JPH0361483A - Novel tissue plasminogen activating factor - Google Patents

Abstract

PURPOSE:To produce t-PA having a finger domain and/or a cringle 1 domain negatively charged by transforming a host cell with a manifesting vector containing DNA coding said t-PA. CONSTITUTION:Host cell is transformed using a manifestation vector containing DNA coding human tissue plasminogen activating factor (t-PA) having a finger domain and/or a cringle 1 domain having negative electric charge. Said transformed host cell is cultured in a medium and generated t-PA is collected from the cultured substance. Resultant t-PA is useful as fibrinolytic agent for the treatment of vascular disease. Besides, cultivation of said transformant is preferably performed at pH about 7-7.5 for about 5-50hr.

Description

DETAILED DESCRIPTION OF THE INVENTION This invention relates to a novel tissue plasminogen activator. It has a strong activity of converting into plasmin which gives rise to soluble products.
D encoding the amino acid sequence of a novel tissue plasminogen activator, thus useful as a thrombolytic agent.
The present invention relates to NA, methods for producing it, and pharmaceutical compositions containing it.

Conventional techniques and the complete amino acid sequence and structure of the first natural human "tissue plus main nogen activator" (hereinafter referred to as rt-PAJ), which this technique attempts to solve, and its origin from human melanoma cells (Bowes). t)NA sequence encoding has already been revealed by recombinant DNA technology [Nature 301
．． 214 (1983)]. Natural t-P^ is a car-
It is a single-chain serine protease that is converted by plasmin into a two-chain form of heavy and light chains linked by disulfide bonds. The light chain (L) is the protease domain and therefore contains the active site of this enzyme.
Weight 1 ()l) is 2 with a finger domain (F), a growth factor domain (E) and three disulfide bonds.
It has two kringles (ie, kringle 1 and kringle 2 domains; 1 and 2).

Therefore, natural t-PA has five functional domains F1E
, ni+ , ni2 and L [European Patent Application Publication No. 0196920 and Proc, Natl.
.

Acad, Sci, USA 83.4670 (19
8B)].

Natural t-PA is unstable and has an extremely short half-life in vivo (approximately 1 to 8 minutes depending on the species). Various studies have been conducted on the modification of natural t-PA to extend its half-life. result,
The inventors of this invention have demonstrated that natural t-PA can be converted in vivo by converting the charge of the finger domain and/or kringle 1 domain of natural t-p^ from positive to negative.
We succeeded in producing a new t, -PA that is more stable than the previous method.

Structure and scope of the invention Therefore, the present invention provides a novel t-p that differs from natural t-PA by having the charge of the finger domain and/or kringle 1 domain of natural t-PA converted to negative. Provide ＾. In other words, the present invention provides novel t-PAs with negatively charged finger domains and/or kringle 1 domains.

Basic amino acids, which are the constituents of polypeptides, have positive (+
It is well known that neutral amino acids, which have a charge of 1) and are constituents of polypeptides, have a charge of zero (0), and acidic amino acids, which constitute polypeptides, have a negative charge (-1) [ Methods in Enzymolog
y, 154, 450-473 (1987)]
. Therefore, the total charges of the finger and kringle 1 domains of native t-PA are +2 and +, respectively.
It is calculated as 1.

Natural t-P^ finger domain and kringle 1
To change the charge of a domain, it is preferred to replace or remove one or more constituent basic amino acids with acidic amino acids.

Natural t-P^ finger domain and kringle 1
The basic amino acids of the domain include lysine (Lys)
and arginine (^rg).

Acidic amino acids include aspartic acid (Asp) and glutamic acid (Glu).

In this specification, the numbering of the constituent amino acids of natural or novel t-PA is based on the numbering proposed by Penntca et al. [Nature 301, 214
(1983)], for example, Tyr2
means the tyrosine at position 2 of the amino acid sequence of natural t-PA.

A preferred example of the novel t-PA of this invention can be represented by the following amino acid sequence: R1-82'''B-R2-A31-123-R3-81
38-527 (I) (wherein R1 is 5et- or GlyAlaArgSer-R2 is -ArgAspG
luLysThrGlnMetI leTyrG1nG
lnH1sG1nSerTrpLeuArgProVa
lLeuArgSer^snArg- or -5erAspGluThrG1nMetlleTyr
GlnGlnH1sGlnSerTrpLeuAspP
roValLeuG1uSerAsnG1u-R3 is-
LysProTyrSarGlyArgArgProA
spAlalleArg-or-GIuProTyrSerGlyGluGluPro
AspAlaLeuG1u-1A2-6 is natural t-PA
831-123 is the same amino acid sequence from Tyr' to Cys' of natural t-PA from Val' to 61n
Same amino acid sequence as up to 12S, ^118,527 is from Leu136 of natural t-P^ to p
, shows the same amino acid sequence as up to O@21. ) In this specification, for convenience, the following code names are used for the new t-p^: FPA Oite for the above amino acid sequence CI), R1 is 5er-1 R2 is
TyrGlnGlnHisG1nSerTrpLeuA
spProValLeuGluSerAsnGlu- and R3 is -LysProTyrSerG1yArgArg
ProAspA1alleArg-, A""-A3l-'"!5 J: H"36-"7
Each of the above terms is as defined in 'A' above.

aKl-124 In the above amino acid sequence (1), R1 is 5er-1 R2 is -ArgAspGluLysThrG1nMet
IleTyrG1nGlnHisG1nSerTrpL
auArgProValLeuAr'gSer^snA
rg- and R3 is -G1uProTyrSerGlyGluGlu
Pro^5pA1aLeuG1u-, and A2-6,^31-123 and^1311-! Ill?
are each as defined above.

The novel t-PA of this invention is produced by recombinant QN^ technology and polypeptide synthesis.

That is, the novel t-p^ of this invention is the new t-P
A host cell transformed with an expression vector containing a DNA encoding the amino acid sequence of A is cultured in a medium, and the new t-p^ is collected from the culture (thereby, it can be produced).

The details of the above manufacturing method will be explained below.

The host cell may be a microorganism [bacteria such as Escherichia coli (Esc
herichia colt), Bacillus subtilis
ussubtilis, etc.), yeasts (e.g. baker's yeast (Saccharomyces cerevisi)
ae), etc.], including animal cell threads and cultured plant cells. Preferred examples of microorganisms include bacteria, especially strains belonging to the genus Escherichia (e.g., E., colt.
33694 to HBOI ATC, E, co
lt HBIOI-16FERM BP-1872
゜E, c, oli 294＾TCC31446,E,
coliz 1776 ATCC31537, etc.)
, yeast, especially strains belonging to the genus Saccharomyces [e.g.
e CRF 18 (see European Patent Application Publication No. 0225286)], animal cell threads [e.g. mouse L929 cells, Chinese hamster Obari (
C) 10) Cells, etc.].

When bacteria, especially Escherichia coli, are used as host cells, the expression vector usually contains at least a promoter, an initiation codon, and a DNA encoding the amino acid sequence of the novel t-PA.
, a stop codon, a terminator region, and a self-replicable unit. When yeast or animal cells are used as host cells, the expression vector contains at least a promoter, an initiation codon, a signal peptide, and a novel t - DN encoding the amino acid sequence of PA
A and a stop codon, preferably consisting of an enhancer sequence, the 5°- and 3- of the natural t-p^
° − non-coding regions, splicing junctions,
A polyadenylation site and a self-replicable unit can also be inserted into the expression vector.

Preferred promoters include conventional promoters [
For example, the PL-promoter and trp for E. coli
- Promoter, TRPI gene AD old or ^D) III gene and acid phosphatase (P
H05) Gene promoter, HT for mammalian cells
LV-promoter, SV40 early and late promoter, LTR-promoter, mouse metallothionein I (MMT)-promoter and cotton cininium promoter, etc.].

A preferred start codon is the methionine codon (ATG
).

Signal peptides include signal peptides such as natural t-PA.

[IN8 encodes the signal peptide or the amino acid sequence of the novel t-p^, e.g., partial or total DNA synthesis using the DN8 synthesis system and/or transformants, [e.g., call LE 392 0 people (
pTP^21), E, colt JA 221 (
pTP^25) ATCC39808, E. coli
JA 221 (i) TP^102) ATCC398
10°E, coli JA 221 (pTPA102
) (Lys 277-hIle) ATCC3981
1, E, colt JM 109 (p51H) F
ERM P-9774゜E, colt JM IQ
B (p853) A suitable vector obtained from FERIA P-97753 [e.g. prp^21, p
TPA25, pTpA102, pTP^x02(L
ys 277-11e);
It can be prepared by a conventional method such as treatment with A ligase, DNA polymerase, etc.). In a preferred embodiment of this invention, the preparation of DNA encoding the novel t-PA is carried out as described by Wells et al.
3, 659-663 (1988) and/or fringe (Frltz) as described in DNA Cloning I, 151 (1985L IRl,
This can be done by oligonucleotide-directed mutagenesis as described in press.

Examples of stop codons include commonly used stop codons (eg, TAG, TGA, etc.). As terminator region, natural or synthetic terminator
(eg, synthetic fd phage terminator 1, etc.).

As a self-replicating unit, all the DNA belonging to it
A DNA sequence that autonomously replicates in a host cell, including natural plasmids, artificially modified plasmids (eg, DNA fragments prepared from natural plasmids), and synthetic plasmids.

Preferred examples of this plasmid include plasmid pBR322 or an artificially modified version thereof (a DNA fragment obtained by treating pBR322 with an appropriate restriction enzyme) when using Escherichia coli as the host cell, and when using yeast as the host cell. Examples include yeast 2μ plasmid or yeast chromosomal DNA, and when mammalian cells are used as host cells, for example, plasmid, pR5Vneo ATCC37
198, plasmid +) SV2dhfr ATCC37
145, plasmid pdBPV-MMTneo AT
CC37224, plasmid psV2neo8TCC3
7149 is mentioned.

Examples of the enhancer sequence include the SV40 enhancer sequence (72b,p,).

Examples of the polyadenylation site include the polyadenylation site of SV40.

As a splicing junction, for example, S
One example is the V40 splicing junction.

The promoter, initiation codon, DNA encoding the novel t-PA amino acid sequence, termination codon, and terminator region are continuously arranged in a circle from upstream to downstream together with an appropriate self-replicable unit (plasmid) as desired. Using the other NA fragments (e.g. linker-5 and other restriction sites, etc.), conventional methods (e.g. restriction enzyme digestion, T4D
An expression vector can be prepared by ligation using NA ligase). @When a mammalian cell line is used as a host, DNA encoding the enhancer sequence, the 5'-non-coding region of the promoter native t-PA cDNA, the start codon, the signal peptide, and the amino acid sequence of the novel t-PA. , a stop codon, a 3°-noncoding region, a splicing junction, and a polyadenylation site can be ligated sequentially and circularly from upstream to downstream to an appropriate self-replicable unit using the above-described method to prepare an expression vector. good.

The expression vector is introduced into host cells. Introduction is the usual method [
For example, transformation (including transfection),
microinjection, etc.] to obtain transformants.

In order to produce novel t-PA using the production method of this invention, the expression vector-containing transformant thus obtained is cultured in an aqueous medium.

The medium contains a carbon source (e.g. glucose, glycerin,
mannitol, fructose, lactose, etc.) and inorganic or organic nitrogen sources (e.g. ammonium sulfate, ammonium chloride, casein hydrolyzate, yeast extract, polypeptone, batatotributon, beef extract, etc.)
Contains.

If desired, other ingredients [e.g., inorganic salts (e.g., sodium or potassium phosphate, dipotassium hydrogen phosphate, magnesium chloride, magnesium sulfate, calcium chloride), vitamins (e.g., vitamin Bl), antibiotics (e.g. Dulbecco's Modified Eagle's Minimum Essential Medium (DMEM) supplemented with fetal comb serum and antibiotics is often used for culturing ffli mammalian cells.

Cultivation of transformants (including transfectants) is
Generally pH 5.5-8.5 (preferably pH 7-7.
5), 5 to 40°C (preferably 25 to 38°C)
It may be carried out for 50 hours.

When the novel t-PA thus produced is present in the solution fraction of the culture, a culture filtrate (supernatant) is obtained by filtration or centrifugation of the culture, from which natural or synthetic protein Purification 1, by conventional methods (e.g., dialysis, gel filtration,
It can be purified and isolated by affinity column chromatography using an anti-t-P^ monoclonal antibody, column chromatography using an appropriate adsorbent, high performance liquid chromatography, etc.). New t-P produced
When A is present in the cells of the cultured transformant, the cells are collected by filtration or centrifugation, and the cell wall and/or cell membrane is disrupted, for example, by ultrasound and/or treatment with lysozyme, to produce debris. The debris can be dissolved in a suitable aqueous solution (eg, 8M urea aqueous solution, 6M guanidium salt aqueous solution), and the new t-PA can be purified from the solution by the conventional method as described above.

The new t-PA produced with E. coli needs to be refolded. Refolding can be performed by conventional methods.

The novel t-p^ of this invention is useful as a thrombolytic agent for the treatment of vascular diseases (eg, myocardial infarction, stroke, heart attack, pulmonary embolism, etc.). New t-PA of this invention
can be mixed with a pharmaceutically acceptable carrier and administered parenterally to mammals, including humans, in the form of a pharmaceutical preparation such as an injection.

Pharmaceutically acceptable carriers include peptides or proteins (
For example, various organic or inorganic carrier materials commonly used in the preparation of pharmaceutical compositions containing serum albumin, etc.) may be included.

The dosage of the novel t-P^ of this invention will vary depending on various factors such as the type of disease, the weight and/or age of the patient, as well as the type of route of administration.
- The optimal dosage of PA is usually selected within the range of 0.1 to laffIg/kg/day for injection or infusion. The above daily dose may be divided and given to the patient every few hours.

The following examples are intended to illustrate the invention, but are not intended to limit it.

All enzymes used in the examples (e.g., restriction enzymes, alkaline phosphatase, DN^polymerase, ON^ligase, etc.) are commercially available, and the conditions for use of these enzymes can be found, for example, in the instructions attached to the commercially available enzymes. It will be obvious to those skilled in the art upon reference to the book.

Bacteriophage Lambda Charon 4
A human genome library containing a partial digest of human DNA cloned into the EcoRI site of [T, available from Maniatis, Mani
atis et al., Ce1l 15.687-701 (19
78)] using the +INA probe obtained by ff2p nick translation and plaque hybridization [Wahl et al., Proc.
tl, Acad, Scf.

IJsA 78.3883-3687 (1979)]. Plasmid pTPA1
02 (Lys277-1ie) [Transformant strain E containing it, coli JA221 (pTPA102)
(Lys277-41ie) ATC(: 3981
Mutant t-PA (Lys277-11e
) Expression vector, PCT International Publication No. WOBB/(11
By using the 232 bp PstI-RsaI fragment of 53B] as a probe, three overlapping recombinant λ
18A1, λ19^2 and λ21^2 were isolated. t
- To isolate phage containing the transcription start site of the PA gene and the 5'-non-coding sequence, t:-1.
A second plaque hybridization was performed using the 5 Kb Eco RI - Bam ) II fragment as a probe. This hybridization results in t-P
Contains the first two exons of the A gene132
AI and λ110^1 were obtained. Mapping of the inserted DNA sequences was performed by restriction enzyme analysis, and their I) NA sequences were partially determined by the dideoxynucleotide chain termination method using the M13 sequencing kit (Amerjam).

Sequences and mapping of their inserted DNA were performed using published t-p^genome clones [Degen et al., J.
, Biol, (t+am, 261.6972-89
85 (1986)].

Total FINA from melanoma (black 11!) cell culture was analyzed by Chirgvln et al., Biochemistry 18.
, 5294 (1979). Human melanoma cells (Bowes
), 3% (V/V) fetal bovine serum and 10
1 each containing 400 mA of Dulbecco's Modified Eagle Minimum Essential Medium (DMEM) supplemented with mM HEPS.
In order to actively produce t-p^, which was cultured in a rotating bottle until it became a confluent monolayer,
Human melanoma cells were treated with 400 mf each of DMEM containing 666 μg of the protease inhibitor 7-brotinin! , in 1
Cultured for 8 hours. Cells were collected by centrifugation and treated with 501111.6M guanidium isothiocyanate, 5mM sodium citrate (pH 7.0), 0.11 it 2-mercaptoethanol and 0.5% N-lauroylsarcosine sodium. I felt sad again. Cells were dispersed by homogenization. The homogenate was placed in a Beckman 5W50.1 polyaromer tube at 0.1 M.
Place on cushion 3 ll1 fl of 5.7 M cesium chloride in EDTA (pH 7,5), 30.000 r
pm, centrifuged for 12 h at 20 °C.

The supernatant was discarded, and the RNA pellet was dissolved in 1 mJZ of water. 0.1 volume 3M sodium acetate (p)l 5.2
) and 2.5 volumes of ethanol were added to precipitate the RNA. mRNA was purified from total RNA preparations using oligo-dT cellulose column chromatography [Aviv et al., Proc. Natl., Acad.
Sci. 69.1408 (1972)]. 4
A typical yield from 10" x 10" cells is approximately 11" total RNA
mg, and about 900 μg of poly(A) plus mtlNA.

This poly(^) plus IIIRN^ was subjected to the 5°-brimer extension method [Lawn et al., Nucleic Ac1ds
Res, 9.6103-1!114 (1981)] was used for the preparation of two 111 cDN^. mRN
A 180 μg and sequence 5'-GATCACTTGGT
5 μg of Brimer with AAGA-3°, Q, IM
It was heated at 90°C for 5 minutes in KCI 200μ°C and then slowly cooled to 42°C. Annealed mRNA
using 50ff1M Tris-HCI (pH 8,3), 1
0mM MgCb, 10mM DTT, 4mM
Sodium birophosphate and four deoxyribonucleotide triphosphates (dA-P, dT
TP, d(:TP, dGTP) at 400 μ℃
Using reverse transcriptase 20Q position 41 in
Chain A was synthesized at 42°C for 60 minutes. the mixture,
2001M Tris-HCl (pH 7,5), 5mM
Mget2.10mM (NH4) 2504.1
00mM KCI, 0.18LIIM NAD.

1.50 ug/mn in BSA2a+fl. O
RNase H of JI rank/ml, 50 vehicle/m! DNA polymerase I at 12°C and E. coli DNA'A ligase at position 5011/++j2 for 1 hour at 22°C.
It was treated for 1 hour.

15 units of 74 DNA polymerase were added to the reaction mixture. After incubating for 10 minutes at 37°C, the reaction mixture was extracted once with phenol/chloroform and the aqueous solution was precipitated with 1 volume of 4M ammonium acetate and 4 volumes of ethanol. Double-stranded cDNA was prepared in 200 mM potassium cacodylate, 25 mM Tris-MCI (pH 6,
9), 1mM dCTP, 0.1mM DTT
, extended with deoxy (C) residues using 10 units of terminal transferase in 200 μA of 1 mM CoC1z at 37° C. for 30 minutes. The reaction mixture was extracted with phenol/chloroform and the aqueous solution was diluted with 0.1 volume of 3M sodium acetate (985,2) and 2
Precipitated with 1 volume of ethanol. Tailed cDN
A, 10mM Tris-)ICI (pH 8.0),
Annealed with 880 ng of deoxy (G)-tailed puc9 (Pharmacia) in 1600 μX of 1 mM EDT^, 0.15 M NaC at 58° C. for 1 hour. Using annealed DNA, a competent E.
, colt DHI was transformed. Approximately 17,000 transformants with ampicillin-resistant phenotype were obtained. This 5°-brimer extended cDNA library was
Colony hybridization (Gru
Stein et al., Proc. Natl. Acad.
Sci., 72.3981-3965 (1975). 1.5k from λ19^2
b Plasmid pMI containing the 5°-noncoding sequence and signal sequence of t-PA cDNA from one of the eight colonies that gave a positive hybridization signal using the EcoRI-BamHI fragment as a probe.
200 was released from IL. The cDNA insert of pMI200 was approximately 170 bp in length, and the DNA base sequence was determined by the dideoxynucleotide chain termination method (the cDNA sequence is shown in Figure 4).

coli JA221 (pTP81 to 2) (L
ys277-=1ie) One loopful of a slant culture of ATCC39811 was added to one broth containing ampicillin at 50°C g/mJZ 11. 800n at 37°C.
The sample was incubated with shaking until the optical density at m (o,o,) was approximately at the o,a absorption position. 0.0. When the value of chloramphenicol was approximately 0.6, chloramphenicol powder was added to the medium to a final concentration of 100 μg/mA.
Incubation was continued overnight.

B, plus pTPA102 (L 5277-11e
) from the culture broth obtained in Example 3A, col
i J^221 (pTPA102) (Lys277
→l1e) cells were collected.

Cells were collected by centrifugation at 4000g for 10 min at 4°C, and the supernatant was discarded. cell pellet, 5mg/
Solution 1 containing mIL lysozyme (50 mM glucose, 25 mM Tris-HCl (pH 8,0), 10
Aqueous solution containing mMEDTA? ri) resuspended in 20 mft and left at room temperature for 5 minutes. Next, lysozyme-treated cells were treated with solution 2 (0,2N NaOH and 1% SOS).
Water-soluble containing? r! i.) 40 mL was added and the solution was gently mixed by inversion. The mixture was left on ice for 10 minutes.

Glacial acetic acid 11.5 mJ2. and water 28.5 mJ2 to 5M
Potassium acetate solution (pH 4,8) 60 If plus 30 ml of water-cooled vinegar m buffer prepared above was added to the mixture above and mixed by inversion. The solution was left on ice for 10 minutes and centrifuged in Tommy Seiko No. -4N-If (or its equivalent) at 2G, OOOrpm, 4°C for 20 minutes. Host DN^ and debris formed a pellet at the bottom of the tube. Approximately 72 mJl of supernatant liquid was collected, and O,a volume of isopropanol was added, mixed, and left at room temperature for 15 minutes. Plasmid DN^ was collected by centrifugation at 11,000 g for 15 minutes at room temperature. The supernatant was discarded and the DNA pellet was washed with 70% ethanol at room temperature and decanted. The pellet was dried in a vacuum dessicator and resuspended in 8 ml of TE buffer [10mM)'LiCl(+)H7,5) and 1mM EDTA].

18 g of CsC was added to the DNA solution. 10a+g/
An aqueous solution of mJZ ethidium bromide for 7 days was added to each 10 mu of CsC1-DNA solution. The final density of the solution is approximately 1.55
g/mlL, ethidium bromide concentration is approximately 600μg/+
nJ! Met. Transfer the solution to a Beckman VTi65 centrifuge tube, fill to the top, seal, and incubate for 50 minutes. OOOr
p.m.

Centrifugation was performed at 20°C for 12 hours. After centrifugation, two DNA bands were visible under normal light. A syringe with a #21 hypodermic needle was inserted into the side of the centrifuge tube to collect the lower DNA band. The recovered DNA solution was extracted several times with 5M NaCl saturated isopropanol to remove ethidium bromide. CsC1 was removed by dialysis against TE11 buffer. Plasmid pTPA102 (Lys277-I
Le) About 1 mg was obtained. This was stored at 4°C.

Viable plasmid pTPA102 (Lys277-11e)
Approximately 50 μg was added to 100 mM NaCl, 50 mM Tris-HCl (pH 7,5), 10 mM MgCh, 7
Restriction buffer A1 consisting of mM 2-mercaptoethanol
37 by restriction enzyme Bg11130 units at 00μ℃
Digested for 2 hours at ℃. DNA was concentrated by ethanol precipitation and electrophoresed on a 0.8% agarose gel. 19
A 74 bp raw II fragment (its DNA sequence is shown in FIG. 4) was visualized and recovered in the same manner as in Example 5A.

B, Ligation and E, Transformation of [1)+1 Approximately 0.8 μg of plasmid 9MI200 was digested with Gloss 31+130 units in restriction enzyme buffer A at 40 μ°C for 2 hours at 37°C to prepare linear DNA. The linearized plasmid was precipitated with 2.5 volumes of ethanol in the presence of 0.3 M sodium acetate, and the DNA was collected from centrifugation @C. The DNA pellet was mixed with water at 94 μC, alkaline phosphatase (250, QL (T/RNR,; Takarashu Co., Ltd.) at 1 μC, and 1M Tris-HCI (pH 8,0).
Resuspended in 5μ°C and placed at 37°C for 1 hour. D
NA was mixed with a (1:1) mixture of phenol and chloroform and a (24:1) mixture of chloroform and isoamyl alcohol.
1) After extraction with the mixture, precipitate with ethanol, and add 20% water
Resuspend in μ°C. This dephosphorylated pMI 2007
ul (approximately 200 ng) of 1974 bp 11 fragments 2 μft (approximately 10100 n, 5x ligation buffer 7
Night [330IIIM Tris-1 (C1 (pH 7,5),
33 mV MgCl2.50mM 2-mercaptoethanol, 2.5mM ATPI 3μIt, T4DN
A ligase was added at 1 μm and water at 2 μ°C. The reaction mixture was partially incubated at 14°C.

The ligation mixture was used to transform E. colt DHI as in Example 5D, resulting in E. c.
oli DHI (pMI 205) transformants with their ampicillin resistance phenotype and their plasmid D
It was identified by analysis of NA with several restriction enzymes. Plasmid pMI 205 was isolated from one of the transformants as in Example 3.

Plasmid pR5Vneo8T (:CNo, 3719
Approximately 13 μg of 8 was added to restriction enzyme H in restriction buffer A at 50 μC.
indII+ 30 units and restriction enzyme Ram II
Digested at 3 ox position for 2 hours at 37°C. Digested plasmid DNA was run on a 1% agarose gel, and the gel was stained with ethidium bromide and visualized with long wave Uv light. Large old ndlll-Bam H1 restriction pieces were cut out and frozen at -80°C for 20 minutes. Freeze-thaw method (Th
Uring et al., 1975, Anal, Bioche
m, 66, 213).
．． The DNA was precipitated with 5 volumes of ethanol-0.3M sodium acetate and collected by centrifugation. The pellets were dried in vacuo and resuspended in 20 μm dry distilled water.

B, approximately 2.1 kb of plasmid MI205)Iind
Isolation of Ill-Ram) II Fragment Approximately 30 μg of plasmid 9MI205 was mixed with restriction enzymes Hind Ill and BamHI in restriction buffer A at 30 μg each.
．． 4! The - position allowed for complete digestion at 37°C. This resulted in two DNA fragments with sizes of 2.7 kb and 2.1 kb. Prior to running on a 1% agarose gel, DN
A was precipitated with ethanol. Hind of about 2.1kb
The lrl-BamHI band was visualized, excised, and collected as in Example 5A.

C, 1100n of each of the above fragments obtained in Ligation Examples 58 and 5B were added to 66mM) Lis-〇(:l (p147.5), 8.
20μ of reaction mixture containing 6mM MgCl2, 10mM 2-mercaptoethanol and 0.5mM ATP
In A, T 4 DNA ligase (350,000 units/
Ligation was carried out at room temperature for 4 hours using a temperature of 1 μC (Takara Shuzo Co., Ltd.).

D, E, calf HBIOI) The resulting ligation mixture was used to perform VSimanis, DN
A. Cloning Vol. 1, IRL Press, Oxford, Washington DC (1985).
Plate (1% Bactodributon, 0.5% yeast extract, 0.5% sodium chloride, 1.5% agar, pH 7.5
) was then transformed into colt HBIOI.

Transformants were determined by their ampicillin resistance phenotype as well as by 2. Identification was made by analysis of the restriction enzyme cleavage pattern of the plasmid DNA, including the presence of the Okb 933 I+ fragment. Using the resulting cells, plasmid psT104 was transferred to Hayabusa, @Shiri in the same manner as in Example 3.

Example 6 Construction of plasmid 5T105N Fuji Plus pSV2dhfr ATCC No. 3714
Approximately 50 ug of BamHI were completely digested for 2 hours at 37° C. using 100 μL each of Jl buffer A and 30 JSL each of BamHI. DNA was concentrated by ethanol precipitation and electrophoresed on a 1% agarose gel. A fragment of approximately 0.9 kb was visualized and recovered as in Example 5A.

B. Ligation and E. coli HBOI
Approximately 0.6 μg of the conjugated plasmid psT104 was added to restriction i serum A.
40 μj! 2 at 37°C with 30 units of BamHI.
After time digestion, linear DNA was prepared. The linearized plasmid was precipitated with 2.5 volumes of ethanol and 0.3M sodium acetate, and the DNA was collected by centrifugation.

The DNA pellet was mixed with water at 94μ℃ and 1μ of alkaline phosphatase solution (250 units/ff1fL: Takara Shuzo Co., Ltd.).
°C and IM) Lis-) ICI (p) 113.0)
Resuspended in 5 μC and placed at 37C for 1 hour, DN
A was mixed with a (1:1) mixture of phenol and chloroform and a (24:1) mixture of chloroform and isoamyl alcohol.
) mixture, precipitated with ethanol, and diluted with 20μ of water.
Resuspend in °C. This dephosphorylated psT104 7
u fl (approximately 200 ng) was added to the LL obtained in Example 6A.
! II-Ram old fragment 2μfL (approximately 10100n
, 5x ligation buffer (containing ATP) 3μA%
T4 DNA ligase was added to a mixture of 1μ°C and water at 2μ°C. The reaction mixture was partially incubated at 14°C.

Similar to Example 5D, the ligation mixture produced E. E.coli HBIOI was transformed and the resulting transformant E.coli HBIOI was transformed. colt) IBIOI (psT105)
were identified by their ampicillin resistance phenotype as well as old ndlll-BamHI restriction enzyme analysis of their plasmid DNA. Plasmid psT105 was isolated from one of the transformants in the same manner as in Example 3.

C. Isolation of 5T105 NarI-5acI fragment Approximately 10 μg of plasmid ps7105 was mixed with 19+nM)-
Lis-HCl ('pH 7, 5), 10 IIIM
In 50 μl of restriction buffer C containing MgCl2, 1 mM DTT, 20 units of restriction enzyme NarI and 5
Complete digestion was performed with ac110 units at 37°C. The digested plasmid DN^ was run on a 1% agarose gel, the gel was stained with ethidium bromide, and the DNA bands were visualized under long-wave UV light. The large NarI-5acI fragment was excised and recovered as in Example 5A.

D, approximately 0.9 kb Narl- of plasmid TP^21
Approximately 10μ of plasmid pTPA21 containing the DNA sequence encoding the JIL-isolated 5acl fragment of native t-PA and part of the 3°-noncoding region.
g was digested to completion with 120 units of restriction enzymes Mar and 110 units of 5ac in restriction buffer C at 37°C. After concentrating the DNA by ethanol precipitation, it was applied to a 1% agarose gel. Approximately 0.9 as in Example 5A
The kb Narl-5acI band was visualized, excised, and collected. (D of NarI-5acI fragment
The NA sequence is shown in Figure 8).

E. Ligation and E. colt HBIOI
of each of the above fragments obtained in Examples 6C and 6p.
n was ligated with T4 DNA ligase (350,000 cells/ff11; Takara Shuzo Co., Ltd.) in a 20μj2 reaction mixture for 4 hours at room temperature. The ligation mixture was determined as in Example 50 and then colt
HBOI was transformed. Transformants were identified by their ampicillin resistance as well as restriction enzyme analysis of plasmid flNA. Using the obtained cells, plasmid ps7105N was isolated in the same manner as in Example 3.

20 μg of ps7105N was digested with restriction enzyme position 15 in 50 μl of Restriction M solution for 4 minutes at 37° C. after preincubation to achieve only partial digestion as examined by gel electrophoresis analysis. Concentrate the DNA by ethanol precipitation and add 150mM NaCl,6
mM Tris-HCl (pH 7,9), 6mM Mg (:
L, 6mM 2-mercaptoethanol and 100
Restriction enzyme 5al containing BSA of Atg/mj2
Resuspend in I buffer at 50 μC and add 20 units of 5al
Added I. The reaction was carried out at 30°C for 2 hours. DNA was concentrated by ethanol precipitation and 30mM sodium acetate (
pH4,6), 50mM NaC11mM ZnC!
, and resuspended in mung bean nuclease buffer containing 5% glycerol. The reaction mixture was incubated at 37°C for 3
After incubation for 0 min and extraction with a (1:1) mixture of phenol and chloroform and a (24:1) mixture of chloroform and isoamyl alcohol, the DNA fragments were precipitated with ethanol and resuspended in water at 2° μC. did.

B. Approximately 50 ng of the above DNA fragment obtained in Ligation Example 7A was added to 66 m
M) Lis-HCI (pH 7,5), 6.6mM Mg
Cl2.1°1M2-mercaptoethanol and 0.
A reaction mixture containing 5 mM ATP was incubated at room temperature for 4 hours using 350 units of ligase (Takara Shuzo Co., Ltd.) at 20 μC.
Time self-ligated.

Using the above ligation mixture of C, E, colt 8B101, Nishite, Dan,
The coil HBIQI was transformed.

The transformation mixture was transformed into L containing 50 μg/afL of ampicillin.
Brated onto the plate. Transformants were identified by their ampicillin resistance phenotype as well as by lll-5all restriction enzyme analysis of their plasmids. From one of these transformants, pST106 was produced as Sat in the same manner as in Example 3.

Ta.

Kojiri! Plasmid pSV2dhfr ATCC No. 371
Approximately 10μg of 45 was added to restriction enzyme H4ndll! in 50μ2 of restriction enzyme solution A. 20 units and restriction enzyme BamH1
Digested with 10 units for 2 hours at 37°C. Digested plasmid DNA was run on a 1% agarose gel, and the gel was stained with ethidium bromide and visualized with long wave Uv light. Big Hindll! -Bam HI restriction fragment was excised and recovered as in Example 5A.

B, ca. 3. of plasmid 5T106. Okb Hindl
IT-Bam HI Dan, colt HBIOI to J
Approximately 10 μg of ILI11 plasmid psT106,
Complete digestion was carried out at 37°C with 20 units of the restriction enzyme old n dllI and 110 units of the restriction enzyme BamH in a restriction Ni buffer solution. Before applying to 1% agarose gel,
DNA was precipitated with ethanol. Approximately 3. Okb ■
The Niwall-Shi band was visualized, excised, and collected in the same manner as in Example 5^.

C. 1100 n of each of the above fragments obtained in Ligation Examples 8A and 8B were treated with T 4 DNA ligase (350 n) in a reaction mixture at 20 μC.
,000i/ll1i; Takara Shuzo Co., Ltd.) 0.5μ℃
was used for 4 hours at room temperature.

Transformation of D, E, cal (Hllol) using the above ligation mixture as in Example 5D,
E. coli HBIOI was transformed. The transformation mixture was plated onto L plates containing 50 μg/raft ampicillin. Transformants were evaluated for their ampicillin resistance phenotype as well as for their plasmid BJiI.
I-Bam was identified by restriction enzyme analysis. From one of these transformants, plasmid I) ST102 was isolated as in Example 3.

Approximately 5 μg of plus 419MI205 was added to limit 11L buffer solution A.
The mixture was completely digested at 37°C with the restriction enzyme Ram [10RL]. Plasmid pMI205 contains a single Ra
Since the mHI site is present, this Ram HI-digested pM
Linear ON8 is generated by I205. Baf
The f1H1-digested pMI205 was precipitated with ethanol, and 94 μA of water was added to the alkaline phosphatase solution (position 2504/
lλ; Takara Shuzo Co., Ltd.) 1μ℃ and 1M Tris-HC
resuspended in 5 mfL (pH 8,0) and 37
℃ for 1 hour. The DNA was extracted with phenol and chloroform (a t:B mixture and a (24:1) mixture of chloroform and isoamyl alcohol), then ethanol precipitated and resuspended in water at 30 μC.

B, ligation and E, colt HBOI
About 1100 each of the above fragments obtained in Sharkfish Examples 6^ and 98
n was ligated with T 4 [ISA ligase at position 1754 in 20 μA of reaction mixture for 4 hours at room temperature. The ligation mixture was then used to transform Mi. as in Example 5D. Transformants were identified by their ampicillin resistance phenotype as well as restriction enzyme analysis of plasmid ON^. Using the obtained cells, plasmid psT101 was isolated in the same manner as in Example 3.

C. Approximately tμg of plasmid psT101 was added to 50mM Na
C1゜10IIM Tris-HCl (pH 7.5),
Limiting M loading solution B consisting of 10mM MgCh, 7mM 2-mercaptoethanol 20μ4! The DNA was digested with the restriction enzyme old nd HT at 37°C to prepare linear DNA. Linearized plasmid was added to 0.3M
I) NA was collected by precipitation with 2.5 volumes of ethanol in the presence of sodium acetate and centrifugation. Add the DNA pellet to the nick trans L/-cyan loading solution (50 m
M Tris-14CI, PH7, 210mM Mg
SO4, 0, 1mM DTT, 50 μg/L
IIA BSA) 40μ resuspended each dNT into
P (5mM dATP.

dTTP, dCTP, clGTP) and 2 units of Klenow fragment (Takara Shuzo Co., Ltd.) were added. The reaction was carried out at room temperature (20°C) for 30 minutes and stopped by heat treatment at 65°C for 10 minutes. History I linker (5゜-CG
GTACCG-3°, New England Biolabs) 1μ°C, 70mM Tris-HCI (7,6).

10mM MgCh, 5mM DTT, 0.5
Phosphorylation was performed using polynucleotide kinase (New England Biolabs) 20JIL in mM ATP at 20 μC. Phosphorylated Kpn I linker-1
0 μg and the blunt-ended old n d II! Fragment 1μ
g was ligated using T 4 DNA ligase position 350411 in the reaction mixture at 20 μC. Combitent E, coli H using the ligation mixture
BIOI cells were transformed. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis. Using the obtained cells, in the same manner as in Example 3,
Plasmid psT101-K was isolated.

Approximately 1 μg of plasmid psT101”K was added to restriction buffer A.
Linear DNA was prepared by digestion with Ram HII O units at 37°C for 2 hours in 20μ°C. The linearized DNA was concentrated by ethanol precipitation. The DNA was resuspended in 40μ square of nick translation buffer, and each dNTP (5mM dATP, dTTP, dCT
P.

dGTP) 1μ℃ and Klenow fragment (Takara Shuzo Co., Ltd.)
The 0 reaction was carried out at room temperature (20° C.) for 30 minutes, and was stopped by heat treatment at 65° C. for 10 minutes. Kpn I linker (5°-
CGGTACCG-3' (manufactured by New England Biolabs) was phosphorylated and a blunt-ended Ram H1 fragment was ligated. The ligation mixture was used to transform competent E, colt HBIOI tal cells. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis. Using the obtained cells, the plasmid ps was produced in the same manner as in Example 3.
T101-2 was isolated.

B, approximately 3.0 kb K in plasmid psT101-2
Approximately 5 μg of the nI fragment was added to the ecological plasmid psT101-2 in Shiko Yugai solution (6a+M NaCl, 6mM Tris-HCl, p
)17.5, 6mM MgCh, 6[IIM
2-mercaptoethanol) at 50μ℃, restriction enzyme 臘1
20! # was further digested at 37°C for 2 hours. DNA
is concentrated by ethanol precipitation, then 0.1% for preparative
Applied to agarose gel. Approximately 3. The Kpn and I bands of Okb were visualized and cut out in the same manner as in Example 5^.
Recovered.

C. Construction of plasmid psT103 To construct psT103, plasmid pKsV1
Approximately 2 μg of 0 (Pharmacia P-L Biochemicals) was digested with restriction enzyme history 1 and treated with bacterial alkaline phosphatase (
Takara Shuzo Co., Ltd.) was used for dephosphorylation at 65° C. for 2 hours. The linearized pKsVIO fragment was ligated to the approximately 3.0 kb history fragment isolated in Example 10B as in Example 5D.

In the same manner as in Example 5D, the plasmid psT103 was first used to transform ■li HBIOI, and the resulting Eco
lt HBIOI (psD103) transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of their plasmid DNA. Plasmid psT103 was isolated from one of the transformants.

Plasmid pdBPV-MMTneo ATCCNo,
Approximately 1 ag of 37224 was added to Bam HI buffer (150
n+M Na(:l, 6mM f-Lis-HCl, pH
7,9,6mM MgC1z) 50 all, restriction enzyme Bam)11. It was completely digested at 37°C by the f1 position.

Bam ) II digested pdBPV-MM neoneo was precipitated with ethanol and resuspended in water at 20 μC.

B, ligation and E, coli HBIOl
(approximately 1 μg of DNA obtained in Example 11A above was transferred to Example 5
Self-ligated in the same manner as C. Using the ligation mixture, F-, co
li HBIOI was transformed. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of plasmid DNA. From one of the transformants, plasmid pMMTneo was generated in the same manner as in Example 3.
of! IL1! I did 111.

Approximately 5 μg of plasmid pMMTneo was added to B10 IN buffer (150mM NaCl, 10mM)-Lis-○C.
I, pH 7, 5, 10mM MgC1□, 10III
M2-Mercaptoethanol) Restriction Enzyme Engineering II 50j1. Complete digestion was performed at 37°C.
DNA was precipitated with ethanol.

B, Klenow blunt end of Bil+ end Example 9A above
The engineered II digested product of pMMDingneo obtained in
O3, +1.1mM DTT, 50ug/m
j! BSA, 0.5mM dATP.

Klenow fragment 1. in a mixture of 0.5mM dGTP, 0.5mM d[:TP and 0.5mM dTTP. The ends were made blunt by the @ position.

The reaction mixture was incubated at 20° C. for 30 minutes and then the reaction was stopped by heat inactivation of the enzyme. DNA
was recovered by ethanol precipitation.

C. Isolation of MIAT promoter deletion Example 9 above
The DNA obtained in B was digested with 50 units of restriction enzyme Ram ) II in 50 μu of restriction buffer A for 1 hour at 37°C. Ethanol precipitation (thus concentrating the DNA to 4.3kb
fragment as in Example 5A! #Removed and collected.

D, about 3. Isolation of Okb t-PA cDNA-containing fragment Approximately 10 μg of plasmid psT106 was transferred to )lindll
1M bombardment (60mM NaCl, 7mM Tris-HC
l, pH7,5,7mM Mg1l:h) 20
Complete digestion was carried out at 37°C with restriction enzyme H1ndlll 100@ in 0 u fl. The DNA was ethanol precipitated and blunt-ended as in Example 9B. DNA was recovered by ethanol precipitation, resuspended in Ram Hr buffer 50 AtIl, and injected with the restriction enzyme Bam HI.
Digested with 20 units for 1 hour at 37°C.

The DNA was concentrated by ethanol precipitation to approximately 3;
The fragments were collected in the same manner as in Example 58.

E6 ligation and E, colt) 1810
1 of each of the fragments obtained in Examples 9C and 9D above.
n in 20 μm of the reaction mixture, T4D? Ligation was performed using 175 units of l^ligase for 4 hours at room temperature. E as in Example 5D using the ligation mixture.
, coli HBIOI was transformed. Transformants were identified by their ampicillin resistance phenotype and restriction analysis of plasmid DNA. Plasmid psT112 was produced in the same manner as in Example 3 using the obtained cells.
was isolated.

Plus main de psT112 about 5 μg, limit & 1 shock liquid 5
Complete double digestion was carried out at 0 .mu.C with restriction enzymes 20-1 and Sal I at position 20-1. After phenol-chloroform extraction, DNA was precipitated with ethanol.

The Ban Hl-5al I digestion product was blunt-ended with 2 units of DNA polymerase I Klenow fragment as in Example 9B. DNA was recovered by ethanol precipitation. Approximately 1100 n of blunt-ended DNA was self-ligated as in Example 5C. E, c as in Example 5D using the ligation mixture.
olt HBIOI was transformed. Transformants were identified by their ampicillin resistance phenotype and plasmid DNA.
identified by restriction analysis. From one of the transformants,
Plasmid psT118 was injected into IL in the same manner as in Example 3.
It was 11i.

Approximately 5 μg of plasmid psT112 was added to restriction buffer^50
In μl, restriction enzyme 10J1. Complete digestion was performed at 37°C. This Bam II digestion results in a linear [INA
Generate pieces. Bam) II digested psT112 was precipitated with ethanol, and 94μA of water was added with alkaline phosphatase (25OJIL/111π; Takara Shuzo Co., Ltd.) 1
μ angle and 1M Tris-)ICI (pHa, o) 5
It was resuspended at μ°C and left at 37°C for 1 hour. Then, after extraction with a (1:1) mixture of phenol and chloroform and a (24:1) mixture of chloroform and isoamyl alcohol, [lN^ was precipitated with ethanol. It was re-precipitated in water at 30 μC.

B, Ram of plasmid dBPV-MMTneo)I
Plasmid pdBPV-MMTneo ATCC isolated from E. coli HBIOI
Approximately 5 ug of No. 37224 was added to restriction enzyme Ram H1 in solution A at 20 positions and ± I20 units to 37
Digestion was completed at ℃. Pvu I digestion removes unwanted recombinants. I) N^ was precipitated with ethanol and resuspended in water at 30 μC.

C, ligation and E, coli) IBIO
Approximately 1100 n of each of the fragments described in Examples 14 and 14B above were added to T 4 in a reaction mixture at 20 μC.
Ligation was performed using DNA ligase 175 at room temperature for 4 hours. Using the ligation mixture, Example 5D
E-, colt) i8101 was transformed in the same manner as described above. Transformants were identified by their ampicillin resistance phenotype and restriction analysis of plasmid DNA. Using the obtained cells, plasmids psT1137 and psT1138 were isolated in the same manner as in Example 3.

Approximately 2 μg of Plusyodo 9UC9 (Pharmacia P-L Biochemicals) was added to restriction enzyme Hl n in restriction buffer B.
Digestion with dIII at 37°C generated linear DNA. The linearized plasmid was precipitated with 2.5 volumes of ethanol in the presence of 0.3 M sodium acetate and D
NA was collected by centrifugation. ■What III of pUc9
Digests were blunt-ended using 1 unit of Klenow fragment in nick translation buffer at 20°C.
for 30 minutes and then stopped by heat inactivation of the enzyme. DNA was recovered by ethanol precipitation. 8gll
The l linker (5°-CAGATCTG-3°; Takara Shuzo Co., Ltd.) was phosphorylated and ligated to the blunt-ended ■nd III fragment in the same manner as in Example 9C. The ligation mixture was used to transform E. coilHBIOI as in Example 5D. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis. Plasmid psTO2 was isolated from the transformant in the same manner as in Example 3.

Approximately 5 μg of plasmid psTO2 was added to 5 mM)-Lis-H
C:j2(1)H7,1), 5mM MgCh,
Restriction enzyme Bbe in Bbe I buffer containing 2mM 2-mercaptoethanol, 0.01% BSA at 50 μC.
Complete digestion was carried out with 20 units of I at 37°C. DNA was recovered by ethanol precipitation, resuspended in 50 μm of restriction buffer A, and completely digested with restriction enzyme type I+ at position 1011 at 37°C. The digested plasmid DNA was run on a 1% agarose gel, and the large mI-■+1 band was excised and collected in the same manner as in Example 5A.

B, approximately 330b BbeI of plasmid 5T106
- Isolation of Bbe I1+ fragment Approximately 20 μg of plasmid psT106 was added to Bbe I1
Restriction enzyme BbeI20 in 100μJ2! Complete digestion was performed at 37°C. DNA was recovered by ethanol precipitation and resuspended in Restriction Buffer A at 100 μC.
Complete digestion was performed at 37°C with 20 units of restriction enzyme type I+. After concentrating the DNA by ethanol precipitation, 1.
It was run on a 5% agarose gel. BbeI of approximately 330 bp
- Visualizing the nymph TI band as in Example 5A,
It was cut out and collected.

C, ligation and E, Co11) 1810
Each of the fragments described in Examples 16A and 16B above has approximately iQO
Each ng was ligated with a 20μjQ reaction mixture using T4 DNA ligase (350,000i/II1.Q; Takara Shuzo Co., Ltd.) at 0.5μ°C over 4 hours at room temperature. The ligation mixture was used to transform E. coli HBIOI as in Example 5D. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of plasmid ON^.

Using the obtained cells, plasmid 9ST107 was imtated in the same manner as in Example 3.

Example 17 Isolation of Pieces Approximately 20 μg of psT107 was added to 100 mM NaCl,1
0mM)-Lis-○CI (pH 7,5), 1001M
Restriction enzyme ± I4 in mI & IL solution 100 μC containing MgCl2.10 + aM2-mercaptoethanol.
Digestion was performed for 5 minutes at 37° C. after preincubation to achieve only partial digestion with 0 units as determined by gel electrophoresis analysis. The DNA was concentrated by ethanol precipitation and run on a 1% agarose gel.

An approximately 2.1 lkb fragment of psT107 was excised and recovered as in Example 5A. The recovered DNA was completely digested with restriction enzyme Pst I at 37°C in a restriction buffer at 8100μ°C. The DNA was reduced by ethanol precipitation and then applied to a 1% agarose gel. Approximately 2.7
The kb engineering I-technical band was cut out and collected in the same manner as in Example 5A.

B, Construction of mTPAI PstI-5sI 75 named mTPAI in the finger domain region
The 7- and 79-mers were transferred to a BS 380 DN 8 Synthesizer (Abride Biosystems, Inc., 850 Lynn Center Drive, Foster City, 944 C.
4). Approximately 1100n of each of the above synthetic deoxynucleotides was added to 68mM t-lis-11CI (
pH7.5), 6.6mM MgCl2.10011
Phosphorylation was carried out for 1 hour at 37°C in a reaction solution containing 112-mercaptoethanol, 0.5d8TP, and 5 units of T4 polynucleotide kinase at 20μ°C.

Each reaction mixture was combined and heated at 95° C. for 5 minutes and slowly cooled to room temperature over 2 hours on a water bath to allow both mirrors to anneal to yield mTP81 pieces of formula; 7S. Ma-: 5°-GCG person TGAGACGC
AG person TGAT person TACCAGCAACATC person GTC
Person TGGCTG79 Ma -・3°-ACGTCGCT Person CTCTGCGTCTACTATATGGTCGTTG
TAGTCAGTACCGACGACCCTCTCCT
CGAGAGCAACGAGGTGG eight people T-3゛CT
GGG people
ccTT-5C, ligation and E, col
About 1100 n of each of the fragments described in Examples 17A and 17B above were added to T4D in a reaction mixture at 20 μC.
Ligation was carried out at room temperature for 4 hours using N^ligase (350,000 units/ml; Takara Shuzo Co., Ltd.) at 0.5 μC. The ligation mixture was used to transform two HBIOI cells as in Example 5D. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of plasmid DNA. Using the obtained cells, plasmid ps was produced in the same manner as in Example 3.
T108 was isolated.

Approximately 10 μg of plasmid psT11B and plasmid psT11B were incubated at 37°C with 120 units of restriction enzyme Bbe in 50 μu of Bbe I buffer.
It was completely digested. The DNA was recovered by ethanol precipitation, resuspended in 50 μm of restriction buffer A, and treated with restriction enzyme type II.
20 units were completely digested. The digested plasmid DNA was run on a 1% agarose gel, and the large ±I - output 1
One fragment was cut out and collected in the same manner as in Example 58.

Approximately 10 μg of plus ξ-do psT109 was added to Bbe I l.
37 with restriction enzyme ±120 units in id street solution 50μ℃
Digestion was completed at ℃. DNA was recovered by ethanol precipitation, resuspended in 50 μA of restriction buffer, and treated with restriction enzyme LL.
Digestion was complete with 20 units of L II at 37°C. D
NA was concentrated by ethanol precipitation and then applied to a 1.5% agarose gel. BQ II-B of approximately 330 bp
The beI hand was visualized and collected as in Example 5^.

C. ligation and E. coli HBOI
Approximately 1100n of each of the DNA fragments obtained in Examples 18A and 18B above were added to T4D in a 20μ2 reaction mixture.
Ligation was performed using 175 units of NA ligase for 4 hours at room temperature. Using the ligation mixture, Example 5D
E. colt HBOI was transformed in the same manner as described above. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of plasmid DN^.

Plasmid DNA was analyzed using the obtained cells.

The mutation region of the novel t-PA cDNA in the plasmid DNA was detected using the Mlff Sequencing Kit (Amar-Jam).
This was confirmed by sequencing them using the dideoxynucleotide chain termination method. Using the obtained cells, 5 ml of plasmid psT119 was produced in the same manner as in Example 3.

Example 19 Preparation of M13mp8 RF DNA A single plaque of M13mp8 phage (sold by Amerjam) was taken in 2XTY broth 1.5+nJZ, and E.
A night culture of E. coli JM103 (sold by Amerjam) at 15 μC was added. The culture was incubated for 6 hours with shaking at 37°C. The cells were collected by centrifugation, and the culture supernatant f 1afe was added to 8 ml of overnight culture of shellfish JM103 and 4 ml of 2XTY broth.
00 mft. Cultures were incubated for 6 hours with shaking at 37°C. Cells were harvested by centrifugation and treated with R as in the alkaline method described in Example 3.
F DNA *mt.

Approximately 1 μg of Dansei plasmid psT106 was added to 5 mM Tris-M.
CI (pH 7,1), 5mM MgCl2.2mM
A mixture of 2-mercaptoethanol and 0.01% BSA was incubated at 37°C with 5 units of restriction enzyme in 10μ°C.
I spent time. The reaction mixture was supplemented with 1M Tris-MCI (p
H7,6) and restriction enzyme EcoRI 5 units, and
Incubation continued for 3 hours at 7°C. The reaction mixture was extracted with a (1:1) mixture of phenol and chloroform, and the aqueous layer was extracted with 0.1 volume of 3M sodium acetate (p
H5,2) and 2 volumes of ethanol. The recovered DNA was washed with 75% ethanol and diluted with 10mM Tris-1+ (:1(pl(7,5) and 1mM ED).
TA was dissolved at 5 μC.

B. Ligation and E. Approximately 1 μg of M13mp8 RF DNA of coli JM103 was transferred to Example 2O.
Digested with Bbe I and EcoRI as in A. The resulting 6,9kb BbeI-EcoRI restriction fragment was purified with 10mM 5tgCl 2.10mM DT.
T, 1mM ATP, 50ug/m, i! B.S.A.
and 350 mM Tris-MCI (pH
7,8) 284b from psTloB at 10 μC
It was ligated with the EcoRI-BbeI fragment of p. Using the ligation mixture, a combinant E,...
colt JM103 and transfectants were expressed in X-gal (5-proso-4-chloro-3-indolyl-β-galactoside) as well as their colorless plaque phenotype as well as their phage double-stranded D
NA (i.e. M13mp8fu3 RF DNA)
Identified by restriction enzyme analysis.

In this example, oligonucleotide-directed mutagenesis was performed using Fr1tz, DNA Cloning 1.1.
51 (1985), IRI Press.

A, -terminal strand M13m8f ejected DNA OA%M13mp8
A single plaque of fu3 phage was placed in 2XTY broth 1
．． For 5mJ2, this includes E, coliJMIQ
Some cultivation of 3! ! This overnight culture with the addition of 15μ℃
To ensure retention of F shrimpsomes that also carry ro^B, they were inoculated from minimal medium stocks. Culture at 37°C
The cells were incubated for 6 hours with shaking. Cells were harvested by centrifugation, and the culture supernatant 1 rni was added to 2XTY with 8 rails of JM103 overnight culture.
Broth 400mjZ was inoculated. Cultures were incubated for 6 hours with shaking at 37°C. The supernatant was collected. 80 m square of 20% polyethylene glycol 6000-2.5M NaCl was added to the supernatant at 400 °C, and the solution was shaken and left for 1 hour. 8900g of solution,
Centrifugation was performed at 4°C for 30 minutes, and the supernatant was discarded. The phage pellets were transformed into IoolM)-Lis-1 (C1 (pH 7)
,5) - suspended in 20 mJZ of 1mM EDTA and 1 with 20mu of phenol saturated with 10mM f-lis-)ICI (ph 7.5) and 1mM EDTA.
Extracted for 0 minutes. The solution was centrifuged at 9000 g and 20° C. for 10 minutes, and the aqueous layer was collected. 3M sodium acetate (p
H5,2) 2 mfl and 50 mJ2 of ethanol were added, and the resulting solution was left at 20° C. overnight. 11,
-Terminal strand DNA was collected by centrifugation at 000g and 4°C for 10 minutes. Discard the supernatant and remove the DNA pellet
Washed with 0% ethanol and dried in vacuum dryer for 5 minutes. Next, the pellet was treated with TE: (i [10 mM Tris-HCl <pH 7,5) and 1 mM EDTA]
1 of.

M13mp8 RF DNA 2011g, 60mM
NaC1.

10mM Tris-HCl (pH 7,5), 10mM
M, JB (:l, 6mM 2-mercaptoethanol,
Restriction enzyme P in 200 μn of 100 μg/mouth 2BS^
Digested with 50 units of Vull at 37°C for 3 hours. After ethanol precipitation and IR, the digested DNA was dissolved in TE buffer solution at 0μ℃ and diluted with 10mM using Sephacryl S-1000.
Tris-14C1 (pH 7,5), 1 mhl EDT
It was separated by gel filtration with elution using a mixture of A and 2QOmiA Mail. M13mpHRF
Purification of DNA The eluate containing the 6.8 kbp PvulI fragment was identified by 0.8% agarose gel electrophoresis and collected.

M13mp8fu3 Ichiki giDNA 60 tt g
6.8kb of the collected M13mp8 RF DNA
The Pvull fragment was added and the mixed DNA was precipitated with ethanol. DNA pellets in 150 mM NaC
1 and 15mM sodium citrate were dissolved at 200μC. The DNA solution was boiled for 7 minutes, transferred to a 65°C water bath for 10 minutes, and cooled on ice. Gap DN that occurred
A was resolved by gel'aA using Sephacryl S-1000 as described above. D with this gap
NA was used as a template in the mutagenesis examples below.

C1 site heterogeneous attraction 5°-G (:(:CAGCTCGAGGGCGTCTG
GCTCCTCCCCCGf; TG Ding AGGGGCTCCT
An oligonucleotide having the sequence GGGC-3' (48-mar) was synthesized. This was designed to make the desired amino acid substitutions and create an Xho1 site.

This 48-mer was phosphorylated with ATP and T4 polynucleotide kinase as in Example 4B. Gap DNA 1100n and phosphorylated 487-10
ng and 150mM KCI and 10mM Tris-
10 μm of reaction mixture containing HCl (pH 7,5)
After annealing at 65°C for 7 minutes, the film was cooled to 4°C. The annealed gap DNA was treated with 80mM KCI,
30mM Tris-MCI (pH 7,5), 15m
MMgC1, 2mM DTT, 0.5mM ATP
Klenow fragment (0,
5 units) and T4 DNA ligase (looJL position), the mixture was incubated for 2 hours at room temperature and a competent E, cal
l Used for transformation of JM103. Phage RF was obtained from 48 of the transfectants as described above.
DNA was prepared and digested with restriction enzyme XhoI. Two preparations of phage RF DNA contained the desired single Xho1 site. Using one of these phages, Example 1
M13mp8fu4 DNA was isolated in the same manner as in 9.

Approximately 10 μg of 1 liter M13IIlp8fu4 RF DNA,
Restriction enzyme ± I in 50μ solution of 5IIIM Tris-HCl (pH 7,1) containing S mM MgCh, 2mM 2-mercaptoethanol and 0.01% BS^
Digested with 20 units for 4 hours at 37°C. DNA was recovered by ethanol precipitation and 50 mM NaCl,1
00mM)-Lis-HCl (pH 7,5), 5m
MMgCl, and 0. 50 μ2 of solution containing O1% BSA
resuspended in
Digested for 2 hours at ℃. The digested DNA was concentrated by ethanol precipitation and then applied to a 1.5% agarose gel.

In the same manner as in Example 5A, the 284 bp Eco RI-
±I bands were visualized, excised, and collected.

B, ligation and E, coli) 1810
Approximately 10μ3 of commercially available plasmid 9ST11B was added to 5mM JC1.
2,2mM 2-mercaptoethanol and 0.2mM 2-mercaptoethanol. O1
5mM Tris-)ICI (PH7) containing %BS^
, 1) At 50μ℃, limit enzyme ±I20 position 37
Complete digestion was carried out at ℃ for 4 hours. DNA was recovered by ethanol precipitation, 50mM NaCl, 100mM)-
ICI (9) 17.5), 5 [OM Mg
It was resuspended in 50 ttl of a solution containing C1* and 0.01% O5. The DNA was incubated at 37°C for 10 minutes and partially digested with the restriction enzyme EcoRI5 for 5 minutes at 37°C. Immediately add 0.25M EDTA at 5μ℃, concentrate the DNA by ethanol precipitation, and then
．． It was run on an 8% agarose gel. A band of approximately 6.8 kb was visualized, excised, and collected in the same manner as in Example 58. 6.8 kb E from plasmid psT118
co R1-Bbe T fragment approximately 1100n and M13mp
284bp Eco R from 8fu4 RF DNA
500 ng of I-Bbe I fragment was added to 50 mM Tris-HCl (pH
7,8), 10mM MgCh, 20IIIM DT
T, 1 mM ATP and 50 μg/ll1
Ligation was carried out for 12 hours at 8°C in a solution of ll BSA at 20μ°C. Example 5 using the ligation mixture
In the same manner as in D, coll 118101 was transformed. Transformants were identified by their ampicillin resistance phenotype and restriction enzyme analysis of their plasmid DNA. Using the obtained m-cells, plus-dominant pFtl161 was isolated in the same manner as in Example 3.

A3 Kunitachi and Yu L-929 cell line cultures are used in this example;
L-929i cells are available as ATCC #CCL-1. The cells were maintained in DMEM containing kanamycin and 10% (V/V) fetal bovine serum at 37° C. and 5% CO. The cells were plated the day before transformation at a cell concentration of 5 x 10' cells per Vetri dish in Loam.
50-60% confluency was obtained on the day of transformation. The medium was changed 3 hours before transformation. Two 10 cm chicken dishes were used for each transformation.

B, Gorman method [DNA CIoning II, 143 (1
L-929 cells were transformed by the calcium phosphate technique as described in 985), IRLpressl.

Expression plasmid (psT119 or pF0161)
3.

ug and plasmid pSV2neo ATCC No. 3
71493 μg was added to 188 ul of 2M CaClz and 1.3 ml of water. 1.5 ml of l1NA solution
X HBS (1,63%NaC1,1,19%He
pes.

0.04%NaJP04. p) 17, 12) 1
, was added dropwise to 5 ml while bubbling. The mixture was left at room temperature for 30 minutes before contacting the cells.

Transfection of C9 cells 0.6 mj2 of the DNA solution prepared in Example 23B was added to a 10c+++ veterinary dish of L-929 cells with gentle stirring, and heated at 37°C in a CO□ stream for 18 hours. Cells were washed twice with DMEM. Complete fresh growth medium containing 10% FC5 was then added and cells were incubated at 37°C in a CO2 stream for 24 hours. Cells were trypsinized for 300
μg/m fl geneticin
G41B) and 1:10 subculture in selection medium consisting of DMEM containing 10% FC5.

Cells expressing phosphotransferase (neo gene product) can survive in the selective medium and form colonies. Change the medium every 3-4 days and remove one colony.
JIB was released after 2-14 days.

G418-resistant colonies were picked by gentle trypsinization in small cylinders, grown to culture clumps, and tested for secretion of mutant t-p^. cells directly 1
．． Cells were grown to approximately 3 x 10' cells in 7 cm of 3IllIL medium in multi-well plates. The medium was removed and washed with PBS. 0 cells
．． 04mM ZnSO4, 101M Sodium Butyrate, 2
Induction culture medium 1+n consisting of DMEM containing %FC5
f! .

The mutant t-PA in the medium was cultured at 37°C for 24 hours.
Indirect absorption spectrometry using 2251 [Trombosi
sResrarch 31.427 (1983)].

Large number 1 [Purification of aFP^ and aKl-124 Plasmid psT119 or pFI obtained in Example 23]
The mutant proteins aFPA and aKl-124 were purified from the culture broth of the +161-containing L-929 clone. Mutant protein! The first step in It purification is the monoclonal anti-t-P
^Antibody-conjugated Sepharose 4B column (1,6 cm 'x
3 cm) [monoclonal anti-t-PA antibody (preparation method for which is described e.g. by Kais Totom et al., Thrombosis Research 4) according to the manufacturer's instructions.
0.9l-99 (1985)) coupled to NBr-activated Sepharose 4B.
,7X 2.5cm), 0.01% Tween 80
and equilibrated with 0.1 M Tris-HCl containing 10 µU/lli of aprotinin. Through each culture process, the column was washed with 10 column volumes of equilibrated 111 buffer. Desorption was performed using 0.01% Tween 80 and 10 K.
0, 1M containing ltl/call aprotinin
The test was carried out using glycine hydrochloride (pH 2,5). The desorbed fraction was immediately neutralized with IC1M Tris-HCl (pH 9,0) and t
- Those containing PA activity were pooled. The next step of purification was 0.15M NaCl, 0,005% Tween 80
and Affinity chromatography on a benzuagin Sepharose 4B (Pharmacia) column (0,45 x 3 cm) equilibrated with 0,05 M Tris-HCI (pH 8,0) containing 10 KItl/ml aprotinin. Ta. The fractions pooled in the first step were applied to a benzamidine Sepharose column. The column was immersed in I M NaCl, 0,005% Tween 8.
0,05M )-Lis-HCI (pH 8,0) containing 0 and 10 KIU/mJ2 of aprotinin 1
Washing was performed with 0 column volume and wash buffer containing 1M arginine.

Fractions containing t-PA activity were pooled and 0.1M (Nt1
4) Dialyzed against 2cO3, 0.15M Na11, 0.05% Tween 80. The yield of the mutant protein in this operation was determined by the Lowry method.

Show the results at the memorial service.

The plasminogen activator activity of the mutant t-PAs aFP^ and aKI-124 was determined by indirect spectrophotometry [T
hrombosis Research 31.427
(1983)]. That is, various amounts of each mutant t-p^ were incubated with Wi in 50 mM Tris-HCl (pH 8.8) containing 0.1 M sodium chloride and 0.01% (V/V) Triton
The method of man et al. [Cl1n, Chim, ^cta 1
27°279 (1983)], 0
．． 2 μM Human Plus Main Nogen (Midori Juji, Osaka)
1.0.9mM) 1-D-Val-Lau-Lys-p
-Nitroanilide, 28CI (S-2251, BAC
) IEM) and 70 μg/ml solubilized fibrin. The reaction mixture was incubated at 37°C for 3 hours. 4 compared to a blank without activator using a microplate reader (Titertic Multiscan, Flow Laboratories, USA).
Absorbance was measured at 0.05 μm. With reference to the standard curve of natural t-PA8 [international standard (WHO)], mutant t-PA
The plasminogen activator activity [t-P^ international vehicle unit Iυ)] was determined. The protein concentration of the mutant t-p^ was determined by the Lowry method.

Show the results at the memorial service.

(Margins below) 8. In-vivo experiments on half of t-FA a) Suicide animals: All experiments were conducted using Nembutal (50B/kg,
Male Sprague-Dawley rats (2
20-245g).

t-P^: Natural t-PA (single chain, >8
0%) purified recombinant mutant t-p^(fFPA) was obtained in Example 16.

Other materials: aprotinin (Boehringer Mannheim), heparin (Wako Pure Chemical Industries, Japan).

b) Standing: A saline-filled cannula was inserted into the femoral vein of the test animal and t-p^ (100 μg/kg) was injected. A polyethylene tube was inserted into the left jugular IIJ pulse of the test animal, filled with heparin (about 100JIL/mfL), and 1.2.3.5.7.10.15 after t-PA injection.
and at 20 min, sodium acetate (3,2%, w/v)
20 μm and abrotinin ([100(IKII
Blood samples (20oμ°C) were collected in polyethylene tubes containing 50 uA (J/nu). 10 blood samples
．． Plasma was collected by centrifugation at OOQ rpm for 2 minutes. Plasma t-PA levels were determined by t-pA ELISA [e.g., Kais et al., Thrombosis Ras,
40.91 (1985)].

C) Result Show the results at the memorial service.

Expression plasmids psT119 and p obtained in the above examples
FU161 to Escheriehla coli 88
101, and the resulting transformed strain was transferred to Japan 305, which is one of the international depository institutions under the Budapest Treaty.
It was deposited on June 23, 1988 at the Microbial Research Institute (FRI), Agency of Industrial Science and Technology, 1-1-3 Higashi, Yatabe-cho, Tsukuba City, Ibaraki Prefecture.

Name of Sikarandandan Deposit number Esche
rlchia colt 1 (BIOI(psT119
) FERM BP-1918 Escherichi
a colj HBIOI(pFUIIltl) F
ERM BP-19234, Brief Description of the Drawings Figure 1 shows the construction of a novel t-PA expression vector.

FIG. 2 shows a restriction site/function map of plasmid pMI200.

FIG. 3 shows the DNA sequence of the cDNA insert of plasmid pMI200.

Figure 4 shows plasmid pTPA102 (Lys277
-11e) 11g1ll DNA fragment (1974b
The DNA sequence of p) is shown.

FIG. 5 shows a restriction site/function map of plasmid pM1205.

FIG. 6 shows a restriction site/function map of psT104.

FIG. 7 shows a restriction site/function map of plasmid psT105.

Figure 8 shows the NarI-5aeI fragment (~0.9kbp
) shows the DNA sequence of

FIG. 9 shows a restriction site/function map of plasmid ps7105N.

FIG. 10 shows a restriction site/function map of plasmid 1lsT106.

FIG. 11 shows a restriction site/function map of plasmid psT102.

FIG. 12 shows a restriction site/function map of plasmid psT101.

Figure 13 shows the restriction site of plasmid psT101-X.
A functional map is shown.

Figure 14 shows the restriction sites and
A functional map is shown.

FIG. 15 shows a restriction site/function map of plasmid psT103.

Figure 16 shows the restriction sites of plasmid pMMT neo.
A functional map is shown.

FIG. 17 shows a restriction site/function map of plasmid psTl12.

's18 diagram shows the restriction site/function map of plasmid psT118.

FIG. 19 shows a restriction site/function map of plasmid psT1137.

FIG. 20 shows a restriction site/function map of plasmid psT1138.

FIG. 21 shows a restriction site/function map of plasmid psTO2.

FIG. 22 shows a restriction site/function map of plasmid psT107.

FIG. 23 shows a restriction site/function map of plusyodo psT108.

FIG. 24 shows a restriction site/function map of plasmid psT119.

Figure 25 shows plasmid M13ml18fu3 RF
A DNA restriction site/function map is shown.

Figure 26 shows plasmid M13mp8fu4 RF D
A map of the NA IIJ restriction site and function is shown.

FIG. 27 shows a restriction site/function map of plasmid pFul161.

Figure 28 shows mutant t-PA c encoding aFPA.
The DNA sequence of the DNA and the corresponding amino acid sequence are shown.

Figure 29 shows mutant t-PA encoding akl-124.
The DNA sequence of the cDNA and the corresponding amino acid sequence are shown.

Figure 1 (1) Figure 1 (2) Figure 1 (3) Figure 4 (1) Figure 4 (2) Figure 4 (3) CAGACTTCTCCAGACCCACCACC
GCAGAAGCGGGACGAGACCCTACAG
GAG;, GGGAAG8GTGC to TTTT to CCA
G,tTAcTTccc＾DingTTTGGAAGTDingTT
CAGGACT Ding GGTC Ding G 8 TTTC AGG^ to 8 CTCTGTCA ATGGGAAGACATG 8 Hachi GCACAC to GCCTC Ding CC 8 GGAATf:C
toTCCTCCCTGGOCAGAAGTGGCCAdingccCAcccTcdingdingdingTCGCTAAAGCCCA
ACCTCCTGACCTGTCACCGTG'AG
CAGCTTTGGAAAACAGGAC:CACAA^
^^TGAA8GCAdingGTCTCAToT AGT8/
To A to A to C (gradient 1: l: Il 88 GA-3 Fig. 8 (2) Pro 85pTrpThrGlut + ygu + u4 engineering 0 Fig. 29 (1) 5'-T Ding^^GGGACGCTOTG^AGCAAT
C>I! 1rHIS to rAlalyr8rgLi1y1
5erL! uThrolusI! rGly^1aser
cysLeuProDrp^snFigure 29 (3) ^
GCATTTTCCCM:
ATACTTCCC8TTTTTOGA to GτTTding CA
GGACTτGG ding C ding (+ATTτCAGOATAC
TCTGTCAGATCGGAAGAC8TC8^TG
CACACTAOCCTCTCCAGO^^T to TGC
To CTCCCTGOGCAG8AGTCOCCATGC
CACCCτGTTTTC(:CT
CACCGTGAGC
ACiCTTTGG^^^CAGG8CCAC8^^^
^TO 8 ^ ^ 0 CATGTC Ding C ^ to τ 8 GT ^ AA
G^8 to CAAG 8-31 1. Display of the case 1998 Patent Application No. 163599 28 Name of the invention Novel tissue plasminogen activator correction person Relationship to the case Patent applicant 4, Agent address: 2-3 Dojima, Kita-ku, Osaka No. 7 Shishiko T:'le 40 Contents of drawing correction Figure 1 will be replaced with attached Figure 1.

Figure 1 (1)

Claims (1)

[Claims] 1) t-PA having a negatively charged finger domain and/or kringle 1 domain. 2) t-PAR according to claim 1 having the following amino acid sequence:
^1-A^2^-^6-R^2-A^3^1^-^1^
2^3-r^5-A^1^3^6^-^5^2^7 (
I ) (where R^1 is Ser- or GlyAlaAr
gSer-, R^2 is -ArgAspGluLysTh
rGlnMetIleTyrGlnGlnHisGln
SerTrpLeuArgProValLeuArgS
erAsnArg-or-SerAspGluThrGlnMetIleTyr
GlnGlnHisGlnSerTrpLeuAspP
roValLeuGluSerAsnGlu-, R^3
-LysProTyrSerGlyArgArgPr
oAspAlaIleArg-or-GluProTyrSerGlyGluGluPro
AspAlaLeuGlu-, A^2^-^6 is natural t
- Same amino acid sequence as Tyr^2 to Cys^6 of PA, A^3^1^-^1^2^3 is Val^ of natural t-PA
Same amino acid sequence as 3^1 to Gln^1^2^3, A^1^3^6^-^5^2^7 is Le of natural t-PA
It shows the same amino acid sequence as u^1^3^6 to Pro^5^2^7. ) 3) DNA encoding t-PA as defined in claim 1. 4) DNA encoding the amino acid sequence of t-PA as defined in claim 2. 5) An expression vector containing the DNA defined in claim 3. 6) An expression vector containing the DNA defined in claim 4. 7) A host cell transformed with the expression vector defined in claim 5. 8) A host cell transformed with the expression vector defined in claim 6. 9) A claim characterized in that a host cell transformed with the expression vector containing the DNA encoding t-PA of claim 1 is cultured in a medium, and the produced t-PA is collected from the culture. 1. Method for producing t-PA. 10) A host cell transformed with the expression vector containing the DNA encoding the amino acid sequence of t-PA according to claim 2 is cultured in a medium, and the resulting t-PA is collected from the culture. , The method for producing t-PA according to claim 2. 11) A pharmaceutical composition comprising the t-PA of claim 1 and a pharmaceutically acceptable carrier.