EP1868698A1 - Use of proteins as demulsifying agents - Google Patents

Abstract

The invention relates to the use of at least one protein, especially at least one hydrophobin or at least one derivative thereof, for improving the phase separation in compositions containing at least two liquid phases. The invention also relates to a method for separating at least two liquid phases in a composition containing at least two liquid phases, and formulations containing at least one compound selected from the group consisting of fuels, combustibles, crude oil or water-soluble or oil-soluble polymer solutions, and at least one protein, especially at least one hydrophobin or derivatives thereof.

Description

Use of proteins as demulsifiers

description

The present invention relates to the use of at least one hydrophobin or at least one derivative thereof for improving the phase separation in compositions comprising at least two liquid phases, processes for the separation of at least two liquid phases in a composition containing at least two liquid phases, and formulations containing at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.

Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units.

Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphiphatic membranes. Thus, for example, Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.

Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.

The use of hydrophobins for various applications has been proposed in the prior art.

WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover claims compositions, in particular compositions for pharmaceutical applications, containing hydrophobins. EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out tests or for storage, ship hulls, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 ⁰ C.

WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.

WO 03/10331 discloses that hydrophobins have surface-active properties. Thus, a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.

WO 2004/000880 also discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.

WO 01/74864, which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.

The use of proteins for phase separation is known in principle.

GB 195,876 discloses a method of breaking water-in-oil emulsions using colloids. Examples of colloids are proteins such as gelatin, casein, albumin or polysccharides such as gum arabic or gum tragacanth.

JP-A 11-169177 discloses the use of proteins having lipase activity for breaking emulsions.

WO 01/60916 discloses the use of surfactant-free mixtures of at least one water-soluble protein, at least one water-soluble polysaccharide and at least one water-soluble polymer such as polyethylene oxide for various applications, including for demulsifying crude oil.

None of the cited documents discloses the use of hydrophobins for phase separation. The use of proteins has the advantage that they are also naturally occurring substances that are biodegradable and thus do not lead to a permanent burden on the environment.

In many large-scale applications, for example, in the separation of crude oil-water emulsions, it depends on the fastest possible phase separation. The object of the invention was to provide an improved process for the phase separation with proteins.

According to the invention, this object is achieved by the use of at least one hydrophobin for improving the phase separation in compositions containing at least two liquid phases.

In this case, the hydrophobin according to the invention can in principle be used in any amount, as long as it is ensured that the phase separation in the compositions containing at least two liquid phases is improved.

In the context of the present invention, "improvement of the phase separation" is understood to mean that the separation of two liquid phases on addition of a substance to a mixture takes place more rapidly than in the same mixture without the addition of the substance, or that the addition of the substance Substance the separation of two liquid phases is only possible.

In the context of the present invention, a hydrophobin is also understood as meaning derivatives thereof or modified hydrophobin. Modified or derivatized hydrophobins may, for example, be hydrophobin infusion proteins or proteins which have an amino acid sequence which is at least 60%, for example at least 70%, in particular at least 80%, more preferably at least 90%, most preferably at least Has 95% identity with the sequence of a hydrophobin, and still to 50%, for example, to 60%, in particular to 70%, particularly preferably 80%, the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with These proteins are changed such that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably by at least 25 °, in particular by at least 30 °.

Surprisingly, it has been found that hydrophobins or derivatives thereof improve the phase separation of at least two liquid phases. This is particularly advantageous if rapid phase separation is to be achieved or the occurrence of emulsions is to be prevented. Here even small amounts are extremely effective. Likewise, this property can be used if already existing emulsions are to be broken up. Compounds that break emulsions are also referred to as demulsifiers.

Therefore, the present invention also relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the at least one hydrophobin or at least one derivative thereof, is used as a demulsifier.

For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive. The amino acid sequence of the natural hydrophobins is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.

The N- and C-terminus is variable over a larger range. Here can z. For example, fusion partner proteins with a length of 10 to 500 amino acids found according to molecular biological techniques known to those skilled in the art can be added.

In addition, for the purposes of the present invention, hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence.

For the purposes of the present invention, the term "hydrophobins" is to be understood below to mean polypeptides of the general structural formula (I)

X _n -C -Xi_ ₅ oC -Xo ₅ -C -Xi-ioo-C -Xi_ioo-C -Xi_ ₅ oC -X _0-S -C -Xi _-S0 -C -X _m (I)

where X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand. X may be the same or different. Here, the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300. The polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.

The amino acids designated C ¹ to C ⁸ are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C ¹ to C ^{8 should} consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or can form disulfide bridges with one another.

Particularly preferred is the intramolecular formation of C-C bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.

If cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions designated X, the numbering of the individual C-positions in the general formulas may change accordingly.

Preference is given to hydrophobins of the general formula (II)

X _n -C-C -X3-25 -Xθ-2 "C-C -X5-50 -X2-35" C -X2-15 "C -Xθ-2" C -X3-35 "C -Xm (H )

used for carrying out the present invention, wherein X, C and the indices standing at X and C have the above meaning, the indices n and m are numbers between 0 and 300, and the proteins are further characterized by the contact angle change mentioned above, and furthermore, at least 6 of the radicals named C are cysteine. Most preferably, all C radicals are cysteine.

Particular preference is given to hydrophobins of the general formula (III) X _n -C -X _δ -gC -C -Xn- ₃₉ -C -X ₂ - ₂₃ -C -X _δ -gC -C -X ₆ - ₁₈ "C -X _m (III)

where X, C and the indices standing at X have the above meaning, the indices n and m are numbers between 0 and 200, the proteins are further characterized by the abovementioned contact angle change, and at least 6 of the C named residues are cysteine. Most preferably, all of the C radicals are cysteine.

The radicals X _n and X _m may it be peptide sequences that are growing naturally, also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X _N and / or X are _m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.

If X _n and / or X _n are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50 and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.

The fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X _n ) and at the carboxy terminus (X _n ,) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X _n or X _n ,) of the protein according to the invention.

Particularly suitable fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis. Examples of such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin. Also suitable are fragments or derivatives of said sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50%, and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids. In a further preferred embodiment, the fusion hydrophobin in addition to the fusion partner as a group X _n or X _n , nor a so-called affinity domain (affinity tag / affinity tail) on. These are in a manner known in principle to anchor groups, which can interact with certain complementary groups and can be used to facilitate processing and purification of the proteins. Examples of such affinity domains include (His) _k , (Arg) _k , (Asp) _k , (Phe) _k or (Cys) _k groups, where k is generally a natural number from 1 to 10. It may preferably be a (His) _k group, where k is 4 to 6.

The proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaric dialdehyde.

A characteristic of the hydrophobins or their derivatives used according to the invention is the change of surface properties when the surfaces are coated with the proteins. The change in surface properties can be determined experimentally, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.

The implementation of contact angle measurements is known in principle to the person skilled in the art. The measurements refer to room temperature and water drops of 5 μl and the use of glass slides as substrate. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part. Under the conditions mentioned there, the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.

Particularly preferred hydrophobins for carrying out the present invention are the dewA, rodA, hypA, hypB, sc3, basfi, basf2 hydrophobins structurally characterized in the Sequence Listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them together with a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin. Also particularly suitable according to the invention are the fusion proteins yaad-XadewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1-his (SEQ ID NO: 24) with the polypeptide sequences given in parentheses and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also proteins which, starting from the amino acid sequences shown in SEQ ID NO. 20, 22 or 24 shown by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins particularly preferred embodiments. The biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.

Derivatives particularly useful in the practice of the invention are those of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ

ID NO: 24) residues derived by truncation of the yaad fusion partner. Instead of the complete yaad fusion partner (SEQ ID NO: 16) with 294 amino acids, advantageously a shortened yaad residue can be used. However, the truncated residue should comprise at least 20, preferably at least 35, amino acids. For example, a truncated radical having 20 to 293, preferably 25 to 250, particularly preferably 35 to

150 and for example 35 to 100 amino acids are used.

A cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage etc.). ,

It is furthermore possible to generate fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA), one behind the other. Likewise, hydrophobin fragments (for example N- or C-terminal truncations) or muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the liquid phases to be separated.

The hydrophobins used according to the invention or the hydrophobins contained in the formulations according to the invention can be prepared chemically by known processes of peptide synthesis, for example by solid phase synthesis according to Merrifield. Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.

The production of fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence. Such a production method is disclosed, for example, in DE 102005007480.4.

Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas speα, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.

The invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.

Preferably, constructs used include a promoter 5 "upstream from the particular coding sequence and a terminator sequence 3" downstream, and optionally further conventional regulatory elements, each operably linked to the coding sequence.

In the context of the present invention, an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.

Examples of operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like. Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

In addition to these regulatory sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.

A preferred nucleic acid construct advantageously also contains one or more so-called "enhancer" sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 "end of the DNA sequences, such as further regulatory elements or terminators.

The nucleic acids may be contained in one or more copies in the construct. The construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.

Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.

It is also possible to use artificial promoters for regulation.

The nucleic acid construct, for expression in a host organism, is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host. In addition to plasmids and phages, all other vectors known to the person skilled in the art, ie, z. For example, viruses such as SV40, CMV, baculovirus and adenovirus, transposon JS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.

These vectors can be autonomously replicated in the host organism or replicated chromosomally. Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL.24, pl_G200, pUR290 _J plN-III ^lI 3-B1 _J tgt11 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, plL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHIac +, pBIN19, pAK2004 or pDH51. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). be removed.

Advantageously, the nucleic acid construct for expression of the further genes contained additionally 3 'and / or 5 "-terminal regulatory sequences for increasing the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.

These regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase. Thus, enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. In addition, however, an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.

In a further embodiment of the vector, the vector containing the nucleic acid construct or the nucleic acid may also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.

For optimal expression of heterologous genes in organisms, it is advantageous to modify the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be easily determined by computer evaluations of other known genes of the organism concerned.

An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator. or polyadenylation signal. Common recombinant and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusion, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

The recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).

With the help of the vectors recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used in the invention. Advantageously, the recombinant constructs described above are introduced into a suitable host system and expressed. In this case, it is preferable to use familiar cloning and transfection methods known to the person skilled in the art, for example co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, in order to express the stated nucleic acids in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscene, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Colard Spring Harbor Laboratory, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, NY, 1989.

Homologously recombined microorganisms can also be produced. For this, a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector). The introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source. Alternatively, the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed). The modified section of the invention according to The gene used is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is e.g. As described in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.

In principle, all prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for such nucleic acids or such nucleic acid constructs. Advantageously, microorganisms such as bacteria, fungi or yeast are used as host organisms. Gram-positive or Gram-negative bacteria, preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.

Depending on the host organism, the organisms used for fusion proteins in the above-described production process are grown or bred in a manner known to the person skilled in the art. Microorganisms are generally contained in a liquid medium containing a carbon source mostly in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts, and optionally vitamins, at temperatures between 0 and 100 ⁰ C, preferably between 10 to 60 ° C attracted under oxygen fumigation. In this case, the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not. The cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.

The hydrophobins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture. The proteins can thus also be produced on an industrial scale, if desired. The recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989). The cells are then disrupted if the proteins are not secreted into the culture medium and the product recovered from the lysate by known protein isolation techniques. The cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.

Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Arbeitsmethoden, Verlag Water de Gruyer, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

It may be particularly advantageous to provide the fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers. Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be increased significantly. Such separation methods are also known as affinity chromatography. For the incorporation of the anchor groups can be used in the production of proteins vector systems or oligonucleotides that extend the cDNA to certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors. Histidine-anchored modified fusion hydrophobins can be purified chromatographically using, for example, nickel-Sepharose as column filling. The fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.

In a simplified purification process can be dispensed with the chromatographic purification. For this purpose, the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be disrupted by means of suitable methods, for example by means of the methods already mentioned above, and the cell debris is separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents. The inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH. The purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight with respect to the amount of all proteins. The solutions obtained by the described simplified purification process can be used without further purification to carry out this invention.

The hydrophobins prepared as described can be used as "pure" hydrophobins both directly as fusion proteins and after cleavage and separation of the fusion partner.

If a separation of the fusion partner is envisaged, it is advisable to incorporate a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part. Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).

According to the invention, the hydrophobins or derivatives thereof can be used to improve the phase separation in compositions containing at least two liquid phases. These may be any compositions as long as they have at least two liquid phases.

In particular, it may also be compositions which are in the form of an emulsion prior to the addition of the at least one hydrophobin or derivative thereof.

In the context of the present invention, the composition may also have further phases in addition to the at least two liquid phases.

The at least two liquid phases are two liquid phases of different density, for example an oil and water, two aqueous solutions of different densities, two organic solutions of different densities, a fuel and water, a fuel and water or a solvent and water. In the context of the present invention, an aqueous solution is understood as meaning solutions which comprise water, optionally in combination with another solvent. Each of the liquid phases may contain further substances in the context of the present invention.

According to the invention, an oil is preferably a crude oil.

Suitable solvents are all liquids which form two-phase mixtures with water, in particular organic solvents, for example ethers, aromatic compounds such as toluene or benzene, alcohols, alkanes, alkenes, cycloalkanes, cycloalkenes, esters, ketones, naphthenes or halogenated hydrocarbons.

According to a further embodiment, the present invention therefore relates to a use as described above of at least one hydrophobin or at least one derivative thereof, wherein the composition containing at least two liquid phases is selected from the group consisting of

Compositions containing oil, preferably crude oil, and water, compositions containing fuel or water and water,

Reaction mixtures containing at least two liquid phases.

In the context of the present invention, the composition may also contain other phases, for example a solid or liquid phase, in particular a solid phase.

The hydrophobins or derivatives thereof can be used for all applications known to those skilled in the art. In particular, in the context of the present invention, the use as a demulsifier in gasoline / water mixtures, as a demulsifier in other fuel or fuel / water mixtures, the phase separation in chemical reactions, especially in large-scale processes, the emulsion cleavage between crude oil and water in the crude oil production or crude oil production, as well as the desalination of crude oil by extraction of crude oil with water and subsequent cleavage of the resulting emulsion. As large-scale chemical processes, all of these are suitable in which a phase separation is to be brought about, for example the hydroforming of polyisobutene with cobalt catalysts, the catalyst removal taking place in an aqueous state.

The hydrophobins or derivatives thereof are also used according to the invention for the phase separation of compositions containing at least two liquid Improve phases that occur in the course of a reaction, ie that form in the course of a reaction or occur by the addition of a solvent or a component. By the use according to the invention of hydrophobins or derivatives thereof, a shortening of the phase separation time is achieved and the loss of valuable substances can be reduced.

Likewise, it is possible according to the invention to improve the phase separation of compositions comprising two aqueous phases of different density, wherein an aqueous phase is understood as meaning a phase which contains water, optionally in combination with a further solvent. According to the invention, hydrophobins or derivatives thereof can be used, for example, to improve the phase separation in the fractionation of polymers in aqueous systems. In particular, water-soluble polymers are fractionated.

In general, all water and oil-soluble polymers known to the person skilled in the art, in particular polyacrylates and their copolymers, which, owing to their production, have a molecular weight distribution or polydispersity of greater than 1.1 are to be mentioned.

By adding demulsifiers emulsions can be broken. Thus, for example, extracted oil is generally present as a relatively stable water-in-oil emulsion which, depending on the type of deposit, may contain up to 90% by weight of water. When working up and cleaning the crude oil falls after the separation of a major part of the water to a crude oil, which still contains about 2 to 3 wt.% Water. This forms a stable emulsion with the oil, which can not be completely separated by centrifuging and adding conventional demulsifiers. This is problematic insofar as the water is on the one hand very saline and thus corrosive acts, on the other hand is increased by the residual water to be transported and stored volume, resulting in increased costs. According to the invention, it has been found that hydrophobins or derivatives thereof can be used to particular advantage in order to improve the phase separation in these compositions. It is achieved a very fast separation.

In this case, the demulsifier must be adjusted to the type of emulsified oils and fats as well as optionally contained emulsifiers and surfactants to achieve optimum effect. Breaking of emulsions may be additionally supported by an elevated temperature, for example a temperature of 0 to 100 ⁰ C, for example from 10 to 80 ° C, in particular from 20 to 60 ° C.

Other applications of the invention include, for example, the demulsification of impregnating emulsions in the chipboard and textile industry, as well as of Drug emulsions. Another application is the demulsification of organically treated effluents, such as industrial and commercial effluents, particularly from metalworking, such as metalworking coolants, tanneries and oil refineries, and domestic sources that produce oil / water emulsions. Such wastewater is produced, for example, in the processing of crude oil in refineries and petrochemical plants. Before these effluents can be fed to the treatment plant, it is necessary to separate oil residues, which are often in the form of an emulsion.

A further application according to the invention is the emulsion splitting of oil-in-water or water-in-oil mixtures, for example emulsions which have been used as cooling lubricants and are to be recycled. For example, water / oil mixtures also occur on board seagoing vessels as bilgewater. The separation of emulsions is necessary in order to be able to separate the water and to reduce the amount of the solvent to be disposed of.

The amount of hydrophobin or derivative thereof used can vary within wide limits, the amount advantageously being matched to the composition per se and optionally to other components contained in the composition.

If, for example, the composition contains substances which retard or worsen a phase separation of the at least two liquid phases, for example surfactants or emulsifiers, it is advantageous to use a larger amount of a hydrophobin or a derivative thereof.

Since oils, in particular crude oils, consist of a mixture of many chemical compounds, it is necessary, due to the different chemical composition of the oil, the water and salt fractions and the concrete conditions of emulsion splitting, such as temperature, duration of emulsion splitting, type of metered addition and interactions with other components of the mixture to tailor the demister to the specific conditions.

Surprisingly, it has been found that even small amounts of one of a hydrophobin or derivative thereof lead to an improvement in the phase separation.

The at least one hydrophobin or derivative thereof can be used according to the invention in any suitable amount. In general, the at least one hydrophobin or derivative thereof is used in an amount of 0.0001 to 1000 ppm on the entire composition, used; preferably in an amount of 0.001 to 500 ppm, more preferably of 0.01 to 200 ppm or 0.01 to 100 ppm and most preferably 0.1 to 50 ppm.

In the context of the present application, the indication ppm ppm per kg.

Therefore, according to a further embodiment, the present invention relates to a use as described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used. The concentration used will be determined by one skilled in the art according to the nature of the composition to be demulsified.

When the composition is a composition containing fuels or water, the hydrophobin or derivative thereof will generally be present in an amount of from 0.001 to 10 ppm, preferably from 0.005 to 2 ppm, more preferably from 0.01 to 1 ppm, particularly preferably 0.05 to 0.5 ppm and more preferably used from 0.01 to 0.1 ppm.

If the composition is a composition comprising crude oil and water, the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 800 ppm, more preferably from 5 to 500 ppm, most preferably 10 used to 200 ppm and more preferably from 15 to 100 ppm and used, for example 20 to 50 ppm.

If the composition is a composition comprising two aqueous phases of different densities, which may occur, for example, in the fractionation of water-soluble polymers, the hydrophobin or derivative thereof will generally be present in an amount of from 1 to 1000 ppm, preferably from 1 to 500 ppm, in particular from 5 to 250 ppm, more preferably 10 to 200 ppm and more preferably used from 15 to 100 ppm.

According to the invention, it is also possible that the composition contains, in addition to the at least one hydrophobin or derivative thereof, further compounds which improve the phase separation. These may be all compounds which are known to those skilled in such applications. For example, suitable as a further compound for improving the phase separation are oxyalkylated phenol-formaldehyde resins, EO / PO block copolymers, crosslinked diepoxides, polyamides or their derivatives, in particular for use as emulsion breakers in crude oil production Alkoxylates, salts of sulfonic acids, ethoxylated fatty amines, succinates and the compounds mentioned in DE 10 2005 006 030.7 for such applications.

Therefore, according to a further embodiment, the present invention relates to a use as described above, wherein in addition to at least one hydrophobin or the at least one derivative thereof, at least one further compound is used which improves the phase separation.

In a further aspect, the present invention also relates to a process for the separation of at least two liquid phases in a composition comprising at least two liquid phases, comprising the addition of at least one hydrophobin or at least one derivative thereof to the composition.

In this case, the composition may be a composition as described above containing at least two liquid phases.

According to a preferred embodiment, the present invention therefore relates to such a process, wherein the composition containing at least two liquid phases is selected from the group consisting of

Compositions containing oil, preferably crude oil, and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.

In principle, in the context of the present invention, the hydrophobins or derivatives thereof can be used in any desired amounts, provided that an improvement in the phase separation is achieved. Particularly suitable is the use of a hydrophobin or derivative thereof in an amount of 0.0001 to 1000 ppm, based on the total composition.

Likewise, the present invention relates to a method described above, wherein the at least one hydrophobin or the at least one derivative thereof, in an amount of 0.0001 to 1000 ppm, based on the total composition, is used. Preferred amounts for the respective systems have already been mentioned.

The process according to the invention may comprise further steps, for example those which improve a phase separation or the breaking of emulsions. This may be, for example, a temperature increase or centrifugation. Such a step may occur before, during or after the addition of the at least one hydrophobin or derivative thereof. According to a further embodiment, the present invention therefore relates to a method as described above, wherein the method comprises, before or after the addition of the at least one hydrophobin or the at least one derivative thereof, an increase in the temperature of the composition comprising at least two liquid phases.

According to the invention, hydrophobins or derivatives thereof, for example formulations containing fuels or fuels, may be added. This allows for contact of the formulation with water rapid segregation or prevents the formation of emulsions. The formation of emulsions, for example in storage tanks, would require expensive purification steps of the formulation.

It is also advantageous to add to crude oils hydrophobins or derivatives thereof, for example to prevent the formation of emulsions.

In the context of the present invention, the formulation comprising fuels or fuels may contain further additives which are customarily contained in such formulations.

Suitable additives are mentioned, for example, in WO 2004/087808.

The present invention therefore also relates to a formulation comprising at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin or derivatives thereof.

The amount of hydrophobin or derivative thereof used may vary depending on the other additives, as long as an improvement of the phase separation upon contact of the formulation with water is ensured.

According to the invention, the amount of hydrophobin or derivative used is preferably in the range from 0.0001 to 1000 ppm, preferably from 0.001 to 500 ppm, more preferably from 0.01 to 100 ppm.

Therefore, the present invention also relates to a formulation as described above wherein the hydrophobin or the derivative thereof is contained in the formulation in an amount of from 0.0001 to 1000 ppm, based on the total formulation. If the formulation is a mixture containing a crude oil, the hydrophobin or derivative thereof is usually added to this formulation in an amount of from 1 to 1000 ppm, preferably from 10 to 800 ppm, in particular from 10 to 500 ppm.

If the formulation is a mixture containing fuels or fuels, the hydrophobin or derivative thereof of this formulation is usually in an amount of 0.001 to 0.5 ppm, preferably from 0.005 to 0.3 ppm, in particular of 0 , 01 to 0.2 ppm added.

Thus, according to another embodiment, the present invention relates to a formulation as described above wherein the formulation contains at least one fuel or power and the hydrophobin or derivative thereof in an amount of 0.001 to 0.5 ppm, based on the total formulation, in the formulation is included.

For the purposes of the present invention, fuels are understood as meaning, for example, light, medium or heavy fuel oils.

In the context of the present invention, fuels are understood as meaning, for example, gasoline fuels, diesel fuels or turbine fuels. Particularly preferred are gasoline fuels.

The fuels may contain other additives. Usual additives are generally known to the expert. Suitable additives and solvents are mentioned, for example, in WO 2004/087808.

According to the invention, for example, as further additive components are additives with detergent action and / or with valve seat wear-inhibiting effect (hereinafter referred to as detergent additives). This detergent additive has at least one hydrophobic hydrocarbon radical with a number-average molecular weight M _n of 85 to 20 000 g / mol and at least one polar group selected from:

(a) mono- or polyamino groups having up to 6 nitrogen atoms, at least one nitrogen atom having basic properties;

(b) nitro groups, optionally in combination with hydroxyl groups; (c) hydroxyl groups in combination with mono- or polyamino groups, wherein at least one nitrogen atom has basic properties;

(d) carboxyl groups or their alkali metal or alkaline earth metal salts;

(e) sulfonic acid groups or their alkali metal or alkaline earth metal salts;

(T) polyoxy-C 2 to C 4 alkylene moieties terminated by hydroxyl groups, mono- or polyamino groups, wherein at least one nitrogen atom has basic properties, or terminated by carbamate groups;

(g) carboxylic acid ester groups;

(h) succinic anhydride-derived moieties having hydroxy and / or amino and / or amido and / or imido groups; and or

(i) by Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings.

The hydrophobic hydrocarbon radical in the above detergent additives, which provides the sufficient solubility in the fuel, has a number average molecular weight (Mn) of 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5000. As a typical hydrophobic hydrocarbon radical, especially in combination with the polar groups (a), (c), (h) and (i), the polypropenyl, polybutenyl and polyisobutenyl radicals have in each case Mn = 300 to 5000, in particular 500 to 2500, especially 700 to 2300, into consideration.

As examples of the above groups of detergent additives, the following are mentioned:

Mono- or polyamino (a) -containing additives are preferably polyalkylene mono- or polyalkene polyamines based on polypropene or conventional (ie with predominantly intermediate double bonds) polybutene or polyisobutene having M _n from 300 to 5000 g / mol. If one starts with the preparation of the additives of polybutene or polyisobutene with predominantly central double bonds (usually in the beta and gamma position), the preparation route by chlorination and subsequent amination or by oxidation of the double bond with air or ozone to carbonyl offers or carboxyl compound and subsequent amination under reductive (hydrogenating) conditions. For amination here amines, such as. As ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, are used. Corresponding additives based on polypropene are described in particular in WO 94/24231.

Further preferred monoamino groups (a) containing additives are the hydrogenation products of the reaction products of polyisobutenes having an average degree of polymerization P = 5 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 97/03946.

Further preferred monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.

Nitro groups (b), optionally in combination with hydroxyl groups, containing additives are preferably reaction products of polyisobutenes of average degree of polymerization P = 5 to 100 or 10 to 100 with nitrogen oxides or mixtures of nitrogen oxides and oxygen, as described in particular in WO 96/03367 and WO 96/03479 are described. These reaction products are generally mixtures of pure nitropolyisobutenes (eg., Alpha-pha, beta-dinitropolyisobutene) and mixed hydroxynitropolyisobutenes (eg., Alpha-nitro-beta-hydroxypolyisobutene).

Hydroxyl groups in combination with mono- or polyamino groups (c) containing additives are in particular reaction products of polyisobutene epoxides, obtainable from preferably predominantly terminal double bonds containing polyisobutene having Mn = 300 to 5000, with ammonia, mono- or polyamines, as in particular in EP A 0 476 485 are described.

Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C2-C40 olefins with maleic anhydride having a total molecular weight of 500 to 20,000 whose carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remainder of the Carboxyl groups are reacted with alcohols or amines. Such additives are known in particular from EP-A 0 307 815. Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.

Sulfonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 0 639 632. Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.

Polyoxy-C2-C4-alkylene (f) containing additives are preferably polyether or polyetheramines, which by reaction of C2-C60-alkanols, C6-C30-alkanediols, mono- or di-C2-C30-alkylamines, C1-C30 Alkylcyclohexanolen or C1-C30-alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyether amines, by subsequent reductive amination with ammonia, monoamines or polyamines nen are available. Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416. In the case of polyethers, such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobute- nolbutoxylate and propoxylates and the corresponding reaction products with ammonia.

Carboxyl ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm ² / s at 100 ° C, as described in particular in DE-A 38 38 918 are. As mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 C atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.

Succinic anhydride-derived groupings containing hydroxyl and / or amino and / or amido and / or imido groups (h) are preferably corresponding derivatives of polyisobutenyl succinic anhydride obtained by reacting conventional or highly reactive polyisobutene having Mn = 300 to 5000 with maleic anhydride on thermal Pathways or via the chlorinated polyisobutene are available. Of particular interest here are derivatives with aliphatic polyamines, such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine. Such Otto fuel additives are described in particular in US 4,849,572.

By Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and Mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine. The polyisobutenyl-substituted phenols may be derived from conventional or highly reactive polyisobutene having Mn = 300 to 5,000. Such "polyisobutene-Mannich bases" are described in particular in EP-A 0 831 141.

For a more detailed definition of the individual listed Otto fuel additives is hereby expressly incorporated by reference to the disclosures of the above-mentioned writings of the prior art.

The additives mentioned are used in those skilled in the appropriate application appearing quantities.

The formulations according to the invention can moreover be combined with still further customary components and additives. For example, carrier oils without pronounced detergent action are to be mentioned here.

Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. According to the invention is suitable also is known as a "hydro-crack oil" and obtained in the refining of mineral oil fraction (vacuum distillate cut having a boiling range of about 360-500 ⁰ C, available surfaces of high-pressure catalytically hydrogenated and isomerized and also deparaffinized natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.

Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyethylenemolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.

Examples of suitable polyolefins are olefin polymers having Mn = 400 to 1800, especially based on polybutene or polyisobutene (hydrogenated or non-hydrogenated).

Examples of suitable polyethers or polyetheramines are preferably polyoxy-C2-

C4-Alkylengruppierungen containing compounds which by reaction of

C2-C60-alkanols, C6-C30-alkanediols, mono- or di-C2-C30-alkylamines, C1-C30-alkylcyclohexanols or C1-C30-alkylphenols with 1 to 30 mol of ethylene oxide and / or Propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyether amines, by subsequent reductive amination with ammonia, monoamines or polyamines are available. Such products are described in particular in EP-A 0 310 875, EP-A 0 356 725, EP-A 0 700 985 and US 4,877,416. For example, as polyetheramines, poly-C 2 -C 6 -alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.

Examples of carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918. As mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms. Typical representatives of the esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and isotricanecanol, such as e.g. Di (n- or iso-tridecyl) phthalate.

Further suitable carrier oil systems are described, for example, in DE-A 38 26 608, DE-A 41 42 241, DE-A 43 09 074, EP-A 0 452 328 and EP-A 0 548 617, to which reference is hereby expressly made.

Examples of particularly suitable synthetic carrier oils are alcohol-started polyethers with about 5 to 35, such as. B. about 5 to 30, C3-C6 alkylene oxide units, such as. B. selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof. Nonlimiting examples of suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C 6 -C 18 -alkyl radical.

Preferred examples are tridecanol and nonylphenol.

Further suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.

The carrier oils mentioned are used in those skilled in the appropriate application appearing quantities. Further customary additives are corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2, 4-di-tert-butylphenol or 3, 5-di-tert-butyl-4-hydroxyphenylpropionsäure; other conventional demulsifiers; Antistatic agents; Metallocenes such as ferrocene; methylcyclopentadienyl; Lubricity additives such as certain fatty acids, alkenyl succinic acid esters, bis (hydroxyalkyl) fatty amines, hydroxyacetamides or castor oil; as well as dyes (markers). Optionally, amines are added to lower the pH of the fuel.

The said detergent additives with the polar groups (a) to (i) are added to the fuel usually in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight. The other components and additives mentioned are added, if desired, in customary amounts.

According to the invention, fuels and fuels which are suitable according to the invention are all fuels and fuels known to the person skilled in the art, for example gasolines, as described, for example, in LJII-Mann's Encyclopedia of Industrial Chemistry, 5th ed. 1990, Volume A16, p. 719ff. are described. According to the invention, suitable fuels are also diesel fuel, kerosene and jet fuel.

In particular, a gasoline with an aromatics content of 60, such. B. maximum 42 vol .-% and a maximum sulfur content of 2000, such as. B. maximum 150 ppm by weight is suitable.

The aromatic content of the gasoline is for example 10 to 50, such as. B. 30 to 42 vol .-%, in particular 32 to 40 vol .-%. The sulfur content of the gasoline is for example 2 to 500, such as. B. 5 to 150 ppm by weight, or 10 to 100 ppm by weight.

Furthermore, a suitable gasoline fuel, for example, an olefin content up to 50 vol .-%, such as. B. from 6 to 21 vol .-%, in particular 7 to 18 vol .-%; a benzene content of up to 5 vol .-%, such as. B. 0.5 to 1.0 vol .-%, in particular 0.6 to 0.9 vol .-% and / or an oxygen content of up to 25 wt -.%, Such as. For example, up to 10% by weight or 1.0 to 2.7% by weight, in particular from 1.2 to 2.0% by weight.

In particular, such gasoline fuels can be exemplified, which at the same time have an aromatics content of at most 38% by volume, an olefin content of ma- ximal 21 vol .-%, a maximum sulfur content of 50 ppm by weight, a benzene content of not more than 1, 0 vol .-% and an oxygen content of 1, 0 to 2.7 wt -.% Have.

The content of alcohols and ethers in gasoline can vary over a wide range. Examples of typical maximum contents are 15% by volume for methanol, 65% by volume for ethanol, 20% by volume for isopropanol, 15% by volume for tert-butanol, 20% by volume for isobutanol and 20% by weight for isobutanol for ethers with 5 or more C atoms in the molecule 30 vol .-%.

The summer vapor pressure of a gasoline suitable according to the invention is usually not more than 70 kPa, in particular 60 kPa (each at 37 ° C).

The ROZ of the gasoline is usually 75 to 105. A common range for the corresponding MOZ is 65 to 95.

The specified specifications are determined by conventional methods (DIN EN 228).

The invention is explained in more detail below by examples.

Examples

example 1

Preliminary work for the cloning of yaad-HisJ vaaE-HiSg

Oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) were used to perform a polymerase chain reaction. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert, and in the previously linearized with the restriction endonucleases Ncol and BglII vector pQE60 from Qiagen Moniert. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS ₆ and YAAE :: HIS ₆ , respectively.

Hal570: gcgcgcccatggctcaaacaggtactga Hal571: gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc Example 2

Cloning of vaad hydrophobin DewA-HiSg

Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out. The template DNA was genomic DNA of the mold

Aspergillus nidulans used. The resulting PCR fragment contained the coding

Sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase

Interface. The PCR fragment was purified and cut with the restriction endonuclease Barn HI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.

The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS ₆ .

KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC

Example 3

Cloning of vaad-Hvdrophobin RodA-HiSg

The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.

KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

Example 4

Cloning of vaad-Hvdrophobin BASFI-HiSg

The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.

The template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12). KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-

GAAGTTCTCCGTCTCCGC

KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 5

Cloning of vaad hydrophobin BASF2-HiSfi

The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.

An artificially synthesized DNA sequence-hydrophobin BASF2-was used as template DNA (see Appendix, SEQ ID NOS: 13 and 14).

KaM417! CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 6

Cloning of vaad-Hvdrophobin SC3-HiSfi

The cloning of plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.

Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).

KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC

KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT

Example 7 Fermentation of the recombinant E. coli strain vaad-Hvdrophobin DewA-HiSg

Inoculation of 3 ml LB liquid medium with a yaad hydrophobin DewA-His ₆ -expressing E. coli strain in 15 ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. Each 2 11 Erlenmeyer flasks with baffles and 250ml LB Medium (+ 100 μg / ml ampicillin) are inoculated with 1 ml each of the preculture and incubated for 9 h at 37 ° C on a shaker with 180 rpm.

13.51 LB medium (+ 100 μg / ml ampicillin) in a 2 l fermenter with 0.5 l of preculture (OD ₆ oo _nm 1:10 measured against H ₂ O). At an OD _60nm of -3.5 add 140ml 10OmM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.

Example e

Purification of the recombinant hvdrobobin fusion protein

(Purification of Hydrophobin Fusion Proteins Having a C-terminal His6 Tag)

100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 ml sodium phosphate buffer, pH 7.5 and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated. Before cell disruption, filter with a glass cartridge (P1). For homogeneity and shearing of the remaining genomic DNA, two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g). According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation (Figure 1). The experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells. 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM Imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.

Figure 1 shows the purification of the prepared hydrophobin: Lane A: Nickel Sepharose column (1:10 dilution)

Lane B: Pass = eluate wash step

Lanes C - E: OD 280 Maxima of elution fractions (WP1, WP2, WP3)

Lane F shows the applied marker.

The hydrophobin of Figure 1 has a molecular weight of about 53 kD. The smaller bands partially represent degradation products of hydrophobin.

Example 9

Application test: Characterization of the hydrophobin by changing the contact angle of a water drop to glass

substrate:

Glass (window glass, Süddeutsche Glas, Mannheim):

The purified according to Example 8 hydrophobin was used.

Concentration of hydrophobin in the solution: 100 ug / ml, the solution further contained 50 mM Na-acetate buffer and 0.1% polyoxyethylene (20) -sorbitan monolaurate (Tween ^® 20)), pH of the solution: 4

- immersion of glass plates in this solution overnight (temperature 80 ⁰ C) - Thereafter, the coated glass flakes with hydrophobin of the solution is removed and gewachen in distilled water,

- Then incubate 10min / 80 ⁰ C / 1% SDS solution in dist. water

- rinse again in dist. water

The samples are air dried and the contact angle (in degrees) of a drop of 5 μl of water with the coated glass surface determined at room temperature.

The contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.

Untreated glass gave a contact angle of 30 ± 5 ° The glass plate coated with the hydrophobin according to Example 8 (yaad-dewA-his ₆ ) gave a contact angle of 75 ± 5 °.

==> Increase of the contact angle: 45 °

Example 10

Use of a hydrophobin concentrate (yaad-Xa-dewA-HiSβ) as an additive in fuels

Experimental principle:

Modern fuels usually contain a number of different additives (so-called additive packages). If the fuel comes in contact with water in the course of the production or distribution, these additives can develop emulsifying effect and lead to the formation of undesirable fuel-water emulsions. In order to avoid this effect, therefore, demulsifiers are usually added to the fuels.

The demulsification experiments were carried out with a hydrophobin concentrate according to Example 8 (SEQ ID NO: 19 or 20).

The hydrophobin concentrate was diluted with ethanol and added to a commercial Eurosuper fuel (according to EN 228), which already contained 725 mg / kg of a special performance additive package A. This additive package consists mainly of the polyisobutenamine Kerocom PIBA, carrier oil mixtures, solvents, corrosion inhibitor and friction modifier.

Fuel samples were prepared at 0.01, 0.03, 0.05, 0.07, 0.14 and 0.28 mg / kg of hydrophobin. The reference (10-V1) was the A-additive fuel without hydrophobin. In a further comparative experiment (10-V2), 1.45 mg / kg of a commercially available demulsifier D based on phenolic resins (ADX 606, from Lubrizol) were used.

Emulsion tests according to DIN 51415 were carried out in each case with the fuel samples. In each case 80 ml of fuel and 20 ml of water are intensively mixed with each other. Thereafter, the segregation process is observed as a function of time. The evaluation is based on standards specified in the standard, where 1 stands for a very good segregation and larger numbers for increasingly poorer segregation. The details are contained in the cited DIN standard. Table 1 summarizes results of the experiments. In each case, the assessments of the phase separation layers are listed after 1 min, 5 min, 30 min and 60 min. As a rule, a rating of 1 or 1 b is required after 5 minutes.

Table 1

Comment:

Without the addition of a demulsifier only a very slow demulsification is observed. The rating 4 is unacceptable, a stable emulsion occurs.

The hydrophobins have a very good demulsifying effect even in extremely small amounts. Already 0.01 ppm of hydrophobin leads to an acceptable result within 1 min. The same effect as with 0.07 mg / kg of hydrophobin is achieved only by adding 1.45 mg / kg of the commercial demulsifier based on phenolic resins to the fuel. When using hydrophobin ity only about 1/20 of the amount of a conventional demulsifier to achieve the same effect required.

Comparative Example 11

Use of other proteins as an additive in fuels

Analogously to Example 10, other proteins other than hydrophobins were tested for use in fuels.

The experiments were carried out with bovine serum albumin (BSA) and casein. Such proteins are commercially available. Furthermore, yaad was used in accordance with SEQ ID NO 15 and 16, ie the non-hydrophobin-associated fusion partner alone. The respective protein was added in a concentration of 0.07 mg / kg to a commercial Euro Super fuel (according to EN 228), which already contained 1000 mg / kg of the abovementioned performance additive package A. The only fuel used as a reference was A, without protein.

In each case emulsion tests according to DIN 51415 were carried out as described above. The results of the experiments are summarized in Table 2.

Table 2

Comment:

The separation of the emulsion runs without addition of a demulsifier as slowly as in Example 10. The rating 4 is unacceptable, it appears a stable emulsion.

The proteins used have a demulsifying effect, but the rate of demulsification is slower than with the use of hydrophobins.

Example 12

Use of a hvdrophobin concentrate (Yaad-Xa-dewA-HiSβ) as an emulsion breaker for crude oil

The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20).

In the experiments carried out, hydrophobin concentrate in various amounts was added to 50 ml of crude oil (sample ex Wintershall AG, Emiichheim, probe 301, residual water content after the use of conventional emulsion breakers about 3%). The concentration of hydrophobin in the crude oil was 1 ppm, 10 ppm and 40 ppm. After homogenization, the mixtures were 10 min. at 2000 rpm, centrifuged. The results are shown in Table 3. Table 3

Upon addition of 10 and 40 ppm hydrophobin concentrate, a predominant portion of the free water phase formed.

Example 13

Use of a hvdrophobin concentrate (Yaad-Xa-dewA-HiSβ) for the fractionation of polymers

The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20).

In two beakers were each 150 g of a polyacrylic acid in the form of its sodium salt (Sokalan CP 10 ^® S; M _w 4000 g / mol, in accordance with DE 199 50 941 A1) were charged, followed by 75 per g of isopropanol was added. It was stirred for 5 min, then 146 g each of isopropanol / water (in the ratio 1/1) were added and stirred for 5 min.

In beaker A, 50 ppm of hydrophobin (1.64 m, 11.3 mg / ml) was added and stirred for 5 min. The hydrophobin produced white streaks in the clear solution which were completely dissolved after 5 minutes. In both beakers 19.75 g of 50% NaOH was added and stirred for 15 min.

With hydrophobin immediately a milky solution was formed, without the addition of hydrophobin a highly opaque solution. After stirring for 15 min, the contents of the beakers were transferred to a 500 ml separatory funnel, shaken briefly and observed how long the separation of the phases took.

After 10 minutes, the sample with hydrophobin showed a clear phase separation, without the addition of the hydrophobin a foam-like "intermediate layer" formed, ie no clear phase boundary Without addition of a hydrophobin, a clear phase boundary only formed after 40 minutes. Duration of separation until the occurrence of a sharp phase boundary:

- With hydrophobin: 12 minutes

- Without hydrophobin: 40 minutes

Example 14, Comparative Example 15

Use of fusion hydrophobin (Yaad-Xa-dewA-HiSβ) and bovine serum albumin (BSA) as demulsifier for an oil-water emulsion at 55 ° C

The experiment was carried out with a hydrophobin concentrate according to Example 8 (SEQ ID Nos. 19 and 20) and carried out with a commercially available solution of bovine serum albumin (BSA).

The demulsification test was carried out as follows:

As oil, a hydraulic oil was used.

40 ml of distilled water were placed in a 100 ml graduated cylinder and the respective protein was added in an amount of 5 ppm with respect to the water or 2.5 ppm relative to the overall system. Subsequently, 40 ml of hydraulic oil were added and the system was heated at 55 ° C in a water bath. The tempering time was 20 min. Thereafter, the oil and the water were emulsified with a paddle stirrer at 1500 rpm for 5 minutes. As a result, the oil is emulsified in the water phase. Thereafter, the phase separation was observed. Indicated is the amount of the separated water phase in ml.

In a series of experiments, the aqueous solution of the two proteins was used unchanged. The results are shown in Diagram 1.

In a second series of experiments, the solution of the two proteins was first adjusted to pH 1 with HCl at RT and left at pH 1 for 24 h. It was then adjusted again to pH 7 with NaOH. The results are shown in Diagram 2. Demulsification of an oil - water emulsion containing 2.5 ppm of proteins

Time in min.

Diagram 1: Comparison of hydrophobin (H * protein A) and bovine serum albumin, unchanged samples

Demulsification of an oil - water emulsion containing 2.5 ppm of proteins

Time in min.

Diagram 2: Comparison of hydrophobin (H * protein A) and bovine serum albumin, samples were adjusted to pH 1 for 24 h each before the experiment. Comment:

The rate of demulsification of the oil-in-water emulsion is only slightly improved by BSA compared to a sample without demulsifier. On the other hand, when hydrophobins are added, a very marked acceleration of the demulsification is observed.

Claims

claims

1. Use of at least one hydrophobin for improving the phase separation in compositions containing at least two liquid phases.

2. Use according to claim 1, wherein the at least one hydrophobin is used as a demulsifier.

3. Use according to any one of claims 1 or 2, wherein the at least one hydrophobin is a fusion hydrophobin.

4. Use according to claim 3, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his ( SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.

5. Use according to any one of claims 1 to 4, wherein the composition containing at least two liquid phases is selected from the group consisting of

Compositions containing oil and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.

6. Use according to any one of claims 1 to 5, wherein the at least one hydrophobin is used in an amount of 0.0001 to 1000 ppm, based on the total composition.

7. Use according to claim 6, characterized daurch in that it is a crude oil-water composition, and the at least one hydrophobin in an amount of 1 to 800 ppm, based on the total composition, is used.

8. Use according to claim 6, daurch characterized in that it is a fuel / fuel-water composition, and the at least one

Hydrophobin is used in an amount of 0.001 to 10 ppm, based on the total composition.

9. Use according to any one of claims 1 to 8, wherein in addition to the at least one hydrophobin at least one further compound is used, which improves the phase separation.

A process for the separation of at least two liquid phases in a composition containing at least two liquid phases comprising the addition of at least one hydrophobin to the composition.

11. The method of claim 10, wherein the at least one hydrophobin is a fusion hydrophobin or a derivative thereof.

12. The method according to claim 11, characterized in that the fusion hydrophobin is at least one selected from the group of y-aad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or y-aad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.

13. The method according to any one of claims 10 to 12, wherein the composition containing at least two liquid phases is selected from the group consisting of

Compositions containing oil and water, compositions containing fuel or water and fuel, reaction mixtures containing at least two liquid phases.

14. The method according to any one of claims 10 to 13, wherein the at least one hydrophobin in an amount of 0.0001 to 1000 ppm, based on the total composition, is used.

15. The method according to claim 14, daurch characterized in that it is a crude oil-water composition, and the at least one hydrophobin in an amount of 1 to 800 ppm, based on the total composition, is used.

16. The method according to claim 14, daurch characterized in that it is a fuel / fuel-water composition, and at least one

Hydrophobin is used in an amount of 0.001 to 10 ppm, based on the total composition.

17. The method according to any one of claims 10 to 16, wherein the method before or after the addition of the at least one hydrophobin an increase in the temperature temperature of the composition comprising at least two liquid phases.

18. Formulation containing at least one compound selected from the group consisting of fuels, fuels, crude oils or water- or oil-soluble polymer solutions and at least one hydrophobin.

19. A formulation according to claim 18, wherein the hydrophobin is contained in an amount of from 0.0001 to 1000 ppm, based on the total formulation, in the formulation.

20. A formulation according to claim 18 or 19, wherein the formulation contains at least one fuel or fuel and the hydrophobin or the derivative thereof in an amount of 0.001 to 0.5 ppm, based on the total formulation, is included in the formulation.

21. Formulation according to claim 20, characterized in that the fuel or fuel is a fuel selected from the group of gasoline fuels, diesel fuels or turbine fuels.

22. A formulation according to any one of claims 18 to 21, wherein the at least one protein is a fusion hydrophobin or a derivative thereof.

23. A formulation according to claim 22, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), wherein yaad can also be a truncated fusion partner yaad 'with 20 to 293 amino acids.