EP1868698A1 - Use of proteins as demulsifying agents - Google Patents
Use of proteins as demulsifying agentsInfo
- Publication number
- EP1868698A1 EP1868698A1 EP06725388A EP06725388A EP1868698A1 EP 1868698 A1 EP1868698 A1 EP 1868698A1 EP 06725388 A EP06725388 A EP 06725388A EP 06725388 A EP06725388 A EP 06725388A EP 1868698 A1 EP1868698 A1 EP 1868698A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- hydrophobin
- water
- fuel
- yaad
- ppm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D17/00—Separation of liquids, not provided for elsewhere, e.g. by thermal diffusion
- B01D17/02—Separation of non-miscible liquids
- B01D17/04—Breaking emulsions
- B01D17/047—Breaking emulsions with separation aids
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D17/00—Separation of liquids, not provided for elsewhere, e.g. by thermal diffusion
- B01D17/02—Separation of non-miscible liquids
- B01D17/04—Breaking emulsions
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D17/00—Separation of liquids, not provided for elsewhere, e.g. by thermal diffusion
- B01D17/02—Separation of non-miscible liquids
- B01D17/04—Breaking emulsions
- B01D17/042—Breaking emulsions by changing the temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G33/00—Dewatering or demulsification of hydrocarbon oils
- C10G33/04—Dewatering or demulsification of hydrocarbon oils with chemical means
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/10—Liquid carbonaceous fuels containing additives
- C10L1/14—Organic compounds
- C10L1/22—Organic compounds containing nitrogen
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/10—Liquid carbonaceous fuels containing additives
- C10L1/14—Organic compounds
- C10L1/22—Organic compounds containing nitrogen
- C10L1/234—Macromolecular compounds
- C10L1/238—Macromolecular compounds obtained otherwise than by reactions involving only carbon-to-carbon unsaturated bonds
- C10L1/2381—Macromolecular compounds obtained otherwise than by reactions involving only carbon-to-carbon unsaturated bonds polyamides; polyamide-esters; polyurethane, polyureas
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/10—Liquid carbonaceous fuels containing additives
- C10L1/14—Organic compounds
- C10L1/24—Organic compounds containing sulfur, selenium and/or tellurium
- C10L1/2462—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds
- C10L1/2475—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds obtained otherwise than by reactions only involving unsaturated carbon to carbon bonds
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
- C10L1/00—Liquid carbonaceous fuels
- C10L1/10—Liquid carbonaceous fuels containing additives
- C10L1/14—Organic compounds
- C10L1/26—Organic compounds containing phosphorus
- C10L1/2666—Organic compounds containing phosphorus macromolecular compounds
- C10L1/2683—Organic compounds containing phosphorus macromolecular compounds obtained otherwise than by reactions only involving unsaturated carbon to carbon bonds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/10—Feedstock materials
- C10G2300/1033—Oil well production fluids
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/10—Feedstock materials
- C10G2300/1037—Hydrocarbon fractions
- C10G2300/104—Light gasoline having a boiling range of about 20 - 100 °C
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/10—Feedstock materials
- C10G2300/1037—Hydrocarbon fractions
- C10G2300/1044—Heavy gasoline or naphtha having a boiling range of about 100 - 180 °C
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/10—Feedstock materials
- C10G2300/1037—Hydrocarbon fractions
- C10G2300/1048—Middle distillates
- C10G2300/1055—Diesel having a boiling range of about 230 - 330 °C
-
- C—CHEMISTRY; METALLURGY
- C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
- C10G—CRACKING HYDROCARBON OILS; PRODUCTION OF LIQUID HYDROCARBON MIXTURES, e.g. BY DESTRUCTIVE HYDROGENATION, OLIGOMERISATION, POLYMERISATION; RECOVERY OF HYDROCARBON OILS FROM OIL-SHALE, OIL-SAND, OR GASES; REFINING MIXTURES MAINLY CONSISTING OF HYDROCARBONS; REFORMING OF NAPHTHA; MINERAL WAXES
- C10G2300/00—Aspects relating to hydrocarbon processing covered by groups C10G1/00 - C10G99/00
- C10G2300/80—Additives
- C10G2300/805—Water
Definitions
- the present invention relates to the use of at least one hydrophobin or at least one derivative thereof for improving the phase separation in compositions comprising at least two liquid phases, processes for the separation of at least two liquid phases in a composition containing at least two liquid phases, and formulations containing at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.
- Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum ses. They usually have 8 cysteine units.
- Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphiphatic membranes.
- Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
- Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.
- WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover claims compositions, in particular compositions for pharmaceutical applications, containing hydrophobins.
- EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out tests or for storage, ship hulls, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C.
- WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
- hydrophobins have surface-active properties.
- a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
- WO 2004/000880 also discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.
- WO 01/74864 which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.
- GB 195,876 discloses a method of breaking water-in-oil emulsions using colloids.
- colloids are proteins such as gelatin, casein, albumin or polysccharides such as gum arabic or gum tragacanth.
- JP-A 11-169177 discloses the use of proteins having lipase activity for breaking emulsions.
- WO 01/60916 discloses the use of surfactant-free mixtures of at least one water-soluble protein, at least one water-soluble polysaccharide and at least one water-soluble polymer such as polyethylene oxide for various applications, including for demulsifying crude oil.
- the object of the invention was to provide an improved process for the phase separation with proteins.
- this object is achieved by the use of at least one hydrophobin for improving the phase separation in compositions containing at least two liquid phases.
- the hydrophobin according to the invention can in principle be used in any amount, as long as it is ensured that the phase separation in the compositions containing at least two liquid phases is improved.
- improvement of the phase separation is understood to mean that the separation of two liquid phases on addition of a substance to a mixture takes place more rapidly than in the same mixture without the addition of the substance, or that the addition of the substance Substance the separation of two liquid phases is only possible.
- a hydrophobin is also understood as meaning derivatives thereof or modified hydrophobin.
- Modified or derivatized hydrophobins may, for example, be hydrophobin infusion proteins or proteins which have an amino acid sequence which is at least 60%, for example at least 70%, in particular at least 80%, more preferably at least 90%, most preferably at least Has 95% identity with the sequence of a hydrophobin, and still to 50%, for example, to 60%, in particular to 70%, particularly preferably 80%, the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with These proteins are changed such that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably by at least 25 °, in particular by at least 30 °.
- hydrophobins or derivatives thereof improve the phase separation of at least two liquid phases. This is particularly advantageous if rapid phase separation is to be achieved or the occurrence of emulsions is to be prevented. Here even small amounts are extremely effective. Likewise, this property can be used if already existing emulsions are to be broken up. Compounds that break emulsions are also referred to as demulsifiers.
- the present invention also relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the at least one hydrophobin or at least one derivative thereof, is used as a demulsifier.
- hydrophobins For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive.
- the amino acid sequence of the natural hydrophobins is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.
- the N- and C-terminus is variable over a larger range.
- z For example, fusion partner proteins with a length of 10 to 500 amino acids found according to molecular biological techniques known to those skilled in the art can be added.
- hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence.
- hydrophobins are to be understood below to mean polypeptides of the general structural formula (I)
- X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
- X may be the same or different.
- the indices standing at X each represent the number of amino acids
- C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300.
- the polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.
- the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or can form disulfide bridges with one another.
- C-C bridges particularly preferred is the intramolecular formation of C-C bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges.
- cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
- cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions designated X, the numbering of the individual C-positions in the general formulas may change accordingly.
- X, C and the indices standing at X and C have the above meaning
- the indices n and m are numbers between 0 and 300
- the proteins are further characterized by the contact angle change mentioned above, and furthermore, at least 6 of the radicals named C are cysteine. Most preferably, all C radicals are cysteine.
- hydrophobins of the general formula (III) X n -C -X ⁇ -gC -C -Xn- 39 -C -X 2 - 23 -C -X ⁇ -gC -C -X 6 - 18 "C -X m (III)
- the proteins are further characterized by the abovementioned contact angle change, and at least 6 of the C named residues are cysteine. Most preferably, all of the C radicals are cysteine.
- radicals X n and X m may it be peptide sequences that are growing naturally, also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
- X n and / or X n are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50 and most preferably at least 100 amino acids in length.
- Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner.
- the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.
- the fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X n ,) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X n ,) of the protein according to the invention.
- fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
- fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin.
- fragments or derivatives of said sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50%, and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids.
- the fusion hydrophobin in addition to the fusion partner as a group X n or X n , nor a so-called affinity domain (affinity tag / affinity tail) on.
- affinity domains include (His) k , (Arg) k , (Asp) k , (Phe) k or (Cys) k groups, where k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
- proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaric dialdehyde.
- a characteristic of the hydrophobins or their derivatives used according to the invention is the change of surface properties when the surfaces are coated with the proteins.
- the change in surface properties can be determined experimentally, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
- contact angle measurements is known in principle to the person skilled in the art.
- the measurements refer to room temperature and water drops of 5 ⁇ l and the use of glass slides as substrate.
- the exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
- the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
- hydrophobins for carrying out the present invention are the dewA, rodA, hypA, hypB, sc3, basfi, basf2 hydrophobins structurally characterized in the Sequence Listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them together with a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
- proteins yaad-XadewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1-his (SEQ ID NO: 24) with the polypeptide sequences given in parentheses and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
- proteins which, starting from the amino acid sequences shown in SEQ ID NO. 20, 22 or 24 shown by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins particularly preferred embodiments.
- the biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
- Derivatives particularly useful in the practice of the invention are those of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ ID NO: 20), yaad-Xa-dewA-his (SEQ ID NO: 22), yaad-Xa-basf 1 -his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his
- the truncated residue should comprise at least 20, preferably at least 35, amino acids.
- a truncated radical having 20 to 293, preferably 25 to 250, particularly preferably 35 to
- a cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage etc.).
- fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA), one behind the other.
- hydrophobin fragments for example N- or C-terminal truncations
- muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the liquid phases to be separated.
- hydrophobins used according to the invention or the hydrophobins contained in the formulations according to the invention can be prepared chemically by known processes of peptide synthesis, for example by solid phase synthesis according to Merrifield.
- Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
- fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
- a production method is disclosed, for example, in DE 102005007480.4.
- Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spe ⁇ , Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
- prokaryotes including archaea
- eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Asperg
- the invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
- constructs used include a promoter 5 "upstream from the particular coding sequence and a terminator sequence 3" downstream, and optionally further conventional regulatory elements, each operably linked to the coding sequence.
- an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
- operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
- Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.
- a preferred nucleic acid construct advantageously also contains one or more so-called “enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 "end of the DNA sequences, such as further regulatory elements or terminators.
- the nucleic acids may be contained in one or more copies in the construct.
- the construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
- Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
- Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
- the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
- a vector such as a plasmid or a phage
- all other vectors known to the person skilled in the art ie, z.
- viruses such as SV40, CMV, baculovirus and adenovirus, transposon JS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.
- vectors can be autonomously replicated in the host organism or replicated chromosomally.
- Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL.24, pl_G200, pUR290 J plN-III lI 3-B1 J tgt11 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, plL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or p
- the plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). be removed.
- nucleic acid construct for expression of the further genes contained additionally 3 'and / or 5 "-terminal regulatory sequences for increasing the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
- genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
- the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
- enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
- an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
- the vector containing the nucleic acid construct or the nucleic acid may also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
- This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
- An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator. or polyadenylation signal.
- Common recombinant and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusion, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
- the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
- Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
- recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used in the invention.
- the recombinant constructs described above are introduced into a suitable host system and expressed.
- Homologously recombined microorganisms can also be produced.
- a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector).
- the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
- the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
- the modified section of the invention according to The gene used is in the homologous recombination vector.
- suitable vectors for homologous recombination is e.g. As described in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.
- prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for such nucleic acids or such nucleic acid constructs.
- microorganisms such as bacteria, fungi or yeast are used as host organisms.
- Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.
- Microorganisms are generally contained in a liquid medium containing a carbon source mostly in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts, and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 ° C attracted under oxygen fumigation.
- a carbon source mostly in the form of sugars
- a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate
- trace elements such as iron, manganese and magnesium salts
- optionally vitamins at temperatures between 0 and 100 0 C, preferably between 10 to 60 ° C attracted under oxygen fumigation.
- the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
- the cultivation can be done batchwise, semi-batchwise or continuously.
- Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
- the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
- the hydrophobins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture.
- the proteins can thus also be produced on an industrial scale, if desired.
- the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J.
- the cells are then disrupted if the proteins are not secreted into the culture medium and the product recovered from the lysate by known protein isolation techniques.
- the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
- Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Methoden, Verlag Water de Gruyer, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
- the fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers.
- Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be increased significantly.
- separation methods are also known as affinity chromatography.
- anchor groups can be used in the production of proteins vector systems or oligonucleotides that extend the cDNA to certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors.
- Histidine-anchored modified fusion hydrophobins can be purified chromatographically using, for example, nickel-Sepharose as column filling.
- the fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.
- the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be disrupted by means of suitable methods, for example by means of the methods already mentioned above, and the cell debris is separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents.
- the inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH.
- the purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight with respect to the amount of all proteins.
- the solutions obtained by the described simplified purification process can be used without further purification to carry out this invention.
- hydrophobins prepared as described can be used as "pure" hydrophobins both directly as fusion proteins and after cleavage and separation of the fusion partner.
- a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
- Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools.
- Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
- the hydrophobins or derivatives thereof can be used to improve the phase separation in compositions containing at least two liquid phases.
- These may be any compositions as long as they have at least two liquid phases.
- compositions which are in the form of an emulsion prior to the addition of the at least one hydrophobin or derivative thereof.
- composition may also have further phases in addition to the at least two liquid phases.
- the at least two liquid phases are two liquid phases of different density, for example an oil and water, two aqueous solutions of different densities, two organic solutions of different densities, a fuel and water, a fuel and water or a solvent and water.
- an aqueous solution is understood as meaning solutions which comprise water, optionally in combination with another solvent.
- Each of the liquid phases may contain further substances in the context of the present invention.
- an oil is preferably a crude oil.
- Suitable solvents are all liquids which form two-phase mixtures with water, in particular organic solvents, for example ethers, aromatic compounds such as toluene or benzene, alcohols, alkanes, alkenes, cycloalkanes, cycloalkenes, esters, ketones, naphthenes or halogenated hydrocarbons.
- organic solvents for example ethers, aromatic compounds such as toluene or benzene, alcohols, alkanes, alkenes, cycloalkanes, cycloalkenes, esters, ketones, naphthenes or halogenated hydrocarbons.
- the present invention therefore relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the composition containing at least two liquid phases is selected from the group consisting of
- compositions containing oil preferably crude oil, and water
- compositions containing fuel or water and water compositions containing fuel or water and water
- Reaction mixtures containing at least two liquid phases Reaction mixtures containing at least two liquid phases.
- composition may also contain other phases, for example a solid or liquid phase, in particular a solid phase.
- the hydrophobins or derivatives thereof can be used for all applications known to those skilled in the art.
- the use as a demulsifier in gasoline / water mixtures as a demulsifier in other fuel or fuel / water mixtures, the phase separation in chemical reactions, especially in large-scale processes, the emulsion cleavage between crude oil and water in the crude oil production or crude oil production, as well as the desalination of crude oil by extraction of crude oil with water and subsequent cleavage of the resulting emulsion.
- large-scale chemical processes all of these are suitable in which a phase separation is to be brought about, for example the hydroforming of polyisobutene with cobalt catalysts, the catalyst removal taking place in an aqueous state.
- hydrophobins or derivatives thereof are also used according to the invention for the phase separation of compositions containing at least two liquid Improve phases that occur in the course of a reaction, ie that form in the course of a reaction or occur by the addition of a solvent or a component.
- compositions comprising two aqueous phases of different density, wherein an aqueous phase is understood as meaning a phase which contains water, optionally in combination with a further solvent.
- hydrophobins or derivatives thereof can be used, for example, to improve the phase separation in the fractionation of polymers in aqueous systems.
- water-soluble polymers are fractionated.
- extracted oil is generally present as a relatively stable water-in-oil emulsion which, depending on the type of deposit, may contain up to 90% by weight of water.
- extracted oil falls after the separation of a major part of the water to a crude oil, which still contains about 2 to 3 wt.% Water.
- This is problematic insofar as the water is on the one hand very saline and thus corrosive acts, on the other hand is increased by the residual water to be transported and stored volume, resulting in increased costs.
- hydrophobins or derivatives thereof can be used to particular advantage in order to improve the phase separation in these compositions. It is achieved a very fast separation.
- the demulsifier must be adjusted to the type of emulsified oils and fats as well as optionally contained emulsifiers and surfactants to achieve optimum effect.
- Breaking of emulsions may be additionally supported by an elevated temperature, for example a temperature of 0 to 100 0 C, for example from 10 to 80 ° C, in particular from 20 to 60 ° C.
- Other applications of the invention include, for example, the demulsification of impregnating emulsions in the chipboard and textile industry, as well as of Drug emulsions.
- Another application is the demulsification of organically treated effluents, such as industrial and commercial effluents, particularly from metalworking, such as metalworking coolants, tanneries and oil refineries, and domestic sources that produce oil / water emulsions.
- Such wastewater is produced, for example, in the processing of crude oil in refineries and petrochemical plants. Before these effluents can be fed to the treatment plant, it is necessary to separate oil residues, which are often in the form of an emulsion.
- a further application according to the invention is the emulsion splitting of oil-in-water or water-in-oil mixtures, for example emulsions which have been used as cooling lubricants and are to be recycled.
- emulsions which have been used as cooling lubricants and are to be recycled.
- water / oil mixtures also occur on board seagoing vessels as bilgewater.
- the separation of emulsions is necessary in order to be able to separate the water and to reduce the amount of the solvent to be disposed of.
- the amount of hydrophobin or derivative thereof used can vary within wide limits, the amount advantageously being matched to the composition per se and optionally to other components contained in the composition.
- the composition contains substances which retard or worsen a phase separation of the at least two liquid phases, for example surfactants or emulsifiers, it is advantageous to use a larger amount of a hydrophobin or a derivative thereof.
- oils in particular crude oils, consist of a mixture of many chemical compounds, it is necessary, due to the different chemical composition of the oil, the water and salt fractions and the concrete conditions of emulsion splitting, such as temperature, duration of emulsion splitting, type of metered addition and interactions with other components of the mixture to tailor the demister to the specific conditions.
- the at least one hydrophobin or derivative thereof can be used according to the invention in any suitable amount.
- the at least one hydrophobin or derivative thereof is used in an amount of 0.0001 to 1000 ppm on the entire composition, used; preferably in an amount of 0.001 to 500 ppm, more preferably of 0.01 to 200 ppm or 0.01 to 100 ppm and most preferably 0.1 to 50 ppm.
- the present invention relates to a use as described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used.
- concentration used will be determined by one skilled in the art according to the nature of the composition to be demulsified.
- the hydrophobin or derivative thereof will generally be present in an amount of from 0.001 to 10 ppm, preferably from 0.005 to 2 ppm, more preferably from 0.01 to 1 ppm, particularly preferably 0.05 to 0.5 ppm and more preferably used from 0.01 to 0.1 ppm.
- the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 800 ppm, more preferably from 5 to 500 ppm, most preferably 10 used to 200 ppm and more preferably from 15 to 100 ppm and used, for example 20 to 50 ppm.
- the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 500 ppm, in particular from 5 to 250 ppm, more preferably 10 to 200 ppm and more preferably used from 15 to 100 ppm.
- the composition contains, in addition to the at least one hydrophobin or derivative thereof, further compounds which improve the phase separation.
- further compounds which improve the phase separation.
- suitable as a further compound for improving the phase separation are oxyalkylated phenol-formaldehyde resins, EO / PO block copolymers, crosslinked diepoxides, polyamides or their derivatives, in particular for use as emulsion breakers in crude oil production Alkoxylates, salts of sulfonic acids, ethoxylated fatty amines, succinates and the compounds mentioned in DE 10 2005 006 030.7 for such applications.
- the present invention relates to a use as described above, wherein in addition to at least one hydrophobin or the at least one derivative thereof, at least one further compound is used which improves the phase separation.
- the present invention also relates to a process for the separation of at least two liquid phases in a composition comprising at least two liquid phases, comprising the addition of at least one hydrophobin or at least one derivative thereof to the composition.
- the composition may be a composition as described above containing at least two liquid phases.
- the present invention therefore relates to such a process, wherein the composition containing at least two liquid phases is selected from the group consisting of
- compositions containing oil preferably crude oil, and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.
- the hydrophobins or derivatives thereof can be used in any desired amounts, provided that an improvement in the phase separation is achieved. Particularly suitable is the use of a hydrophobin or derivative thereof in an amount of 0.0001 to 1000 ppm, based on the total composition.
- the present invention relates to a method described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used. Preferred amounts for the respective systems have already been mentioned.
- the process according to the invention may comprise further steps, for example those which improve a phase separation or the breaking of emulsions.
- This may be, for example, a temperature increase or centrifugation.
- Such a step may occur before, during or after the addition of the at least one hydrophobin or derivative thereof.
- the present invention therefore relates to a method as described above, wherein the method comprises, before or after the addition of the at least one hydrophobin or the at least one derivative thereof, an increase in the temperature of the composition comprising at least two liquid phases.
- hydrophobins or derivatives thereof for example formulations containing fuels or fuels, may be added. This allows for contact of the formulation with water rapid segregation or prevents the formation of emulsions.
- the formulation comprising fuels or fuels may contain further additives which are customarily contained in such formulations.
- Suitable additives are mentioned, for example, in WO 2004/087808.
- the present invention therefore also relates to a formulation comprising at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.
- the amount of hydrophobin or derivative thereof used may vary depending on the other additives, as long as an improvement of the phase separation upon contact of the formulation with water is ensured.
- the amount of hydrophobin or derivative used is preferably in the range from 0.0001 to 1000 ppm, preferably from 0.001 to 500 ppm, more preferably from 0.01 to 100 ppm.
- the present invention also relates to a formulation as described above wherein the hydrophobin or the derivative thereof is contained in the formulation in an amount of from 0.0001 to 1000 ppm, based on the total formulation. If the formulation is a mixture containing a crude oil, the hydrophobin or derivative thereof is usually added to this formulation in an amount of from 1 to 1000 ppm, preferably from 10 to 800 ppm, in particular from 10 to 500 ppm.
- the hydrophobin or derivative thereof of this formulation is usually in an amount of 0.001 to 0.5 ppm, preferably from 0.005 to 0.3 ppm, in particular of 0 , 01 to 0.2 ppm added.
- the present invention relates to a formulation as described above wherein the formulation contains at least one fuel or power and the hydrophobin or derivative thereof in an amount of 0.001 to 0.5 ppm, based on the total formulation, in the formulation is included.
- fuels are understood as meaning, for example, light, medium or heavy fuel oils.
- fuels are understood as meaning, for example, gasoline fuels, diesel fuels or turbine fuels. Particularly preferred are gasoline fuels.
- the fuels may contain other additives.
- Usual additives are generally known to the expert. Suitable additives and solvents are mentioned, for example, in WO 2004/087808.
- additives with detergent action and / or with valve seat wear-inhibiting effect are additives with detergent action and / or with valve seat wear-inhibiting effect (hereinafter referred to as detergent additives).
- This detergent additive has at least one hydrophobic hydrocarbon radical with a number-average molecular weight M n of 85 to 20 000 g / mol and at least one polar group selected from:
- T polyoxy-C 2 to C 4 alkylene moieties terminated by hydroxyl groups, mono- or polyamino groups, wherein at least one nitrogen atom has basic properties, or terminated by carbamate groups;
- the hydrophobic hydrocarbon radical in the above detergent additives which provides the sufficient solubility in the fuel, has a number average molecular weight (Mn) of 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5000.
- Mn number average molecular weight
- Mono- or polyamino (a) -containing additives are preferably polyalkylene mono- or polyalkene polyamines based on polypropene or conventional (ie with predominantly intermediate double bonds) polybutene or polyisobutene having M n from 300 to 5000 g / mol. If one starts with the preparation of the additives of polybutene or polyisobutene with predominantly central double bonds (usually in the beta and gamma position), the preparation route by chlorination and subsequent amination or by oxidation of the double bond with air or ozone to carbonyl offers or carboxyl compound and subsequent amination under reductive (hydrogenating) conditions. For amination here amines, such as.
- ammonia monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, are used.
- Corresponding additives based on polypropene are described in particular in WO 94/24231.
- monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.
- nitropolyisobutenes eg., Alpha-pha, beta-dinitropolyisobutene
- mixed hydroxynitropolyisobutenes eg., Alpha-nitro-beta-hydroxypolyisobutene
- Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C2-C40 olefins with maleic anhydride having a total molecular weight of 500 to 20,000 whose carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remainder of the Carboxyl groups are reacted with alcohols or amines.
- Such additives are known in particular from EP-A 0 307 815.
- Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
- Sulfonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 0 639 632.
- Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
- Polyoxy-C2-C4-alkylene (f) containing additives are preferably polyether or polyetheramines, which by reaction of C2-C60-alkanols, C6-C30-alkanediols, mono- or di-C2-C30-alkylamines, C1-C30 Alkylcyclohexanolen or C1-C30-alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyether amines, by subsequent reductive amination with ammonia, monoamines or polyamines nen are available.
- Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416.
- polyethers such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobute- nolbutoxylate and propoxylates and the corresponding reaction products with ammonia.
- Carboxyl ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm 2 / s at 100 ° C, as described in particular in DE-A 38 38 918 are.
- mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 C atoms.
- esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.
- derivatives with aliphatic polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine.
- Such Otto fuel additives are described in particular in US 4,849,572.
- Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and Mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine.
- Such "polyisobutene-Mannich bases" are described in particular in EP-A 0 831 141.
- formulations according to the invention can moreover be combined with still further customary components and additives.
- carrier oils without pronounced detergent action are to be mentioned here.
- Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. According to the invention is suitable also is known as a "hydro-crack oil" and obtained in the refining of mineral oil fraction (vacuum distillate cut having a boiling range of about 360-500 0 C, available surfaces of high-pressure catalytically hydrogenated and isomerized and also deparaffinized natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.
- Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyethylenemolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.
- polyethers or polyetheramines are preferably polyoxy-C2-
- Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416.
- polyetheramines poly-C 2 -C 6 -alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.
- carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918.
- mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms.
- suitable representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and isotricanecanol, such as e.g. Di (n- or iso-tridecyl) phthalate.
- suitable synthetic carrier oils are alcohol-started polyethers with about 5 to 35, such as. B. about 5 to 30, C3-C6 alkylene oxide units, such as. B. selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof.
- suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C 6 -C 18 -alkyl radical.
- Preferred examples are tridecanol and nonylphenol.
- suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.
- ком ⁇ онентs are corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2, 4-di-tert-butylphenol or 3, 5-di-tert-butyl-4-hydroxyphenylpropionklare; other conventional demulsifiers; Antistatic agents; Metallocenes such as ferrocene; methylcyclopentadienyl; Lubricity additives such as certain fatty acids, alkenyl succinic acid esters, bis (hydroxyalkyl) fatty amines, hydroxyacetamides or castor oil; as well as dyes (markers).
- amines are added to lower the pH of the fuel.
- the said detergent additives with the polar groups (a) to (i) are added to the fuel usually in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight.
- the other components and additives mentioned are added, if desired, in customary amounts.
- fuels and fuels which are suitable according to the invention are all fuels and fuels known to the person skilled in the art, for example gasolines, as described, for example, in LJII-Mann's Encyclopedia of Industrial Chemistry, 5th ed. 1990, Volume A16, p. 719ff. are described.
- suitable fuels are also diesel fuel, kerosene and jet fuel.
- a gasoline with an aromatics content of 60, such. B. maximum 42 vol .-% and a maximum sulfur content of 2000, such as. B. maximum 150 ppm by weight is suitable.
- the aromatic content of the gasoline is for example 10 to 50, such as. B. 30 to 42 vol .-%, in particular 32 to 40 vol .-%.
- the sulfur content of the gasoline is for example 2 to 500, such as. B. 5 to 150 ppm by weight, or 10 to 100 ppm by weight.
- a suitable gasoline fuel for example, an olefin content up to 50 vol .-%, such as. B. from 6 to 21 vol .-%, in particular 7 to 18 vol .-%; a benzene content of up to 5 vol .-%, such as. B. 0.5 to 1.0 vol .-%, in particular 0.6 to 0.9 vol .-% and / or an oxygen content of up to 25 wt -.%, Such as. For example, up to 10% by weight or 1.0 to 2.7% by weight, in particular from 1.2 to 2.0% by weight.
- gasoline fuels can be exemplified, which at the same time have an aromatics content of at most 38% by volume, an olefin content of ma- ximal 21 vol .-%, a maximum sulfur content of 50 ppm by weight, a benzene content of not more than 1, 0 vol .-% and an oxygen content of 1, 0 to 2.7 wt -.% Have.
- the content of alcohols and ethers in gasoline can vary over a wide range. Examples of typical maximum contents are 15% by volume for methanol, 65% by volume for ethanol, 20% by volume for isopropanol, 15% by volume for tert-butanol, 20% by volume for isobutanol and 20% by weight for isobutanol for ethers with 5 or more C atoms in the molecule 30 vol .-%.
- the summer vapor pressure of a gasoline suitable according to the invention is usually not more than 70 kPa, in particular 60 kPa (each at 37 ° C).
- the ROZ of the gasoline is usually 75 to 105.
- a common range for the corresponding MOZ is 65 to 95.
- the specified specifications are determined by conventional methods (DIN EN 228).
- Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
- the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
- the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert, and in the previously linearized with the restriction endonucleases Ncol and BglII vector pQE60 from Qiagen Moniert.
- the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
- Hal570 gcgcgcccatggctcaaacaggtactga
- Hal571 gcagatctccagccgcgttcttgcatac
- Hal572 ggccatgggattaacaataggtgtactagg
- Hal573 gcagatcttacaagtgccttttgcttatattcc
- the template DNA was genomic DNA of the mold
- the resulting PCR fragment contained the coding
- the PCR fragment was purified and cut with the restriction endonuclease Barn HI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
- the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
- KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
- KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
- plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
- KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
- plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
- the template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12).
- KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
- Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
- Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
- Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).
- KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
- KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
- 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 ml sodium phosphate buffer, pH 7.5 and resuspended.
- the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated.
- filter with a glass cartridge P1.
- two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
- the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
- the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
- the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
- 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
- the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM Imidazole.
- the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
- Figure 1 shows the purification of the prepared hydrophobin: Lane A: Nickel Sepharose column (1:10 dilution)
- Lanes C - E OD 280 Maxima of elution fractions (WP1, WP2, WP3)
- Lane F shows the applied marker
- the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
- the smaller bands partially represent degradation products of hydrophobin.
- the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water with the coated glass surface determined at room temperature.
- the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
- hydrophobin concentrate yaad-Xa-dewA-HiS ⁇
- additive packages Modern fuels usually contain a number of different additives (so-called additive packages). If the fuel comes in contact with water in the course of the production or distribution, these additives can develop emulsifying effect and lead to the formation of undesirable fuel-water emulsions. In order to avoid this effect, therefore, demulsifiers are usually added to the fuels.
- the hydrophobin concentrate was diluted with ethanol and added to a commercial Eurosuper fuel (according to EN 228), which already contained 725 mg / kg of a special performance additive package A.
- This additive package consists mainly of the polyisobutenamine Kerocom PIBA, carrier oil mixtures, solvents, corrosion inhibitor and friction modifier.
- Fuel samples were prepared at 0.01, 0.03, 0.05, 0.07, 0.14 and 0.28 mg / kg of hydrophobin.
- the reference (10-V1) was the A-additive fuel without hydrophobin.
- 10-V2 1.45 mg / kg of a commercially available demulsifier D based on phenolic resins (ADX 606, from Lubrizol) were used.
- Emulsion tests according to DIN 51415 were carried out in each case with the fuel samples. In each case 80 ml of fuel and 20 ml of water are intensively mixed with each other. Thereafter, the segregation process is observed as a function of time. The evaluation is based on standards specified in the standard, where 1 stands for a very good segregation and larger numbers for increasingly poorer segregation. The details are contained in the cited DIN standard. Table 1 summarizes results of the experiments. In each case, the assessments of the phase separation layers are listed after 1 min, 5 min, 30 min and 60 min. As a rule, a rating of 1 or 1 b is required after 5 minutes.
- hydrophobins have a very good demulsifying effect even in extremely small amounts. Already 0.01 ppm of hydrophobin leads to an acceptable result within 1 min. The same effect as with 0.07 mg / kg of hydrophobin is achieved only by adding 1.45 mg / kg of the commercial demulsifier based on phenolic resins to the fuel. When using hydrophobin ity only about 1/20 of the amount of a conventional demulsifier to achieve the same effect required.
- bovine serum albumin BSA
- casein bovine serum albumin
- SEQ ID NO 15 and 16 ie the non-hydrophobin-associated fusion partner alone.
- the respective protein was added in a concentration of 0.07 mg / kg to a commercial Euro Super fuel (according to EN 228), which already contained 1000 mg / kg of the abovementioned performance additive package A.
- the only fuel used as a reference was A, without protein.
- the proteins used have a demulsifying effect, but the rate of demulsification is slower than with the use of hydrophobins.
- hydrophobin concentrate in various amounts was added to 50 ml of crude oil (sample ex Wintershall AG, Emiichheim, probe 301, residual water content after the use of conventional emulsion breakers about 3%).
- concentration of hydrophobin in the crude oil was 1 ppm, 10 ppm and 40 ppm. After homogenization, the mixtures were 10 min. at 2000 rpm, centrifuged. The results are shown in Table 3.
- fusion hydrophobin Yaad-Xa-dewA-HiS ⁇
- BSA bovine serum albumin
- the experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20) and carried out with a commercially available solution of bovine serum albumin (BSA).
- BSA bovine serum albumin
- the demulsification test was carried out as follows:
Abstract
The invention relates to the use of at least one protein, especially at least one hydrophobin or at least one derivative thereof, for improving the phase separation in compositions containing at least two liquid phases. The invention also relates to a method for separating at least two liquid phases in a composition containing at least two liquid phases, and formulations containing at least one compound selected from the group consisting of fuels, combustibles, crude oil or water-soluble or oil-soluble polymer solutions, and at least one protein, especially at least one hydrophobin or derivatives thereof.
Description
Verwendung von Proteinen als DemulgatorenUse of proteins as demulsifiers
Beschreibungdescription
Die vorliegende Erfindung betrifft die Verwendung mindestens eines Hydrophobins oder mindestens eines Derivats davon zur Verbesserung der Phasentrennung in Zusammensetzungen enthaltend mindestens zwei flüssige Phasen, Verfahren zur Trennung von mindestens zwei flüssigen Phasen in einer Zusammensetzung enthaltend mindestens zwei flüssige Phasen, sowie Formulierungen, enthaltend mindestens eine Verbindung ausgewählt aus der Gruppe bestehend aus Kraftstoffen, Brennstoffen, Rohölen oder wasser- oder öllöslichen Polymerlösungen und mindestens ein Hydrophobin oder Derivate davon.The present invention relates to the use of at least one hydrophobin or at least one derivative thereof for improving the phase separation in compositions comprising at least two liquid phases, processes for the separation of at least two liquid phases in a composition containing at least two liquid phases, and formulations containing at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.
Hydrophobine sind kleine Proteine von etwa 100 bis 150 Aminosäuren, die charakteris- tisch für filamentöse Pilze, beispielsweise Schizophyllum commune, sind. Sie weisen in aller Regel 8 Cystein-Einheiten auf.Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units.
Hydrophobine weisen eine ausgeprägte Affinität zu Grenzflächen auf und eignen sich daher zur Beschichtung von Oberflächen, um die Eigenschaften der Grenzflächen durch Bildung von amphiphatischen Membranen zu verändern. So lässt sich beispielsweise Teflon mittels Hydrophobinen unter Erhalt einer hydrophilen Oberfläche beschichten.Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphiphatic membranes. Thus, for example, Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
Hydrophobine können aus natürlichen Quellen isoliert werden. Ebenso sind Herstell- verfahren für Hydrophobine und Derivate davon bekannt. Beispielsweise DE 10 2005 007 480.4 offenbart ein Herstellverfahren für Hydrophobine und Derivate davon.Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.
Im Stand der Technik ist die Verwendung von Hydrophobinen für verschiedene Anwendungen vorgeschlagen worden.The use of hydrophobins for various applications has been proposed in the prior art.
WO 96/41882 schlägt die Verwendung von Hydrophobinen als Emulgatoren, Verdicker, oberflächenaktive Substanzen, zum Hydrophilieren hydrophober Oberflächen, zur Verbesserung der Wasserbeständigkeit hydrophiler Substrate, zur Herstellung von Öl-inWasser-Emulsionen oder von Wasser-in-öl-Emulsionen vor. Weiterhin werden phar- mazeutische Anwendungen wie die Herstellung von Salben oder Cremes sowie kosmetische Anwendungen wie Hautschutz oder die Herstellung von Haarshampoos oder Haarspülungen vorgeschlagen. WO 96/41882 beansprucht darüber hinaus Zusammensetzungen, insbesondere Zusammensetzungen für pharmazeutische Anwendungen, enthaltend Hydrophobine.
EP-A 1 252 516 offenbart die Beschichtung von Fenstern, Kontaktlinsen, Biosensoren, medizinischen Vorrichtungen, Behältern zur Durchführung von Versuchen oder zur Lagerung, Schiff rümpfen, festen Teilchen oder Rahmen oder Karosserie von Personenkraftwagen mit einer Hydrophobine enthaltenden Lösung bei einer Temperatur von 30 bis 800C.WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover claims compositions, in particular compositions for pharmaceutical applications, containing hydrophobins. EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out tests or for storage, ship hulls, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C.
WO 03/53383 offenbart die Verwendung von Hydrophobin zum Behandeln von Keratin- Materialien in kosmetischen Anwendungen.WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
WO 03/10331 offenbart, dass Hydrophobine oberflächenaktive Eigenschaften aufweisen. So wird ein mit Hydrophobin beschichteter Sensor offenbart, beispielsweise eine Messelektrode, an den nicht kovalent weitere Substanzen, z.B. elektroaktive Substanzen, Antikörper oder Enzyme gebunden sind.WO 03/10331 discloses that hydrophobins have surface-active properties. Thus, a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
WO 2004/000880 offenbart ebenfalls die Beschichtung von Oberflächen mit Hydrophobin oder Hydrophobin-ähnlichen Substanzen. Weiter wird offenbart, dass auch Öl-inWasser oder Wasser-in-öl Emulsionen durch Zugabe von Hydrophobinen stabilisiert werden können.WO 2004/000880 also discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.
Auch WO 01/74864, die Hydrophobin-ähnliche Proteine betrifft, offenbart, dass diese zur Stabilisierung von Dispersionen und Emulsionen eingesetzt werden können.WO 01/74864, which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.
Die Verwendung von Proteinen zur Phasentrennung ist prinzipiell bekannt.The use of proteins for phase separation is known in principle.
GB 195,876 offenbart ein Verfahren zum Brechen von Wasser-in-öl-Emulsionen unter Verwendung von Kolloiden. Als Kolloide werden beispielhaft Proteine wie Gelatine, Casein, Albumin oder Polysccharide wie Gummi Arabicum oder Gummi Tragacanth genannt.GB 195,876 discloses a method of breaking water-in-oil emulsions using colloids. Examples of colloids are proteins such as gelatin, casein, albumin or polysccharides such as gum arabic or gum tragacanth.
JP-A 11-169177 offenbart die Verwendung von Proteinen mit Lipase-Aktivität zum Brechen von Emulsionen.JP-A 11-169177 discloses the use of proteins having lipase activity for breaking emulsions.
WO 01/60916 offenbart die Verwendung von tensidfreien Mischungen aus mindestens einem wasserlöslichen Protein, mindestens einem wasserlöslichen Polysaccharid so- wie mindestens einem wasserlöslichen Polymer wie bspw. Polyethylenoxid für verschiedene Anwendungen, darunter auch zum Demulgieren von Rohöl.WO 01/60916 discloses the use of surfactant-free mixtures of at least one water-soluble protein, at least one water-soluble polysaccharide and at least one water-soluble polymer such as polyethylene oxide for various applications, including for demulsifying crude oil.
Keine der zitierten Schriften offenbart die Verwendung von Hydrophobinen zur Phasentrennung.
Die Verwendung von Proteinen hat den Vorteil, dass es sich um auch natürlich vorkommende Substanzen handelt, die biologisch abbaubar sind und damit nicht zu einer dauerhaften Belastung der Umwelt führen.None of the cited documents discloses the use of hydrophobins for phase separation. The use of proteins has the advantage that they are also naturally occurring substances that are biodegradable and thus do not lead to a permanent burden on the environment.
Bei vielen großtechnischen Anwendungen, beispielsweise bei der Trennung von Rohöl-Wasser-Emulsionen, kommt es auf eine möglichst schnelle Phasentrennung an. Aufgabe der Erfindung war es, ein verbessertes Verfahren zur Phasentrennung mit Proteinen bereit zu stellen.In many large-scale applications, for example, in the separation of crude oil-water emulsions, it depends on the fastest possible phase separation. The object of the invention was to provide an improved process for the phase separation with proteins.
Erfindungsgemäß wird diese Aufgabe gelöst durch die Verwendung mindestens eines Hydrophobins zur Verbesserung der Phasentrennung in Zusammensetzungen enthaltend mindestens zwei flüssige Phasen.According to the invention, this object is achieved by the use of at least one hydrophobin for improving the phase separation in compositions containing at least two liquid phases.
Dabei kann das Hydrophobin erfindungsgemäß grundsätzlich in beliebiger Menge eingesetzt werden, solange gewährleistet ist, dass die Phasentrennung in den Zusammensetzungen enthaltend mindestens zwei flüssige Phasen verbessert wird.In this case, the hydrophobin according to the invention can in principle be used in any amount, as long as it is ensured that the phase separation in the compositions containing at least two liquid phases is improved.
Unter „Verbesserung der Phasentrennung" wird im Rahmen der vorliegenden Erfin- düng verstanden, dass die Trennung von zwei flüssigen Phasen bei Zusatz einer Substanz zu einem Gemisch schneller erfolgt, als in demselben Gemisch ohne den Zusatz der Substanz, bzw. dass durch den Zusatz der Substanz die Trennung von zwei flüssigen Phasen erst ermöglicht wird.In the context of the present invention, "improvement of the phase separation" is understood to mean that the separation of two liquid phases on addition of a substance to a mixture takes place more rapidly than in the same mixture without the addition of the substance, or that the addition of the substance Substance the separation of two liquid phases is only possible.
Unter einem Hydrophobin werden im Rahmen der vorliegenden Erfindung auch Derivate davon bzw. modifizierte Hydrophobin verstanden. Bei modifizierten bzw. derivatisier- ten Hydrophobinen kann es sich beispielsweise um Hydrophobinfusionsproteine handeln oder um Proteine, die eine Aminosäurensequenz aufweisen, die mindestens 60%, beispielsweise mindestens 70 %, insbesondere mindestens 80 %, besonders bevor- zugt mindestens 90 %, insbesondere bevorzugt mindestens 95 % Identität mit der Sequenz eines Hydrophobins aufweist, und die noch zu 50 %, beispielsweise zu 60 %, insbesondere zu 70 %, besonders bevorzugt zu 80 %, die biologischen Eigenschaften eines Hydrophobins erfüllt, insbesondere die Eigenschaft, dass die Oberflächeneigenschaften durch Beschichten mit diesen Proteinen derart geändert werden, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung einer Glasoberfläche mit dem Protein eine Vergrößerung um mindestens 20°, bevorzugt um mindestens 25°, insbesondere um mindestens 30° aufweist.In the context of the present invention, a hydrophobin is also understood as meaning derivatives thereof or modified hydrophobin. Modified or derivatized hydrophobins may, for example, be hydrophobin infusion proteins or proteins which have an amino acid sequence which is at least 60%, for example at least 70%, in particular at least 80%, more preferably at least 90%, most preferably at least Has 95% identity with the sequence of a hydrophobin, and still to 50%, for example, to 60%, in particular to 70%, particularly preferably 80%, the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with These proteins are changed such that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably by at least 25 °, in particular by at least 30 °.
Überraschenderweise wurde gefunden, dass Hydrophobine oder Derivate davon, die Phasentrennung von mindestens zwei flüssigen Phasen verbessern.
Dies ist insbesondere vorteilhaft, wenn eine schnelle Phasentrennung erreicht werden soll, oder das Auftreten von Emulsionen verhindert werden soll. Hierbei sind schon geringe Mengen äußerst wirksam. Ebenso kann diese Eigenschaft genutzt werden, wenn bereits bestehende Emulsionen aufgebrochen werden sollen. Verbindungen, die Emulsionen brechen, werden auch als Demulgatoren bezeichnet.Surprisingly, it has been found that hydrophobins or derivatives thereof improve the phase separation of at least two liquid phases. This is particularly advantageous if rapid phase separation is to be achieved or the occurrence of emulsions is to be prevented. Here even small amounts are extremely effective. Likewise, this property can be used if already existing emulsions are to be broken up. Compounds that break emulsions are also referred to as demulsifiers.
Daher betrifft die vorliegende Erfindung auch eine wie oben beschriebene Verwendung mindestens eines Hydrophobins oder mindestens eines Derivats davon, wobei das mindestens eine Hydrophobin oder mindestens eine Derivat davon, als Demulgator eingesetzt wird.Therefore, the present invention also relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the at least one hydrophobin or at least one derivative thereof, is used as a demulsifier.
Für die Definition von Hydrophobinen ist dabei die Struktur- und nicht die Sequenzspe- zifität der Hydrophobine entscheidend. Die Aminosäuresequenz der natürlichen Hydrophobine ist sehr divers, sie haben jedoch alle ein hochcharakteristisches Muster von 8 konservierten Cysteinresten. Diese Reste bilden vier intramolekulare Disulfid- brücken.For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive. The amino acid sequence of the natural hydrophobins is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.
Der N- und C-Terminus ist über einen größeren Bereich variabel. Hier können z. B. nach dem Fachmann bekannten molekularbiologischen Techniken gefundene Fusionspartnerproteine mit einer Länge von 10 bis 500 Aminosäuren angefügt werden.The N- and C-terminus is variable over a larger range. Here can z. For example, fusion partner proteins with a length of 10 to 500 amino acids found according to molecular biological techniques known to those skilled in the art can be added.
Darüber hinaus sind im Sinne der vorliegenden Erfindung unter Hydrophobinen und Derivaten davon Proteine mit einer ähnlichen Struktur und funktioneller Äquivalenz zu verstehen.In addition, for the purposes of the present invention, hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence.
Unter dem Begriff „Hydrophobine" im Sinne der vorliegenden Erfindung sollen im Folgenden Polypeptide der allgemeinen Strukturformel (I)For the purposes of the present invention, the term "hydrophobins" is to be understood below to mean polypeptides of the general structural formula (I)
Xn-C -Xi_5o-C -Xo-5-C -Xi-ioo-C -Xi_ioo-C -Xi_5o-C -X0-S-C -Xi-S0-C -Xm (I)X n -C -Xi_ 5 oC -Xo 5 -C -Xi-ioo-C -Xi_ioo-C -Xi_ 5 oC -X 0-S -C -Xi -S0 -C -X m (I)
verstanden werden, wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann. Dabei können X jeweils gleich oder verschieden sein. Hierbei stellen die bei X stehenden Indizes jeweils die Anzahl der Aminosäuren dar, C steht für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin, wobei mindestens vier der mit C benannten Reste für Cystein stehen, und die Indizes n und m stehen unabhängig voneinander für natürliche Zahlen zwischen 0 und 500, bevorzugt zwischen 15 und 300.
Die Polypetide gemäß der Formel (I) sind weiterhin durch die Eigenschaft charakterisiert, dass sie bei Raumtemperatur nach Beschichten einer Glasoberfläche eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, bevorzugt mindestens 25° und besonders bevorzugt 30° bewirken, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der un beschichteten Glasoberfläche.where X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand. X may be the same or different. Here, the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300. The polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.
Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemäßen Proteinen entweder reduziert vorliegen oder miteinander Di- sulfidbrücken ausbilden.The amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or can form disulfide bridges with one another.
Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevorzugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.Particularly preferred is the intramolecular formation of C-C bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der ein- zelnen C-positionen in den allgemeinen Formeln entsprechend verändern.If cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions designated X, the numbering of the individual C-positions in the general formulas may change accordingly.
Bevorzugt werden Hydrophobine der allgemeinen Formel (II)Preference is given to hydrophobins of the general formula (II)
Xn-C -X3-25-C -Xθ-2"C -X5-50-C -X2-35"C -X2-15"C -Xθ-2"C -X3-35"C -Xm (H)X n -C-C -X3-25 -Xθ-2 "C-C -X5-50 -X2-35" C -X2-15 "C -Xθ-2" C -X3-35 "C -Xm (H )
zur Ausführung der vorliegenden Erfindung eingesetzt, wobei X, C und die bei X und C stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 300 stehen, und sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, und es sich weiterhin bei mindestens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Reste C um Cystein.used for carrying out the present invention, wherein X, C and the indices standing at X and C have the above meaning, the indices n and m are numbers between 0 and 300, and the proteins are further characterized by the contact angle change mentioned above, and furthermore, at least 6 of the radicals named C are cysteine. Most preferably, all C radicals are cysteine.
Besonders bevorzugt werden Hydrophobine der allgemeinen Formel (IM)
Xn-C -Xδ-g-C -C -Xn-39-C -X2-23-C -Xδ-g-C -C -X6-18"C -Xm (III)Particular preference is given to hydrophobins of the general formula (III) X n -C -X δ -gC -C -Xn- 39 -C -X 2 - 23 -C -X δ -gC -C -X 6 - 18 "C -X m (III)
eingesetzt, wobei X, C und die bei X stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 200 stehen, sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, und es sich bei mindestens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Resten C um Cystein.where X, C and the indices standing at X have the above meaning, the indices n and m are numbers between 0 and 200, the proteins are further characterized by the abovementioned contact angle change, and at least 6 of the C named residues are cysteine. Most preferably, all of the C radicals are cysteine.
Bei den Resten Xn und Xm kann es sich um Peptidsequenzen handeln, die natürlicher- weise auch mit einem Hydrophobin verknüpft sind. Es kann sich aber auch bei einem oder beiden Resten um Peptidsequenzen handeln, die natürlicherweise nicht mit einem Hydrophobin verknüpft sind. Darunter sind auch solche Reste Xn und/oder Xm zu verstehen, bei denen eine natürlicherweise in einem Hydrophobin vorkommende Peptid- sequenz durch eine nicht natürlicherweise in einem Hydrophobin vorkommende Pep- tidsequenz verlängert ist.The radicals X n and X m may it be peptide sequences that are growing naturally, also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
Falls es sich bei Xn und/oder Xn, um natürlicherweise nicht in Hydrophobinen verknüpfte Peptidsequenzen handelt, sind derartige Sequenzen in der Regel mindestens 20, bevorzugt mindestens 35, besonders bevorzugt mindestens 50 und ganz besonders be- vorzugt mindestens 100 Aminosäuren lang. Ein derartiger, natürlicherweise nicht mit einem Hydrophobin verknüpfter Rest soll im Folgenden auch als Fusionspartner bezeichnet werden. Damit soll ausgedrückt werden, dass die Proteine aus mindestens einem Hydrophobinteil und einem Fusionspartnerteil bestehen können, die in der Natur nicht zusammen in dieser Form vorkommen.If X n and / or X n are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50 and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.
Der Fusionspartnerteil kann aus einer Vielzahl von Proteinen ausgewählt werden. Es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xn,) des Hydropho- binteils. Es können aber auch beispielsweise zwei Fusionspartner mit einer Position (Xn oder Xn,) des erfindungsgemäßen Proteins verknüpft werden.The fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X n ,) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X n ,) of the protein according to the invention.
Besonders geeignete Fusionspartner sind Proteine, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartner sind die Sequenzen yaad (SEQ ID NO: 15 und 16), yaae (SEQ ID NO: 17 und 18), und Thioredoxin. Gut geeignet sind auch Fragmente oder Derivate dieser genannten Sequenzen, die nur einen Teil, beispielsweise 70 bis 99 %, bevorzugt 5 bis 50 %, und besonders bevorzugt 10 bis 40 % der genannten Sequenzen umfassen, oder bei denen einzelne Aminosäuren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind, wobei sich die Prozentangaben jeweils auf die Anzahl der Ami- nosäuren bezieht.
In einer weiterhin bevorzugten Ausführungsform weist das Fusion-Hydrophobin neben dem Fusionspartner als eine Gruppe Xn oder Xn, noch eine sogenannte Affinitätsdomäne (affinity tag / affinity tail) auf. Hierbei handelt es sich in prinzipiell bekannter Art und Weise um Ankergruppen, welche mit bestimmten komplementären Gruppen wechselwirkend können und der leichteren Aufarbeitung und Reinigung der Proteine dienen können. Beispiele derartiger Affinitätsdomänen umfassen (His)k- , (Arg)k-, (Asp)k-, (Phe)k- oder (Cys)k-Gruppen, wobei k im allgemeinen für eine natürliche Zahl von 1 bis 10 steht. Bevorzugt kann es sich um eine (His)k-Gruppe handeln, wobei k für 4 bis 6 steht.Particularly suitable fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis. Examples of such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin. Also suitable are fragments or derivatives of said sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50%, and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids. In a further preferred embodiment, the fusion hydrophobin in addition to the fusion partner as a group X n or X n , nor a so-called affinity domain (affinity tag / affinity tail) on. These are in a manner known in principle to anchor groups, which can interact with certain complementary groups and can be used to facilitate processing and purification of the proteins. Examples of such affinity domains include (His) k , (Arg) k , (Asp) k , (Phe) k or (Cys) k groups, where k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
Die erfindungsgemäß als Hydrophobine oder Derivate davon verwendeten Proteine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielswei- se mit Glutardialdehyd.The proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaric dialdehyde.
Eine Eigenschaft der erfindungsgemäß verwendeten Hydrophobine bzw. deren Derivate ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Proteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich ex- perimentell beispielsweise dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung der Oberfläche mit dem Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird.A characteristic of the hydrophobins or their derivatives used according to the invention is the change of surface properties when the surfaces are coated with the proteins. The change in surface properties can be determined experimentally, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die Messungen beziehen sich auf Raumtemperatur sowie Wassertropfen von 5 μl und die Verwendung von Glasplättchen als Substrat. Die genauen experimentellen Bedingungen für eine beispielhaft geeignete Methode zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt. Unter den dort genannten Bedingungen besitzen die erfindungsgemäß verwendeten Fusionsproteine die Eigenschaft, den Kontaktwinkel um mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30° zu vergrößern, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der un beschichteten Glasoberfläche.The implementation of contact angle measurements is known in principle to the person skilled in the art. The measurements refer to room temperature and water drops of 5 μl and the use of glass slides as substrate. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part. Under the conditions mentioned there, the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
Besonders bevorzugte Hydrophobine zur Ausführung der vorliegenden Erfindung sind die Hydrophobine des Typs dewA, rodA, hypA, hypB, sc3, basfi , basf2, die im nachfolgenden Sequenzprotokoll strukturell charakterisiert sind. Es kann sich auch nur um Teile oder Derivate davon handeln. Es können auch mehrere Hydrophobinteile, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft und mit einer entsprechenden geeigneten Polypeptidsequenz, die natürlicherweise nicht mit einem Hydrophobin verbunden ist, verknüpft werden.
Erfindungsgemäß besonders geeignet sind weiterhin die Fusionsproteine yaad-Xa- dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf 1 - his (SEQ ID NO: 24) mit den in Klammern angegebenen Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäß SEQ ID NO: 19, 21 , 23. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 20, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deleti- on von mindestens einer, bis hin zu 10, bevorzugt 5, besonders bevorzugt 5% aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50% besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die bereits beschriebene Änderung des Kontaktwinkels um mindestens 20° verstanden.Particularly preferred hydrophobins for carrying out the present invention are the dewA, rodA, hypA, hypB, sc3, basfi, basf2 hydrophobins structurally characterized in the Sequence Listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them together with a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin. Also particularly suitable according to the invention are the fusion proteins yaad-XadewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1-his (SEQ ID NO: 24) with the polypeptide sequences given in parentheses and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also proteins which, starting from the amino acid sequences shown in SEQ ID NO. 20, 22 or 24 shown by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins particularly preferred embodiments. The biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
Besonders zur Ausführung der Erfindung geeignete Derivate sind von yaad-Xa-dewA- his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf 1 -his (SEQDerivatives particularly useful in the practice of the invention are those of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ
ID NO: 24) durch Verkürzung des yaad-Fusionspartners abgeleitete Reste. Anstelle des vollständigen yaad-Fusionspartners (SEQ ID NO: 16) mit 294 Aminosäuren kann vorteilhaft ein verkürtzer yaad-Rest eingesetzt werden. Der verkürzte Rest sollte aber zumindest 20, bevorzugt mindestens 35 Aminosäuren umfassen. Beispielsweise kann ein verkürzter Rest mit 20 bis 293, bevorzugt 25 bis 250, besonders bevorzugt 35 bisID NO: 24) residues derived by truncation of the yaad fusion partner. Instead of the complete yaad fusion partner (SEQ ID NO: 16) with 294 amino acids, advantageously a shortened yaad residue can be used. However, the truncated residue should comprise at least 20, preferably at least 35, amino acids. For example, a truncated radical having 20 to 293, preferably 25 to 250, particularly preferably 35 to
150 und beispielsweise 35 bis 100 Aminosäuren eingesetzt werden.150 and for example 35 to 100 amino acids are used.
Eine Spaltstelle zwischen dem Hydrophobin und dem Fusionspartner bzw. den Fusionspartnern kann dazu genutzt, das reine Hydrophobin in underivatisierter Form frei- zusetzen (beispielsweise durch BrCN-Spaltung an Methionin, Faktor Xa-, Enterokinase-, Thrombin-, TEV-Spaltung etc.).A cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage etc.). ,
Es ist weiterhin möglich, Fusionsproteine aus einem Fusionspartner, beispielsweise yaad oder yaae, und mehreren Hydrophobinen, auch unterschiedlicher Sequenz, bei- spielsweise DewA-RodA oder Sc3-DewA, Sc3-RodA), hintereinander zu generieren. Ebenso können Hydrophobinfragmente (beispielsweise N- oder C-terminale Verkürzungen) oder Mutein, die bis zu 70% Homologie aufweisen, eingesetzt werden. Die Auswahl der optimalen Konstrukte erfolgt jeweils in Bezug auf die jeweilige Verwendung, d.h. die zu trennenden flüssigen Phasen.It is furthermore possible to generate fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA), one behind the other. Likewise, hydrophobin fragments (for example N- or C-terminal truncations) or muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the liquid phases to be separated.
Die erfindungsgemäß verwendeten Hydrophobine, bzw. die in den erfindungsgemäßen Formulierungen enthaltenen Hydrophobine lassen sich chemisch durch bekannte Verfahren der Peptidsynthese, beispielsweise durch Festphasensynthese nach Merrifield herstellen.
Natürlich vorkommende Hydrophobine lassen sich aus natürlichen Quellen mittels geeigneter Methoden isolieren. Beispielhaft sei auf Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) oder WO 96/41882 verwiesen.The hydrophobins used according to the invention or the hydrophobins contained in the formulations according to the invention can be prepared chemically by known processes of peptide synthesis, for example by solid phase synthesis according to Merrifield. Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
Die Herstellung von Fusionsproteinen kann bevorzugt durch gentechnische Verfahren erfolgen, bei denen eine für den Fusionspartner und eine für den Hydrophobinteil codierende Nukleinsäuresequenz, insbesondere DNA-Sequenz, so kombiniert werden, dass in einem Wirtsorganismus durch Genexpression der kombinierten Nukleinsäuresequenz das gewünschte Protein erzeugt wird. Ein derartiges Herstellverfahren ist bei- spielsweise in DE 102005007480.4 offenbart.The production of fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence. Such a production method is disclosed, for example, in DE 102005007480.4.
Geeignete Wirtsorganismen (Produktionsorganismen) für das genannte Herstellverfahren können dabei Prokaryonten (einschließlich der Archaea) oder Eukaryonten sein, besonders Bakterien einschließlich Halobacterien und Methanococcen, Pilze, Insek- tenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas speα, Lactobacillen, Hansenula poly- morpha, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a..Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas speα, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
Gegenstand der Erfindung ist außerdem die Verwendung von Expressionskonstrukten, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen, eine für ein erfindungsgemäß verwendetes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte.The invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
Vorzugsweise umfassen eingesetzte Konstrukte 5"-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3"-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.Preferably, constructs used include a promoter 5 "upstream from the particular coding sequence and a terminator sequence 3" downstream, and optionally further conventional regulatory elements, each operably linked to the coding sequence.
Unter einer "operativen Verknüpfung" wird im Rahmen der vorliegenden Erfindung die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann, verstanden.In the context of the present invention, an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie En- hancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene
Expression Technology : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).Examples of operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like. Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesen Regulationssequenzen kann die natürliche Regulation dieser Se- quenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.In addition to these regulatory sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.
Ein bevorzugtes Nukleinsäurekonstrukt enthält vorteilhaft auch eine oder mehrere so- genannte "Enhancer"-Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 3"-Ende der DNA- Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren.A preferred nucleic acid construct advantageously also contains one or more so-called "enhancer" sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 "end of the DNA sequences, such as further regulatory elements or terminators.
Die Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Au- xotrophien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein.The nucleic acids may be contained in one or more copies in the construct. The construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
Vorteilhafte Regulationssequenzen für die Herstellung sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, Iaclq-T7-, T5-, T3-, gal-, trc-, ara- , rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhaft in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulationssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH enthalten.Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
Es können auch künstliche Promotoren für die Regulation verwendet werden.It is also possible to use artificial promoters for regulation.
Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhafterweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind außer Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, TransposonsJS- EIe- mente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium- System zu verstehen.The nucleic acid construct, for expression in a host organism, is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host. In addition to plasmids and phages, all other vectors known to the person skilled in the art, ie, z. For example, viruses such as SV40, CMV, baculovirus and adenovirus, transposon JS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden. Geeignete Plasmide sind beispielsweise in E. coli pLG338, pACYC184, pBR322, pUC18,pUC19, pKC30, pRep4, pHS1 , pKK223-3, pDHE19.2, pHS2,
pPLc236, pMBL.24, pl_G200, pUR290JplN-llllI3-B1J tgt11 oder pBdCI, in Streptomyces plJ101 , plJ364, plJ702 oder plJ361, in Bacillus pUB110, pC194 oder pBD214, in Cory- nebacterium pSA77 oder pAJ667, in Pilzen pALS1 , plL2 oder pBB116, in Hefen 2alpha, pAG-1, YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23,pGHIac+, pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann bekannt und können beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.These vectors can be autonomously replicated in the host organism or replicated chromosomally. Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL.24, pl_G200, pUR290 J plN-III lI 3-B1 J tgt11 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, plL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHIac +, pBIN19, pAK2004 or pDH51. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). be removed.
Vorteilhaft enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3"-und/oder 5"-terminale regulatorische Sequenzen zur Steigerung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.Advantageously, the nucleic acid construct for expression of the further genes contained additionally 3 'and / or 5 "-terminal regulatory sequences for increasing the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.These regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Genexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.The regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase. Thus, enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. In addition, however, an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
In einer weiteren Ausgestaltungsform des Vektors kann der das Nukleinsäurekonstrukt oder die Nukleinsäure enthaltende Vektor auch vorteilhaft in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Re- kombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nukleinsäurekonstrukt oder der Nukleinsäure bestehen.In a further embodiment of the vector, the vector containing the nucleic acid construct or the nucleic acid may also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage" zu verändern. Der "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.For optimal expression of heterologous genes in organisms, it is advantageous to modify the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be easily determined by computer evaluations of other known genes of the organism concerned.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Pro- motors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminator-
oder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F.Fritsch und J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) und in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator. or polyadenylation signal. Common recombinant and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusion, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus, vorteilhaft in einen wirtsspezifischen Vektor inser- tiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden.The recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
Mit Hilfe der Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Hydrophobine oder Derivate davon eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfek- tion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscien- ce, New York 1997, oder Sambrook et al. Molecular Cloning : A Laboratory Manual. 2. Aufl., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989 beschrieben.With the help of the vectors recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used in the invention. Advantageously, the recombinant constructs described above are introduced into a suitable host system and expressed. In this case, it is preferable to use familiar cloning and transfection methods known to the person skilled in the art, for example co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, in order to express the stated nucleic acids in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscene, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Colard Spring Harbor Laboratory, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, NY, 1989.
Es sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Ve k- tor hergestellt, der zumindest einen Abschnitt eines zu verwendenden Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure- Deletion, -Addition oder -Substitution eingebracht worden ist, um die Sequenz zu verändern, z. B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Sequenz kann z. B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe- oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombination mutiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z. B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endo- genen Proteins verändert wird). Der veränderte Abschnitt des erfindungsgemäß ver-
wendeten Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z. B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.Homologously recombined microorganisms can also be produced. For this, a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector). The introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source. Alternatively, the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed). The modified section of the invention according to The gene used is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is e.g. As described in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.
Als rekombinante Wirtsorganismen für derartige Nukleinsäuren oder derartige Nuklein- säurekonstrukte kommen prinzipiell alle prokarγontischen oder eukarγontischen Organismen in Frage. Vorteilhafterweise werden als Wirtsorganismen Mikroorganismen wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden gram-positive oder gramnegative Bakterien, bevorzugt Bakterien der Familien Enterobacteriaceae, Pseudomo- nadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevorzugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.In principle, all prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for such nucleic acids or such nucleic acid constructs. Advantageously, microorganisms such as bacteria, fungi or yeast are used as host organisms. Gram-positive or Gram-negative bacteria, preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.
Die im soben beschriebenen Herstellverfahren für Fusionsproteine verwendeten Orga- nismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise angezogen bzw. gezüchtet. Mikroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoffquelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan- und Magnesiumsalze sowie gegebenen- falls Vitamine enthält, bei Temperaturen zwischen 0 und 100 0C, bevorzugt zwischen 10 bis 60 °C unter Sauerstoffbegasung angezogen. Dabei kann der pH-Wert der Nährflüssigkeit auf einem festen Wert gehalten werden, das heißt während der Anzucht reguliert werden oder nicht. Die Anzucht kann "batch"-weise, "semi-batch"-weise oder kontinuierlich erfolgen. Nährstoffe können zu Beginn der Fermentation vorgelegt oder semikontinuierlich oder kontinuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebenen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reaktion verwendet werden.Depending on the host organism, the organisms used for fusion proteins in the above-described production process are grown or bred in a manner known to the person skilled in the art. Microorganisms are generally contained in a liquid medium containing a carbon source mostly in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts, and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 ° C attracted under oxygen fumigation. In this case, the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not. The cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
Die erfindungsgemäß verwendeten Hydrophobine oder funktionelle, biologisch aktive Fragmente davon können mittels eines Verfahrens zur rekombinanten Herstellung hergestellt werden, wobei man einen Polypeptide-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Proteine induziert und diese aus der Kultur isoliert. Die Proteine können so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Ver- fahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB- oder LB-Medium und bei einer Temperatur von 20 bis 40°C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Labo- ratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) be- schrieben.
Die Zellen werden dann, falls die Proteine nicht in das Kulturmedium sezerniert werden, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z. B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.The hydrophobins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture. The proteins can thus also be produced on an industrial scale, if desired. The recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989). The cells are then disrupted if the proteins are not secreted into the culture medium and the product recovered from the lysate by known protein isolation techniques. The cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
Eine Aufreinigung der Proteine kann mit bekannten, chromatographischen Verfah- ren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q- Sepharose- Chromatographie, lonenaustausch-Chromatographie und hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden bei- spielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Water de Gruy- ter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin beschrieben.Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Arbeitsmethoden, Verlag Water de Gruyer, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
Besonders vorteilhaft kann es sein, die Fusions-Hydrophobine zur Erleichterung der Isolierung und Reinigung mit speziellen Ankergruppen zu versehen, die an entsprechende komplementäre Gruppen an festen Trägern, insbesondere geeigneten Polymeren anbinden können. Derartige feste Träger können beispielsweise als Füllung für Chromatographiesäulen verwendet werden, und auf diese Art und Weise kann die Effizienz der Trennung in der Regel deutlich gesteigert werden. Solche Trennverfahren sind auch als Affinitätschromatographie bekannt. Zum Einbau der Ankergruppen kann man bei der Herstellung der Proteine Vektorsysteme oder Oligonukleotide verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit veränderte Proteine oder Fusionsproteine kodieren. Zur leichteren Reinigung modifierte Proteine umfassen als Anker fungierende sogenannte "Tags", wie beispielsweise die als Hexa- Histidin-Anker bekannte Modifikation. Mit Histidin-Ankem modifizierte Fusions-Hydrophobine lassen sich beispielsweise unter Verwendung von Nickel-Sepharose als Säulenfüllung chromatographisch reinigen. Das Fusions-Hydrophobin kann anschließend mittels geeigneten Mitteln zum Eluieren, wie beispielsweise einer Imidazol-Lösung, wieder von der Säule eluiert werden.It may be particularly advantageous to provide the fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers. Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be increased significantly. Such separation methods are also known as affinity chromatography. For the incorporation of the anchor groups can be used in the production of proteins vector systems or oligonucleotides that extend the cDNA to certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors. Histidine-anchored modified fusion hydrophobins can be purified chromatographically using, for example, nickel-Sepharose as column filling. The fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.
In einem vereinfachten Reinigungsverfahren kann auf die chromatographische Reinigung verzichtet werden. Hierzu werden die Zellen zunächst mittels einer geeigneten Methode aus der Fermetationsbrühe abgetrennt, beispielsweise durch Mikrofiltration oder durch Zentrifugieren. Anschließend können die Zellen mittels geeigneter Metho- den, beispielsweise mittels der bereits oben genannten Methoden, aufgeschlossen,
und die Zelltrümmer von den Einschlusskörpern (inclusion bodies) getrennt werden. Letzteres kann vorteilhaft durch Zentrifugieren erfolgen. Schließlich können die Einschlusskörper in prinzipiell bekannter Art und Weise aufgeschlossen werden, um die Fusions - Hydrophobine freizusetzen. Dies kann beispielsweise durch Säuren, Basen und/oder Detergentien erfolgen. Die Einschlusskörper mit den erfindungsgemäß verwendeten Fusion-Hydrophobinen können in der Regel schon unter Verwendung von 0,1 m NaOH innerhalb von ca. 1 h vollständig gelöst werden. Die Reinheit der nach diesem vereinfachten Verfahren erhaltenen Fusions-Hydrophobine liegt in der Regel bei 60 bis 80 Gew. % bzgl. der Menge aller Proteine. Die nach dem beschriebenen, vereinfachten Reinigungsverfahren erhaltenen Lösungen können ohne weitere Reinigung zur Ausführung dieser Erfindung eingesetzt werden.In a simplified purification process can be dispensed with the chromatographic purification. For this purpose, the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be disrupted by means of suitable methods, for example by means of the methods already mentioned above, and the cell debris is separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents. The inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH. The purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight with respect to the amount of all proteins. The solutions obtained by the described simplified purification process can be used without further purification to carry out this invention.
Die wie beschrieben hergestellten Hydrophobine können sowohl direkt als Fusionsproteine als auch nach Abspaltung und Abtrennung des Fusionspartners als „reine" Hydrophobine verwendet werden.The hydrophobins prepared as described can be used as "pure" hydrophobins both directly as fusion proteins and after cleavage and separation of the fusion partner.
Wenn eine Abtrennung des Fusionspartners vorgesehen ist, empfiehlt es sich eine potentielle Spaltstelle (spezifische Erkennungsstelle für Proteasen) in das Fusionsprotein zwischen Hydrophobinteil und Fusionspartnerteil einzubauen. Als Spaltstelle ge- eignet sind insbesondere solche Peptidsequenzen, die ansonsten weder im Hydrophobinteil noch im Fusionspartnerteil vorkommen, was sich mit bioinformatischen Tools leicht ermitteln lässt. Besonders geeignet sind beispielsweise BrCN-Spaltung an Methionin, oder durch Protease vermittelte Spaltlung mit Faktor Xa-, Enterokinase-, Thrombin, TEV-Spaltung (Tobacca etch virus Protease).If a separation of the fusion partner is envisaged, it is advisable to incorporate a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part. Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
Erfindungsgemäß können die Hydrophobine oder Derivate davon, zur Verbesserung der Phasentrennung in Zusammensetzungen enthaltend mindestens zwei flüssige Phasen eingesetzt werden. Dabei kann es sich um beliebige Zusammensetzungen handeln, solange diese mindestens zwei flüssige Phasen aufweisen.According to the invention, the hydrophobins or derivatives thereof can be used to improve the phase separation in compositions containing at least two liquid phases. These may be any compositions as long as they have at least two liquid phases.
Insbesondere kann es sich auch um Zusammensetzungen handeln, die vor der Zugabe des mindestens einen Hydrophobins oder Derivats davon, in Form einer Emulsion vorliegen.In particular, it may also be compositions which are in the form of an emulsion prior to the addition of the at least one hydrophobin or derivative thereof.
Die Zusammensetzung kann dabei im Rahmen der vorliegenden Erfindung neben den mindestens zwei flüssigen Phasen auch weitere Phasen aufweisen.In the context of the present invention, the composition may also have further phases in addition to the at least two liquid phases.
Bei den mindestens zwei flüssigen Phasen handelt es sich um zwei flüssige Phasen unterschiedlicher Dichte, beispielsweise um ein öl und Wasser, zwei wässrige Lösun- gen unterschiedlicher Dichte, zwei organische Lösungen unterschiedlicher Dichte,
einen Kraftstoff und Wasser, einen Brennstoff und Wasser oder ein Lösungsmittel und Wasser. Dabei werden unter einer wässrigen Lösung im Rahmen der vorliegenden Erfindung Lösungen verstanden, die Wasser, gegebenenfalls in Kombination mit einem weiteren Lösungsmittel enthalten. Jede der flüssigen Phasen kann dabei im Rahmen der vorliegenden Erfindung weitere Stoffe enthalten.The at least two liquid phases are two liquid phases of different density, for example an oil and water, two aqueous solutions of different densities, two organic solutions of different densities, a fuel and water, a fuel and water or a solvent and water. In the context of the present invention, an aqueous solution is understood as meaning solutions which comprise water, optionally in combination with another solvent. Each of the liquid phases may contain further substances in the context of the present invention.
Erfindungsgemäß handelt es sich bei einem öl vorzugsweise um ein Rohöl.According to the invention, an oil is preferably a crude oil.
Geeignete Lösungsmittel sind alle Flüssigkeiten, die mit Wasser zweiphasige Gemi- sehe ausbilden, insbesondere organische Lösungsmittel, beispielsweise Ether, aromatische Verbindungen wie Toluol oder Benzol, Alkohole, Alkane, Alkene, Cycloalkane, Cycloalkene, Ester, Ketone, Naphtene oder halogenierte Kohlenwasserstoffe.Suitable solvents are all liquids which form two-phase mixtures with water, in particular organic solvents, for example ethers, aromatic compounds such as toluene or benzene, alcohols, alkanes, alkenes, cycloalkanes, cycloalkenes, esters, ketones, naphthenes or halogenated hydrocarbons.
Gemäß einer weiteren Ausführungsform betrifft die vorliegende Erfindung daher eine wie zuvor beschriebene Verwendung mindestens eines Hydrophobins oder mindestens eines Derivats davon, wobei die Zusammensetzung enthaltend mindestens zwei flüssige Phasen ausgewählt ist aus der Gruppe bestehend ausAccording to a further embodiment, the present invention therefore relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the composition containing at least two liquid phases is selected from the group consisting of
Zusammensetzungen enthaltend öl, bevorzugt Rohöl, und Wasser, - Zusammensetzungen enthaltend Kraft- oder Brennstoff und Wasser,Compositions containing oil, preferably crude oil, and water, compositions containing fuel or water and water,
Reaktionsgemischen enthaltend mindestens zwei flüssige Phasen.Reaction mixtures containing at least two liquid phases.
Im Rahmen der vorliegenden Erfindung kann die Zusammensetzung auch weitere Phasen enthalten, beispielsweise eine feste oder flüssige Phase, insbesondere eine feste Phase.In the context of the present invention, the composition may also contain other phases, for example a solid or liquid phase, in particular a solid phase.
Die Hydrophobine oder Derivate davon können für alle dem Fachmann bekannten Anwendungen eingesetzt werden. Insbesondere sind im Rahmen der vorliegenden Erfindung die Verwendung als Demulgator in Ottokraftstoff/Wasser-Mischungen, als De- mulgator in anderen Kraftstoff- oder Brennstoff/Wasser-Mischungen, die Phasentrennung bei chemischen Reaktionen, insbesondere bei großtechnischen Prozessen, die Emulsionsspaltung zwischen Rohöl und Wasser bei der Rohölförderung bzw. Rohölproduktion, sowie die Entsalzung von Rohöl durch Extraktion von Rohöl mit Wasser sowie anschließende Spaltung der resultierenden Emulsion zu nennen. Als großtech- nische chemische Prozesse kommen all diese in Frage, bei denen eine Phasentrennung herbeigeführt werden soll, beispielsweise die Hydroformulierung von Polyisobu- ten mit Kobalt-Katalysatoren, wobei die Katalysatorabtrennung wässerig erfolgt.The hydrophobins or derivatives thereof can be used for all applications known to those skilled in the art. In particular, in the context of the present invention, the use as a demulsifier in gasoline / water mixtures, as a demulsifier in other fuel or fuel / water mixtures, the phase separation in chemical reactions, especially in large-scale processes, the emulsion cleavage between crude oil and water in the crude oil production or crude oil production, as well as the desalination of crude oil by extraction of crude oil with water and subsequent cleavage of the resulting emulsion. As large-scale chemical processes, all of these are suitable in which a phase separation is to be brought about, for example the hydroforming of polyisobutene with cobalt catalysts, the catalyst removal taking place in an aqueous state.
Die Hydrophobine oder Derivate davon werden erfindungsgemäß auch verwendet, um die Phasentrennung von Zusammensetzungen enthaltend mindestens zwei flüssigen
Phasen verbessern, die im Verlauf einer Reaktion auftreten, d.h. die sich im Verlauf einer Reaktion bilden oder die durch Zugabe eines Lösungsmittels oder einer Komponente auftreten. Durch die erfindungsgemäße Verwendung von Hydrophobinen oder Derivaten davon wird eine Verkürzung der Phasentrennzeit erreicht und der Verlust an Wertstoffen kann verringert werden.The hydrophobins or derivatives thereof are also used according to the invention for the phase separation of compositions containing at least two liquid Improve phases that occur in the course of a reaction, ie that form in the course of a reaction or occur by the addition of a solvent or a component. By the use according to the invention of hydrophobins or derivatives thereof, a shortening of the phase separation time is achieved and the loss of valuable substances can be reduced.
Ebenso ist es erfindungsgemäß möglich, die Phasentrennung von Zusammensetzungen enthaltend zwei wässrige Phasen unterschiedlicher Dichte zu verbessern, wobei unter einer wässrigen Phase eine Phase verstanden wird, die Wasser, gegebenenfalls in Kombination mit einem weiteren Lösungsmittel enthält. Erfindungsgemäß können Hydrophobine oder Derivate davon beispielsweise eingesetzt werden, um die Phasentrennung bei der Fraktionierung von Polymeren in wässrigen Systemen zu verbessern. Dabei werden insbesondere wasserlösliche Polymere fraktioniert.Likewise, it is possible according to the invention to improve the phase separation of compositions comprising two aqueous phases of different density, wherein an aqueous phase is understood as meaning a phase which contains water, optionally in combination with a further solvent. According to the invention, hydrophobins or derivatives thereof can be used, for example, to improve the phase separation in the fractionation of polymers in aqueous systems. In particular, water-soluble polymers are fractionated.
Generell sind sämtliche dem Fachmann bekannten wasser- und öllöslichen Polymere zu nennen, insbesondere Polyacrylate und deren Copolymere, die herstellbedingt mit einer Molmassenverteilung bzw. Polydispersität von größer 1,1 anfallen.In general, all water and oil-soluble polymers known to the person skilled in the art, in particular polyacrylates and their copolymers, which, owing to their production, have a molecular weight distribution or polydispersity of greater than 1.1 are to be mentioned.
Durch Zugabe von Demulgatoren können Emulsionen gebrochen werden. So liegt bei- spielsweise gefördertes Erdöl in der Regel als relativ stabile Wasser-in-öl-Emulsion vor, welche je nach Art der Lagerstätte bis zu 90 Gew. % Wasser enthalten kann. Bei der Aufarbeitung und Reinigung des Rohöls fällt nach dem Abtrennen eines Großteils des Wassers ein Rohöl an, das immer noch ca. 2 bis 3 Gew. % Wasser enthält. Dieses bildet mit dem öl eine stabile Emulsion, die auch durch Zentrifugierung und Zugabe herkömmlicher Demulgatoren nicht vollständig abzutrennen ist. Dies ist insofern problematisch, als das Wasser einerseits stark salzhaltig ist und damit korrodierend wirkt, zum anderen wird durch das Restwasser das zu transportierende und zu lagernde Volumen erhöht, was zu erhöhten Kosten führt. Erfindungsgemäß wurde gefunden, dass Hydrophobine oder Derivate davon besonders vorteilhaft eingesetzt werden können, um die Phasentrennung in diesen Zusammensetzungen zu verbessern. Es wird eine sehr schnelle Trennung erreicht.By adding demulsifiers emulsions can be broken. Thus, for example, extracted oil is generally present as a relatively stable water-in-oil emulsion which, depending on the type of deposit, may contain up to 90% by weight of water. When working up and cleaning the crude oil falls after the separation of a major part of the water to a crude oil, which still contains about 2 to 3 wt.% Water. This forms a stable emulsion with the oil, which can not be completely separated by centrifuging and adding conventional demulsifiers. This is problematic insofar as the water is on the one hand very saline and thus corrosive acts, on the other hand is increased by the residual water to be transported and stored volume, resulting in increased costs. According to the invention, it has been found that hydrophobins or derivatives thereof can be used to particular advantage in order to improve the phase separation in these compositions. It is achieved a very fast separation.
Dabei muss der Demulgator auf die Art der emulgierten öle und Fette sowie auf gegebenenfalls enthaltene Emulgatoren und Tenside eingestellt werden, um eine optimale Wirkung zu erzielen. Das Brechen von Emulsionen kann durch eine erhöhte Temperatur zusätzlich unterstützt werden, beispielsweise eine Temperatur von 0 bis 1000C, beispielsweise von 10 bis 80 °C, insbesondere von 20 bis 60°C.In this case, the demulsifier must be adjusted to the type of emulsified oils and fats as well as optionally contained emulsifiers and surfactants to achieve optimum effect. Breaking of emulsions may be additionally supported by an elevated temperature, for example a temperature of 0 to 100 0 C, for example from 10 to 80 ° C, in particular from 20 to 60 ° C.
Weitere erfindungsgemäße Anwendungen umfassen beispielsweise das Demulgieren von Imprägnieremulsionen in der Spanplatten- und Textilindustrie, sowie von
Medikamentemulsionen. Eine weitere Anwendung ist die Emulsionsspaltung organisch behandelter Abwässer, beispielsweise industrieller und gewerblicher Abwässer, insbesondere aus der Metallverarbeitung, beispielsweise Kühlschmiermittel aus der Metallverarbeitung, aus Gerbereien und Erdölraffinerien sowie häuslichen Quellen, bei denen Öl/Wasser-Emulsionen anfallen. Derartige Abwässer entstehen beispielsweise bei der Verarbeitung von Erdöl in Raffinerien und petrochemischen Anlagen. Bevor diese Abwässer zur Kläranlage geführt werden können, ist es nötig, ölreste abzutrennen, die häufig in Form einer Emulsion vorliegen.Other applications of the invention include, for example, the demulsification of impregnating emulsions in the chipboard and textile industry, as well as of Drug emulsions. Another application is the demulsification of organically treated effluents, such as industrial and commercial effluents, particularly from metalworking, such as metalworking coolants, tanneries and oil refineries, and domestic sources that produce oil / water emulsions. Such wastewater is produced, for example, in the processing of crude oil in refineries and petrochemical plants. Before these effluents can be fed to the treatment plant, it is necessary to separate oil residues, which are often in the form of an emulsion.
Eine weitere erfindungsgemäße Anwendung ist die Emulsionsspaltung von Öl-inWasser- oder Wasser-in-öl-Gemischen, beispielsweise Emulsionen, die als Kühlschmierstoffe eingesetzt wurden und recycelt werden sollen. Wasser/Öl-Gemische fallen beispielsweise auch an Bord von Seeschiffen als Bilgewasser an. Dabei ist die Trennung von Emulsionen nötig, um das Wasser abtrennen zu können und die Menge des zu entsorgenden Lösungsmittels zu reduzieren.A further application according to the invention is the emulsion splitting of oil-in-water or water-in-oil mixtures, for example emulsions which have been used as cooling lubricants and are to be recycled. For example, water / oil mixtures also occur on board seagoing vessels as bilgewater. The separation of emulsions is necessary in order to be able to separate the water and to reduce the amount of the solvent to be disposed of.
Die Menge des eingesetzten Hydrophobins oder Derivats davon kann in weiten Bereichen variieren, wobei die Menge vorteilhafterweise auf die Zusammensetzung an sich und gegebenenfalls in der Zusammensetzung enthaltene weitere Komponenten abge- stimmt wird.The amount of hydrophobin or derivative thereof used can vary within wide limits, the amount advantageously being matched to the composition per se and optionally to other components contained in the composition.
Sofern beispielsweise die Zusammensetzung Stoffe enthält, die eine Phasentrennung der mindestens zwei flüssigen Phasen verzögern oder verschlechtern, beispielsweise Tenside oder Emulgatoren, wird vorteilhaft eine größere Menge eines Hydrophobins oder eines Derivats davon, eingesetzt.If, for example, the composition contains substances which retard or worsen a phase separation of the at least two liquid phases, for example surfactants or emulsifiers, it is advantageous to use a larger amount of a hydrophobin or a derivative thereof.
Da öle, insbesondere Rohöle, aus einem Gemisch vieler chemischer Verbindungen bestehen, ist es erforderlich, aufgrund der unterschiedlichen chemischen Zusammensetzung des Öls, der Wasser- und Salzanteile sowie der konkreten Bedingungen der Emulsionsspaltung, wie Temperatur, Dauer der Emulsionsspaltung, Art der Zudosie- rung und Wechselwirkungen mit weiteren Komponenten des Gemischs, den Demuga- tor auf die konkreten Bedingungen abzustimmen.Since oils, in particular crude oils, consist of a mixture of many chemical compounds, it is necessary, due to the different chemical composition of the oil, the water and salt fractions and the concrete conditions of emulsion splitting, such as temperature, duration of emulsion splitting, type of metered addition and interactions with other components of the mixture to tailor the demister to the specific conditions.
Überraschenderweise wurde gefunden, dass bereits geringe Mengen eines eines Hydrophobins oder Derivats davon, zu einer Verbesserung der Phasentrennung führen.Surprisingly, it has been found that even small amounts of one of a hydrophobin or derivative thereof lead to an improvement in the phase separation.
Das mindestens eine eine Hydrophobin oder Derivat davon kann erfindungsgemäß in jeder geeigneten Menge eingesetzt werden. In der Regel wird das mindestens eine Hydrophobin oder Derivat davon in einer Menge von 0,0001 bis 1000 ppm, bezogen
auf die gesamte Zusammensetzung, eingesetzt; bevorzugt in einer Menge von 0,001 bis 500 ppm, besonders bevorzugt von 0,01 bis 200 ppm oder 0,01 bis 100 ppm und ganz besonders bevorzugt 0,1 bis 50 ppm.The at least one hydrophobin or derivative thereof can be used according to the invention in any suitable amount. In general, the at least one hydrophobin or derivative thereof is used in an amount of 0.0001 to 1000 ppm on the entire composition, used; preferably in an amount of 0.001 to 500 ppm, more preferably of 0.01 to 200 ppm or 0.01 to 100 ppm and most preferably 0.1 to 50 ppm.
Im Rahmen der vorliegenden Anmeldung bezeichnet die Angabe ppm mg pro kg.In the context of the present application, the indication ppm ppm per kg.
Daher betrifft die vorliegende Erfindung gemäß einer weiteren Ausführungsform eine wie zuvor beschriebene Verwendung, wobei das mindestens eine Hydrophobin oder das mindestens eine Derivat davon, in einer Menge von 0,0001 bis 1000 ppm, bezo- gen auf die gesamte Zusammensetzung, eingesetzt wird. Die eingesetzte Konzentration wird vom Fachmann je nach der Art des zu demulgierenden Zusammensetzung festgelegt.Therefore, according to a further embodiment, the present invention relates to a use as described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used. The concentration used will be determined by one skilled in the art according to the nature of the composition to be demulsified.
Sofern es sich bei der Zusammensetzung um eine Zusammensetzung enthaltend Kraft- oder Brennstoffe und Wasser handelt, wird das Hydrophobin oder Derivat davon, in der Regel in einer Menge vom 0,001 bis 10 ppm, bevorzugt von 0,005 bis 2 ppm, insbesondere von 0,01 bis 1 ppm, besonders bevorzugt 0,05 bis 0,5 ppm und weiter bevorzugt von 0,01 bis 0,1 ppm eingesetzt.When the composition is a composition containing fuels or water, the hydrophobin or derivative thereof will generally be present in an amount of from 0.001 to 10 ppm, preferably from 0.005 to 2 ppm, more preferably from 0.01 to 1 ppm, particularly preferably 0.05 to 0.5 ppm and more preferably used from 0.01 to 0.1 ppm.
Sofern es sich bei der Zusammensetzung um eine Zusammensetzung enthaltend Rohöl und Wasser handelt, wird das Hydrophobin oder Derivat davon in der Regel in einer Menge vom 1 bis 1000 ppm, bevorzugt von 1 bis 800 ppm, insbesondere von 5 bis 500 ppm, besonders bevorzugt 10 bis 200 ppm und weiter bevorzugt von 15 bis 100 ppm eingesetzt und beispielsweise 20 bis 50 ppm eingesetzt.If the composition is a composition comprising crude oil and water, the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 800 ppm, more preferably from 5 to 500 ppm, most preferably 10 used to 200 ppm and more preferably from 15 to 100 ppm and used, for example 20 to 50 ppm.
Sofern es sich bei der Zusammensetzung um eine Zusammensetzung enthaltend zwei wässrige Phasen unterschiedlicher Dichte, die beispielsweise bei der Fraktionierung wasserlöslicher Polymere auftreten können, handelt, wird das Hydrophobin oder Derivat davon in der Regel in einer Menge vom 1 bis 1000 ppm, bevorzugt von 1 bis 500 ppm, insbesondere von 5 bis 250 ppm, besonders bevorzugt 10 bis 200 ppm und weiter bevorzugt von 15 bis 100 ppm eingesetzt.If the composition is a composition comprising two aqueous phases of different densities, which may occur, for example, in the fractionation of water-soluble polymers, the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 500 ppm, in particular from 5 to 250 ppm, more preferably 10 to 200 ppm and more preferably used from 15 to 100 ppm.
Erfindungsgemäß ist es auch möglich, dass die Zusammensetzung neben dem mindestens einen Hydrophobin oder Derivat davon, weitere Verbindungen enthält, die die Phasentrennung verbessern. Dabei kann es sich um alle Verbindungen handeln, die dem Fachmann für derartige Anwendungen bekannt sind. Beispielsweise geeignet als weitere Verbindung zur Verbesserung der Phasentrennung sind insbesondere für die Anwendung als Emulsionsspalter bei der Rohölproduktion oxyalkylierte Phenolformaldehydharze, EO/PO-Blockcopolymere, vernetzte Diepoxide, Polyamide bzw. deren
Alkoxylate, Salze der Sulfonsäuren, ethoxylierte Fettamine, Succinate sowie die in DE 10 2005 006 030.7 für derartige Anwendungen genannten Verbindungen.According to the invention, it is also possible that the composition contains, in addition to the at least one hydrophobin or derivative thereof, further compounds which improve the phase separation. These may be all compounds which are known to those skilled in such applications. For example, suitable as a further compound for improving the phase separation are oxyalkylated phenol-formaldehyde resins, EO / PO block copolymers, crosslinked diepoxides, polyamides or their derivatives, in particular for use as emulsion breakers in crude oil production Alkoxylates, salts of sulfonic acids, ethoxylated fatty amines, succinates and the compounds mentioned in DE 10 2005 006 030.7 for such applications.
Daher betrifft die vorliegende Erfindung gemäß einer weiteren Ausführungsform eine wie zuvor beschriebene Verwendung, wobei neben mindestens einen Hydrophobin oder dem mindestens einen Derivat davon mindestens eine weitere Verbindung eingesetzt wird, die die Phasentrennung verbessert.Therefore, according to a further embodiment, the present invention relates to a use as described above, wherein in addition to at least one hydrophobin or the at least one derivative thereof, at least one further compound is used which improves the phase separation.
Gemäß einem weiteren Aspekt betrifft die vorliegende Erfindung auch ein Verfahren zur Trennung von mindestens zwei flüssigen Phasen in einer Zusammensetzung enthaltend mindestens zwei flüssige Phasen, umfassend die Zugabe von mindestens einem Hydrophobin bzw. mindestens einem Derivat davon zu der Zusammensetzung.In a further aspect, the present invention also relates to a process for the separation of at least two liquid phases in a composition comprising at least two liquid phases, comprising the addition of at least one hydrophobin or at least one derivative thereof to the composition.
Dabei kann es sich bei der Zusammensetzung um eine wie zuvor beschriebene Zu- sammensetzung enthaltend mindestens zwei flüssige Phasen handeln.In this case, the composition may be a composition as described above containing at least two liquid phases.
Gemäß einer bevorzugten Ausführungsform betrifft die vorliegende Erfindung daher ein derartiges Verfahren, wobei die Zusammensetzung enthaltend mindestens zwei flüssige Phasen ausgewählt ist aus der Gruppe bestehend ausAccording to a preferred embodiment, the present invention therefore relates to such a process, wherein the composition containing at least two liquid phases is selected from the group consisting of
Zusammensetzungen enthaltend öl, bevorzugt Rohöl, und Wasser, Zusammensetzungen enthaltend Kraft- oder Brennstoff und Wasser, Reaktionsgemischen enthaltend mindestens zwei flüssige Phasen.Compositions containing oil, preferably crude oil, and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.
Grundsätzlich können im Rahmen der vorliegenden Erfindung die Hydrophobine oder Derivate davon in beliebigen Mengen eingesetzt werden, sofern eine Verbesserung der Phasentrennung erreicht wird. Insbesondere geeignet ist der Einsatz eines Hydropho- bins oder Derivats davon in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Zusammensetzung.In principle, in the context of the present invention, the hydrophobins or derivatives thereof can be used in any desired amounts, provided that an improvement in the phase separation is achieved. Particularly suitable is the use of a hydrophobin or derivative thereof in an amount of 0.0001 to 1000 ppm, based on the total composition.
Ebenso betrifft die vorliegende Erfindung ein zuvor beschriebenes Verfahren, wobei das mindestens eine Hydrophobin oder das mindestens eine Derivat davon, in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird. Bevorzugte Mengen für die jeweiligen Systeme wurden bereits genannt.Likewise, the present invention relates to a method described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used. Preferred amounts for the respective systems have already been mentioned.
Das erfindungsgemäße Verfahren kann weitere Schritte umfassen, beispielsweise solche, die eine Phasentrennung oder das Brechen von Emulsionen verbessern. Dabei kann es sich beispielsweise um eine Temperaturerhöhung oder um Zentrifugieren handeln. Ein derartiger Schritt kann vor, während oder nach der Zugabe des mindestens einen Hydrophobins oder Derivats davon erfolgen.
Gemäß einer weiteren Ausführungsform betrifft die vorliegende Erfindung daher ein wie zuvor beschriebenes Verfahren, wobei das Verfahren vor oder nach der Zugabe des mindestens einen Hydrophobins oder des mindestens einen Derivats davon eine Erhöhung der Temperatur der Zusammensetzung enthaltend mindestens zwei flüssige Phasen umfasst.The process according to the invention may comprise further steps, for example those which improve a phase separation or the breaking of emulsions. This may be, for example, a temperature increase or centrifugation. Such a step may occur before, during or after the addition of the at least one hydrophobin or derivative thereof. According to a further embodiment, the present invention therefore relates to a method as described above, wherein the method comprises, before or after the addition of the at least one hydrophobin or the at least one derivative thereof, an increase in the temperature of the composition comprising at least two liquid phases.
Erfindungsgemäß können Hydrophobine oder Derivate davon, beispielsweise Formulierungen enthaltend Kraft- oder Brennstoffe zugesetzt werden. Dies ermöglicht bei Kontakt der Formulierung mit Wasser eine schnelle Entmischung bzw. verhindert die Bildung von Emulsionen. Die Bildung von Emulsionen beispielsweise in Lagertanks würde aufwendige Reinigungsschritte der Formulierung nötig machen.According to the invention, hydrophobins or derivatives thereof, for example formulations containing fuels or fuels, may be added. This allows for contact of the formulation with water rapid segregation or prevents the formation of emulsions. The formation of emulsions, for example in storage tanks, would require expensive purification steps of the formulation.
Ebenso ist es vorteilhaft, Rohölen Hydrophobine oder Derivate davon zuzusetzen, um beispielsweise die Emulsionsbildung zu verhindern.It is also advantageous to add to crude oils hydrophobins or derivatives thereof, for example to prevent the formation of emulsions.
Die Formulierung enthaltend Kraft- oder Brennstoffe kann dabei im Rahmen der vorliegenden Erfindung weitere Additive enthalten, die üblicherweise in derartigen Formulierungen enthalten sind.In the context of the present invention, the formulation comprising fuels or fuels may contain further additives which are customarily contained in such formulations.
Geeignete Zusatzstoffe sind beispielsweise in WO 2004/087808 genannt.Suitable additives are mentioned, for example, in WO 2004/087808.
Die vorliegende Erfindung betrifft daher auch eine Formulierung, enthaltend mindestens eine Verbindung ausgewählt aus der Gruppe bestehend aus Kraftstoffen, Brenn- Stoffen, Rohölen oder wasser- oder öllöslichen Polymerlösungen und mindestens ein Hydrophobin oder Derivate davon.The present invention therefore also relates to a formulation comprising at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.
Die Menge der eingesetzten Hydrophobins oder Derivats davon kann abhängig von den weiteren Zusatzstoffen variieren, solange eine Verbesserung der Phasentrennung bei Kontakt der Formulierung mit Wasser gewährleistet ist.The amount of hydrophobin or derivative thereof used may vary depending on the other additives, as long as an improvement of the phase separation upon contact of the formulation with water is ensured.
Erfindungsgemäß liegt die Menge des eingesetzten Hydrophobins oder Derivats davon vorzugsweise im Bereich von 0,0001 bis 1000 ppm eingesetzt, bevorzugt von 0,001 bis 500 ppm, besonders bevorzugt von 0,01 bis 100 ppm.According to the invention, the amount of hydrophobin or derivative used is preferably in the range from 0.0001 to 1000 ppm, preferably from 0.001 to 500 ppm, more preferably from 0.01 to 100 ppm.
Daher betrifft die vorliegende Erfindung auch eine wie zuvor beschriebene Formulierung, wobei das Hydrophobin oder das Derivat davon in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Formulierung, in der Formulierung enthalten ist.
Sofern es sich bei der Formulierung um ein Gemisch enthaltend ein Rohöl handelt, wird das Hydrophobin oder Derivat davon dieser Formulierung in der Regel in einer Menge vom 1 bis 1000 ppm, bevorzugt von 10 bis 800 ppm, insbesondere von 10 bis 500 ppm zugesetzt.Therefore, the present invention also relates to a formulation as described above wherein the hydrophobin or the derivative thereof is contained in the formulation in an amount of from 0.0001 to 1000 ppm, based on the total formulation. If the formulation is a mixture containing a crude oil, the hydrophobin or derivative thereof is usually added to this formulation in an amount of from 1 to 1000 ppm, preferably from 10 to 800 ppm, in particular from 10 to 500 ppm.
Sofern es sich bei der Formulierung um ein Gemisch enthaltend Kraft- oder Brennstoffe handelt, wird das Hydrophobin oder Derivat davon dieser Formulierung in der Regel in einer Menge vom 0,001 bis 0,5 ppm, bevorzugt von 0,005 bis 0,3 ppm, insbesondere von 0,01 bis 0,2 ppm zugesetzt.If the formulation is a mixture containing fuels or fuels, the hydrophobin or derivative thereof of this formulation is usually in an amount of 0.001 to 0.5 ppm, preferably from 0.005 to 0.3 ppm, in particular of 0 , 01 to 0.2 ppm added.
Daher betrifft die vorliegende Erfindung gemäß einer weiteren Ausführungsform eine wie zuvor beschriebene Formulierung, wobei die Formulierung mindestens einen Kraftoder Brennstoff enthält und das Hydrophobin oder das Derivat davon in einer Menge von 0,001 bis 0,5 ppm, bezogen auf die gesamte Formulierung, in der Formulierung enthalten ist.Thus, according to another embodiment, the present invention relates to a formulation as described above wherein the formulation contains at least one fuel or power and the hydrophobin or derivative thereof in an amount of 0.001 to 0.5 ppm, based on the total formulation, in the formulation is included.
Im Rahmen der vorliegenden Erfindung werden unter Brennstoffen beispielsweise leichte, mittlere oder schwere Heizöle verstanden.For the purposes of the present invention, fuels are understood as meaning, for example, light, medium or heavy fuel oils.
Im Rahmen der vorliegenden Erfindung werden unter Kraftstoffen beispielsweise Ottokraftstoffe, Dieselkraftstoffe oder Turbinenkraftstoffe verstanden. Besonders bevorzugt handelt es sich um Ottokraftstoffe.In the context of the present invention, fuels are understood as meaning, for example, gasoline fuels, diesel fuels or turbine fuels. Particularly preferred are gasoline fuels.
Die Kraftstoffe können weitere Zusätze enthalten. Übliche Zusätze sind dem Fach- mann grundsätzlich bekannt. Geeignete Zusätze und Lösungsmittel sind beispielsweise in der WO 2004/087808 genannt.The fuels may contain other additives. Usual additives are generally known to the expert. Suitable additives and solvents are mentioned, for example, in WO 2004/087808.
Erfindungsgemäß beispielsweise geeignet als weitere Additivkomponenten sind Additive mit Detergenswirkung und/oder mit Ventilsitzverschleiß-hemmender Wirkung (im folgenden bezeichnet als Detergensadditive). Dieses Detergensadditiv besitzt mindestens einen hydrophoben Kohlenwasserstoffrest mit einem zahlengemittelten Molekulargewicht Mn von 85 bis 20 000 g/mol und mindestens eine polare Gruppierung ausgewählt aus :According to the invention, for example, as further additive components are additives with detergent action and / or with valve seat wear-inhibiting effect (hereinafter referred to as detergent additives). This detergent additive has at least one hydrophobic hydrocarbon radical with a number-average molecular weight M n of 85 to 20 000 g / mol and at least one polar group selected from:
(a) Mono- oder Polyaminogruppen mit bis zu 6 Stickstoffatomen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat;(a) mono- or polyamino groups having up to 6 nitrogen atoms, at least one nitrogen atom having basic properties;
(b) Nitrogruppen, ggf. in Kombination mit Hydroxylgruppen;
(c) Hydroxylgruppen in Kombination mit Mono- oder Polyaminogruppen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat;(b) nitro groups, optionally in combination with hydroxyl groups; (c) hydroxyl groups in combination with mono- or polyamino groups, wherein at least one nitrogen atom has basic properties;
(d) Carboxylgruppen oder deren Alkalimetall- oder Erdalkalimetallsalzen;(d) carboxyl groups or their alkali metal or alkaline earth metal salts;
(e) Sulfonsäuregruppen oder deren Alkalimetall- oder Erdalkalimetallsalzen;(e) sulfonic acid groups or their alkali metal or alkaline earth metal salts;
(T) Polyoxy-C2-bis C4-alkylengruppierungen, die durch Hydroxylgruppen, Mono- oder Polyaminogruppen, wobei mindestens ein Stickstoffatom basische Eigenschaften hat, oder durch Carbamatgruppen terminiert sind;(T) polyoxy-C 2 to C 4 alkylene moieties terminated by hydroxyl groups, mono- or polyamino groups, wherein at least one nitrogen atom has basic properties, or terminated by carbamate groups;
(g) Carbonsäureestergruppen;(g) carboxylic acid ester groups;
(h) aus Bernsteinsäureanhydrid abgeleiteten Gruppierungen mit Hydroxy- und/oder Amino- und/oder Amido- und/oder Imidogruppen; und/oder(h) succinic anhydride-derived moieties having hydroxy and / or amino and / or amido and / or imido groups; and or
(i) durch Mannich-Umsetzung von substituierten Phenolen mit Aldehyden und Mono- oder Polyaminen erzeugten Gruppierungen.(i) by Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings.
Der hydrophobe Kohlenwasserstoffrest in den obigen Detergensadditiven, welcher für die ausreichende Löslichkeit im Kraftstoff sorgt, hat ein zahlengemitteltes Molekulargewicht (Mn) von 85 bis 20000, insbesondere von 113 bis 10000, vor allem von 300 bis 5000. Als typischer hydrophober Kohlenwasserstoffrest, insbesondere in Verbindung mit den polaren Gruppierungen (a), (c), (h) und (i), kommen der Polypropenyl-, Polybu- tenyl- und Polyisobutenylrest mit jeweils Mn = 300 bis 5000, insbesondere 500 bis 2500, vor allem 700 bis 2300, in Betracht.The hydrophobic hydrocarbon radical in the above detergent additives, which provides the sufficient solubility in the fuel, has a number average molecular weight (Mn) of 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5000. As a typical hydrophobic hydrocarbon radical, especially in combination with the polar groups (a), (c), (h) and (i), the polypropenyl, polybutenyl and polyisobutenyl radicals have in each case Mn = 300 to 5000, in particular 500 to 2500, especially 700 to 2300, into consideration.
Als Beispiele für obige Gruppen von Detergensadditiven seien die folgenden genannt:As examples of the above groups of detergent additives, the following are mentioned:
Mono- oder Polyaminogruppen (a) enthaltende Additive sind vorzugsweise Polyalken- mono- oder Polyalkenpolyamine auf Basis von Polypropen oder konventionellem (d. h. mit überwiegend mittenständigen Doppelbindungen) Polybuten oder Polyisobuten mit Mn von 300 bis 5000 g/mol. Geht man bei der Herstellung der Additive von Polybuten oder Polyisobuten mit überwiegend mittenständigen Doppelbindungen (meist in der beta- und gamma-Position) aus, bietet sich der Herstellweg durch Chlorierung und anschließende Aminierung oder durch Oxidation der Doppelbindung mit Luft oder Ozon zur Carbo-nyl- oder Carboxylverbindung und anschließende Aminierung unter redukti- ven (hydrierenden) Bedingungen an. Zur Aminierung können hier Amine, wie z. B. Ammoniak, Monoamine oder Polyamine, wie Dimethylaminopropylamin, Ethylendia- min,Diethylentriamin,Triethylentetramin oder Tetraethylenpentamin, eingesetzt werden.
Entsprechende Additive auf Basis von Polypropen sind insbesondere in der WO 94/24231 beschrieben.Mono- or polyamino (a) -containing additives are preferably polyalkylene mono- or polyalkene polyamines based on polypropene or conventional (ie with predominantly intermediate double bonds) polybutene or polyisobutene having M n from 300 to 5000 g / mol. If one starts with the preparation of the additives of polybutene or polyisobutene with predominantly central double bonds (usually in the beta and gamma position), the preparation route by chlorination and subsequent amination or by oxidation of the double bond with air or ozone to carbonyl offers or carboxyl compound and subsequent amination under reductive (hydrogenating) conditions. For amination here amines, such as. As ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, are used. Corresponding additives based on polypropene are described in particular in WO 94/24231.
Weitere bevorzugte Monoaminogruppen (a) enthaltende Additive sind die Hydrierungs- produkte der Umsetzungsprodukte aus Polyisobutenen mit einem mittleren Polymerisationsgrad P = 5 bis 100 mit Stickoxiden oder Gemischen aus Stickoxiden und Sauerstoff, wie sie insbesondere in WO 97/03946 beschrieben sind.Further preferred monoamino groups (a) containing additives are the hydrogenation products of the reaction products of polyisobutenes having an average degree of polymerization P = 5 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 97/03946.
Weitere bevorzugte Monoaminogruppen (a) enthaltende Additive sind die aus Polyiso- butenepoxiden durch Umsetzung mit Aminen und nachfolgender Dehydratisierung und Reduktion der Aminoalkohole erhältlichen Verbindungen, wie sie insbesondere in DE-A 196 20 262 beschrieben sind.Further preferred monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.
Nitrogruppen (b), ggf. in Kombination mit Hydroxylgruppen, enthaltende Additive sind vorzugsweise Umsetzungsprodukte aus Polyisobutenen des mittleren Polymerisationsgrades P = 5 bis 100 oder 10 bis 100 mit Stickoxiden oder Gemischen aus Stickoxiden und Sauerstoff, wie sie insbesondere in WO 96/03367 und WO 96/03479 beschrieben sind. Diese Umsetzungsprodukte stellen in der Regel Mischungen aus reinen Nitropolyisobutenen (z. B.alpha, beta-Dinitropolyisobuten) und gemischten Hydro- xynitropolyisobutenen (z. B.alpha-Nitro-beta-hydroxypolyisobuten) dar.Nitro groups (b), optionally in combination with hydroxyl groups, containing additives are preferably reaction products of polyisobutenes of average degree of polymerization P = 5 to 100 or 10 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 96/03367 and WO 96/03479 are described. These reaction products are generally mixtures of pure nitropolyisobutenes (eg., Alpha-pha, beta-dinitropolyisobutene) and mixed hydroxynitropolyisobutenes (eg., Alpha-nitro-beta-hydroxypolyisobutene).
Hydroxylgruppen in Kombination mit Mono- oder Polyaminogruppen (c) enthaltende Additive sind insbesondere Umsetzungsprodukte von Polyisobutenepoxiden, erhältlich aus vorzugsweise überwiegend endständige Doppelbindungen aufweisendem Polyiso- buten mit Mn = 300 bis 5000, mit Ammoniak, Mono- oder Polyaminen, wie sie insbesondere in EP-A 0 476 485 beschrieben sind.Hydroxyl groups in combination with mono- or polyamino groups (c) containing additives are in particular reaction products of polyisobutene epoxides, obtainable from preferably predominantly terminal double bonds containing polyisobutene having Mn = 300 to 5000, with ammonia, mono- or polyamines, as in particular in EP A 0 476 485 are described.
Carboxylgruppen oder deren Alkalimetall- oder Erdalkalimetallsalze (d) enthaltende Additive sind vorzugsweise Copolymere von C2-C40-Olefinen mit Maleinsäureanhydrid mit einer Gesamt-Molmasse von 500 bis 20 000, deren Carboxylgruppen ganz oder teilweise zu den Alkalimetall- oder Erdalkalimetallsalzen und ein verbleibender Rest der Carboxylgruppen mit Alkoholen oder Aminen umgesetzt sind. Solche Additive sind insbesondere aus der EP-A 0 307 815 bekannt. Derartige Additive dienen hauptsächlich zur Verhinderung von Ventilsitzverschleiß und können, wie in der WO 87/01126 be- schrieben, mit Vorteil in Kombination mit üblichen Kraftstoffdetergenzien wie Po- ly(iso)butenaminen oder Polyetheraminen eingesetzt werden.Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C2-C40 olefins with maleic anhydride having a total molecular weight of 500 to 20,000 whose carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remainder of the Carboxyl groups are reacted with alcohols or amines. Such additives are known in particular from EP-A 0 307 815. Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
Sulfonsäuregruppen oder deren Alkalimetall- oder Erdalkalimetallsalze (e) enthaltende Additive sind vorzugsweise Alkalimetall- oder Erdalkalimetallsalze eines Sulfo- bemsteinsäurealkylesters, wie er insbesondere in der EP-A 0 639 632 beschrieben ist.
Derartige Additive dienen hauptsächlich zur Verhinderung von Ventilsitzverschleiß und können mit Vorteil in Kombination mit üblichen Kraftstoffdetergenzien wie Po- ly(iso)butenaminen oder Polyetheraminen eingesetzt werden.Sulfonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 0 639 632. Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
Polyoxy-C2-C4-alkylengruppierungen (f) enthaltende Additive sind vorzugsweise PoIy- ether oder Polyetheramine, welche durch Umsetzung von C2-C60-Alkanolen, C6-C30- Alkandiolen, Mono- oder Di-C2-C30-alkylaminen, C1-C30-Alkylcyclohexanolen oder C1-C30-Alkylphenolen mit 1 bis 30 mol Ethylenoxid und/oder Propylenoxid und/oder Butylenoxid pro Hydroxylgruppe oder Aminogruppe und, im Falle der Polyetheramine, durch anschließende reduktive Aminierung mit Ammoniak, Monoaminen oder Polyami- nen erhältlich sind. Derartige Produkte werden insbesondere in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 und US 4,877,416 beschrieben. Im Falle von Polyethern erfüllen solche Produkte auch Trägeröleigenschaften. Typische Beispiele hierfür sind Tridecanol- oder Isotridecanolbutoxylate, Isononylphenolbutoxylate sowie Polyisobute- nolbutoxylate und -propoxylate sowie die entsprechenden Umsetzungsprodukte mit Ammoniak.Polyoxy-C2-C4-alkylene (f) containing additives are preferably polyether or polyetheramines, which by reaction of C2-C60-alkanols, C6-C30-alkanediols, mono- or di-C2-C30-alkylamines, C1-C30 Alkylcyclohexanolen or C1-C30-alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyether amines, by subsequent reductive amination with ammonia, monoamines or polyamines nen are available. Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416. In the case of polyethers, such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobute- nolbutoxylate and propoxylates and the corresponding reaction products with ammonia.
Carbonsäureestergruppen (g) enthaltende Additive sind vorzugsweise Ester aus Mono- , Di- oder Tricarbonsäuren mit langkettigen Alkanolen oder Polyolen, insbesondere solche mit einer Mindestviskosität von 2 mm2/s bei 100°C, wie sie insbesondere in DE- A 38 38 918 beschrieben sind. Als Mono-, Di- oder Tricarbonsäuren können aliphati- sche oder aromatische Säuren eingesetzt werden, als Esteralkohole bzw. -polyole eignen sich vor allem langkettige Vertreter mit beispielsweise 6 bis 24 C-Atomen. Typi- sehe Vertreter der Ester sind Adipate, Phthalate, iso-Phthalate, Terephthalate und Tri- mellitate des iso-Octanols, iso-Nonanols, iso-Decanols und des iso-Tridecanols. Derartige Produkte erfüllen auch Trägeröleigenschaften.Carboxyl ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm 2 / s at 100 ° C, as described in particular in DE-A 38 38 918 are. As mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 C atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.
Aus Bernsteinsäureanhydrid abgeleitete Gruppierungen mit Hydroxy- und/oder Amino und/oder Amido- und/oder Imidogruppen (h) enthaltende Additive sind vorzugsweise entsprechende Derivate von Polyisobutenylbemsteinsäureanhydrid, welche durch Umsetzung von konventionellem oder hochreaktivem Polyisobuten mit Mn = 300 bis 5000 mit Maleinsäureanhydrid auf thermischen Wege oder über das chlorierte Polyisobuten erhältlich sind. Von besonderem Interesse sind hierbei Derivate mit aliphatischen PoIy- aminen wie Ethylendiamin, Diethylentriamin, Triethylentetramin oder Tetraethylenpen- tamin. Derartige Otto kraftstoffadditive sind insbesondere in US 4,849,572 beschrieben.Succinic anhydride-derived groupings containing hydroxyl and / or amino and / or amido and / or imido groups (h) are preferably corresponding derivatives of polyisobutenyl succinic anhydride obtained by reacting conventional or highly reactive polyisobutene having Mn = 300 to 5000 with maleic anhydride on thermal Pathways or via the chlorinated polyisobutene are available. Of particular interest here are derivatives with aliphatic polyamines, such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine. Such Otto fuel additives are described in particular in US 4,849,572.
Durch Mannich-Umsetzung von substituierten Phenolen mit Aldehyden und Mono- o- der Polyaminen erzeugte Gruppierungen (i) enthaltende Additive sind vorzugsweise Umsetzungsprodukte von polyisobutensubstituierten Phenolen mit Formaldehyd und
Mono- oder Polyaminen wie Ethylendiamin, Diethylentriamin, Triethylentetramin, Tetraethylenpentamin oder Dimethylaminopropylamin. Die polyisobutenylsubstituierten Phenole können aus konventionellem oder hochreaktivem Polyisobuten mit Mn = 300 bis 5000 stammen. Derartige "Polyisobuten-Mannichbasen" sind insbesondere in der EP-A 0 831 141 beschrieben.By Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and Mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine. The polyisobutenyl-substituted phenols may be derived from conventional or highly reactive polyisobutene having Mn = 300 to 5,000. Such "polyisobutene-Mannich bases" are described in particular in EP-A 0 831 141.
Zur genaueren Definition der einzelnen aufgeführten Otto kraftstoffadditive wird hier auf die Offenbarungen der oben genannten Schriften des Standes der Technik ausdrücklich Bezug genommen.For a more detailed definition of the individual listed Otto fuel additives is hereby expressly incorporated by reference to the disclosures of the above-mentioned writings of the prior art.
Die genannten Additive werden dabei in dem Fachmann für die jeweilige Anwendung geeignet erscheinenden Mengen eingesetzt.The additives mentioned are used in those skilled in the appropriate application appearing quantities.
Die erfindungsgemäßen Formulierungen können darüber hinaus mit noch weiteren üblichen Komponenten und Additiven kombiniert werden. Hier sind in beispielsweise Trägeröle ohne ausgeprägte Detergenswirkung zu nennen.The formulations according to the invention can moreover be combined with still further customary components and additives. For example, carrier oils without pronounced detergent action are to be mentioned here.
Geeignete mineralische Trägeröle sind bei der Erdölverarbeitung anfallende Fraktionen, wie Brightstock oder Grundöle mit Viskositäten wie beispielsweise aus der Klasse SN 500-2000; aber auch aromatische Kohlenwasserstoffe, paraffinische Kohlenwasserstoffe und Alkoxyalkanole. Erfindungsgemäß geeignet ist ebenfalls eine als "hydro- crack oil" bekannte und bei der Raffination von Mineralöl anfallende Fraktion (Vakuumdestillatschnitt mit einem Siedebereich von etwa 360 bis 5000C, erhältlich aus unter Hochdruck katalytisch hydriertem und isomerisiertem sowie entparaffiniertem natürli- chen Mineralöl). Ebenfalls geeignet sind Mischungen oben genannter mineralischer Trägeröle.Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. According to the invention is suitable also is known as a "hydro-crack oil" and obtained in the refining of mineral oil fraction (vacuum distillate cut having a boiling range of about 360-500 0 C, available surfaces of high-pressure catalytically hydrogenated and isomerized and also deparaffinized natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.
Beispiele für erfindungsgemäß verwendbare synthetische Trägeröle sind ausgewählt unter: Polyolefinen (Polyalphaolefine oder Polyintemalolefine), (Poly)estem, (Po- ly)alkoxylaten, Polyethem, aliphatischen Polyetheraminen, alkylphenolgestarteten Po- lyethem, alkylphenolgestarteten Polyetheraminen und Carbonsäureester langkettiger Alkanole.Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyethylenemolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.
Beispiele für geeignete Polyolefine sind Olefinpolymerisate mit Mn = 400 bis 1800, vor allem auf Polybuten- oder Polyisobuten-Basis (hydriert oder nicht hydriert).Examples of suitable polyolefins are olefin polymers having Mn = 400 to 1800, especially based on polybutene or polyisobutene (hydrogenated or non-hydrogenated).
Beispiele für geeignete Polyether oder Polyetheramine sind vorzugsweise Polyoxy-C2-Examples of suitable polyethers or polyetheramines are preferably polyoxy-C2-
C4-alkylengruppierungen enthaltende Verbindungen, welche durch Umsetzung vonC4-Alkylengruppierungen containing compounds which by reaction of
C2-C60-Alkanolen, C6-C30-Alkandiolen, Mono- oder Di-C2-C30-alkylaminen, C1-C30- Alkylcyclohexanolen oder C1-C30-Alkylphenolen mit 1 bis 30 mol Ethylenoxid und/oder
Propylenoxid und/oder Butylenoxid pro Hydroxylgruppe oder Aminogruppe und, im Falle der Polyetheramine, durch anschließende reduktive Aminierung mit Ammoniak, Monoaminen oder Polyaminen erhältlich sind. Derartige Produkte werden insbesondere in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 und US 4,877,416 beschrie- ben. Beispielsweise können als Polyetheramine Poly-C2-C6-Alkylenoxidamine oder funktionelle Derivate davon verwendet werden. Typische Beispiele hierfür sind Tride- canol- oder Isotridecanolbutoxylate, Isononylphenolbutoxylate sowie Polyisobutenolbu- toxylate und -propoxylate sowie die entsprechenden Umsetzungsprodukte mit Ammoniak.C2-C60-alkanols, C6-C30-alkanediols, mono- or di-C2-C30-alkylamines, C1-C30-alkylcyclohexanols or C1-C30-alkylphenols with 1 to 30 mol of ethylene oxide and / or Propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyether amines, by subsequent reductive amination with ammonia, monoamines or polyamines are available. Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416. For example, as polyetheramines, poly-C 2 -C 6 -alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.
Beispiele für Carbonsäureester langkettiger Alkanole sind insbesondere Ester aus Mono-, Di- oder Tricarbonsäuren mit langkettigen Alkanolen oder Polyolen, wie sie insbesondere in der DE-A 38 38 918 beschrieben sind. Als Mono-, Di- oder Tricarbonsäuren können aliphatische oder aromatische Säuren eingesetzt werden, als Esteralkohole bzw. -polyole eignen sich vor allem langkettige Vertreter mit beispielsweise 6 bis 24 C- Atomen. Typische Vertreter der Ester sind Adipate, Phthalate, iso-Phthalate, Te- rephthalate und Trimellitate des Isooctanols, Isononanols, Isodecanols und des Isotri- decanols, wie z.B. Di-(n- oder lso-tridecyl)-phthalat.Examples of carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918. As mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and isotricanecanol, such as e.g. Di (n- or iso-tridecyl) phthalate.
Weitere geeignete Trägerölsysteme sind beispielsweise beschrieben in DE-A 38 26 608, DE-A 41 42 241, DE-A 43 09 074, EP-A 0 452 328 und EP-A 0 548 617, worauf hiermit ausdrücklich Bezug genommen wird.Further suitable carrier oil systems are described, for example, in DE-A 38 26 608, DE-A 41 42 241, DE-A 43 09 074, EP-A 0 452 328 and EP-A 0 548 617, to which reference is hereby expressly made.
Beispiele für besonders geeignete synthetische Trägeröle sind alkoholgestartete PoIy- ether mit etwa 5 bis 35, wie z. B. etwa 5 bis 30, C3-C6-Alkylenoxideinheiten, wie z. B. ausgewählt unter Propylenoxid-, n-Butylenoxid-und i-Butylenoxid-Einheiten, oder Gemischen davon. Nichtlimitierende Beispiele für geeignete Starteralkohole sind langkettige Alkanole oder mit langkettigem Alkyl substituierte Phenole, wobei der langkettige Alkylrest insbesondere für einen geradkettigen oder verzweigten C6-C18-Alkylrest steht.Examples of particularly suitable synthetic carrier oils are alcohol-started polyethers with about 5 to 35, such as. B. about 5 to 30, C3-C6 alkylene oxide units, such as. B. selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof. Nonlimiting examples of suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C 6 -C 18 -alkyl radical.
Als bevorzugte Beispiele sind zu nennen Tridecanol und Nonylphenol.Preferred examples are tridecanol and nonylphenol.
Weitere geeignete synthetische Trägeröle sind alkoxylierte Alkylphenole, wie sie in der DE-A 10 102 913.6 beschrieben sind.Further suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.
Die genannten Trägeröle werden dabei in dem Fachmann für die jeweilige Anwendung geeignet erscheinenden Mengen eingesetzt.
Weitere übliche Additive sind Korrosionsinhibitoren, beispielsweise auf Basis von zur Filmbildung neigenden Ammoniumsalzen organischer Carbonsäuren oder von hetero- cyclischen Aromaten im Falle von Buntmetallkorrosionsschutz; Antioxidantien oder Stabilisatoren, beispielsweise auf Basis von Aminen wie p-Phenylendiamin, Dicyclohe- xylamin oder Derivaten hiervon oder von Phenolen wie 2, 4-Di-tert.-butylphenol oder 3, 5-Di-tert.-butyl-4-hydroxyphenylpropionsäure; weitere herkömmliche Demulgatoren; Antistatikmittel; Metallocene wie Ferrocen; Methylcyclopentadienylmangantricarbonyl; Schmierfähigkeitsverbesserer (Lubricity-Additive) wie bestimmte Fettsäuren, Alkenyl- bemsteinsäureester, Bis(hydroxyalkyl)fettamine, Hydroxyacetamide oder Ricinusöl; sowie Farbstoffe (Marker). Gegebenenfalls werden auch Amine zur Absenkung des pH-Wertes des Kraftstoffes zugesetzt.The carrier oils mentioned are used in those skilled in the appropriate application appearing quantities. Further customary additives are corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2, 4-di-tert-butylphenol or 3, 5-di-tert-butyl-4-hydroxyphenylpropionsäure; other conventional demulsifiers; Antistatic agents; Metallocenes such as ferrocene; methylcyclopentadienyl; Lubricity additives such as certain fatty acids, alkenyl succinic acid esters, bis (hydroxyalkyl) fatty amines, hydroxyacetamides or castor oil; as well as dyes (markers). Optionally, amines are added to lower the pH of the fuel.
Die genannten Detergensadditive mit den polaren Gruppierungen (a) bis (i) werden dem Kraftstoff üblicherweise in einer Menge von 10 bis 5000 Gew.-ppm, insbesondere 50 bis 1000 Gew.-ppm, zugegeben. Die sonstigen erwähnten Komponenten und Additive werden, wenn gewünscht, in hierfür üblichen Mengen zugesetzt.The said detergent additives with the polar groups (a) to (i) are added to the fuel usually in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight. The other components and additives mentioned are added, if desired, in customary amounts.
Als Kraft- und Brennstoffe sind erfindungsgemäß alle dem Fachmann bekannten Kraft- und Brennstoffe geeignet, beispielsweise Ottokraftstoffe, wie sie beispielsweise in LJII- mann's Encyclopedia of Industrial Chemistry, 5.Aufl. 1990, Band A16, S. 719ff. beschrieben sind. Geeignete Kraftstoffe sind erfindungsgemäß auch Dieselkraftstoff, Ke- rosin und Jet-Treibstoff.According to the invention, fuels and fuels which are suitable according to the invention are all fuels and fuels known to the person skilled in the art, for example gasolines, as described, for example, in LJII-Mann's Encyclopedia of Industrial Chemistry, 5th ed. 1990, Volume A16, p. 719ff. are described. According to the invention, suitable fuels are also diesel fuel, kerosene and jet fuel.
Insbesondere ein Ottokraftstoff mit einem Aromatengehalt von maximal 60, wie z. B. maximal 42 Vol.-% und einem Schwefelgehalt von maximal 2000, wie z. B. maximal 150 Gew.-ppm ist geeignet.In particular, a gasoline with an aromatics content of 60, such. B. maximum 42 vol .-% and a maximum sulfur content of 2000, such as. B. maximum 150 ppm by weight is suitable.
Der Aromatengehalt des Ottokraftstoffes beträgt beispielsweise 10 bis 50, wie z. B. 30 bis 42 Vol.-%, insbesondere 32 bis 40 Vol.-%. Der Schwefelgehalt des Ottokraftstoffes beträgt beispielsweise 2 bis 500, wie z. B. 5 bis 150 Gew.-ppm, oder 10 bis 100 Gew.- ppm.The aromatic content of the gasoline is for example 10 to 50, such as. B. 30 to 42 vol .-%, in particular 32 to 40 vol .-%. The sulfur content of the gasoline is for example 2 to 500, such as. B. 5 to 150 ppm by weight, or 10 to 100 ppm by weight.
Weiterhin kann ein geeigneter Ottokraftstoff beispielsweise einen Olefingehalt bis zu 50 Vol.-%, wie z. B. von 6 bis 21 Vol.-%, insbesondere 7 bis 18 Vol.-%; einen Benzolge- halt von bis zu 5 Vol.-%, wie z. B. 0,5 bis 1,0 Vol.-%, insbesondere 0,6 bis 0,9 Vol.-% und/oder einen Sauerstoffgehalt von bis zu 25 Gew. -%, wie z. B. bis zu 10 Gew. -% oder 1,0 bis 2,7 Gew. -%, insbesondere von 1,2 bis 2,0 Gew. -%, aufweisen.Furthermore, a suitable gasoline fuel, for example, an olefin content up to 50 vol .-%, such as. B. from 6 to 21 vol .-%, in particular 7 to 18 vol .-%; a benzene content of up to 5 vol .-%, such as. B. 0.5 to 1.0 vol .-%, in particular 0.6 to 0.9 vol .-% and / or an oxygen content of up to 25 wt -.%, Such as. For example, up to 10% by weight or 1.0 to 2.7% by weight, in particular from 1.2 to 2.0% by weight.
Insbesondere können solche Ottokraftstoffe beispielhaft genannt werden, welche gleichzeitig einen Aromatengehalt von maximal 38 Vol.-%, einen Olefingehalt von ma-
ximal 21 Vol.-%, einen Schwefelgehalt von maximal 50 Gew. -ppm, eine Benzolgehalt von maximal 1 ,0 Vol.-% und eine Sauerstoffgehalt von 1 ,0 bis 2,7 Gew. -% aufweisen.In particular, such gasoline fuels can be exemplified, which at the same time have an aromatics content of at most 38% by volume, an olefin content of ma- ximal 21 vol .-%, a maximum sulfur content of 50 ppm by weight, a benzene content of not more than 1, 0 vol .-% and an oxygen content of 1, 0 to 2.7 wt -.% Have.
Der Gehalt an Alkoholen und Ethern im Ottokraftstoff kann über einem weiten Bereich variieren. Beispiele typischer maximaler Gehalte sind für Methanol 15 Vol.-%, für Etha- nol 65 Vol.-%, für Isopropanol 20 Vol.-%, für tert.-Butanol 15 Vol.-%, für Isobutanol 20 Vol.-% und für Ether mit 5 oder mehr C-Atomen im Molekül 30 Vol.-%.The content of alcohols and ethers in gasoline can vary over a wide range. Examples of typical maximum contents are 15% by volume for methanol, 65% by volume for ethanol, 20% by volume for isopropanol, 15% by volume for tert-butanol, 20% by volume for isobutanol and 20% by weight for isobutanol for ethers with 5 or more C atoms in the molecule 30 vol .-%.
Der Sommer-Dampfdruck eines erfindungsgemäß geeigneten Ottokraftstoffes beträgt üblicherweise maximal 70 kPa, insbesondere 60 kPa (jeweils bei 37°C).The summer vapor pressure of a gasoline suitable according to the invention is usually not more than 70 kPa, in particular 60 kPa (each at 37 ° C).
Die ROZ des Ottokraftstoffes beträgt in der Regel 75 bis 105. Ein üblicher Bereich für die entsprechende MOZ liegt bei 65 bis 95.The ROZ of the gasoline is usually 75 to 105. A common range for the corresponding MOZ is 65 to 95.
Die genannten Spezifikationen werden nach üblichen Methoden bestimmt (DIN EN 228).The specified specifications are determined by conventional methods (DIN EN 228).
Die Erfindung wird im folgenden durch Beispiele näher erläutert.The invention is explained in more detail below by examples.
BeispieleExamples
Beispiel 1example 1
Vorarbeiten für die Klonierung von yaad-HisJ vaaE-HiSgPreliminary work for the cloning of yaad-HisJ vaaE-HiSg
Mit Hilfe der Oligonukleotide Hal570 und Hal571 (HaI 572/ HaI 573) wurde eine PoIy- merase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Gens yaaD / yaaE aus Bacillus subtilis, und an den Enden je eine Ncol bzw. BgIII Restriktionsschnittstelle. Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen Ncol und BgIII geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit den Restriktionsendonukleasen Ncol und BgIII linearisierten Vektor pQE60 der Firma Qiagen Moniert. Die so enstandenen Vektoren pQE60YAAD#2 / pQE60YaaE#5 können zur Expression von Proteinen bestehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.Oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) were used to perform a polymerase chain reaction. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert, and in the previously linearized with the restriction endonucleases Ncol and BglII vector pQE60 from Qiagen Moniert. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
Hal570: gcgcgcccatggctcaaacaggtactga Hal571 : gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573 : gcagatcttacaagtgccttttgcttatattcc
Beispiel 2Hal570: gcgcgcccatggctcaaacaggtactga Hal571: gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc Example 2
Klonierung von vaad-Hydrophobin DewA-HiSgCloning of vaad hydrophobin DewA-HiSg
Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenre- aktion durchgeführt. Als Template DNA wurde genomische DNA des SchimmelpilzesUsing the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out. The template DNA was genomic DNA of the mold
Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierendeAspergillus nidulans used. The resulting PCR fragment contained the coding
Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa ProteinaseSequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase
Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea- se Barn H I geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 klo- niert.Interface. The PCR fragment was purified and cut with the restriction endonuclease Barn HI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
Der so enstandene Vektor #508 kann zur Expressions eines Fusionsproteins bestehend aus, YAAD::Xa::dewA::HIS6 verwendet werden.The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGCKaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
Beispiel 3Example 3
Klonierung von vaad-Hvdrophobin RodA-HiSgCloning of vaad-Hvdrophobin RodA-HiSg
Die Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 434 und KaM 435.The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGGKaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4Example 4
Klonierung von vaad-Hvdrophobin BASFI-HiSgCloning of vaad-Hvdrophobin BASFI-HiSg
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF1 -eingesetzt (siehe Anhang, SEQ ID NO. 11 und 12).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-The template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12). KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
GAAGTTCTCCGTCTCCGCGAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAGKaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 5Example 5
Klonierung von vaad-Hydrophobin BASF2-HiSfiCloning of vaad hydrophobin BASF2-HiSfi
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF2 -eingesetzt (siehe Anhang, SEQ ID NO. 13 und 14).An artificially synthesized DNA sequence-hydrophobin BASF2-was used as template DNA (see Appendix, SEQ ID NOS: 13 and 14).
KaM417!CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAGKaM417! CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 6Example 6
Klonierung von vaad-Hvdrophobin SC3-HiSfiCloning of vaad-Hvdrophobin SC3-HiSfi
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.The cloning of plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
Als Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe Anhang, SEQ ID NO. 9 und 10).Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGCKaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGTKaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 7 Fermentation des rekombinanten E.coli Stammes vaad-Hvdrophobin DewA-HiSgExample 7 Fermentation of the recombinant E. coli strain vaad-Hvdrophobin DewA-HiSg
Inokulation von 3ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-His6 expri- mierenden E.coli Stamm in 15ml Greiner Röhrchen. Inkubation für 8h bei 37°C auf einem Schüttler mit 200 UpM. Je 2 11 Erlenmeyer Kolben mit Schikanen und 250ml LB
Medium (+ 100μg/ml Ampicillin) werden mit jeweils 1 ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert.Inoculation of 3 ml LB liquid medium with a yaad hydrophobin DewA-His 6 -expressing E. coli strain in 15 ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. Each 2 11 Erlenmeyer flasks with baffles and 250ml LB Medium (+ 100 μg / ml ampicillin) are inoculated with 1 ml each of the preculture and incubated for 9 h at 37 ° C on a shaker with 180 rpm.
13,51 LB-Medium (+100μg/ml Ampicillin) in einem 2Ol Fermenter mit 0,51 Vorkultur (OD6oonm 1 :10 gegen H2O gemessen) animpfen. Bei einer OD60nm von -3.5 Zugabe von 140ml 10OmM IPTG. Nach 3h Fermenter auf 10°C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.13.51 LB medium (+ 100 μg / ml ampicillin) in a 2 l fermenter with 0.5 l of preculture (OD 6 oo nm 1:10 measured against H 2 O). At an OD 60nm of -3.5 add 140ml 10OmM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.
Beispiel eExample e
Reinigung des rekombinanten Hvdrohobin-FusionsproteinsPurification of the recombinant hvdrobobin fusion protein
(Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)(Purification of Hydrophobin Fusion Proteins Having a C-terminal His6 Tag)
100 g Zellpellet (100 - 500 mg Hydrophobin) werden mit 50 rtiM Natriumphosphatpuf- fer, pH 7,5 auf 200 ml Gesamtvolumen aufgefüllt und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25 (Janke und Kunkel; IKA-Labortechnik) für 10 Minuten behandelt und anschliessend für 1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck, Darmstadt; Best.-Nr. 1.01697.0001) zum Abbau der Nukleinsäuren inkubiert. Vor dem Zellaufschluss wird mit einer Glaskartusche (P1) filtriert. Zum ZeI- laufschluß und für das Scheren der restlichen genomischen DNA werden zwei Homogenisatorläufe bei 1.500 bar durchgeführt (Microfluidizer M-110EH; Microfluidics Corp.). Das Homogenisat wird zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g), der Überstand auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer, pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung 1 % SDS enthält. Nach der Resuspension wird für eine Stunde gerührt und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA- Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g). Gemäß SDS-PAGE Analyse ist das Hydrophobin nach der abschliessenden Zentrifugation im Überstand enthalten (Abbildung 1). Die Versuche zeigen, dass das Hydrophobin wahrscheinlich in Form von Einschlusskörpern in den entsprechenden E. coli Zellen enthalten ist. 50 ml des Hydrophobin-enthaltenden Überstandes werden auf eine 50 ml Ni- ckel-Sepharose High Performance 17-5268-02 Säule aufgetragen (Amersham), die mit 50 rtiM Tris-Cl pH 8,0 Puffer äquilibriert wurde. Die Säule wird mit 50 rtiM Tris-Cl pH 8,0 Puffer gewaschen und das Hydrophobin anschliessend mit 50 rtiM Tris-Cl pH 8,0 Puffer, der 200 rtiM Imidazol enthält, eluiert. Zur Entfernung des Imidazols wird die Lösung gegen 50 rtiM Tris-Cl pH 8,0 Puffer dialysiert.100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 ml sodium phosphate buffer, pH 7.5 and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated. Before cell disruption, filter with a glass cartridge (P1). For homogeneity and shearing of the remaining genomic DNA, two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g). According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation (Figure 1). The experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells. 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM Imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
Abbildung 1 zeigt die Reinigung des hergestellten Hydrophobins:
Spur A: Auftrag Nickel-Sepharose Säule (1 :10 Verdünnung)Figure 1 shows the purification of the prepared hydrophobin: Lane A: Nickel Sepharose column (1:10 dilution)
Spur B: Durchlauf = Eluat WaschschrittLane B: Pass = eluate wash step
Spuren C - E: OD 280 Maxima der Elutionsfraktionen (WP1 , WP2, WP3)Lanes C - E: OD 280 Maxima of elution fractions (WP1, WP2, WP3)
Spur F zeigt den aufgetragenen Marker.Lane F shows the applied marker.
Das Hydrophobin der Abbildung 1 besitzt ein Molekulargewicht von ca. 53 kD. Die kleineren Banden repräsentieren zum Teil Abbauprodukte des Hydrophobins.The hydrophobin of Figure 1 has a molecular weight of about 53 kD. The smaller bands partially represent degradation products of hydrophobin.
Beispiel 9Example 9
Anwendungstechnische Prüfung: Charakterisierung des Hvdrophobins durch Kontaktwinkeländerung eines Wassertropfens auf GlasApplication test: Characterization of the hydrophobin by changing the contact angle of a water drop to glass
Substrat:substrate:
Glas (Fensterglas, Süddeutsche Glas, Mannheim):Glass (window glass, Süddeutsche Glas, Mannheim):
Es wurde das gemäß Beispiel 8 gereinigte Hydrophobin eingesetzt.The purified according to Example 8 hydrophobin was used.
Konzentration des Hydrophobins in der Lösung: 100 μg/ml, die Lösung enthielt weiterhin 50 rtiM Na-Acetat-Puffer sowie 0,1% Polyoxyethylen(20)-sorbitan- monolaureat (Tween® 20)), pH-Wert der Lösung: 4Concentration of hydrophobin in the solution: 100 ug / ml, the solution further contained 50 mM Na-acetate buffer and 0.1% polyoxyethylene (20) -sorbitan monolaurate (Tween ® 20)), pH of the solution: 4
- Eintauchen von Glasplättchen in diese Lösung über Nacht (Temperatur 800C) - Danach wird das mit Hydrophobin beschichtete Glasplättchen der Lösung entnommen und in destilliertem Wasser gewachen,- immersion of glass plates in this solution overnight (temperature 80 0 C) - Thereafter, the coated glass flakes with hydrophobin of the solution is removed and gewachen in distilled water,
- Danach Inkubation 10min / 800C / 1% SDS-Lösung in dest. Wasser- Then incubate 10min / 80 0 C / 1% SDS solution in dist. water
- Erneutes Waschen in dest. Wasser- rinse again in dist. water
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser mit der beschichteten Glasoberfläche bei Raumtemperatur bestimmt.The samples are air dried and the contact angle (in degrees) of a drop of 5 μl of water with the coated glass surface determined at room temperature.
Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.The contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°
Das mit dem Hydrophobin gemäss Beispiel 8 (yaad-dewA-his6) beschichtete Glasplätt- chen ergab einen Kontaktwinkel von 75 ± 5°.Untreated glass gave a contact angle of 30 ± 5 ° The glass plate coated with the hydrophobin according to Example 8 (yaad-dewA-his 6 ) gave a contact angle of 75 ± 5 °.
==> Zunahme des Kontaktwinkels: 45°==> Increase of the contact angle: 45 °
Beispiel 10Example 10
Verwendung eines Hydrophobin-Konzentrats (yaad-Xa-dewA-HiSβ) als Additiv in KraftstoffenUse of a hydrophobin concentrate (yaad-Xa-dewA-HiSβ) as an additive in fuels
Versuchsprinzip:Experimental principle:
Moderne Kraftstoffe enthalten üblicherweise eine Reihe verschiedener Additive (sogenannte Additivpakete). Sofern der Kraftstoff im Zuge des Herstell- bzw. Vertriebsweges mit Wasser in Kontakt kommt, können diese Additive emulgierende Wirkung entfalten und zur Bildung von unerwünschten Kraftstoff-Wasser-Emulsionen führen. Zur Vermei- düng dieses Effektes werden den Kraftstoffen daher üblicherweise Demulgatoren zugesetzt.Modern fuels usually contain a number of different additives (so-called additive packages). If the fuel comes in contact with water in the course of the production or distribution, these additives can develop emulsifying effect and lead to the formation of undesirable fuel-water emulsions. In order to avoid this effect, therefore, demulsifiers are usually added to the fuels.
Die Demulgierversuche wurden mit einem Hydrophobin-Konzentrat gemäß Beispiel 8 (SEQ ID NO. 19 bzw. 20) durchgeführt.The demulsification experiments were carried out with a hydrophobin concentrate according to Example 8 (SEQ ID NO: 19 or 20).
Das Hydrophobin-Konzentrat wurde mit Ethanol verdünnt und einem handelsüblichen Eurosuper-Kraftstoff (gemäß EN 228) zugesetzt, der bereits 725 mg/kg eines speziellen Performance-Additivpakets A enthielt. Dieses Additivpaket besteht hauptsächlich aus dem Polyisobutenamin Kerocom PIBA, Trägerölmischungen, Lösungsmittel, Kor- rosionsinhibitor und Friction Modifier.The hydrophobin concentrate was diluted with ethanol and added to a commercial Eurosuper fuel (according to EN 228), which already contained 725 mg / kg of a special performance additive package A. This additive package consists mainly of the polyisobutenamine Kerocom PIBA, carrier oil mixtures, solvents, corrosion inhibitor and friction modifier.
Es wurden Kraftstoff-Proben mit 0,01 , 0,03, 0,05, 0,07, 0,14 und 0,28 mg/kg Hydrophobin hergestellt. Als Referenz (10 - V1) diente der nur mit A additivierte Kraftstoff ohne Hydrophobin. In einem weiteren Vergleichsversuch (10 - V2) wurden 1 ,45 mg/kg eines handelsüblichen Demulgators D auf Basis von Phenolharzen (ADX 606, Fa. Lubrizol) eingesetzt.Fuel samples were prepared at 0.01, 0.03, 0.05, 0.07, 0.14 and 0.28 mg / kg of hydrophobin. The reference (10-V1) was the A-additive fuel without hydrophobin. In a further comparative experiment (10-V2), 1.45 mg / kg of a commercially available demulsifier D based on phenolic resins (ADX 606, from Lubrizol) were used.
Mit den Kraftstoff-Proben wurden jeweils Emulsionstests nach DIN 51415 durchgeführt. Hierbei werden jeweils 80 ml Kraftstoff und 20 ml Wasser intensiv miteinander ge- mischt. Danach wird der Entmischungsvorgang in Abhängigkeit der Zeit beobachtet. Die Auswertung geschieht anhand von in der Norm vorgegebenen Standards, wobei 1 für eine sehr gute Entmischung und größere Zahlen für zunehmend schlechtere Entmischung stehen. Die Einzelheiten sind in der zitieren DIN-Norm enthalten.
In Tabelle 1 sind Ergebnisse der Versuche zusammengestellt. Aufgeführt sind jeweils die Beurteilungen der Phasentrennschichten nach 1 min, 5min, 30 min und 60 min. In der Regel wird eine Bewertung 1 oder 1 b nach 5 Minuten gefordert.Emulsion tests according to DIN 51415 were carried out in each case with the fuel samples. In each case 80 ml of fuel and 20 ml of water are intensively mixed with each other. Thereafter, the segregation process is observed as a function of time. The evaluation is based on standards specified in the standard, where 1 stands for a very good segregation and larger numbers for increasingly poorer segregation. The details are contained in the cited DIN standard. Table 1 summarizes results of the experiments. In each case, the assessments of the phase separation layers are listed after 1 min, 5 min, 30 min and 60 min. As a rule, a rating of 1 or 1 b is required after 5 minutes.
Tabelle 1Table 1
Kommentar:Comment:
Ohne Zusatz eines Demulgators wird nur eine ganz langsame Demulgierung beobach- ten. Die Bewertung 4 ist inakzeptabel, es tritt eine stabile Emulsion auf.Without the addition of a demulsifier only a very slow demulsification is observed. The rating 4 is unacceptable, a stable emulsion occurs.
Die Hydrophobine weisen schon in äußerst geringen Mengen eine sehr gut demulgie- rende Wirkung auf. Schon 0,01 ppm Hydrophobin führen innerhalb von 1 min zu einem akzeptablen Ergebnis. Die gleiche Wirkung wie mit 0,07 mg/kg Hydrophobin wird erst durch Zugabe von 1,45 mg/kg des handelsüblichen Demulgators auf Basis von Phenolharzen zum Kraftstoff erzielt. Bei der Verwendung von Hydrophobin iat also nur ca. 1/20 der Menge eines konventionellen Demulgators zur Erzielung der gleichen Wirkung erforderlich.The hydrophobins have a very good demulsifying effect even in extremely small amounts. Already 0.01 ppm of hydrophobin leads to an acceptable result within 1 min. The same effect as with 0.07 mg / kg of hydrophobin is achieved only by adding 1.45 mg / kg of the commercial demulsifier based on phenolic resins to the fuel. When using hydrophobin ity only about 1/20 of the amount of a conventional demulsifier to achieve the same effect required.
Vergleichsbeispiel 11Comparative Example 11
Verwendung von anderen Proteinen als Additiv in KraftstoffenUse of other proteins as an additive in fuels
Analog Beispiel 10 wurde andere Proteine, bei denen es sich nicht um Hydrophobine handelt, zur Verwendung in Kraftstoffen gestest.Analogously to Example 10, other proteins other than hydrophobins were tested for use in fuels.
Die Versuche wurden mit Rinderserumalbumin (BSA) und Casein durchgeführt. Derartige Proteine sind kommerziell erhältlich. Weiterhin wurde yaad gemäß SEQ ID NO 15 und 16 eingesetzt, d.h. der nicht mit einem Hydrophobin verbundene Fusionspartner alleine.
Das jeweilige Protein wurde in einer Konzentration von 0,07 mg/kg einem handelsüblichen Eurosuper-Kraftstoff (gemäß EN 228) zugesetzt, der bereits 1000 mg/kg des o- ben erwähnten Performance-Additivpakets A enthielt. Als Referenz diente der nur mit A additivierte Kraftstoff ohne Protein.The experiments were carried out with bovine serum albumin (BSA) and casein. Such proteins are commercially available. Furthermore, yaad was used in accordance with SEQ ID NO 15 and 16, ie the non-hydrophobin-associated fusion partner alone. The respective protein was added in a concentration of 0.07 mg / kg to a commercial Euro Super fuel (according to EN 228), which already contained 1000 mg / kg of the abovementioned performance additive package A. The only fuel used as a reference was A, without protein.
Es wurden jeweils Emulsionstests nach DIN 51415 wie oben beschrieben durchgeführt. Die Ergebnisse der Versuche sind in Tabelle 2 zusammengestellt.In each case emulsion tests according to DIN 51415 were carried out as described above. The results of the experiments are summarized in Table 2.
Tabelle 2Table 2
Kommentar:Comment:
Die Trennung der Emulsion läuft ohne Zusatz eines Demulgators genauso langsam wird in Beispiel 10. Die Bewertung 4 ist inakzeptabel, es tritt eine stabile Emulsion auf.The separation of the emulsion runs without addition of a demulsifier as slowly as in Example 10. The rating 4 is unacceptable, it appears a stable emulsion.
Die eingesetzten Proteine wirken demulgierend, allerdings ist die Geschwindigkeit der Demulgierung langsamer als bei der Verwendung von Hydrophobinen.The proteins used have a demulsifying effect, but the rate of demulsification is slower than with the use of hydrophobins.
Beispiel 12Example 12
Verwendung eines Hvdrophobin-Konzentrats (Yaad-Xa-dewA-HiSβ) als Emulsionsbre- cher für RohölUse of a hvdrophobin concentrate (Yaad-Xa-dewA-HiSβ) as an emulsion breaker for crude oil
Der Versuch wurde mit einem Hydrophobin-Konzentrat gemäß Beispiel 8 (SEQ ID NO. 19 und 20) durchgeführt.The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20).
Bei den durchgeführten Versuchen wurden zu 50 ml Rohöl (Probe ex Wintershall AG, Emiichheim, Sonde 301 ; Restwassergehalt nach Einsatz von herkömmlichen Emulsionsspaltern ca. 3 %) Hydrophobin-Konzentrat in verschiedenen Mengen zugegeben. Die Konzentration des Hydrophobins im Rohöl betrug 1 ppm, 10 ppm und 40 ppm. Nach dem Homogenisieren wurden die Mischungen 10 min. bei 2000 U/min, zentrifu- giert. Die Ergebnisse sind in Tabelle 3 wiedergegeben.
Tabelle 3In the experiments carried out, hydrophobin concentrate in various amounts was added to 50 ml of crude oil (sample ex Wintershall AG, Emiichheim, probe 301, residual water content after the use of conventional emulsion breakers about 3%). The concentration of hydrophobin in the crude oil was 1 ppm, 10 ppm and 40 ppm. After homogenization, the mixtures were 10 min. at 2000 rpm, centrifuged. The results are shown in Table 3. Table 3
Bei Zugabe von 10 und 40 ppm Hydrophobin-Konzentrat bildete sich ein überwiegender Anteil der freien Wasserphase.Upon addition of 10 and 40 ppm hydrophobin concentrate, a predominant portion of the free water phase formed.
Beispiel 13Example 13
Verwendung eines Hvdrophobin-Konzentrats (Yaad-Xa-dewA-HiSβ) zur Fraktionierung von PolymerenUse of a hvdrophobin concentrate (Yaad-Xa-dewA-HiSβ) for the fractionation of polymers
Der Versuch wurde mit einem Hydrophobin-Konzentrat gemäß Beispiel 8 (SEQ ID NO. 19 und 20) durchgeführt.The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20).
In zwei Bechergläsern wurden je 150 g einer Polyacrylsäure in Form ihres Natriumsalzes (Sokalan® CP 10 S; Mw 4000 g/mol, gemäß DE 199 50 941 A1) vorgelegt, anschließend je 75 g Isopropanol zugegeben. Es wurde für 5 min gerührt, anschließend wurden je 146 g Isopropanol/ Wasser (im Verhältnis 1/1) zugeben und für 5 min gerührt.In two beakers were each 150 g of a polyacrylic acid in the form of its sodium salt (Sokalan CP 10 ® S; M w 4000 g / mol, in accordance with DE 199 50 941 A1) were charged, followed by 75 per g of isopropanol was added. It was stirred for 5 min, then 146 g each of isopropanol / water (in the ratio 1/1) were added and stirred for 5 min.
In Becherglas A wurden 50 ppm Hydrophobin (1,64 m, 11 ,3 mg/ml) zugegeben und für 5 min gerührt. Das Hydrophobin erzeugte weiße Schlieren in der klaren Lösung, die nach 5 min vollständig gelöst waren. In beide Bechergläser wurde 19,75 g 50%ige NaOH zugegeben und für 15 min gerührt.In beaker A, 50 ppm of hydrophobin (1.64 m, 11.3 mg / ml) was added and stirred for 5 min. The hydrophobin produced white streaks in the clear solution which were completely dissolved after 5 minutes. In both beakers 19.75 g of 50% NaOH was added and stirred for 15 min.
Mit Hydrophobin entstand sofort eine milchige Lösung, ohne Zusatz von Hydrophobin eine stark opake Lösung. Nach 15 min Rührzeit wurde der Inhalt der Bechergläser in je einen 500 ml Scheidetrichter überführt, kurz geschüttelt und beobachtet wie lange die Trennung der Phasen dauerte.With hydrophobin immediately a milky solution was formed, without the addition of hydrophobin a highly opaque solution. After stirring for 15 min, the contents of the beakers were transferred to a 500 ml separatory funnel, shaken briefly and observed how long the separation of the phases took.
Bei der Probe mit Hydrophobin zeigte sich nach 10 min eine deutliche Phasentrennung, ohne Zusatz des Hydrophobins bildete sich zunächst eine schaumartige „Zwischenschicht", also keine klare Phasengrenze. Ohne Zusatz eines Hydrophobins bildete sich erst nach 40 Minuten eine klare Phasengrenze.
Dauer der Trennung bis zum Auftreten einer scharfen Phasengrenze:After 10 minutes, the sample with hydrophobin showed a clear phase separation, without the addition of the hydrophobin a foam-like "intermediate layer" formed, ie no clear phase boundary Without addition of a hydrophobin, a clear phase boundary only formed after 40 minutes. Duration of separation until the occurrence of a sharp phase boundary:
- Mit Hydrophobin: 12 Minuten- With hydrophobin: 12 minutes
- Ohne Hydrophobin: 40 Minuten- Without hydrophobin: 40 minutes
Beispiel 14, Vergleichsbeispiel 15Example 14, Comparative Example 15
Verwendung von Fusions-Hydrophobin (Yaad-Xa-dewA-HiSβ) und Rinderserumalbumin (BSA) als Demulgator für eine Öl-Wasser-Emulsion bei 55°CUse of fusion hydrophobin (Yaad-Xa-dewA-HiSβ) and bovine serum albumin (BSA) as demulsifier for an oil-water emulsion at 55 ° C
Der Versuch wurde mit einem Hydrophobin-Konzentrat gemäß Beispiel 8 (SEQ ID NO. 19 und 20) durchgeführt sowie mit einer kommerziell erhältlichen Lösung von Rinderserumalbumin (BSA) durchgeführt.The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20) and carried out with a commercially available solution of bovine serum albumin (BSA).
Die Prüfung des Demulgiervermögens wurde wie folgt vorgenommen:The demulsification test was carried out as follows:
Als öl wurde ein Hydrauliköl eingesetzt.As oil, a hydraulic oil was used.
40 ml destilliertes Wasser wurden in einem 100 ml Messzylinder vorgelegt und das jeweilige Protein einer Menge von 5 ppm bezüglich des Wassers bzw. 2,5 ppm bezüg- lieh des Gesamtsystems zugegeben. Anschließend wurden 40 ml Hydrauliköl zugegeben und das System bei 55°C in einem Wasserbad temperiert. Die Temperierzeit betrug 20 min. Danach wurden das öl und das Wasser mit einem Padelrührer 5 min bei 1500 U/min emulgiert. Hierdurch wird das öl in der Wasserphase emulgiert. Danach wurde die Phasenseparation beobachtet. Angegeben ist jeweils die Menge der wieder getrennten Wasserphase in ml.40 ml of distilled water were placed in a 100 ml graduated cylinder and the respective protein was added in an amount of 5 ppm with respect to the water or 2.5 ppm relative to the overall system. Subsequently, 40 ml of hydraulic oil were added and the system was heated at 55 ° C in a water bath. The tempering time was 20 min. Thereafter, the oil and the water were emulsified with a paddle stirrer at 1500 rpm for 5 minutes. As a result, the oil is emulsified in the water phase. Thereafter, the phase separation was observed. Indicated is the amount of the separated water phase in ml.
In einer Versuchsserie wurde die wässrige Lösung der beiden Proteine unverändert eingesetzt. Die Ergebnisse sind in Diagramm 1 dargestellt.In a series of experiments, the aqueous solution of the two proteins was used unchanged. The results are shown in Diagram 1.
In einer zweiten Versuchsserie wurde die Lösung der beiden Proteine zunächst bei RT mit HCl auf pH 1 gestellt und 24 h bei pH 1 belassen. Danach wurde mit NaOH wieder auf pH 7 eingestellt. Die Ergebnisse sind in Diagramm 2 dargestellt.
Demulgierung einer Öl - Wasser - Emulsion mit 2,5 ppm ProteinenIn a second series of experiments, the solution of the two proteins was first adjusted to pH 1 with HCl at RT and left at pH 1 for 24 h. It was then adjusted again to pH 7 with NaOH. The results are shown in Diagram 2. Demulsification of an oil - water emulsion containing 2.5 ppm of proteins
Zeit in min.Time in min.
Diagramm 1 : Vergleich von Hydrophobin (H*Protein A) und Rinderserumalbumin, unveränderte ProbenDiagram 1: Comparison of hydrophobin (H * protein A) and bovine serum albumin, unchanged samples
Demulgierung einer Öl - Wasser - Emulsion mit 2,5 ppm ProteinenDemulsification of an oil - water emulsion containing 2.5 ppm of proteins
Zeit in min.Time in min.
Diagramm 2: Vergleich von Hydrophobin (H*Protein A) bezeichnet) und Rinderserumalbumin, Proben vor Versuch jeweils 24 h auf pH 1 gestellt.
Kommentar:Diagram 2: Comparison of hydrophobin (H * protein A) and bovine serum albumin, samples were adjusted to pH 1 for 24 h each before the experiment. Comment:
Die Geschwindigkeit der Demulgierung der Öl-Wasser-Emulsion wird durch BSA im Vergleich zu einer Probe ohne Demulgator nur geringfügig verbessert. Beim Zusatz von Hydrophobinen wird hingegen eine sehr deutliche Beschleunigung der Demulgie- rung beobachtet.
The rate of demulsification of the oil-in-water emulsion is only slightly improved by BSA compared to a sample without demulsifier. On the other hand, when hydrophobins are added, a very marked acceleration of the demulsification is observed.
Claims
1. Verwendung mindestens eines Hydrophobins zur Verbesserung der Phasentrennung in Zusammensetzungen enthaltend mindestens zwei flüssige Phasen.1. Use of at least one hydrophobin for improving the phase separation in compositions containing at least two liquid phases.
2. Verwendung nach Anspruch 1 , wobei das mindestens eine Hydrophobin als De- mulgator eingesetzt wird.2. Use according to claim 1, wherein the at least one hydrophobin is used as a demulsifier.
3. Verwendung nach einem der Ansprüche 1 oder 2, wobei das mindestens eine Hydrophobin ein Fusions-Hydrophobin ist.3. Use according to any one of claims 1 or 2, wherein the at least one hydrophobin is a fusion hydrophobin.
4. Verwendung nach nach Anspruch 3, dadurch gekennzeichnet, dass es sich bei dem Fusions-Hydrophobin um mindestens eines ausgewählt aus der Gruppe von yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf1-his (SEQ ID NO: 24) handelt, wobei es sich bei yaad auch um einen verkürzten Fusionspartner yaad' mit 20 bis 293 Aminosäuren handeln kann.4. Use according to claim 3, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his ( SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.
5. Verwendung nach einem der Ansprüche 1 bis 4, wobei die Zusammensetzung enthaltend mindestens zwei flüssige Phasen ausgewählt ist aus der Gruppe be- stehend aus5. Use according to any one of claims 1 to 4, wherein the composition containing at least two liquid phases is selected from the group consisting of
Zusammensetzungen enthaltend öl und Wasser, Zusammensetzungen enthaltend Kraft- oder Brennstoff und Wasser, Reaktionsgemischen enthaltend mindestens zwei flüssige Phasen.Compositions containing oil and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.
6. Verwendung nach einem der Ansprüche 1 bis 5, wobei das mindestens eine Hydrophobin in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird.6. Use according to any one of claims 1 to 5, wherein the at least one hydrophobin is used in an amount of 0.0001 to 1000 ppm, based on the total composition.
7. Verwendung nach Anspruch 6, daurch gekennzeichnet, dass es sich um eine Rohöl-Wasser-Zusammensetzung handelt, und das mindestens eine Hydrophobin in einer Menge von 1 bis 800 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird.7. Use according to claim 6, characterized daurch in that it is a crude oil-water composition, and the at least one hydrophobin in an amount of 1 to 800 ppm, based on the total composition, is used.
8. Verwendung nach Anspruch 6, daurch gekennzeichnet, dass es sich um eine Kraft-/Brennstoff-Wasser-Zusammensetzung handelt, und das mindestens eine8. Use according to claim 6, daurch characterized in that it is a fuel / fuel-water composition, and the at least one
Hydrophobin in einer Menge von 0,001 bis 10 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird. Hydrophobin is used in an amount of 0.001 to 10 ppm, based on the total composition.
9. Verwendung nach einem der Ansprüche 1 bis 8, wobei neben dem mindestens einen Hydrophobin mindestens eine weitere Verbindung eingesetzt wird, die die Phasentrennung verbessert.9. Use according to any one of claims 1 to 8, wherein in addition to the at least one hydrophobin at least one further compound is used, which improves the phase separation.
10. Verfahren zur Trennung von mindestens zwei flüssigen Phasen in einer Zusammensetzung enthaltend mindestens zwei flüssige Phasen, umfassend die Zugabe von mindestens einem Hydrophobin zu der Zusammensetzung.A process for the separation of at least two liquid phases in a composition containing at least two liquid phases comprising the addition of at least one hydrophobin to the composition.
11. Verfahren nach Anspruch 10, wobei das mindestens eine Hydrophobin ein Fusi- ons-Hydrophobin oder ein Derivat davon ist.11. The method of claim 10, wherein the at least one hydrophobin is a fusion hydrophobin or a derivative thereof.
12. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass es sich bei dem Fusions-Hydrophobin um mindestens eines ausgewählt aus der Gruppe von y- aad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder y- aad-Xa-basf1-his (SEQ ID NO: 24) handelt, wobei es sich bei yaad auch um einen verkürzten Fusionspartner yaad' mit 20 bis 293 Aminosäuren handeln kann.12. The method according to claim 11, characterized in that the fusion hydrophobin is at least one selected from the group of y-aad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or y-aad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.
13. Verfahren nach einem der Ansprüche 10 bis 12, wobei die Zusammensetzung enthaltend mindestens zwei flüssige Phasen ausgewählt ist aus der Gruppe be- stehend aus13. The method according to any one of claims 10 to 12, wherein the composition containing at least two liquid phases is selected from the group consisting of
Zusammensetzungen enthaltend öl und Wasser, Zusammensetzungen enthaltend Kraft- oder Brennstoff und Wasser, Reaktionsgemischen enthaltend mindestens zwei flüssige Phasen.Compositions containing oil and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.
14. Verfahren nach einem der Ansprüche 10 bis 13, wobei das mindestens eine Hydrophobin in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird.14. The method according to any one of claims 10 to 13, wherein the at least one hydrophobin in an amount of 0.0001 to 1000 ppm, based on the total composition, is used.
15. Verfahren nach Anspruch 14, daurch gekennzeichnet, dass es sich um eine Rohöl-Wasser-Zusammensetzung handelt, und das mindestens eine Hydrophobin in einer Menge von 1 bis 800 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird.15. The method according to claim 14, daurch characterized in that it is a crude oil-water composition, and the at least one hydrophobin in an amount of 1 to 800 ppm, based on the total composition, is used.
16. Verfahren nach Anspruch 14, daurch gekennzeichnet, dass es sich um eine Kraft-/Brennstoff-Wasser-Zusammensetzung handelt, und das mindestens eine16. The method according to claim 14, daurch characterized in that it is a fuel / fuel-water composition, and at least one
Hydrophobin in einer Menge von 0,001 bis 10 ppm, bezogen auf die gesamte Zusammensetzung, eingesetzt wird.Hydrophobin is used in an amount of 0.001 to 10 ppm, based on the total composition.
17. Verfahren nach einem der Ansprüche 10 bis 16, wobei das Verfahren vor oder nach der Zugabe des mindestens einen Hydrophobins eine Erhöhung der Tem- peratur der Zusammensetzung enthaltend mindestens zwei flüssige Phasen um- fasst.17. The method according to any one of claims 10 to 16, wherein the method before or after the addition of the at least one hydrophobin an increase in the temperature temperature of the composition comprising at least two liquid phases.
18. Formulierung, enthaltend mindestens eine Verbindung ausgewählt aus der Gruppe bestehend aus Kraftstoffen, Brennstoffen, Rohölen oder wasser- oder öllöslichen Polymerlösungen und mindestens ein Hydrophobin.18. Formulation containing at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin.
19. Formulierung nach Anspruch 18, wobei das Hydrophobin in einer Menge von 0,0001 bis 1000 ppm, bezogen auf die gesamte Formulierung, in der Formulie- rung enthalten ist.19. A formulation according to claim 18, wherein the hydrophobin is contained in an amount of from 0.0001 to 1000 ppm, based on the total formulation, in the formulation.
20. Formulierung nach Anspruch 18 oder 19, wobei die Formulierung mindestens einen Kraft- oder Brennstoff enthält und das Hydrophobin oder das Derivat davon in einer Menge von 0,001 bis 0,5 ppm, bezogen auf die gesamte Formulierung, in der Formulierung enthalten ist.20. A formulation according to claim 18 or 19, wherein the formulation contains at least one fuel or fuel and the hydrophobin or the derivative thereof in an amount of 0.001 to 0.5 ppm, based on the total formulation, is included in the formulation.
21. Formulierung gemäß Anspruch 20, dadurch gekennzeichnet, dass es sich bei dem Kraft- oder Brennstoff um einen Kraftstoff ausgewählt aus der Gruppe von Ottokraftstoffen, Dieselkraftstoffen oder Turbinenkraftstoffen handelt.21. Formulation according to claim 20, characterized in that the fuel or fuel is a fuel selected from the group of gasoline fuels, diesel fuels or turbine fuels.
22. Formulierung nach einem der Ansprüche 18 bis 21 , wobei das mindestens eine Protein ein Fusions-Hydrophobin oder ein Derivat davon ist.22. A formulation according to any one of claims 18 to 21, wherein the at least one protein is a fusion hydrophobin or a derivative thereof.
23. Formulierung gemäß Anspruch 22, dadurch gekennzeichnet, dass es sich bei dem Fusions-Hydrophobin um mindestens eines ausgewählt aus der Gruppe von yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf1-his (SEQ ID NO: 24) handelt, wobei es sich bei yaad auch um einen verkürzten Fusionspartner yaad' mit 20 bis 293 Aminosäuren handeln kann. 23. A formulation according to claim 22, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP06725388A EP1868698A1 (en) | 2005-04-01 | 2006-03-29 | Use of proteins as demulsifying agents |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP05007208 | 2005-04-01 | ||
EP05016962 | 2005-08-04 | ||
PCT/EP2006/061132 WO2006103251A1 (en) | 2005-04-01 | 2006-03-29 | Use of proteins as demulsifying agents |
EP06725388A EP1868698A1 (en) | 2005-04-01 | 2006-03-29 | Use of proteins as demulsifying agents |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1868698A1 true EP1868698A1 (en) | 2007-12-26 |
Family
ID=41343481
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP06725388A Withdrawn EP1868698A1 (en) | 2005-04-01 | 2006-03-29 | Use of proteins as demulsifying agents |
Country Status (9)
Country | Link |
---|---|
US (1) | US20100170142A1 (en) |
EP (1) | EP1868698A1 (en) |
KR (1) | KR20070118157A (en) |
CN (1) | CN101151081B (en) |
BR (1) | BRPI0609776A2 (en) |
CA (1) | CA2599985C (en) |
MX (1) | MX2007011125A (en) |
NO (1) | NO20074580L (en) |
WO (1) | WO2006103251A1 (en) |
Families Citing this family (32)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP5250264B2 (en) | 2005-02-07 | 2013-07-31 | ビーエーエスエフ ソシエタス・ヨーロピア | Novel hydrophobin fusion protein, its production and use |
WO2006103225A1 (en) * | 2005-03-31 | 2006-10-05 | Basf Aktiengesellschaft | Use of polypeptides in the form of adhesive agents |
BRPI0608681A2 (en) | 2005-04-01 | 2010-12-07 | Basf Ag | use of at least one hydrophobin, process for stabilizing liquid phases in a composition comprising at least two liquid phases, and, formulation |
CA2602706C (en) | 2005-04-01 | 2013-01-08 | Basf Aktiengesellschaft | Drilling fluid containing hydrophobin |
DE102005027139A1 (en) * | 2005-06-10 | 2006-12-28 | Basf Ag | New cysteine-depleted hydrophobin fusion proteins, their production and use |
DE102005033002A1 (en) * | 2005-07-14 | 2007-01-18 | Basf Ag | Aqueous monomer emulsions containing hydrophobin |
DE102005048720A1 (en) * | 2005-10-12 | 2007-04-19 | Basf Ag | Use of proteins as an antifoam component in fuels |
EP2054687B1 (en) | 2006-08-15 | 2011-10-19 | Basf Se | Method for the production of dry free-flowing hydrophobin preparations |
WO2008107439A1 (en) | 2007-03-06 | 2008-09-12 | Basf Se | Open-cell foam modified with hydrophobines |
EP2155611A1 (en) * | 2007-05-24 | 2010-02-24 | Basf Se | Use of hydrophobins as additives in the crystallization of solids |
BRPI0816256A2 (en) * | 2007-09-13 | 2015-03-17 | Basf Se | Use of hydrophobin, and process for preparing an agent for improved absorption of active substances in topical use |
EP2042155A1 (en) | 2007-09-28 | 2009-04-01 | Basf Se | Method for removing water-insoluble substances from substrate surfaces |
WO2009047210A1 (en) * | 2007-10-08 | 2009-04-16 | Basf Se | Use of hyperbranched polyesters and/or polyester amides for separating oil-in-water emulsions |
CA2716290C (en) | 2008-03-04 | 2016-09-06 | Basf Se | Use of alkoxylated polyalkanolamines for splitting oil-water emulsions |
US8507726B2 (en) * | 2008-11-03 | 2013-08-13 | Basf Se | Photoinitiator mixtures |
CA2750421C (en) | 2008-11-27 | 2016-10-18 | B.R.A.I.N. Biotechnology Research And Information Network Ag | Surface active proteins as excipients in solid pharmaceutical formulations |
WO2010072665A1 (en) | 2008-12-23 | 2010-07-01 | Basf Se | Modification of nano- or mesofibers or textile fabrics manufactured by way of electrospinning using amphiphilic proteins |
CN102333576B (en) | 2008-12-29 | 2014-06-18 | 巴斯夫欧洲公司 | Hyperbranched polyesters and polycarbonates as demulsifiers for cracking crude oil emulsions |
EP2400988B1 (en) | 2009-02-26 | 2016-04-13 | B.R.A.I.N. Biotechnology Research and Information Network AG | Compositions, use and method for the use of surface active proteins in topical drug delivery across keratin |
WO2010102934A1 (en) * | 2009-03-09 | 2010-09-16 | Basf Se | Use of a mixture of water soluble polymers and hydrophobins for thickening aqueous phases |
EP2462166A2 (en) | 2009-08-03 | 2012-06-13 | Basf Se | Process for deposition of thin layers of metal oxides |
EP2536744B1 (en) * | 2010-02-18 | 2018-10-17 | B.R.A.I.N. Biotechnology Research And Information Network AG | Chimeric surface active proteins |
JP2013523232A (en) | 2010-03-31 | 2013-06-17 | ビーエーエスエフ ソシエタス・ヨーロピア | Coated stent and method of coating with protein |
CN103842487A (en) | 2011-03-29 | 2014-06-04 | 富林纳技术有限公司 | Hybrid fuel and method of making the same |
EP2631296A1 (en) * | 2012-02-22 | 2013-08-28 | Kimmo Koivu | A method for hydrophobin production in plants and methods to produce hydrophobin multimers in plants and microbes |
RU2554348C2 (en) * | 2012-12-04 | 2015-06-27 | Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Вятский государственный университет"(ФГБОУ ВПО "ВятГУ") | Fuel emulsion |
EP2961402A4 (en) * | 2013-02-28 | 2016-11-23 | Full Spectrum Lab Ltd | Biosynthesis of cannabinoids |
WO2016030828A1 (en) | 2014-08-25 | 2016-03-03 | Full Spectrum Laboratories Limited | Apparatus and methods for the simultaneous production of cannabinoid compounds |
WO2016089994A1 (en) | 2014-12-03 | 2016-06-09 | Drexel University | Direct incorporation of natural gas into hydrocarbon liquid fuels |
RU2629021C2 (en) * | 2016-02-08 | 2017-08-24 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Вятский государственный университет" | Fuel composition |
CN110775979B (en) * | 2019-12-05 | 2020-09-25 | 中国科学院合肥物质科学研究院 | Method for recovering high-purity silicon and silicon carbide from crystalline silicon cutting waste |
CN114774158B (en) * | 2022-02-17 | 2023-08-11 | 贵州民族大学 | Preparation method of aromatic polyamino acid low-temperature demulsifier |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB195876A (en) * | 1922-04-25 | 1923-04-12 | Sharples Specialty Co | Process for resolving water-in-oil emulsions |
US2688001A (en) * | 1952-12-23 | 1954-08-31 | Shell Dev | Low-temperature lubricating composition |
DE2843685A1 (en) * | 1978-10-06 | 1980-04-24 | Biotechnolog Forschung Gmbh | METHOD FOR SEPARATING OILS OR PETROLEUM HYDROCARBONS FROM SOLID OR SOLID-LIQUID MATERIAL |
JPS60206893A (en) * | 1984-03-31 | 1985-10-18 | Yoshinari Shimada | Preparation of w/o type emulsion fuel oil |
US4741835A (en) * | 1986-09-08 | 1988-05-03 | Exxon Research And Engineering Company | Oil-in-water emulsion breaking with hydrophobically functionalized cationic polymers |
EP0386923A1 (en) * | 1989-03-09 | 1990-09-12 | Exxon Chemical Patents Inc. | Hydrogenated lecithin for friction and flow properties |
US5021167A (en) * | 1989-07-10 | 1991-06-04 | Nalco Chemical Company | Method for separating liquid from water using amine containing polymers |
WO1994009094A1 (en) * | 1992-10-09 | 1994-04-28 | Won Jae Yim | A process for preparing emulsified fuel oil |
CA2124301A1 (en) * | 1993-06-09 | 1994-12-10 | Manian Ramesh | Hydrophobic demulsifiers for oil-in-water systems |
IL145337A0 (en) * | 1999-03-25 | 2002-06-30 | Valtion Teknillinen | Process for partitioning of proteins |
US7517837B2 (en) * | 2003-05-22 | 2009-04-14 | Anderol, Inc. | Biodegradable lubricants |
BRPI0608681A2 (en) * | 2005-04-01 | 2010-12-07 | Basf Ag | use of at least one hydrophobin, process for stabilizing liquid phases in a composition comprising at least two liquid phases, and, formulation |
-
2006
- 2006-03-29 US US11/886,610 patent/US20100170142A1/en not_active Abandoned
- 2006-03-29 CA CA2599985A patent/CA2599985C/en not_active Expired - Fee Related
- 2006-03-29 CN CN2006800101415A patent/CN101151081B/en not_active Expired - Fee Related
- 2006-03-29 EP EP06725388A patent/EP1868698A1/en not_active Withdrawn
- 2006-03-29 MX MX2007011125A patent/MX2007011125A/en unknown
- 2006-03-29 BR BRPI0609776-6A patent/BRPI0609776A2/en not_active IP Right Cessation
- 2006-03-29 KR KR1020077025100A patent/KR20070118157A/en not_active Application Discontinuation
- 2006-03-29 WO PCT/EP2006/061132 patent/WO2006103251A1/en active Application Filing
-
2007
- 2007-09-11 NO NO20074580A patent/NO20074580L/en not_active Application Discontinuation
Non-Patent Citations (1)
Title |
---|
See references of WO2006103251A1 * |
Also Published As
Publication number | Publication date |
---|---|
BRPI0609776A2 (en) | 2011-10-18 |
CN101151081B (en) | 2012-02-29 |
CA2599985C (en) | 2012-11-13 |
MX2007011125A (en) | 2007-10-23 |
KR20070118157A (en) | 2007-12-13 |
CA2599985A1 (en) | 2006-10-05 |
WO2006103251A1 (en) | 2006-10-05 |
NO20074580L (en) | 2007-10-29 |
US20100170142A1 (en) | 2010-07-08 |
CN101151081A (en) | 2008-03-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1868698A1 (en) | Use of proteins as demulsifying agents | |
EP1868700A2 (en) | Use of hydrophobin as a phase stabiliser | |
EP1869138B1 (en) | Drilling fluid containing hydrophobin | |
WO2007042487A2 (en) | Use of proteins as an antifoaming constituent in fuels | |
EP1904534B1 (en) | Aqueous monomer emulsions containing hydrophobin | |
MX2007011134A (en) | Elevator system. | |
EP1848734A2 (en) | Method for coating surfaces with hydrophobins | |
EP1866401A1 (en) | Use of hydrophobin for hard surface soil-repellent treatment | |
WO2006128877A1 (en) | Method for reducing the evaporation rate of liquids | |
DE102005051515A1 (en) | Coating surfaces with hydrophobins involves coating with hydrophobin in form of fusion hydrophobin and using formulation with pH value of greater than or equal to 4 | |
MX2008004720A (en) | Use of proteins as an antifoaming constituent in fuels |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20071102 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: BASF SE |
|
DAX | Request for extension of the european patent (deleted) | ||
17Q | First examination report despatched |
Effective date: 20130610 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20131022 |