CA1273883A - Recombinant dna material comprising bovine growth hormone nucleotide sequence - Google Patents

Abstract

ABSTRACT

A polypeptide product is produced by ex-pression in yeast of a recombinant DNA material comprising a bovine growth hormone nucleotide sequence.

Description

1~738~

The present application is a division of Canadian application No. 448,315 filed February 27, 1984 and relating to the use of the GALl yeast pro-moter.
- Developments in recombinant DNA technology have enabled the cloning in bacteria of the natural coding sequence of a variety of genes. [See Seeburg, P.H., Shine, J., Martial, J.A., Baxter, J.D. and Goodman, H.M., Nature 270, 486-494 (1977) and Shine, J., Seeburg, P.H., Martial, J.A., Baxter, J.D. and Goodman, H.M., Nature 270, 494-499 (1977); Keshet, E., Rosner, A., Bernstein, Y., Gorecki, M. and Aviv, H., Nucleic Acids Res. 9, 19 (1981)i Miller, W. L., Martial, J. A. and Baxter, J.D., J. biol. Chem. 255, 7521-7524 (1980)]. Recently, recombinant DNA
techniques have been described in which a foreign protein is cloned and expressed in yeast. Evidence for foreign gene expression in yeast came from studies on the _ vivo transcription of a rabbit globin gene introduced into Saccharomyces cerevisiae on a yeast plasmid vector. [See Beggs, 3.D., van den Berg, J., van Obyen, A., and Weissmann, C., Nature 283, 835-840 (1980)].
In an attempt to maximize expression of foreign genes in yeast, their 5'-promoter region, translation start and signal peptide sequences were replaced with similar regions from the yeast genome.

, . .

lX73~3 With bovine growth hormone, these regions were re-placed with those from the yeast alcohol dehydrogenase (ADHl) gene. Full length, biologically active bovine growth hormone molecules were produced in yeast. [See Hitzeman, R. A., Hagie, F.E., Levine, H.L., Goeddel, D. V., Ammerer, G., and Hall, B.D., Nature 295, 717-722 (1981)]. Other promoters were employed but demonstrated much less gene expression. The ability of having a single strong promoter is highly useful to permit the attainment of substantial levels of ex-pression for a variety of genes in yeast.
In accordance with the invention of the parent application, it has been discovered that promoters for the GALl galactokinase gene are such a ; promoters. ln addition, these promoters are under glucose repression. Thus, it becomes practical to clone any one of a variety of genes including bovine growth hormone, interferon, pre-prorennin and proren-nin in yeast with expression maximized by direction of a yeast GALl promoter.
According to the invention of the parent application, the expression of a gene for a desired polypeptide product is controlled by a GALl promoter of a yeast strain such as Saccharomyces cerevisiae.
The GALl promoter is a DNA segment that contains the .
~ -2-- ', - . .

:' ' - ~ ', ~ . . .

i~73~3 transcription start signal for galactokinase in yeast.
The sequencing information for the GALl promoter is shown in Table 1.

-:' . ' ' ' ' , .

1;~'7~
T~LE I .
LISTING O~ THE SEQUENCE GAL125 AND GAL126 GAATTcGAcAGGTTATcAGcAAcAcAGTcATATccATTcTcAATTAGcTc TACCACAGTGTGTGAACCAATGTATCCAGCACCACCTGTAACCAAAACAA

TTTTAGAAGTACTTTCACTTTGTAACTGAGCTGTCATTTATATTGAATTT

TCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATC

ATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATC

TAATCTACTATATGTTGTGGTATGTAAAGAGCCCCATTATCTTAGCCTAA
310 320 330 3~0 350 AAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCT

ATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAG

GAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAAC

GCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATA

CTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCAC
560 570 580 . 590 600 AAACCTTCAAATGAACGAATCAAATTAACAAÇCATAGGATGATAATGCGA

TTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATT

TTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAA

~4--1;~7;~
TABLE I (contlnued)-CTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTC [
MATGTMT

ATCC [GAL126]
AAAAGTATcAAcAAAAAATTGTTAATATAccTcTATAcTTTAAcGTcAAG

GAGAAAAAACCCCGGATCC [GAL125]

-4a-., ~;~738OE~

A DNA segment is provided which contains a GALl promoter linked to a gene foreign to the yeast genome for directing the expression of the gene within a yeast cell. The segment is preferably a 0.755 or 0.82 kilobase DNA sequence from the yeast genome that contains signals for transcription of the GALl gene into mRNA and subsequent translation of the mRNA. The coding sequence for galactokinase is not present in this DNA fragment.
In a method for obtaining expression of a desired polypeptide product in yeast, a yeast GALl promoter is inserted in vitro in front of the gene for that polypeptide product which is contained in a chromosome or plasmid. These vectors are used to transform cells and this new genetic information is maintained in the cell and passed on to its progeny.
Synthesis of a polypeptide product using a GALl promoter is advantageous for several reasons:
-GALl promoters are strong, leading to synthesis of significant amounts of polypeptide product, -the GALl promoter activity can be regulated by changing the yeast's carbon source permitting propagation Gf the yeast without the potentially deleterious effects of polypeptide production, since overly high levels of the product may be toxic to cells, ~t7;~8~3 -construction of a yeast strain with these properties is particularly desirable for commercial production of polypeptide products because of existing large-scale yeast fermentation technology and also because of the low toxicity of S. cerevisiae.
The invention of the present divisional application relates to a recombinant DNA material comprising the following bovine growth hormone nu-cleotide sequence:

1~73~83 oVlC~o o_l--o oa~o o- ~--o oct~o ov~o c ~ E
~ ~ a~ ~ _ ~: a~ t ~ ~ ~ ~ t C t ~ L, ~ C~ ~
~ ~ v~ t _ ~ o ~ ~ ~ o ~ ~ _ ~ ~ v~ cr ~ ~ ~ ~ a~ ~ z o ~t~ ~ C t~ L ~ L ~ ~ c,~ ~ t~
o ~ ~o~ ~ ~ o ~o~ ~ o ~ o ~o ~-- o ~ ~
cn~ ~ a ~ e ~ c ~L ~ o c~ ~ ~ L ~ ~ ~ c ~ ~ ~ e _ ~ ~ ~ ~ L ~ _ e ~ u ~ ~ ~ ~

~ e E~ ~ ~ ~S a~ _~ ~ ~
I~ ~ ~ ~ L ~ ~ ~ ~ ¢
~t o ~ ~ e~

c~ Q~ n ~-- ~ ~ ~1-- a ~ ~ C~ ~ ~ ~
~,~ ~ ~ ` ~ ~ O ~ ~ ~ ~ c~ L 1-- v~ ~ _ e~ c~ q v.~ Q~ ~ e u~ _ ~ ,~ ~ o ~o ~ ~ o ~ ~ tl~ o QI ~ o ~ o v ~ ~
~ S~- ~ ~ ~ ~ e .!~ ~ ~ ~ ~ Q~ ~ V~ E ~: E S
--~ L l~ ~ c ~ _ t_~
~ ~ ~ e ~e c ~ ~0 t ~ ~ c e~
e~ , cn~ a~ ~ _~ v.~ ~e a~s c ~ L ~ ~ ~ ~e ~ ~
~ ~ ~ L t-- L ~ C~ -- L
o ~ ~ ~ ~ ~ ~ c c~
L t~ 0 ~--~ 1-- --~ :~et: ~,~ .
~ ~ cn~ _ e ~
~ ~ e _ ~ V ~ U ~ --~1: _ ~ ~ ~ Vl v~ ~7~-- ~ ~ ~C!~ Ll-- L~ ~--u~ c ~s e ~_ 0 ~ ~ ' e ~
O ~ ~ O ~ t~ ~ ~ ~ ~ ~I L t~
-'' ' : : ' ~: ' -- , , --The present divisional application is also directed to the polypeptide product produced by expression in yeast of the nucleotide sequence defined above.
Microorganisms prepared by the genetic engineering processes described herein are exemplified by cultures now on deposit with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland. These cultures were deposited by Collabora-tive Research, Inc. and are identified as follows:
Accession Number 20643, Strain DesignationCGY196, deposited September, 1982;
Accession Number 20661, Strain Designation CGY457, deposited February, 1983;
Accession Number 20662, Strain Designation CGY461, deposited February, 1983;
Accession Number 20663, Strain Designation CGY528, deposited February, 1983.
As more fully described below, a particular DNA segment is linked to a gene foreign to the yeast genome and incorporated in a modified strain of Saccharomyces cerevisiae so that it produces a poly-peptide product under the control of a GALl promoter of the yeast galactokinase gene. The S. cerevisiae is genetically transformed with a novel recombinant DNA
plasmid. The plasmid was constructed by ligation of DNA segments from the E. coli plasmid pBR322, yeast , :
. ~ , . . ~ .

t;~

genomic and plasmid DNA's, and synthetic DNA linkers.
The construction of plasmid pBR322, sequenced by J.G.
Sutcliffe, Cold Spring Harbor Symposium 43, 77-90 (1979), is shown diagrammatically in Table 2.

_ HindIII
E~Rl \ ~

Bcl pBR322 ~ Aval Ball P~~I

1~'7;~

Clal HindIII
E~RI \,~
~ Ba~T~I

Ylp5C~aIII

AvaI

~/Ura3 /\ BalI

P~l :

1;~7;~383 Generally, in preparing the plasmid for joining with the exogenous gene, a wide variety of techniques can be used, including the formation of or introduction of cohesive termini. slunt ends can be joined. Alternatively, the plasmid and gene may be cleaved in such a manner that the two chains are cleaved at different sites to leave extensions at each end which serve as cohesive termini. Cohesive termini may also be introduced by removing nucleic acids from the opposite ends of the two chains or alternatively, introducing nucleic acids at opposite ends of the two chains. Methods which may be employed in joining cleaved DNA segments depend on the nature of the termini, as described below.
~ Blunt-ended" refers to DNA molecules with duplex base-paired termini. ~See Sgaramella, V., van de Sande, J.
H., and Khorana, H. G., Proc. Nat. Acaa. Sci. USA 67, 1468-1475 (1970).) The DNA blunt-end termini may be joined by T4 DNA ligase with an apparent Rm of about 50~M DNA
5'-ends. (Sugino, A., Goodman, H. M., Heyneker, ~. L., Shine, I., Boyer, H. W., and Cozzarelli, N. R., J. Biol.
Chem. 252, 3987-3994 (1977).) Blunt-ended DNA's are produced as for example, by cleavage with any of a number of restriction endonucleases, such as HaeIII. Alternatively, random shear breakage or a restriction enzyme making staggered cuts, such as EcoRI, HindIII, or BamHI, may be used, but the DNA termini must then ... . . .. . . . .
' - ' -' .

' ' ' " ' ~ ' 1.;~73~33 be made blunt by bioche~ical methods. Such biochemical methods include incubation with single-strand-specific nuclease Sl, as described in the following articles:
Ulbrich, A., Shine, J., Chirgwin, J., Pictet, R., Tischer, E., Rutter, W. J., and Goodman, H. M., Science 196, 1313 ~1977); Maniatis, T., ~ardison, R. C., Lacy, E., Lauer, G., O'Connell, C., Guon, D., Sim, G. X., and Efstratiadis, A., Cell 15, 687 (1978); Scheller, R. H., Thomas, T. L., Lee, A.
S., Klein, W. H., Niles, W. D., Britten, R. J., and Davidson, H., Science 196, 197 (1977); and Charnay, P., Perricaudet, M., Galibert, F., and Tiollais, P., Nucleic Acids Res. 5, 4479 (19781. Alternatively, blunt termini can be created by incubation with T4 DNA polymerase [see Itakura, K., Hirose, T., Crea, R., Riggs, A. D., Heyneker, H. L., Bolivar, F., and Boyer, H. W., Science l9B, 1056 (1977); and Fraser, T. H., - and Bruce, B. J., Proc. Nat. Acad. Sci. USA 75, 5936 (1978)], E. coli DNA polymerase lsee Seeburg, P. H., Shine, J., Martial, J. A., Baxter, J. D., and Goodman, H. M., Nature 270, 486 ~1977); Heffron, ~., So, M., and McCarthy, B. J., Proc. Nat. Acad. Sci USA 75, 6012 (1978); and Backman, K., Ptashne, M. and Gilbert, W., Proc. Nat. Acad. Sci. USA 73, -4174 (1976)~, and reverse transcriptase [see Ulbrich, A., Shine, J., Chirgwin, J., Pictet, R., Tischer, E., Rutter, W.
J., and Goodman, H. M., Science 196, 1313 (1977)] with added deoxynucleotide triphosphates.

.~

, .

' ' ' ~ ' -.
.' ~ ', ' ~ Cohesive-ended~ refers to DNA molecules with single-stranded termini. The ~ingle-stranded extensions are complementary and antiparallel. (See Mertz, J. E., and Davis, R. W., Proc. Nat. Acad. Sci. ~SA 69, 3370-3374 (1972).) Joining of base-paired duplexes occurs when the nucleoside at a 5'-end carries a phosphate group and the co~plementary nucleoside opposite to it carries a free 3'-hydroxyl group. Two phosphodiester bonds would be made essentially simultaneously and the joined duplexes would have their nucleotide seguence inverted with respect to one another.
There are three general approaches to creating cohesive-ends on DNA:
1. digest DNA with type II restriction endonucleases that introduce staggered scissions at unique sequences;

2. treat linear DNA molecules with terminal deoxynucleotidyl transferase to generate single-stranded tails of either poly(dA) and poly(dT) or poly(dC) and poly(dG) at the 3'-hydroxyl terminus of different populations of DNA molecules;
and

3. add to blunt-ended molecules linkers, which are - short duplexes containing a restricton endonuclease cleavage site. Such linkers are joined to DNA by T4 DNA-ligase catalyzed blunt-end joining. After ~'7~ ~8~

digesting the product with the restriction enzyme that cleaves the linker, the DNA is terminated with cohesive ends.
These methods are well known, as exe~plified in the following articles: Sadler, J. R., Betz, J~ L., Teiklenburg, M., Goeddel, D. V., Yansura, D. G., and Car~thers, M. H., Gene 3, 211 (1978); Bahl, C. P., Marians, K. J., Wu, R., Stawinsky, J., and Narang, S. A., Gene 1, 81 (1976); and Scheller, R.
H., Dickerson, R. E., Boyer, H. W., Riggs, A. D., and Itakura, K., Science 196, 177 (1977).
~ Linker" refers to a duplex, blunt-ended DNA molecule from 6-14 base pairs in length, containing the recognition site for a restriction endonuclease that produces cohesive termini.
In the preferred embodiment of the present invention, the plasmid serves as the vehicle for introduction of the foreign gene into the yeast cell. However, it is not necessary to ùse a plasmid, since any molecule capable of replication in yeast can be employed. The DNA molecule can be attached to a vector other than a plasmid, which can be a virus or cosmid as known in the art; or it can be integrated into the chromosome.
The recombinant plasmid or plasmid chimera is constructed in vitro. Since the annealing and ligation process not only results in the formation of the recombinant plasmid, but also in the reclrcularization of the plasmid vehicle, a mixture of .

1 ~ 7~
ligation products is obtained involving the original plasmid and the foreign DNA. Only the original plasmid and the DNA
chimera consisting of the plasmid vehicle and linked foreign DNA will normally be capable of replication. When the mixture is employed for transformation of the bacteria, replication of both the plasmid vehicle genotype and the foreign genotype will-occur.
The transformation of the bacterial cells will result in a mixture of bacterial cells, the dominant proportion of which will not be transformed. Of the fraction of cells which are transformed, some significant proportion, but in some cases a minor proportion, will have been transformed by recombinant plasmid. In any event, only a very small fraction of the total number of cells which are present will have the desired phenotypic characteristics.
In order to isolate only the bacteria containing the DNA
chimera or the original plasmid, a selectable genetic marker is included on the original plasmid, such as resistance to an antibiotic or heavy metal. The cells can then ~e grown on ~a 20 agar medium containing the growth inhibiting substance.
Since E. coli is used as the bacteria for transformation in the present invention, ampicillin is used as the growth inhibiting material to afford selection in E. coli. Only available cells hav;ng the resistant genotype will survive.
If the foreign gene does not provide a phenotypical property, which allows for distinction between the cells transformed by ' ~ .

the plasmid vehicle and the cells transformed by the plasmid chimera, a further step is necessary to isolate the replicated plasmid chimera from the replicated plasmid vehicle. The steps include lysing of the cells and isolation and separation of the DNA by conventional means or random selection of transformed bacteria and characterization of DNA
from such transformants to determine which cells contain molecular chimeras. This is accomplished by physically characterizing the DNA by electrophoresis, gradient centrifugation, sequence analysis or electron microscopy.
Cells from various clones may be harvested and the plasmid D~A isolated from these transformants. The plasmid DNA may then be analyzed in a ~ariety of ways. One way is to treat the plasmid with an appropriate restriction enzyme and analyze the resulting fra~ments for the presence of the foreign gene. Other techniques have been indicated above.
Once the recombinant plasmid has been replicated in E.
coli and isolated, the E. coli may be grown and multiplied and the recombinant plasmid employed for transformation of the S. cerevisiae strain.
The term GALl promoter as employed in the present invention, also designated PGALl, is preferrably either a 0.755 or 0.82 kilobase DNA sequence from the yeast genome which contains signals for transcription of the GALl gene into mRNA and subsequent translation of the mRNA. The coding sequence for galactokinase is not present in this DNA

-` - - .. . .....
.
.

~2~3~83 fraqment, but ~he fragment can direct the expression of foreign genes and the regulation follows the mode for the GALl gene. (See St. John, T. P. and Davis, R. W., J. Mol.
Biol. 152, 285-315 (1981).]
The bovine growth hormone gene referred to, which can be promoted by the promoter used in this invention, is a protein of about 22,000 daltons synthesized in anterior pituitaries.
The hormone is required for pre-adult growth. Bovine growth hormone (BGH) contains a single polypeptide of 191 amino 10 acids with two disulfide bridges synthesized initially as a pre-growth hormone containing an amino-terminal extension of 26 amino acid residues. [See Miller, W. L., Martial, J. A.
and Baxter, J. D., J. Biol. Chem. 255, 7521-7524 (1980);
Xeshet, E., Rosner, A., Bernstein, Y., Gorecki, M. and Aviv, ~., Nucleic Acids Res. 9, 19-30 (1980); and Lingappa, V. R., - Deviller-Thiery, A. and Blobel, G., Proc. Nat. Acad. Sci. USA
74, 2432-2436 (1977).1 The interferon gene referred to, which can be promoted by the promoter used in this invention, ls any one of the three 20 classes of interferon qenes described below:
(a) leukocyte - derived from leukocyte or lymphoblastoid cells, designated LeIFN or IFN-~;
(b) fibroblast - derived from fibroblast cells, designated FIFN or IFN-B; and (c) lmmune - derived from mitogen- or antigen-stimulated lymphoid cells, designated IFN-~.

r ~
'~

_. .. . ~. ...
~, .
' ~ ' ' : . .
.

~ 3~83 Such interferon genes are described in -Goeddel, D. V., Leung, D. W., Drell, ~. J., Gross, M., Lawn, R. M., McCandliss, R., Seeburg; P. H., Ullrich, A., Yelverton, E., and Gray, P. W., Na ure 290, 20-26 (1981).
-Allen, G. and Fantes, K. H., Nature 287, 408-411 (1980) and preceding reference.
-Zoon, X. C., Science 207, 527-528 (1980~.
-Mantei, N., Schwartzstein, M., Streuli, M., Panam, S., Nagata, S., and Weissman, C., Gene 10, 1-10 (1980).
-Streuli, M., Nagata, S., and Weissman, C., Science 209, 1343-1347 (19801-Preferably in the methods of this invention pre-prvrennin and prorennin can each be obtained by isolation of pre-prorennin DNA material. The pre-prorennin is a precursor of prorennin. By removing portions of the pre-prorennin DNA, one could obtain genetic material which will code for prorennin.
Pre-prorennin or prorennin genes in accordance with this invention comprise any nucleotide sequences coding for the amino acid sequence of pre-prorennin or prorennin respectively and exclude any intervening nucleotide sequences present in the genomic DNA encoding pre-prorennin or prorennin respectively. These genes are also provided attached to vectors which replicate in suitable host cells.

-:' ' . ' ' . ' ' , , ~7~8~3 For the purposes of this application, the prorennin gene is defined as any sequence of nucleotides which codes for the prorennin molecule, the amino acid sequence of which is described in the literature (8. F~ltmann, V.B.Pedersen, H.Jacobsen, D.Rauffman, and G.Wybrandt, Proc. Nat. Acad. Sci.
USA 74, 2321-2324 11977).
The pre-prorennin gene includes the sequence of nucleotides coding for prorennin, but also includes 48 additional nucleotides on the ~' end which code for the amino-terminal precursor polypeptide found on the pre-prorennin enzyme.
The yeast strain employed as the host cell in the preferred embodiment of the present invention is Saccharomyces cerevisiae, a common laboratory strain of yeast used for its low toxicity and well-known genetic characteristics. This strain is readily cultivatable on a large scale. However, the recombinant DNA material of the present invention containing a GALl promoter can be used to express a polypeptide product in any yeast cells capable of transformation, including yeast mutants that alter regulation.
Saccharomyces cerevisiae is a yeast whose vegetative reproduction occurs by multilateral budding cells. Such cells are usually found in pairs or small clusters. The species $s usually diploid where spores are produced directly in vegetative cells, but the species can also be grown in higher ploidy. In addition, S. cerevisiae forms an ascus , ~ - 1 9 - .

.

`

`, ~ ,`, :
~''-: . ' ~ , ' ' 1 ~ 73 ~

with one to four spheroidal spores in each ascus. The ascusfor this 6pecies does not rupture at maturity. The yeast has a strongly fermentative as well as respiratory metabolism.
Selected ~trains are referred to as distillers' yeasts and baker'~ yeast.
The vast majority of yeasts can be cultivated under relatively uniform conditions on common laboratory media.
The usual growth requirements of yeast include:
ta) organic carbon compound for carbon and energy;
(b) organic or inorganic nitrogen for the synthesis of proteins and nucleic acids;
(c) various minerals (including compounds furnishing trace elements); and (d) frequently a mixture of vitamins.
Such growth requirements are met by yeast nitrogen base (YNB, obtained from Difco), a chemically defined medium which contains a number of trace elements, 9 vitamins, trace amounts of amino acids to stimulate growth of certain fastidious yeasts and the principal minerals, potassium phosphate, magnesium sulfate, sodium chloride, and calcium chloride. The nitrogen source is ammonium sulfate. The desired carbon source must be added and is normally at a concentration of 0.5 - 3~. Additions are made to this medium to fit particular strain requirements. The pH range of the medium is usually from pH 3 - 8. The preferred range is pH 4.5 - 6.5.

-- .

.

~738~

The starting point for obtaining the cells o~ the present invention is the use of recombinant DNA techniques known in the art to obtain the genetic material desired and to insert it into the host cell after which the host cell is cloned.
Preferably, the gene which one wishes to ultimately clone in yeast is isolated in a first step by obtaining messenger RNA of the gene from a primary source. In the case of BGH, this is obtained by isolation from the bovine pituitaries.
The messenger RNA can be isolated as by the method of Deeley, et al. (R.G. Deeley, J.I.Gordon, A.T.H. Burns, R.P. Mullinix, M.Bina-Stein, R.E. Goldberger J.Biol.Chem. 252 8310-8319 tl977]) and poly A-enriched RNA can be obtained by chromatography over oligo (dT) cellulose by the method of R.C. Desrosiers, K.H. Friderici, ~ F.M. Rottman Biochemistry -

4 4367-4374 (19751.
The messenger RNA is then converted to double-stranded DNA by conventional means. First, the complimentary copy of the DNA is made from the messenger RNA by conventional recombinant DNA means as by the use of AMV reverse 20 transcriptase. For example, the methods of A. Efstratiadis, .C. Kafatos, A.M. Maxam and T. Maniatis, Cell 7 279-288 (1976), R.Higuchi, G.V. Paddock, R.Wall and W.Salser, Proc.
Nat. Acad_.Sci. USA 73, 3146-3150 (1976), D.L.Kacian and J.C.
Myers, Proc. Nat. Acad. Sci. VSA 73, 2191-2195 (1976), M.P.
Wickens, G.N. Buell and R.T. Schimke, J. Biol. Chem. 253, 2483-2495 (1978), G.M.Wahl, R.A. Padgett and G.R. Stack, J.

~ ., .... ,_ _. . . . . . .. .
~ ~' Biol. Chem., 254, 8679-8689 (1979) can be used to obtain the copy DNA (cDNA). The RNA portion can be disposed of by breaking the ctrands as known in the art using any of the above methods or by heat denaturing according to the method of Wickens, et al. (1978).
Next, enzymes such as E. coli DNA polymerase I or AMV
reverse transcriptase can be used to turn the cDNA into double-stranded DNA using the methods of the publications above and J.I. Gordon, A.T.H. Burns, J.L. Christmann & R.G.
Deeley, J. Biol. Chem. 253, 8629-8639 (1978).
Thirdly, synthetic linkers can be attached to both ends of the double-stranded DNA as for example by the use of Hind~II or EcoRI synthetic oligonucleotide linkers using conventional methods such as described in R.H. Scheller, T.L.
Thomas, A.S. Lee, W.H.Klein, W.D. Niles, R.J. ~ritten and E.H. Davidson, Science 196, 197-200 (1977), T.H. Fraser and B.J. Bruce, Proc. Natl. Acad. Sci. USA 75 5936-5940 (1978), A. Ullrich, J. Shine, J. Chirgwin, R. Pictet, E. Tischer, W.J. Rutter & H.M. Goodman, Science 196, 1313-1319 (1977), J.
Shine, P.H. Seeburg, J.A. Martial, J.D. Baxter & H. M.
Goodman, Nature 270, 494-499 (1977), or P.H. Seeburg, J.
Shine, J.A. Martial, J.D. Baxter & H.M. Goodman, Nature 270, 486-494 (1977).

;:~

~ -22-"

~' ' .. .

. . .
: : ~ ', ' `' - . ~ `
'- . :, : ~ ` ' . ' - ' : ' `

1~7~3 In a fourth step, thè DNA molecule is integrated into the chromos~me or attached to a vector which can be a plas~id, virus or cosmid as known in the art. Such vectors include:
pBR322 (F.Bolivar, R.L.Rodriguez, P.J. Greene, M.C.
Betlach, H.L. Heyneker, H.W. Boyer, ~.H. Crosa, S.
Falkow, 1977 Gene 2 95-119) pMB9 (R.L. Rodriguez, F. Bolivara, H.M. Good~an, H.W. Boyer, M.C. Betlach in ~Molecular Mechanisms in the Control of Gene Expression~ lD.P. Nierlich, W.J. Rutter, C.F. Fox, Eds.] 471 Academic Press New York 1976) pSC101 (S.N. Cohen, A.C.Y. Chang, H.W. Boyer, R.B.
Helling 1973 Proc. Nat. Acad. Sci. USA 70 3240) ~ gtWES (D.Tiemeier, L. Enquist, P. Leder Nature 263 526-52~) (1976) ~charon phages (F.R. Blattner, et al Scienc~ 16 161-169) (1977) fl R229 (J.D. Boeke Molec. Gen. Genetics 181, 288-291) (1981) pJC75-58 (J. Collins Methods in EnzYmologY 68 309-326) (1979) This step is again carried out outside of the final host cell. Useful techniques for this procedure are described in the references above in connection with the linkers as well as in the following publications: V. Hershfield, H.W. Boyer, C. Yanofsky, M.A. Lovett & P.R. Helinski, Proc. Natl. Acad.
Sci. USA 71, 3455-3459 (1974), N.E. Murray ~ R. Murray, ~, . . . . . . .. . . . .. . . . ..
: ' ' - ' . "
~ ~' ~' ' ` -'` ' 3~8;3 Nature 251, 476-482 (1974), F.R. Blattner et al, Science 196, 161-169 (1977).
In a fifth step, the recombinant DNA molecule can be introduced into the cytoplasm of the host cell line using conventional procedures such as described in M. Mandel ~ A.
Higa (1970) J. Mol. Biol. 53 159-162, P.C. Wensink, D.J.
Finnegan, J.E. Donelson & D.S. Hogness, Cell 3, 315-325 (1974), S.N. Cohen, A.C.Y. Chang and L. Hsu, Proc. Natl.
Acad. Sci. USA 69, 2110-2114 (1972), B.M. Goodman, and R.J.
MacDonald, Methods_in EnzYmolo~ 68, 75-90 (1979), E.M.
Lederberg and S.N. Cohen, J. Bact. 119, 1072-1074 (1974).
Recognition of the correct clone may be accomplished by the method of hybridization selection or by probing with synthetic oligonucleotides, (T. Taniguchi, Y. Fu~ii, Ruriyama and M. Muramatsu, Proc. Natl._ Acad._Sci. USA 77, 4003-4006 (1980), R.P. Ricciardi, J.S. Miller & B.E. Roberts, Proc.
Natl. Acad. Sci. USA 76, 4927-4931 (1979), D.L. Montsomery, B.D. Hall, S. Gillam and M. Smith, Cell 14, 673-680 [1978]).
The newly modified host cell is then cloned and expression of the material desired obtained. ~or example, the technique of Guarente, et al. using the lactose operon promoter, (1980) (L. Guarente, G. Lauer, T.M. Roberts & M.
Ptashne, Cell 20, 543-553 ~1980], L. Guarente, T.M. Roberts M. Ptashne, Science 209, 1428-1430 [1980]) allows one to obtain and optimize expression of foreign DNA.
In the present invention, the arrangement of the DNA
segments in the plasmid construction is shown diagramatically in Table 4.

.

1,c:7~883 . . _ jl 2 5 ) Amp / C4) ~ \ X' E. coli origin _ _ 2~2) (3~ ~
origin \ ~ /URA3 ... ,. . ~ . , , . .. . . _ . .... . . . .. .... . .
-- . ,: , , - : - - ', - .
.
.

1;~73~8;~
This construction consists of several components generally used ~n ~huttle~ vectors, i.e., plasmids that can be maintained either in E. coli or yeast. The plasmid described in Table 4 is a modified construction of plasmid YIp5, as described`by K. Struhl, D. T. Stinchcomb, S. Scherer and R. W. Davis, Proc. Nat. Acad. Sci. USA 76, 1035-1039 . . .
(1979) [see Table 3]. Segment ~1) is a 2.4 kilobase fragment of plasmid pBR322 and contains a DNA replication origin and B-lactamase gene, allowing propagation of the DNA in E. coli and continuous selection for its presence by ampicillin resistance. Segment (2) is a 1.6 kilobase HpaI to HindIII
fragment of the yeast 2~plasmid containing an initiation site for replication in yeast. lThe 2~ plasmid is described by J. L. Hartley and J. E. Donelson, Nature 286, 860-865 (1980)]. Segment (3) is the URA3 gene from the yeast genome (1.1 kb long) to allow the selection of yeast harboring the plasmid by virtue of its complementation of the ura3 mutation in the host strain. lThe URA3 gene is described by M. Bach, F. Lacroute and D. Botstein, Proc. Nat. Acad. Sci.
20 USA 76,386-390 (1979).1 Segment (4) is a 0.755 or 0.82 kb fragment of DNA from the yeast genome which contains signals for transcription of the GALl gene into mRNA and subsequent translation of the mRNA. The GALl gene is repressed when the yeast strain is grown ~n high glucose medium. The coding sequence for galactokinase is not present in the 0.755 or 0.82 kb , .
.,' ' ' .

~ ~73~383 fragments. These pieces of DNA can direct the expression of foreign genes and the regulation follows the mode for the GALl gene as herein disclosed.
Segment (5) is a fragment of DNA which encodes for the desired polypeptide product sequence. This piece of DNA is oriented so that transcription of the mRNA is controlled by a GALl promoter. The sequence coding for the signal peptide was removed and an ATG translational initiation codon was incorporated. Therefore, a gene initiated by methionine is used for the studies.
The plasmid was constructed by ligation of DNA pieces from various sources and synthetic linkers. The sequence at the junction of the 0.82 kb GALl promoter and the foreign gene sequence is:

(I) PGALl - A6 C C C C G G A T C T C G A C C - A T G - X

where X is the foreign gene. The sequence TCGACC is part of a synthetic SalI linker and CCCCGGATC is part of a BamHl - 20 linker.
The sequence at the junction of the 0.755 kb GALl promoter and the foreign gene sequence is:

PGA~ T T A T T C C T C T A C C G G A T C A A - A T G - X, . .. . . . . .

!

t73~83 where X is the foreign gene.
The plasmid was first cloned and amplified in E. coli and then transformed into yeast. Expression levels were determined for various genes using similar constructi~ns. In the case of BGH, for example, a fusion gene of BGH' 'lacZ
replaced the BGH gene (at X) in Figure 3. This construction contains essentially the whole BGH sequence (only the coding sequence for 4 amino acids for the N-terminus is missing) and nearly the whole lacZ gene. By monitoring the ~-galactosidase (lacZ gene product) activity, approximately 80,000 molecules of fusion protein were produced per cell in strain CGY 150 (~ leu2-3 ura3-52 GAL ).
Permissible modlfications in the production of a polypeptide product in yeast would include:
--Different terminators can be used.
--With respect to BGH, the N-terminal amino acid is heterologous for BGH with both phenylalanine (Phe) and alanine ~Ala) being observed. This heterogeneity is a consequence of ambiguous processing of the precursor molecule (pre-growth hormone). The gene described above codes for the Phe-BGH. The other gene for Ala-BGH can also be ùsed for expression.
--Mutations in the GALl promoter (element (4) in Table 4) can affect the level of expression or the mode of regulation. Other mutations in the chromosomal genome may also have the same effects. In fact, there are ; -28-, '' . ' -, . , ~ ''~
.'' ' ' ' ' ~ 8~3 mutants available to turn a GALl promoter on constitutively. These strains can be used to get higher levels of expression.
--The DNA segment containing PGALl linked to the forei~n gene (elements t4) and ~) in Table 4) can be integrated into the yeast chromosome for a stable construction rather than having this segment on an extrachromosomal plasmid.
--The ATG initiation codon in the foreign gene can be replaced by other sequences such as sequences coding for a signal peptide. Further, the protein could be secreted from yeast cells into the medium.
--Different lengths and sequences of DNA can be used at the junction of the GALl promoter and the foreign gene sequence to optimize the level of production. For instance, sequence (I) could be changed to:

(II) PGA~l - A6 C C C C G C A A G C T T A T C G - A T G - X
-Other sequences in this region can be derived by performing mutagenesis.
--Different lengths of the GALl promoter can be used.
--A terminator for transcription from the yeast genome can be added to the C-terminus of the BG~ gene.
--The term GALl promoter, as used herein, includes any portion of a 0.755 or 0.82 kilobase DNA sequence which acts to cause expression of galactokinase in yeast.

.

.. ~ ` .
- . ~ . . .

~ ~ 7~ ~3 The yeast strain described herein will produce the desired polypeptide product if the medium contains galactose. The medium should contain 6.7 g/l yeast nitrogen base, 2% galactose and the appropriate amino acids. If the polypeptide product proves to be ; deleterious to the hoststrain, the production can be repressed by growing the yeast in a medium containing 2% glucose, 6.7 g/l yeast nitrogen base and then inducing the production of the polypeptide product after growth has ceased by transferring the yeast to the galactose me~ium. The cells are centrifuged and the cell-free extract is obtained by breaking cells by vigorous vortexing with glass beads.
The following non-limiting examples illus-trate the inventions of both the parent and divisional applications.

, .

- - , . .

. ~. .- . , ~ .

~738~;~

EXAMPLE l .

Production of Bovine Growth Hormone 1. Isolation of BGH mRNA

Bovine pituitaries were collected shortly after killing and were frozen immediately on dry ice. 14.4 grams of tissue were disrupted by means of a Waring blender into 200 ml of cold buffer (10 C) consisting of 50 mM Tris-HCl, pH 7.5, 8 M
guanidine HCl, and 1 mM dithiothreitol. The resulting solution was centrifuged at 5 C in a Sorval SA600 rotor at 10,000 rpm for 17 minutes. The material was resuspended by homogenization and sat on ice for one hour in 40 ml of cold buffer consisting of 20 mM NaOAc, 20 mM EDTA, and then treated with half volume of ice-cold absolute ethanol. After l hour at -20 C, the precipitate was pelleted by a centrifugation at 3,000 rpm for 30 minutes at -10 C. The pellet was resuspended two times in 20 ml of the preceding buffer, treated with half volume of ice cold absolute ethanol, incubated one hour at -20 C and the pellet collected as decribed previously. The final pellet was resuspended in 8 ml of 0.1 M EDTA with heating at 60 C, and then 0.1 volume of 2M NaOAC, pH 5.0, and 2 volumes of ice-cold absolute ethanol were added and the solution placed at -20 overnight. The RNA precipitate was collected by .

1~ 7 ~

centrifugation at 8,000 rpm for 20 minutes at -10 C, and was dissolved in 5 ml water. The yield was 5 mg RNA. The RNA
solution was diluted with 5 ml of 2x concentrated binding buffer (20 mM Tris-~Cl, pH 7.5; 2mM EDTA, pH 7.0; 0.4~ SDS;
and 0.24 M NaCl). The RNA was applied to a 1.5 ml oligo-dT-cellulose column, the column was washed with lx concentrated binding buffer and then the poly A-containinq RNA (mRNA) was eluted by washing the column with binding buffer containing no NaCl. About 100 mg of poly A-conta;ning RNA were obtained. A portion of the poly A-containing RNA was translated in vitro in a rabbit reticulocyte lysate system [Pelham, H.R.B. and Jackson, R.J., Eur. J. Biochem. 67 247-256 ~1976)] to confirm the isolation of mRNA coding for BGH.

2. Preparation of double-stranded copy DNA (cDNA) About 2.5~ 9 of cDNA was synthesized from 25 ~ 9 of the poly A-containing RNA by incubation for one hour at 42 C in 50 mM
~ris-HCl, pH 8.3; lO0 mM KCl; 8mM MgC12; 0.4 mM
dithiothreitol; 5 mM each dATP, dGTP and dTTP; and 20~ g/ml oligo (-dT)12_18, containing lOO units reverse transcriptase and 1.3~Ci d-32P-dCTP(1.8 Ci/mmole). After heating the reaction mixture at 100 C for 3.5 minutes, quick chilling on ice for approximately 3 minutes and removing the precipitated protein by centrifugation, to the .:. .
~, .. , .. . . ... , . .. . . .. _ _ .
.
-' .
' ~

~ ~73883 supernatant was added HEPES-NaOH, pH 6.9, to 100 mM; MgC12 to 5 mM; dithiothreitol to 0.5 mM; and deoxynucleos~de triphosphates to 0.125 mM. Incubation of this mixture with 300 units of E. coli DNA polymerase I for 2.5 hours at 15 C
produced 1.8,f~9 of double-stranded cDNA. The DNA was phenol extracted, separated from unincorporated triphosphates by chromatography on Sephadex G-100 113.5 ml column, 0.7 cm x 35 cm, eluted with 20 mM NaCl) and ethanol precipitated overnight at -20 C by addition of 1/10 volume 2 M NaOAc, p~

5, and 2.5 volumes cold ethanol. The double-stranded cDNA
was then treated with 8,000 units of Sl nuclease at 37 C for one hour in buffer (0.3 M NaCl, 30 mM NaOAc, pH 4.6, 3 mM
ZnSO4). The reaction was terminated by addition of EDTA to 10 mM, and Tris-HCl, pH 8.3, to 200 mM, and the mixture applied to a Biogel A-150m column (0.75 cm x 40 cm) equilibrated and eluted with 10 mM Tris-HCl, pH 7.5, 250 mM
NaCl and 1 mM EDTA. The peak fractions (0.5 ml each) of large molecular weight DNA were pooled and ethanol precipitated by addition of 1/10 volume 2 M NaOAC, pH 5, and 20 2.5 volumes cOla absolute ethanol.

3. Addition of EcoRI Linkers The Sl-treated double-stranded cDNA (0.21J~g) was incubated in buffer (60 mM Tris-HCl, pH 7.5; 8 mM MgCl; 5 mM
dithiothreitol, 1 mM ATP and 5 mM of each deoxynucleoside .

.
~ -33-~ . -.. . _ _ _ . _ . _ .. . . . . . . . . .
: - . ~ .

, , : .

1 ~ 73 ~ ~

triphosphate) with 9 units of E. coli DNA polymerase ~ at 10 C for 10 m~nutes and then placed on ice. This blunt- ended double ~tranded cDNA was next incubated in 65 mM Tris-HCl, pH
7.5; 6 mN Mg C12; 5 mM dithiothreitol; 1 mM ATP, with 160 pmoles of 32P-labelled EcoRI synthetic linker (lOOx excess over cDNA ends) and 4 blunt-end units of T4 DNA ligase at 15 C for 5 hours, cooled on ice, treated with EcoRI restriction endonuclease (New England Biolabs, 9 units) in 100 mM
Tris-HCl, pH 7.5, 50 mM NaCl, 5.6 mM MgC12 at 37 C for 4 10 hours 45 minutes and then phenol extracted. The reaction was fractionated on a Biogel A-150m column (0.7 cm x 31.5 cm).
Fractions ~0.5 ml each) containing high molecular weight DNA
were pooled and ethanol precipitated.
This double stranded cDNA with EcoRI cohesive termini was then ligated to fl phage CGF4 doùble-stranded DNA which had been cut open with EcoRI restriction endonuclease and treated with calf intestinal alkaline phosphatase by the method of H.
Goodman and R. J. MacDonald [Goodman, H. M. and MacDonald, R.
J., Methods in EnzYmol. 68, 75-91 (1979)~ to remove the terminal phosphates: The ligation reaction contained 60 mM
Tris-HCl, pH 7.5; 6 mM MgC12; 7 mM dithiothreitol; 0.12J~g double-stranded cDNA; 1.2~9 CGF4 DNA; O.S mM ATP and 450 cohesive end units of T4 DNA ligase. Ligation was for 19 hours at 15 C.

' ~, . '' , ,. . . . . . ' , ~' : ' : . '~ - . -.

1~ 73 ~

4. Transfection of E. coli DB4548 with recombinant CGF4 DNA

E. coli strain CGE6 (DB4548; hsdR , hsdM , sup E, sup F, ~1 , met ) was grown in 150 ml tryptone broth at 37 C
with shaking and harvested at OD700=0.5 by centrifuqation at 7,000 rpm for 10 minutes at 4 C. The cells were resuspended in 70 ml ice cold 50 mM CaC12 and allowed to sït at 0 C for 30 minutes. The suspension was then centrifuged at 7,000 rpm for 10 minutes at 4 C and resuspended in 3 ml ice cold 50 mM CaC12. After standing 10 at 0 C for 2 hours the cells were used for transfection.
Either lJ~l or 2 ~1 of 1:40 dilution of ligation reaction in 50 mM Tris-HCl, pH 7.5, was added to each of 12 tubes containing 50 ml sterile 50 mM Tris-HCl, pB 7.5. One-tenth milliliter of the CaC12-treated cells was added to each tube and the mixtures set on ice for 30 minutes. After warming to 37 C for 2 minutes, 0.2 ml of CGE5 (JM101: J.
Messing (1979), F'traD36 proAB lacIZVM15 in a v(lac pro) SupE
thi background) overnight culture and 3 ml of 0.~ soft agar were added, and the mixture poured into tryptone agar plates. Incubation at 37 C overnight produced over 3000 plaques.

..

~ ~ ~ 3 ~8~

5. Identification of a recombinant-CGF4 carrying the bovine growth hormone sequence The plaques were transferred to nitrocelluloses and probed as described by Benton and Davis lBenton, W. D. and Davis, R.
W., Science 196, 180-182 (1977] using a 32P-labelled BGH
cDNA. The phages which hybridize intensely to the cDNA probe were picked from the plates and stored in TY medium at 4 C.
Samples of the intact phage were amplified by growth overnight on CGE5 cells, harvested by centrifugation, and ~ubjected to electrophoresis in a 0.6~ agarose gel containing 0.37 M Tris-glycine, pH 9.5, and stained with ethidium bromide after treatment in 0.2 N NaOH for one hour and neutralization in 0.5 M Tris-HCl, pH 7.4. The migration is inversely proportional to the log of the size of the phage DNA and allowed selection of about 45 phages carrying inserted BGH DNA of size of 600 to 1200 base pairs. Single ~tranded DNA was prepared by the method of Horiuchi, et al.
lHoriuchi, R., Vovis, G. F. and Zinder, N. D., J. Biol. Chem.
249, 543-552 ~1974)1 and hybrid selection was carried out.
The eluted RNA was translated in a reticulocyte lysate system by the method of Pelham and Jackson [Pelham, H. R. D. and Jackson, R. J., Eur. J. 8iochem. 67, 247-256] and alalysis of the protein products revealed the production of authentic immunoprecipitable BGH. Double-stranded RFI DNA was prepared from the phages by the method of Moses, et al. IMoses, P.B., .. ~ .

~ -36-, . , . ~ ~ -- . . .
.:' .~, , ~ ~ 7~

Boeke, J.D., Horiuchi, K. and Zinder, N. D., viroloqy 104, 267-273 tl980)]. Each DNA was cut with EcoRI and PstI
restriction endon~cleases and the resulting fragments analyzed on an agarose gel to confirm that the insert contained a P I site. One of the phage DNA's which had a segment of about 850 base pairs (bp) was chosen for further study. ~he DNA insert was sequenced by the method of Maxam and Gilbert [Maxam, A. M. and Gilbert, W., Methods in Enzymol.
68, 499-560 (1980)] as shown in Table 6.

Eco RI

( 12 5 ) pr / ~ I
/

\ BGH

E. coli c)rigin pCGSl 4 4 . ~
\ ~ _Cla I

' ~ ' / ' 2~ \ . /
origin \ ~ /URA3 :
,~ .

'~ .
~ - 3 ~-' ~' ' ' ~' . ~
, - , ~,~ ~ ; , : ' ' , ' ' :

1~73~33 ` - -~5o Vt ~o o ~o o, ~o o, ~ o o ~ ~o o U~ ~o ~
C t!~ C C!:l L ~ --~ 1) t~ ~ V ~
r0 V ~ t ~

~ ~ c ~~n~ ~ ~ ~ v~ ~ _ _ ~ L C,~ C ~ V~ S _ L ~_) C t_~ L t~ ~ C~ Cl 1-- ~n t~ ~ L 5_~
_ ~ O ~ ~ ~ O C~
~ ~ ~ t~ ~ ~: 0 ~ > t.!:l Q. t ~ _ o V~ CJ 1-- c ~ L ~ ~ ~ L l ~ ~ C!~ 1~1 r~ L t~ S i~ .c t~ 1 O O o ~ C~ o >~c~O V~ S o L ~ o ~ ~ o ~,1-- o 8 c~ _ t ~--8 ~ n8 r- ~ rl ~ ~
~,~ ~,~ ~ ~ c ~~ r~ r~ 1-- L ~
~C!~ _ C!~ C
1'0 ~S ~ L ~ o ~~ t!~ ~ L t~ ~ _.
_ t~ ~ o~ ~ L ~ _ ~S t.~ ~ ~
~t ~ ~ 0 ~ o ~ ~
~D ~ t!) L ~ L t_~ ~ ~ _ ~ ~ ~ ~ ~ ~ ~ ~_ ~LIJ ~ E 1-- S ~ ~ ~L ~ L ~) ~ ~ O ~ . ~3 ~-- 3 ~ ~
~ Y 1-- >~ S ~ O ~ GC~
~ LO~ C~ 3~ E
8 ~ ~ ~ ~ ~ 4 _ ~
" ~ ,~ ~ o ~ C~ o ~o ~ o ~ t~ t~ ~ ~ o V~ o U~
0 ~~ ~ :~
h ~ ~ sG~ L ~L ~ ~ E ~ ~
t~ _ ~ L ~ ,t~ ~ Cl; C C~

~ ~ 0 0 t~ ~ ~ _ ~ V~t~ S ~'S 0 L 1~ ~ 3 ~ v~ 3 ~
C~ ~1--L 1-- L ~ ~C_~ L

s ~ ~ ~ ~ ~ s ~t '~~ ~ --3~ ~ t t o ~ ~ o ~ t~0 t,~ ~ ~ ~ t!:J L ~ vt C~ C!S

, ,~
. .
, '. ~ ' `. ~ . ' `' ' ' ' ' .' ~'' ' , 1~73~38;~

6. Expression of BG~ in Saccharomvces cerevisiae A plasmid, pCGS144, as seen in ~able 5, designed to facilitate obtaining expression of BGH in yeast was constructed. In order to produce the BGH in yeast, an ATG
initiation codon was incorporated at the 5'-side of the first amino acid (phenylalanine). Based on the fact that HaeII
cuts at the 3'-side of the first codon, a HaeII digest was carried out to open the 5'-end at the Phe codon. The cohesive ends were trimmed back by treating the DNA with 4 units E. coli DNA polymerase I (Klenow fragment) in the presence of O.S mM dATP in 6.6 mM Tris-HCl, pH 7.5; 6.6 mM
NaCl; 6.6 mM MgC12 and 66 mM dithiothreitol, for 30 minutes at room temperature, and then blunt-ended with Sl nuclease..
A ClaI synthetic linker (CATCGATG) containing the ATG
initiation codon was ligated onto the blunt-ended fragment in 66 mM Tris-HCl, pH 7.5; 10 mM MgC12; 10 mM 2-mercapto-ethanol; lmM ATP with 500 pmole 32P-ClaI linker; 4 pmoles DNA ~20 ~g) and 4 blunt-end units of T4 DNA ligase at 17 C
overnight. This ligation created an ATG initiation codon and restored the first codon TGT. ClaI polylinker was removed by treating the fragment with 20 units restriction endonuclease ClaI for 3 hours at 37 C in a 20J41 reaction containing 10 mM Tris-HCl, pH 7.5; 10 mM MgC12; and 0.1 mg/ml bovine serum albumin. The resulting fragment was cloned into the ClaI site of plasmid pBR322. The plasmid ~10J~9) was cut .
.:' . .
.,:. . . : , . . , ' -, ~73~a~

with the restriction endonuclease ClaI (New England Biolabs, 20 units) for 2 hours at 37 C in a 20~1 reaction containing lOmM Tris-HCl, pH 7.5; 10 mM MgC12 and 0.1 mg/ml bovine serum albumin. The preparation of restriction cut plasmid was phenol extracted, ethanol precipitated and treated with calf intestinal phosphatase by the method of H. Goodman and R. J. MacDonald [Goodman, H. M. and MacDonald, R. J., Methods in Enzymology 68, 75-91 (1979)] to remove the terminal phosphates. Approximately O.S pmole of the ClaI fragment and 0.3 pmole of the ClaI cut plasmid were ligated together at 15 C for 3 hours in a 20J~1 reaction containing 66 mM
Tris-HCl, pH 7.5; 6 mM MgC12; 10 mM dithiothreitol; lmM
ATP; and T4 DNA ligase (New England Biolabs, 300 units) creating plasmid pCGE27.
Transformation-competent E. coli strain CGE43 (LG90;
F ~(lac-pro)Xlll) was prepared as described previously for CGE6, and 5 ~1 of the ligated DNA was mixed with 200 ~1 of the cells for 30 minutes at 0 C, heat treated at 37 C for 2 minutes, incubated at room temperature for 10 minutes, and diluted five-fold with fresh tryptone broth.
After incubation for 30 minutes at 37~ C with shaking, cells were plated on tryptone plates containing ampicillin (20 ~g/ml). Ampicillin-resistant colonies were picked, and the plasmid DNA was prepared and analyzed by restriction enzyme digestion. By these criteria several cells carried the desired plasmid, pCGE27. Plasmid pCGE27 DNA (10~9) was ...

~ 73~8~
cut with the restr;ction endonuclease HindlII (Collaborative Research, Inc., 12 units) for 2 hours at 37 C in a 20~1 reacti~n containing 10 mM Tris-HCl, pH 7.5; 10 mM MgC12; 60 ~M NaCl; and 0.1 mg/ml bovine serum alb~min). This DNA was next digested witb the end~nuclease EcoRI (Collaborative Research, Inc., 15 units~ for 3 hours at 37 C in a 20 ~1 reaction containing 100 mM Tris-HCl, pH 7.6; lOmM MgC12; 50 mM NaCl; and 1 mg/ml bovine serum albumin. The restr;ction cut DNA was trimmed back with E. coli DNA polymerase I
(Rlenow fragment) in the presence of 0.5 mM dTTP and made blunt-ended with Sl nuclease as described previously. The DNA was then phenol extracted, ethanol precipitated, redissolved in water and applied to a preparative horizontal 1.5~ agarose gel. After electrophoresis for 2 to 3 hours in 40 mM Tris-acetate, pH 7.2, the gel was stained with ethidium bromide and examined under long wavelength ultraviolet light. The digested DNA was extracted by freezing and thawing the gel pieces [Thuring, et al., Anal. Biochem 66, 213 ~1975)1. The DNA fragment was ethanol-precipitated and redissolved in water. A plasmid (pGL101; 20 ~9) containing 95 base pairs of PlaC inserted at EcoRI/PvuII site of pBR322 was cut with the restriction endonuclease PvuII (New England Biolabs, 24 units) for 6 minutes at 37 C. The restriction cut DNA was phenol extracted, ethanol precipitated, and redissolved in water. This PvuII opened vector was analyzed by gel electrophoresis and excised from .
' ' ~
' "'' .' ' ' ' ' ,: - :
' i ~ 7~

the gel (see above). Approximately 0.25 pmole of the DNA
fragment coding for sGH was ligated into plasmid pGL101 opened at its PvuII site tsee above) for 4 hours at 14 C in a 20 ~ reaction containing 66 mM Tris-HCl, pH 7.6; 6.6 mM
MgC12; 10 mM dithiothreitol; 1 mM ATP and T4 DNA ligase (New England Biolabs, 300 units). Transformation-competent E. coli strain CGE43 cells were prepared exactly as described àbove, and 5 ~1 of the ligated DNA was mixed with 100~1 of the cells for 30 minutes at 0 C, heat treated at 37 C for 2-5 min~tes, and diluted ten-fold with fresh tryptone broth.
After incubation for 30 minutes at 37 C with shaking, cells were plated on tryptone plates containing ampicillin (20 ,~g/ml). Ampicillin-resistant colonies were picked, and the plasmid DNA was prepared and analyzed by restriction enzyme digestion for the correct orientation. By these criteria several strains carried the desired plasmid, pCGE22, which contained the PLAC-phe-BGH gene-The fragment containing the gene for BGH was isolatedfrom plasmid pCGE22 (30J~gS by partial cutting the plasmid with restricton endonuclease PvuII and PstI at 37 C as above. The restriction cut DNA was phenol extracted, ethanol precipitated, redissolved in water and applied to a preparative 0.5~ agarose gel. After electrophoresis in 40 mM
Tris-acetate, pH 7.2, the gel was stained with ethidium bromide and examined under long wavelength ultraviolet light. ~he band was excised and the DNA extraced by freezing ~738~3 and thawing the gel pieces IThuring, et al., Anal. Biochem.
66, 213 (1975)1. The DNA fragment was ethanol precipitated and redissolved in water. Approximately 0.5 pmole of the PvuII/PstI fragment was ligated into plasmid pCGE41 opened at its EcoRI site adjacent to the PLAC/'~ region and at Pstl site. ~he EcoRI site was filled in with E. coli DNA
polymerase I. Ligation was carried out for 2.5 hours at 14 C in a 20J~1 reaction containing 66 mM Tris-Hcl, pH 7.6; 6.6 mM MqC12; 10 mM dithiothreitol; 1 mM ATP and T4 DNA ligase (Collaborative Research, Inc., lO units). The ligated DNA
was used to transform competent E. coli cells which were verified to contain the desired plasmid, pCGE51.
The plasmid, pCGE27, was cut with ClaI restriction enzyme, and the resulting fragment made blunt-ended with Sl nuclease. A SalI synthetic linker (GGTCGACC) was litaged onto the blunt-ended fragment. SalI polylinker was removed by treatment with 20 units restriction endonuclease SalI. It was then cut with Pstl. The resulting fragment together with the PstI/XhoI BGH' 'Z fragment of pCGE51 were cloned into the 20 yeast shuttle vector pCGS40 as descrlbed previously.
The plasmid, pCGS40, comprises most of pBR322 containing a DNA replication origin and B-lactamase yene for selection in E. coli, with a l.6 kilobase fragment of the yeast plasmid containing an initiation site for replication in - yeast, with a l.l kilobase fragment from the yeast chromosomal DNA carrying a URA3 gene for selection in yeast .~ .

,~ ' .
.. ..

.. . . ~ .

, 1273f~3 and with a 0.9 kilobase fragment from yeast chromosomal DNA
containing the SUC2 promoter of the yeast invertase gene.
The plasmid pCGS40 was constructed by first cutting 60~9 of plasmid pRB118 lCarlson, M. and Botstein, D., Cell 28, 145-154 ~1982)] with restriction endonuclease HindIII for 30 minutes at 37 C and then with restriction endonuclease EcoRI
(see above). The restricti~n cut DNA was phenol extracted, ethanol precipitated, redissolved in water and purified by gel electrophoresis. The digested EcoRI to HindlII 0.9 kilobase band which contains the promoter for the SUC2 gene was excised and the DNA extracted by glass beads.
[Vogelstein, B. and Gillespie, D., PNAS 76, 615-619 (1979).]
The 0.9 kilobase DNA fragment containing the SUC2 promoter was placed on the~ plasmid YIp5 (a shuttle vector which can be selected for and maintained in yeast due to the presence of the URA3 gene or E. coli due to the presence of the AmP
gene). The resulting plasmid, pCGS46, obtained after ligation and transformation was purified and its structure verified. The plasmid pCGS40 was constructed by cutting the plasmid pCGS46 with restriction endonuclease PvuII for 1 hour at 37 C. A 1.56 kilobase fragment of 2J~ DNA from plasmid YEpl3, obtained from R. Davis, Stanford University, was removed by cutting YEpl3 with HPaI and HindIII. The resulting fragment was gel purified, phenol extracted, ethanol precipitated, and treated with T4 DNA polymerase (see above) in order to create blunt ends at the HindIIl .

:
.' , . . . . .

. ' ' ' , ' ' ' ' .

1;~73~8;~

restr;ction c~t. After phenol extraction and ethanol precipitation, the PvuII cut ~NA and blunt-ended 2~ DNA
fragment were purified by qel electr~phoresis and ligated together overnight. The resulting plasmid, pC~S40, can be grown and its presence can be selected for in either E. coli or Saccharomyces cerevisiae. Following transformation and restriction analyses, the desired plasmid, pCGS75, was obtained containing BGH' 'Z.
The plasmid, pCGS75, was cut with SalI and then rendered blunt-ended by treatment with E. coli DNA polymerase I. The blunt-ended DNA was then cut with Xbal and the fragment gel purified. This same plasmid was also cut with EcoRI/XbaI to produce a fragment which upon ligation with the previously isolated SalI-blunt-ended/XbaI fragment and an EcoRI/BamHI
fragment of pBM125 yielded pCGS118 containing PGALl BGH' 'Z
on a yeast shuttle vector. The PGALl promoter ~820 bp) came from pBM125 (courtesy of R. Davis, Stanford University) which was cut with BamHI, filled in with E. coli DNA
polymerase I then cut with EcoRI.

The construction of pCGS144 containing the BGH gene promoted by PGALl was accomplished by a tri-molecular reaction. ~he GALl promoter and part of the BGH gene were removed from pCGS118 by restriction with XbaI and PstI. The rest of BGH was obtained by cutting pCGE27 with PstI and - ClaI. These gel pruified fragments were ligated with a XbaI/ClaI fragment of pCGS57 which contained part of the 2 and the URA3 gene.

, : . , ' .

.
- :

~ ~3 ~S~3 The yeast strain CGY150 (MATa, leu 2-3, leu 2-112, ura 8-50) was transformed with the BGH plasmid DNA by the method of A. Hinnen, J. B. Hicks, and G. Fink tHinnen, A., Hicks, J.
B. and Fink, G. ~., Proc. Nat. Acad. sci. USA 75, 1929-1933 (1978)1. Yeast transformants CGY196, capable of growth without added uracil due to the presence of URA3 gene on the plasmid, were picked. (Strain CGY196 bearing plasmid pCGS144 is on deposit with the American Type Culture Collection (ATCC), Accession number 20643, deposited September, 1982.) The yeast cells were grown at 30~ C with agitation in a medium containing 6.7 9/1 yeast nitrogen base, 30 mq/l L-leucine and 2~ galactose. The synthesis of BGH was induced due to the presence of galactose. After growing to Klett =
50 at 30 C with agitation, the cells were collected by centrifugation, resuspended in 0.25 ml 0.05 M Tris-HCl, pH

7.6, 20% glycerol and 1 mM PMSF, and frozen at -20 C. The cells were disrupted by glass beads by the method of M Rose, et al. lRose, M., Casadaban, M. J. and Botstein, D., Proc.
Nat. Acad. Sci. US~ 78, 2460-2464 (1981)] and the amount of 20 BGH activity in the cellular extract was determined by immunoprecipitation.
The seguencing information for the bovine growth hormone gene produoed is shown in ~able 6.

: .
", ~
,,; , -, ~ ~ 7~

_ Production of Interferon 1. Isolation of IFN mRNA

3.55 grams of Sendai virus induced lymphocytes were disrupted by means of a Dounce homogenizer into 40 ml of cold buffer (10 C) consisting of 50 mM NaOAc, pH 5.2; 6 M guanidine HCl;
and 0.1 M 2-mercaptoethanol. The resulting solution was sonicated at 60W pulsed power for 2x30 seconds and then layered onto 3 ml shelves of 5.8 M CsCl, pH 7.2, containing 0.1 M EDTA. The material was centrifuged at 15 C in a Beckman Type 50 Ti rotor at 40,000 rpm overnight. The pellet was resuspended on ice for 20 minutes in 6.6 ml of the above cold buffer plus 20 mM EDTA, and then treated with 3.3 ml of ice-cold absolute ethanol. After 1 hour at -20 C, the precipitate was pelleted by a centrifugation at 8,000 rpm for 20 minutes at -10 C. The pellet was resuspended two times in 18 ml of the preceding buffer, treated with 9 ml of ice cold absolute ethanol, chilled one hour at -20 C and the pellet collected as decribed previously. The final pellet 20 was resuspended in 8 ml of 0.1 M EDTA with heating at 60 C, and then 0.1 volume of 2M NaOAC, pH 5.0, and 2 volumes of ice-cold absolute ethanol were added and the solution placed at -20 overnight. The RNA precipitate was collected by ': ~ ., . - .:

.
~ . ~ - ' :

1i~7388;~
centrifugation at 8,000 rpm for 20 minutes at -10 C, and was dissolved in ~ ml water. The yield was 396 mg RNA. ~he RNA
solution was diluted with S ml of 2x concentratea binding buffer (20 mM Tris-HCL, pH 7.5; 2mM EDTA, pH 7.0 0.4~ SDS;
and 0.24 M NaCl). The RNA was applied to a 1 ml oligo-dT-cellulose column, the column was washed with lx concentrated binding buffer and then the poly A-containing RNA (mRNA) was eluted by washing the column with binding buffer containing no NaCl. About 39 mg of poly A-containing RNA was obtained.
A portion of the poly A-containing RNA was translated in vitr_ in a rabbit reticulocyte lysate system [Pelham, H.R.B.
and Jackson, R.J., Eur. J. Biochem. 67, 247-256 (1976)] to confirm the isolation of mRNA coding for interferon.

2. Preparation of double-stranded copy DNA (cDNA) About 2.5~9 of cDNA was synthesized from 25J4g of the lymphocyte poly A-containing RNA by incubation for one hour at 42 C in 50 mM Tris-~cl, pH 8.3; 100 mM RCl; 8mM MgC12;
0.4 mM dithiothreitol; 1.2 mM each dATP, dGTP and dTTP; and 20J~g/ml oligo (-dT)12 18~ containing 100 units reverse transcriptase and 0.25 mM d-32P-dCTP(1.8 Ci/mmole). After heating the reaction mixture at 100 C for 3.5 minutes, quick - chilling on ice for approximately 3 minutes and removing the precipitated protein by centrifugation, to the supernatant was added Hepes-NaOH, p8 6.9, to 100 mM: MgC12 ' ~ -49-, , . "'''~ ' , ': ' ' ' , ~ , . ' ' ~ -' ' : ,, . ' 1~73~8;~

to 5 mM; dithiothreitol to 0.5 mM; and deoxynucleoside tripho~phates as above. Incubation of this mixture with 300 units of E. coli DNA polymerase I for 2.5 hours at 15 C
produced l.8~9 of double-stranded CDNA. The DNA was phenol extracted, separated from unincorporated triphosphates by chromatography on Sephadex G-100 (13 ml column, 0.68 cm x 37 cm, eluted with 20 mM Tris-HCl, p~ 7.5, 3.5 mM EDTA) and ethanol precipitated overnight at -20 C by addition of l/10 volume 2 M NaOAc, pH 5, and 2.5 volumes cold ethanol. The double-stranded cDNA was then treated with 8,000 units of Sl nuclease at 37 C for one hour in buffer (0.3 M NaCl, 30 mM
NaOAc, pH 4.6, 3 mM ZnS04). The reaction was terminated by addition of EDTA to l0 mM, and Tris-HCl, pH 8.3, to 200 mM, and the mixture applied to a Biogel A-150m column (0.7 cm x 35 cm) equilibrated and eluted with 10 mM Tris -HCl, pH 7.5, 250 mM NaCl and 1 mM EDTA. The peak fractions (0.5 ml each) of large molecular weight DNA were pooled and ethanol precipitated by addition of l/10 volume 2 M NaOAC, p~ 5, and 2.5 volumes cold absolute ethanol.

3. Addition of HindIlI Linkers The Sl-treated double-stranded cDNA (0.21 ~g) was incubated in buffer (60 mM Tris-HCl, pH 7.5; 8 mM MgCl; 5 mM
dithiothreitol, 1 mM ATP and 1 mM of each deoxynucleoside .:
': ~ ' ` ' ~ ~'7~

triphosphate) with 9 units of E. coli DNA polymerase I at 10 C for 10 minutes and then placed on ~ce. This blunt-ended double stranded cDNA was next incubated in 65 mM
Tris-HCl, pH 7.5; MgC12; 5 mM dithiothreitol; 1 mM ATP, with 160 pmoles of 32P-'abelled HindIII ~ynthetic linker (100 x excess over cDNA ends) and 4 blunt-end units of T4 DNA
ligase at 15~ C for 5 minutes, cooled on ice, heat treated to inactivate the ligase, treated with HindIII restriction endonuclease (New England Biolabs, 9 units) in 5.6 mM

Tris-HCl, pH 7.5, 5.6 mM MgC12 at 37 C for 4 hours 45 minutes and then phenol extracted. The reaction was fractionated on a Biogel ~-150m column (0.7 cm x 31.5 cm).
~ractions (0.5 ml each) containing high molecular weight DNA
were pooled and ethanol precipitated.
This double stranded cDNA with HindIII cohesive termini was then ligated to fl phage CGF4 double-stranded DNA which had been cut open with HindlII restriction endonuclease and treated with calf intestinal alkaline phosphatase by the method of H. Goodman and R. J. MacDonald [Goodman, H. M. and MacDonald, R. J., Methods in Enzvmol. 68, 75-91 (1979)] to remove the terminal phosphates (Note: In order to produce phage CGE4, fl phage R229 [Boeke, J. D., Mol. Gen. Genet.
181, 288-291 (1981)] was cut with EcoRI endonuclease, rendered blunt ended with T4 DNA polymerase and ligated with HindIII synthetic oligonucleotide linkers from Collaborative Research, Inc. of Eexington, Massachusetts.) The ligation ' , ' , ~ ' ' - :
. -. ' . ' ~

.

~;~7~

reaction contained 60 mM Tris-HCl, pH 7.5; 6 m~ MgC12; 7 mM
dithiothreitol; 0.12 ~9 double-stranded cDNA; 1.2,yg CGF4 DNA; 0.5 mM ATP and 450 cohesive end units of T4 DNA ligase.
Ligation was for 19 hours at 15- C.

4. Transfection of E. coli DB4548 with recombinant CGF4 DNA
. _ E. coli strain CGE6 (DB4548; hsdR , hsdM , sup E~ sup F, Bl , met ) was yrown in 150 ml tryptone broth at 37~ C
with shaking and harvested at OD700=0.5 by centrifugation at 7,000 rpm for 10 minutes at 4~ C. The cells were 10 resuspended in 70 ml ice cold 50 mM CaC12 and allowed to sit at 0 C for 30 minutes. The suspension was then centrifuged at 7,000 rpm for 10 minutes at 4 C and resuspended in 3 ml ice cold 50 mM CaC12. After stan~ing at 0 C for 2 hours the cells were used for transfection.
Either 1 ~1 or 2 J41 of 1:40 dilution of ligation reaction in 50 mM Tris-HCl, pH 7.5, was added to each of 12 tubes containing 50~1 sterile 50 mM Tris-HCl, pH 7.5. One-tenth - milliliter of the CaC12-treated cells was added to each tube and the mixtures set on ice for 30 minutes. After warming to 37- C for 2 minutes, 0.2 ml of CGE5 (JM101: J.
Messing (1979), F'traD36 proAB lacIZVM15 in a ~(lac pro) SupE
thi background) overnight culture and 3 ml of 0.7~ soft agar were added, and the mixture poured into tryptone agar plates. Incubation at 37- C overni~ht produced over 1280 plaques.

.

1~ 7~
5. Identification of a recombinant-CGF4 carrying the leukocyte interferon ~equence The plaques were transferred to nitrocelluloses and probed as described by Benton and Davis [Benton, W. D. and Davis, R.
W., _ience 196, 180-182 (1977] using a 2P-labelled synthetic oligonucleotide (with the sequence, CATGATTTCTGCTCTGAC, Collaborative Research, Inc.) which corresponds to a known segment of LeIFN. The oligonucleotide (1 ~g) was kinased with 0.5 mC ~-32P-ATP using 6 units of T4 polynucleotide kinase (P-L Biochemicals) in a 20 ~1 reaction containing 66 mM Tris-HCl, pH 7.5, and 10 mM
MgC12. The phage which hybridized intensely to the synthetic oligonucleotide probe were picked from the plates and stored in TY medium at 4- C. Samples of the intact phage were amplified by growth overnight on CGE5 cells, harvested by centrifugation, and subjected to electrophoresis in a 0.6%
agarose gel containing 0.37 M Tris-glycine, pH 9.5, and stained with ethidium bromide after treatment in 0.2 N NaQH
for one hour and neutralization in 0.5 M Tris-HCl, pH 7.4.
The migration is inversely proportional to the log of the size of the phage DNA ana allowed selection of phage carrying inserted IFN DNA of size of 1000 to 1200 base pairs. Double-stranded RFl DNA was prepared from the phage by the ~ethod of Moses et al. [Moses, P.B., Boeke, J.D., Horuchi, K. and Zinder, N.D., Virology 104, 267-273 (1980)]. This DNA was 1.~7;~
cut with HindIII restriction endonuclease and the resulting fragments analyzed on an agarose gel to confirm that the insert was in the HindlII site and of the anticipated size.
One of the phage DNA's which has an insert of about 1200 base pairs (bp) was chosen for further study. The DNA insert was sequenced by the method of Maxam and Gilbert [Maxam, A. M.
and Gilbert, W., Methods in Enzymol 68, 499-560 (1980)~.

~7~8~3 promoter (125) Eco RI ~
Hind III

"~ IFN-cl B ' Amp /
~d III

pCGS261 E. coli origin >~ ~

' ' ~ ~ .

. .

., . , ' . , "" - - ~- - ' ' : -~L~t;~

6. Expression of LeIFN in Saccharo~yces cerevisiae A plasmid, pCGS261, as seen in Table 7, designed to facilitate obtaining expression of LeIFN in yeast was constructed. In order to produce the LelFN in yeast, an ATG
initiation codon was incorporated at the 5'-side of the first codon (TGT for cysteine) of mature, processed IFN. Based on the fact that Sau~AI cuts at the 3'-side of the first codon, an oligonucleotide (ACACATCGATGTGT) which is recognized by ClaI and also contains thè ATG-TGT sequence was synthesized by Collaborative Research, Inc. A Sau3Al fragment which codes the amino acid residues 2 to 61 was purified by digesting 30~g of the HindIII 1.2 kilobase fragment with 10 units Sau3Al restriction endonuclease in a 50 ~ 1 reaction volume containing 10 mM Tris-HCl, pH 7.5; 10 mM MgC12; and 60 mM NaCl for 4 hours at 37 C. The DNA fragment was purified by polyacrylamide gel electrophoresis. The DNA was phenol extracted and precipitated with ice-cold absolute ethanol. The cohesive ends were filled in by treating the DNA with 4 units E. coli DNA Polymerase I Klenow fragment and 0.1 mM each nucleoside triphosphate in 66 mM Tris-HCl, pH
7.5 66 mM NaCl; 66 m~ MgC12 and 66 mM dithiothreitol, for 30 minutes at room temperature.

~56-:
.

~ ~73~
The above synthetic oligonucleotide wa~ ligated onto the Sau3Al fragment in 66 mM Tris-HCl, p~ 7.5; 10 mM MgC12; 10 mM 2-mercaptoethanol; lmM ATP with 500 pmole 32P-oligonucleotide (5~yg); 4 p~oles DNA (20 ~g) and 4 blunt-end units of T4 DNA ligase at 17- C overnight. This ligdtion created an ATG initiation codon and restored the first codon TGT. ClaI polylinker was removed by treating the fragment with 20 units restriction endonuclease ClaI ~or 3 hours at 37 C in a 20 ~1 reaction containing 10 mM Tris-HCl, pH 7.5; 10 mM MgC12; and 1 mg/ml bovine serum albumin. The resulting fragment was cloned into the ClaI site of plasmid pBR322. The plasmid (lOJ~g) was cut with the restriction endonuclease ClaI (New England Biolabs, 20 units) for 2 hours at 37- C in a 20 ~1 reaction containing lOmM Tris-HCl, pH
7.5: lO mM MgC12 and 1 mg/ml bovine serum albumin. The preparation of restriction cut plasmid was phenol extracted, ethanol precipitated and treated with calf intestinal phosphatase by the method of H. Gbodman and R. J. MacDonald ~Goodman, ~. M. and MacDonald, R. J., Methods in Enzymology 68, 75-91 (1979)] to remove the terminal phosphates.
Approximately 0.5 pmole of the ClaI fragment and 0.3 pmole of the ClaI cut plasmid were ligated together at 15- C for 3 hours in a 20 ~1 reaction containing 66 mM Tris-HCl, pH 7.5;
6 mM MgC12 10 mM dithiothreitol; lmM ATP; and T4 DNA
ligase (New England Biolabs, 300 units) creating plasmid pCGE32. Transformation-competent E. coli ~, . -. .. . .

.
: . .

1;~73~38~
strain CGæ43 (LG90; F ~(lac-~_)xlll) was prepared as described previously for CGE6, and 5 ~ 1 of the ligated DNA
was mixed with 200~ 1 of the cells for 30 minutes at 0- C, heat treated at 37- C for 2 minutes, incubated at 18- C for 10 minutes, and diluted five-fold with fresh tryptone broth.
After incubation for 30 ~inutes at 37 C with shaking, cells were plated on tryptone plates containing ampicillin (20~g/ml). Ampicillin-resistant colonies were picked, and the plasmid DNA was prepared and analyzed by restriction enzyme digestion. By these criteria several cells carried the desired plasmid, pC OE32.
The rest of the IFN gene was put back together by using the EcoRI site located in the region coding for amino acid residue 37. Plasmid pCGE32 DNA (10 ~ g) was cut with the restriction endonuclease HindlII (Collaborative Research, Inc., 12 units) for 2 hours at 37- C in a 20 ~1 reaction containing 10 mM Tris-HCl, pH 7.5; 10 mM MgC12; 60 mM NaCl;
and 1 mg/ml bovine serum albumin). This DNA was next digested with the endonuclease EcoRI (Collaborative Research, Inc., 15 units) for 3 hours at 37- C in a 20~ 1 reaction containing 100 mM Tris-HCl, pH 7.6; lOmM MgC12; 30 mM NaCl;
and 1 mg/ml bovine serum albumin. The restriction cut DNA
was phenol extracted, ethanol precipitated, redissolved in water and applied to a preparative horizontal 1.5% agarose gel. After electrophoresis for 2 to 3 hours in 40 mM
Tris-acetate, pH 7.2, the gel was stained with ethidium .

.

, . . .
-:

bromide and examined under long wa~elength ultraviolet light. The digested HindIII to EcoRI band whi~h codes the ATG-TGT to amino acid residue 37 was excised and the DNA
extracted by freezing and thawing the gel pieces CThuring, et al., Anal. Biochem 66, 213 tl975)]. m e DNA fragment was ethanol-precipitated and redissolved in water. The plasmid (20 ~g) containing the IFN clone was cut with the restriction endonuclease HindIII (New England Biolabs, 180 units) for 2 hours at 37 C as above and then the DNA
(lZ ~g) was cut with the restriction endonuclease EcoRI (New England Biolabs, 24 units) for 6 minutes at 37 C. The restriction cut DNA was phenol extracted, ethanol precipitated, and redissolved in water. This EcoRI to HindIII fragment coding for amino acid residue 37 to the 3'-nontranslating region of IFN was analyzed by gel electrophoresis and excised from the gel (see above).
Approximately 0.25 pmole of each fragment were ligated together into plasmid pBR322 opened at its HindIII site (see above) for 4 hours at 14- C in a 20 ~1 reaction containing 66 mM Tris-HCl, pH 7.6; 6.6 mM MgC12; 10 ~M dithiothreitol; 1 -- mM ATP and T4 DNA ligase (New England Biolabs, 300 units).
Transformation-competent E. coli strain C OE43 cells were prepared exactly as described above, and 5J~1 of the ligated DNA was mi~ed with lOOJ~l of the cells for 30 minutes at 0-.~ C, heat treated at 37- C for 2.5 minutes, and diluted ~ ten-fold with fresh tryptone broth. After incubation .:.

- ,............. . .
' ~ ' . .' , '. ~ . :"
-, . ~ . .
.
'. ', ' ' . : .

1273~
~or 30 minutes at 37D C with shaking, cells were plated on tryptone plates containing ampicillin (20 ~g/ml).
Ampicillin-resistant colonies were picked, and the plasmid DNA was prepared and analyzed by restriction enzyme digestion. By these criteria several strains carried the desired plasmid, pC OE38.
A HindIII site was constructed in pCGS109 -~hich is a standard shuttle vector (pCGS42) with PGALl inserted between the EcoRI and BamHl sites. The vector, pCGS109, was cut with BamRl restriction enzyme, digested with Sl nuclease to remove cohesive ends making it blunt-ended and then ligating on HindIII linker. The vector was treated with ~indIII restriction enzyme and then the cohesive ends were ligated together to produce the vector ~CGS135. The 1.1 kilobase HindIII fragment containing the gene for LeIFN was isolated from plasmid pCGE38 (30J~g) by cutting the plasmid with restricton endonuclease HindIII for 1.5 hours at 37- C
; as above. The restriction cut DNA was phenol extracted, ethanol precipitated, redissolved in water and applied to a preparative 1% agarose gel. After electrophoresis in 40 mM
Tris-acetate, pH 7.2, the gel was stained with ethidium bromide and examined under long wavelength ultraviolet light. The 1.1 kilobase band was excised and the DNA
extraced by freezing and thawing the gel pieces CThuring, et al., Anal. Biochem. 66, 213 (1975)]. The DNA fragment was ethanol precipitated and redissolved in water. Approximately ~ ' .

'- '' :., .
- , - : :
.

1i~73~83 0.2J~g of the HindIII fragment was ligated into plasmid pCGs135 (l~g) opened at its HindIII site adjacent to the PGAL1 region. Ligation of the vector and IFN fragment was carried out at 14^ C in a 20Jy1 reaction containing 66 mM
Tris-Hcl, pH 7.6; 6.6 mM MgC12; 10 mM dithiothreitol; 1 mM
ATP and T4 DNA ligase (Collaborative Research, ~c., 10 units).
The yeast strain CGY528 (~ ura 3-52, his 4-29, pep 4-3, GAL+) was transformed with the plasmid DNA by the method of A. Hinnen, J. B. Hicks, and G. Fink CHinnen, A., Hicks, J. B.
and Fink, G. F., Proc. Nat. Acad. Sci. USA 75, 1929-1933 (1978)]. Yeast transformant CGY528, capable of growth without added uracil due to the presence of URA3 gene on the plasmid was picked. (Strain CGY528 bearing plasmid pCGS261 is on deposit with the American Type Culture Collection (ATCC), Accession Number 20663, deposited February, 1983.) The yeast cells were grown at 30- C with agitation in a medium containing 6.7 g/l yeast nitrogen base, 20~g/1 histidine and 2S galactose. m e synthesis of interferon was verified by collecting cells grown to ~lett = 50 (107 cells/ml) by centrifugation; resuspended in 0.25 ml 0.05 M
Tris-HCl, pH 7.6, 20~ glycerol and 1 mM PMSF, and frozen at -20- C. The cells were disrupted by glass beads by the method of M Rose, et al. tRose, M., Casadaban, M. J. and Botstein, D., Proc. Nat. Acad. Sci. USA 78, 2460-2464 (1981)]

- . ~ - .. . .

-. ~ '. ~ '' ' ' ~ ' -~73~33 and the amount of interferon activity in the cellular extract was determined by conventional methods to he 105 units/mg of soluble protein.
The sequencing information for the human leukocyte interferon gene produced is shown in Table 8.

~ -62-,",,,,., . :
.' ' .

lX~38~33 R ~ G~g ~ Y~ y~ v ~, ~, E' ^~ ~3' ~ '~ V3~ ~ E 3 ~ E ~
,~ y~ ~oY~ ~os~ ~oY~ y~ 0 0= ~ y ~ s, ~ ~ O u S ~ Y ~ U ~ æ ~ <
0 ~ U 0 0 ~ g - ~ ` ~ ee~ e~ e ~ ~
O ~o ~ O ~ y O ~ u~u ~ ~ ~ ~ æ ~ ~ O _ ~
æ æ~ æ~ S ~ E, ~E~ ~Y= ~ Y~8 co~6 0tw y~ $~ ~~ Oo ~ ~a u o~<C O O ~ O O ~ ~ ~0 Uc Z ~o ~ ~ ~ g o 0~ y ~~j 5 ~lZ ~ ~LI~ ~ ~ $ ~ ~

jo ~ o ,o,~w O ~ ", u O .~ s o O <~ x~ O ~t ~0 ~ ~ ~0 ~ ~a 3 ~ ~ ~
o~w ~;~a O 1 <o~ -U t ~ ~ ~a ~ e ;;X~ , , .' ' - : - ' :
~" ` : : ~' ' -.:

1;~7~

.

Production of Prorennin 1. Isolation of the RNA

Sto~ach tissue from milk-fed calves was obtained fresh from a local slaughterhouse; the mucosa of the fourth stomach was dissected away from the stomach wall and frozen in dry ice. Twenty-one grams of the mucosal tissue was disrupted by means of a blender into 200 ml of cold buffer (10 degrees C) consisting of 50mM Tris.HCl, pH 7.5, 8M guanidine HCl, and lmM dithiothreitol. Insoluble material was removed by -centrifugation in a Sorvall SA-600 rotor at 10,000 rpm for 12 minutes. To the 200 ml of supernatant from the spin was added 100 ml of ice cold absolute ethanol. After 1.5 hours at -20 degrees C, the precipitate was pelleted by a centrifugation at 3000 rpm for 30 minutes at -10 degrees C.
The pellet was dissolved in 40 ml of ice cold buffer (EGAD) consiRting of 20mM EDTA, pH7, 20mM NaOAc, pH7, 8M
guanidine.HCl, and lmM dithiothreitol. Twenty milliliters of cold absolute ethanol was added and the solution placed at -20 degrees C for 45 minutes. The precipitate was pelleted by centrifugation at 3000 rpm for 20 minutes at -10 degrees C. The pellet was redissolved in 40 ml cold EGAD buffer and .;- .
~ the precipitation with 20 ml cold ethanol, centrifugation and `~' : ' , ,', .
,~ , .. . . . .
~''~' , ' - , :

1;273~83 ledissolving the pellet in EGAD buffer was repeated two additio~al times. Finally, the pellet was dissolved in 16 ml of 20mM EDTA, pH 7 and extracted three times with chloroform:isobutanol (4:1). Next, two volumes of 4.5M NaOAc pH5.2 was added to the aqueous layer and the solution was placed at -20 degrees C overnight. The RNA precipitate was collected by centrifugation at 10,000 rpm for 25 minutes at -10 degrees C, and was dissolved in 30 ml water. The yield was 45 mg RNA. m e RNA was precipitated by addition of 1 ml of 2M NaOAc pH5 and 75 ml absolute ethanol, followed by incubation at -20 degrees C overnight. The RNA was pelleted - by centrifuyation (10,000 rpm, 10 minutes -10 degrees C) and redissolved in 20 ml water, heated to 60 degree~ C for 10 minutes, chilled rapidly on ice and diluted with 21 ml of 2x concentrated binding buffer (20mM Tris HCl pH7,5, 2mM EDTA.
pH7, 0.4% SDS and 0.24M NaCl¦. The RNA was applied to a 4 ml oligo-dT-cellulose column, the column was washed with 45 ml of lY concentrated binding buffer, and then the poly A-containing RNA was eluted by washing the column with binding buffer containing no NaCl. About 1 mg of poly A-containing RNA was obtained. A portion of the poly A-containing RNA was translated in vitro in a rabbit reticulocyte lysate system (H.R.B. Pelham and R.J. Jackson tl976~ Eur J. Biochem. 67 247-256). The protein products were analyzed on a 10% polyacrylamide gel. A single major protein band was observed which was precipitated with rennin ..
~ ' ` ' ' :, ' ' ' '1~'73~3 Intiseru~ showing that rennin ~RNA i~ present in the poly A-containing RNA~

2. Preparation of d oubl e-stranded copy DNA tcDNA) About 8.7 ~ g of cDNA was synthesized from 20~9 of the calf stomach poly A-containing RNA by incubation for one hour at 42 degrees C in 50mM Tris HCl pH8.3, 100mM KCl, 8mM
MgC12, 0.4mM dithiothreitol, ln~l each deoxynucle~side triphosphate, 20~ g/ml oligo(-dT)12 18 containing 100 units reverse transcriptase and lCi/mmole ~ 2P-dCTP. After heating the reaction mixture at 100 degrees C for 3 minutes, chilling on ice for 3 minutes and removing the precipitated protein by centrifugation, to half the ~upernatant material was added Hepes-KOH pH6.9 to 100mM, MgC12 to 5mM, dithiothreitol to 0.5mM, deoxynucleoside triphosphates to 0.125mM. Incubation of this mixture with 300 units of E.
coli DNA polymerase I for 2 hours at 16-C produced 8.6~g of double-stranded cDNA. The DNA was phenol extrac'ed and ; separated from unincorporated triphosphates by chromatography on Sephadex G-100 (12 ml column, 0.7 cm x 30 cm, eluted with 20mM Tris HCl pH 7.5, 0.5mM EDTA) and was ethanol precipitated overnight at -20 degrees C by addition of 1/10 volume 2M NaOAc pH5, and 2.5 volumes cold ethanol. The double-stranded cDNA t4.6 ~y) was then treated with 1000 units of Sl nuclease at 37 degree~

' , ' , : . :
- ' ' .
: .
. ~ ' ~ :.' ' . ' ' ' - . .
' ' ' ' ' '' '. ,.

` ` ~.;~7~
C for 1 hour in Buffer S (0.3M Na~l, 30mM NaOAc, pH4.6, 3mM
ZnS04). The reaction was terminated by addition of EDTA to 10mM, and Tris'HCl pH8.3 to 200mM, and the mixture applied to a Biogel A-150m column (0.7cm x 33cm) equi~ibrated and eluted with 10mM Tris'HCl pH7.5, lmM EDTA and 250mM NaCl.
The peak fractions (0.5ml each) of large molecular weight DNA
were pooled and et~anol precipitated by addition of 1/10 volume 2M NaOAC pH5 and 2.5 volumes cold absolute ethanol.

3. Addition of HindIII Linkers The Sl-treated double-stranded cDNA (1.7~g) was incubated in Buffer T (25mM Tris'HCl pH8, 6.6 mM MgC12, O.5mM EDTA, 5mM 2-mercaptoethanol and 0.5mM of each deoxynucleoside triphosphate) with 2 units of T4 DNA
polymerase at roo~ temperature for 30 minutes. m e material was phenol extracted and ether extracted and ethanol precipitated by addition of 1/10 volume 2M NaOAc pH5 and 2.5 volumes ethanol. This blunt-ended double-stranded cDNA was next incubated in 66mM Tris'HCl pH7.6, 6.6mM MgC12, 5mM
; 2-mercaptoethanol, 0.5mM ATP, with 300 pmoles of 20 32P-labelled Hind 111 synthetic lin~er (100 x excess over cD~A ends) and 9 blunt-end units of T4 DNA ligase at 12 degrees overnight.
~ he reaction was adjusted to 10mM EDTA pH8 and fractionated on a Biogel A-150m column (0.7cm x 20cm).

;

... .
.': - ' , ' ' ' ~ ;~73~
rractions (0.25~1 each) conta;ning high molecular weight DNA
were pooled and ethanol precipitated. This material was treated with Hind III restriction endonuclease (9 unit~) in 5.6mM Tris HCl pH7.6, 5.6mM MgC12 at 37 degrees C for 45 min~tes, then phenol extracted, ether extracted and ethanol precipitated by the addition of l/lO volume 1~ NaOAc pH5 and 2.5 volume, absolute ethanol. This double-stranded cDNA with Hind III cohesive termini was then ligated to fl phage C OE4 double~stranded DNA which had been cut open with Hind III
restriction endonuclease and treated twice with calf intestinal phosphatase by the method of H. Goodman and R.J.
MacDonald (H.M. Goodman and R.J. MacDonald ~1979] Methods in Enzymology 68, 75-91) to remove the terminal pnosphates (Note: In order to produce phage CGF4, fl phage R229 (J.D.
Boecke ~1981] Mol. Gen. Genet. 181, 288-291) was cut with EcoR1 endonuclease, rendered blunt-ended with T4 DNA
polymerase and ligated with Hind III synthetic ; oligonucleotide linkers from Collaborative Research, Inc. of Waltham, Massachusetts). The ligation reaction contained 20 66mM Tris-HCl pH7.6, 6.6mM MgC12, 5mM 2-mercapto-ethanol, 0.3J~g double-stranded cDNA, 0.2 ~ g CGF4 DNA, 0.5mM ATP and 300 cohesive-end units of T4 DNA ligase. Ligation was for 29 hours at 16 degrees C.

~., .'' :
. . .
.
-' . - ' ` , .
- : ' . ~ ' lZ73~383 4 ~ransfection of E. coll ~NN45 with reco~binant-CGF4 DNA

E. coli strain CGE6 (~NN45; hsdR , hsdM~, sup E, sup F, Bl , met ) was grown in tryptone broth at 37 deyrees C
with shaking and harvested at OD700 = 0.5 by centrifugation at 7000 rpm for 10 minutes at 4 degrees C. The cells were resuspended in ice cold 50mM CaC12 (one-half tne original culture volume) and allowed to sit at 0 degrees C for 30 minutes. The suspension was then centrifuged at 7000 rpm for 10 minutes at 4 degrees C and resuspended in 1~20 the original culture volume ice cold 50mM CaC12. After standing at 0 degrees C for 60 minutes the cells were used for transfection. One-half microliter of the 20~ 1 ligation reaction was added to each of 8 tubes containing 50 ~1 ~terile 50mM Tris HCl pH7.6. One-tenth milliliter of the CaC12-treated cells was added to each tube and the mixtures sat on ice for 30 minutes. After warming to 37c for two minutes, 0.2 ml of a CGE5(JM101:J. Messing C1979], F'tra D36 pro AB lac IZVM15 in a v(lac pro) SupEthi bacXground) overnight culture and 3ml of 0.7~ soft agar were added, and the mixture poured onto eight tryptone agar plates.
lncubation at 37 degrees C overnight produced about 250 plaques per plate.

1~73~83 5. Identification of a Recombinant CGF4 carrying the rennin coding sequence.

The plaques were transferred to nitrocellulose and p~obed as described by Benton & Davis (W.D. Benton and R.W. Davis tl977] Science l9G, 180-182) using P-labelled cDNA made from the cal~-stomach poly A-containing RNA using ~32p_ dCTP and reverse transcriptase (T.P. St. John and R.W. Davis ~1979~ Cell 16 443-452). About 80 recombinant phage which hybridize intensely to the labelled cDNA were picked from the plates and stored in TY medium at 4 degrees C. Samples of th0 intact phage were amplified by growth overnight on CGE5 cells, harvested by centrifugation, and subjected to electrophoresis in a 2% agarose gel containing 0.37M
Tris-glycine pH9.5 and stained with ethidium bromide after treatment in 0.2N NaOH for one hour and neutralization in 0.5M Tris HCl pH7.4. The migration is inversely proportional to the log of the size of the phage DNA and allowed selection of eight phage carrying inserted DNA of size l000 to 2000 base pairs. Double-stranded RFI DNA was prepared from these eight phages by the method of Moses et al (P.B. Moses, J.D. BoeXe, ~.Horiuchi & N.D. Zinder ~1980~
Virology 104, 267). Thi~ DNA was cut with Hind IlI and the resulting fragments analyzed on an agarose gel to confirm that the insert was in the Hind III site and of the anticipated size. Finally, the DNA from four of the 1~7;3883 recombinant phages (approximately 5-10~9 from each~ and DNA
from the vector CGF4 was cut with Hind IIl and the fragments, after denaturation by boiling for 45 seconds and freezing in dry ice/ethanol, were bound to nitrocellulose by spotting the DNA in water onto small pieces of nitrocellulose pretreated with 20x SSC and dried. After baking in vacuo at 75 degrees C for 1.5 hours, the DNA bound to nitrocellulose was carried through the hybrid selection procedure as described by Miller et al (J.S. Miller, R.P. Ricciardi, B.E. Roberts, B.M.
Pater~on & M.B. Mathews C1980] J. Mol. Biol. 142, 455-488) u~ing 2~g poly A-enriched calf stomach RNA for each hybridization. The eluted RNA was then translated in a reticulocyte lysate system labelling with 35S-methionine by the method of Pelham and Jackson (H.R.B. Pelham & R.J.Jackson ~1976] Eur. J. Biochem. 67, 247-256) and the resulting protein products analyzed on a 10% polycrylamide gel containing 0.1% SDS according to Laemmli (U. Laemmli C1970]
Nature 227, 680-685). The results of the gel analysis indicated that all four of the phage DNAs tested did hybridize to the rennin mRNA since all four selected an RNA
species which, upon translation in a rabbit reticulocyte lysate, yields a protein product identical to pre-prorennin in size and immunological criteria. Two of the four, 293-207 which has an insert of about 1400 base pairs (bp) and 293-118/37 which ha~ an insert of about 1250 bp, were chosen for further study. The DNA inserts were sequenced by the .

. :. - .
~ ~ .

1~73~3 method of Maxam and Gilbert (A.M. Maxam and W. Gilbert ~1980]
Methods in Enzymology 68, 499-560). Fron nucleotide 205 to 1350 is the DNA sequence for the pre-prorennin A gene (see Table 9). The nucleotide sequences 1-204 and 1351 to 1460 are attached to the pre-prorennin but can be removed if desired and are not essential to use of the gene in expression. Useful portions of the DNA material of Table 9 can be separated and used by known techniques.
.

.. I , , - .
: ' ~' ' ' - , , .
, -: ~

. ' '.' -" ..

lZ738~33 o o o Y ~ o ~ ~ ~ 5 Z Y ~ ~ ~ 8 ~ y ~ 5 o Y ~ E w ~ ~ 5 ~ ~ O ~ O ~ o O ~ 3 3 a Ye E ~ 0 ~ ~ y ~ O O ~ 3 o o ~ Z y = y y ~0 ~ o ~ ~ ~;
E~ 0~ ~Z ~s 0~ 3~
Y ~ Y~ ~ ~ ~o Y~ ~Yo~ ~0~ ~;~ y o ~ z. y~ ~ YO~ ~30 oo ~3 ~o o~ o~ o~ Y~ ~
o ~ 0 ~ y s ~ ~ 0 ~ Yo ~ E ~ U
y ~ ~ o ~ ~ ~ y ~ ~ ~ Y ~ ~ 0 30 ~ ~ Y 3 0~ y~ oO~O ~ 3 -3~ 8 0~ ~0~ Es ~, uO, e ~ o ~o t; '~ 3 ~ ~ ~ ~ Z ~ Z ~
~ ~ ~ ~ 6 o o 0 ~ 5 ~ ~ o z u8~ y@ YO~ ~0 ~ 0~O ~0~ ~3 O~ ~ O
O ~ O O O O ~ S Yo e Yo ~ ~ S ~ o o ~ @ ~ ~ 8 ~oi ~ ~
u ~ o ~ ~ o ' ~ 3 Yo ~ 8 ~ ~o Y ~ gZ u8o 0~ uu ~ ~3 y~ ~ 0~O ~ 3 ~ ~
o~ z ~ ~3 ~ vs IY ~ ~o ~ ~ 3 ~ E
~e i~ ~ ~o ~ 4 ~ S ~ ~ Y ~ Y ~ Y ,~ O
', ,~ .

' - - . ' - ~ , , --: . ~ -1~73~383 mhis Tabl~ combines information from both 293-207 and 293-118/37: recombinant phage 293-207 carries an insert bearing the sequence shown in Table 9 from nucleotide ~1 to at least nucleotide ~1360 except for nucleotides 848-961 which are deletea, while phage 293-118/37 carries an insert -bearing the sequence from nucleotide ~229 to nucleotide ~1460. As revealed by the sequencing results, initiation of rennin synthesis occurs at a methionine codon (nucleotides 205-207) and results in a pre-prorennin molecule ~ith sixteen additional amino acids compared to purified prorennin (The prorennin B amino acid seguence was published by B. Foltmann et al~ Proc. Nat. Acad. Sci. USA 74 2321-2324(1977) and B.
Foltmann et al J. Biol. Chem. 254 8447-8456 (1979); the nuc,leotide sequencing data of Table 9 is the first indication for the existence of pre-prorennin). Together, the two recombinant fl phages 293-207 and 293-118/37 carry the DNA
sequence for the entire pre-prorennin A molecule. The ; prorennin portion of the pre-prorennin A differs from prorennin B at amino acid ~290 (aspartate in rennin A and glycine in rennin B as described by Foltmann et al Csee above]; amino acid position numbering is that of Foltmann).
An asparagine codon is shown at amino acid position ~204 while Foltmann reported an aspartate at that position;
however, this may be an amino acid sequencing error since the amides of aspartate and glutamate are difficult to distinguish from their acid forms, while nucleotide sequencing can readily distingui~h the codons.

~ ~': . ' . ' ' ' ,' ' ~ ' ' ' ' lZ73~8;~

The cloned rennin gene represented by phage 293-118/37 was used to investigate properties of the bovine genomic copy or copies of the rennin gene. These experiments were done by hy~ridizing cloned rennin DNA labelled with 32p by the method of nick-translation (P.W.J. Rigby, M. Dieckmann, C.
Rhodes, and P. Berg Cl977] J. Mol. Biol. 113, 237-251) to bovine DNA cut with various restriction enzymes, separatea with an agarose gel and transferred to a nitrocellulose membrane according to the method of Southern (E.M. Southern 10 C197s] J. ~ol. siol. 98, 503-517). The results indicate that restriction endonuclease cleavage of the bovine DNA with enzymes such as SacI and BglI, which do not cut the cloned pre-prorennin cDNA sequence, nevertheless frequently yields more than one band of DNA which will hybridize to the rennin sequence. This suggests (a) that the genomi. copy of rennin information contains additional DNA, presumably intervening sequences, which contain restriction enzyme sites not found in rennin cDNA, or (b) that more than one rennin gene exists in the genome and some restriction enzymes cut between the copies. This latter possibility was eliminated by hybridizing re~triction cut bovine genomic DNA with 32P-labelled probes derived from the 5' and 3' ends of the cloned rennin cDNA. These results, using restriction endonucleases EcoRI and Ba~HI for example, are consistent with a single genomic copy of rennin coding information.

:

This mean~ that A and B forms of rennin observed by B.
Foltmann et al (J. Biol. Chem. 254, 8447-8456 C1979]) are most likely the products of two different alleles of the rennin gene. Furthermore, the bovine genomic copy of the rennin gene contains intervening sequences, and in that respect the genomic copy is different from our cloned cDNA
gene which is identicai to the messenger RNA for pre-prorennin.

6. Expression of Prorennin in Yeast Recombinant fl phaye CGF 293-207 RFI DNA (40~ g) was cut with Bind lII (N. E. Biolabs, 15 units~ and Bgl II (N. E. Biolabs, 14 units) for one hour at 37C in a 103J~1 reaction volume as described previously. The restriction cut DNA was applied to a preparative horizontal agarose gel, and the 435 ~p 293-207 piece was excised and eluted by freezing and crushing the agarose chunk. After ethanol precipitation, the DNA was redi6solved in water and about 1~ g was partially cut with Hhal (N. E. Biolabs, 0.06 units) for lS minutes at 37C to obtain the 190 bp HhaI to BgeII piece containing the pR
gtart. Thi6 DNA fragment was isolated by gel as described previously and rendered blunt-ended by treatment with DNA
polymerase I (Boehringer Mannheim, 14 units) in a 30~ 1 reaction containing 60mM tris-HCl, pH 7.5, 8mM MgC12, lOmM
dithiothreitol, lmM ATP and 0.2 mM of lZ73~3 each deoxynucleotide triphosphate for 30 minutes at roo~
temperature. The DNA was phenol extracted and ethanol precipitated.
A synthetic oligonucleotide bearing an Xba I restriction endonuclease sequence ending with ATGG, (i.e., CCATCTAGATGG) was synthesized by the triester method (K. Itakura, et al., J. Biol. Chem. 250 4592 ~1975~) by Collaborative Research, Inc. and 5 ~g was kinased with X -p-ATP using 6 units of T4 polynucleotide kinase (P-L Biochemicals) in a 35~ 1 reaction containing Tris HCl pH 7.6, lOmM MgC12, lOmM
2-mercaptoethanol and 2 nmoles ATP. This 5'-labelled - oligor.ucleotide (22 p-moles ends) was added to about 0.5 pmoles of the 190 bp fragment with buffer plus 500 unites of T4 DNA ligase (N.E. Biolabs). The reaction was incubated at 15-C for one hour then at 4C overnight, and then diluted with four volumes of 180mM NaCl, 7mM MgC12 and 5mM Tris HCl, pH 8. After heating at 65C for five minutes, the DNA
was trFated with 12 units of XbaI restriction endonuclease (5 unit~ additionally were added after one hour for a total of 1.5 hours of digestion). Finally, the oligonucleotide monomers were removed from the linkered 190 bp DNA by gel electrophoresis (7% polyacrylamide gel). The D~A fragment was eluted from the acrylamide chunk by soaking in buffer for 24 hours. The DNA was ethanol precipitated, redissolved in 15~41 of water and incubated in a ligation reaction containing 0.5~9 of ~GF12-fl vector opened at Xba I site :'.' ~ - ' ' .

, ~Z73~3 and the~ treated with al~aline phosphatase as described previously. Aliquots of the ligation reaction were used to transform competent cells of strain LG90 as described above.
The transformed cells were plated on tryptone-yeast extract plates containing fl sensitive cells (JM101). Several phage plaques were picked and small cultures of each were grown to provide a small amount of RFl DNA. Restriction endonuclease digestion (XbaI and HaeIII) and agarose gel electrophoresis revealed that some phage clones carried the desired 190 bp fragment in the desired orientation (5'-end of prorennin gene adjacent to the single EcoRI site of CGF12). One such isolate was named CG~21.
About 10 ~ g of the CGF21 DNA was cut with PstI (N E~
Biolabs, 7 units) for 45 minutes at 37C in a 40ml reaction as previously described. The Pst I cut DNA was then with EcoRI (N.E. Biolabs, 10 units) for 45 minutes at 37 DC. The 100 ~p PstI/EcoRI fragment was isolated by acrylamide gel.
The plasmid pBR322 (~8 ~ ) was cut with EcoRI (N.E. Biolabs, 7.5 units) and HindIII ~N.E. 8iolabs, 7.5 units) for one hour at 37 C in a 30 ~ 1 reaction volume. The resulting HindIII/EcoRI fragment (4.3Kb) was purified by agarose gel.
CGF293-118/37 DNA (10 ~ g) was cut with PstI (N.E. Biolabs, 8 units) and HindIII (N.E. Biolabs, 10 units) for one hour at 37-C in a 30 ~1 reaction volume. m e l.lkb PstI/HindIII DNA
fragment was purified by agarose gel. The three DNA
fragments were joined in a tri-molecular ligation reaction to .
- . ., ' - . : .' ' . .
- ' . ' ~ ' 1;~73~3 yield pCGE68. The tri-molecular ligation (reaction v~olume 27~1) contained approxi~ately equal molar proportions of the three frag~ents totaling 1.5~4g DNA. The ligation reaction was carried out with 400 units T4 DNA ligase (N.E. Biolabs) at 12 DC for 8 hours. Aliquots of the ligation reaction were used to transform competent cells of strain LE392 as described. Analysis of the plasmid DNA by restriction enzyme digestion (PstI, Xbal, Bgell and ~I) and ~garose gels revealed that some isolates carried the desired plasmid pC OE68. This plasmid contains the DNA encoding Met-prorer~in.
~he pCGE68 DNA (lO~ g) was cut with XbaI (N.E. Biolabs, 10 units for 2 hours at 37C. After precipitation with ethanol, the DNA was rendered blunt ended by treatment with Sl nuclease (30 units) for 30 minutes at 37C. After phenol extraction and ethanol precipitation the DNA was incubated with 5'-phosphorylated SalI linker (Collaborative Research, 2.5 ~ g). The linker had been kinased with ~-22P-ATP using 2.5 units of T4 polynucleotide kinase (P-L Biochemicals) in a 10J4l reaction containing lOmM Trifi-HCl, pH 7.6, lOmM Mg C12 lOmM 2-mercaptoethanol and 0.12 nmoles ATP. The linker was ligated to the blunt-ended pCGE68 DNA in a 25~1 reaction for 8 hours at 14-C. The resulting ligated DNA containing a SalI linker was used to transform competent cells of strain BNN45. Restriction enzyme (SalI) and agarose gels were used to identify the desired plasmid, pCGE91.

- ~

~;~73~383 The construction of prorennin in yeast was now begun.
The first yeast vector of interest, pCGS128, was made from a ligation of three pieces. First, pCGE91 wa~ cut with Salr (N.E. Biolabs, 10 unit~) for 3 hours at 37C. This DNA
fragment was then rendered blunt-enaed by treatment with DNA
polymerase I (soehrin9er/Mannheim~ 10 units) in a 50~ 1 reaction containing 10 mM Tris-HCl, pH7.5, 8mM MgC12, lOmM
dithiothreitol, and 0.2mM of each deoxynucleotide triphosphate for one hour at room temperature. The blunt ended DNA was then ethanol precipitated, redissolved and cut with HindIII (N.E. Biolabs, 7.5 units) for 1 hour at 37C.
The 1200 bp blunt-ended SalI/HindIII DNA fragment was purified by àgarose gel electrophoresis. The next DNA
fragment containing the necessary components of a shuttle vector was purified from cCGS40. This latter vector was cut .
with EcoRI and HindIII and the resulting 7000 bp fragment was purified by agarose gel electrophoreies. The third DNA
.. ... .
fragment containing the PGALpromoter came from pBM125 (courtesy of R. Davis, Stanford University) which was cut with BamHl, blunted with DNA polymerase I plus all four deoxyllucleotide triphosphates, then cut with EcoRI to yield a 820 bp piece designated PGALl25. m e nucleotide sequences depicting the promoter lengths are shown in Table 1. The three pieces of DNA (1200bp from pCGE9l, SalI
blunt-ended/HindIII, 7000 bp from pCGS 40 EcoRI/HinaIII, and 820 bp from PGAL125) were ligated together using equimolar ' ;'' ' ' ~ ' ' ` ' -.

lz73883 amounts of the fragments in a 25J~1 reaction containing ~4 DNA ligase (Collaborative Research, 2 blunt-ended units) and appropriate buffers and ATP and incubated for 18 hours at 14-C.
The ligated DNA was used to transform competent cells of strain CGE129. Analysis of the plasmid DNA by restriction enzyme digestion and agarose gel revealed isolates which carried the desired plasmid pCGS128. DNA of pCGS128 was used to transform yeast strain CGY150. The transformed sp~leropla~ts were selected. Western protein blot analyses revealed that the yeast strain carried prorennin (~0.02~).
In order to increase the expression of prorennin an additional construction was carried. The pCGS128 DNA was cut with HindIII. A fragment (pRB58) from the 3' end of the SUC
2 gene was cut with HindlII, made blunt-ended with E. coli DNA polymerase I and then SalI linkers were ligated on. The resulting fragment was cut with SalI and BamHl to produce a gel purified 1 kb DNA fragment which was ligated into p CGS40 cut with BamHl and SalI.
The resulting vector, pCGS108, was cut at Hpal and SalI, made blunt with E. coli DNA polymerase I and gel purified.
HindlII linker (Collaborative Research, 10 nucleotides long) were ligated to the DNA fragment which was then cut with - HindIlI and gel purified to produce a 650 bp fragment which was ligated into the ~indlll site of pCGS128 to produce ; pCGS108.

~ -81-1 ' .

- ~
.' '' ' 7~ 3 A partial EcoRI and SalI cut was made of the pCGS168 vector to isolate a 2.6kb DNA fragment containing PGAL125 and prorennin. A partial EcoR1 cut was made from FJDB219 to produce a gel purified 2.3 kb fragment containing the LEU2 gene on a 2~ DNA fragment. These two DNA fragments were ligated together with a EcoRI/SalI digest fo Ylp5 (containing selection for URA3 to yield pCGS241 and ~CGS242 (Table 10).
The difference in structure is due to the two orientations of the 2.3 kb fragment. Both vectors were separately used to transform CGY150. Analysis of the plasmid DNA by restriction enzyme digestion and agarose gel revealed the desired plasmid with the level of prorennin expression via western analysis was increased to 0.2~ of the soluble protein. The protein demonstrated milk clottin~ activity after conversion to rennin.
Strain CGY461 bearing plasmid pCGS242 is on deposit with the American Type Culture Collection (ATCC~, Accession Number 20662, deposited February, 1983.

.

, ~7~ 33 LEU2 2~
~ Eco RI

Eco RI / ~ GALl promoter ~ \ (12~) Ampr / ~ ~lunt joint . . Prorennin A
: pCGS242 \
origln \ ~ Hind III
~ / SUC2 (3' end) " \ \/
URA3 ~ I
.' , ;._~ ,,~ . . .
' ~ - ' ' .
. .
:`
~: '' . `

. . . _ Production of Pre-prorennin Steps 1 through 5 of Example 3 were repeated for this experiment.

6. Expression of Pre-prorennin in Yeast Recombinant fl phage CGF 293/207 RFI DNA (20~u g) was cut with AvaII (N.E. Biolabs, 5 units) in a 100~ 1 reaction. The 256 bp AvaII fragment was purified by gel electrophoresis and made blunt-ended with E. coli DNA
polymerase 1 Klenow fragment. After phenol extraction and ethanol precipitation, the DNA was ligated with HindIII
linker (Collaborative Research, CAAGCTT G) then cut with HindIII (N.E. Biolabs, 15 units) and BglII (N.E. Biolabs, 3.6 units). A 245 bp fragment was purified by gel electro-phoresis containing part of the preprorennin gene. Plasmid pCGS28 DNA (British Patent No. 2,091,271 issued August 30, 1984 to B. Alford, et al.) was cut with BglII (N.E. Biolabs, 5 units( and SalI (N.E. Biolabs, 10 units) and a 1000 pb DNA
fragment containing the rest of the preprorennin gene was purified by gel. These two DNA fragments were ligated together with pBR322 cut with HindIII (N.E. Biolabs, 12 units) and SalI (N.E. Biolabs, 8 units). This vector was used to transform competent E.coli cells and ~738~;~

the resulting restriction enzyme analysis of plasmid DNA from several E. coli clones revealed the desired plasmid pCGE63 in E. coli strain CGE130.
The preprorennin gene was used to construct PCGS148 which i8 PGAL126 preprorennin. Plasmid PCGE63DNA was cut with HindIII and SalI to yield a 1200 bp fragment containing preprorennin DNA. A EcoRI/HindII I double digest was carried out on pRB118 to obtain a 850 bp fragment containing P8UC2. These fragments were ligated in a tri-molecular reaction as described with an EcoRI/SaII fragment of pCGS40 which imports the characteristics of a shuttle vector. The mixture was used to transform competent C OE129 E. coli cells. Clones of E. coli carrying the desired plasmid PCGS64 were identified by restriction digestion of plasmid DNA from several transformants.
A BglII/SalI fragment ~9 kb) of pCGS64 was purified by gel electrophoresis and contained part of the preprorennin gene, as well as the pCGS40 EcoRI/SalI fragment. A
BglII/Xho-I 3600 bp fragment of pCGE74 containing the rest of 20 preprorennin fused at the SmaI site in preprorennin gene moist of the E. coli 3-galactosidase gene was ligated to the piece from pCGS64. Transformation was carried out and restriction analyses showed the presence of the desired yeast plasmid pCGS81.

.
; ' ' ' .

.
- , .. .

~.27;~83 The Psuc2 was removed from pCGS81 by restriction first with HindIII followed by filling in with E. coli DNA
_ polymerase I Klenow fragment. The opened plasmid was then restricted with EcoRI and the large fragment minus P8UC2 was gel purified. The PGAL126 was obtained by restriction of pBM126 (courtesy R. Davis, Stanford, University). The plasmid psMl26 was cut with BamHl and filled in with E.coli DNA polymerase I Klenow fragment and then cut with EcoRI to yield the desired 750 bp PGAL126. These two fragments were ligated together to get pCGS148, which contains PGAL126 preprorennin 'Z (where 'Z represents a portion of B-galactosidase gene).
A 1000 bp piece of DNA was obtained by digesting pCGS148 with EcoRI and ~ II. In addition, the BglII/SalI 1800 bp fragment of pCGS168 was gel purified. These two fragments were ligated with the 8~b Eco~I/SalI fragment of pCGS 40 in excess. Transformation of competent E. coli CGE129 was carried out and restriction analysis revealed clones carrying the desired plasmid pCGS240 (Table ll). Plasmid DNA prepared 20 from E. coli carrying pCGS240 was used to transform yeast strain CGY150. Yeast strain CGY457 re~ulted from that transformation and carries plasmid pCGS240. The level of expression of protein from the GALl promoter as demonstrated by western hybridization with rennin antibody was ~0.2~ of the soluble protein.

. , .

: , '-~ ~ , . , . ~ .~ ' : ' ~f~73~

Strain CGY457 bearing plasmid pCGS240 is on deposit with the American Type Culture Collection (ATCC), Accession Number 20661, deposited February, 1983.

-' ~ :

~.~73~8;~

TAsLE 11 GALl promoter (126) Eco RI ~ Blunt joint >~ ~
~\

Ampr / X
\P.reprorennin _ ~ d III
pCGS240 UC2 (3' end) \ ~ Sal I
E. coli\
origin origin .

..:
, ..
.

.
:
.

Claims

The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. The recombinant DNA material comprising the following bovine growth hormone nucleotide sequence:

2. The polypeptide product produced by expression in yeast of the nucleotide sequence of

claim 1.