EP1941009A2 - Use of proteins as an antifoaming constituent in fuels - Google Patents

Abstract

The invention relates to the use of a hydrophobin or a derivative thereof as an antifoaming agent in additive compositions or in fuels, to a method for defoaming fuels, to an additive and fuel composition containing a hydrophobin or derivative thereof and at least one additional fuel additive, and to a method for producing a fuel composition.

Description

Use of proteins as an antifoam component in fuels

description

The present invention relates to the use of a hydrophobin or a derivative thereof as a defoamer in additive compositions or fuels, a process for defoaming fuels, additive and fuel composition containing a hydrophobin or derivative thereof and at least one further fuel additive, and a process for producing a fuel composition - tongue.

The hydrocarbon mixtures used as diesel fuel, which may also contain aromatics, gasoil and kerosene, have the unpleasant property of developing foam when filling in reservoirs, such as storage tanks and fuel tanks of motor vehicles, in conjunction with air. This leads to the delay of the filling process and insufficient filling of the container. It is therefore common to add defoamer to the diesel fuel. These defoamers should be effective in the lowest possible concentration and must not form harmful residues when the diesel fuel is burnt in the engine or adversely affect the combustion of the fuel. Correspondingly effective defoamers are described in the patent literature.

Thus, anti-foaming agents or defoamers based on silicone are known. DE-A 103 14 853 discloses, for example, organofunctionally modified polysiloxanes and their use for defoaming liquid fuel, in particular diesel fuel.

GB-B-2 173 510 relates to a process for defoaming diesel fuel or jet fuel, wherein an antifoaming agent based on a silicone polyether copolymer is added to the fuel.

A disadvantage of known antifoams is the poor defoaming of wet diesel fuel. By wet diesel fuel is meant a fuel that contains about 250 ppm of water. This water is either condensation that gets into the fuel in the storage tanks, or it is added to the fuel during transport in oil tankers, due to incomplete emptying of the tanks of water.

It is known from US Pat. No. 5,542,960 that phenol derivatives (particularly preferably genol) show a relatively good defoaming capability in wet diesel fuel.

B05 / 0622PC The described and further known from the prior art anti-foaming agents for diesel fuels are various disadvantages own. Thus, the silicon content of typical polysiloxane-polyoxyalkylene copolymers is 10 to 15% by weight or even 20 to 25% by weight. Since compounds with such high silicon content can result in undesirable silica deposits upon combustion in the engine, there is a desire for defoamers for diesel fuels with reduced silicon content or at least improved foam prevention and scumming to reduce the use concentration of these additives.

Another disadvantage of the known antifoams is their often too low compatibility (miscibility) with the additive packages, which are added to the crude diesel oil to improve its properties. By additive packages are meant mixtures of various additives, such as. As means for improving the combustion behavior, means for reducing the formation of smoke, means for reducing the formation of harmful exhaust gases, inhibitors for reducing corrosion in the engine and its parts, surface-active substances, lubricants and the like. Such additive packages are e.g. in JP-OS 05 132 682, GB-OS 2 248 068 and in the journal Mineralöltechnik, 37 (4), 20 described. The additives of the additive package are dissolved in an organic solvent to a master concentrate, which is added to the raw diesel fuel. Antifoam agents with polar groups often can not be uniformly incorporated or separated into these additive packages during storage.

One possible approach is naturally occurring additives that have the desired properties. A suitable diversity of substances occurs, for example, in proteins.

Proteins are macromolecules made up of amino acids. The length of these polypeptide chains ranges from below 50, for example 10, to over 1000 amino acids.

Their spatial structure is particularly important for the mode of action of the proteins. The protein structure can be described by the primary structure, the secondary structure, the tertiary structure and the quaternary structure. The primary structure is the sequence of the individual amino acids within the polypeptide chain. The spatial arrangement of the amino acids of a protein is called secondary structure. The tertiary structure is one of the secondary structure superordinate spatial arrangement of the polypeptide chain. It is determined by the forces and bonds between the residues (ie the side chains) of the amino acids. If several molecules form a superordinate functional unit in a spatial arrangement, this is called the quaternary structure. Two main groups of proteins are distinguished, the globular proteins, whose tertiary or quaternary structure looks approximately spherical or pear-shaped and which are usually well soluble in water or saline solutions, and the fibrillar proteins, which have a thread-like or fibrous structure, are mostly insoluble and to the support and builder substances.

Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units.

Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphipathic membranes. For example, Teflon can be coated by means of hydrophobins to give a hydrophilic surface.

Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.

Due to the extraordinary properties of hydrophobins for coating surfaces, these proteins have great potential for numerous technical applications. The use of hydrophobins for various applications has been proposed in the prior art.

WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover describes compositions, in particular compositions for pharmaceutical applications, containing hydrophobins.

EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fuming, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 ° C. WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.

WO 03/10331 discloses that hydrophobins have surface-active properties. Thus, a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.

WO 2004/000880 likewise discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.

WO 01/74864, which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.

EP 05 007 208.1 proposes the use of proteins, in particular of hydrophobins or derivatives thereof, as demulsifiers.

It has been an object of the present invention to provide defoamers which have a good defoaming action and a low Si content.

A further object of the present invention was to provide defoamers, which are inexpensive in addition to a good defoaming effect.

Another object of the present invention was to provide defoamers, which are inexpensive and environmentally friendly in addition to a good defoaming effect.

According to the invention, this object is achieved by the use of at least one hydrophobin or a derivative thereof as antifoams in additive compositions or fuels.

The use of hydrophobins or derivatives thereof has the advantage that they are also naturally occurring substances that are biodegradable and thus do not lead to a burden on the environment. In addition, hardly any substances are formed during decomposition, which lead to deposits in the engine area. According to the invention, hydrophobins or derivatives thereof are used as defoamers, ie the foaming of a fuel or a fuel composition is reduced.

According to the invention, it is possible to add at least one hydrophobin or a derivative thereof alone to a fuel as defoamer. However, it is also possible to use at least one hydrophobin or derivative thereof in combination with at least one further compound which acts as defoamer. It is also possible to use various hydrophobins or derivatives thereof in combination.

In the context of the present invention, a hydrophobin or a derivative thereof is understood to mean a hydrophobin or a modified hydrophobin. The modified hydrophobin may, for example, be a hydrophobin infusion protein or a protein which has a polypeptide sequence which is at least 60%, for example at least 70%, in particular at least 80%, particularly preferably at least 90%, particularly preferably at least 95%. Having identity with the polypeptide sequence of a hydrophobin, and still to 50%, for example, to 60%, in particular to 70%, particularly preferably to 80%, the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with these proteins be changed so that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably at least 25 °, in particular by at least 30 °.

It has surprisingly been found that hydrophobins or derivatives thereof give good results when used as defoamers.

For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive. The amino acid sequence of the mature hydrophobin is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.

The N- and C-terminus is variable over a larger range. Here fusion partner proteins with a length of 10 to 500 amino acids can be added by means of molecular biological techniques known to those skilled in the art.

In addition, for the purposes of the present invention, hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence. For the purposes of the present invention, the term "hydrophobins" is to be understood below to mean polypeptides of the general structural formula (I)

X _n -C -Xi _-5O -C -X ₀ -C ₅ -Xi-1 _OO -C -Xi-1 _OO- C-Xi- _5O -C -X ₀ -C ₅ -C -Xi- _5O -C -X _m (I)

where X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand. X may be the same or different. Here, the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300.

The polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.

The amino acids designated C ¹ to C ⁸ are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C ¹ to C ^{8 should} consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.

If cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.

Preference is given to hydrophobins of the general formula (II)

X _n -C-X ₃ -X ₅ -C -2 -2 _θ "C-X _5-50 -C -X2- ₃₅ -C -X2-I -C ₅ -X _θ -2" C -X ₃ - ₃₅ -C -X _m (II) used for carrying out the present invention, wherein X, C and the indices standing at X and C have the above meaning, the indices n and m are numbers between 0 and 300, and the proteins are further characterized by the above-mentioned contact angle change and at least 6 of the residues named C are cysteine. Most preferably, all C radicals are cysteine.

Particular preference is given to hydrophobins of the general formula (III)

X _n -C -Xs.gC -C -Xii_ ₃ gC -X2-2 ₃ -C -X _δ .gC -C -X ₆ -1 ₈ "C -X _m (III)

where X, C and the indices standing at X have the above meaning, the indices n and m are numbers between 0 and 200, and the proteins continue to be distinguished by the abovementioned contact angle change.

The radicals X _n and X _m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X _N and / or X are _m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.

If X _n and / or X _m are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.

The fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X _n ) and at the carboxy terminus (X _m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X _n or X _m ) of the protein according to the invention.

Particularly suitable fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis. Examples of such Fusion partners are the sequences yaad (SEQ ID NOs: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin. Also suitable are fragments or derivatives of these sequences which comprise only a part, preferably from 70 to 99%, particularly preferably from 80 to 98%, of said sequences, or in which individual amino acids or nucleotides are modified relative to said sequence , wherein the percentages in each case refers to the number of amino acids.

The proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical cross-linking, for example with glutaraldehyde.

One property of the hydrophobins or derivatives thereof used in the present invention is the change in surface properties when the surfaces are coated with the proteins. The change in the surface properties can be experimentally determined, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.

The implementation of contact angle measurements is known in principle to the person skilled in the art. The measurements refer to room temperature and water drops of 5 μl. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part. Under the conditions mentioned there, the proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.

In the hydrophobin part of the previously known hydrophobins or derivatives thereof, the positions of the polar and nonpolar amino acids are conserved, which manifests itself in a characteristic hydrophobicity plot. Differences in biophysical properties and in hydrophobicity led to the classification of previously known hydrophobins into two classes, I and II (Wessels et al., 1994, Ann. Rev. Phytopathol., 32, 413-437).

The assembled membranes of class I hydrophobins are highly insoluble (even against 1% Na dodecyl sulfate (SDS) at elevated temperature) and can only be dissociated by concentrated trifluoroacetic acid (TFA) or formic acid. In contrast, the assembled forms of class II hydrophobins are less stable. They can already be redissolved by 60% ethanol or 1% SDS (at room temperature). A comparison of the amino acid sequences shows that the length of the region between cysteine C ³ and C ⁴ in class II hydrophobins is significantly shorter than in class I hydrophobins. Class II hydrophobins furthermore have more charged amino acids than class I.

Particularly preferred hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basF, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.

Also particularly suitable according to the invention are the fusion proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also proteins which are derived from those described in SEQ ID NO. 20, 22 or 24 represented by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and which still have at least 50% of the biological property of the starting proteins particularly preferred embodiments. The biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.

Suitable fusion partners are proteins which result in the fusion protein thus generated being capable of coating surfaces while being resistant to detergent treatment. Examples of fusion partners are, for example, in E. coli yaad, yaae, thioredoxin.

It has been found that fusion proteins produced in this way are already functionally active and not, as described in the literature, by dissociation of the hydrophobins by trifluoroacetic acid or formic acid treatment and therefore have to be activated. Solutions containing these fusion proteins or, after cleavage of the fusion protein, only the hydrophobin are suitable directly for coating surfaces.

A C- or N-terminal fusion with an affinity tag (eg, His ₆ , HA, calmodulin-BD, GST, MBD, chitin-BD, streptavidin-BD-AviTag, Flag-Tag, T7, etc.) proves to be favorable for a fast and efficient cleaning. Corresponding standard protocols are available from the commercial providers of affinity tags. A cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example, by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage, etc.).

It is also possible to generate fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA, in succession. Similarly, hydrophobin fragments (for example N- or C-terminal truncations) or muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the fuel to be defoamed.

The polypeptides used according to the invention or contained in the compositions according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merrifield.

Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. For example, see Wösten et al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.

The production of fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence. Such a production method is disclosed, for example, in DE 102005007480.4.

Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.

In this case, expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention and vectors comprising at least one of these expression constructs are used. Preferably, constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.

In the context of the present invention, an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.

Examples of operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like. Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. In Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

In addition to these regulatory sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.

A preferred nucleic acid construct advantageously also contains one or more so-called "enhancer" sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.

The nucleic acids may be contained in one or more copies in the construct. The construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.

Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH. It is also possible to use artificial promoters for regulation.

The nucleic acid construct is advantageously inserted into a host organism for expression in a vector, such as a plasmid or a phage, which allows optimal expression of the genes in the host. In addition to plasmids and phages, all other vectors known to the person skilled in the art, ie, z. As viruses, such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.

These vectors can be autonomously replicated in the host organism or replicated chromosomally. Suitable plasmids are described, for example, in E.coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pNIII "3-B1, tgtl 1 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL1 or pBB1 16, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHIac +, pBIN19, pAK2004 or pDH51 The above-mentioned plasmids represent a small selection of the possible plasmids Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).

Advantageously, the nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.

These regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors may preferably have a positive effect on the gene expression of the introduced genes and thereby increase it. Thus, enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. In addition, however, an enhancement of the translation is possible by, for example, the stability of the mRNA is improved. In a further embodiment of the vector, the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.

For optimal expression of heterologous genes in organisms, it is advantageous to modify the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be easily determined by computer evaluations of other known genes of the organism concerned.

An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal. Common recombination and cloning techniques are used, for example, as described in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1984), and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

The recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).

With the aid of the vectors, recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used according to the invention. Advantageously, the recombinant constructs described above are introduced into a suitable host system and expressed. In this case, it is preferred to use familiar cloning and transfection methods known to the person skilled in the art, such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, in order to express the stated nucleic acids in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Colard Spring Harbor Laboratory, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, NY, 1989. Homologously recombined microorganisms can also be produced. For this purpose, a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, eg to functionally disrupt it (Knockout "- vector). For example, the introduced sequence may also be a homologue from a related microorganism or derived from a mammalian, yeast or insect source. Alternatively, the vector used for homologous recombination may be such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression of the endogenous protein is changed). The altered portion of the gene used according to the invention is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is described, for example, in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.

As recombinant host organisms for such nucleic acids or such nucleic acid constructs, in principle all prokaryotic or eukaryotic organisms can be considered. Advantageously, microorganisms such as bacteria, fungi or yeast are used as host organisms. Gram-positive or Gram-negative bacteria, preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.

The organisms used in the fusion protein preparation process described above are grown or cultured according to the host organism in a manner known to those skilled in the art. Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 ° C, preferably between 10 and 60 ° C attracted under oxygen fumigation. In this case, the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not. The cultivation can take place "batchwise", "semi-batch" - wise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction. The proteins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture. The proteins can thus also be produced on an industrial scale, if desired. The recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).

If the proteins are not secreted into the culture medium, the cells are disrupted and the product is recovered from the lysate by known protein isolation procedures. The cells may optionally be treated by high frequency ultrasound, high pressure, e.g. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods.

Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out , Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

It can be advantageous to use vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered polypeptides or fusion proteins which serve, for example, a simpler purification. Such suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press). Other suitable tags include HA, calmodulin BD, GST, MBD; Chitin-BD, streptavidin-BD-avi-tag, flag-tag, T7, etc. These anchors may serve to attach the proteins to a solid support, such as a polymer matrix, for example, in a chromosome. or can be used on a microtiter plate or on another carrier. The corresponding purification protocols are available from the commercial affinity tag providers.

The proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner as "pure" hydrophobins.

If a separation of the fusion partner is envisaged, it is advisable to incorporate a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part. Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).

In the context of the present invention, fuels are understood as meaning both fuels in the narrower sense, which serve for the operation of internal combustion engines, and also fuels in general.

Suitable fuels are middle distillates and gasoline. Preferably, however, middle distillates are used.

Suitable middle distillates are those which boil in a range of about 120 to 500 ° C and are selected, for example, from diesel fuels, kerosene and fuel oil. Preferred middle distillates are diesel fuels.

The diesel fuels are, for example, petroleum raffinates, which usually have a boiling range of 100 to 400 ^° C. These are mostly distillates with a 95% point up to 36O ⁰ C or even beyond. However, these may also be so-called "ultra low sulfur diesel" or "city diesel", characterized by a 95% point of, for example, a maximum of 345 ⁰ C and a maximum sulfur content of 0.005 wt .-% or by a 95% point, for example 285 ° C and a maximum sulfur content of 0.001 wt .-%. In addition to the diesel fuels available through refining, those obtainable by coal gasification or gas liquefaction ("gas to liquid" (GTL) fuels) are suitable. Also suitable are mixtures of the abovementioned diesel fuels with regenerative fuels, such as biodiesel or bioethanol.

The diesel fuels are particularly preferably those with a low sulfur content, ie with a sulfur content of less than 0.05% by weight. %, preferably less than 0.02% by weight, in particular less than 0.005% by weight and especially less than 0.001% by weight of sulfur. The fuel oils are also particularly preferably those with a low sulfur content, for example with a sulfur content of at most 0.1% by weight, preferably of at most 0.05% by weight, particularly preferably of at most 0.005% by weight. , And in particular of at most 0.001 wt .-%.

According to the invention, hydrophobins or derivatives thereof are preferably used as defoamers in diesel fuels.

According to a further embodiment, the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the fuel is a diesel fuel.

The at least one hydrophobin or derivative thereof is used according to the invention preferably in an amount of 0.1 to 100 ppm, based on the fuel, preferably from 0.15 to 50 ppm, more preferably from 0.2 to 30 ppm or 0.3 to 10 ppm.

In the context of the present application, the indication ppm ppm per kg.

According to a further embodiment, the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm, based on the fuel ,

According to the invention, a fuel, in particular a diesel fuel, can be defoamed by adding at least one hydrophobin or a derivative thereof.

Therefore, the present invention also relates to a method of defoaming fuel comprising adding at least one hydrophobin or derivative thereof to a fuel.

According to a further embodiment, the present invention relates to a method for defoaming fuel as described above, wherein a diesel fuel is used as fuel.

According to a further preferred embodiment, the present invention relates to a method for defoaming fuel as described above, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm based on the fuel.

It is within the scope of the present invention possible that the at least one hydrophobin or derivative thereof is added directly to a fuel or a fuel composition or in the form of an additive composition.

The present invention furthermore relates to additive compositions which contain, in addition to at least one further fuel additive, at least one hydrophobin or a derivative thereof. Likewise, the present invention relates to fuel compositions containing at least one hydrophobin or a derivative thereof and at least one further fuel additive.

Therefore, according to a further embodiment, the present invention relates to an additive composition comprising at least one hydrophobin or derivative thereof and at least one further fuel additive.

Likewise, according to a further embodiment, the present invention relates to a fuel composition comprising, in addition to at least one fuel as the main constituent, at least one hydrophobin or derivative thereof and at least one further fuel additive.

The additive composition or the fuel contain, in addition to the at least one hydrophobin or derivative thereof, at least one further fuel additive, in particular at least one detergent and / or one demulsifier. Suitable detergent additives and demulsifiers are listed below. The additive compositions and fuels may also instead or additionally contain various fuel additives such as carrier oils, corrosion inhibitors, antioxidants, antistatic agents, colorants and the like. However, the additive composition or the fuel preferably contains at least one detergent and / or one demulsifier and optionally further, different fuel additives.

Therefore, according to a further preferred embodiment, the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one detergent. Likewise, according to a further preferred embodiment, the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one demulsifier

In the following, suitable detergent additives are exemplified. Preferably, the detergent additives are amphiphilic substances having at least one hydrophobic hydrocarbon radical having a number average molecular weight (Mn) of from 85 to 20,000 and at least one polar moiety selected from:

(a) mono- or polyamino groups having up to 6 nitrogen atoms, at least one nitrogen atom having basic properties;

(b) nitro groups, optionally in combination with hydroxyl groups;

(c) hydroxyl groups in combination with mono- or polyamino groups, wherein at least one nitrogen atom has basic properties;

(d) carboxyl groups or their alkali metal or alkaline earth metal salts;

(e) sulfonic acid groups or their alkali metal or alkaline earth metal salts;

(f) polyoxy-C ₂ to C ₄ alkylene moieties terminated by hydroxyl groups, mono- or polyamino groups wherein at least one nitrogen atom has basic properties or by carbamate groups;

(g) carboxylic acid ester groups;

(h) succinic anhydride-derived moieties having hydroxy and / or amino and / or amido and / or imido groups; and or

(i) by Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings.

The hydrophobic hydrocarbon radical in the above detergent additives, which provides sufficient solubility in the fuel, has a number average molecular weight (Mn) of from 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5,000. As a typical hydrophobic hydrocarbon radical, especially in combination with the polar groups (a), (c), (h) and (i), the polypropenyl, polybutenyl and polyisobutenyl radicals have in each case Mn = 300 to 5000, in particular 500 to 2500, especially 700 to 2300, into consideration.

As examples of the above groups of detergent additives, the following are mentioned:

Mono- or polyamino (a) -containing additives are preferably polyalkene mono- or Polyalkenpolyamine based on polypropene or conventional (ie polybutene or polyisobutene having Mn = 300 to 5000. If one starts with the preparation of the additives of polybutene or polyisobutene with predominantly central double bonds (usually in the beta and gamma position), the preparation route by chlorination and subsequent amination or by oxidation of the double bond with air or ozone to the carbonyl or carboxyl compound and subsequent amination under reductive (hydrogenating) conditions. For amination, amines, for example ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, can be used here. Corresponding additives based on polypropene are described in particular in WO 94/24231.

Further preferred monoamino groups (a) containing additives are the hydrogenation of the reaction products of polyisobutenes having a mean degree of polymerization P = 5 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 97/03946.

Further preferred monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.

Nitro groups (b), optionally in combination with hydroxyl groups, containing additives are preferably reaction products of polyisobutenes of the average degree of polymerization P = 5 to 100 or 10 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 96/03367 and WO 96/03479. These reaction products typically are mixtures of pure nitropolyisobutenes (e.g., α, β-dinitropolyisobutene) and mixed hydroxynitripropylisobutenes (e.g., α-nitro-β-hydroxy polyisobutene).

Hydroxyl groups in combination with mono- or polyamino groups (c) containing additives are, in particular, reaction products of polyisobutene epoxides obtainable from polyisobutene preferably having predominantly terminal double bonds with Mn = 300 to 5000, with ammonia, mono- or polyamines, as used in particular in EP-A A 476 485 are described.

Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C ₂ -C ₄₀ olefins with maleic anhydride having a total molecular weight of 500 to 20 000, the carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remaining Rest of the carboxyl groups are reacted with alcohols or amines. Such additives are in particular known from EP-A 307 815. Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.

Sulphonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 639 632. Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.

Polyoxy-C ₂ -C ₄ -alkylene (f) additives are preferably polyethers or polyetheramines which are obtainable by reaction of kanolen C ₂ -C _6O -AI, C ₆ -C ₃₀ - alkanediols, mono- or di-C ₂ -C ₃₀ alkylamines, CrC ₃₀ -Alkylcyclohexanolen d- or C ₃₀ alkyl phenols having 1 to 30 mol ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of the polyetheramines, by subsequent reductive amination with ammonia , Monoamines or polyamines are available. Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416. In the case of polyethers, such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.

Carboxylic ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm ² / s at 100 ° C, as described in particular in DE-A 38 38 918 are. Aliphatic or aromatic acids can be used as the mono-, di- or tricarboxylic acids, especially suitable as ester alcohols or polyols are long-chain representatives with, for example, 6 to 24 C atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.

Succinic anhydride-derived groupings containing hydroxyl and / or amino and / or amido and / or imido groups (h) are preferably corresponding derivatives of polyisobutenyl succinic anhydride obtained by reacting conventional or highly reactive polyisobutene having Mn = 300 to 5000 with maleic anhydride thermal route or via the chlorinated polyisobutene are available. Of particular interest here are derivatives with aliphatic poly- amines such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine. The groups having hydroxyl and / or amino and / or amido and / or imido groups are, for example, carboxylic acid groups, acid amides, acid amides of diamines or polyamines which, in addition to the amide function, still have free amine groups, succinic acid derivatives with a Acid and an amide, Carbonsäureimide with monoamines, Carbonsäureimide with di- or polyamines, which still have free amine groups in addition to the imide function, and diimides, which are formed by the reaction of di- or polyamines with two succinic acid derivatives. Such fuel additives are described in particular in US Pat. No. 4,849,572.

By Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine. The polyisobutenyl-substituted phenols may be derived from conventional or highly reactive polyisobutene having Mn = 300 to 5,000. Such "polyisobutene-Mannich bases" are described in particular in EP-A 831 141.

For a more detailed definition of the individual listed fuel additives is hereby made to the disclosures of the above-mentioned documents of the prior art express reference.

Particularly preferred are detergent additives from group (h). These are in particular polyisobutenyl-substituted succinimides, especially the imides with aliphatic polyamines.

Examples of suitable demulsifiers according to the invention are the following.

Demulsifiers are substances which cause the separation of an emulsion. These may be both ionogenic and non-ionic substances which are effective at the phase boundary. Accordingly, basically all surface-active substances are suitable as demulsifiers. Particularly suitable emulsifiers are selected from anionic active compounds, such as the alkali metal or alkaline earth metal salts of alkyl-substituted phenol and naphthalene sulfonates, and the alkali metal or alkaline earth metal salts of fatty acids, as well as neutral compounds, such as alcohol alkoxylates, for example alcohol ethoxylates, phenol alkoxylates, for example tert Butylphenolethoxylat or tert-Pentylphenolethoxylat, fatty acids, alkylphenols, condensation products of ethylene oxide (EO) and propylene oxide (PO), for example in the form of EO / PO block copolymers, polyethyleneimines or polysiloxanes. The additive composition and the fuel can also be combined with other conventional components and additives. For example, carrier oils without pronounced detergent action should be mentioned here, these being particularly useful when used in gasoline fuels. Occasionally, however, they are also used in middle distillates.

By way of example, suitable carrier oils are listed below.

Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. Also useful is a fraction known as "hydrocrack oil" and derived from the refining of mineral oil (vacuum distillate cut having a boiling range of about 360-500 ° C, available from high pressure, catalytically hydrogenated and isomerized and dewaxed natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.

Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyinternalolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.

Examples of suitable polyolefins are olefin polymers having Mn = 400 to 1800, especially based on polybutene or polyisobutene (hydrogenated or non-hydrogenated).

Examples of suitable polyethers or polyetheramines are preferably PoIyOXy-C ₂ - C ₄ -alkylene-containing compounds produced by reaction of C ₂ - C oil _6O -AI kan, C ₆ -C ₃₀ alkanediols, mono- or di-C ₂ - C ₃ o-alkylamines, CrC ₃₀ - alkylcyclohexanols or CrC ₃₀ -alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyetheramines, by subsequent reductive amination with ammonia, monoamines or polyamines are available. Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416. For example, as polyetheramines, poly-C ₂ -C 6 alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbutoxylate and propoxylates and the corresponding reaction products with ammonia. Examples of carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918. As mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and of isotricanecanol, for example di (n- or isotridecyl) phthalate.

Further suitable carrier oil systems are described, for example, in DE-A 38 26 608, DE-A 41 42 241, DE-A 43 09 074, EP-A 0 452 328 and EP-A 0 548 617, to which reference is hereby expressly made.

Examples of particularly suitable synthetic carrier oils are alcohol-initiated polyethers having from about 5 to 35, such as about 5 to 30, C ₃ -C ₆ -alkylene oxide units, for example selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof. Nonlimiting examples of suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C ₆ -C ₆ -alkyl radical. Preferred examples are tridecanol and nonylphenol.

Further suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.

The compositions of the invention may optionally contain further co-additives.

Further customary additives are the cold properties of the fuel-improving additives, such as nucleators, flow improvers, paraffin dispersants and mixtures thereof, for example ethylene-vinyl acetate copolymers; Corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; dehazers; Anti-foaming agents, eg certain siloxane compounds; Cetane number improvers (ignitability improvers); combustion improvers; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2,4-di-tert-butylphenol or 3,5-di-tert-butyl-4-hydroxyphenylpropionic acid; Antistatic agents; Metallocenes such as ferrocene; Methylcyclopentadienyl manganese tricarbonyl; Lubricity improvers, for example certain fatty acids, alkenyl succinic esters, bis (hydroxyalkyl) fatty amines, hydroxyacetamides or castor oil; as well as dyes (markers). Optionally, amines are added to lower the pH of the fuel. When detergent additives, for example those with the polar groupings (a) to (i), are used, they are usually added to the fuel in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight, particularly preferably 25 added to 500 ppm by weight.

When demulsifiers are used, they are usually added to the fuel in an amount of 0.1 to 100 ppm by weight, especially 0.2 to 10 ppm by weight.

The other components and additives mentioned are added, if desired, in customary amounts.

If the additive composition according to the invention contains a detergent additive, it is preferably present in an amount of from 1 to 60% by weight, preferably from 1 to 50% by weight, particularly preferably from 1 to 40% by weight and in particular from 1 to 15 Wt .-%, based on the total weight of the composition, before.

When the additive composition of the present invention contains a demulsifier, it is preferably contained in an amount of 0.01 to 5% by weight, more preferably 0.01 to 2.5% by weight, and more preferably 0.01 to 1% by weight. %, based on the total weight of the composition.

In addition, the compositions according to the invention may optionally also contain a solvent or diluent

Suitable diluents and solvents are, for example, aromatic and aliphatic hydrocarbons, for example C ₅ -C 10 -alkanes, such as pentane, hexane, heptane, octane, nonane, decane, their constitutional isomers and mixtures; Petroleum ethers, aromatics such as benzene, toluene, xylene and solvent naphtha; Alkanols having 3 to 8 carbon atoms, for example, propanol, isopropanol, n-butanol, sec-butanol, isobutanol and the like, in combination with hydrocarbon solvents; and alkoxyalkanoethylene. Suitable diluents are, for example, fractions obtained in petroleum processing, such as kerosene, naphtha or bright stock. When middle distillates, especially in diesel fuels and heating oils preferred diluent used are naphtha, kerosene, diesel fuels, aromatic hydrocarbons such as Solvent Naphtha heavy, Solvesso ^® or Shellsol ^®, as well as mixtures of these solvents and diluents. The individual components may be added to the fuel or the conventional fuel composition singly or as a previously prepared concentrate (additive package; additive composition).

The present invention also relates to a process for producing at least one fuel composition, wherein a fuel or a fuel composition

(a) with at least one hydrophobin or derivative thereof and at least one further fuel additive or

(b) with an additive composition as described above

is offset.

Hydrophobins or derivatives thereof have good defoaming properties of fuels.

The invention is explained in more detail below by examples.

Examples

example 1

Preliminary work for the cloning of yaad-His ^ / vaaE-Hiss

Oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) were used to perform a polymerase chain reaction. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS ₆ and YAAE :: HIS ₆ , respectively.

Hal570: gcgcgcccatggctcaaacaggtactga Hal571: gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc

Example 2

Cloning of vaad-Hvdrophobin DewA-Hiss Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out. The template DNA used was genomic DNA of the mold Aspergillus nidulans. The resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site. The PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.

The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.

KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC

Example 3

Cloning of vaad-Hvdrophobin RodA-Hiss

The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.

KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

Example 4

Cloning of vaad-Hvdrophobin BASFI-HJSR

The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.

The template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12).

KaM417! CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 5

Cloning of vaad-Hvdrophobin BASF2-HJSR

The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418. An artificially synthesized DNA sequence-hydrophobin BASF2-was used as template DNA (see Appendix, SEQ ID NOS: 13 and 14).

KaM417! CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C

KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 6

Cloning of yaad hydrophobin SC3-HJSR

The cloning of plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.

Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).

KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC

KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT

Example 7

Fermentation of the recombinant E. coli strain vaad-Hvdrophobin DewA-Hiss Inoculation of 3 ml LB liquid medium with a yaad-hydrophobin DewA-His ₆ -expressing E. coli strain in 15 ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. Each 2 l of Erlenmeyer flasks with baffles and 250 ml LB medium (+ 100 μg / ml ampicillin) are inoculated with 1 ml each of the preculture and incubated for 9 h at 37 ° C. on a shaker at 180 rpm.

13.51 LB medium (+ 100 μg / ml ampicillin) in a 2 l fermenter with 0.5 l of preculture (OD ₆ ounm 1:10 measured against H ₂ O). At OD ₆ o _n m of -3.5 add 140ml 10OmM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.

Example 8

Purification of the recombinant hvdrobobin fusion protein

(Purification of Hydrophobin Fusion Proteins Having a C-terminal His6 Tag)

100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then incubated for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids. Before cell disruption, filter with a glass cartridge (P1). For homogeneity and shearing of the remaining genomic DNA, two homogenizer runs are carried out at 1500 bar (Microfluidizer M-1 10EH, Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g). According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation (Figure 1). The experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells. 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.

The illustration in Fig. 1 shows the purification of the hydrophobin prepared, wherein the tracks A to F are shown.

Lane A: Nickel Sepharose column (1:10 dilution)

Lane B: Pass = eluate wash step

Lanes C - E: OD 280 Maxima of elution fractions (WP1, WP2, WP3)

Lane F shows the applied marker.

The hydrophobin of Figure 1 has a molecular weight of about 53 kD. The smaller bands partially represent degradation products of hydrophobin.

Example 9

Application testing; Characterization of the hvdrophobin by changing the contact angle of a drop of water on glass

substrate:

Glass (window glass, Süddeutsche Glas, Mannheim): Concentration of hydrophobin: 100 μg / mL

Incubation of glass slides overnight (temperature 80 ° C) in 5OmM Na acetate pH 4 + 0.1% Tween 20 then wash coating in distilled water - then incubation 10min / 80 ° C / 1% SDS solution in dist. water

Washing in dist. water

The samples are air dried and the contact angle (in degrees) of a drop of 5 μl of water is determined. The contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.

Untreated glass gave a contact angle of 30 ± 5 °; a coating with the functional hydrophobin according to Example 8 (yaad-dewA-hisβ) gave contact angles of 75 ± 5 °.

Example 10

Use of a hvdrophobin concentrate (Yaad-dewA-Hisβ) as defoaming agent

The defoaming improvement was carried out by means of a handshake foam test as follows:

10 omL of fuel or additized fuel were placed in a 250 mL screw-cap bottle and tightly closed; - the sample was shaken for 2 min; then the sample was immediately turned off and the volume of the foam (mL) and the decay time of the foam (sec) determined

For the experiment, a hydrophobin concentrate (Yaad-dewA-His ₆ , as a solution in NaH 2 PO 4 buffer (50 mmol / L, pH = 7.5)) was used. The starting sample had a concentration of 6.1 mg / ml hydrophobin. 2 mL of the starting sample were made up to 10OmL (Hyd.Lsgl) and 3 mL of the resulting solution was added to 97 mL of fuel (EN 590 fuel).

The results of the experiment are shown in the following table.

The amount of foam and foam disintegration time were lower when added with the hydrophobin concentrate than when the diesel fuel did not contain hydrophobin.

Claims

1Patentansprüche

1. Use of at least one hydrophobin or a derivative thereof as a defoamer in additive compositions or fuels.

2. Use according to claim 1, wherein the fuel is a diesel fuel.

3. Use according to any one of claims 1 or 2, wherein the at least one hydrophobin or derivative thereof in an amount of 0.1 to 100 ppm, based on the fuel, is used.

4. A method of defoaming fuel comprising adding at least one hydrophobin or derivative thereof to a fuel.

5. The method of claim 4, wherein the fuel is a diesel fuel.

6. The method according to any one of claims 4 or 5, wherein the at least one hydrophobin or derivative thereof in an amount of 0.1 to 100 ppm, based on the fuel, is used.

7. An additive composition comprising at least one hydrophobin or derivative thereof and at least one further fuel additive.

8. A fuel composition, comprising in addition to at least one fuel as the main component at least one hydrophobin or derivative thereof and at least one further fuel additive.

9. An additive composition or fuel composition according to any one of claims 7 or 8, wherein the composition comprises at least one detergent.

10. An additive composition or fuel composition according to any one of claims 7 to 9, wherein the composition comprises at least one demulsifier.

1 1. A method for producing at least one fuel composition, wherein a fuel or a fuel composition

(a) with at least one hydrophobin or derivative thereof and at least one further fuel additive or B05 / 0622PC (b) is added with an additive composition according to any one of claims 7, 9 or 10.