate oxidase activity U/ml PSV860 0.105 pSEi < 0.01 It is found that the COS cells transfected by - 81 plasmid pSV860 carrying urate oxidase cDNA express an appreciable level of urate oxidase activity, whereas no urate oxidase activity is detectable in the control. There is therefore expression of urate oxidase cDNA.

EXAMPLE 17 ; Expression in a 2.5 1 fermenter of the cDNA of urate oxidase for the EMY500 pEMR515 etrain. Purification and partial characterization of the recombinant urate oxidase: 1) Culture in a 2,5 1 fermenter of the EMY500 pEMR515 strain: The culture of the EMY500 pEMR515 strain is carried out in the following manner: a) Preculture stage in erlenmeyer A 500 ml erlenmeyer containing 90 ml of a growth medium MCPA, (sterilizable by autoclave) complemented with 1.28 g of MES (2-/ N-morpholino/-ethanesulfonic acid : Sigma π° M8250) and 10 ml of e growth medium MCPF (sterilized by ultra filtration) is seeded with 1 ml of a solution of the EMY500 pEMR515 strain in a medium containing 20% glycerol with a number of calls corresponding to sn Optical Density of 2.35. The compositions of the media MCPA and MCPF are given hereinafter. After 24 hours of incubation, under stirring at 30°C, the Optical Density of the culture is about 7. b) Culture phase in fermenter The above culture is used for seeding a 2.5 1 fermenter containing the culture medium having the following composition: θΟΟ ml MCPA + 200 ml of MCPF The pH of the culture is regulated by the fermenter to the given value of 5.5. After 6-7 hours of culture at 30®C, 72 ml of a 500 g/1 glucose solution is linearly added over a period of 9 hours (namely a total of 36 g of glucose). c) Expression stage To the previously described mixture, 100 ml of the expression medium ΜΕΡΑ (sterilizable by autoclave) and 150 ml of the expression medium MEPF (sterilized by ultra filtration) having the following compositions, are added. The culture is then continued for 5 hours. Then 150 ml of a solution containing 30 g of galactose, 15 g of glycerol and 36 g of ethanol ere linearly added for 20 hours. An optical density of about 160 is then obtained.

CHEMICAL COMPOSITION OF THE GROWTH AND EXPRESSION MEDIA 10 - Growth medium MCPA (sterilizable by autoclave) For total 900 ml NTA (nitrilotriacetic acid) 1.2 g Yeast extract (DIFCO) θ 0 K2so4 1.2 g 15 NaCl 0.6 g MgS04, 7H20 1.2 g CaCl2 2H20 840 mg FaCl3 108 mg glutamic acid 4.44 g 20 HYCASE SF (Sheffield Products) 30 g leucine 2.16 g histidine 600 mg methionine 1.2 g oligoelements I (see hereinafter) 5 ml 25 urscil 1.2 g List of oligoelements I for 1 1 of ultra purified water CuS04, 5Hg0 780 mgH3B03 5 g ZnS04, 7H20 3 g KI i g MnS04, 2H20 3.5 g Na2MD4. 2H20 2 g FeClg, 6H20 4.8 g Add 100 ml of concentrated hydrochloric acid to the solution and adjust to 1,000 ml. - tfrowth medium MCPF (sterilized by ultra filteretion) for total 200 ml of ultra purified water KH2P04 4.8 g Tryptophane 420 mg Vitamin I (see hereinafter) 5 ml glucose 36 g Heat to dissolve, return to ambient temperature, add the vitamins I and filter through 0.2 pm filter.

List of vitamins I for total 100 ml of ultra purified water biotine 1.2 mg folic acid 1 mg niacine 144 mg (nicotinic acid) pyridoxine. HC1 B0 mg thiamine, HC1 240 mg calcium pantothenate 1.2 g mesoinositol 2.4 g Fill to 100 ml after dissolving Sterile filter, cold, et 2 yum - Expression medium ΜΕΡΑ (sterili2able by autoclave) for total 100 ml of ultra purified water NTA k2so4 glutamic acid HYCASE SF (Sheffield Products) leucine 1.2 g 2.08 g 6 g 24 g 2.16 g 20 histidine 600 mg methionine 1.2 g MgSO4, 7H20 720 mg CaCl2, 2H20 840 mg FeCl3, GH20 108 mg 25 oligoelements I 5 ml uracil 1.2 g Adjust the pH to 5.5 with concentrated H,,SO4 or concentrated KOH Autoclave for 20 mins at 120°C - Expression medium MEPF (sterilized by ultra filtration) for total 150 ml of ultra purified water KH2P04 2.4 g tryptophane 420 mg vitamins I 5 ml glycerol 36 g galactose 45 g Haet to dissolve, return to ambient tempereture, edd the vitamins and filter. 2) Grinding of the cells After 20 hours of induction, the OD of the culture, measured et 600 nm, is 98. 800 g of the fermentation wort ere centrifugated for 5 minutee at 10,000 g and the cell cake is taken up in 80 ml of e lysis buffer (glycine 20 mM pH 8.5). The cells ere then ground twice at 4°C, for 2.5 minutes in a grinding device (Vibrogenic Zellmiihle mill VI 4) in the presence of a volume of beads (0.50 mm in diameter) equel to thet of the solution of cells to be lysed. After grinding, the supernatant is taken up end the beads are washed twice with 80 ml of e lysis buffer. 210 ml of a lysate is recovered; seid lysate has a total protein content of about 3 mg/ml and an urate oxydase activity of about 7.7 yu/ml (namely a urate oxidase percentage towards the total protein of about 8.5 %, considering a specific activity of that protein of 30 /u/mg). 3) Purification of the recombinant urate oxidase a) Purification protocol The above lysate is submitted to the two-step purification protocol disclosed hereinafter.

Step 1 : Anionic chromatography Support : DEAE (diethylaminoeulphate) sepharose fast flow (Pharmacia ref. 17.07.09,91) The compressed gel occupies a volume of 70 ml.

The separation is carried out et ambient temperature, the recovered fractions being preserved at 0eC.

Separation conditions : A gradient of a chloride ionic force between buffer 1 (sodium borate 10 mM, pH 9.2) and buffer 2 (sodium borate 10 mM, sodium chloride 1M) is used. The buffers are previously degased and preserved at 0°C during the elution. In each buffer 0.02 % of azide are added.

The raw extract is deposited (10 ml) and eluted with buffer 1 up to the complete recovery of the urate oxidase (by fractions of 10 ml) which is not retained on the column.

The pigments and the contaminating proteins ere thereafter removed by an elution with buffer 2.

The purification is followed by measuring of the 0D of the eluate at 214 nm.

Step 2 : High pressure and inverse phase liquid chromatography Support: Grafted 08 silica column, Aquspore 0D-300 (100 x 2.1 ran) (Brownlee-Applied Bioaystems) Operating conditions : Eluent 1 : ultrapurified water (filtered through a Millipore system) containing 0.1% of trifluoroacetic acid.

Eluent 2 : Acetonitrile (of spectrophotometric quality or similar) containing 0.08 % of trifluoroacetic acid.

Flow rate : 0.3 ml/min.

The gradient is of 35 % of acetonitrile/TFA to 70 % of acetonitrile/TFA for 20 minutes and is maintained at 70 % for 5 minutes. The injeoted quantity is of 1 mi per run.

Recovery of the fractions : The separation is followed by measurement of the opticel density at 218 nm. The acetonitrile is evaporated during the centrifugation under vacuum. b) Results : The sample before end after the first step of purification was analysed by liquid chromatography on a grafted C8 silica column, the Aquapore 00-300 previously disclosed with the same gradient, with an injected quantity of 50 yjl. Purified urate oxidase from A flavus is used as an external control.

In the starting lysate, the urate oxidase represents 53 % of the total proteins. After the first step of purification, the urate oxidase represents 84 % of the total proteins.

The whole sample obtained after step 2 was used for the following partial characterization. Said sample certainly contains more than % of urate oxidaee. 4) Partial characterization of the recombinant urate oxidase a) Analysis of the amino acids The analysis of the amino acids of the acid hydrolysate of the purified recombinant urate oxidase was carried out in an analyser from Applied Biosystems model 420-130A. The repartition of the quantified amino acids is compatible (there exists no significant - 89 10 difference) with the supposed sequence. The same result was observed for the purified urate oxidase extracted from A. flavuo (obtained in example 4) b) Tryptic peptidic map A trypic peptidic map was established for the purified recombinant urate oxidase and for the purified urate oxidase extract obtained in example 4) under the following conditions : A urate oxidase solution having a concentration of 1 mg/ml is prepared. Extemporaneously a trypsin solution having a concentration of 1 mg/ml ie prepared.

The two solutions are mixed together in a proportion of 1/30 enzyme/substrate for 8 hours et ambient temperature. The trypsic hydrolysate is then chromatographied (liquid phase chromatography) on a C18 grafted silica column (5 /jm; lichrosorb 250 x 4.6 mm Hichrom-ref. RP 18-5-250A) provided with a UV detector coupled with e recorder. The gradient applied is of 1 % acetonitrile/TFA to 60 % acetonitrile/TFA for 120 minutes and then the gradient is maintained at 60 % for 5 minutes.

The peptidic maps obtained have a very narrow profile.

) Determination of the blocked character of the amino-terminal The amino-terminal sequence was analysed by means of the sequencer, Applied Biosyetem model 470A, coupled with an analyser of phenylthiohydantoic derivatives, Applied Bioaystems model 120A. The purified recombinant urate oxidase (200 pmoles detected by analysis of the amino acids) was put on the sequencer in the presence of 20 pmoles of β-lactoglobuline (control protein).

No amino-terminal sequence corresponding to the sequence of the urate oxidase was detected, whereas the amino-terminal sequence of the control protein was detected.

Therefore, the recombinant urate oxidase of the invention, es well as the urate oxidase extract, has e blocked amino-terminel end.

Claims (1)

1.CLAIMS I. A protein possessing a specific urate oxidase activity of at least 16 U/mg and having the following sequence : SerAlaVallysAlaAlaArgTyrGly LysAspAsnValArgValTyrLyaValHis LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrVelCysValleuLeuGlu GlyGluIleGluThrSerTyrThrLysAla AspAsnSerVallleValAlaThrAspSer IleLysAsnThrlleTyrlleThrAlaLys GlnAsnProVelThrProProGluLeuPhe GlySerlleLeuGlyThrHisPhoIleGlu LysTyrAsnHisIleHisAleAleHisVal AsnlleValCysHisArgTrpThrArgMet AspIleAspGlylysProHisProHisSer PhelleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGIytysGly IleAspIleLysSerSerleuSerGlyLeu ThrValLeuLysSerThrAsnSerGlnPhe TrpGlyPheLeuArgAspGluTyrThrThr LeuLysGluThrTrpAspArglleLeuSer 15 ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrleulysThrPhe AlaGluAspAsnSerAlaSerValGlnAle ThrMetTyrLysMetAlaGluGlnlleLeu AlaArgGlnGlnleuIleGluThrVolGlu TyrSerLeuProAsnLysHisTyrPheGlu IleAspLeuSerTrpHisLysGlyleuGln AsnThrGlyLysAsnAlaGluValPheAla on ProGlnSerAspProAsnGlyLeuXleLys CysThrValGlyArgSerSerLeuLysSer LysLeu preceded if appropriate, by a methionine, or having a substantial degree of homology with that sequence. 25 2. k protein according to claim 1, possessing a specific urate oxidase activity of at least 30 U/mg. 3. A protein according to claim I or 2, which presents, by analysis on a bidimensional gel, a spot of molecular mass of about 33.5 kDa and an isoelectric point around 8.0, representing at least 30 90 7. of the protein mass. 4. A protein according to anyone of claims 1 to 3, having a purity degree, determined by liquid chromatography on a C8 grafted silica column, higher than 80 X, 5. A protein according to anyone of claims 1 to 4, having an 35 isoelectric point around 8.0. - 92 6· A protein according to anyone of claims J to 4, which carries a blocking group on the amino-terminal serine having preferably a molecular mass around 43 units of atomic mass. 7· A drug containing a protein according to anyone eiaioo 05 I to 6. 8. A recombinant gene which has the DNA sequence coding for the protein having the following sequence : 10 MetSerAlaValLysAlaAlaArgTyrGly LysAspAsnValArgValTyrlysValHis LysAspGluLysThrGlyValGlnThrVal TyrGluMetThrValCysVelLeuleuGlu GlyGluIleGluThrSerTyrThrLysAla AspAsnSerVallleValAlaThrAspSer IlelysAsnThrlleTyrlleThrAlaLys GlnAsnProValThrProProGluLcuPhe GlySerllaLeuGlyThrHisPhalleGlu LysTyrAsnHisIleHisAlaAleHisVal IS AsnlleValCysHisArgTrpThrArgMet AspIleAspGlyLysProHisProKisSer PhelleArgAspSerGluGluLysArgAsn ValGlnValAspValValGluGlyLysGly IleAspIlBLysSerSerLeuSerGlyLeu ThrVelLeuLysSerThrAsnSerGlnPh* TrpGlyPheLeuArgAspGluTyrThrThr LeuLysGluThrTrpAspArglleLeuSer ThrAspValAspAlaThrTrpGlnTrpLys AsnPheSerGlyLeuGlnGluValArgSer 20 HisValProLysPheAspAlaThrTrpAla ThrAlaArgGluValThrLeuLysThrPhe AlaGluAspAsnSerAlaSerValGlnAla ThrMetTyrLysMetAleGluGlnlleleu AlaArgGlnGlnLeuIleGluThrVelGlu TyrSerLeuProAsnLysHisTyrPheGlu IleAspLeuSerTrpHislysGlyLeuGln AsnThrGlylysAsnAlaGluValPheAla ProGlnSerAspProAsnGlyLeuIleLys CysThrValGlyArgSerSerLeuLyeSer 25 LysLeu 9. A recombinant gene according to claim 8, which permits Che expression in the prokaryotic microorganisms. 30 10. A recombinant gene according to claim 9, wherein the DNA sequence contains the followings sequence : \Ε 90255θ ATGTCTGCGG TAAAAGCAGC CAAGGTTCAC AAGGACGAGA CCGTCTGTGT GCTTCTGGAG GACAACAGCG TCATTGTCGC 05 CACCGCCAAG CAGAACCCCG TGGGCACACA CTTCATTGAG AACATTGTCT GCCACCGCTG CCCTCACTCC TTCATCCGCG ACGTGGTCGA GGGCAAGGGC 10 ACCGTGCTGA AGAGCACCAA GTACACCACA CTTAAGGAGA ATGCCACTTG GCAGTGGAAG CACGTGCCTA AGTTCGATGC GAAGACTTTT GCTGAAGATA 15 AGATGGCAGA GCAAATCCTG TACTCGTTGC CTAACAAGCA GGGCCTCCAA AACACCGGCA ACGCCAACGG TCTGATCAAG AAATTG. GCGCTACGGC AAGGACAATG TTCGCGTCTA AGACCGGTGT CCAGACGGTG TACGAGATGA GGTGAGATTG AGACCTCTTA CACCAAGGCC AACCGACTCC ATTAAGAACA CCATTTACAT TTACTCCTCC CGAGCTGTTC GGCTCCATCC AAGTACAACC ACATCCATGC CGCTCACGTC GACCCGGATG GACATTGACG GCAAGCCACA ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ATCGATATCA AGTCGTCTCT GTCCGGCCTG CTCGCAGTTC TGGGGCTTCC TGCGTGACGA CCTGGGACCG TATCCTGAGC ACCGACGTCG AATTTCAGTG GACTCCAGGA GGTCCGCTCG TACCTGGGCC ACTGCTCGCG AGGTCACTCT ACAGTGCCAG CGTGCAGGCC ACTATGTACA GCGCGCCAGC AGCTGATCGA GACTGTCGAG CTATTTCGAA ATCGACCTGA GCTGGCACAA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT 11. A recombinant gene according to claim 8, which permita the expression in the eukaryotic cells. 12. A recombinant gene according to claim 11, wherein the DNA sequence contains the following sequence : - 94 atgtctgctg ttaaggctgc tagatacggt aaggacaacg ttagactcta CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT 05 CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG 6ACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG Φ ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC'ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG. 13. A recombinant gene according to claim 8, which permits Che expression in the animal cells. 14. A recombinant gene according to claim 13, wherein the DNA sequence contains the following sequence : 5'-ATGTC CGCAGTAAAA GCAGCCCGCT ACGGCAAGGA CAATGTCCGC GTCTACAAGG TTCACAAGGA CGAGAAGACC GGTGTCCAGA CGGTGTACGA GATGACCGTC TGTGTGCTTC TGGAGGGTGA GATTGAGACC TCTTACACCA AGGCCGACAA CAGCGTCATT GTCGCAACCG ACTCCATTAA GAACACCATT TACATCACCG CCAAGCAGAA CCCCGTTACT CCTCCCGAGC TGTTCGGCTC CATCCTGGGC ACACACTTCA TTGAGAAGTA CAACCACATC CATGCCGCTC ACGTCAACAT TGTCTGCCAC CGCTGGACCC GGATGGACAT TGACGGCAAG CCACACCCTC ACTCCTTCAT CCGCGACAGC GAGGAGAAGC GGAATGTGCA GGTGGACGTG GTCGAGGGCA AGGGCATCGA TATCAAGTCG TC.TCTGTCCG GCCTGACCGT GCTGAAGAGC ACCAACTCGC AGTTCTGGGG CTTCCTGCGT GACGAGTACA CCACACTTAA GGAGACCTGG GACCGTATCC TGAGCACCGA CGTCGATGCC ACTTGGCAGT GGAAGAATTT CAGTGGACTC CAGGAGGTCC GCTCGCACGT GCCTAAGTTC GATGCTACCT GGGCCACTGC TCGCGAGGTC ACTCTGAAGA CTTTTGCTGA AGATAACAGT GCCAGCGTGC AGGCCACTAT GTACAAGATG GCAGAGCAAA TCCTGGCGCG CCAGCAGCTG ATCGAGACTG TCGAGTACTC GTTGCCTAAC AAGCACTATT TCGAAATCGA CCTGAGCTGG CACAAGGGCC TCCAAAACAC CGGCAAGAAC GCCGAGGTCT TCGCTCCTCA GTCGGACCCC AACGGTCTGA TCAAGTGTAC CGTCGGCCGG TCCTCTCTGA AGTCTAAATT G 20 preceded by a non-translated 5' sequence favoring expression in animal cells 15. Recombinant gene according to claim 14, wherein the non-translated 5’ sequence favoring expression in animal cells comprises the sequence AGCTTGCCGCCACT, located immediately upstream from the sequence described in claim 14. 25 16. An expression vector carrying a recombinant gene according to any one of claims 8 to 15 with the moans necessary for its expression. 17. An expression vector according to claim 16, which carries at least one selection mariner. 30 18. An expression vector according to claim 17, which has the characteristics of one of plasmids pEMR469, pEKR473, and pEMR 515. 19. Prokaryotic microorganisms which are transformed by an expression vector according co claim 16, carrying a recombinant gene according to claim 9. 20. Eukaryotic cells which are transformed by one of the expression vectors according to any one of claims 16 to 18, carrying the recombinant gene according to claim II. 21. A strain of Saccharomyces cerevisiae which is transformed 05 by one of the expression vectors according to any one of claims 16 to 18. 22. A strain according to claim 21, which carries a mutation on at least one of the genes responsible for the synthesis of leucine or uracil. 10 23. A strain according to claim 22, which carries o mutation on at least on of the LEU2 and URA3 genes. 24. A process for producing a recombinant urate oxidase which comprises the steps of : 1) cultivating a strain according to claims 21 to 23 ; 15 2. ) lysing the cells ; 3. ) isolating and purifying the recombinant urate oxidase contained in the lysate. 25. Animal cells containing a recombinant gene according to claim 13 with the means necessary for its expression. 20 26. Animal cells containing an expression vector according to claim 16, carrying a recombinant gene according to claim 14. - 97 27. A protein having urate oxidase activity according to Claim 1, substantially as herein described in the Examples. 28. A pharmaceutical composition containing a drug according to Claim 7, or a pharmaceutically acceptable salt 5 thereof, together with a physiologically acceptable carrier. 29. A recombinant gene according to Claim 8, substantially as herein described in the Examples and with reference to the drawings. 10 30. An expression vector according to Claim 16, substantially as herein described in the Examples and with reference to the drawings. 31. A prokaryotic microorganism or a eukaryotic cell or a strain of Saccharomyces cerevisiae according to Claim 19, 15 Claim 20 or Claim 21 respectively, substantially as herein described in the Examples. 32. A process for producing a recombinant urate oxidase according to Claim 24, substantially as herein described in the Examples. 33. Recombinant urate oxidase whenever produced by a process according to Claim 32. 34. An animal cell containing a recombinant gene or an expression vector according to Claim 25 or Claim 26 5 respectively, substantially as herein described in the Examples. 35. The features described in the foregoing specification or any obvious equivalent thereof, in any novel selection.