EP1941009A2 - Verwendung von proteinen als antischaum-komponente in kraftstoffen - Google Patents

Verwendung von proteinen als antischaum-komponente in kraftstoffen

Info

Publication number
EP1941009A2
EP1941009A2 EP06793992A EP06793992A EP1941009A2 EP 1941009 A2 EP1941009 A2 EP 1941009A2 EP 06793992 A EP06793992 A EP 06793992A EP 06793992 A EP06793992 A EP 06793992A EP 1941009 A2 EP1941009 A2 EP 1941009A2
Authority
EP
European Patent Office
Prior art keywords
fuel
hydrophobin
proteins
additive
hydrophobins
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06793992A
Other languages
English (en)
French (fr)
Inventor
Thomas Subkowski
Hans-Georg Lemaire
Marvin Karos
Susan Hammer
Jörn KARL
Dietmar Posselt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1941009A2 publication Critical patent/EP1941009A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L10/00—Use of additives to fuels or fires for particular purposes
    • C10L10/18—Use of additives to fuels or fires for particular purposes use of detergents or dispersants for purposes not provided for in groups C10L10/02 - C10L10/16
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/10—Liquid carbonaceous fuels containing additives
    • C10L1/14—Organic compounds
    • C10L1/24—Organic compounds containing sulfur, selenium and/or tellurium
    • C10L1/2462—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds
    • C10L1/2475—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds obtained otherwise than by reactions only involving unsaturated carbon to carbon bonds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/10—Liquid carbonaceous fuels containing additives
    • C10L1/14—Organic compounds
    • C10L1/22—Organic compounds containing nitrogen
    • C10L1/234—Macromolecular compounds
    • C10L1/238—Macromolecular compounds obtained otherwise than by reactions involving only carbon-to-carbon unsaturated bonds
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2230/00—Function and purpose of a components of a fuel or the composition as a whole
    • C10L2230/14—Function and purpose of a components of a fuel or the composition as a whole for improving storage or transport of the fuel
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2270/00—Specifically adapted fuels
    • C10L2270/02—Specifically adapted fuels for internal combustion engines
    • C10L2270/026—Specifically adapted fuels for internal combustion engines for diesel engines, e.g. automobiles, stationary, marine
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2300/00—Mixture of two or more additives covered by the same group of C10L1/00 - C10L1/308
    • C10L2300/20—Mixture of two components

Definitions

  • the present invention relates to the use of a hydrophobin or a derivative thereof as a defoamer in additive compositions or fuels, a process for defoaming fuels, additive and fuel composition containing a hydrophobin or derivative thereof and at least one further fuel additive, and a process for producing a fuel composition - tongue.
  • hydrocarbon mixtures used as diesel fuel which may also contain aromatics, gasoil and kerosene, have the unpleasant property of developing foam when filling in reservoirs, such as storage tanks and fuel tanks of motor vehicles, in conjunction with air. This leads to the delay of the filling process and insufficient filling of the container. It is therefore common to add defoamer to the diesel fuel. These defoamers should be effective in the lowest possible concentration and must not form harmful residues when the diesel fuel is burnt in the engine or adversely affect the combustion of the fuel. Correspondingly effective defoamers are described in the patent literature.
  • DE-A 103 14 853 discloses, for example, organofunctionally modified polysiloxanes and their use for defoaming liquid fuel, in particular diesel fuel.
  • GB-B-2 173 510 relates to a process for defoaming diesel fuel or jet fuel, wherein an antifoaming agent based on a silicone polyether copolymer is added to the fuel.
  • wet diesel fuel is meant a fuel that contains about 250 ppm of water. This water is either condensation that gets into the fuel in the storage tanks, or it is added to the fuel during transport in oil tankers, due to incomplete emptying of the tanks of water.
  • the silicon content of typical polysiloxane-polyoxyalkylene copolymers is 10 to 15% by weight or even 20 to 25% by weight. Since compounds with such high silicon content can result in undesirable silica deposits upon combustion in the engine, there is a desire for defoamers for diesel fuels with reduced silicon content or at least improved foam prevention and scumming to reduce the use concentration of these additives.
  • additive packages are meant mixtures of various additives, such as.
  • means for improving the combustion behavior means for reducing the formation of smoke, means for reducing the formation of harmful exhaust gases, inhibitors for reducing corrosion in the engine and its parts, surface-active substances, lubricants and the like.
  • Such additive packages are e.g. in JP-OS 05 132 682, GB-OS 2 248 068 and in the journal Mineralöltechnik, 37 (4), 20 described.
  • the additives of the additive package are dissolved in an organic solvent to a master concentrate, which is added to the raw diesel fuel.
  • Antifoam agents with polar groups often can not be uniformly incorporated or separated into these additive packages during storage.
  • Proteins are macromolecules made up of amino acids.
  • the length of these polypeptide chains ranges from below 50, for example 10, to over 1000 amino acids.
  • the protein structure can be described by the primary structure, the secondary structure, the tertiary structure and the quaternary structure.
  • the primary structure is the sequence of the individual amino acids within the polypeptide chain.
  • the spatial arrangement of the amino acids of a protein is called secondary structure.
  • the tertiary structure is one of the secondary structure superordinate spatial arrangement of the polypeptide chain. It is determined by the forces and bonds between the residues (ie the side chains) of the amino acids. If several molecules form a superordinate functional unit in a spatial arrangement, this is called the quaternary structure.
  • the globular proteins whose tertiary or quaternary structure looks approximately spherical or pear-shaped and which are usually well soluble in water or saline solutions
  • the fibrillar proteins which have a thread-like or fibrous structure, are mostly insoluble and to the support and builder substances.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum ses. They usually have 8 cysteine units.
  • Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphipathic membranes.
  • Teflon can be coated by means of hydrophobins to give a hydrophilic surface.
  • Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.
  • hydrophobins Due to the extraordinary properties of hydrophobins for coating surfaces, these proteins have great potential for numerous technical applications.
  • the use of hydrophobins for various applications has been proposed in the prior art.
  • WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover describes compositions, in particular compositions for pharmaceutical applications, containing hydrophobins.
  • EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fuming, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 ° C.
  • WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
  • hydrophobins have surface-active properties.
  • a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
  • WO 2004/000880 likewise discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.
  • WO 01/74864 which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.
  • EP 05 007 208.1 proposes the use of proteins, in particular of hydrophobins or derivatives thereof, as demulsifiers.
  • a further object of the present invention was to provide defoamers, which are inexpensive in addition to a good defoaming effect.
  • Another object of the present invention was to provide defoamers, which are inexpensive and environmentally friendly in addition to a good defoaming effect.
  • this object is achieved by the use of at least one hydrophobin or a derivative thereof as antifoams in additive compositions or fuels.
  • hydrophobins or derivatives thereof have the advantage that they are also naturally occurring substances that are biodegradable and thus do not lead to a burden on the environment. In addition, hardly any substances are formed during decomposition, which lead to deposits in the engine area. According to the invention, hydrophobins or derivatives thereof are used as defoamers, ie the foaming of a fuel or a fuel composition is reduced.
  • At least one hydrophobin or a derivative thereof alone to a fuel as defoamer.
  • at least one hydrophobin or derivative thereof in combination with at least one further compound which acts as defoamer.
  • various hydrophobins or derivatives thereof in combination.
  • a hydrophobin or a derivative thereof is understood to mean a hydrophobin or a modified hydrophobin.
  • the modified hydrophobin may, for example, be a hydrophobin infusion protein or a protein which has a polypeptide sequence which is at least 60%, for example at least 70%, in particular at least 80%, particularly preferably at least 90%, particularly preferably at least 95%.
  • the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with these proteins be changed so that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably at least 25 °, in particular by at least 30 °.
  • hydrophobins or derivatives thereof give good results when used as defoamers.
  • hydrophobins For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive.
  • the amino acid sequence of the mature hydrophobin is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.
  • N- and C-terminus is variable over a larger range.
  • fusion partner proteins with a length of 10 to 500 amino acids can be added by means of molecular biological techniques known to those skilled in the art.
  • hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence.
  • hydrophobins is to be understood below to mean polypeptides of the general structural formula (I)
  • X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids
  • C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300.
  • the polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • indices n and m are numbers between 0 and 200, and the proteins continue to be distinguished by the abovementioned contact angle change.
  • radicals X n and X m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
  • X n and / or X m are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length.
  • Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner.
  • the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.
  • the fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X m ) of the protein according to the invention.
  • fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • Fusion partners are the sequences yaad (SEQ ID NOs: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin.
  • fragments or derivatives of these sequences which comprise only a part, preferably from 70 to 99%, particularly preferably from 80 to 98%, of said sequences, or in which individual amino acids or nucleotides are modified relative to said sequence , wherein the percentages in each case refers to the number of amino acids.
  • proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical cross-linking, for example with glutaraldehyde.
  • One property of the hydrophobins or derivatives thereof used in the present invention is the change in surface properties when the surfaces are coated with the proteins.
  • the change in the surface properties can be experimentally determined, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
  • contact angle measurements is known in principle to the person skilled in the art.
  • the measurements refer to room temperature and water drops of 5 ⁇ l.
  • the exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • the assembled membranes of class I hydrophobins are highly insoluble (even against 1% Na dodecyl sulfate (SDS) at elevated temperature) and can only be dissociated by concentrated trifluoroacetic acid (TFA) or formic acid.
  • the assembled forms of class II hydrophobins are less stable. They can already be redissolved by 60% ethanol or 1% SDS (at room temperature).
  • a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 in class II hydrophobins is significantly shorter than in class I hydrophobins.
  • Class II hydrophobins furthermore have more charged amino acids than class I.
  • hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basF, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
  • fusion proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • the biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
  • Suitable fusion partners are proteins which result in the fusion protein thus generated being capable of coating surfaces while being resistant to detergent treatment.
  • Examples of fusion partners are, for example, in E. coli yaad, yaae, thioredoxin.
  • fusion proteins produced in this way are already functionally active and not, as described in the literature, by dissociation of the hydrophobins by trifluoroacetic acid or formic acid treatment and therefore have to be activated. Solutions containing these fusion proteins or, after cleavage of the fusion protein, only the hydrophobin are suitable directly for coating surfaces.
  • a C- or N-terminal fusion with an affinity tag proves to be favorable for a fast and efficient cleaning.
  • an affinity tag eg, His 6 , HA, calmodulin-BD, GST, MBD, chitin-BD, streptavidin-BD-AviTag, Flag-Tag, T7, etc.
  • a cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example, by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage, etc.).
  • fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA, in succession.
  • hydrophobin fragments for example N- or C-terminal truncations
  • muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the fuel to be defoamed.
  • polypeptides used according to the invention or contained in the compositions according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merrifield.
  • Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. For example, see Wösten et al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • a production method is disclosed, for example, in DE 102005007480.4.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Asperg
  • expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention and vectors comprising at least one of these expression constructs are used.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
  • an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. In Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.
  • a preferred nucleic acid construct advantageously also contains one or more so-called “enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
  • Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH. It is also possible to use artificial promoters for regulation.
  • the nucleic acid construct is advantageously inserted into a host organism for expression in a vector, such as a plasmid or a phage, which allows optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • vectors can be autonomously replicated in the host organism or replicated chromosomally.
  • Suitable plasmids are described, for example, in E.coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pNIII "3-B1, tgtl 1 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL1 or pBB1 16, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMB
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors may preferably have a positive effect on the gene expression of the introduced genes and thereby increase it.
  • enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • Common recombination and cloning techniques are used, for example, as described in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1984), and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used according to the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, eg to functionally disrupt it (Knockout "- vector).
  • the introduced sequence may also be a homologue from a related microorganism or derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression of the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is described, for example, in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 ° C, preferably between 10 and 60 ° C attracted under oxygen fumigation.
  • a carbon source usually in the form of sugars
  • a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate
  • trace elements such as iron, manganese and magnesium salts
  • optionally vitamins at temperatures between 0 and 100 ° C, preferably between 10 and 60 ° C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can take place "batchwise", “semi-batch” - wise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • the proteins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture. The proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods.
  • Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation procedures.
  • the cells may optionally be treated by high frequency ultrasound, high pressure, e.g. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods.
  • Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out , Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Methoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered polypeptides or fusion proteins which serve, for example, a simpler purification.
  • suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press).
  • Suitable tags include HA, calmodulin BD, GST, MBD; Chitin-BD, streptavidin-BD-avi-tag, flag-tag, T7, etc.
  • anchors may serve to attach the proteins to a solid support, such as a polymer matrix, for example, in a chromosome. or can be used on a microtiter plate or on another carrier.
  • the corresponding purification protocols are available from the commercial affinity tag providers.
  • the proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner as "pure" hydrophobins.
  • a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools.
  • Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
  • fuels are understood as meaning both fuels in the narrower sense, which serve for the operation of internal combustion engines, and also fuels in general.
  • Suitable fuels are middle distillates and gasoline. Preferably, however, middle distillates are used.
  • Suitable middle distillates are those which boil in a range of about 120 to 500 ° C and are selected, for example, from diesel fuels, kerosene and fuel oil. Preferred middle distillates are diesel fuels.
  • the diesel fuels are, for example, petroleum raffinates, which usually have a boiling range of 100 to 400 ° C. These are mostly distillates with a 95% point up to 36O 0 C or even beyond. However, these may also be so-called “ultra low sulfur diesel” or "city diesel", characterized by a 95% point of, for example, a maximum of 345 0 C and a maximum sulfur content of 0.005 wt .-% or by a 95% point, for example 285 ° C and a maximum sulfur content of 0.001 wt .-%.
  • those obtainable by coal gasification or gas liquefaction (“gas to liquid” (GTL) fuels) are suitable.
  • GTL gas to liquid
  • mixtures of the abovementioned diesel fuels with regenerative fuels such as biodiesel or bioethanol.
  • the diesel fuels are particularly preferably those with a low sulfur content, ie with a sulfur content of less than 0.05% by weight. %, preferably less than 0.02% by weight, in particular less than 0.005% by weight and especially less than 0.001% by weight of sulfur.
  • the fuel oils are also particularly preferably those with a low sulfur content, for example with a sulfur content of at most 0.1% by weight, preferably of at most 0.05% by weight, particularly preferably of at most 0.005% by weight. , And in particular of at most 0.001 wt .-%.
  • hydrophobins or derivatives thereof are preferably used as defoamers in diesel fuels.
  • the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the fuel is a diesel fuel.
  • the at least one hydrophobin or derivative thereof is used according to the invention preferably in an amount of 0.1 to 100 ppm, based on the fuel, preferably from 0.15 to 50 ppm, more preferably from 0.2 to 30 ppm or 0.3 to 10 ppm.
  • the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm, based on the fuel ,
  • a fuel in particular a diesel fuel, can be defoamed by adding at least one hydrophobin or a derivative thereof.
  • the present invention also relates to a method of defoaming fuel comprising adding at least one hydrophobin or derivative thereof to a fuel.
  • the present invention relates to a method for defoaming fuel as described above, wherein a diesel fuel is used as fuel.
  • the present invention relates to a method for defoaming fuel as described above, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm based on the fuel.
  • the at least one hydrophobin or derivative thereof is added directly to a fuel or a fuel composition or in the form of an additive composition.
  • the present invention furthermore relates to additive compositions which contain, in addition to at least one further fuel additive, at least one hydrophobin or a derivative thereof.
  • the present invention relates to fuel compositions containing at least one hydrophobin or a derivative thereof and at least one further fuel additive.
  • the present invention relates to an additive composition
  • an additive composition comprising at least one hydrophobin or derivative thereof and at least one further fuel additive.
  • the present invention relates to a fuel composition
  • a fuel composition comprising, in addition to at least one fuel as the main constituent, at least one hydrophobin or derivative thereof and at least one further fuel additive.
  • the additive composition or the fuel contain, in addition to the at least one hydrophobin or derivative thereof, at least one further fuel additive, in particular at least one detergent and / or one demulsifier. Suitable detergent additives and demulsifiers are listed below.
  • the additive compositions and fuels may also instead or additionally contain various fuel additives such as carrier oils, corrosion inhibitors, antioxidants, antistatic agents, colorants and the like.
  • the additive composition or the fuel preferably contains at least one detergent and / or one demulsifier and optionally further, different fuel additives.
  • the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one detergent. Likewise, according to a further preferred embodiment, the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one demulsifier
  • detergent additives are amphiphilic substances having at least one hydrophobic hydrocarbon radical having a number average molecular weight (Mn) of from 85 to 20,000 and at least one polar moiety selected from:
  • the hydrophobic hydrocarbon radical in the above detergent additives which provides sufficient solubility in the fuel, has a number average molecular weight (Mn) of from 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5,000.
  • Mn number average molecular weight
  • amines for example ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, can be used here.
  • amines for example ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, can be used here.
  • Corresponding additives based on polypropene are described in particular in WO 94/24231.
  • monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.
  • These reaction products typically are mixtures of pure nitropolyisobutenes (e.g., ⁇ , ⁇ -dinitropolyisobutene) and mixed hydroxynitripropylisobutenes (e.g., ⁇ -nitro- ⁇ -hydroxy polyisobutene).
  • Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C 2 -C 40 olefins with maleic anhydride having a total molecular weight of 500 to 20 000, the carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remaining Rest of the carboxyl groups are reacted with alcohols or amines.
  • Such additives are in particular known from EP-A 307 815.
  • Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
  • Sulphonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 639 632.
  • Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
  • Polyoxy-C 2 -C 4 -alkylene (f) additives are preferably polyethers or polyetheramines which are obtainable by reaction of kanolen C 2 -C 6O -AI, C 6 -C 30 - alkanediols, mono- or di-C 2 -C 30 alkylamines, CrC 30 -Alkylcyclohexanolen d- or C 30 alkyl phenols having 1 to 30 mol ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of the polyetheramines, by subsequent reductive amination with ammonia , Monoamines or polyamines are available.
  • Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416.
  • polyethers such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.
  • Carboxylic ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm 2 / s at 100 ° C, as described in particular in DE-A 38 38 918 are.
  • Aliphatic or aromatic acids can be used as the mono-, di- or tricarboxylic acids, especially suitable as ester alcohols or polyols are long-chain representatives with, for example, 6 to 24 C atoms.
  • esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.
  • derivatives with aliphatic poly- amines such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine.
  • the groups having hydroxyl and / or amino and / or amido and / or imido groups are, for example, carboxylic acid groups, acid amides, acid amides of diamines or polyamines which, in addition to the amide function, still have free amine groups, succinic acid derivatives with a Acid and an amide, Carbon Textreimide with monoamines, Carbonklareimide with di- or polyamines, which still have free amine groups in addition to the imide function, and diimides, which are formed by the reaction of di- or polyamines with two succinic acid derivatives.
  • Such fuel additives are described in particular in US Pat. No. 4,849,572.
  • Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine.
  • Such "polyisobutene-Mannich bases" are described in particular in EP-A 831 141.
  • detergent additives from group (h) are in particular polyisobutenyl-substituted succinimides, especially the imides with aliphatic polyamines.
  • Examples of suitable demulsifiers according to the invention are the following.
  • Demulsifiers are substances which cause the separation of an emulsion. These may be both ionogenic and non-ionic substances which are effective at the phase boundary. Accordingly, basically all surface-active substances are suitable as demulsifiers.
  • Particularly suitable emulsifiers are selected from anionic active compounds, such as the alkali metal or alkaline earth metal salts of alkyl-substituted phenol and naphthalene sulfonates, and the alkali metal or alkaline earth metal salts of fatty acids, as well as neutral compounds, such as alcohol alkoxylates, for example alcohol ethoxylates, phenol alkoxylates, for example tert Butylphenolethoxylat or tert-Pentylphenolethoxylat, fatty acids, alkylphenols, condensation products of ethylene oxide (EO) and propylene oxide (PO), for example in the form of EO / PO block copolymers, polyethyleneimines or polysiloxa
  • suitable carrier oils are listed below.
  • Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. Also useful is a fraction known as "hydrocrack oil” and derived from the refining of mineral oil (vacuum distillate cut having a boiling range of about 360-500 ° C, available from high pressure, catalytically hydrogenated and isomerized and dewaxed natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.
  • Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyinternalolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.
  • suitable polyethers or polyetheramines are preferably PoIyOXy-C 2 - C 4 -alkylene-containing compounds produced by reaction of C 2 - C oil 6O -AI kan, C 6 -C 30 alkanediols, mono- or di-C 2 - C 3 o-alkylamines, CrC 30 - alkylcyclohexanols or CrC 30 -alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyetheramines, by subsequent reductive amination with ammonia, monoamines or polyamines are available.
  • Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416.
  • polyetheramines poly-C 2 -C 6 alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbutoxylate and propoxylates and the corresponding reaction products with ammonia.
  • carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918.
  • mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms.
  • esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and of isotricanecanol, for example di (n- or isotridecyl) phthalate.
  • suitable synthetic carrier oils are alcohol-initiated polyethers having from about 5 to 35, such as about 5 to 30, C 3 -C 6 -alkylene oxide units, for example selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof.
  • suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C 6 -C 6 -alkyl radical.
  • Preferred examples are tridecanol and nonylphenol.
  • suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.
  • compositions of the invention may optionally contain further co-additives.
  • Further customary additives are the cold properties of the fuel-improving additives, such as nucleators, flow improvers, paraffin dispersants and mixtures thereof, for example ethylene-vinyl acetate copolymers; Corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; dehazers; Anti-foaming agents, eg certain siloxane compounds; Cetane number improvers (ignitability improvers); combustion improvers; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2,4-di-tert-butylphenol or 3,5-di-tert-butyl-4-hydroxyphenylpropionic acid; Antistatic agents; Metallocenes such as ferrocene; Methylcyclopentadienyl
  • amines are added to lower the pH of the fuel.
  • detergent additives for example those with the polar groupings (a) to (i), they are usually added to the fuel in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight, particularly preferably 25 added to 500 ppm by weight.
  • demulsifiers When demulsifiers are used, they are usually added to the fuel in an amount of 0.1 to 100 ppm by weight, especially 0.2 to 10 ppm by weight.
  • the additive composition according to the invention contains a detergent additive, it is preferably present in an amount of from 1 to 60% by weight, preferably from 1 to 50% by weight, particularly preferably from 1 to 40% by weight and in particular from 1 to 15 Wt .-%, based on the total weight of the composition, before.
  • the additive composition of the present invention contains a demulsifier, it is preferably contained in an amount of 0.01 to 5% by weight, more preferably 0.01 to 2.5% by weight, and more preferably 0.01 to 1% by weight. %, based on the total weight of the composition.
  • compositions according to the invention may optionally also contain a solvent or diluent
  • Suitable diluents and solvents are, for example, aromatic and aliphatic hydrocarbons, for example C 5 -C 10 -alkanes, such as pentane, hexane, heptane, octane, nonane, decane, their constitutional isomers and mixtures; Petroleum ethers, aromatics such as benzene, toluene, xylene and solvent naphtha; Alkanols having 3 to 8 carbon atoms, for example, propanol, isopropanol, n-butanol, sec-butanol, isobutanol and the like, in combination with hydrocarbon solvents; and alkoxyalkanoethylene.
  • aromatic and aliphatic hydrocarbons for example C 5 -C 10 -alkanes, such as pentane, hexane, heptane, octane, nonane, decane, their constitutional isomers and mixtures
  • Suitable diluents are, for example, fractions obtained in petroleum processing, such as kerosene, naphtha or bright stock.
  • middle distillates especially in diesel fuels and heating oils preferred diluent used are naphtha, kerosene, diesel fuels, aromatic hydrocarbons such as Solvent Naphtha heavy, Solvesso ® or Shellsol ®, as well as mixtures of these solvents and diluents.
  • the individual components may be added to the fuel or the conventional fuel composition singly or as a previously prepared concentrate (additive package; additive composition).
  • the present invention also relates to a process for producing at least one fuel composition, wherein a fuel or a fuel composition
  • Hydrophobins or derivatives thereof have good defoaming properties of fuels.
  • Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • vaad-Hvdrophobin DewA-Hiss Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12).
  • plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • An artificially synthesized DNA sequence-hydrophobin BASF2- was used as template DNA (see Appendix, SEQ ID NOS: 13 and 14).
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then incubated for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-1 10EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • FIG. 1 shows the purification of the hydrophobin prepared, wherein the tracks A to F are shown.
  • Lane A Nickel Sepharose column (1:10 dilution)
  • Lanes C - E OD 280 Maxima of elution fractions (WP1, WP2, WP3)
  • Lane F shows the applied marker
  • the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • the defoaming improvement was carried out by means of a handshake foam test as follows:
  • the starting sample had a concentration of 6.1 mg / ml hydrophobin.
  • 2 mL of the starting sample were made up to 10OmL (Hyd.Lsgl) and 3 mL of the resulting solution was added to 97 mL of fuel (EN 590 fuel).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Combustion & Propulsion (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Solid Fuels And Fuel-Associated Substances (AREA)
  • Detergent Compositions (AREA)
  • Liquid Carbonaceous Fuels (AREA)

Abstract

Die vorliegende Erfindung betrifft die Verwendung eines Hydrophobins oder eines Derivats davon als Entschäumer in Additivzusammensetzungen oder Kraftstoffen, ein Verfahren zum Entschäumen von Kraftstoffen, Additiv- und Kraftstoffzusammensetzung, enthaltend ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv, sowie ein Verfahren zur Herstellung einer Kraftstoffzusammensetzung.

Description

Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
Beschreibung
Die vorliegende Erfindung betrifft die Verwendung eines Hydrophobins oder eines Derivats davon als Entschäumer in Additivzusammensetzungen oder Kraftstoffen, ein Verfahren zum Entschäumen von Kraftstoffen, Additiv- und Kraftstoffzusammensetzung, enthaltend ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv, sowie ein Verfahren zur Herstellung einer Kraftstoffzusammenset- zung.
Die als Dieselkraftstoff verwendeten Kohlenwasserstoffgemische, die auch Aromaten, Gasöl und Kerosin beinhalten können, haben die unangenehme Eigenschaft, beim Abfüllen in Vorratsbehälter, wie Lagertanks und Kraftstoffbehälter von Motorfahrzeu- gen, in Verbindung mit Luft, Schaum zu entwickeln. Dies führt zur Verzögerung des Abfüllvorgangs und zu unzureichender Befüllung der Behälter. Es ist deshalb üblich, dem Dieselkraftstoff Entschäumer zuzusetzen. Diese Entschäumer sollen in möglichst geringer Konzentration wirksam sein und dürfen bei der Verbrennung des Dieselkraftstoffs im Motor keine schädlichen Rückstände bilden oder die Verbrennung des Kraft- Stoffs negativ beeinflussen. Entsprechend wirksame Entschäumer sind in der Patentliteratur beschrieben.
So sind Antischaummittel bzw. Entschäumer auf Basis von Silicon bekannt. DE-A 103 14 853 offenbart beispielsweise organofunktionell modifizierte Polysiloxane sowie de- ren Verwendung zum Entschäumen von flüssigem Kraftstoff, insbesondere von Dieselkraftstoff.
GB-B-2 173 510 betrifft ein Verfahren zum Entschäumen von Dieselkraftstoff oder Jet Fuel, wobei dem Kraftstoff ein auf einem Siliconpolyether-Copolymer beruhendes Anti- schaummittel zugegeben wird.
Ein Nachteil bekannter Antischaummittel besteht in der schlechten Entschäumung von feuchtem Dieselkraftstoff. Unter feuchtem Dieselkraftstoff versteht man einen Kraftstoff, der ca. 250 ppm Wasser beinhaltet. Dieses Wasser ist entweder Kondenswasser, wel- ches in den Lagertanks in den Kraftstoff gelangt, oder es wird während des Transportes in Öltankern, durch die nicht vollständige Entleerung der Tanks von Wasser, in den Kraftstoff eingetragen.
Es ist aus der US 5 542 960 bekannt, dass Phenolderivate (besonders bevorzugt Eu- genol) ein relativ gutes Entschäumungsvermögen in feuchtem Dieselkraftstoff zeigen.
B05/0622PC Den beschriebenen und weiteren aus dem Stand der Technik bekannten Antischaum- mitteln für Dieselkraftstoffe sind verschiedene Nachteile zu eigen. So liegt der Silicium- gehalt typischer Polysiloxan-Polyoxyalkylen-Copolymere bei 10 bis 15 Gew.-% oder sogar bei 20 bis 25 Gew.-%. Da Verbindungen mit solch hohem Siliciumgehalt bei der Verbrennung im Motor zu unerwünschten Siliciumdioxidablagerungen führen können, besteht der Wunsch nach Entschäumern für Dieselkraftstoffe mit verringertem Siliciu- manteil oder zumindest verbesserter Schaumverhütung und Schaumbeseitigung, um die Einsatzkonzentration dieser Additive verringern zu können.
Ein weiterer Nachteil der bekannten Antischaummittel besteht in ihrer oft zu geringen Verträglichkeit (Mischbarkeit) mit den Additivpaketen, welche dem rohen Dieselöl zu seiner Eigenschaftsverbesserung zugesetzt werden. Unter Additivpaketen versteht man Mischungen verschiedener Zusatzstoffe, wie z. B. Mittel zur Verbesserung des Verbrennungsverhaltens, Mittel zur Verminderung der Rauchbildung, Mittel zur Verrin- gerung der Bildung schädlicher Abgase, Inhibitoren zur Verringerung der Korrosion im Motor und seinen Teilen, grenzflächenaktive Substanzen, Schmiermittel und dergleichen. Derartige Additivpakete sind z.B. in der JP-OS 05 132 682, der GB-OS 2 248 068 und in der Zeitschrift Mineralöltechnik, 37(4), 20 beschrieben. Die Zusätze des Additivpaketes sind dabei in einem organischen Lösungsmittel zu ein Stammkonzentrat gelöst, das dem rohen Dieselkraftstoff zugesetzt wird. Antischaummittel mit polaren Gruppen lassen sich in diese Additivpakete häufig nicht gleichmäßig einarbeiten oder separieren bei der Lagerung.
Ein möglicher Ansatz sind natürlich vorkommende Zusatzstoffe, die die gewünschten Eigenschaften aufweisen. Eine geeignete Stoffvielfalt kommt beispielsweise bei Proteinen vor.
Proteine sind Makromoleküle, die aus Aminosäuren aufgebaut sind. Die Länge dieser Polypeptidketten reicht von unter 50, beispielsweise 10, bis über 1000 Aminosäuren.
Für die Wirkungsweise der Proteine ist ihre räumliche Struktur besonders wichtig. Die Proteinstruktur lässt sich durch die Primärstruktur, die Sekundärstruktur, die Tertiärstruktur und die Quartärstruktur beschreiben. Als Primärstruktur wird die Abfolge der einzelnen Aminosäuren innerhalb der Polypeptidkette bezeichnet. Die räumliche An- Ordnung der Aminosäuren eines Proteins wird als Sekundärstruktur bezeichnet. Die Tertiärstruktur ist eine der Sekundärstruktur übergeordnete räumliche Anordnung der Polypeptidkette. Sie wird von den Kräften und Bindungen zwischen den Resten (d. h. den Seitenketten) der Aminosäuren bestimmt. Falls mehrere Moleküle in einer räumlichen Anordnung eine übergeordnete funktionelle Einheit bildet, wird diese Quartär- struktur genannt. Es werden zwei Hauptgruppen von Proteinen unterschieden, die globulären Proteine, deren Tertiär- oder Quartärstruktur annähernd kugel- oder birnenförmig aussieht und die meist in Wasser oder Salzlösungen gut löslich sind, und die fibrillären Proteine, die eine fadenförmige oder faserige Struktur besitzen, meist unlöslich sind und zu den Stütz- und Gerüstsubstanzen gehören.
Hydrophobine sind kleine Proteine von etwa 100 bis 150 Aminosäuren, die charakteristisch für filamentöse Pilze, beispielsweise Schizophyllum commune, sind. Sie weisen in aller Regel 8 Cystein-Einheiten auf.
Hydrophobine weisen eine ausgeprägte Affinität zu Grenzflächen auf und eignen sich daher zur Beschichtung von Oberflächen, um die Eigenschaften der Grenzflächen durch Bildung von amphipathischen Membranen zu verändern. So lässt sich beispielsweise Teflon mittels Hydrophobinen unter Erhalt einer hydrophilen Oberfläche be- schichten.
Hydrophobine können aus natürlichen Quellen isoliert werden. Ebenso sind Herstellverfahren für Hydrophobine und Derivate davon bekannt. Beispielsweise DE 10 2005 007 480.4 offenbart ein Herstellverfahren für Hydrophobine und Derivate davon.
Aufgrund der außergewöhnlichen Eigenschaften von Hydrophobinen zur Beschichtung von Oberflächen besitzen diese Proteine ein hohes Potenzial für zahlreiche technische Anwendungen. Im Stand der Technik ist die Verwendung von Hydrophobinen für verschiedene Anwendungen vorgeschlagen worden.
WO 96/41882 schlägt die Verwendung von Hydrophobinen als Emulgatoren, Verdicker, oberflächenaktive Substanzen, zum Hydrophilieren hydrophober Oberflächen, zur Verbesserung der Wasserbeständigkeit hydrophiler Substrate, zur Herstellung von Öl-inWasser-Emulsionen oder von Wasser-in-ÖI-Emulsionen vor. Weiterhin werden phar- mazeutische Anwendungen wie die Herstellung von Salben oder Cremes sowie kosmetische Anwendungen wie Hautschutz oder die Herstellung von Haarshampoos oder Haarspülungen vorgeschlagen. WO 96/41882 beschreibt darüber hinaus Zusammensetzungen, insbesondere Zusammensetzungen für pharmazeutische Anwendungen, enthaltend Hydrophobine.
EP-A 1 252 516 offenbart die Beschichtung von Fenstern, Kontaktlinsen, Biosensoren, medizinischen Vorrichtungen, Behältern zur Durchführung von Versuchen oder zur Lagerung, Schiffrümpfen, festen Teilchen oder Rahmen oder Karosserie von Personenkraftwagen mit einer Hydrophobine enthaltenden Lösung bei einer Temperatur von 30 bis 80°C. WO 03/53383 offenbart die Verwendung von Hydrophobin zum Behandeln von Keratin- Materialien in kosmetischen Anwendungen.
WO 03/10331 offenbart, dass Hydrophobine oberflächenaktive Eigenschaften aufwei- sen. So wird ein mit Hydrophobin beschichteter Sensor offenbart, beispielsweise eine Messelektrode, an den nicht kovalent weitere Substanzen, z.B. elektroaktive Substanzen, Antikörper oder Enzyme gebunden sind.
WO 2004/000880 offenbart ebenfalls die Beschichtung von Oberflächen mit Hydropho- bin oder Hydrophobin-ähnlichen Substanzen. Weiter wird offenbart, dass auch Öl-inWasser oder Wasser-in-ÖI Emulsionen durch Zugabe von Hydrophobinen stabilisiert werden können.
Auch WO 01/74864, die Hydrophobin-ähnliche Proteine betrifft, offenbart, dass diese zur Stabilisierung von Dispersionen und Emulsionen eingesetzt werden können.
In EP 05 007 208.1 wird die Verwendung von Proteinen, insbesondere von Hydrophobinen oder Derivaten davon als Demulgatoren vorgeschlagen.
Eine Aufgabe der vorliegenden Erfindung bestand ausgehend vom Stand der Technik darin, Entschäumer bereitzustellen, die eine gute entschäumende Wirkung haben und einen geringen Si-Anteil haben.
Eine weitere Aufgabe der vorliegenden Erfindung lag darin, Entschäumer bereitzustel- len, die neben einer guten entschäumenden Wirkung kostengünstig sind.
Eine weitere Aufgabe der vorliegenden Erfindung lag darin, Entschäumer bereitzustellen, die neben einer guten entschäumenden Wirkung kostengünstig und umweltverträglich sind.
Erfindungsgemäß wird diese Aufgabe gelöst durch die Verwendung mindestens eines Hydrophobins oder eines Derivats davon als Entschäumer in Additivzusammensetzungen oder Kraftstoffen.
Die Verwendung von Hydrophobinen oder Derivaten davon hat den Vorteil, dass es sich um auch natürlich vorkommende Substanzen handelt, die biologisch abbaubar sind und damit nicht zu einer Belastung der Umwelt führen. Darüber hinaus entstehen beim Abbau kaum Substanzen, die zu Ablagerungen im Motorbereich führen. Erfindungsgemäß werden Hydrophobine oder Derivate davon als Entschäumer eingesetzt, d.h. die Schaumbildung eines Kraftstoffs bzw. einer Kraftstoffzusammensetzung wird vermindert.
Erfindungsgemäß ist es möglich, mindestens ein Hydrophobin oder ein Derivat davon alleine einem Kraftstoff als Entschäumer zuzusetzen. Es ist jedoch ebenso möglich, mindestens ein Hydrophobin oder Derivat davon in Kombination mit mindestens einer weiteren Verbindung einzusetzen, die als Entschäumer wirkt. Ebenso ist es möglich, verschiedene Hydrophobine oder Derivate davon in Kombination einzusetzen.
Unter einem Hydrophobin oder einem Derivat davon wird im Rahmen der vorliegenden Erfindung ein Hydrophobin oder ein modifiziertes Hydrophobin verstanden. Bei dem modifizierten Hydrophobin kann es sich beispielsweise um ein Hydrophobinfusionspro- tein handeln oder um ein Protein, das ein Polypeptidsequenz aufweist, die mindestens 60%, beispielsweise mindestens 70 %, insbesondere mindestens 80 %, besonders bevorzugt mindestens 90 %, insbesondere bevorzugt mindestens 95 % Identität mit der Polypeptidsequenz eines Hydrophobins aufweist, und das noch zu 50 %, beispielsweise zu 60 %, insbesondere zu 70 %, besonders bevorzugt zu 80 %, die biologischen Eigenschaften eines Hydrophobins erfüllt, insbesondere die Eigenschaft, dass die Oberflächeneigenschaften durch Beschichten mit diesen Proteinen derart geändert werden, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung einer Glasoberfläche mit dem Protein eine Vergrößerung um mindestens 20°, bevorzugt um mindestens 25°, insbesondere um mindestens 30° aufweist.
Überraschenderweise wurde gefunden, dass Hydrophobine oder Derivate davon bei der Verwendung als Entschäumer gute Ergebnisse liefern.
Für die Definition von Hydrophobinen ist dabei die Struktur- und nicht die Sequenzspe- zifität der Hydrophobine entscheidend. Die Aminosäuresequenz der reifen Hydropho- bine ist sehr divers, sie haben jedoch alle ein hochcharakteristisches Muster von 8 konservierten Cysteinresten. Diese Reste bilden vier intramolekulare Disulfidbrücken.
Der N- und C-Terminus ist über einen größeren Bereich variabel. Hier können mittels dem Fachmann bekannten molekularbiologischen Techniken Fusionspartnerproteine mit einer Länge von 10 bis 500 Aminosäuren angefügt werden.
Darüber hinaus sind im Sinne der vorliegenden Erfindung unter Hydrophobinen und Derivaten davon Proteine mit einer ähnlichen Struktur und funktioneller Äquivalenz zu verstehen. Unter dem Begriff „Hydrophobine" im Sinne der vorliegenden Erfindung sollen im Folgenden Polypeptide der allgemeinen Strukturformel (I)
Xn-C -Xi-5O-C -X0-5-C -Xi-IOO-C -Xi-IOO-C -Xi-5O-C -X0-5-C -Xi-5O-C -Xm (I)
verstanden werden, wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann. Dabei können X jeweils gleich oder verschieden sein. Hierbei stellen die bei X stehenden Indizes jeweils die Anzahl der Aminosäuren dar, C steht für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin, wobei mindestens vier der mit C benannten Reste für Cystein stehen, und die Indizes n und m stehen unabhängig voneinander für natürliche Zahlen zwischen 0 und 500, bevorzugt zwischen 15 und 300.
Die Polypetide gemäß der Formel (I) sind weiterhin durch die Eigenschaft charakterisiert, dass sie bei Raumtemperatur nach Beschichten einer Glasoberfläche eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, bevorzugt mindestens 25° und besonders bevorzugt 30° bewirken, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasober- fläche.
Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemässen Proteinen entweder reduziert vorliegen oder miteinander Disulfidbrücken ausbilden. Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevor- zugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der einzelnen C-positionen in den allgemeinen Formeln entsprechend verändern.
Bevorzugt werden Hydrophobine der allgemeinen Formel (II)
Xn-C -X3-25-C -Xθ-2"C -X5-50-C -X2-35-C -X2-I5-C -Xθ-2"C -X3-35-C -Xm (II) zur Ausführung der vorliegenden Erfindung eingesetzt, wobei X, C und die bei X und C stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 300 stehen, und sich die Proteine weiterhin durch die oben erwähnte Kon- taktwinkeländerung auszeichnen, und es sich weiterhin bei mindestens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Reste C um Cystein.
Besonders bevorzugt werden Hydrophobine der allgemeinen Formel (IM)
Xn-C -Xs.g-C -C -Xii_3g-C -X2-23-C -Xδ.g-C -C -X6-18"C -Xm (III)
eingesetzt, wobei X, C und die bei X stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 200 stehen, und sich die Proteine wei- terhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen.
Bei den Resten Xn und Xm kann es sich um Peptidsequenzen handeln, die natürlicherweise auch mit einem Hydrophobin verknüpft sind. Es kann sich aber auch bei einem oder beiden Resten um Peptidsequenzen handeln, die natürlicherweise nicht mit einem Hydrophobin verknüpft sind. Darunter sind auch solche Reste Xn und/oder Xm zu verstehen, bei denen eine natürlicherweise in einem Hydrophobin vorkommende Peptid- sequenz durch eine nicht natürlicherweise in einem Hydrophobin vorkommende Pep- tidsequenz verlängert ist.
Falls es sich bei Xn und/oder Xm um natürlicherweise nicht in Hydrophobinen verknüpfte Peptidsequenzen handelt, sind derartige Sequenzen in der Regel mindestens 20, bevorzugt mindestens 35, besonders bevorzugt mindestens 50 und ganz besonders bevorzugt mindestens 100 Aminosäuren lang. Ein derartiger, natürlicherweise nicht mit einem Hydrophobin verknüpfter Rest soll im Folgenden auch als Fusionspartner be- zeichnet werden. Damit soll ausgedrückt werden, dass die Proteine aus mindestens einem Hydrophobinteil und einem Fusionspartnerteil bestehen können, die in der Natur nicht zusammen in dieser Form vorkommen.
Der Fusionspartnerteil kann aus einer Vielzahl von Proteinen ausgewählt werden. Es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xm) des Hydropho- binteils. Es können aber auch beispielsweise zwei Fusionspartner mit einer Position (Xn oder Xm) des erfindungsgemäßen Proteins verknüpft werden.
Besonders geeignete Fusionspartner sind Proteine, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartner sind die Sequenzen yaad (SEQ ID NO: 15 und 16), yaae (SEQ ID NO: 17 und 18), und Thioredoxin. Gut geeignet sind auch Fragmente oder Derivate dieser genannten Sequenzen, die nur einen Teil, bevorzugt 70 bis 99%, besonders bevorzugt 80 bis 98% der genannten Sequenzen umfassen, oder bei denen einzelne Aminosäu- ren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind, wobei sich die Prozentangaben jeweils auf die Anzahl der Aminosäuren bezieht.
Die erfindungsgemäß als Hydrophobine oder Derivate davon verwendeten Proteine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielsweise mit Glutaraldehyd.
Eine Eigenschaft der erfindungsgemäß verwendeten Hydrophobine oder Derivate davon ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Proteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich experimentell beispielsweise dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung der Oberfläche mit dem Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird.
Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die Messungen beziehen sich auf Raumtemperatur sowie Wassertropfen von 5 μl. Die genauen experimentellen Bedingungen für eine beispielhaft geeignete Methode zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt. Unter den dort genannten Bedingungen besitzen die erfindungsgemäß verwendeten Proteine die Ei- genschaft, den Kontaktwinkel um mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30° zu vergrößern, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche.
Im Hydrophobinteil der bisher bekannten Hydrophobine oder Derivate davon sind die Positionen der polaren und unpolaren Aminosäuren konserviert, was sich in einem charakteristischen Hydrophobizitätsplot äußert. Unterschiede in den biophysikalischen Eigenschaften und in der Hydrophobizität führten zur Einteilung der bisher bekannten Hydrophobine in zwei Klassen, I und Il (Wessels et al. 1994, Ann. Rev. Phytopathol., 32, 413-437).
Die assemblierten Membranen aus Klasse I Hydrophobinen sind hochgradig unlöslich (selbst gegenüber 1 % Na-Dodecylsulfat (SDS) bei erhöhter Temperatur) und können nur durch konzentrierte Trifluoressigsäure (TFA), bzw. Ameisensäure wieder dissoziiert werden. Im Gegensatz dazu sind die assemblierten Formen von Klasse Il Hydrophobi- nen weniger stabil. Sie können bereits durch 60%iges Ethanol, bzw. 1 % SDS (bei Raumtemperatur) wieder aufgelöst werden. Ein Vergleich der Aminosäuresequenzen zeigt, dass die Länge des Bereichs zwischen Cystein C3 und C4 bei Klasse Il Hydrophobinen deutlich kürzer ist, als bei Hydrophobinen der Klasse I. Klasse Il Hydrophobine weisen weiterhin mehr geladene Aminosäu- ren als Klasse I auf.
Besonders bevorzugte Hydrophobine zur Ausführung der vorliegenden Erfindung sind die Hydrophobine des Typs dewA, rodA, hypA, hypB, sc3, basfl , basf2, die im nachfolgenden Sequenzprotokoll strukturell charakterisiert sind. Es kann sich auch nur um Teile oder Derivate davon handeln. Es können auch mehrere Hydrophobinteile, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft und mit einer entsprechenden geeigneten Polypeptidsequenz, die natürlicherweise nicht mit einem Hydrophobin verbunden ist, verknüpft werden.
Erfindungsgemäß besonders geeignet sind weiterhin die Fusionsproteine mit den in SEQ ID NO: 20, 22, 24 dargestellten Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäß SEQ ID NO: 19, 21 , 23. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 20, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deletion von mindes- tens einer, bis hin zu 10, bevorzugt 5, besonders bevorzugt 5% aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50% besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die bereits beschriebene Änderung des Kontaktwinkels um mindestens 20° verstanden.
Als Fusionspartner eignen sich Proteine, die dazu führen, dass das so generierte Fusionsprotein zur Beschichtung von Oberflächen fähig und gleichzeitig resistent gegenüber einer Detergenzienbehandlung ist. Beispiele für Fusionspartner sind beispielsweise in E. coli yaad, yaae, Thioredoxin.
Es wurde gefunden, dass so hergestellte Fusionsproteine funktionell bereits aktiv sind und nicht, wie in der Literatur beschrieben, durch Trifluoressigsäure- oder Ameisensäurebehandlung die Hydrophobine dissoziiert und dadurch aktiviert werden müssen. Lösungen, die diese Fusionsproteine oder, nach Spaltung des Fusionsproteins, nur das Hydrophobin enthalten, eignen sich direkt zur Beschichtung von Oberflächen.
Eine C- oder N-terminale Fusion mit einem Affinitäts-Tag (z.B. His6, HA, Calmodulin- BD, GST, MBD, Chitin-BD, Streptavidin-BD-AviTag, Flag-Tag, T7, etc.) erweist sich als günstig für eine schnelle und effiziente Reinigung. Entsprechende Standardprotokolle liegen bei den kommerziellen Anbietern der Affinitäts-Tags vor. Eine Spaltstelle zwischen dem Hydrophobin und dem Fusionspartner bzw. den Fusionspartnern kann dazu genutzt, das reine Hydrophobin in underivatisierter Form freizusetzen (beispielsweise durch BrCN-Spaltung an Methionin, Faktor Xa-, Enterokinase-, Thrombin-, TEV-Spaltung etc.).
Es ist weiterhin möglich, Fusionsproteine aus einem Fusionspartner, beispielsweise yaad oder yaae, und mehreren Hydrophobinen, auch unterschiedlicher Sequenz, beispielsweise DewA-RodA oder Sc3-DewA, Sc3-RodA, hintereinander zu generieren. Ebenso können Hydrophobinfragmente (beispielsweise N- oder C-terminale Verkür- zungen) oder Mutein, die bis zu 70% Homologie aufweisen, eingesetzt werden. Die Auswahl der optimalen Konstrukte erfolgt jeweils in Bezug auf die jeweilige Verwendung, d.h. den zu entschäumenden Kraftstoff.
Die erfindungsgemäß verwendeten bzw. in den erfindungsgemäßen Zusammenset- zungen enthaltenen Polypeptide lassen sich chemisch durch bekannte Verfahren der Peptidsynthese, beispielsweise durch Festphasensynthese nach Merrifield herstellen.
Natürlich vorkommende Hydrophobine lassen sich aus natürlichen Quellen mittels geeigneter Methoden isolieren. Beispielhaft sei auf Wösten et al., Eur. J Cell Bio. 63, 122- 129 (1994) oder WO 96/41882 verwiesen.
Die Herstellung von Fusionsproteinen kann bevorzugt durch gentechnische Verfahren erfolgen, bei denen eine für den Fusionspartner und eine für den Hydrophobinteil codierende Nukleinsäuresequenz, insbesondere DNA-Sequenz, so kombiniert werden, dass in einem Wirtsorganismus durch Genexpression der kombinierten Nukleinsäuresequenz das gewünschte Protein erzeugt wird. Ein derartiges Herstellverfahren ist beispielsweise in DE 102005007480.4 offenbart.
Geeignete Wirtsorganismen (Produktionsorganismen) für das genannte Herstellverfah- ren können dabei Prokaryonten (einschließlich der Archaea) oder Eukaryonten sein, besonders Bakterien einschließlich Halobacterien und Methanococcen, Pilze, Insektenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacillen, Hansenula poly- morpha, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a..
Dabei werden Expressionskonstrukte, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen, eine für ein erfindungsgemäß verwendetes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte, eingesetzt. Vorzugsweise umfassen eingesetzte Konstrukte 5'-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.
Unter einer "operativen Verknüpfung" wird im Rahmen der vorliegenden Erfindung die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann, verstanden.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie En- hancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und derglei- chen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene Expression Technology : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesen Regulationssequenzen kann die natürliche Regulation dieser Se- quenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.
Ein bevorzugtes Nukleinsäurekonstrukt enthält vorteilhaft auch eine oder mehrere so- genannte "Enhancer"-Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 3'-Ende der DNA- Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren.
Die Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Au- xotrophien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein.
Vorteilhafte Regulationssequenzen für die Herstellung sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, Iaclq-T7-, T5-, T3-, gal-, trc-, ara- , rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhaft in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulationssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1 , MFalpha, AC, P-60, CYC1 , GAPDH, TEF, rp28, ADH enthalten. Es können auch künstliche Promotoren für die Regulation verwendet werden.
Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhaft- erweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind außer Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, Transposons.lS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium- System zu verstehen.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden. Geeignete Plasmide sind beispielsweise in E. coli pLG338, pACYC184, pBR322, pUC18,pUC19, pKC30, pRep4, pHS1 , pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-lll"3-B1 , tgtl 1 oder pBdCI, in Streptomyces plJ101 , plJ364, plJ702 oder plJ361 , in Bacillus pUB110, pC194 oder pBD214, in Cory- nebacterium pSA77 oder pAJ667, in Pilzen pALS1 , plL2 oder pBB1 16, in Hefen 2alpha, pAG-1 , YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23, pGHIac+, pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann bekannt und können beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.
Vorteilhaft enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3'-und/oder 5'-terminale regulatorische Sequenzen zur Steigerung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Ge- nexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird. In einer weiteren Ausgestaltungsform des Vektors kann der das Nukleinsäurekonstrukt oder die Nukleinsäure enthaltende Vektor auch vorteilhaft in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Rekombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nukleinsäurekonstrukt oder der Nukleinsäure bestehen.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage" zu verändern. Der "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminator- oder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F. Fritsch und J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) und in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus, vorteilhaft in einen wirtsspezifischen Vektor inser- tiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden.
Mit Hilfe der Vektoren sind rekombinante Mikroorganismen herstellbar, welche bei- spielsweise mit wenigstens einem Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Hydrophobine oder Derivate davon eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie bei- spielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfek- tion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscience, New York 1997, oder Sambrook et al. Molecular Cloning : A Laboratory Manual. 2. Aufl., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989 beschrieben. Es sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Vektor hergestellt, der zumindest einen Abschnitt eines zu verwendenden Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure- Deletion, -Addition oder -Substitution eingebracht worden ist, um die Sequenz zu verändern, z.B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Sequenz kann z.B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe- oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombination mutiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z.B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endogenen Proteins verändert wird). Der veränderte Abschnitt des erfindungsgemäß verwendeten Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z.B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.
Als rekombinante Wirtsorganismen für derartige Nukleinsäuren oder derartige Nuklein- säurekonstrukte kommen prinzipiell alle prokaryontischen oder eukaryontischen Orga- nismen in Frage. Vorteilhafterweise werden als Wirtsorganismen Mikroorganismen wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden gram-positive oder gramnegative Bakterien, bevorzugt Bakterien der Familien Enterobacteriaceae, Pseudomo- nadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevorzugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.
Die in dem oben beschriebenen Herstellverfahren für Fusionsproteine verwendeten Organismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise angezogen bzw. gezüchtet. Mikroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoffquelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan- und Magnesiumsalze sowie gegebenenfalls Vitamine enthält, bei Temperaturen zwischen 0 und 100°C, bevorzugt zwischen 10 und 60°C unter Sauerstoffbegasung angezogen. Dabei kann der pH-Wert der Nährflüssigkeit auf einem festen Wert gehalten werden, das heißt während der Anzucht reguliert werden oder nicht. Die Anzucht kann "batch"-weise, "semi-batch"- weise oder kontinuierlich erfolgen. Nährstoffe können zu Beginn der Fermentation vorgelegt oder semikontinuierlich oder kontinuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebenen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reaktion verwendet werden. Die erfindungsgemäß verwendeten Proteine oder funktionelle, biologisch aktive Fragmente davon können mittels eines Verfahrens zur rekombinanten Herstellung hergestellt werden, wobei man einen Polypeptide-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Proteine induziert und diese aus der Kultur isoliert. Die Proteine können so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Verfahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB- oder LB- Medium und bei einer Temperatur von 20 bis 40°C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen bei- spielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Labo- ratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) beschrieben.
Die Zellen werden dann, falls die Proteine nicht in das Kulturmedium sezerniert wer- den, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z.B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren auf- geschlossen werden.
Eine Aufreinigung der Proteine kann mit bekannten, chromatographischen Verfah- ren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q- Sepharose- Chromatographie, lonenaustausch-Chromatographie und hydrophobe Chroma- tographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden beispielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Walter de Gruy- ter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin beschrieben.
Vorteilhaft kann es sein, zur Isolierung des rekombinanten Proteins Vektorsysteme oder Oligonukleotide zu verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit für veränderte Polypeptide oder Fusionsproteine kodieren, die beispielsweise einer einfacheren Reinigung dienen. Derartige geeignete Modifikationen umfassen als Anker fungierende sogenannte "Tags", wie beispielsweise die als Hexa- Histidin-Anker bekannte Modifikation oder Epitope, die als Antigene von Antikörpern erkannt werden können (beschrieben zum Beispiel in Harlow, E. and Lane, D., 1988, Antibodies : A Laboratory Manual. CoId Spring Harbor (N. Y. ) Press). Weitere geeignete Tags sind z.B. HA, Calmodulin-BD, GST, MBD; Chitin-BD, Streptavidin-BD-Avi- Tag, Flag-Tag, T7 etc. Diese Anker können zur Anheftung der Proteine an einen festen Träger, wie z.B. einer Polymermatrix, dienen, die beispielsweise in einer Chroma- tographiesäule eingefüllt sein kann, oder an einer Mikrotiterplatte oder an einem sonstigen Träger verwendet werden kann. Die entsprechenden Reinigungsprotokolle sind von den kommerziellen Affinitäts-Tag-Anbietern erhältlich.
Die wie beschrieben hergestellten Proteine können sowohl direkt als Fusionsproteine als auch nach Abspaltung und Abtrennung des Fusionspartners als „reine" Hydrophobine verwendet werden.
Wenn eine Abtrennung des Fusionspartners vorgesehen ist, empfiehlt es sich eine potentielle Spaltstelle (spezifische Erkennungsstelle für Proteasen) in das Fusionsprotein zwischen Hydrophobinteil und Fusionspartnerteil einzubauen. Als Spaltstelle geeignet sind insbesondere solche Peptidsequenzen, die ansonsten weder im Hydrophobinteil noch im Fusionspartnerteil vorkommen, was sich mit bioinformatischen Tools leicht ermitteln lässt. Besonders geeignet sind beispielsweise BrCN-Spaltung an Methionin, oder durch Protease vermittelte Spaltlung mit Faktor Xa-, Enterokinase-, Thrombin, TEV-Spaltung (Tobacca etch virus Protease).
Unter Kraftstoffen versteht man im Rahmen der vorliegenden Erfindung sowohl Kraftstoffe im engeren Sinn, die zum Betrieb von Verbrennungsmotoren dienen, als auch Brennstoffe allgemein.
Geeignete Kraftstoffe sind Mitteldestillate und Ottokraftstoffe. Vorzugsweise werden jedoch Mitteldestillate verwendet.
Geeignete Mitteldestillate sind solche, die in einem Bereich von etwa 120 bis 500°C sieden und beispielsweise unter Dieselkraftstoffen, Kerosin und Heizöl ausgewählt sind. Bevorzugte Mitteldestillate sind Dieselkraftstoffe.
Bei den Dieselkraftstoffen handelt es sich beispielsweise um Erdölraffinate, die üblicherweise einen Siedebereich von 100 bis 4000C haben. Dies sind meist Destillate mit einem 95%-Punkt bis zu 36O0C oder auch darüber hinaus. Dies können aber auch sogenannte "Ultra low sulfur diesel" oder "City diesel" sein, gekennzeichnet durch einen 95%-Punkt von beispielsweise maximal 3450C und einem Schwefelgehalt von maximal 0,005 Gew.-% oder durch einen 95%-Punkt von beispielsweise 285°C und einem Schwefelgehalt von maximal 0,001 Gew.-%. Neben den durch Raffination erhältlichen Dieselkraftstoffen sind solche, die durch Kohlevergasung oder Gasverflüssigung ("gas to liquid" (GTL) Kraftstoffe) erhältlich sind, geeignet. Geeignet sind auch Mischungen der vorstehend genannten Dieselkraftstoffe mit regenerativen Kraftstoffen, wie Biodiesel oder Bioethanol.
Besonders bevorzugt handelt es sich bei den Dieselkraftstoffen um solche mit niedrigem Schwefelgehalt, das heißt mit einem Schwefelgehalt von weniger als 0,05 Gew.- %, vorzugsweise von weniger als 0,02 Gew.-%, insbesondere von weniger als 0,005 Gew.-% und speziell von weniger als 0,001 Gew.-% Schwefel. Auch bei den Heizölen handelt es sich besonders bevorzugt um solche mit einem niedrigen Schwefelgehalt, beispielsweise mit einem Schwefelgehalt von höchstens 0,1 Gew.-%, bevorzugt von höchstens 0,05 Gew.-%, besonders bevorzugt von höchstens 0,005 Gew.-%, und insbesondere von höchstens 0,001 Gew.-%.
Erfindungsgemäß bevorzugt werden Hydrophobine oder Derivate davon als Entschäumer in Dieselkraftstoffen eingesetzt.
Gemäß einer weiteren Ausführungsform betrifft die vorliegende Erfindung daher eine wie zuvor beschriebene Verwendung mindestens eines Hydrophobins oder eines Derivats davon als Entschäumer, wobei der Kraftstoff ein Dieselkraftstoff ist.
Das mindestens eine Hydrophobin oder Derivat davon wird erfindungsgemäß vorzugsweise in einer Menge von 0,1 bis 100 ppm, bezogen auf den Kraftstoff, eingesetzt, bevorzugt von 0,15 bis 50 ppm, besonders bevorzugt von 0,2 bis 30 ppm oder 0,3 bis 10 ppm.
Im Rahmen der vorliegenden Anmeldung bezeichnet die Angabe ppm mg pro kg.
Gemäß einer weiteren Ausführungsform betrifft die vorliegende Erfindung daher eine wie zuvor beschriebene Verwendung mindestens eines Hydrophobins oder eines Derivats davon als Entschäumer, wobei das mindestens eine Hydrophobin oder Derivat davon in einer Menge von 0,1 bis 100 ppm, bezogen auf den Kraftstoff, eingesetzt wird.
Erfindungsgemäß kann ein Kraftstoff, insbesondere ein Dieselkraftstoff durch Zugabe mindestens eines Hydrophobins oder eines Derivats davon entschäumt werden.
Daher betrifft die vorliegende Erfindung auch ein Verfahren zum Entschäumen von Kraftstoff, umfassend die Zugabe von mindestens einem Hydrophobin oder Derivat davon zu einem Kraftstoff.
Gemäß einer weiteren Ausführungsform betrifft die vorliegende Erfindung ein wie zuvor beschriebenes Verfahren zum Entschäumen von Kraftstoff, wobei als Kraftstoff ein Dieselkraftstoff eingesetzt wird.
Gemäß einer weiter bevorzugten Ausführungsform betrifft die vorliegende Erfindung ein wie zuvor beschriebenes Verfahren zum Entschäumen von Kraftstoff, wobei das mindestens eine Hydrophobin oder Derivat davon in einer Menge von 0,1 bis 100 ppm, bezogen auf den Kraftstoff, eingesetzt wird.
Dabei ist es im Rahmen der vorliegenden Erfindung möglich, dass das mindestens eine Hydrophobin oder Derivat davon einem Kraftstoff oder einer Kraftstoffzusammensetzung direkt zugesetzt wird oder in Form einer Additivzusammensetzung.
Die vorliegende Erfindung betrifft weiterhin Additivzusammensetzungen, die neben mindestens einem weiteren Kraftstoffadditiv mindestens ein Hydrophobin oder ein De- rivat davon enthalten. Ebenso betrifft die vorliegende Erfindung Kraftstoffzusammensetzungen, die mindestens ein Hydrophobin oder ein Derivat davon und mindestens ein weiteres Kraftstoffadditiv enthalten.
Daher betrifft die vorliegende Erfindung gemäß einer weiteren Ausführungsform eine Additivzusammensetzung, enthaltend mindestens ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv.
Ebenso betrifft die vorliegende Erfindung gemäß einer weiteren Ausführungsform eine Kraftstoffzusammensetzung, enthaltend neben mindestens einem Kraftstoff als Haupt- bestandteil mindestens ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv.
Die Additivzusammensetzung oder der Kraftstoff enthalten neben dem mindestens einen Hydrophobin oder Derivat davon wenigstens ein weiteres Kraftstoffadditiv, insbe- sondere wenigstens ein Detergens und/oder einen Demulgator. Geeignete Detergen- sadditive und Demulgatoren sind nachfolgend ausgeführt. Die Additivzusammensetzungen und Kraftstoffe können auch stattdessen oder zusätzlich verschiedene Kraftstoffadditive, wie Trägeröle, Korrosionsinhibitoren, Antioxidantien, Antistatika, Farb- marker und dergleichen, enthalten. Vorzugsweise enthalten die Additivzusammenset- zung oder der Kraftstoff jedoch wenigstens ein Detergens und/oder einen Demulgator und gegebenenfalls weitere, davon verschiedene Kraftstoffadditive.
Daher betrifft die vorliegende Erfindung gemäß einer weiteren bevorzugten Ausführungsform eine wie zuvor beschriebene Additivzusammensetzung oder Kraftstoffzu- sammensetzung, wobei die Zusammensetzung wenigstens ein Detergens umfasst. Ebenso betrifft die vorliegende Erfindung gemäß einer weiteren bevorzugten Ausführungsform eine wie zuvor beschriebene Additivzusammensetzung oder Kraftstoffzusammensetzung, wobei die Zusammensetzung wenigstens einen Demulgator umfasst
Im folgenden sind geeignete Detergensadditive beispielhaft aufgeführt. Vorzugsweise handelt es sich bei den Detergensadditiven um amphiphile Substanzen, die mindestens einen hydrophoben Kohlenwasserstoffrest mit einem zahlengemittelten Molekulargewicht (Mn) von 85 bis 20 000 und mindestens eine polare Gruppierung besitzen, die ausgewählt ist unter:
(a) Mono- oder Polyaminogruppen mit bis zu 6 Stickstoffatomen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat;
(b) Nitrogruppen, ggf. in Kombination mit Hydroxylgruppen;
(c) Hydroxylgruppen in Kombination mit Mono- oder Polyaminogruppen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat;
(d) Carboxylgruppen oder deren Alkalimetall- oder Erdalkalimetallsalzen;
(e) Sulfonsäuregruppen oder deren Alkalimetall- oder Erdalkalimetallsalzen;
(f) Polyoxy-C2- bis C4-alkylengruppierungen, die durch Hydroxylgruppen, Mono- oder Polyaminogruppen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat, oder durch Carbamatgruppen terminiert sind;
(g) Carbonsäureestergruppen;
(h) aus Bernsteinsäureanhydrid abgeleiteten Gruppierungen mit Hydroxy- und/oder Amino- und/oder Amido- und/oder Imidogruppen; und/oder
(i) durch Mannich-Umsetzung von substituierten Phenolen mit Aldehyden und Mono- oder Polyaminen erzeugten Gruppierungen.
Der hydrophobe Kohlenwasserstoffrest in den obigen Detergensadditiven, der für die ausreichende Löslichkeit im Kraftstoff sorgt, hat ein zahlengemitteltes Molekulargewicht (Mn) von 85 bis 20000, insbesondere von 113 bis 10000, vor allem von 300 bis 5000. Als typischer hydrophober Kohlenwasserstoffrest, insbesondere in Verbindung mit den polaren Gruppierungen (a), (c), (h) und (i), kommen der Polypropenyl-, Polybu- tenyl- und Polyisobutenylrest mit jeweils Mn = 300 bis 5000, insbesondere 500 bis 2500, vor allem 700 bis 2300, in Betracht.
Als Beispiele für obige Gruppen von Detergensadditiven seien die folgenden genannt:
Mono- oder Polyaminogruppen (a) enthaltende Additive sind vorzugsweise Polyalken- mono- oder Polyalkenpolyamine auf Basis von Polypropen oder konventionellem (d.h. mit überwiegend mittenständigen Doppelbindungen) Polybuten oder Polyisobuten mit Mn = 300 bis 5000. Geht man bei der Herstellung der Additive von Polybuten oder Polyisobuten mit überwiegend mittenständigen Doppelbindungen (meist in der beta-und gamma-Position) aus, bietet sich der Herstellweg durch Chlorierung und anschließen- de Aminierung oder durch Oxidation der Doppelbindung mit Luft oder Ozon zur Carbo- nyl- oder Carboxylverbindung und anschließende Aminierung unter reduktiven (hydrierenden) Bedingungen an. Zur Aminierung können hier Amine, wie z.B. Ammoniak, Mo- noamine oder Polyamine, wie Dimethylaminopropylamin, Ethylendiamin, Diethylentri- amin, Triethylentetramin oder Tetraethylenpentamin, eingesetzt werden. Entsprechen- de Additive auf Basis von Polypropen sind insbesondere in der WO 94/24231 beschrieben.
Weitere bevorzugte Monoaminogruppen (a) enthaltende Additive sind die Hydrierungsprodukte der Umsetzungsprodukte aus Polyisobutenen mit einem mittleren Polymerisa- tionsgrad P = 5 bis 100 mit Stickoxiden oder Gemischen aus Stickoxiden und Sauerstoff, wie sie insbesondere in WO 97/03946 beschrieben sind.
Weitere bevorzugte Monoaminogruppen (a) enthaltende Additive sind die aus Polyiso- butenepoxiden durch Umsetzung mit Aminen und nachfolgender Dehydratisierung und Reduktion der Aminoalkohole erhältlichen Verbindungen, wie sie insbesondere in DE-A 196 20 262 beschrieben sind.
Nitrogruppen (b), ggf. in Kombination mit Hydroxylgruppen, enthaltende Additive sind vorzugsweise Umsetzungsprodukte aus Polyisobutenen des mittleren Polymerisati- onsgrades P = 5 bis 100 oder 10 bis 100 mit Stickoxiden oder Gemischen aus Stickoxiden und Sauerstoff, wie sie insbesondere in WO 96/03367 und WO 96/03479 beschrieben sind. Diese Umsetzungsprodukte stellen in der Regel Mischungen aus reinen Nitropolyisobutenen (z.B. α,ß-Dinitropolyisobuten) und gemischten Hydroxynitro- polyisobutenen (z.B. α-Nitro-ß-hydroxypolyisobuten) dar.
Hydroxylgruppen in Kombination mit Mono- oder Polyaminogruppen (c) enthaltende Additive sind insbesondere Umsetzungsprodukte von Polyisobutenepoxiden, erhältlich aus vorzugsweise überwiegend endständige Doppelbindungen aufweisendem Polyisobuten mit Mn = 300 bis 5000, mit Ammoniak, Mono- oder Polyaminen, wie sie insbe- sondere in EP-A 476 485 beschrieben sind.
Carboxylgruppen oder deren Alkalimetall- oder Erdalkalimetallsalze (d) enthaltende Additive sind vorzugsweise Copolymere von C2-C40-Olefinen mit Maleinsäureanhydrid mit einer Gesamt-Molmasse von 500 bis 20 000, deren Carboxylgruppen ganz oder teilweise zu den Alkalimetall- oder Erdalkalimetallsalzen und ein verbleibender Rest der Carboxylgruppen mit Alkoholen oder Aminen umgesetzt sind. Solche Additive sind insbesondere aus der EP-A 307 815 bekannt. Derartige Additive dienen hauptsächlich zur Verhinderung von Ventilsitzverschleiß und können, wie in der WO 87/01126 beschrieben, mit Vorteil in Kombination mit üblichen Kraftstoffdetergenzien wie Po- ly(iso)butenaminen oder Polyetheraminen eingesetzt werden.
Sulfonsäuregruppen oder deren Alkalimetall- oder Erdalkalimetallsalze (e) enthaltende Additive sind vorzugsweise Alkalimetall- oder Erdalkalimetallsalze eines Sulfo- bernsteinsäurealkylesters, wie er insbesondere in der EP-A 639 632 beschrieben ist. Derartige Additive dienen hauptsächlich zur Verhinderung von Ventilsitzverschleiß und können mit Vorteil in Kombination mit üblichen Kraftstoffdetergenzien wie Po- ly(iso)butenaminen oder Polyetheraminen eingesetzt werden.
Polyoxy-C2-C4-alkylengruppierungen (f) enthaltende Additive sind vorzugsweise PoIy- ether oder Polyetheramine, welche durch Umsetzung von C2-C6O-AI kanolen, C6-C30- Alkandiolen, Mono- oder Di-C2-C30-alkylaminen, CrC30-Alkylcyclohexanolen oder d- C30-Alkylphenolen mit 1 bis 30 mol Ethylenoxid und/oder Propylenoxid und/oder Buty- lenoxid pro Hydroxylgruppe oder Aminogruppe und, im Falle der Polyetheramine, durch anschließende reduktive Aminierung mit Ammoniak, Monoaminen oder Polyami- nen erhältlich sind. Derartige Produkte werden insbesondere in EP-A 310 875, EP-A 356 725, EP-A 700 985 und US 4 877 416 beschrieben. Im Falle von Polyethern erfüllen solche Produkte auch Trägeröleigenschaften. Typische Beispiele hierfür sind Tride- canol- oder Isotridecanolbutoxylate, Isononylphenolbutoxylate sowie Polyisobutenolbu- toxylate und -propoxylate sowie die entsprechenden Umsetzungsprodukte mit Ammoniak.
Carbonsäureestergruppen (g) enthaltende Additive sind vorzugsweise Ester aus Mono-, Di- oder Tricarbonsäuren mit langkettigen Alkanolen oder Polyolen, insbesondere solche mit einer Mindestviskosität von 2 mm2/s bei 100°C, wie sie insbesondere in DE-A 38 38 918 beschrieben sind. Als Mono-, Di- oder Tricarbonsäuren können alipha- tische oder aromatische Säuren eingesetzt werden, als Esteralkohole bzw.- polyole eignen sich vor allem langkettige Vertreter mit beispielsweise 6 bis 24 C-Atomen. Typische Vertreter der Ester sind Adipate, Phthalate, iso-Phthalate, Terephthalate und Tri- mellitate des iso-Octanols, iso-Nonanols, iso-Decanols und des iso-Tridecanols. Derartige Produkte erfüllen auch Trägeröleigenschaften.
Aus Bernsteinsäureanhydrid abgeleitete Gruppierungen mit Hydroxy- und/oder Amino- und/oder Amido- und/oder Imidogruppen (h) enthaltende Additive sind vorzugsweise entsprechende Derivate von Polyisobutenylbernsteinsäureanhydrid, welche durch Umsetzung von konventionellem oder hochreaktivem Polyisobuten mit Mn = 300 bis 5000 mit Maleinsäureanhydrid auf thermischem Weg oder über das chlorierte Polyisobuten erhältlich sind. Von besonderem Interesse sind hierbei Derivate mit aliphatischen PoIy- aminen wie Ethylendiamin, Diethylentriamin, Triethylentetramin oder Tetraethylenpen- tamin. Bei den Gruppierungen mit Hydroxy- und/oder Amino- und/oder Amido- und/oder Imidogruppen handelt es sich beispielsweise um Carbonsäuregruppen, Säu- reamide, Säureamide von Di- oder Polyaminen, die neben der Amidfunktion noch freie Amingruppen aufweisen, Bernsteinsäurederivate mit einer Säure- und einer Amidfunktion, Carbonsäureimide mit Monoaminen, Carbonsäureimide mit Di- oder Polyaminen, die neben der Imidfunktion noch freie Amingruppen aufweisen, und Diimide, die durch die Umsetzung von Di- oder Polyaminen mit zwei Bernsteinsäurederivaten gebildet werden. Derartige Kraftstoffadditive sind insbesondere in US 4 849 572 beschrieben.
Durch Mannich-Umsetzung von substituierten Phenolen mit Aldehyden und Mono- oder Polyaminen erzeugte Gruppierungen (i) enthaltende Additive sind vorzugsweise Umsetzungsprodukte von Polyisobuten-substituierten Phenolen mit Formaldehyd und Mono- oder Polyaminen wie Ethylendiamin, Diethylentriamin, Triethylentetramin, Tetraethylenpentamin oder Dimethylaminopropylamin. Die polyisobutenylsubstituierten Phenole können aus konventionellem oder hochreaktivem Polyisobuten mit Mn = 300 bis 5000 stammen. Derartige "Polyisobuten-Mannichbasen" sind insbesondere in der EP-A 831 141 beschrieben.
Zur genaueren Definition der einzelnen aufgeführten Kraftstoffadditive wird hier auf die Offenbarungen der obengenannten Schriften des Standes der Technik ausdrücklich Bezug genommen.
Besonders bevorzugt sind Detergensadditive aus der Gruppe (h). Hierbei handelt es sich insbesondere um Polyisobutenyl-substituierte Bernsteinsäureimide, speziell um die Imide mit aliphatischen Polyaminen.
Als erfindungsgemäß geeignete Demulgatoren sind beispielsweise die folgenden zu nennen.
Demulgatoren sind Substanzen, welche die Entmischung einer Emulsion bewirken. Hierbei kann es sich sowohl um ionogene als auch um nicht-ionogene Subtanzen handeln, die an der Phasengrenze wirksam sind. Dementsprechend sind grundsätzlich alle oberflächenaktiven Substanzen als Demulgatoren geeignet. Besonders geeignete De- mulgatoren sind ausgewählt unter Anionen-aktiven Verbindungen, wie die Alkali- oder Erdalkalisalze von Alkyl-substituierten Phenol- und Naphthalinsulfonaten und die Alkalioder Erdalkalisalze von Fettsäuren, außerdem neutrale Verbindungen, wie Alkoholal- koxylate, z.B. Alkoholethoxylate, Phenolalkoxylate, z.B. tert-Butylphenolethoxylat oder tert-Pentylphenolethoxylat, Fettsäuren, Alkylphenole, Kondensationsprodunkte von Ethylenoxid (EO) und Propylenoxid (PO), z.B. auch in Form von EO/PO- Blockcopolymeren, Polyethylenimine oder auch Polysiloxane. Die Additivzusammensetzung und der Kraftstoff können darüber hinaus mit weiteren üblichen Komponenten und Additiven kombiniert werden. Hier sind beispielsweise Trägeröle ohne ausgeprägte Detergenswirkung zu nennen, wobei diese insbesondere beim Einsatz in Ottokraftstoffen zum Tragen kommen. Gelegentlich kommen sie aber auch in Mitteldestillaten zum Einsatz.
Beispielhaft sind im folgenden geeignete Trägeröle aufgeführt.
Geeignete mineralische Trägeröle sind bei der Erdölverarbeitung anfallende Fraktionen, wie Brightstock oder Grundöle mit Viskositäten wie beispielsweise aus der Klasse SN 500 - 2000; aber auch aromatische Kohlenwasserstoffe, paraffinische Kohlenwasserstoffe und Alkoxyalkanole. Brauchbar ist ebenfalls eine als "hydrocrack oil" bekannte und bei der Raffination von Mineralöl anfallende Fraktion (Vakuumdestillatschnitt mit einem Siedebereich von etwa 360 bis 500°C, erhältlich aus unter Hochdruck kataly- tisch hydriertem und isomerisiertem sowie entparaffiniertem natürlichen Mineralöl). Ebenfalls geeignet sind Mischungen oben genannter mineralischer Trägeröle.
Beispiele für erfindungsgemäß verwendbare synthetische Trägeröle sind ausgewählt unter: Polyolefinen (Polyalphaolefine oder Polyinternalolefine), (Poly)estern, (Po- ly)alkoxylaten, Polyethern, aliphatischen Polyetheraminen, alkylphenolgestarteten Po- lyethern, alkylphenolgestarteten Polyetheraminen und Carbonsäureester langkettiger Alkanole.
Beispiele für geeignete Polyolefine sind Olefinpolymerisate mit Mn = 400 bis 1800, vor allem auf Polybuten- oder Polyisobuten-Basis (hydriert oder nicht hydriert).
Beispiele für geeignete Polyether oder Polyetheramine sind vorzugsweise PoIyOXy-C2- C4-alkylengruppierungen enthaltende Verbindungen, welche durch Umsetzung von C2- C6O-AI kan ölen, C6-C30-Alkandiolen, Mono- oder Di-C2-C3o-alkylaminen, CrC30- Alkylcyclohexanolen oder CrC30-Alkylphenolen mit 1 bis 30 mol Ethylenoxid und/oder Propylenoxid und/oder Butylenoxid pro Hydroxylgruppe oder Aminogruppe und, im Falle der Polyetheramine, durch anschließende reduktive Aminierung mit Ammoniak, Monoaminen oder Polyaminen erhältlich sind. Derartige Produkte werden insbesonde- re in EP-A 310 875, EP-A 356 725, EP-A 700 985 und US 4,877,416 beschrieben. Beispielsweise können als Polyetheramine Poly-C2-C6-Alkylenoxidamine oder funktionelle Derivate davon verwendet werden. Typische Beispiele hierfür sind Tridecanol- oder Isotridecanolbutoxylate, Isononylphenolbutoxylate sowie Polyisobutenolbutoxylate und -propoxylate sowie die entsprechenden Umsetzungsprodukte mit Ammoniak. Beispiele für Carbonsäureester langkettiger Alkanole sind insbesondere Ester aus Mono-, Di- oder Tricarbonsäuren mit langkettigen Alkanolen oder Polyolen , wie sie insbesondere in der DE-A 38 38 918 beschrieben sind. Als Mono-, Di- oder Tricarbonsäuren können aliphatische oder aromatische Säuren eingesetzt werden, als Esteralkohole bzw. -polyole eignen sich vor allem langkettige Vertreter mit beispielsweise 6 bis 24 C- Atomen. Typische Vertreter der Ester sind Adipate, Phthalate, iso-Phthalate, Te- rephthalate und Trimellitate des Isooctanols, Isononanols, Isodecanols und des Isotri- decanols, wie z.B. Di-(n- oder lso-tridecyl)-phthalat.
Weitere geeignete Trägerölsysteme sind beispielsweise beschrieben in DE-A 38 26 608, DE-A 41 42 241 , DE-A 43 09 074, EP-A 0 452 328 und EP-A 0 548 617, worauf hiermit ausdrücklich Bezug genommen wird.
Beispiele für besonders geeignete synthetische Trägeröle sind alkoholgestartete PoIy- ether mit etwa 5 bis 35, wie z.B. etwa 5 bis 30, C3-C6-Alkylenoxideinheiten, wie z.B. ausgewählt unter Propylenoxid-, n-Butylenoxid- und i-Butylenoxid-Einheiten, oder Gemischen davon. Nichtlimitierende Beispiele für geeignete Starteralkohole sind langkettige Alkanole oder mit langkettigem Alkyl substituierte Phenole, wobei der langkettige Alkylrest insbesondere für einen geradkettigen oder verzweigten C6-Cie-Alkylrest steht. Als bevorzugte Beispiele sind zu nennen Tridecanol und Nonylphenol.
Weitere geeignete synthetische Trägeröle sind alkoxylierte Alkylphenole, wie sie in der DE-A 10 102 913.6 beschrieben sind.
Die erfindungsgemäßen Zusammensetzungen können gegebenenfalls weitere Co- Additive enthalten.
Weitere übliche Additive sind die Kälteeigenschaften des Kraftstoffs verbessernde Additive, z.B. Nukleatoren, Fließverbesserer, Paraffindispergatoren und deren Gemische, z.B. Ethylen-Vinylacetat-Copolymere; Korrosionsinhibitoren, beispielsweise auf Basis von zur Filmbildung neigenden Ammoniumsalzen organischer Carbonsäuren oder von heterocyclischen Aromaten im Falle von Buntmetallkorrosionsschutz; Dehazer; Anti- schaummittel, z.B. bestimmte Siloxanverbindungen; Cetanzahlverbesserer (Zündfähig- keitsverbesserer); Verbrennungsverbesserer; Antioxidantien oder Stabilisatoren, bei- spielsweise auf Basis von Aminen wie p-Phenylendiamin, Dicyclohexylamin oder Derivaten hiervon oder von Phenolen wie 2,4-Di-tert-butylphenol oder 3,5-Di-tert-butyl-4- hydroxyphenylpropionsäure; Antistatikmittel; Metallocene wie Ferrocen; Methylcyclo- pentadienylmangantricarbonyl; Schmierfähigkeitsverbesserer, z.B. bestimmte Fettsäuren, Alkenylbernsteinsäureester, Bis(hydroxyalkyl)fettamine, Hydroxyacetamide oder Ricinusöl; sowie Farbstoffe (Marker). Gegebenenfalls werden auch Amine zur Absenkung des pH-Wertes des Kraftstoffes zugesetzt. Wenn Detergensadditive, z.B. solche mit den polaren Gruppierungen (a) bis (i), verwendet werden, so werden sie dem Kraftstoff üblicherweise in einer Menge von 10 bis 5000 Gew.-ppm, insbesondere 50 bis 1000 Gew.-ppm, besonders bevorzugt 25 bis 500 Gew.-ppm zugegeben.
Wenn Demulgatoren verwendet werden, so werden sie dem Kraftstoff üblicherweise in einer Menge von 0,1 bis 100 Gew.-ppm, insbesondere 0,2 bis 10 Gew.-ppm, zugegeben.
Die sonstigen erwähnten Komponenten und Additive werden, wenn gewünscht, in hierfür üblichen Mengen zugesetzt.
Wenn die erfindungsgemäße Additivzusammensetzung ein Detergensadditiv enthält, so liegt dieses vorzugsweise in einer Menge von 1 bis 60 Gew.-%, bevorzugt von 1 bis 50 Gew.-%, besonders bevorzugt von 1 bis 40 Gew.-% und insbesondere von 1 bis 15 Gew.-%, bezogen auf das Gesamtgewicht der Zusammensetzung, vor.
Wenn die erfindungsgemäße Additivzusammensetzung einen Demulgator enthält, so liegt dieser vorzugsweise in einer Menge von 0,01 bis 5 Gew.-%, besonders bevorzugt von 0,01 bis 2,5 Gew.-% und insbesondere von 0,01 bis 1 Gew.-%, bezogen auf das Gesamtgewicht der Zusammensetzung, vor.
Außerdem können die erfindungsgemäßen Zusammensetzungen gegebenenfalls noch ein Lösungs- oder Verdünnungsmittel enthalten
Geeignete Verdünnungs- und Lösungsmittel sind beispielsweise aromatische und a- liphatische Kohlenwasserstoffe, beispielsweise C5-Ci o-Alkane, wie Pentan, Hexan, Heptan, Octan, Nonan, Decan, deren Konstitutionsisomere und Gemische; Petrolether, Aromaten, wie Benzol, Toluol, XyIoIe und Solvent Naphtha; Alkanole mit 3 bis 8 Kohlenstoffatomen, z.B. Propanol, Isopropanol, n-Butanol, sec-Butanol, Isobutanol und dergleichen, in Kombination mit Kohlenwasserstoff-Lösungsmitteln; und Alkoxyalkano- Ie. Geeignete Verdünnungsmittel sind beispielsweise auch bei der Erdölverarbeitung anfallende Fraktionen, wie Kerosin, Naphtha oder Brightstock. Bei Mitteldestillaten, insbesondere bei Dieselkraftstoffen und Heizölen bevorzugt verwendete Verdünnungsmittel sind Naphtha, Kerosin, Dieselkraftstoffe, aromatische Kohlenwasserstoffe, wie Solvent Naphtha schwer, Solvesso® oder Shellsol® sowie Gemische dieser Lösungs- und Verdünnungsmittel. Die einzelnen Komponenten können dem Kraftstoff oder der herkömmlichen Kraftstoffzusammensetzung einzeln oder als ein zuvor hergestelltes Konzentrat (Additivpaket; Additivzusammensetzung) zugegeben werden.
Die vorliegende Erfindung betrifft darüber hinaus auch ein Verfahren zur Herstellung mindestens einer Kraftstoffzusammensetzung, wobei ein Kraftstoff oder eine Kraftstoffzusammensetzung
(a) mit mindestens ein Hydrophobin oder Derivat davon und mindestens einem weiteren Kraftstoffadditiv oder
(b) mit einer wie zuvor beschriebenen Additivzusammensetzung
versetzt wird.
Hydrophobine oder Derivate davon weisen gute Eigenschaften beim Entschäumen von Kraftstoffen auf.
Die Erfindung wird im folgenden durch Beispiele näher erläutert.
Beispiele
Beispiel 1
Vorarbeiten für die Klonierung von yaad-His^/ vaaE-Hiss
Mit Hilfe der Oligonukleotide Hal570 und Hal571 (HaI 572/ HaI 573) wurde eine PoIy- merase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Gens yaaD / yaaE aus Bacillus subtilis, und an den Enden je eine Ncol bzw. BgIII Restriktionsschnittstelle. Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen Ncol und BgIII geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit den Restriktionsendonukleasen Ncol und BgIII linearisierten Vektor pQE60 der Firma Qiagen kloniert. Die so enstandenen Vektoren pQE60YAAD#2 / pQE60YaaE#5 können zur Expression von Proteinen bestehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.
Hal570: gcgcgcccatggctcaaacaggtactga Hal571 : gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc
Beispiel 2
Klonierung von vaad-Hvdrophobin DewA-Hiss Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Schimmelpilzes Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa Proteinase Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea- se BamHI geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 klo- niert.
Der so entstandene Vektor #508 kann zur Expressions eines Fusionsproteins bestehend aus, YAAD::Xa::dewA::HIS6 verwendet werden.
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
Beispiel 3
Klonierung von vaad-Hvdrophobin RodA-Hiss
Die Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 434 und KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4
Klonierung von vaad-Hvdrophobin BASFI -HJSR
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF1 -eingesetzt (siehe Anhang, SEQ ID NO. 11 und 12).
KaM417!CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 5
Klonierung von vaad-Hvdrophobin BASF2-HJSR
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418. Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF2 -eingesetzt (siehe Anhang, SEQ ID NO. 13 und 14).
KaM417!CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 6
Klonierung von yaad-Hydrophobin SC3-HJSR
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.
Als Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe Anhang, SEQ ID NO. 9 und 10).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 7
Fermentation des rekombinanten E.Coli Stammes vaad-Hvdrophobin DewA-Hiss Inokulation von 3ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-His6 expri- mierenden E. coli Stamm in 15ml Greiner Röhrchen. Inkubation für 8h bei 37°C auf einem Schüttler mit 200 UpM. Je 2 11 Erlenmeyer Kolben mit Schikanen und 250ml LB Medium (+ 100μg/ml Ampicillin) werden mit jeweils 1 ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert.
13,51 LB-Medium (+100μg/ml Ampicillin) in einem 2Ol Fermenter mit 0,51 Vorkultur (OD6oonm 1 :10 gegen H2O gemessen) animpfen. Bei einer OD6onm von -3.5 Zugabe von 140ml 10OmM IPTG. Nach 3h Fermenter auf 10°C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.
Beispiel 8
Reinigung des rekombinanten Hvdrohobin-Fusionsproteins
(Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)
100 g Zellpellet (100 - 500 mg Hydrophobin) werden mit 50 mM Natriumphosphatpuffer, pH 7,5 auf 200 ml Gesamtvolumen aufgefüllt und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25 (Janke und Kunkel; IKA-Labortechnik) für 10 Minuten behandelt und anschliessend für 1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck, Darmstadt; Best. -Nr. 1.01697.0001 ) zum Abbau der Nukleinsäuren inkubiert. Vor dem Zellaufschluss wird mit einer Glaskartusche (P1 ) filtriert. Zum ZeI- laufschluß und für das Scheren der restlichen genomischen DNA werden zwei Homogenisatorläufe bei 1.500 bar durchgeführt (Microfluidizer M-1 10EH; Microfluidics Corp.). Das Homogenisat wird zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g), der Überstand auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer, pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung 1 % SDS enthält. Nach der Resuspension wird für eine Stunde gerührt und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA- Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g). Gemäß SDS-PAGE Analyse ist das Hydrophobin nach der abschliessenden Zentrifugation im Überstand enthalten (Abbildung 1 ). Die Versuche zeigen, dass das Hydrophobin wahrscheinlich in Form von Einschlusskörpern in den entsprechenden E. coli Zellen enthalten ist. 50 ml des Hydrophobin-enthaltenden Überstandes werden auf eine 50 ml Ni- ckel-Sepharose High Performance 17-5268-02 Säule aufgetragen (Amersham), die mit 50 mM Tris-Cl pH 8,0 Puffer äquilibriert wurde. Die Säule wird mit 50 mM Tris-Cl pH 8,0 Puffer gewaschen und das Hydrophobin anschliessend mit 50 mM Tris-Cl pH 8,0 Puffer, der 200 mM Imidazol enthält, eluiert. Zur Entfernung des Imidazols wird die Lösung gegen 50 mM Tris-Cl pH 8,0 Puffer dialysiert.
Die Abbildung in Fig. 1 zeigt die Reinigung des hergestellten Hydrophobins, wobei die Spuren A bis F dargestellt sind.
Spur A: Auftrag Nickel-Sepharose Säule (1 :10 Verdünnung)
Spur B: Durchlauf = Eluat Waschschritt
Spuren C - E: OD 280 Maxima der Elutionsfraktionen (WP1 , WP2, WP3)
Spur F zeigt den aufgetragenen Marker.
Das Hydrophobin der Abbildung 1 besitzt ein Molekulargewicht von ca. 53 kD. Die kleineren Banden repräsentieren zum Teil Abbauprodukte des Hydrophobins.
Beispiel 9
Anwendungstechnische Prüfung; Charakterisierung des Hvdrophobins durch Kontaktwinkeländerung eines Wassertropfens auf Glas
Substrat:
Glas (Fensterglas, Süddeutsche Glas, Mannheim): Konzentration Hydrophobin: 100 μg/mL
Inkubation von Glasplättchen über Nacht (Temperatur 80°C) in 5OmM Na- Acetat pH 4 + 0,1 % Tween 20 danach Beschichtung waschen in destilliertem Wasser - danach Inkubation 10min / 80°C / 1 % SDS-Lösung in dest. Wasser
Waschen in dest. Wasser
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser bestimmt. Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; eine Beschichtung mit dem funktionellen Hydrophobin gemäss Beispiel 8 (yaad-dewA-hisβ) ergab Kontaktwinkel von 75 ± 5°.
Beispiel 10
Verwendung eines Hvdrophobin-Konzentrats (Yaad-dewA-Hisβ) als Entschäumungs- mittel
Die Entschäumungsverbesserung wurde mittels eines Handshake-Schaumtest wie folgt durchgeführt:
10OmL Kraftstoff bzw. additivierter Kraftstoff wurden in eine 250 mL Schraubglasflasche gegeben und fest verschlossen; - die Probe wurde für 2 min geschüttelt; anschließend wurde die Probe sofort abgestellt und das Volumen des Schaums (mL) sowie die Zerfallzeit des Schaums (sec) bestimmt
Für den Versuch wurde ein Hydrophobin-Konzentrat (Yaad-dewA-His6, als Lösung in NaH2PO4-Puffer (50 mmol/L, pH=7,5)) verwendet. Die Ausgangsprobe hatte eine Konzentration von 6,1 mg/ml Hydrophobin. 2 mL der Ausgangsprobe wurden auf 10OmL aufgefüllt (Hyd.Lsgl ), von der entstandenen Lösung wurden 3 mL zu 97 mL Kraftstoff (EN 590 Kraftstoff) gegeben.
Die Ergebnisse des Versuchs sind in der folgenden Tabelle wiedergegeben.
Die Schaummenge und die Schaumzerfallszeit waren bei Additivierung mit dem Hydrophobin-Konzentrat niedriger als wenn der Dieselkraftstoff keine Hydrophobin enthielt.

Claims

1Patentansprüche
1. Verwendung mindestens eines Hydrophobins oder eines Derivats davon als Entschäumer in Additivzusammensetzungen oder Kraftstoffen.
2. Verwendung nach Anspruch 1 , wobei der Kraftstoff ein Dieselkraftstoff ist.
3. Verwendung nach einem der Ansprüche 1 oder 2, wobei das mindestens eine Hydrophobin oder Derivat davon in einer Menge von 0,1 bis 100 ppm, bezogen auf den Kraftstoff, eingesetzt wird.
4. Verfahren zum Entschäumen von Kraftstoff, umfassend die Zugabe von mindes- tens einem Hydrophobin oder Derivat davon zu einem Kraftstoff.
5. Verfahren nach Anspruch 4, wobei der Kraftstoff ein Dieselkraftstoff ist.
6. Verfahren nach einem der Ansprüche 4 oder 5, wobei das mindestens eine Hydrophobin oder Derivat davon in einer Menge von 0,1 bis 100 ppm, bezogen auf den Kraftstoff, eingesetzt wird.
7. Additivzusammensetzung, enthaltend mindestens ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv.
8. Kraftstoffzusammensetzung, enthaltend neben mindestens einem Kraftstoff als Hauptbestandteil mindestens ein Hydrophobin oder Derivat davon und mindestens ein weiteres Kraftstoffadditiv.
9. Additivzusammensetzung oder Kraftstoffzusammensetzung nach einem der Ansprüche 7 oder 8, wobei die Zusammensetzung wenigstens ein Detergens um- fasst.
10. Additivzusammensetzung oder Kraftstoffzusammensetzung nach einem der An- sprüche 7 bis 9, wobei die Zusammensetzung wenigstens einen Demulgator um- fasst.
1 1. Verfahren zur Herstellung mindestens einer Kraftstoffzusammensetzung, wobei ein Kraftstoff oder eine Kraftstoffzusammensetzung
(a) mit mindestens ein Hydrophobin oder Derivat davon und mindestens einem weiteren Kraftstoffadditiv oder B05/0622PC (b) mit einer Additivzusammensetzung gemäß einem der Ansprüche 7, 9 oder 10 versetzt wird.
EP06793992A 2005-10-12 2006-10-09 Verwendung von proteinen als antischaum-komponente in kraftstoffen Withdrawn EP1941009A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005048720A DE102005048720A1 (de) 2005-10-12 2005-10-12 Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
PCT/EP2006/067169 WO2007042487A2 (de) 2005-10-12 2006-10-09 Verwendung von proteinen als antischaum-komponente in kraftstoffen

Publications (1)

Publication Number Publication Date
EP1941009A2 true EP1941009A2 (de) 2008-07-09

Family

ID=37672197

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06793992A Withdrawn EP1941009A2 (de) 2005-10-12 2006-10-09 Verwendung von proteinen als antischaum-komponente in kraftstoffen

Country Status (12)

Country Link
US (1) US8038740B2 (de)
EP (1) EP1941009A2 (de)
JP (1) JP2009511689A (de)
KR (1) KR101265375B1 (de)
CN (1) CN101326271B (de)
AU (1) AU2006301257B2 (de)
BR (1) BRPI0617287A2 (de)
CA (1) CA2625134C (de)
DE (1) DE102005048720A1 (de)
NO (1) NO20081618L (de)
RU (1) RU2008118099A (de)
WO (1) WO2007042487A2 (de)

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
JP4772110B2 (ja) 2005-03-31 2011-09-14 ビーエーエスエフ ソシエタス・ヨーロピア 接着促進剤としてのポリペプチド使用方法
EP1868700A2 (de) 2005-04-01 2007-12-26 Basf Aktiengesellschaft Verwendung von hydrophobin als phasen-stabilisator
CA2602706C (en) 2005-04-01 2013-01-08 Basf Aktiengesellschaft Drilling fluid containing hydrophobin
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
EP1926398B1 (de) * 2005-09-23 2011-01-05 Unilever PLC Durchlüftete produkte mit verringerter aufrahmung
ATE417511T1 (de) * 2005-09-23 2009-01-15 Unilever Nv Durchlüftete produkte mit niedrigem ph-wert
EP1926399B2 (de) * 2005-09-23 2014-03-12 Unilever PLC Herstellungsverfahren für eine gefrorene und durchlüftete zusammensetzung
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
WO2008107439A1 (de) * 2007-03-06 2008-09-12 Basf Se Mit hydrophobinen modifizierte offenzellige schaumstoffe
EP2042155A1 (de) * 2007-09-28 2009-04-01 Basf Se Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen
JP2012505645A (ja) * 2008-10-16 2012-03-08 ユニリーバー・ナームローゼ・ベンノートシヤープ 消泡剤を含むハイドロフォビン溶液
BRPI1010003A2 (pt) * 2009-03-09 2018-06-12 Basf Se uso de uma mistura, e, composição
US8394444B2 (en) * 2009-05-29 2013-03-12 Conopco, Inc. Oil-in-water emulsion
US8357420B2 (en) * 2009-05-29 2013-01-22 Conopco, Inc. Oil-in-water emulsion
CA2704702C (en) * 2009-06-02 2018-06-12 Unilever Plc Aerated baked products

Family Cites Families (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB195876A (en) 1922-04-25 1923-04-12 Sharples Specialty Co Process for resolving water-in-oil emulsions
US2399161A (en) 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
GB1278924A (en) 1970-02-06 1972-06-21 Ici Ltd Improvements in synthetic film materials
DE2609104A1 (de) 1976-03-05 1977-09-15 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
DE2638839A1 (de) 1976-08-28 1978-03-02 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
JPS60206893A (ja) 1984-03-31 1985-10-18 Yoshinari Shimada 油中水滴型乳状燃料油の製造方法
US5049504A (en) 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
GB8508254D0 (en) 1985-03-29 1985-05-09 Dow Corning Ltd Foam control
JPS6323670A (ja) 1986-04-25 1988-01-30 バイオ−ポリマ−ズ　インコ−ポレ−テツド 接着・被覆組成物とその使用方法
IT209201Z2 (it) 1986-07-10 1988-09-20 Calzaturificio Tecnica Dispositivo di bloccaggio per scarpe e scarponi.
IT1196484B (it) 1986-07-11 1988-11-16 Sclavo Spa Vettore ad espressione e secrezione in lieviti,utile per la preparazione di proteine eterologhe
GB8918185D0 (en) 1989-08-09 1989-09-20 Secr Defence Ochrobactrum surfactant
DE4024871A1 (de) 1990-08-06 1992-02-13 Basf Ag Perlfoermige antistatische expandierbare styrolpolymerisate
GB2248068A (en) 1990-09-21 1992-03-25 Exxon Chemical Patents Inc Oil compositions and novel additives
JP3102934B2 (ja) 1991-11-13 2000-10-23 日石三菱株式会社 添加剤組成物およびその使用方法並びにディーゼル燃料
DE4220225A1 (de) 1992-06-20 1993-12-23 Basf Ag Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten
WO1994009094A1 (en) 1992-10-09 1994-04-28 Won Jae Yim A process for preparing emulsified fuel oil
FR2701490B1 (fr) 1993-02-16 1995-04-14 Inst Francais Du Petrole Procédé de production d'un mout de xanthane ayant une propriété améliorée, composition obtenue et application de la composition dans une boue de forage de puits.
JP3508157B2 (ja) 1993-05-19 2004-03-22 旭硝子株式会社 分裂酵母接合フェロモン前駆体遺伝子
CA2143619C (en) 1993-06-30 2000-11-28 Wojciech Grabowski Efficient diesel fuel antifoams of low silicone content
DE69426289T2 (de) 1993-12-10 2001-04-12 Korea Institute Of Science And Technology, Seoul/Soul Signalsequenzen für die Secretion heterologer Proteine von Hefe
JP3537487B2 (ja) 1994-04-27 2004-06-14 株式会社海洋バイオテクノロジー研究所 ムラサキイガイ接着蛋白質遺伝子
IL110938A (en) 1994-09-12 2001-01-28 Haber Meir Adhesive proteins isolated from mature macro and microalgae
WO1996023890A1 (fr) 1995-02-03 1996-08-08 Asahi Glass Company Ltd. Gene de signal de secretion et vecteur d'expression comprenant ce signal
JPH08266281A (ja) 1995-03-31 1996-10-15 Kaiyo Bio Technol Kenkyusho:Kk イガイ接着蛋白質遺伝子
WO1996041882A1 (en) 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof
US6093222A (en) * 1996-04-04 2000-07-25 Ck Witco Corporation Diesel fuel antifoam composition
EP1223219A3 (de) 1997-10-31 2002-10-23 Asahi Glass Company Ltd. Induzierbarer Promoter und Sekretionssignal zur Verwendung in Schizosaccharomyces pombe, Expressionsvektor diese enthaltend und ihre Verwendungen
US6572845B2 (en) 1998-10-16 2003-06-03 Burt D. Ensley Recombinant hair treatment compositions
AU778477B2 (en) 1999-03-25 2004-12-09 Valtion Teknillinen Tutkimuskeskus Process for partitioning of proteins
FI108863B (fi) 1999-08-20 2002-04-15 Valtion Teknillinen Parannettu biotekninen tuotantomenetelmä
DE19942539A1 (de) 1999-09-07 2001-03-08 Cognis Deutschland Gmbh Waschmittel
DE19956802A1 (de) 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002663D0 (en) 2000-02-04 2000-03-29 Biomade B V Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
GB0002660D0 (en) 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coatinga surface with a hydrophobin
FR2805278B1 (fr) 2000-02-17 2006-09-29 Chalen Papier Europ Service Compositions utiles comme surfactants et leurs utilisations
GB0007770D0 (en) 2000-03-30 2000-05-17 Biomade B V Protein capable of self-assembly at a hydrophobic hydrophillic interface, method of coating a surface, method of stabilizing a dispersion, method of stabilizi
WO2002020651A2 (en) 2000-09-06 2002-03-14 Zymogenetics, Inc. Human phermone polypeptide
GB0030038D0 (en) 2000-12-08 2001-01-24 Univ Warwick Yeast-based assay
DE10061280A1 (de) 2000-12-08 2002-06-13 Novaprot Gmbh Reinigungswirksame, grenzflächenaktive Kombination aus nachwachsenden Rohstoffen mit hoher Fettlösekraft
EP1279742A1 (de) 2001-07-23 2003-01-29 Applied NanoSystems B.V. Methode unter Verwendung von Hydrophobin, um eine Verbindung an eine Sensoroberflaeche zu binden
KR100978348B1 (ko) 2001-08-31 2010-08-26 케라텍 리미티드 가용성 ｓ-술폰화 케라틴 유도체로부터의 생체고분자 필름, 섬유, 발포체 및 접착제 재료의 제조
AT410669B (de) 2001-10-11 2003-06-25 Bcd Rohstoffe F Bauchemie Hand Sprühgetrocknete dispersionen, verfahren zu ihrer herstellung und deren anwendung
FR2833490B1 (fr) * 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
EP1490122B1 (de) 2002-03-26 2016-03-23 BioPolymer Products of Sweden AB Verfahren zur befestigung von zwei flächen aneinander unter verwendung eines bioadhäsiven polyphenolischen proteins und perjodationen.
DE60303207T2 (de) 2002-06-21 2006-09-14 Applied Nanosystems B.V. Verfahren zur bindung einer verbindung an eine oberfläche
DE10314853A1 (de) 2003-04-02 2004-10-14 Goldschmidt Ag Organofunktionell modifizierte Polysiloxane und ihre Verwendung zum Entschäumen von flüssigen Kraftstoffen
DE10342794A1 (de) 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
WO2005068087A2 (en) 2004-01-16 2005-07-28 Applied Nanosystems B.V. Method for coating an object with hydrophobin at low temperatures
WO2005115306A2 (de) 2004-05-24 2005-12-08 Basf Aktiengesellschaft Keratin-bindende polypeptide
DE102004025805A1 (de) 2004-05-24 2005-12-29 Basf Ag Keratin-bindende Effektormoleküle
US7241734B2 (en) 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
WO2006103215A1 (de) 2005-03-30 2006-10-05 Basf Aktiengesellschaft Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
WO2006103230A1 (de) 2005-03-30 2006-10-05 Basf Aktiengesellschaft Verwendung von hydrophobinen zur oberflächenbehandlung von gehärteten mineralischen baustoffen, naturstein, kunststein und keramiken
JP4772110B2 (ja) 2005-03-31 2011-09-14 ビーエーエスエフ ソシエタス・ヨーロピア 接着促進剤としてのポリペプチド使用方法
CA2602706C (en) 2005-04-01 2013-01-08 Basf Aktiengesellschaft Drilling fluid containing hydrophobin
EP1868700A2 (de) * 2005-04-01 2007-12-26 Basf Aktiengesellschaft Verwendung von hydrophobin als phasen-stabilisator
WO2006103251A1 (de) * 2005-04-01 2006-10-05 Basf Aktiengesellschaft Verwendung von proteinen als demulgatoren
DE102005027039A1 (de) 2005-06-10 2006-12-21 Basf Ag Hydrophobin als Beschichtungsmittel für expandierbare oder expandierte, thermoplastische Polymerpartikel
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005029704A1 (de) 2005-06-24 2007-01-11 Basf Ag Verwendung von Hydrophobin-Polypeptiden sowie Konjugaten aus Hydrophobin-Polypeptiden mit Wirk-oder Effektstoffen und ihre Herstellung sowie deren Einsatz in der Kosmetik
DE102005033002A1 (de) 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
DE502006008140D1 (de) 2005-08-01 2010-12-02 Basf Se Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007042487A2 *

Also Published As

Publication number Publication date
JP2009511689A (ja) 2009-03-19
US8038740B2 (en) 2011-10-18
WO2007042487A3 (de) 2007-05-31
CA2625134C (en) 2013-02-05
WO2007042487A2 (de) 2007-04-19
KR20080059439A (ko) 2008-06-27
CA2625134A1 (en) 2007-04-19
DE102005048720A1 (de) 2007-04-19
US20090241413A1 (en) 2009-10-01
RU2008118099A (ru) 2009-11-20
CN101326271A (zh) 2008-12-17
AU2006301257A1 (en) 2007-04-19
KR101265375B1 (ko) 2013-05-22
CN101326271B (zh) 2012-06-13
BRPI0617287A2 (pt) 2013-01-01
NO20081618L (no) 2008-07-08
AU2006301257B2 (en) 2011-12-01

Similar Documents

Publication Publication Date Title
EP1941009A2 (de) Verwendung von proteinen als antischaum-komponente in kraftstoffen
EP1868698A1 (de) Verwendung von proteinen als demulgatoren
EP1869138B1 (de) Bohrspülung enthaltend hydrophobin
EP1868700A2 (de) Verwendung von hydrophobin als phasen-stabilisator
EP1848733B1 (de) Neue hydrophobinfusionsproteine, deren herstellung und verwendung
EP1866401A1 (de) Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
MX2007011134A (es) Sistema de elevador.
EP1848734A2 (de) Verfahren zum beschichten von oberflächen mit hydrophobinen
WO2006128877A1 (de) Verfahren zur verringerung der verdunstungsgeschwindigkeit von flüssigkeiten
MX2008004720A (es) Uso de proteinas como un constituyente antiespumante en combustibles

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080513

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20140120

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140501