IE77158B1 - Protein with urate oxidase activity recombinant gene coding therefor expression vector micro-organisms and transformed cells - Google Patents

Abstract

The invention concerns a new urate oxidase activity protein which has the sequence (I), possibly preceeded by a methionine, or in that it may present a degree of substantial homology with this sequence. The invention is also aimed at medicines containing this protein, as well as the genetic engineering implements to obtain it.

Description

PROTEIN WITH URATE OXIDASE ACTIVITY, RECOMBINANT GENE CODING THEREFOR, EXPRESSION VECTOR, MICRO-ORGANISMS AND TRANSFORMED CELLS The invention relates to a novel protein with urate oxidase activity, to a drug in which it is present and to the genetic engineering tools for producing this protein and in particular a recombinant gene, an expression vector carrying said gene, the eukaryotic cells and the prokaryotic microorganisms transformed by this expression vector.

Urate oxidase (EC 1.7.3.3.), which is also called uricase, is an enzyme of the purine degradation pathway. This enzyme does not exist in primates (such as man), birds, a few reptiles or most insects. It is J» also non-existent in some dogs (such as the dalmatian).

In man, the purine bases - adenine and guanine - are converted to xanthine. The xanthine is oxidized 15 by xanthine oxidase to form uric acid according to the reaction: xanthine + H2O + O2 -* uric acid + O2.

The O2" radical, which is the substrate for superoxide dismutase, is converted by the latter to hydrogen peroxide.

Uric acid, a metabolite present in blood, is normally found essentially in the form of the soluble monosodium salt. However, in certain people, it may happen that the uric acid precipitates and forms calculi. Hyperuricemia, which is an increase in the amount of uric acid circulating in the blood, causes uric acid to deposit in the cartilaginous tissues, leading to gout. Hyperuricemia can also have consequences on the kidneys: an excess of uric acid in the urine and in the kidneys can result in uric acid nephrolithiasis, i.e. the accumulation of renal calculi, which are very painful and can damage the kidney. These calculi are composed of uric acid possibly associated with phosphate and oxalate salts.

• I I JO Overproduction of uric acid can have a variety of origins: congenital metabolic defects, Lesch-Nyhan syndrome, excess ingestion of purine or proteins, * treatments with uricosuric drugs, treatment of hemopathies, in particular cancerous hemopathies with < cytolytics (chemotherapy) or by radiotherapy, etc.

(Gutman, A.B. and YU, T.F. (1968) Am. J. Med. 45 - 756779).

Urate oxidase, the enzyme which catalyzes the degradation of uric acid to allantoin (a compound which is much more soluble than uric acid and does not crystallize at the concentrations reached in biological fluids), therefore has therapeutic value. Used in injections, it has a large number of advantages in the treatment of hyperuricemia and nephrolithiases: speed of the hypouricemic effect (reduction of hyperuricemia of the order of 50% in less than 24 h), better protection of the kidney against lithiases compared with other drugs such as allopurinol (a xanthine oxidase inhibitor), etc. This enzyme is currently mainly used as a cytolytic additive in chemotherapy.

The urate oxidase currently used as a drug is obtained by a method comprising the culture of a mycelium of Aspergillus flavus and isolation of the urate oxidase from the culture medium by extraction, together with several steps for partially purifying this protein. This method, which makes it possible to obtain urate oxidase with a specific urate oxidase activity around 8 U/mg, devoid of toxic contaminants, nevertheless has disadvantages. In fact, the physiology and especially the genetics of A. flavus are not easy to work with (WOLOSHUK et al. (1989) Applied environ, microbiol., vol. 55, p. 86-90). It is therefore $ impossible to obtain strains which produce this enzyme in substantial amounts. Furthermore, A. flavus is liable to produce aflatoxins, which are sometimes difficult to separate off. The purified product should I consequently be checked to ensure that It is free from these toxins.

There is therefore a need for a purer A. flavus urate oxidase as well as for genetic engineering tools and techniques whereby these disadvantages can be overcome.

The Applicant purified the urate oxidase extracted from A. flavus, hereinafter called extractive urate oxidase, at a degree of purity much higher than that already known for said protein, determined the partial sequence thereof and constructed two pools of labeled probes which are liable to hybridize with the nucleotides coding for two portions of said protein. It then constructed an expression vector comprising this cDNA, transformed a strain of E. coli K12 with the latter, cultured said strain and verified that the lyzate of the cells contained a recombinant protein of the expected molecular mass, which possesses urate oxidase activity (capacity to degrade uric acid to allantoin).

The Applicant also constructed several vectors for expression in eukaryotic cells, comprising a recombinant gene coding for urate oxidase whose sequence contains variations, relative to the isolated cDNA, introduced for the purpose of inserting codons which are customary in eukaryotic cells, transformed different eukaryotic cells with the aid of these vectors, cultured said cells in a small volume as well as in a larger volume (fermenter), and found that the lyzates of the cells contained a substantial proportion of a recombinant protein of the expected molecular mass, possessing urate oxidase activity.

It purified this recombinant protein and characterized it partially in a comparative manner with respect to the extractive urate oxidase.

The Invention therefore relates to a novel protein, characterized in that it has a specific urate oxidase activity of at least 16 U/mg and in that it has the following sequence: Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val Tyr Lys Val His Lys Asp Glu Lys Thr Gly Val Gin Thr Val Tyr Glu Ret Thr Val Cys Val Leu Leu Glu Gly Glu lie Glu Thr Ser Tyr Thr Lys Ala Asp Asn Ser Val lie Val Ala Thr Asp Ser lie Lys Asn Thr lie Tyr lie Thr Ala Lys Gin Asn Pro Val Thr Pro Pro Glu Leu Phe Gly Ser lie Leu Gly Thr His Phe He Glu Lys Tyr Asn His lie His Ala Ala His val Asn lie Val Cys His Arg Trp Thr Arg Met Asp lie Asp Gly Lys Pro His Pro His Ser Phe lie Arg Asp Ser Glu Glu Lys Arg Asn Val Gin Val Asp Val Val Glu Gly Lys Gly lie Asp lie Lys Ser Ser Leu Ser Gly Leu Thr Val Leu Lys Ser Thr Asn Ser Gin Phe Trp Gly Phe Leu Arg Asp Glu Tyr Thr Thr Leu Lys Glu Thr Trp Asp Arg lie Leu Ser Thr Asp Val Asp Ala Thr Trp Gin Trp Lys Asn Phe Ser Gly Leu Gin Glu Val Arg Ser His Val Pro Lys Phe Asp Ala Thr Trp Ala Thr Ala Arg Glu Val Thr Leu Lys Thr Phe Ala Glu Asp Asn Ser Ala Ser Val Gin Ala Thr Het Tyr Lys Met Ala Glu Gin lie Leu Ala Arg Gin Gin Leu lie Glu Thr Val Glu Tyr Ser Leu Pro Asn Lys His Tyr Phe Glu lie Asp Leu Ser Trp His Lys Gly Leu Gin Asn Thr Gly Lys Asn Ala Glu Val Phe Ala Pro Gin Ser Asp Pro Asn Gly Leu He Lys Cys Thr Val Gly Arg Ser Ser Leu Lys Ser Lys Leu preceded, optionally, by a methionine.

Preferably, said protein has a specific urate oxidase activity of approximately 30 U/mg.

A valuable protein of this type is the one which has, by two-dimensional gel analysis, a spot of molecular mass of approximately 33.5 kDa and an isoelectric point which is around 8.0 representing at least 90% of the protein mass.

Preferably, the purity degree of this protein which is determined by liquid chromatography on a C8 grafted silica column is higher than 80%.

A valuable protein of this type Is the one which has an isoelectric point around 8.0. It is advantageous that the amino-terminal serine carries a blocking group, preferably of mass around 43 units of atomic mass, such as for example the acetyl group.

The invention also relates to the drug which contains, in a pharmaceutically acceptable vehicle, the above-defined protein. The latter may advantageously replace, in its various indications, the extractive urate oxidase with a specific urate oxidase activity around 8 U/rog sold in injectable preparations under the trademark Uricozyme (Vidal 1990).

The invention further relates to a recombinant gene, characterized in that it comprises a DNA sequence coding for the protein which has the following sequence: Met Lys Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val Tyr Val His Lys Asp Glu Lys Thr Gly Val Gin Thr Val Tyr Glu Het Thr 20 Val Cys Val Leu Leu Glu Gly Glu lie Glu Thr Ser Tyr Thr Lys Ala Asp Asn Ser Val He Val Ala Thr Asp Ser lie Lys Asn Thr lie Tyr lie Thr Ala Lys Gin Asn Pro Val Thr Pro Pro Glu Leu Phe Gly Ser Xie Leu Gly Thr His Phe lie Glu Lys Tyr Asn His He His Ala Ala His Val Asn He Val Cys His Arg Trp Thr Arg Het Asp lie Asp Gly Lys Pro His Pro His 25 Ser Phe lie Arg Asp Ser Glu Glu Lys Arg Asn Val Gin Val Asp Val Val Glu Gly Lys Gly lie Asp lie Lys Ser Ser Leu Ser Gly Leu Thr Val Leu Lys Ser Thr Asn Ser Gin Phe Trp Gly Phe Leu Arg Asp Glu Tyr Thr Thr Leu Lys Glu Thr Trp Asp Arg He Leu Ser Thr Asp Val Asp Ala Thr Trp Gin Trp Lys Asn Phe Ser Gly Leu Gin Glu Val Arg Ser His Val Pro Lys 30 Phe Asp Ala Thr Trp Ala Thr Ala Arg Glu Val Thr Leu Lys Thr Phe Ala Glu Asp Asn Ser Ala Ser Val Gin Ala Thr Het Tyr Lys Met Ala Glu Gln: He Leu Ala Arg Gin Gin Leu He Glu Thr Val Glu Tyr Ser Leu Pro Asn: Lys His Tyr Phe Glu lie Asp Leu Ser Trp His Lys Gly Leu Gin Asn Thr: Gly Lys Asn Ala Glu Val Phe Ala Pro Gin Ser Asp Pro Asn Gly Leu lie! 35 Lys Cys Thr Val Gly Arg Ser Ser Leu Lys Ser Lys Leu i I Because of the degeneracy of the genetic code, there are a large number of DNA sequences coding for a protein whose sequence corresponds to the formula given above. One particularly preferred DNA sequence which is suitable for expression in prokaryotic microorganisms is as follows: ATGTCTGCGG TAAAAGCAGC GCGCTACGGC AAGGACAATG TTCGCGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT gtccggcctg . accgtgctga AGAGCACCAA CTCGCAGTTC tggggcttcc tgcgtgacga GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ; ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCT6GCACAA GG6CCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG.

Another preferred DNA sequence, which is particularly suitable for expression in eukaryotic cells, such as yeast, is as follows: ATGTCTGCTG TTAAGGCTGC TAGATACGGT AAGGACAACG TTAGAGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAA6GCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT ! CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC ! TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTCj AACATTGTCT GCCACCGCTG GACCCG6ATG GACATTGACG GCAAGCCACA! CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTGi ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGAl GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG! ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG: CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCA6 CGTGCA6GCC ACTATGTACA \ AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA > GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ! ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG.

Another preferred DNA sequence, which is particularly suitable for expression in animal cells, is as follows: '-ATGTC CGCAGTAAAA GCAGCCCGCT ACGGCAAGGA CAATGTCCGC GTCTACAAGG TTCACAAGGA CGAGAAGACC GGTGTCCAGA CGGTGTACGA GATGACCGTC TGTGTGCTTC TGGAGGGTGA GATTGAGACC TCTTACACCA AGGCCGACAA CAGCGTCATT GTCGCAACCG ACTCCATTAA GAACACCATT TACATCACCG CCAAGCAGAA CCCCGTTACT CCTCCCGAGC TGTTCGGCTC CATCCTGGGC ACACACTTCA TTGAGAAGTA CAACCACATC CATGCCGCTC ACGTCAACAT TGTCTGCCAC CGCTGGACCC GGATGGACAT TGACGGCAAG CCACACCCTC ACTCCTTCAT CCGCGACAGC GAGGAGAAGC GGAATGTGCA GGTGGACGTG GTCGAGGGCA AGGGCATCGA TATCAAGTCG TCTCTGTCCG GCCTGACCGT GCTGAAGAGC ACCAACTCGC AGTTCTGGGG CTTCCTGCGT GACGAGTACA CCACACTTAA GGAGACCTGG GACCGTATCC TGAGCACCGA CGTCGATGCC ACTTGGCAGT GGAAGAATTT CAGTGGACTC CAGGAGGTCC GCTCGCACGT GCCTAAGTTC GATGCTACCT GGGCCACTGC TCGCGAGGTC ACTCTGAAGA CTTTTGCTGA AGATAACAGT GCCAGCGTGC AGGCCACTAT GTACAAGATG GCAGAGCAAA TCCTGGCGCG CCAGCAGCTG ATCGAGACTG TC6A6TACTC GTTGCCTAAC AAGCACTATT TCGAAATC6A CCTGAGCTGG CACAAGGGCC TCCAAAACAC CGGCAAGAAC GCCGAGGTCT TCGCTCCTCA GTCGGACCCC AACGGTCTGA TCAAGTGTAC CGTCGGCCGG TCCTCTCTGA AGTCTAAATT G preceded by a non-translated 5' sequence favoring expression in animal cells. A preferred non-translated 5' sequence of this type is the one comprising the sequence AGCTTGCCGCCACT, located immediately upstream from the sequence described above.

It should be noted that the protein which is coded for by the above cDNA sequences can undergo maturation by the methionyl aminopeptidase, which cleaves it from its amino-terminal methionine residue.

The invention further relates to an expression vector carrying the above-defined recombinant gene with the means necessary for its expression.

For expression in prokaryotic microorganisms, in particular in Escherichia coli, the coding sequence must be inserted into an expression vector containing especially an effective promoter, followed by a ribosome binding site upstream from the gene to be expressed, and also an effective transcription stop sequence downstream from the gene to be expressed. This plasmid must also contain an origin of replication and a selection marker. All these sequences must be chosen depending on the host cell.

For expression in eukaryotic cells, the expression vector according to the invention carries the above-defined recombinant gene with the means necessary for its expression, for its replication in eukaryotic cells and for selection of the transformed cells. Preferably, this vector carries a selection marker, chosen for example to complement a mutation of the recipient eukaryotic cells, which makes It possible to select those cells which have integrated a large number of copies of the recombinant gene either into their genome or into a multicopy vector.

For expression in animal cells, especially in the cells of Chinese hamster ovaries, CHO, the coding sequence is inserted into a plasmid (for example derived from pBR322) containing two expression units, a first unit, into which the recombinant gene is inserted upstream from an effective promoter (for example the SV40 early promoter). The sequence around the initiation ATG is preferably chosen depending on the consensus sequence described by KOZAK (M. KOZAK (1978) Cell, 15, 1109-1123). An intron sequence, for example the intron of mouse α-globin, can be inserted upstream from the recombinant gene, and a sequence containing a polyadenylation site, for example an SV40 polyadenylation sequence, can be inserted downstream from the recombinant gene. The second expression unit contains a selection marker (for example a DNA sequence) coding for dihydrofolate reductase (an enzyme abbreviated hereafter to DHFR). The plasmid is transfected in animal cells, for example DHFR CHO cells (incapable of expressing DHFR). A line is selected for its resistance to methotrexate : it has integrated a large number of copies of the recombinant gene into its genome and expresses said recombinant gene at a sufficient level.

For expression in eurkaryotic cells such as yeast, for example Saccharomyces cerevislae, the coding sequence should be inserted between, on the one hand, sequences recognized as an effective promoter and, on the other hand, a transcription terminator. The array promoter/coding sequence/terminator, which is called an expression cassette, is either cloned in a plasmid vector (singlecopy or multicopy for the yeast), or integrated as a multicopy into the genome of the yeast.

The invention further relates to the eukaryotic cells transformed by the above expression vector. Of value among these eukaryotic cells are strains of the species Saccharomyces cerevisiae, in particular those which contain a mutation on one of the genes responsible for the synthesis of leucine or uracil, for example the LEU2 gene or the URA3 gene.

The invention further relates to the animal cells containing this recombinant gene with the means necessary for its expression. Said recombinant gene may, for example, have been introduced into the cells by transfection by the above expression vector, by infection with a virus or a retrovirus carrying said expression vector, or by microinjection.

The invention also relates to a method for obtaining recombinant urate oxidase which comprises the following steps: 1/ culturing of a strain as defined above; 2/ lysis of cells; 3/ isolation and purification of the recombinant urate oxidase contained in the lyzate.

The invention will be understood more clearly with the aid of the Examples below: many of the following techniques, which are well known to those skilled in the art, are described in detail in the work by Maniatis et al.: Molecular cloning: a laboratory manual published in 1984 by Cold Spring Harbor Press in New York.

EXAMPLE 1: Isolation of the messenger RNAs from Aspergillus flavus The strain of A. flavus which produces urate oxidase was cultivated under conditions appropriate for the production of urate oxidase, i.e. in a medium containing uric acid and having the following composition: glucose 15 g/1, MgSO4.7H2O 1 g/1, KH2PO4 0.75 g/1, CaCOs 1.2 g/1, uric acid 1.2 g/1, KOH 0.5 g/1, soy bean oil 0.66 ml/1, FeS04.7H20 10 mg/1, CuSCU.5H20 1 mg/1, ZnS04.7H20 3 mg/1, MnSO^.HzO 1 mg/1. The medium is adjusted to pH 7 with H2SO4 1 M and sterilized at 120eC for 80 min.

In a 5 1 Erlenmeyer flask, 1.5 1 of medium are inoculated with about 1 to 3.107 spores.

The culture is incubated for about 40 h at 30*C, with agitation (120 rpm). The mycelium is recovered by filtration on gauze, washed with water and frozen in liquid nitrogen. g of mycelium (wet weight) are thawed, resuspended' in 45 ml of lysis buffer and then taken up in the same volume of beads (0.45 pm in diameter). The lysis buffer consists of guanidine thiocyanate 4 M, Tris-HCl mM pH 7.6, EDTA 10 mM, β-mercaptoethanol 50 ml/1. The mycelian suspension is ground in a Zellmiihler mill (vibrogenic) for 5 min.

The ground material is recovered and the beads are decanted. The supernatant is sampled (about 45 ml), brought back to a final concentration of 3 M in respect of lithium chloride and stored at 0*C.

After two days, it is centrifuged for 60 min at 10,000 rpm. The supernatant is discarded and the residue is taken up in 40 ml of 3M Kiel and centrifuged again at ,000 rpm for 1 h 30 min.

The following are added: proteinase K (SIGMA) 40 pg/ml, SDS (0.1% w/v) and EDTA 20 mM. The mixture is incubated at 37°C for 3 h. Precipitation with 2 volumes of ethanol is followed by washing with 70% ethanol. The residue is taken up in 0.5 ml of TE buffer (Tris-HCl mM, EDTA 1 mM pH 7.5), the mixture is extracted twice with chloroform and precipitation is carried out with ethanol. The RNAs , are stored at -80 *C in alcohol. EXAMPLE 2: Purification of the polv A* fraction of the RNAs About 1 mg of RNA is precipitated for 20 min at 4*C (15,000 rpm) and then washed with 70% ethanol and dried. The residue is taken up in 1 ml of TE buffer and resuspended by agitation in a Vortex. Oligo dT-cellulose type 3 (marketed by Collaborative Research Inc., Biomedical Products Division) is prepared according to the manufacturer's recommendations. The RNA is deposited on the oligo dT, agitated gently to resuspend the beads and then heated for 1 min at 65‘C.

The suspension is adjusted to 0.5 M NaCl and then agitated gently for 10 min. It is then centrifuged for 1 min at 1000 rpm, the supernatant is removed and the residue is washed twice with 1 ml of TE buffer containing 0.5 M NaCl. The supernatants are removed. The poly20 adenylated fraction of the RNAs (consisting of the messenger RNAs is eluted by suspending the beads in 1 ml of TE buffer, then heating this suspension at 60*C for 1 min and subsequently agitating it for 10 min on a tilting plate. It is then centrifuged for 1 min at 1000 rpm, which makes it possible to recover on the one hand the supernatant containing free mRNAs in solution, and on the other hand the residue of cellulose beads. The above series of operations (starting from elution) is repeated. The supernatants obtained in thia way are pooled, the excess beads are removed by centrifugation and the supernatant is precipitated with ethanol containing NaCl in accordance with the usual techniques (Maniatis: op. cit.). example 3: Building oX the cDNA library The messenger RNAs isolated as described In the previous Example were used to build a cDNA library in vector pTZ19R (marketed by PHARMACIA). This vector is a plasmid comprising a polylinker containing unique restriction sites.

The cloning technique used is the one described by Caput et al. (primer-adapter technique: Caput et al., Proc. Natl. Acad. Sci. (U.S.A.) (1986) 83, 1870-1674).

It consists on the one . hand in digesting the1vector^ with Psti, adding a polydC tail to the protuberant 3' end and then digesting the resulting plasmids with BamHI. The fragment corresponding to the vector is purified on a column of Sepharose CL4B (Pharmacia). It therefore comprises a polydC tail at one end, the other end being a sticky end of the BamHI type. On the other hand·, iehe-nfessenger RNAs are subjected to reverse transcription starting from a primer having the sequence 5')<3. Thus the cDNAs i have at their 5' end the sequence GATCC complementary to the BamHI sticky end. The RNA-DNA hybrids obtained by the action of reverse transcriptase are subjected to alkaline hydrolysis, enabling the RNA to be removed. The single-stranded cDNAs:. are then purified by 2 cycles on a column of Sepharose CL4B and subjected to a treatment with terminal transferase so as to add polydGs at the 3' end. The cDNAs are inserted in single-stranded form into the vector prepared as described above. A second oligonucleotide, the adapter, complementary to the primer, is necessary in order to generate an open’* BamHI site at the 5' end of the cDNAs After hybridization of the vector, the cDNA and the adapter, the recombinant molecules are circularized by the action of the ligase of phage T4. The singlestranded regions are then repaired by means of the DNA polymerase of phage T4. The plasmid pool obtained in this way is used to transform the MC1061 strain for ampicillin resistance (Casabadan, Chou and Cohen, J.

Bact. (1980) 143, pages 971-980), EXAMPLE 4:_Purification of the extractive urate oxidase of A. flavus and characterization thereof 1) Purification of the extractive urate oxidase of A. flavus A preparation of extractive urate oxidase of A. flavus (uricozyme - Laboratoires Clin Midy) possessing a specific urate oxidase activity of 8 U/mg (the specific urate oxidase activity being the ratio between the urate oxydase activity measured according to the test described in example 9 and the total mass of proteins measured by Bradford's method: Anal. Biochem., 72, 248-254) was repurified by chromatography on a grafted agarose column, Red-agarose 120 (SIGMA), concentration by ultrafiltration and filtration on a polyacrylamide agarose gel, Ultrogel ACA 44 (IBF), according to the following protocol: Step 1: Affinity chromatography on grafted agarose Temperature: 4*C Column: PHARMACIA K50/30 - diameter » 50 mm - length » 33 cm Resin: Red-Agarose 120 (3,000 CL/R-0503 SIGMA) (gel volume = 410 ml, gel height 20 cm) Equilibration buffer: glycine/NaOH 20 mM pH 8.3 Elution buffer: glycine/NaOH 20 mM, NaCl 2M pH 8.3 Conditioning rate: 250 ral.h-1 Operating rate: 160 ml.h'1 Elution rate: 60 ml.lr1 1) Deposit the Uricozyme solution at the top of the column using a constant flow pump 2) After adsorption, wash the column with twice its volume of balancing buffer 3) Use a gradient of ionic strength having the following composition as the eluent: glycine, NaOH, 20 mM pH 8.3/glycine, NaOH, 20 mM + NaCl 2M pH 8.3 The total volume of the gradient is equal to 10 times the volume of the column, distributed by half in each constituent.

The chromatographic recording is performed at λ 280 nm; the urate oxidase pool is collected after combination of the fractions having a specific urate oxidase activity which is higher or equal to 16 U/mg.

Step 2: Concentration of the urate oxidase pool by ultrafiltration using a Biopass system comprising an ultrafiltration membrane of 10 kDa.

Step 3: Temperature: 4·C Column; PHARMACIA K50/100 - diameter « 50 mm - length - 100 cm Resin: Polyacrylamide agarose with amine and hydroxyl groups: Ultrogel ACA 44 (IBF) - gel volume - 1.6 1 - gel height - 80 cm Equilibration buffer: glycine/NaOH 20 mM pH 8.3 Conditioning rate: 40 ml.h'1 Operating rate: 24 ml.h'1 1) Deposit the concentrated urate oxidase pool at the top of the column using a constant flow pump. 2) After deposit of the sample, continue to supply the column with glycine/NaOH buffer 20 mM pH 8.3. 3) After chromatography, wash with NaCl 2M up to a U.V. absorbance value (λ » 280 nm) < 0.05.

Store under NaCl 2M at 4*C.

The chromatographic recording is performed at λ · 280 nm; the urate oxidase pool is collected after combination of the fractions having together: - a specific urate oxidase activity which is higher or equal to 20 U/mg. - only 2 electrophoresis bends under denaturing conditions (presence of S.D.S.) and silver nitrate development (Biorad staining kit), with: . a major band of 33-34 kDa . a minor band of 70-71 kDa 2) Characterization of the purified extractive urate oxidase of A. flavus: a) partial sequencing Direct amino-terminal sequencing of the protein was attempted in order to obtain information on the amino acid sequence of the purified extractive urate oxidase, making it possible to synthesize the probes necessary for cloning the cDNA. This sequencing was not successful, probably because of amino-terminal blocking of the protein (see f) below).

The following strategy was therefore developed to obtain the partial sequence of urate oxidase: - cleavage of the protein with proteolytic enzymes (using the enzymes trypsin and protease V8 from Staphylococcus aureus) - separation of the resulting polypeptides by reversed phase HPLC - sequencing of the purified peptides a) Hydrolysis of the urate oxidase with trvpsin. purification and sequencing of the peptides The urate oxidase, at a concentration of 9 mg/ml in an ammonium carbonate buffer 100 mM pH 8.9, was digested with trypsin (Worthington, TPCK), in a ratio urate oxidase/trypsin of 30/1 by weight, at 30*C for 24 h. After tryptic hydrolysis, 60 pg of digested urate oxidase were directly Injected onto a Brownlee 618 reverse phase HPLC column of grafted silica (column: 10 x 0.2 cm) equilibrated with acetonitrile 1% (v/v) and trifluoroacetic acid 0.1% (v/v) in water. The peptides were then eluted by a linear gradient of acetonitrile in a solution of trifluoroacetic acid (0.1% v/v) in water, varying from 1% to 60% of acetonitrile over 60 min, at a I rate of 150 μΐ/min. The peptides leaving the column were detected by measurement of the optical density at 218 nm.

The elution profile is shown in Figure 1, in which the numbers following the letter T (trypsin) correspond to the peaks identified.

Each peak was collected and stored at -20*C until analyzed on a protein sequencer (model 470 A from Applied Biosystems) equipped with a chromatograph (model 430 A from Applied Biosystems), which continuously analyzes the phenylthiohydantoic derivatives formed, after each degradation cycle. Table I below shows the peptide sequences of the 9 peaks identified. β) Hydrolysis of the urate oxidase with protease V8. purification and sequencing of the peptides The urate oxidase, at a concentration of 2 mg/ml in an ammonium acetate buffer 100 mM pH 6.8, was digested with protease V8 of Staphylococcus aureus (BoehringerMannheim), in a ratio urate oxidase/ protease V8 of 60/1, at 30C for 72 h. 160 pg of digested urate oxidase were then injected onto a Brownlee G18 reverse phase HPLC column of grafted silica (column: 10 x 0.2 cm); particles (7 x 0.03 pm), equilibrated with acetonitrile 1% and trifluoroacetic acid 0.1% (v/v) in water. The peptides were then eluted by a linear gradient of acetonitrile in a solution of trifluoroacetic acid in water (0.1% (v/v)), varying from 1% to 60% of acetonitrile over 60 min, at a rate of 150 pl/min. The peptides leaving the column were detected by measurement of the optical density at 218 nm.

The elution profile is shown in Figure 2, in which the numbers following the letter V (protease V8) correspond to the peaks identified.

Each peak was collected and stored at -20*C until analyzed on the protein sequencer already mentioned.

Table I below shows the peptide sequences of the 5 peaks identified.

TABLE I Sequencing of the products obtained by hydrolysis With the aid of trypsin T 17 Asn - Val - Gin - Val - Asp - Val - Val - Glu - Gly - Lys T 20 Asn - Phe - Ser - Gly - Leu - Gin - Glu - Val T 23 Phe*- Asp - Ala - Thr - Trp - Ala T 27 His - Tyr - Phe - Glu - lie - Asp - Leu - Ser T 28 He - Leu - Ser - Thr - Asp - Val - Asp - Ala - Thr - Trp - Gin - Trp - Lys • T 29 His - Tyr - Phe - Glu - lie - Asp - Leu - Ser - Trp - His - Lys T 31 Ser - Thr - Asn - Ser - Gin - Phe - Trp - Gly - Phe - Leu - Arg T 32 Gin - Asn ,- Pro - Val - Thr - Pro - Pro - Glu - Leu - Phe - Gly - Ser - lie Leu - Gly - Thr ' T 33 Gin - Asn - Pro - Val - Thr - Pro - Pro - Glu - Leu - Phe - Gly - Ser - He Leu - Gly - Thr With the aid of protease V8 V 1 Tyr - Ser - Leu - Pro - Asn - Lys - His - Tyr - Phe - Glu - lie - Asp - Leu - Ser - Trp - His - Lys V 2 Val - Thr - Leu - Lys - Thr - Phe - Ala - Glu - Asp - Asn - Ser - Ala - Ser - Val - Gin - Ala V 3 Thr - Ser - Tyr - Thr - Lys - Ala - Asp - Asn - Ser - Val - He - Val - /\χ3 Thr - Asp - Ser - He - Lys - Asn - Thr - He - Tyr - lie - Thr V 5 Gly - Lys - Gly - He - Asp - lie - Lys - Ser - Ser - Leu - Ser - Gly - Leu - Thr - Val - Leu - Lys - Ser - Thr - Asn - Ser - Gin - Phe - Trp - Gly - Phe Leu - Arg V β Gly - lys - Gly - He - Asp - He - Lys - Ser - Ser - Leu - Ser - Gly - Leu - Thr - Val - Leu - Lys co f) b) specific activity: The purified extractive urate oxidase has a specific activity of about 30 U/mg, c) Electrophoresis under denaturing conditions The electrophoresis of the purified extractive urate oxidase on a polyacrylamide gel in the presence of SDS (sodium dodecylsulfate), followed by silver development, makes it possible to see a band of high Intensity of about 33-34 kDa and a band of very low intensity of about 70-71 kDa. d) Determination of the isoelectric point: ErocacLura: - Use of ready-to-use gels, LKB Ampholines Gel Plates of Pharmacia of pH ranges comprised between (3.5-9.5) and (5-8).

- Deposit of 10 μΐ of proteins of LKB controls (range of the isolectric points of the control proteins: 3.5-9.5) and of 4 pg and 8 pg of purified urate oxidase (on two different tracks).

- Run 1 h 30, 12V, 6*C.

- Then coloration with Coomasie blue (0.1%) in (25% Ethanol, 8% Acetic Acid) so as to color the proteins, followed by a discoloration using a solution containing 25% Ethanol and 8% Acetic Acid (so as to remove the background).

- Results: Observation on each one of the two tracks of two close bands (doublet) of isoelectric points 8.1 and 7.9. e) Two-dimensional ael analysis The two-dimensional gel analysis makes it possible to separate the proteins at first according to their isoelectric points and then according to their molecular masses.

Protocol Sample: solution of purified extractive urate oxidase in a glycine buffer 20 mM of pH 8.3.

Preparation of the sample Two samples of 5 pg and 10 pg of urate oxidase; - Drying by in vacuo centrifugation, taking up in 5 μΐ of the lysis buffer of the following composition: urea 2.5 M- / 3-(3-cholamidopropyl) dimethylamroonio-1propanesulfonate CHAPS (Sigma) 2% (v/v) / Ampholines Amphoters (LKB) of pH ranging from 5-8 and 3.5-9.5 0.4% / β-mercaptoethanol 5%.

Isoelectrofocusing gel - Preparation of a solution containing: urea 9.5 M, CHAPS 5%, Ampholines LKB (pH (3.5-9.5) 1%; pH (5-8) 1%), Acrylamide/bisacrylamide (28.4%/1.7%) 3.5% final, H20.

- Solution filtered and degased then addition of 0.075% of tetramethylethylenediamine Temed (Pharmacia) and 0.015% of ammonium persulfate.

- Solution poured into tubes (16 x 0.12 cm) polymerization overnight at 20*C.

- Cathodic solution: NaOH 0.1 M degased.

Anodic solution: H3PO4 25 mM.

- Pre run 45 min 4 mA (voltage 300 V -* 1,000 V).

Deposit of samples at the cathode level.

- Run 19 h at 1,000 V at 20*C.

- Gels equilibrated and unmoulded 10 min at 20 *C in a buffer (Tris 0.375 M pH 8.8; SDS 3% ; Dithiothreitol DTT 50 mM).

Denaturing PACE/SDS gel - Preparation of a solution containing: Acrylamide/ bisacrylamide (30%/0.8%) 15% final, tris-HCl (pH 8.8) 0.375 M, H20.

- Solution filtered and degased then addition of SDS (0.1%), ammonium persulfate 0.05% and Temed 0.05%.

Polymerization overnight at 4*C (gel 16 x 20 x 0.15 cm).

- The Isoelectrofocusing gel after equilibration is deposited on the surface of the PAGE/SDS gel which is sealed with agarose.

- Electrophoresis buffer: (Tris-HCl 25 mM pH 8.3, glycine 0.192 M, SDS 0.1%).

- Run 100 mA - 6 h at 6*C.

- Gel fixed in 50% of methanol, 10% of acetic acid then colored with silver nitrate (Method of Blum. H., Electrophoresis 1987, 8 p. 93-99), - Gel scanned with a face scanner 2000/Kodak in order to determine the optical density and the surface of each spot, thus making it possible to calculate the quantity ratio between the spots.

- The molecular mass of the protein is determined by making a two-dimensional gel in the presence of Amersham control proteins.

RaSAill: Two spots of molecular mass around 33.5 kDa can be observed, the one in majority having an isoelectric point around 8.0 of intensity 5.2 (representing about 93% of the protein mass), the one in minority having an isoelectric point around 7.4 of intensity 0.41 (representing about 7% of the protein mass). f) Determination of the amino-terminal sequence and of the mass of the blocking amino-terminal group; a) demonstration, of the,, blockiDg..characteristic of the amino-terminal sequence; The amino-terminal sequence was analyzed using an Applied Biosystem sequencer model 470 A, coupled to an analyzer for analyzing phenylthiohydantoic derivatives Applied Biosystem model 120A. The purified urate oxidase (200 pmols controled by amino acid analysis) was deposited on the sequencer in the presence of 20 pmols of β-lactoglobulin, control protein.

No amino-terminal sequence corresponding to a sequence of the urate oxidase was detected (however, the amino-terminal sequence of the control protein was detected, thus the sequencer is working).

Therefore the amino-terminal end of A. flavus urate oxidase is blocked. β) determination of the sequence of an aminoterminal peptide having 32 amino acids and of the mass of the blocking amino-terminal group; Method; Digestion bv cvanoaen bromide The purified extractive urate oxidase is subjected to a gel filtration on a gel which is obtained by cross-linking of dextran with epichlorhydrin, Sephadex G25 (PD10 - Pharmacia), equilibrated with a solution containing 7% of formic acid, which makes it possible to eliminate the salts and change the buffer. By in vacuo centrifugation, the formic acid concentration is increased to 70%. Cyanogen bromide is then added to a final concentration of 0.2 M and the mixture is reacted for 20 h under argon in the absence of any light and at room temperature.

- Separation bv ion exchange chromatography of the peptides derived from the cyanogen bromide digestion of the protein The peptides were separated on an ion exchange column based on mono S hydrophylic resin (Pharmacia).

Buffer A: Ammonium acetate 10 mM pH 6.2 Buffer B: Ammonium acetate 1 M pH 6.2 Rate: 0.6 ml/min, detection of the peaks by measuring the optical density at 278 nm Gradients: from 0% of B to 100% of B over 30 min collection of fractions of 1 ml.

The fractions derived from the ion exchange step were analyzed by PAGE/SDS gel following the method described by Schagger and Von Jagow (1987) Anat. Biochem 166 - p. 368-379.

- Purification of the amino-terminal peptide by reverse phase HPLC and analysis thereof by mass spectrometry The peptide derived from the ion exchange step and having a molecular mass around 4,000 Da (on PAGE/SDS gel) was purified on a C18 reverse phase HPLC column based on grafted silica, the Beckman Altex C18 column (250 x 2.1 mm) Rate: 0.3 ml/min, detection of the peaks by measuring the optical density at 218 nm Buffer A: ^0/0.1% TFA (trifluoroacetic acid) Buffer B: Acetonitrile/0.1% TFA Gradient of 1 to 50% of B over 60 min.

The peptide collected after a first step of reverse phase HPLC was repurified on the same reverse phase HPLC column but with a different gradient.

Gradient of 1 to 50% of B over 10 min.

The peak collected was subjected to a fast atom bombing mass spectrometry analysis (FAB/MS) with a glycerol + thioglycerol matrix.

- Digestion bv chvmotrvpsin of the amino-terminal pentide-and analysis, of the amino acids of the chvmotrvntic peptides separated bv reverse phase HPLC In order to establish the sequence of the purified peptide by reverse phase HPLC, the latter was digested by chymotrypsin. The chymotryptic peptides were separated by reverse phase HPLC on a Beckman Altex C18 (250 x 2.1 mm) column.

Rate 0.3 ml/min, detection of the peaks by measuring the optical density at 218 nm, Buffer A H20/0.11% TFA Buffer B Acetonitrile/0.08% TFA Gradient from 1% of B to 50% of B over 60 min collection of the peaks.

The chymotryptic peptides were identified by analyzing the amino acids on an Applied Biosystem Analyzer (model 420-130A).

Results: The results presented hereinafter, established after the determination of the cDNA sequence of A. flavus urate oxidase and of the deduced amino acid sequence (see example 6), can only be understood in the light thereof.

- Analysis by mass spectrometry of the aminoterminal peptide.

A difference of about 42 atomic mass units is observed between the two molecular masses determined by mass spectrometry, 3684 and 3666, and the theoretical molecular masses determined from the following sequence (amino acid sequence deduced from the cDNA of A. flavus urate oxidase with cleavage of the amino-terminal methionine group and peptide cleavage by cyanogen bromide after the first methionine residue): Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val Tyr Lys Val His Lys Asp Glu Lys Thr Gly Val Gin Thr Val Tyr Gly (1) with a carboxyterminal methionine residue modified by action of cyanogen bromide either in homoserine, 3642, or in lactone homoserine, 3624.

There is therefore a blocking group on the aminoterminal serine which imparts an additional mass of about 42 atomic mass units, probably corresponding to an acetylation of the latter (mass of CH3CO-mass H - 42 atomic mass units).

Analysis of the amino acids of the chymotryptic peptides: This analysis made it possible to show without any ambiguity that the amino-terminal peptide sequence obtained by digestion with cyanogen bromide comprises the sequence (1), explained above.

The complete sequence of amino acids of urate oxidase is indicated hereinunder; Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val Tyr Lys Val His Lys Asp Glu Lys Thr Gly Val Gin Thr Val Tyr Glu Met. Thr val Cys Val Leu Leu Glu Gly Glu He Glu Thr Ser Tyr Thr Lys Ala Asp Asn Ser Val lie Val Ala Thr Asp Ser lie Lys Asn Thr lie Tyr He Thr Ala Lys Gin Asn Pro Val Thr Pro Pro Glu Leu Phe Gly Ser He Leu Gly Thr His Phe lie Glu Lys Tyr Asn His He His Ala Ala His Val Asn He Val cys His Arg Trp Thr Arg Met Asp lie Asp Gly Lys Pro His Pro His Ser Phe He Arg Asp Ser Glu Glu Lys Arg Asn Val Gin Val Asp Val Val Glu Gly Lys Gly He Asp He Lys Ser Ser Leu Ser Gly Leu Thr Val Leu Lys Ser Thr Asn Ser Gin Phe Trp Gly Phe Leu Arg Asp Glu Tyr Thr Thr Leu Lys Glu Thr Trp Asp Arg He Leu Ser Thr Asp Val Asp Ala Thr Trp Gin Trp Lys Asn Phe Ser Gly Leu Gin Glu Val Arg Ser His Val Pro Lys Phe Asp Ala Thr Trp Ala Thr Ala Arg Glu Val Thr Leu Lys Thr Phe Ala Glu Asp Asn Ser Ala Ser Val Gin Ala Thr Met Tyr Lys Met Ala Glu Gin He Leu Ala Arg Gin Gin Leu lie Glu Thr Val Glu Tyr Ser Leu Pro Asn Lys His Tyr Phe Glu He Asp Leu Ser Trp His Lys Gly Leu Gin Asn Thr Gly Lys Asn Ala Glu Val Phe Ala Pro Gin Ser Asp Pro Asn Gly Leu He Lys cys Thr Val Gly Arg Ser Ser Leu Lys Ser Lys Leu EXAMPLE 5: Screening of the bacteria 1) Preparation of the labeled probes Two pools of probes deduced from amino acid sequences of the protein were synthesized with the aid of a Biosearch 4600 DNA synthesizer. The first pool corresponds to the sequence of residues His-Tyr-Phe-Glu-Ile-Asp (part of the sequence of T 27), i.e. from 5' to 3: A T G G G 1Q TCGATTCAATATG T C A A A This pool in fact consists of 24 x 3 = 48 different oligonucleotides, representing all the possible combi15 nations. The second pool corresponds to the sequence of amino acid residues Gln-Phe-Trp-Gly-Phe-Leu (part of the sequence of V 5) , i.e.'from 5' to 3': GG A GT A AAGCCCCA AA TG AA C AC T This pool consists of 24 x 4 = 64 combinations. The probes are labeled with terminal deoxynucleotide transferase (TdT) (marketed by IBI Inc.).

The reaction is carried out on 100 ng of a mixture of oligonucleotides in solution (100 mg/ml) in Cobalt reaction buffer (supplied as a 10-fold concen30 trate by IBI Inc.): 1.4 M potassium cacodylate - pH 7.2, 300 mM dithiothreitol, 1 μΐ of the enzyme terminal deoxynucleotide transferase (IBI Inc.) and 50 uCi of deoxycytidyl triphosphate, dCTP, labeled with P32. The reaction is carried out at 37°C for 10 min and is then stopped by the addition of 1 ul of EDTA 0.5 M. A phenol extraction is carried out and the extract is dialyzed on a column of Biogel P10 polyacrylamide (Biorad: 150-1050). 2) Hybridization and detection of the colonies containing urate oxidase cDNA About 40,000 colonies are screened by the in situ hybridization technique developed by Grunstein and Hogness (1975, Proc. Natl. Acad. Sci. (U.S.A.), 72. 3961). About 6000 bacteria are plated out in Petri dishes to give isolated colonies. After incubation for 24 h at 37*C, each dish is replicated on 2 filters, each filter being intended to be treated with one of the 2 pools of probes, so that all the colonies obtained are tested with the 2 pools of probes in parallel.

The filters are hybridized with one of the 2 pools of probes in a buffer containing 6 x SSC, 10 x Denhardt's solution and 100 ug/ml of sonicated and denatured salmon sperm DNA (SIGMA). The hybridization is carried out at a temperature of 42 eC for 16 h. The 6 x SSC solution is obtained by diluting a 20 x SSC solution. The preparation of the 20 x SSC buffer is described by Maniatis, Fritsch and Sambrook (op. cit.). In summary, this buffer contains 175.3 g/1 of NaCl and 68.2 g/1 of sodium citrate and is adjusted to pH 7 with a few drops of NaOH 10 N. The 10 x Denhardt's solution contains 1 g of Ficoll, 1 g of polyvinylpyrrolidone and 1 g of human serum albumin per 500 ml of final volume.

After washing in the 6 x SSC solution at 42°C (3 h with 5 changes of bath), the filters are wiped with Joseph paper and subjected to autoradiography. The filters are developed after 16 h. A fraction of about 0.5% of the colonies was found to have hybridized with the 2 pools of probes. colonies from this fraction were taken up and purified. The plasmid DNA was prepared from each of these colonies and this DNA was analyzed by digestion with either BamHI, or Hindlll, or both BamHI and Hindlll.

After analysis on agarose gel, the 5 plasmids obtained were found to have been linearized by BamHI and by Hindlll. The double digestions make it possible to release a fragment corresponding to the whole of the cloned cDNA. The size of this fragment is about 1.2 kb in 3 cases and about 0.9 kb in the other 2 cases. For the following determination, one of the 0.9 kb fragments and one of the 1.2 kb fragments were selected and recloned (see Example 6 below).

EXAMPLE 6: Determination of the sequence of urate oxidase cDNA On the one hand one of the 0.9 kb fragments (clone 9A) and on the other hand one of the 1.2 kb fragments (clone 9C) were recloned in the DNA of the replicative form of single-stranded phage M13. The DNA of the* M13 clones, containing the 0.9 kb fragment on the one hand and the 1.2 kb fragment on the other, was digested with exonuclease so as to generate a series of overlapping M13 clones (procedure: Cyclone I Biosystem of IBI). Said clones were sequenced by the dideoxyribonucleotide method (Sanger et al., PNAS-U.S.A. - 1977, 14, 5463-5467).

The nucleotide sequence of clone 9C is shown in Figure 3, which also indicates, with an arrow, the start of clone 9A and, with a nucleotide symbol followed by an asterisk *, the sequenced nucleotides of clone 9A which are not identical to those of clone 9C (when matching the two sequences and the AccI and BamHI restriction sites used in the subsequent constructions (cf. Example 10)).

It is found that - the nucleotide sequence of the longer fragment (clone 9C) overlaps that of the shorter fragment (clone 9A) but for two differences (see Figure 3). One of the differences is quiescent and the other corresponds to a change from a trytophan residue to a glycine residue. These differences may be due either to differences in the isolated messenger RNAs (cf. Example 2 above) or to errors in the reverse transcriptase used when building the cDNA library (cf. Example 3 above). Sequencing the genomic DNA of A. flavus urate oxidase made it possible to remove this ambiguity : it is a tryptophan residue (and thus probably an error in the reverse transcriptase).

In the case of the longer fragment, an ATG codon (in position 109 in Figure 3) opens an open reading frame corresponding to a polypeptide of 302 amino acids, with a molecular mass around 34,240 Da, whose sequence corresponds to the partial sequence of purified A. flavus urate oxidase (cf. Example 4).

Figure 4 shows the DNA sequence opened by the ATG codon and the polypeptide coded for, and, with arrows opposite the polypeptide coded for, the sequenced peptides (cf. Example 4) obtained by hydrolysis of A. flavus urate oxidase with trypsin and protease V8.

It is found that the sequence of the polypeptide terminates in the triplet Ser-Lys-Leu, which is typical of peroxisomal location enzymes (Gould S.J. et al., J. Cell Biology 108 (1989) 1657-1664).

EXAMPLE .7: Construction of an saoacasaion vector· for, urate oxidase cDNA Plasmid p466, a vector for expression in E. coli, was prepared. It comprises a fragment of pBR327 including the origin of replication and the ampicillin resistance gene; it also comprises a synthetic promoter of E. coli (R. RODRIGUEZ and M. CHAMBERLIN, Promoters-Structure and function (1982), Preager), a Shine-Dalgarno sequence followed by a polylinker containing the unique Ndel and Kpnl sites, a transcription terminator (derived from phage fd) and the lac i gene.

This plasmid was constructed from an expression plasmid for hGH in E. coli (p462) by replacing a fragment carrying the hGH gene with urate oxidase cDNA.

The construction of plasmid p466 will now be described in greater detail in the following account, which will refer to Figures 5, 6, 7, 8 and 9.

Figure 5 shows a restriction map of plasmid pl63,l. The different restriction segments are labeled arbitrarily according to the following legend: - DNA segment derived from plasmid pBR322 Location of the origin of replication (ORI) DNA segment containing the sequence coding for a natural precursor of hGH DNA segment of phage fd containing a transcription terminator 7777777 DNA segment containing a tryptophanlactose UV5 hybrid promoter-operator DNA segment coding for β-lactamase (ApR: ampicillin resistance) Figure 6 shows the restriction map of plasmid pl60, whose PvuI-XhoI-BamHI(1) and PvuI-ORI-BamHI(2) fragments originate respectively from plasmids pl63,l and pBR327 and whose small BamHI(2)-BamHI(1) fragment is fragment 3 described below.

Figure 7 shows the restriction map of plasmid p373,2. The different restriction segments are labeled arbitrarily according to the following legend: = PvuI-BamHI sequence derived from plasmid PBR327 = Pvul-Xhol sequence derived from plasmid pl63,l ΞΖΖΖΖΖΖΖ = XhoI-HincII sequence derived from plasmid pl63,l (Hindi) al Ndel Pstl IIIIIIIT Fragment 4 described below X X X X X X = Fragment 3 described below = DNA segment of phage fd containing a transcription terminator Figure β shows a restriction map of plasmid p462, the synthetic Bglll-Hindlll fragment defined below being represented by: Figure 9 shows a restriction map of plasmid p466, the Ndel-Kpnl fragment, comprising the gene coding for urate oxidase, being represented by: A A A A AAA A 1) Construction of plasmid p373,2 The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK, Cold Spring Harbor Laboratory (1982). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer.

Plasmid pl63,l (Figure 5), described in European patent application A-0245138 and deposited in the CNCM under the reference 1-530 on 17 February 1986, was digested with the enzymes Pvul and BamHI. This plasmid contains the gene coding for hGH. The PvuI-BamHI fragment - hereafter called fragment 1 - containing the site of action of the restriction enzyme Xhol, shown in Figure 5, was purified.

Likewise, plasmid pBR327, which is well known to those skilled in the art (q.v. SOBERON, X. et al., Gene, (1980) 287-305), was digested with the enzymes Pvul and BamHI. The PvuI-BamHI fragment - hereafter called fragment 2 - containing the origin of replication, was purified.

Fragment 3 was then prepared; this is a synthetic BamHI(1)-BamHI(2) fragment containing the lac i gene and its promoter and it has the following sequence, in which the two ends of the strand are identified by the numbers 1 and 2 in order to specify the orientation of the fragment in the plasmids described in Figures 6 and 7: FRAGMENT 3 BamHI(1) ' GATCC GCGGAAGCAT AAAGTGTAAA GAGCTAACTT ACATTAATTG CGTTGCGCTC GAAACCTGTC GTGCCAGCTG CATTAATGAA GGCGGTTTGC GTATTGGGCG CCAGGGTGGT CGGGCAACAG CTGATTGCCC TTCACCGCCT AAGCGGTCCA CGCTGGTTTG CCCCACCACC GGTTAACGGC GGGATATAAC ATGAGCTGTC CTACCGAGAT ATCCGCACCA ACGCGCAGCC ATTGCGCCCA GCGCCATCTG ATCGTTGGCA GATGCCCTCA TTCAGCATTT GCATGGTTTG TCCAGTCGCC TTCCCGTTCC GCTATCGGCT TATTTATGCC AGCCAGCCAG ACGCAGACGC GCCCGCTAAC AGCGCGATTT GCTGGTGACC CGCCCAGTCG CGTACCGTCT TCATGGGAGA GTCTGGTCAG AGACATCAAG AAATAACGCC TTCCACAGCA ATGGCATCCT GGTCATCCAG CACTGACGCG TTGCGCGAGA AGATTGTGCA ACGCCGCTTC GTTCTACCAT CGACACCACC GGCGCGAGAT TTAATCGCCG CGACAATTTG GACTGGAGGT GGCAACGCCA ATCAGCAACG TGTGCCACGC GGTTGGGAAT GTAATTCAGC TTTTTCCCGC GTTTTCGCAG AAACGTGGCT AAACGGTCTG ATAACAGACA CCGGCATACT ACTGGTTTCA CATTCACCAC CCTGAATTGA TGCCATACCG CGAAAGGTTT TGCGCCATTC GCCTGGGGTG CCTAATGAGT ACTGCCCGCT TTCCAGTCGG TCGGCCAACG CGCGGGGAGA TTTTCTTTTC ACCAGTGAGA GGCCCTGAGA GAGTTGCAGC CGAAAATCCT GTTTGATGGT TTCGGTATCG TCGTATCCCA CGGACTCGGT AATGGCGCGC ACCAGCATCG CAGTGGGAAC TTGAAAACCG GACATGGCAC GAATTTGATT GCGAGTGAGA GCCGAGACAG AACTTAATGG CAATGCGACC AGATGCTCCA AAATAATACT GTTGATGGGT GGAACATTAG TGCAGGCAGC CGGATAGTTA ATGATCAGCC CCGCCGCTTT ACAGGCTTCG ACGCTGGCAC CCAGTTGATC CGACGGCGCG TGCAGGGCCA ACTGTTTGCC CGCCAGTTGT TCCGCCATCG CCGCTTCCAC GGCCTGGTTC ACCACGCGGG CTGCGACATC GTATAACGTT CTCTCTTCCG GGCGCTATCA GATGGTGTCC G 3' BamHI(2) Fragments 1, 2 and 3 were then ligated to give plasmid pl60, shown in Figure 6.

This plasmid was partially digested with the restriction enzymes Hindi and Pstl. The large Hindi33 Pstl fragment, containing the origin of replication and shown in Figure 6, was then ligated with fragment 4, shown below, which is a synthetic DNA fragment carrying a sequence coding for the first 44 amino acids of a natural precursor of hGH and, upstream from this sequence, regulatory signals.

FRAGMENT . 4 Clal V ’ TCGAGCTGACTGACCTGTTGCTTATATTACATCGA AGCTCGACTGACTGGACAACGAATATAATGTAGCT A Ndel TAGCGTATAATGTGTGGAATTGTGAGCGATAACAATTTCACACAGTTTAACTTTAAGAAGGAGATATACAT ATCGATATTACACACCTTAACACTCGCCTATTGTTAAAGTGTGTCAAATTGAAATTCTTCCTCTATATGTA ATG GCT ACC GGA TCC CGG ACT AGT CTG CTC CTG GCT TTT GGC CTG CTC TGC CTG TAC CGA TGG CCT AGG GCC TGA TCA GAC GAG GAC CGA AAA CCG GAC GAC ACG GAC MATGSRTSLLLAFGLLCL Xbal ▼ CCC TGG CTT CAA GAG GGC AGT GCC TTC CCA ACC AH CCC TTA TCT AGA CH TTT GGG ACC GAA GTT CTC CCG TCA CGG AAG GGT TGG TAA GGG AAT AGA TCT GAA AAA PWLQEGSAFPTIPLSR^LF -1 1 GAC AAC GCT ATG CTC CGC GCC CAT CGT CTG CAC CAG CTG GCC TTT GAC ACC TAC CTG HG CGA TAC GAG GCG CGG GTA GCA GAC GTG GTC GAC CGG AAA CTG TGG ATC ONAMLRAHRLHQLAFLTY Pstl CAG GAG ITT GAA GAA GCC TAT ATC CCA AAG GAA CAG AAG TAT TCA TTC CTG CA GTC CTC AAA CTT CH CGG ATA TAG GGT TTC CTT GTC TTC ATA AGT AAG G QEFEEAYIPKEQKYSF U In this fragment, the amino acids are designated by letters according to the following code: A = Alanine C = Cysteine D = Aspartic acid E = Glutamic acid F = Phenylalanine G = Glycine H = Histidine I = Isoleucine K = Lysine L = Leucine M ~ Methionine N = Asparagine P = Proline Q = Glutamine R = Arginine S = Serine T = Threonine V = Valine W = Tryptophan Y = Tyrosine The sequences -35 (TTGCTT) and -10 (TATAAT) of the promoter sequence, and the Shine-Dalgarno sequence well known to those skilled in the art, are successively underlined in this fragment.

Plasmid p380,l was obtained in this way.

Plasmid p380,l was then digested with the restriction enzymes Clal and Ndel so as to remove therefrom the small Clal-Ndel fragment of fragment 4 above and to replace it with the Clal-Ndel fragment below: Clal ' CGATAGCGTATAATGTGTG6AATTGTGAGCGGATAACA TATCGCATATTACACACCTTAACACTCGCCTATTGT Ndel ATTTCACACAGTTTTTCGCGAAGAAGGAGATATACA TAAAGTGTGTCAAAAAGCGCTTCTTCCTCTATATGTAT 5' The resulting plasmid is plasmid p373,2 (Figure 7) 2) Construction of plasmid p466 Plasmid p373,2 was subjected to a double digestion with the enzymes Bglll and Hindlll. The large fragment derived from this digestion was purified and ligated with a synthetic DNA fragment whose sequence, given below, is intended to reconstitute the end of the hGH gene, followed at the 3' end by the Kpnl and SnaBI cloning sites. Β g I I I GATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACGAT ----+---------+-----------------------------+ AAGTTCGTCTGGATGTCGTTCAAGCTGTGTTTGAGTGTGTTGCTA GACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTG ---------+---------+---------+----------+---------+——-----+ CTGCGTGATGAGTTCTTGATGCCCGACGAGATGACGAAGTCCTTCCTGTACCTGTTCCAG F S P I 'GAGACATTCCTGCGCATCGTGCAGTGCCGCTCTGTGGAGGGCAGCTGTGGCTTCTAGTAA —_—----+--- ---—+--——-—+-------—+------—+---------+ CTCTGTAAGGACGCGTAGCACGTCACGGCGAGACACCTCCCGTCGACACCGAAGATCATT H i S n K n d p a I n BI I I _I.

GGTACCCTGCCCTACGTACCA ------------------------CCATGGGACGGGATGCATGGTTCGA This fragment comprises the Bglll and HindiII sticky ends. The novel plasmid formed in this way, p462 (cf. Figure Θ), thus comprises a Kpnl site and an Ndel site, which will be used for cloning the fragment containing urate oxidase cDNA in the expression vector.

The hybrid plasmid derived from pTZ19R, carrying urate oxidase cDNA of about 1.2 kb (clone 9C) (see Example 3), comprises a unique Kpnl site. This site is located a few base pairs downstream from the cDNA cloning site. Furthermore, urate oxidase cDNA contains an AccI site situated near the 5' end.

The Accl-Kpnl fragment, comprising the greater part of this cDNA, was therefore isolated and purified. Two complementary oligonucleotides were also synthesized, whose sequence, given below: '-TATGTCTGCGGTAAAAGCAGCGCGCTACGGCAAGGACAATGTTCGCGT ACAGACGCCATTTTCGTCGCGCGATGCCGTTCCTGTTACAAGCGCAGA-5' is intended to reconstitute the 5' end of the cDNA. This synthetic fragment obtained in this way has an Ndel end and another AccI end. The fragment and the synthetic sequence were ligated with the expression vector cut by Kpnl and by Ndel. This three-fragment ligation makes it possible to obtain the expression vector, called p466, for urate oxidase in E.coli (cf. Figure 9). This plasmid was subjected to a series of enzymatic hydrolyses with restriction enzymes, which made it possible to verify the presence of the expected restriction sites, in particular those carried by the gene coding for urate oxidase.

Plasmid p466 therefore contains, by construction, a gene coding for urate oxidase, having the following sequence: ATGTCTGCGG TAAAAGCAGC GCGCTACGGC AAGGACAATG TKGCGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA1 AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG.

(The nucleotides which are different from the nucleotides of the cDNA isolated from A. flavus are underlined in the above sequence. These differences were introduced into the synthetic Accl-Kpnl fragment so as to have, downstream from the ATG, a nucleotide sequence corresponding more closely to those normally encountered in a prokaryotic gene.) EXAMPLE 8: Expression of urate oxidase cDNA The E. coli K12 RR1 strain (Bethesda Research Lab. Inc.) was transformed for ampicillin resistance with plasmid p466 and with a negative control plasmid, pBR322. Ampicillin-resistant colonies were obtained in both cases. 1 colony of each type was cultured in a medium (LB + ampicillin 100 ug/ml). After one night at 37°C, with agitation, the two cultures were diluted 100-fold in the medium (LB + ampicillin 100 pg/ml). After culture for 1 h, IPTG (isopropyl-0-D-thiogalactoside) 1 mM is added for 3 h.

Immunodetection of the urate oxidase by Western blot 1) Procedure An aliquot corresponding to 0.2 ml at 0D = 1 is taken from the culture medium obtained after induction with IPTG for 3 h. This aliquot is centrifuged and the supernatant is removed. The residue is then subjected to a Western blot - a technique well known to those skilled in the art - which comprises the following steps: - solubilization of the residue by boiling for 10 min in a buffer, called a loading buffer, consisting of Tris-HCl 0.125 M pH 6.5, SDS 4%, bromophenol blue 0.002%, glycerol 20%, β-mercaptoethanol 10% (according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685)); - electrophoretic separation of the different proteins contained in the solubilizate, according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685); and - transfer of said proteins contained in the gel on to a nitrocellulose filter (according to the technique of H. TOWBIN et al., Proc. Natl. Acad. Sci. USA (1979) 43504354).

Immunodetection, performed according to the technique of BURNETTE (W.W. BURNETTE, Ana. Biochem. 112 (1981) 195203), involves the following successive operations: • rinsing the nitrocellulose filter for 10 min with a buffer A (Tris-HCl 10 mM, NaCl 170 mM, KC1 1 mM); • bringing the nitrocellulose filter into contact with a buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml) for 30 min at 37®C; • bringing the nitrocellulose filter into contact with an immune serum (polyclonal antibodies recognizing A. flavus urate oxidase) for 1 h at 37°C; • rinsing the nitrocellulose filter with buffer B; • bringing the nitrocellulose filter into contact with a solution of protein G, labeled with iodine 125 at a rate of 0.1 microcurie/ml, for 1 h at 37’C; • rinsing the filter with buffer A; • drying the filter between two absorbent sheets; • bringing the filter into contact with an X-ray film; and · developing the film. 2) Results It is found that the strain transformed by plasmid p466 overproduces a protein with an apparent molecular weight of about 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase and which is absent from the control strain.

EXAMPLE 9: Assay of this urate oxidase activity An aliquot corresponding to the equivalent of 0.5 ml at OD = 1 is taken from the culture medium obtained after induction with IPTG for 3 h under the culture conditions described in the previous Example. This aliquot is centrifuged and the supernatant is removed. The residues are taken up in 1 ml of TEA (triethanolamine) buffer 0.05 M pH 8.9. The cell suspension is sonicated twice for 30 s in ice with a W10 ultrasonic sonicator (set to strength 8 and intensity 4). The extracts are centrifuged at 10,000 g for 10 min and the supernatants are used for the assay.

The above operations are carried out for four colonies taken at random from E. coli K12 transformed by plasmid p466 (colonies Ax, Bx, Cx and Dx) and one colony transformed by plasmid pBR322. 1) Principle The conversion of uric acid to allantoin is followed by the decrease in absorbance at 292 nm. The (absorbs at 292 nm) 2) Reagenta a) TEA 0.05 M pH 3.9/EDTA buffer - 7.5 g of TEA (reagent for analysis - Prolabo ref. 287.46.266) are dissolved in 400 ml of distilled water; - 0.372 g of Complexon III (Merck - ref. 6418) is dissolved in 50 ml of distilled water; - the two solutions are combined and made up to 500 ml (solution 1); - the pH of this solution is adjusted to 8.9 with HCl 0.2 N; and - the volume is made up to 1000 ml with distilled water (solution 2). b) Uric acid stock solution - 100 mg of uric acid (Carbiochem - ref. 6671) are dissolved in 50 ml of solution 1; - the pH is adjusted to 8.9 with HCl 0.2 N; and - the volume is made up to 100 ml with distilled water.

The solution obtained can be stored for one week at 4*C. c) Uric acid substrate solution - 1.5 ml of uric acid stock solution (Carbiochem - ref. 6671) are taken and diluted to 100 ml with TEA buffer (reagent for analysis - Prolabo ref. 287.46.266).

This solution must be used the same day. 3) Procedure The following volumes are introduced into the quartz cell of a spectrophotometer set to 292 nm and thermostated at 30°C: - 600 μΐ of uric acid substrate solution (preheated to 30°C) and - 100 μΐ of the above supernatants to which 200 μΐ of TEA pH 8.9 have been added (preheated to 30°C).

After mixing, the change in optical density is read off every 30 s for 5 min. ΔΕ, the variation in optical density per minute, is deduced from these readings. 4) Results The urate oxidase enzymatic activity A, expressed in U/ml 0D 1, is calculated from the ΔΕ measurement with the aid of the formula ΔΕ x Vr x d PE in which the symbols Vr, d, I and VpE respectively represent the reaction volume (0.9 ml), the dilution factor (2), the extinction coefficient of uric acid at 292 nm (12.5) and the volume of the test sample (0.3 ml).

The results obtained are collated in Table II below.

TABLE II E. coli K12 strain transformed by Urate oxidase activity (U/ml OD 1) PBR322 < 0.001 p466 colony Ax 0.086 colony Bx 0.119 colony Cx 0.135 colony Dx 0.118 The above Table clearly shows that the E. coli cells transformed by plasmid p466 are capable of producing urate oxidase activity in the presence of IPTG. EXAMPLE 10: Construction of three expression vectors for urate.oxidase cDNA in veast: plasmids pEMR469> PEMR473 and pEMR515 The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK in Molecular Cloning, a laboratory manual (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer.

The following description will be understood more clearly with reference to Figures 10, 11 and 12, which respectively show restriction maps of plasmids pEMR414, pEMR469 and pEMR473. The symbols used in these Figures will be specified in the description below. In the case where a site has been blunted by Klenow polymerase, it carries the index where the sites have been eliminated by ligation, they are indicated in brackets. 1) Construction of_ plasmid PEMR469 This plasmid was constructed from the shuttle vector E. coli-veast pEMR414, constructed by successive ligations of the following components: - the Pstl-Hindlll® fragment - symbolized by ++++ in Figure 10 - of plasmid pJDB207 (BEGGS, 1978: Gene cloning in yeast - p. 175-203 in: Genetic Engineering, vol. 2 - WILLIAMSON - Academic Press - London UK) comprising the upstream part of the ampicillin resistance gene Amp11 of pBR322 (Sutcliffe, 1979, Cold Spring Symp. Quart. Biol. 43, 779) and an endogenous 2μ fragment, B form, carrying the LEU2 gene of S. cerevisiae partially modified by the deletion of its promoter (called LEU2d), the locus STB (REP3) and the origin of replication of the 2μ fragment (HARTLEY and DONELSON, 1980, Nature, 286, 860-865). The HindiII end of this fragment has been blunted by the action of Klenow polymerase. It is denoted by Hindi11° in Figure 10. - the Hindlll-Smal fragment - represented by / / / in Figure 10 - of chromosome V of yeast containing the URA3 gene with its promoter (ROSE et al., 1984, Gene, 29, p. 113-124). This Hindlll-Smal fragment originates from plasmid pFLl (CHEVALLIER et al., 1980, Gene 11, 11-19). The Hindlll end of this plasmid has been blunted by the action of Klenow polymerase. - an Sami-BamHI fragment - symbolized by _ in Figure 10 - containing a synthetic version of the promoter of the ADH2 gene which differs from the natural version described by RUSSEL and SMITH (RUSSEL et al. (1983) J. Biol. Chem. 258, 2674-2682) only by a few base pairs intended for introducing restriction sites. (The natural sequence could be used with only slightly different results.) The sequence of this fragment is given below: S Μ m 1 s u I I ▼ gggacgcgtctcctctgccggaacaccgggcatctccaacttataagttggag CCCTGCGCAGAGGAGACGGCCT7GTGGCCCGTAGAGGTTGAATATTCAACCTC aaataagacaatttcagattgagagaatgaaaaaaaaaaaaaaaaaaaaggcacaggaga _ _________*------------------------------------♦ tttattctcttaaagtctaactctcttacttttttttttttttttttttccgtctcctct s P h. gcatagaaatggggttcactttttggtaaagctatagcatgcctatcacatataaataga ___ _________♦_____________________________________----- ~ CGT ATCTTTACCCCAAGTCAAAAACCAT T TCGAT AT CGT ACGGAT AGT GT AT ATTT ATCT GTGCCAGT AGCGACT 7 TTTT CAC AC 7 CG AG AT ACT CT TAC T ACTGCTCT CT TG7 T GT T TT ...♦ ___......♦.............................................CACGGTCATCGCTGAAAAAAGTGTGAGCTCT ATGAGAATGATGACGAGAGAACAACAAAA TATCACTTCTTGTTTCTTCTTGGTAAATAGAATATCAAGCTACAAAAAGCATACAATCAA AT AGT GAAGAACAAAGAAGAACCAT T T ATCT T AT AGT T CGATGT T T T T CGT AT GT T AGTT Q CTATCAACTATTAACTATATCGATACCATATGGATCCGTCGACTCTAGAuTGATCGTC - - - ♦---------*---------- - ------------------♦------------GATAGTTGATAATTGATATAGCTATGGTATACCTAGGCAGCTGAGATCTCCTAGCAG B a Π H GACTCTAGAGi . _ -----+CrGAGATCTCCTAG - the Bglll-Hindlll fragment - symbolized by HHHI in Figure 10 - carrying the 3' end of the yeast PGK gene. This fragment originates from complete digestion with Bglll of the Hindlll fragment of the yeast chromosomal DNA, carrying the PGK gene described by HITZEMAN et al. (1982, Nucleic Acids Res., 10, 77917808), which has only one Bglll site. This digestion makes it possible to obtain two Hindlll-Bglll fragments of which the smaller, of about 0.4 kb, which carries the 3' end of the yeast PGK gene, is retained. The sequence of the latter fragment is described by HITZEMANN et al. (op. cit.). The Bglll site is cloned in the BamHI site of the previous fragment (the BamHI and Bglll sites therefore disappearing), and the Hindlll site, blunted by the action of Klenow polymerase, is cloned in the PvuII site of the PvuII-Pstl fragment of pBR322, described below: ' - the PvuII-Pstl fragment - symbolized by xxx in Figure 10 - of pBR322, containing the origin of replication and the downstream part of the ampicillin resistance gene AmpR.

Plasmid pEMR414 formed in this way therefore contains the following components: - an origin of replication and an ampicillin resistance gene Amp11 permitting the replication and selection of the plasmid in E. coli cells. These components permit transformation in E. coli cells. - an origin of replication for the yeast (ARS), the locus STB and the LEU2 gene of S. cereviaiae without promoter and the URA3 gene of S. cereviaiae with its promoter. These components permit the replication and selection of the plasmid in S. cereviaiae cells and a sufficient partition efficacy in cells containing the endogenous 2μ plasmid.

Plasmid pEMR414 was completely digested with the restriction enzymes Nhel and Clal. The small Nhel-Clal fragment containing the URA3 gene, hereafter called fragment A, was purified.

Plasmid pEMR414 was completely digested with the enzymes Nhel and BamHI. The large Nhel-BamHI fragment containing especially the LEU2d gene and the origin of replication of plasmid pBR322, hereafter called fragment B, was purified.

The synthetic Clal-AccI fragment, containing the start of a gene coding for the protein deduced from the urate oxidase cDNA sequence (clone 9C), was also prepared. This fragment contains modifications, relative to clone 9C, introduced for the purpose of inserting codons which are customary in yeast (q.v. SHARP et al., 1986, Nucl. Ac. Res., vol. 14, 13, pp. 5125-5143) without changing the amino acids coded for. The sequence of this fragment, hereafter called fragment C, is as follows (the underlined nucleotides are those modified relative to clone 9C): I I T CGATATACACAATGTC2GCT_GTT_AAG^GCTGCTAG£TACGG2AAGGACAAC_GTTAGA_GT ---+---------+---------+---------+3--------+---------+---TATATGTGTTACAGACGACAATTCCGACGATCTATGCCATTCCTGTTGCAATCTCAGA The plasmid of clone 9C (cf. Figure 3) was digested with the enzymes AccI and BamHI. The AccI-BamHI fragment, which contains the end of urate oxidase cDNA, hereafter called fragment D, was purified. This fragment has the following sequence: Accl _ T ctacaagc7tcacaaggacgagaag - --+---------+---------+ (TGTTCCAAGTGTTCCTGCTCTTC ACCGGTGTCCAGACGGTGTACGAGATGACC GTCTGTGTGCTTCTGGAGGGTGAGATTGAG — — — » — — — * — — — — — + — — — — — — — + — — — — ····"·· — + *»·* — *«**· + TGGCCACAGGTCTGCCACATGCTCTACTGG CAGACACACGAAGACCTCCCACTCTAACTC ACCTCTTACACCAAGGCCGACAACAGCGTC ATTGTCGCAACCGACTCCATTAAGAACACC ---------+- +---------+---------+---------+ --- ---+ TGGAGAATGTGGTTCCGGCTGTTGTCGCAG TAACAGCGTTGGCTGAGGTAATTCTTGTGG ATTTACATCACCGCCAAGCAGAACCCCGTT ACTCCTCCCGAGCTGTTCGGCTCCATCCTG —-------+ ---------+---------+---------+ TAAATGTAGTGGCGGTTCGTCTTGGGGCAA TGAGGAGGGCTCGACAAGCCGAGGTAGGAC GGCACACACTTCATTGAGAAGTACAACCAC ATCCATGCCGCTCACGTCAACATTGTCTGC ---------+---------+---------+ CCGTGTGTGAAGTAACTCTTCATGTTGGTG TAGGTACGGCGAGTGCAGTTGTAACAGACG CACCGCTGGACCCGGATGGACATTGACGGC AAGCCACACCCTCACTCCTTCATCCGCGAC ---------+---------+---------+ GTGGCGACCTGGGCCTACCTGTAACTGCCG TTCGGTGTGGGAGTGAGGAAGTAGGCGCTG AGCGAGGAGAAGCGGAATGTGCAGGTGGAC GTGGTCCAGGGCAAGGGCATCGATATCAAG ---------+---------+ ---------+-------------------TCGCTCCTCTTCGCCTTACACGTCCACCTG CACCAGCTCCCGTTCCCGTAGCTATAGTTC TCGTCTCTGTCCGGCCTGACCGTGCTGAAG AGCACCAACTCGCAGTTCTGGGGCTTCCTG -------— ---+ +---------+ ---- + AGPAGAGACAGGCCGGACTGGOACGACTTC TCGTGGTTGAGCGTCAAGACCCCGAAGGAC CGTGACGAGTACACCACACTTAAGGAGACC TGGGACCGTATCCTGAGCACCGACGTCGAT GCACTGCTCATGTGGTGTGAATTCCTCTGG ACCCTGGCATAGGACTCGTGGCTGCAGCTA GCCACTTGGCAGTGGAAGAATTTCAGTGGA CTCCAGGAGGTCCGCTCGCACGTGCCTAAG ---------+---------+---------+ CGGTGAACCGTCACCTTCTTAAAGTCACCT GAGGTCCTCCAGGCCAGCGTGCACGGATTC TTCGATGCTACCTGGGCCACTGCTCGCGAG GTCACTCTGAAGACTTTTGCTGAAGATAAC ---------+---------+---------+ AAGCTACGATGGACCCGGTGACGAGCGCTC CAGTGAGACTTCTGAAAACGACTTCTATTG AGTGCCAGCGTGCAGGCCACTATGTACAAG ATGGCAGAGCAAATCCTGGCGCGCCAGCAG ---------+-------------------+---------+---------+---------TCACGGTCGCACGTCCGGTGATACATGTTC TACCGTCTCGTTTAGGACCGCGCGGTCGTC CTGATCGAGACTGTCGAGTACTCGTTGCCT AACAAGCACTATTTCGAAATCGACCTGAGC GACTAGCTCTGACAGCTCATGAGCAACGGA TTCTTCG7GATAAAGCTTTAGCTGGACTCG TGCCACAAGGGCCTCCAAAACACCGGCAAG AACGCCGAGGTCTTCGCTCCTCAGTCGGAC ---------+---------+---------+ ---------+---------+---------+ ACCG7C77CCCGGAGGT7T7G7CCCCG77C TTGCGCCTCCAGAAGCGAGGAGTCAGCCTG CCCAACGGTCTGATCAAGTGTACCG7CGGC CGGTCC7C7CTGAAG7C7AAATTG7AAACC ---------+----—-—+---------+---------+---------+---------♦ GGGTTCCCAGACTAGTTCACATGGCAGCCG GCCAGGAGAGACTTCAGATTTAACATTTGG AACATGATTCTCACGTTCCGGAGTTTCCAA GGCAAAC7GTATATAG7CTGGGATAGGG7A -------—+-----..._+ -------+ ------+ - ----+ TTGTACTAAGAGTGCAAGGCCTCAAAGGTT CCGTTTGACATATATCAGACCCTATCCCAT TAGCATTCATTCACTTGTTTTTTACTTCCA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ---- — ---+--- --- + ---------+--------- +--------- + ---—----+ ATCGTAAGTAAGTGAACAAAAAATGAAGGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT aaaaaaaaaaaaaaaaaaaaagggcccg· ------- -- + --------- + -------TT7T77T7T7TTTTTTTTTTTCCCGGGCC7 AG 5amKi Fragments A, B, C and D were ligated to give plasmid pEMR469 shown in Figure 11, in which the symbols have the same meanings as in Figure 10, the novel ClalAccI and AccI-BamHI fragments being symbolized by . 2) Construction of plasmid pEMR473 Plasmid pEMR469 was completely digested with the enzymes Mlul and SphI. The large MluI-SphI fragment, containing the urate oxidase gene, was then ligated with the synthetic fragment, whose sequence is given below, corresponding to a part (200 bp) of the sequence upstream from the TATA component of promoter GAL7 of £L. cereviaiae. said part comprising the upstream activation sequences (UAS).

M u I CGCGTCTATACTTCGGAGCACTGTTGAGCGAAGGCTCATTAGATATATTTTCTGTCAT AGATATGAAGCCTCG TGACAAC TCGC T TCCGACTAA TCTATA TAAAAGACAGTA TTTCCTTAACCCAAAAATAAGGGAGAGGGTCCAAAAAGCGCTCGGACAACTGTTGACCGT AAAGGAAT TGGGT TT T TAT TCCCTCTCCCAGGT Τ T TTCGCGAGCCTGT TGACAAC TGGCA GATCCGAAGGACTGGCTATACAGTGTTCACAAAATAGCCAAGCTGAAAATAATGTGTAGC CTAGGCTTCCTGACCGATATGTCACAAGTGTTTTATCGGTTCGACTTTTAT TACACATCG S P h I CTTTAGCTATGTTCAGTTAGTTTGGCATG GAAATCGA TACAAG TCAATCAAACC Plasmid pEMR473 Figure 12, in which the in Figure 11, the novel being symbolized by □ obtained in this way is shown in symbols have the same meanings as Mlul-SphI fragment introduced 3) Construction of plasmid pEMR515 Plasmid pEMR473 was partially digested with the enzyme Xbal and totally digested with the enzyme Mlul.

The large Xbal-Mlul fragment was purified. This fragment contains especially the sequences of the origin of replication and the locus STB of the 2μ fragment, the LEU2d gene, the ampicillin resistance gene Amp1*, the origin of replication of pBE322 and the expression cassette for urate oxidase. On the other hand, it contains neither the URA3 gene nor that part of the 2μ fragment which is between the Xbal and Nhel sites.

The large Xbal-Mlul fragment was recircularized via the following sequence adapter containing Mlul and modified Xbal sticky ends: modified Xbal ^CTAGGC.TAGCGGGCCCGCATGCA CGATCGCCCGGGCGTACGTGCGC^ Mlul Plasmid pEMR515 obtained in this way has only one of the three components of the target FRT site of the recombinase coded for by the FLP gene of the 2μ fragment.

Plasmids pEMR469, pEMR473 and pEMR515 possess the gene coding for urate oxidase, which has the following sequence: ATGTCTGCTG CAAGGTTCAC CCGTCTGTGT GACAACAGCG CACCGCCAAG TGGGCACACA AACATTGTCT CCCTCACTCC ACGTGGTCGA ACCGTGCTGA GTACACCACA ATGCCACTTG CACGTGCCTA GAAGACTTTT AGATGGCAGA -TACTCGTTGC GGGCCTCCAA ACCCCAACGG AAATTG.

TTAAGGCTGC AAGGACGAGA GCTTCTGGAG TCATTGTCGC CAGAACCCCG CTTCATTGAG GCCACCGCTG TTCATCCGCG GGGCAAGGGC AGAGCACCAA CTTAAGGAGA GCAGTGGAAG AGTTCGATGC GCTGAAGATA GCAAATCCTG CTAACAAGCA AACACCGGCA TCTGATCAAG TAGATACGGT AGACCGGTGT GGTGAGATTG AACCGACTCC TTACTCCTCC AAGTACAACC GACCCGGATG ACAGCGAGGA ATCGATATCA CTCGCAGTTC CCTGGGACCG AATTTCAGTG TACCTGGGCC ACAGTGCCAG GCGCGCCAGC CTATTTCGAA AGAACGCCGA TGTACCGTCG AAGGACAACG CCAGACGGTG AGACCTCTTA ATTAAGAACA CGAGCTGTTC ACATCCATGC GACATTGACG GAAGCGGAAT.

AGTCGTCTCT TGGGGCTTCC TATCCTGAGC GACTCCAGGA ACTGCTCGCG CGTGCAGGCC AGCTGATCGA ATCGACCTGA GGTCTTCGCT GCCGGTCCTC TTAGAGTCTA TACGAGATGA CACCAAGGCC CCATTTACAT GGCTCCATCC CGCTCACGTC GCAAGCCACA GTGCAGGTGG GTCCGGCCTG TGCGTGACGA ACCGACGTCG GGTCCGCTCG AGGTCACTCT ACTATGTACA GACTGTCGAG GCTGGCACAA CCTCAGTCGG TCTGAAGTCT EXAMPLE 11: Transformation of .the EMY76L veaat strain bv plasmids pEMR469. PEMR473. and pEMR515 .Transformation of the EMY50.Q and GRF18 yeast Strains bv plasmid oEMR515 - Transformation with selection either for the prototrophv of uracil or for the prototrophv of. leucine Three non-isogenic strains of Saccharomvces cerevisiae were used as recipient strains: - the EMY761 strain (Mata, leu2, ura3, his3, gal) - the EMY500 strain (Mata, leu2, ura3, pep4) - the GRF18 strain (Mata, lsu2, his3) The GRF18 strain is well known to those skilled in the art (Gerry FINK, MIT, USA). The EMY761 and EMY500 strains are related to the GRF18 strain. They were obtained by successively crossing the GRF18 strain with a ura3 strain derived from the FL100 strain (deposited in the ATCC under n° 28 383) and with the 20B12 strain (Mata, tspl, pep4) described by E.W. JONES (E.W. JONES et al. (1977) Genetics, 85, 23).

The GRF18 strain can be obtained by curing plasmid pEMR515 of the GRF18 pEMR515 (leu^) strain deposited in the CNCM under reference η* 1-920 on 28 December 1989, and the EMY500 strain can be obtained by curing plasmid pEMR515 of the EMY500 pEMR515 (leu***) strain deposited in the CNCM under reference n° 1-919 on 28 December 1989.

These strains contain mutations (leu2 and ura3) capable of being complemented by the LEU2d defective selection marker and the URA3 selection marker, which are present in each of plasmids pEMR469 and pEMR473. 1) Transformation with selection for the prototrophv of uracil A colony of the EMY761 strain was used to inoculate 100 ml of a medium called liquid YPG medium (cf. Table III below). When the cell density had reached 107 cells per ml, the cells were treated with lithium acetate 0.2 M for transformation by a technique well known to those skilled in the art and described by ITO et al. (ITO et al., 1983, J. Bacteriology 153, 163-168).

The EMY761 cells were transformed in parallel with about 1 pg of each of plasmids pEMR469 and pEMR473. The transformed cells are selected for the auxotrophic character of uracil (ura*) on a medium called uracil-free solid medium (cf. Table III below). An EMY761 pEMR469 (ura*) transformed strain and an EMY761 pEMR473 (ura*) transformed strain were thus retained. 2) Transformation with selection for the orototrophv of leucine The transformation technique used is a variant of that described by Beggs et al. (Beggs et al. (1978) Nature 275, 104-109). It consists in subjecting yeasts to a protoplastization treatment in the presence of an osmotic stabilizer, namely sorbitol at a concentration of 1 M.

The precise transformation protocol is specified below: a) 200 ml of liquid YPG medium (cf. Table III) are inoculated with about 5 x 10® cells of a culture in the stationary phase, and the culture inoculated in this way is agitated overnight at 30°C. b) When the density of the culture reaches about 107 cells per ml, the cells are centrifuged at 4000 rpm for 5 min and the residue is washed with sorbitol 1 M. c) The cells are suspended in 5 ml of sorbitol solution 1 M containing 25 mM EDTA and 50 mM dithiothreitol, and are incubated for 10 min at 30°C. d) The cells are washed once with 10 ml of sorbitol 1 M and suspended in 20 ml of sorbitol. Zymolase-100T (a preparation obtained by partial purification of Arthobacter luteua culture supernatant on an affinity column and containing 0-1,3-glucan laminaripentahydrolase, marketed by SEYKAGAKU KOGYO Co. Ltd.) is added up to a final concentration of 20 ug/ml and the suspension is incubated at room temperature for about 15 min. e) The cells are resuspended in 20 ml of a medium containing sorbitol, called sorbitol YPG medium (cf.

Table III below) and incubated for 20 min at 30°C, with gentle agitation. f) The cells are centrifuged for 3 min at 2500 rpm. g) The cells are resuspended in 9 ml of trans55 formation buffer (sorbitol 1 M, Tris-HCl 10 mM pH 7.5 and CaCl2 10 mM). h) 0.1 ml of cells and 5 μΐ of DNA solution (about 5 Mg) are added and the suspension obtained is left for 10 to 15 min at room temperature. i) 1 ml of the following solution is added: polyethylene glycol PEG 4000 20%, Tris-HCl 10 mM pH 7.5 and CaCl2 10 mM. j) 0.1 ml of the suspension obtained in i) is poured into a tube containing leucine-free solid regeneration medium (cf. Table III below) which has been melted beforehand and kept liquid at about 45°C. The suspension is poured into a Petri dish containing a solidified layer of 15 ml of leucine-free solid regeneration medium. k) Step j) is repeated with the remainder of the cell suspension obtained in i).

The transformed strains start to appear after three days.

The EMY761 PEMR469 (leu*), EMY761 pEMR473 (leu*), EMY761 pEMR515 (leu*), GRF18 pEMR515 (leu*) and EMY500 pEMR515 (leu*) transformed strains were thus retained.

TABLE III Principal media used in Examples 11. 12. 13 and 14 - uracilr-free solid- medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) .0 g of casein hydrolyzate (Casamino acids from DIFCO) 10 g of glucose 20 g of agar Mix all the ingredients in distilled water and make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120°C. - uracil-free liquid medium Use the formulation of the uracil-free solid medium without the agar. Autoclave for 15 min at 120*C. - leucine-free aolid.medium 6.7 g of Yeast nitrogen base without Amino Acids (from DIFCO) mg of adenine mg of uracil mg of 1-tryptophan mg of 1-histidine mg of 1-arginine mg of 1-methionine mg of 1-tyrosine mg of 1-isoleucine mg of 1-lysine mg of 1-phenylalanine 100 mg of 1-glutamic acid 150 mg of 1-valine 400 mg of 1-leucine g of glucose g of agar Mix all the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120*C. After autoclaving, add 200 mg of 1-threonine and 100 mg of 1-aspartic acid. - leuclnerfree solid regeneration.medium Use -the formulation of the leucine-free solid medium, mixing in 30 g of agar instead of 20 g and adding 182 g of sorbitol to the mixture. - leucine-free liquid medium Use the formulation of the leucine-free solid medium without the agar. Autoclave for 15 min at 120®C.

After autoclaving, add 200 mg of 1-threonine and 100 mg of 1-aspartic acid. - liquid YP medium g of yeast extract (Bacto-yeast extract from DIFCO) 20 g of peptone (Bacto-peptone from DIFCO) Mix the ingredients in distilled water. Make up the final volume to 1 1 with distilled water. Autoclave for 15 min at 120°C. - liquid YPG medium Use the formulation of the liquid YP medium, adding, after autoclaving, glucose at a concentration of 20 g/1. - sorbitol YPG medium Use the formulation of the liquid YPG medium, adding, after autoclaving, sorbitol at a concentration of 1 M. - ethanol-glvcerol YP medium Use the formulation of the liquid YP medium. After autoclaving, add 10 ml of ethanol 100% (1% final concentration) and 30 g of glycerol. - ethanol-glvcerol-galactoae YP medium Use the formulation of the liquid YP medium. After autoclaving, add 10 ml of ethanol 100%, 30 g of glycerol and 30 g of galactose.

EXAMPLE 12: Expression, in an Erlenmever flask, of urate oxidase cDNA bv the EMY761 pEMR469 fura-1.

EMY761 PEMR473 fura*K EMY761 PEMR469 fleu*) and EMY761 pEMR473 fleu*) strains - Immunodetection bv Western blot - Assay of the urate oxidase activity and the soluble proteins 1) Expression of urate oxidase cDNA a) Strains selected on uracil-free medium A colony of each of the EMY761 pEMR469 (ura*) and EMY761 pEMR473 (ura*) strains was cultured in 20 ml of uracil-free liquid medium (cf. Table III, Example 11). After one night at 30°C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium (cf. Table III, Example 11) for the EMY761 pEMR469 (ura*) strain and in 20 ml of ethanol-glycerol-galactose YP medium (cf. Table III, Example 11) for the EMY761 pEMR473 (ura*) strain.

The cultures were incubated again at 30°C for 22 h, with agitation. b) Strains selected on leucine-free medium In a first stage, a colony of each of the EMY761 PEMR469 (leu*) and EMY761 pEMR473 (leu*) strains was cultured in 20 ml of leucine-free liquid medium (cf.

Table III, Example 11). This made it possible to obtain and maintain a large number of copies of plasmids by carrying out the selection for complementation of the leu2 mutation by the LEU2d gene carried by plasmids pEMR469 and pEMR473.

After one night at 30°C, with agitation, the two cultures were centrifuged for 10 min at 7000 rpm. The residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min at 7000 rpm. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol YP medium for the EMY761 pEMR469 (leu*) strain and in 20 ml of ethanolglycerol-galactose YP medium (cf. Table III, Example 11) for the EMY761 pEMR473 (leu*) strain. The cultures were incubated again at 30°C for 22 h, with agitation. c) Control strain The non-transformed EMY761 strain, i.e. the EMY761'strain without plasmid, was cultivated as above.

It was subjected on the one hand to induction in 10 ml of ethanol-glycerol liquid YP medium and on the other hand to induction in 10 ml of ethanol-glycerol-galactose YP medium. 2) Preparation of_the samples a) The cells cultivated in la), lb) and lc) were centrifuged and the supernatant was removed. The residues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of triethanol amine buffer, TEA, of pH 8.9. About 300 pi of cells taken up in said buffer were lyzed in the presence of glass beads (from 400 to 500 pm in diameter), representing about half the final volume. This mixture was agitated vigorously in a Vortex 4 times for 1 min, the samples being placed in ice for 30 s between grinding operations. The liquid was withdrawn from the tubes with a Pasteur pipette and transferred to a microtube. The glass beads were washed once with about 200 μΐ of TEA buffer of pH 8.9. The beads were agitated in a Vortex once for 1 min and the liquid was withdrawn with a Pasteur pipette and added to the above lyzate. The lyzate was then centrifuged in a microtube for 5 min at 7000 rpm. The supernatant was cautiously withdrawn and stored at -20°C for Western blot, assay of the urate oxidase activity and assay of the proteins. The residue of the lyzed cells was stored separately at -20’C for Western blot (cf. 3) below).

Furthermore, samples of the cultures prepared in la) and lb) were taken in the following manner before induction: 2 ml of culture were centrifuged for 10 min at 7000 rpm. The residues were taken up in 500 μΐ of distilled water and centrifuged again for 5 min at 7000 rpm. The residues were taken up in about 200 μΐ of TEA buffer of pH-8.9 and lyzed as above in the presence of glass beads. The supernatants and the residues of the lyzed cells were stored separately at -20’C. 3) Immunodetection of the urate oxidase bv Western blot a) Procedure The residues and the supernatants of the different samples were subjected to a Western blot - a technique well known to those skilled in the art - which comprises the following steps: - solubilization of the residue by boiling for 10 min in a buffer, called a loading buffer, consisting of TrisHCl 0.125 M pH 6.8, SDS 4%, bromophenol blue 0.002%, glycerol 20%, β-mercaptoethanol 10% (according to the protocol described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685), (step merely carried out for the residues); - electrophoretic separation of the different proteins contained in the solubilizate, according to the protocole described by LAEMMLI (U.K. LAEMMLI, Nature, 227 (1970) 680-685); and - transfer of said proteins contained in the gel on to a nitrocellulose filter (according to the technique of H. TOWBIN et al., Proc. Natl. Acad. Sci. USA (1979) 4350-4354).

Immunodetection, performed according to the technique of BURNETTE (W.W. BURNETTE, Ana. Biochem. 112 (1981) 195203), involves the following successive operations: • rinsing the nitrocellulose filter for 10 min with a buffer A (Tris-HCl 10 mM, NaCl 170 mM, KC1 1 mM); * bringing the nitrocellulose filter into contact with a buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml) for 30 min at 37eC; • bringing the nitrocellulose filter into contact with an immune serum (polyclonal antibodies recognizing flavus urate oxidase) for 1 h at 37°C; • rinsing the nitrocellulose filter with buffer B; • bringing the nitrocellulose filter into contact with a solution of protein G, labeled with iodine 125 at a rate of 0.1 microcurie/ml, for 1 h at 37eC; · rinsing the filter with buffer A; • drying the filter between two absorbent sheets; • bringing the filter into contact with an X-ray film; and • developing the film. b) Results It is found that the EMY761 pEMR469 (ura*), EMY761 PEMR473 (ura*), EMY761 pEMR469 (leu*) and EMY761 pEMR473 (leu*) strains produce a protein with an apparent molecular weight of about 33 kDa, which is recognized by antibodies directed against A. flavus urate oxidase and which is absent from the control strain.

It is also found that the non-induced strains produce none or very little of the protein described above.

Comparison between the amounts of this protein for the residues and the supernatants makes it possible to deduce that about 80% of said protein is in soluble form in the lyzate. 4) Assay of the urate oxidaae activity The urate oxidase activity was measured on the supernatants of the lyzed cells according to the procedure described in Example 9 above.

The results obtained are collated in Table IV below, which specifies the urate oxidase activity in U/ml for each strain induced by glycerol-ethanol, each strain induced by glycerol-ethanol-galactose and each noninduced strain.

TABLE IV Strain/Inducer Urate oxidase activity (U/ml) EMY761/YP ethanol-glycerol-galactose < 0.1 EMY761/YP ethanol-glycerol < 0.1 EMY761 pEMR469 (ura*)/(non-induced) 0.4 EMY761 pEMR469 (ura*)/YP ethanol-glycerol 12 EMY761 pEMR469 (leu*)/(non-induced) 0.17 EMY761 pEMR469 (leu*)/YP ethanol-glycerol 36 EMY761 pEMR473 (ura*)/(non-induced) < 0.1 EMY761 pEMR473 (ura*)/YP ethanol-glycerol- galactose 12.5 EMY761 pEMR473 (leu*)/(non-induced) < 0.1 EMY761 pEMR473 (leu*)/YP ethanol-glycerol- galactose 15.3 The above Table clearly shows that the yeast cells transformed by these plasmids pEMR469 and pEMR473 are capable of producing urate oxidase activity after induction.

) Assay of the total soluble proteins in the lvzatea The protein assay kit from BIORAD was used for assaying the total proteins present in the supernatant of the lyzed cells. It is based on the observation that the maximum absorbance of an acid solution of Coomassie brilliant blue g-250 changes from 465 run to 595 nm when proteins become attached thereto (q.v. Reisner et al., Anal. Biochem., 64, 509 (1975)). a) Procedure The following volumes are introduced into the cell of a spectrophotometer set to 595 nm: - 10 pi of sample to which 790 pi of distilled water have been added - 200 pi of concentrated Dye reagent (Biorad).

The ingredients are mixed and the optical density is read off at 595 nm. A calibration range with increasing concentrations of BSA (bovine serum albumin) was prepared in this way. The unknown concentration of the total proteins in the lyzates is read off on the calibration curve obtained. ~ b) Results The main results obtained are collated in Table V below, which specifies the amount (in mg/ml) of total soluble proteins and the percentage of urate oxidase in the total soluble proteins for each strain induced by glycerol-ethanol, each strain induced by glycerolethanol-galactose and each non-induced strain (it is assumed here that the specific activity of the recombinant protein is identical to that of the urate oxidase obtained from A. flavus: 30 U/mg).

TABLE V Strain/Inducer Total soluble proteins mg/ml % of urate oxidase in the total soluble proteins EMY761/glycerol-ethanol 5.3 < 0.05 EMY761/glycerol-ethanol-galactose 5.8 < 0.05 EMY761 pEMR469 (ura*)/non-induced 8.5 0.25 EMY761 pEMR469 (ura*)/glycerol-ethanol 5.3 4.7 EMY761 pEMR469 (leu*)/non-induced 1.7 0.3 EMY761 pEMR469 (leu*)/glycerol-ethanol 5.9 20 EMY761 pEMR473 (ura*)/non-induced 10.3 < 0.05 EMY761 pEMR473 (ura*)/glycerol-ethanol- galactose 6.5 6.4 EMY761 pEMR473 (leu*)/non-induced 0.5 < 0.05 EMY761 pEMR473 (leu*)/glycerol-ethanol- galactose 3.9 13 It is found that the production rate of urate oxidase varies from 5 to 20% according to the transformants and the mode of selection of the transformed strains (leu*). example 13: Expression, in a 2.5 1 fermenter, of urate oxidase cDNA bv the EMY761 PEMR473 ( ura*) strain 1) Ferment at ion, prot onol a) Media Inoculum medium A colony of the EMY761 pEMR473 (ura*) strain was cultured in 200 ml of uracil-free liquid medium (cf. Table III, Example 11). Culture is continued overnight, with agitation, until the 0D is about 3.

Culture medium A for 1 1 of purified water on an apparatus of the Milli-Q type glucose 30 g glycerol 30 g casein hydrolyzate (Casamino acids from DIFCO) 30 g Yeast Nitrogen Base (from DIFCO) 15 g Yeast extract (from DIFCO) 2.5 g K2HPO4 3 g MgS0<.7Hz0 0.5 g Additional medium.B for 100 ml of purified water on an apparatus of the Milli-Q type glycerol 30 g peptone hydrolyzate (Primatone from G. Sheffield) 30 e Yeast Nitrogen Base (from DIFCO) 15 g Yeast extract (from DIFCO) 5 g K2HPO4 3 g MgSO4.7HsO 0.5 g b) Fermentation parameters Bioreactor of total volume 2.5 1, equipped with two turbines Temperature = 30°C pH = 5 Oxygen partial pressure = 30 mm Hg Air flow rate = 1 1/min The bioreactor is filled with 1.5 1 of medium A and inoculated with 150 ml of the inoculum.

Once the glucose has been exhausted at 0D 2.5 to about 0D 17, induction is effected by the addition of a volume of 150 ml of galactose at 20% weight/volume.

Growth is continued and additional medium B is then added at about 0D 30.

Growth continues for about another fifteen hours and the product was harvested at OD 104. 2) Preparation and analysis of the samples The samples were prepared as described in Example 92) a) from the culture in the fermenter. Two samples were taken: the first after 7 h of induction and the second after 22 h of induction.

The following tests, described in Example 9, were performed on these two* lyzates obtained after lysis of the cells: - immunodetection by Western blot - assay of the biological activity - assay of the total proteins The following results were obtained: a) Immunodetection by Western-hlat It is found that the EMY761 pEMR473 (ura*) strain, cultivated in a 2 1 fermenter, produces a protein with an apparent molecular weight of 33 kDa, which is recognized by antibodies directed against A. f lavua urate oxidase (said antibodies being prepared in rabbits by techniques well known to those skilled in the art: q.v. VAITUKAITIS et al. (1981) Methods in Enzymology, Academic Press, New York, vol. 73, p. 46) and which is absent from the control strain. b) Assay .of ..the .biological activity The results obtained are collated in Table VI below: TABLE VI Strain/Induction time U/ml EMY761 pEMR473 (ura*)/7 h 9 EMY761 pEMR473 (ura*)/22 h 12.5 It is found that the EMY761 pEMR473 (ura*) strain, cultivated in a fermenter, is capable of producing urate oxidase activity after induction. c) Aaaav of the total soluble, proteina The results are collated in Table VII below: TABLE VII Strain/Induction time Total soluble proteins mg/ml % of urate oxidase in the total soluble proteins EMY761 pEMR473 (ura*)/7 h 5.2 5.7 EMY761 pEMR473 (ura*)/21 h 6.2 6.6 These results indicate that the rate of synthesis of urate oxidase by the EMY761 pEMR473 (ura*) strain, cultivated in a fermenter, is about 5% of the total proteins of the cell after 7 h and 22 h of induction. example 14: Espreaaion. in an Erlenmsyer flaak. of urate oxidase cDNA bv the EMY761 PEMR515 (leu*-) . EMY5QQ PEMR515 fleur) and GRF1B. gEHRSlS (lsu±)_ atraina A colony of each of the above three strains was cultured in 20 ml of leucine-free liquid medium.

After one night at 30°C, with agitation, the three cultures were centrifuged for 10 min at 7000 rpm. The cell residues were taken up in 10 ml of sterile distilled water and centrifuged again for 10 min. Expression of the urate oxidase was induced by taking up the cells in 20 ml of ethanol-glycerol-galactose YP medium (cf. Table I, Example 8). The cultures were incubated again at 30°C for about 20 h, with agitation. The non-transformed host strains were each cultured as controls.

The cells of each of the six cultures are separated out again by centrifugation and the supernatant is removed. The residues were taken up in 10 ml of distilled water and centrifuged for 10 min at 7000 rpm. The residues washed in this way were taken up in about 1 ml of TEA buffer of pH 8.9 and the grinding and removal of the particles by centrifugation were carried out as described in Example 9, 2). The supernatant of each culture is used, as previously, for assaying the urate oxidase and the total proteins. The main results obtained are collated in Table VIII below: TABLE VIII Strain/Culture conditions Urate oxidase activity (U/ml) Total soluble proteins (mg/ml) % of urate oxidase in the soluble proteins GRF18 pEMR515 (leu*)/a) < 0.1 2.2 < 0.05 EMY500 pEMR515 (leu*)/a) < 0.1 0.9 < 0.05 EMY761 pKMR515 (leu*)/a) < 0.1 1.8 < 0.05 GRF18 pEMR515 (leu*)/b) 38 5.4 23 EMY500 pEMR515 (leu*)/b) 20 2.5 26 EMY761 pEMR515 (leu*)/b) 33 4.2 26 a): the strains are cultivated in the presence of glucose (noninduction conditions) b): the strains are cultivated in the absence of glucose and in the presence of galactose (induction) These results show that a high level of expression of urate oxidase can be obtained with three non68 isogenic recipient strains transformed by the expression vector according to the invention, EXAMPLE 15; Expression in a 2.5 1 fermenter of urate oxidase cDNA for the EMY500 pEMR515 strain. Purification and partial characterization of the recombinant urate oxidase 1) Culture in a 2.5 1 fermenter of the EMY5QO PEMR515 strain: The culture of the EMY500 pEMR515 strain is carried out in a fermenter as follows: a) Preculture Phase in an erlenmeyer flask A 500 ml erlenmeyer flask containing 90 ml of autoclave phase growth medium APGM complemented with 1.28 g of MES (2-(N-morpholino)ethanesulfonic acid: Sigma No.

M 8250) and 10 ml of filtered phase growth medium FPGM, are inoculated from 1 ml of solution of the EMY500 pEMR515 strain in a medium containing 20% of glycerol with a number of cells corresponding to an OD of 2.35.

The compositions of the APGM and FPGM media are specified hereinafter. After 24 h of incubation, with stirring, at 30*C, the optical density of the culture is about 7. b) Fermenter culture phases The above culture is used for inoculating a 2.5 1 fermenter, containing the culture medium having the following composition: 900 ml of APGM + 200 ml of FPGM The pH of the culture is regulated by the fermenter at the reference value which is 5.5. After 6 to 7 hours of culture at 30*C, 72 ml of a solution of glucose at 500 g/1, i.e. 36 g of glucose, are added linearly over 9 h. c) Expression Phase 100 ml of autoclavable phase expression medium APEM and 150 ml of filtered phase expression medium FPEM (the compositions of which are specified hereinafter) are added to the above-described mixture.

Culture is then continued for 5 h. Thereafter, 150 ml of a solution containing 30 g of galactose, 15 g of glycerol and 36 g of ethanol are added linearly over 20 h which gives an OD around 160.

CHEMICAL COMPOSITION OF THE EXPRESSION AND GROWTH MEDIA - Autoclavable phase growth medium APGM for a final volume of 900 ml NTA (Nitrilotriacetic acid) 1.2 g yeast extract (DIFCO) 6 g K2S04 1.2 g NaCl 0.6 g MgS04. 7H20 1.2 g CaCl2. 2H20 840 mg FeCl3 108 mg glutamic acid 4.44 g HYCASE SF (Sheffield Products) 30 g Leucine 2.16 g Histidine 600 mg methionine 1.2 g trace elements I (see hereinafter) 5 ml uracil _ List of trace elements I for 1 1 of ultrapurified water CuS04. 5H20 780 mg H3BO3 5 g ZnS04. 7H20 3 g Kl 1 g MnS04. 2H20 3.5 g Na2M04. 2H2O 2 g FeClo. 6H20- 4.8 q Add 100 ml of concentrated hydrochloric acid to the solution. Make up to 1,000 ml.

- Filtered phase growth medium FPGM for a final volume of 200 ml of ultrapurlfled water KH2P04 4.8 g tryptophan 420 mg vitamin I (see hereinafter) 5 ml glucose_36 g Heat to dissolve,temperate, add vitamins I and filter on 0.2 μ.

List of vitamins I for a final volume of 100 ml of ultrapurlfled water biotin 1.2 mg folic acid 1 mg niacin (nicotinic acid) 144 mg pyridoxin.HC1 60 mg thiamine. HC1 240 mg calcium pantothenate 1.2 g mesoinosltol_Make up to 100 ml after dissolution.

Filter cold in a sterile manner on 0.2 μ.

- Autoclavable phase expression medium APEM for 100 ml of ultrapurlfled water NTA K2S04 glutamic acid 1.2 g 2.08 g g HYCASE SF (Sheffield Products) 24 g Leucine 2.16 g Histidine 600 mg methionine 1.2 g MgSO4. 7H20 720 g CaCl2. 2H20 840 mg FeCl3. 6H20 108 mg Trace elements list I 5 ml uracil 1.2 a Adjust the pH to 5.5 with concentrated H2SO4 or concentrated KOH. Autoclave for 20 min at 120*C. - Filtered phase exDression medium FPEM 150 ml for a final volume of of ultrapurlfled water KH2P04 2.4 g tryptophan 420 mg vitamins I 5 ml glycerol 36 g aalacioss 45 a Heat to dissolve,temperate, add the vitamins and filter. 2) Grinding of the cells After 20 h of induction, the optical density, measured at 600 nm, of the culture is 98. 800 g of fermentation wort are centrifuged for 5 min at 10,000 g and the cell residue is taken up in 80 ml of lysis buffer (glycine 20 mM pH 8.5). The cells are then ground, twice during 2.5 min in a mill (Vibrogen ZellmUhler V14) at 4*C in the presence of a volume of beads of 0.5 mm in diameter, equal to the volume of the solution of cells to be lyzed. After grinding, the supernatant is taken up and the beads are washed twice with 80 ml of lysis buffer. 210 ml of lyzate are recovered having a total protein amount of about 3 mg/ml and an urate oxidase activity of about 7.7 U/ml (i.e. a percentage of urate oxidase with respect to the total proteins of about 8.5% assuming a specific activity thereof of 30 U/mg). 3) Purification of the recombinant urate oxidase a) Purification protocol The previous lyzate is subjected to the two-step purification protocol described hereinafter.

STEE_I: Anionic chromatography: Carrier: DEAE (diethylaminosulfate) sepharose fast flow (Pharmacia ref. 17.07.09.91).

Once the gel is compressed, it fills a volume of 70 ml. Separation is carried out at room temperature, the fractions are collected and stored at 0*C.

Separation conditions: A chloride ion force gradient is used between a buffer 1 (10 mM sodium borate , pH 9.2) and a buffer 2 (10 mM sodium borate, 1 M sodium chloride ). The buffers are degased beforehand and during elution they are stored at 0*C. The equivalent of 0.02% of azide was added to each buffer.

The crude extract is deposited (10 ml) and eluted with buffer 1 until all of the urate oxidase, which is not retained in the column, has been collected (by fractions of 10 ml).

The pigments and the contaminating proteins are then eliminated by eluting with buffer 2.

Purification is followed by measuring the optical density of the eluate at 214 nm.

STEP 2: Reverse phase high pressure liquid chromatography: Carrier: C8 grafted silica-based column, Aquapore OD-300 (100 x 2.1 mm) (Brownlee-Applied Biosystems) Operating conditions: Eluent 1: Ultrapurified water (gone through a Millipore system) with 0.1% of trifluoroacetic acid.

Eluent 2: Acetonitrile (of spectrophotometric grade or the like) with 0.08% of trifluoroacetic acid.

Flow rate: 0.3 ml/min.

The gradient is from 35% acetonitrile/TFA to 70% acetonltrlle/TFA over 20 min, it is kept at 70% for 5 min. The injected quantity is 1 ml per run.

Collecting the fractions: Separation is followed by measuring the optical density at 218 nm. The acetonitrile evaporates off during in vacuo centrifugation. b) Results: The sample before and after the first purification step was analyzed by liquid chromatography on a C8 grafted silica column, the Aguapore 0D-300 described above with the same gradient, with an injected quantity of 50 μΐ. Purified A. flavus urate oxidase is used as an outer control.

In the starting lyzate, the urate oxidase represents 63% of the total proteins. After the first purification step, the urate oxydase represents 84% of the total proteins.

All of the sample obtained after the second step, which sample probably contains more than 84% of urate oxidase, was used for the partial characterization described hereinafter. 4) Partial characterization of the recombinant urate oxidase a) Analysis of amino acids The amino acids of the acid hydrolysate of the purified recombinant urate oxidase were analyzed on an Applied Biosystems analyzer model 420-130A. The distribution of the quantified amino acids is compatible (no significant difference) with the supposed sequence.

The same result was observed with the purified extractive A. flavus urate oxidase (obtained in example 4). b) Tryptic peptide map A tryptic peptide map was established for the purified recombinant urate oxidase and for the purified extractive urate oxidase (obtained in example 4) under the following conditions: A solution of urate oxidase at a concentration of about 1 mg/ml is prepared and a solution of trypsin at a concentration of 1 mg/ml is prepared beforehand.

The two solutions are brought into contact in an enzyme/substrate proportion of 1/30 for 8 hours at room temperature. The tryptic hydrolysate is then subjected to liquid phase chromatography on a C18 grafted silica-based column, 5 pm, lichrosorb (250 x 4.6 mm) (Hichrom-ref.RP 18-5-250A), equipped with a UV detector at 218 nm coupled to a recorder. The applied gradient is 1% acetonitrile/TFA to 60% acetonitrile/TFA over 120 min, then it is kept at 60% for 5 min.

The peptide maps obtained have a very close profile. 3) Demonstration of the blocked characteristic of the amino-terminal sequence: The amino-terminal sequence was analyzed using an Applied Biosystem sequencer model 470A, coupled to an Applied Biosystem analyzer of phenylthioidantoic derivatives, model 120 A. The purified recombinant urate oxidase (200 pmols controlled by amino acid analysis) was deposited on the sequencer in the presence of 20 pmols of β-lactoglobuline as control protein.

No amino-terminal sequence corresponding to a urate oxidase sequence was detected (however the aminoterminal sequence of the control protein was detected).

The amino-terminal end of the recombinant urate oxydase is thus blocked like the extractive urate oxidase.

EXAMPLE 16: Construction of an expression vector for urate oxidase cDNA in animal cells: plasmid pSV860 This vector was obtained by - ligation of the small AccI-SnaBI fragment containing a sequence coding for urate oxidase with the exception of the first 16 amino acids, said fragment being derived from plasmid p466 (an expression vector for A. flavus urate oxidase in E. coli, available in the laboratory and described below), with a synthetic Hindlll-AccI fragment, which made it possible to obtain a Hlndlll-SnaBI fragment containing a complete sequence coding for A. flavus urate oxidase and a non-translated 5' sequence favoring expression in animal cells; and - insertion of the HindiII-SnaBl fragment between the Hindlll and SnaBl sites of the multiple cloning site (also called polylinker) of the expression vector for animal cells, namely plasmid pSE^.

The following account will successively describe the construction of plasmid p466, plasmid pSEj and plasmid pSV860. 1) Construction of plasmid p466 Plasmid p466, an expression vector for urate oxidase cDNA in E. coli, was prepared. It comprises a fragment of pBR327 including the origin of replication and the ampicillin resistance gene; it also comprises a synthetic promoter of E. coli (R. RODRIGUEZ and M. CHAMBERLIN, Promoters - Structure and function (1982), Preager), a Shine-Dalgarno sequence followed by a polylinker containing the unique Ndel and Kpnl sites, a transcription terminator (derived from phage fd) and the lac i gene.

This plasmid was constructed from an expression plasmid for hGH in E. coli (p462) by replacing a fragment carrying the hGH gene with urate oxidase cDNA.

The construction of plasmid p466 was described in detail in Example 7 above. 2) Construction of an expression vector for animal cells: plasmid pSEi The strategy employed uses fragments obtained from pre-existing plasmids available to the public, and fragments prepared synthetically by the techniques now in common use. The cloning techniques employed are those described by T. MANIATIS, E.F. FRITSCH and J. SAMBROOK in Molecular Cloning, a laboratory manual (Cold Spring Harbor Laboratory, 1984). The oligonucleotides are synthesized with the aid of a Biosearch 4600 DNA synthesizer.

The following description will be understood more clearly with referenceto Figure 13, which shows a restriction map of plasmid pSEi, the sites which have disappeared due to ligation being indicated in brackets.

The symbols used in this Figure will be specified in the description below.

This plasmid was constructed by successive ligations of the following components: 1) - a Pvul I-Pvul I fragment - symbolized by ++++++ in Figure 13 - of 2525 bp, obtained by complete digestion of plasmid pTZ18R (Pharmacia) with the restriction enzyme PvuII. This fragment contains the origin of replication of phage FI (denoted by ORI FI in Figure 13), a gene (denoted by AmpR in Figure 13) carrying ampicillin resistance, and the origin of replication (denoted by ORI pBR322 in Figure 13) permitting the replication of this plasmid in E. coli. The first PvuII blunt site disappears on ligation with the EcoRV blunt site (which also disappears) of the fragment described in 7). 2) - a PvuII-Hpal fragment - symbolized by |·Β in Figure 13 - of 1060 bp, of type 5 adenovirus DNA between position 11299 (PvuII restriction site) and position 10239 (Hpal restriction site) (DEKKER & VAN ORMONDT, Gene 22, 1984, 115-120), containing the information for VA-I and VA-II RNAs· The Hpal blunt site disappears on ligation with the PvuII blunt site (which also disappears) of the fragment described in 3). 3) - a PvuII-Hindlll fragment - symbolized by ///// in Figure 13 - of 344 bp, derived from SV40 virus DNA and obtained by complete digestion with the restriction enzymes PvuII and Hindlll. This fragment contains the origin of replication and the early promoter of SV40 virus DNA (ref. B.J. BYRNE et al., PNAS-USA (1983) 80, 721-725).

The Hindlll site disappears on ligation with the site binding to Hindlll of the fragment described in 4). 4) - a*synthetic site binding to HindiII-HindiII fragment - symbolized by ~~~~~ in Figure 13 - of 419 bp, whose sequence, given below, is similar to the nontranslated 5' sequence of the HTLV1 virus (ref. WEISS et al., Molecular Biology of Tumor Viruses - part 2 - 2nd edition - 1985 - Cold Spring Harbor Laboratory - p. 1057). site binding to Hindlll ΤAGCTGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCC 1---------+---------+---------+---------+---------+---------+ 5Q CCGAGCGTAGAGAGGAAGTGCGCGGGCGGCGGGATGGACTCCGGCGGTAGGTGCGG GGTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTA 51-------------------+---------+---------+---------+---------+120 CCACTCAGCGCAAGACGGCGGAGGGCGGACACCACGGAGGACTTGACGCAGGCGGCAGAT GGTAGGCTCCAAGGGAGCCGGACAAAGGCCCGGTCTCGACCTGAGCTCTAAACTTACCTA 121 —-------+---------+---------+---------+---------+---------+180 CCATCCGAGGTTCCCTCGGCCTGTTTCCGGGCCAGAGCTGGACTCGAGATTTGAATGGAT GACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTT 181 ---------+---------+---------+---------+---------+---------+240 CTGAGTCGGCCGAGAGGTGCGAAACGGACTGGGACGAACGAGTTGAGATGCAGAAACAAA CGTTTTCTGTTCTGCGCCGTTACAACTTCAAGGTATGCGCTGGGACCTGGCAGGCGGCAT 241 ---------+---------+---------+---------+---------+---------+300 GCAAAAGACAAGACGCGGCAATGTTGAAGTTCCATACGCGACCCTGGACCGTCCGCCGTA CTGGGACCCCTAGGAAGGGCTTGGGGGTCCTCGTGCCCAAG6CAGGGAACATAGTGGTCC 301---------►---------+---------+---------+---------+--------+360 GACCCTGGGGATCCTTCCCGAACCCCCAGGAGCACGGGTTCCGTCCCTTGTATCACCAGG CAGGAAGGGGAGCAGAGGCATCAGGGTGTCCACTTTGTCTCCGCAGCTCCTGAGCCTGCA 361 ---------+---------+---------+---------+---------+---------+420 GTCCTTCCCCTCGTCTCCGTAGTCCCACAGGTGAAACAGAGGCGTCGAGGACTCGGACGT GA CTTCGA A Hindlll ) - a synthetic HindiII-site binding to BamHI fragment - symbolized by X XXX in Figure 13 - containing the promoter of the RNA polymerase of phage T7 and also a polylinker containing the Smal cloning site.

AGCTTGTCGACTAATACGACTCACTATAGGGCGGCCGCGGGCCCCTGCAGGAATTC ACAGCTGATTATGCTGAGTGATATCCCGCCGGCGCCCGGGGACGTCCTTAAG Hindlll Smal site binding to BamHI * ψ GGATCCCCCGGGTGACTGACT CCTAGGGGGCCCACTGACTGACTAG 6) - a BamHI-BcII fragment of 240 bp - represented by WW in Figure 13 - which is a small fragment obtained by complete digestion of -the SV40 virus with the enzymes Bell and BamHI and containing the late polyadenylation site of said virus (M. FITZGERALD et al., Cell, 24, 1961, 251-260). The BamHI and Bell sites disappear on ligation respectively with the site binding to BamHI of the fragment described in 5) and the BamHI site (which also disappears) of the fragment described in 7). 7) - a BamHI-EcoRV fragment - symbolized by OQC)C7 in Figure 13 - of 190 bp, which is a small fragment derived from plasmid pBR322 after complete digestion with the enzymes EcoRV and BamHI. 3) Construction of plasmid pSV860 Plasmid p466 (cf. Figure 9) was completely digested with the enzymes AccI and SnaBI. The small AcclSnaBI fragment, which contains a DNA sequence coding for urate oxidase with the exception of the first 16 aminoterminal acids, was purified and ligated with the synthetic HindHI-AccI fragment having the following sequence: Hindlll AccI t * AGCTTGCCGCCACTATGTCCGCAGTAAAAGCAGCCCGCTACGGCAAGGACAATGTCCGCGT -------------------+---------+---------+---------+---------+ ACGGCGGTGATACAGGCGTCATTTTCGTCGGGCGATGCCGTTCCTGTTACAGGCGCAGA This ligation makes it possible to obtain the Hindlll-SnaBI fragment containing a sequence, coding for urate oxidase, which is identical to that of clone 9C and a non-translated 5' sequence favoring expression in animal cells (KOZAK, M., Nucl. Acids Res., 12, 2, 1984, 857-872).

The Hindlll-SnaBI fragment contains the following sequence: ' -AGCTTGCCG CCACTATGTC CGCAGTAAAA GCAGCCCGCT ACGGCAAGGA CAATGTCCGC GTCTACAAGG TTCACAAGGA CGAGAAGACC GGTGTCCAGA CGGTGTACGA GATGACCGTC TGTGTGCTTC TGGAGGGTGA GATTGAGACC TCTTACACCA AGGCCGACAA CAGCGTCATT GTCGCAACCG ACTCCATTAA GAACACCATT TACATCACCG CCAAGCAGAA CCCCGTTACT CCTCCCGAGC TGTTCGGCTC CATCCTGGGC ACACACTTCA TTGAGAAGTA CAACCACATC CATGCCGCTC ACGTCAACAT TGTCTGCCAC CGCTGGACCC GGATGGACAT TGACGGCAAG CCACACCCTC ACTCCTTCAT CCGCGACAGC GAGGAGAAGC GGAATGTGCA GGTGGACGTG GTCGAGGGCA AGGGCATCGA TATCAAGTCG TCTCTGTCCG GCCTGACCGT GCTGAAGAGC ACCAACTCGC AGTTCTGGGG CTTCCTGCGT GACGAGTACA CCACACTTAA GGAGACCTGG GACCGTATCC TGAGCACCGA CGTCGATGCC ACTTGGCAGT GGAAGAATTT CAGTGGACTC CAGGAGGTCC GCTCGCACGT GCCTAAGTTC GATGCTACCT GGGCCACTGC TCGCGAGGTC ACTCTGAAGA CTTTTGCTGA AGATAACAGT GCCAGCGTGC AGGCCACTAT GTACAAGATG GCAGAGCAAA TCCTGGCGCG CCAGCAGCTG ATCGAGACTG TCGAGTACTC GTTGCCTAAC AAGCACTATT TCGAAATCGA CCTGAGCTGG CACAAGGGCC TCCAAAACAC CGGCAAGAAC GCCGAGGTCT TCGCTCCTCA GTCGGACCCC AACGGTCTGA TCAAGTGTAC CGTCGGCCGG TCCTCTCTGA AGTCTAAATT G The HindiII-SnaBl fragment was then inserted into vector pSEi, which had first been incubated with the enzymes Hindlll and Smal. This gave plasmid pSV860 shown in Figure 14, in which the symbols have the same meanings as in Figure 13, the novel Hindlll-SnaBI fragment being symbolized by . (The SnaBl and Smal sites disappeared on ligation.) EXAMPLE 17: Transient expression of urate oxidase cDNA in COS cells - Assay of the urate oxidase activity in the cell lvzate COS cells are monkey kidney cells expressing the T-antigen of the SV40 virus (Gluzman, Y., Cell 23, 1981, 175-182). These cells, which permit the replication of vectors containing the origin of replication of SV40 virus DNA, are preferred hosts for studying the expression of genes in animal cells. 1) Transfection of COS cells and transient expression of urate oxidase cDNA 4.10® COS cells are plated out in a Petri dish of diameter 6 cm (Corning) in 5 ml of Dulbecco's modified Eagle's medium (from Gibco), hereafter called DMEM, which contains 0.6 g/1 of glutamine and 3.7 g/1 of NaHCOe and is complemented with fetal calf serum (GIBCO) at a rate of 5%. After about 16 h of culture at 37’C in an atmosphere containing 5% of carbon dioxide, the culture medium is sucked off and the cells are washed with 3 ml of PBS (phosphate buffered saline from GIBCO). The following mixture is then added: 1000 μΐ of (DMEM + 10% of fetal calf serum (GIBCO)), 110 μΐ of diethylaminoethyldextran of average molecular weight 500,000 at a concentration of 2 mg/ml (Pharmacia), 1.1 μΐ of chloroquine 100 mM (Sigma) and 3 ug of DNA of either plasmid pSV860 or plasmid pSEi (for the control). After incubation for 5 h at 37*C in an atmosphere containing 5% of carbon dioxide, the mixture is withdrawn from the cells. 2 ml of PBS containing % of dimethyl sulfoxide (spectroscopic grade, Merck) are then added. After incubation for 1 min at room temperature, the mixture is withdrawn and the cells'are washed twice with PBS. 5 ml of DMEM complemented with fetal calf serum at a rate of 2% are added. Incubation is continued for 4 days at 37°C under an atmosphere containing 5% of carbon dioxide. 2) Preparation of the samples The culture medium is sucked off and the COS cells are rinsed twice with 3 ml of PBS. The cells are then Collected by scratching with a rubber spatula (policeman) in 1 ml of PBS. After scratching, the dish is rinsed with 1 ml of PBS. The two cell suspensions are combined and centrifuged for 10 min at 1000 rpm. The supernatant is removed and the cell residue is resuspended in 1 ml of triethanolamine (TEA) 0.05 M of pH 8.9/ EDTA buffer.

The cells are lyzed by sonication (on ice) by means of 10 s pulses with a sonicator (Vibra Cell from Sonics and Materials Inc. USA) set to a power of 12 W.

The cell lyzate is centrifuged for 10 min at 10,000 rpm and the supernatant is recovered for assay of the urate oxidase. 3) Assay of the urate oxidase activity The urate oxidase activity was assayed as described in Example 9.

The results are collated in the Table below: COS cells transfected by Urate oxidase activity U/ml pSV860 0.105 pSEi < 0.01 It is found that the COS cells transfected by plasmid pSV860 carrying urate oxidase cDNA express an appreciable level of urate oxidase activity, whereas no urate oxidase activity is detectable in the control. There is therefore expression of urate oxidase cDNA.

Claims (5)

CLAIMS: 1. / culturing of a strain according to any one of claims 21 to 23;

1. Recombinant protein, characterized in that it has a specific urate oxidase activity of at least 16 U/mg and in that it has the following sequence: Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val Tyr 1 Lys Val 5 His Lys Asp Glu Lys 10 Thr Gly Val Gin Thr Val 15 Tyr Glu Met Thr Val 20 Cys Val Leu Leu Glu 25 Gly Glu He Glu Thr Ser 30 Tyr Thr Lys Ala Asp 35 Asn Ser Val He Val 40 Ala Thr Asp Ser He 45 Lys Asn Thr lie 50 Tyr lie 55 Thr Ala Lys Gin Asn 60 Pro Val Thr Pro Pro Glu Leu Phe Gly 65 Ser lie 70 Leu Gly Thr His Phe 75 He Glu Lys Tyr Asn His lie His 80 Ala Ala His 85. Val Asn He Val Cys 90 His Arg Trp Thr Arg Met 95 Asp lie Asp Gly Lys 100 Pro His Pro His Ser 105 Phe He Arg Asp Ser Glu 110 Glu Lys Arg Asn Val 115 Gin Val Asp Val Val 120 Glu Gly Lys Gly He 125 Asp He Lys Ser 130 Ser Leu 135 Ser Gly Leu Thr Val 140 Leu Lys Ser Thr Asn Ser Gin Phe Trp 145 Gly Phe 150 Leu Arg Asp Glu Tyr 155 Thr Thr Leu Lys Glu Thr Trp Asp 160 Arg lie Leu 165 Ser Thr Asp Val Asp 170 Ala Thr Trp Gin Trp Lys 175 Asn Phe Ser Gly Leu 180 Gin Glu Val Arg Ser 185 His Val Pro Lys Phe Asp 190 Ala Thr Trp Ala Thr 195 Ala Arg Glu Val Thr 200 Leu Lys Thr Phe Ala 205 Glu Asp Asn Ser 210 Ala Ser 215 Val Gin Ala Thr Met 220 Tyr Lys Met Ala Glu Gin He Leu Ala 225 Arg Gin 23Ο Gin Leu lie Glu Thr 235 Val Glu Tyr Ser Leu Pro Asn Lys 240 His Tyr Phe 245 Glu lie Asp Leu Ser 250 Trp His Lys Gly Leu Gin 255 Asn Thr Gly Lys Asn 260 Ala Glu Val Phe Ala 265 Pro Gin Ser Asp Pro Asn 270 Gly Leu lie Lys Cys 290 275 Thr Val Gly Arg Ser 295 280 Ser Leu Lys Ser Lys 300 285 Leu preceded, optionally, by a methionine. 2. / lysis of cells;

2. Recombinant protein according to claim 1, characterized in that it has a specific urate oxidase activity of approximately 30 U/mg. 3. / isolation and purification of the recombinant urate oxidase contained in the lyzate. 25. Animal cells, characterized in that they contain a recombinant gene according to claim 13 with the means necessary for its expression. 26. Animal cells, characterized in that they contain an expression vector according to claim 16, carrying a recombinant gene according to claim 14. - 90 27. A protein having urate oxidase activity according to Claim 1, substantially as herein described in the Examples. 28. A pharmaceutical composition containing a drug according to Claim 7, or a pharmaceutically acceptable salt 5 thereof, together with a physiologically acceptable carrier. 29. A recombinant gene according to Claim 8, substantially as herein described in the Examples and with reference to the drawings. 10 30. An expression vector according to Claim 16, substantially as herein described in the Examples and with reference to the drawings. 31 . A prokaryotic microorganism or a eukaryotic cell or a strain of Saccharomvces cerevisiae according to Claim 19, 15 Claim 20 or Claim 21 respectively, substantially as herein described in the Examples. 32. A process for producing a recombinant urate oxidase according to Claim 24, substantially as herein described in the Examples. - 91 33. An animal cell containing a recombinant gene or an expression vector according to Claim 25 or Claim 26

3. Recombinant protein according to one of claims 1 and 2, characterized in that it has, by bidimensional gel analysis, a spot of molecular mass of approximately 33.5 kDa which represents at least 90% of the protein mass.

4. Recombinant protein according to any one of claims 1 to 3, characterized in that its purity degree, determined by liquid chromatography on a C8 grafted silica column, is higher than 80%. 5. Recombinant protein according to any one of claims 1 to 4, characterized in that it has an isoelectric point around 8.0. 6. Recombinant protein according to any one of claims 1 to 4, characterized in that it carries a blocking group, preferably of molecular mass around 43 units of atomic mass, on the amino-terminal serine. 7. Medicament, characterized in that it contains the recombinant protein according to any one of claims 1 to 6. 8. Recombinant gene, characterized in that it comprises a DNA sequence coding for the protein which has the fo llowing r se< guence: Met Ser Ala Val Lys Ala Ala Arg Tyr Gly Lys Asp Asn Val Arg Val 1 5 10 15 Tyr Lys Val His Lys Asp Glu Lys Thr Gly Val Gia Thr Val Tyr Glu 20 25 , 30 Met Thr Val Cys Val Leu Leu Glu Gly Glu lie Glu Thr Ser Tyr Thr 35 40 45 Lys Ala Asp Asn Ser Val He Val Ala Thr Asp Ser He Lys Asn Thr 50 55 60 He Tyr lie Thr Ala Lys Gin Asn Pro Val Thr Pro Pro Glu Leu Phe 65 70 75 80 Gly Ser He Leu Gly Thr His Phe He Glu Lys Tyr Asn His lie His 85 90 95 Ala Ala His Val Asn lie Val Cys His Arg Trp Thr Arg Met Asp lie Asp Gly Lys 100 Pro His Pro His Ser 105 Phe lie Arg Asp Ser 110 Glu Glu Lys Arg Asn 115 Val Gin Val Asp Val 120 Val Glu Gly Lys Gly 125 lie Asp lie Lys Ser 130 Ser Leu Ser Gly Leu 135 Thr Val Leu Lys Ser 140 Thr Asn Ser Gin Phe 145 Trp Gly Phe Leu Arg 150 Asp Glu Tyr Thr Thr 155 Leu Lys Glu Thr Trp 160 Asp Arg lie Leu Ser 165 Thr Asp Val Asp Ala 170 Thr Trp Gin Trp Lys 175 Asn Phe Ser Gly Leu 180 Gin Glu Val Arg Ser 185 His Val Pro Lys Phe 190 Asp Ala Thr Trp Ala 195 Thr Ala Arg Glu Val 200 Thr Leu Lys Thr Phe 205 Ala Glu Asp Asn Ser 210 Ala Ser Val Gin Ala 215 Thr Met Tyr Lys Met 220 Ala Glu Gin lie Leu 225 Ala Arg Gin Gin Leu 230 lie Glu Thr Val Glu 235 Tyr Ser Leu Pro Asn 240 Lys His Tyr Phe Glu 245 He Asp Leu Ser Trp 250 His Lys Gly Leu Gin 255 Asn Thr Gly Lys Asn 260 Ala Glu Val Phe Ala 265 Pro Gin Ser Asp Pro 270 Asn Gly Leu lie Lys 290 275 Cys Thr Val Gly Arg 295 280 Ser Ser Leu Lys Ser 300 285 Lys Leu 9. Recombinant gene according to claim 8, characterized in that it permits expression in prokaryotic microorganisms. 10. Recombinant gene according to claim 9, characterized in that said DNA sequence contains the following sequence: ATGTCTGCGG TAAAAGCAGC GCGCTACGGC AAGGACAATG TTCGCGTCTA CAAGGTTCAC 60 AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG 120 GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC l80 ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC 240 GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC 300 AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC 360 TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC 420 ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC 480 TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC 5^0 ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTIT GCTGAAGATA acagtgccag cgtgcaggcc actatgtaca agatggcaga gcaaatcctg GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATITCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG 11. Recombinant gene according to claim 8, characterized in that it permits expression in eukaryotic cells. 12. Recombinant gene according to claim 11, characterized in that said DNA seguence contains the following seguence: ATGTCTGCTG TTAAGGCTGC TAGATACGGT AAGGACAACG TTAGAGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCCTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTIT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG 13. Recombinant gene according to claim 8, characterized in that it permits expression in animal cells. 14. Recombinant gene according to claim 13, characterized in that said DNA seguence comprises the following sequence: ATGTCCGCAG TAAAAGCAGC CCGCTACGGC AAGGACAATG TCCGCGTCTA CAAGGTTCAC AAGGACGAGA AGACCGGTGT CCAGACGGTG TACGAGATGA CCGTCTGTGT GCTTCTGGAG GGTGAGATTG AGACCTCTTA CACCAAGGCC GACAACAGCG TCATTGTCGC AACCGACTCC ATTAAGAACA CCATTTACAT CACCGCCAAG CAGAACCCCG TTACTCCTCC CGAGCTGTTC GGCTCCATCC TGGGCACACA CTTCATTGAG AAGTACAACC ACATCCATGC CGCTCACGTC AACATTGTCT GCCACCGCTG GACCCGGATG GACATTGACG GCAAGCCACA CCCTCACTCC TTCATCCGCG ACAGCGAGGA GAAGCGGAAT GTGCAGGTGG ACGTGGTCGA GGGCAAGGGC ATCGATATCA AGTCGTCTCT GTCCGGCCTG ACCGTGCTGA AGAGCACCAA CTCGCAGTTC TGGGGCTTCC TGCGTGACGA GTACACCACA CTTAAGGAGA CCTGGGACCG TATCCTGAGC ACCGACGTCG ATGCCACTTG GCAGTGGAAG AATTTCAGTG GACTCCAGGA GGTCCGCTCG CACGTGCCTA AGTTCGATGC TACCTGGGCC ACTGCTCGCG AGGTCACTCT GAAGACTTTT GCTGAAGATA ACAGTGCCAG CGTGCAGGCC ACTATGTACA AGATGGCAGA GCAAATCCTG GCGCGCCAGC AGCTGATCGA GACTGTCGAG TACTCGTTGC CTAACAAGCA CTATTTCGAA ATCGACCTGA GCTGGCACAA GGGCCTCCAA AACACCGGCA AGAACGCCGA GGTCTTCGCT CCTCAGTCGG ACCCCAACGG TCTGATCAAG TGTACCGTCG GCCGGTCCTC TCTGAAGTCT AAATTG preceded by a non-translated 5' sequence favoring expression in animal cells. 15. Recombinant gene according to claim 14, characterized in that the non-translated 5' sequence favoring expression in animal cells comprises the sequence AGCTTGCCGCCACT, located immediately upstream from the sequence described in claim 14. 16. Expression vector, characterized in that it carries a recombinant gene according to any one of claims 8 to 15 with the means necessary for its expression. 17. Expression vector according to claim 16, characterized in that it carries at least one selection marker. 18. Expression vector according to claim 17, characterized in that it has the characteristics of one of plasmids pEMR469, pEMR473, described in Figures 11 and 12, or pEMR515 derived from pEMR473 by deletion of the URA3 gene and of the Xbal-Nhel fragment of the 2 μ. 19. Prokaryotic microorganisms, characterized in that they are transformed by an expression vector according to claim 16, carrying a recombinant gene according to claim 9. 20. Eukaryotic cells, characterized in that they are transformed by one of the expression vectors according to any one of claims 16 to 18, carrying the recombinant gene according to claim 11. 21. Strain of Saccharomvces cerevisiae. characterized in that it is transformed by one of the expression vectors according to any one of claims 16 to 18. 22. Strain according to claim 21, characterized in that it carries a mutation on at least one of the genes responsible for the synthesis of leucine or uracil. 23. Strain according to claim 22, characterized in that it carries a mutation on at least one of the LEU2 and URA3 genes. 24. Method for obtaining the recombinant urate oxidase according to claim 1, characterized in that it comprises the following steps:

5. Respectively, substantially as herein described in the Examples.