EP1913123A1 - Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche - Google Patents

Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche

Info

Publication number
EP1913123A1
EP1913123A1 EP06792583A EP06792583A EP1913123A1 EP 1913123 A1 EP1913123 A1 EP 1913123A1 EP 06792583 A EP06792583 A EP 06792583A EP 06792583 A EP06792583 A EP 06792583A EP 1913123 A1 EP1913123 A1 EP 1913123A1
Authority
EP
European Patent Office
Prior art keywords
yaad
hydrophobin
proteins
protein
detergent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP06792583A
Other languages
English (en)
French (fr)
Other versions
EP1913123B1 (de
Inventor
Dieter Boeckh
Volker Schwendemann
Ulf Baus
Thorsten Montag
Marvin Karos
Thomas Subkowski
Claus Bollschweiler
Hans-Georg Lemaire
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1913123A1 publication Critical patent/EP1913123A1/de
Application granted granted Critical
Publication of EP1913123B1 publication Critical patent/EP1913123B1/de
Not-in-force legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D11/00—Special methods for preparing compositions containing mixtures of detergents
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/0005—Other compounding ingredients characterised by their effect
    • C11D3/0036—Soil deposition preventing compositions; Antiredeposition agents
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D2111/00—Cleaning compositions characterised by the objects to be cleaned; Cleaning compositions characterised by non-standard cleaning or washing processes
    • C11D2111/10—Objects to be cleaned
    • C11D2111/12—Soft surfaces, e.g. textile

Definitions

  • the present invention relates to the use of surface-active, non-enzymatic proteins for textile washing. It further relates to laundry detergents containing surfactant non-enzymatic proteins and to a process for washing using such proteins.
  • WO 98/00500 discloses for this purpose the use of cellulases, cellulase derivatives or cellulase-like proteins
  • WO 01/46357 discloses for this purpose a fusion protein having a binding site for cellulose as well as a binding site for other compounds.
  • Hydrophobins have a strong affinity for interfaces and are therefore suitable for coating surfaces, for example Teflon can be hydrophilized by exposing the Teflon surface to hydrophobins coated.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units. Hydrophobins can be isolated on the one hand from natural sources. But they can also be obtained by genetic engineering. Our earlier application PCT / EP2006 / 050719 discloses such a production process for hydrophobins.
  • WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams and cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed.
  • EP 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fumes, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C. ,
  • WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
  • WO 03/10331 discloses a hydrophobin-coated sensor, for example a measuring electrode, to which non-kova nt further substances, e.g. electroactive substances, antibodies or enzymes are bound.
  • the object of the invention was to provide improved detergents and improved processes for washing textiles. They should be distinguished in particular by an improved washing performance when washing at low temperatures.
  • laundry detergents comprising surfactant non-enzymatic proteins have been discovered.
  • a method of washing using a wash liquor comprising surface active non-enzymatic proteins is carried out at a temperature of not more than 60 0 C.
  • the surface-active, non-enzymatic proteins are each hydrophobins.
  • non-enzymatic proteins are used.
  • non-enzymatic is intended to mean that the proteins preferably have no or at least no significant enzymatic action.
  • the term "surface-active" is intended to mean that the protein used has the ability to affect the properties of interfaces.
  • the interfaces to be considered may be solid-solid, solid-liquid, solid-gaseous, liquid-liquid or In particular, they may be solid-liquid or liquid-liquid interfaces.
  • the property may be the hydrophilicity or hydrophobicity of the solid surface, which changes under the influence of the protein used. The change in hydrophilicity or hydrophobicity can be measured in a known manner by measuring the contact angle of a water droplet on the coated and uncoated surface.
  • Another interface property is the change in surface tension of a liquid, which can be measured by known methods.
  • proteins which are surface-active even at low concentrations are preferred. Particularly suitable are those proteins which have significant surface-active properties even in concentrations of 0.05 to 50 ppm in aqueous solution.
  • those proteins are used which are characterized by the property of increasing the contact angle of a water droplet (5 ⁇ l) at least 20 ° after application to a glass surface at room temperature compared to the contact angle of an equal size Drop the water with the uncoated glass surface. Preference is given to using proteins in which the contact angle enlargement is at least 25 °, particularly preferably at least 30 °.
  • the implementation of contact angle measurements is known in principle to the person skilled in the art. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the proteins used are hydrophobins.
  • hydrophobins are to be understood as meaning polypeptides of the general structural formula (I)
  • X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
  • the radicals X may be the same or different.
  • the indices standing at X each represent the number of amino acids in the respective subsequence X
  • C stands for cysteine, alanine, serine, glycine, methionine or threonine, at least four of the radicals named C being cysteine
  • the indices n and m independently represent natural numbers between 0 and 500, preferably between 15 and 300.
  • the polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or can form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C positions in the general formulas may change accordingly.
  • X, C and the indices standing at X and C have the above meaning
  • the indices n and m are numbers between 0 and 350, preferably 15 to 300
  • the proteins further by the above-mentioned Distinguish contact angle change and it is still at least 6 of the radicals named C is cysteine.
  • C is cysteine.
  • all C radicals are cysteine.
  • the proteins continue to be distinguished by the abovementioned contact angle change, and at least at least 6 of the residues named C are cysteine. Most preferably, all of the C radicals are cysteine.
  • radicals X n and X m may it be peptide sequences that are growing naturally, also linked to a hydrophobin. However, one or both of the residues may be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended by a non-naturally occurring in a hydrophobin peptide sequence.
  • X n and / or X m are naturally non-hydrophobic linked peptide sequences
  • such sequences are generally at least 20, preferably at least 35 and more preferably at least 50 amino acids and for example at least 100 amino acids long. They may, for example, be sequences from 20 to 500, preferably 30 to 400 and particularly preferably 35 to 100 amino acids.
  • Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner. This is to say that the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.
  • the fusion partner portion can be selected from a variety of proteins. Only a single fusion partner can be linked to the hydrophobin moiety, or several fusion partners can also be linked to a hydrophobin moiety, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobic moiety. However, it is also possible, for example, to link two fusion partners with a position (X n or X m ) of the protein according to the invention.
  • fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin.
  • fragments or derivatives of said sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50%, and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids.
  • the fusion hydrophobin has, in addition to the fusion partner mentioned, one of the groups X n or X m or, as the terminal constituent of such a group, a so-called affinity domain (affin ity tag / affine ity tail).
  • affinity domains include (His) k, (Arg) k, (Asp) k, (Phe) k or (Cys) k groups, where k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
  • the group X can be N and / or X m exclusively of such an affinity domain consist or a naturally or non-naturally linked to a hydrophobin radical X n and Xm is Gert extended for a terminal affinity domain.
  • proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaric dialdehyde.
  • a characteristic of the hydrophobins or their derivatives used according to the invention is the change of surface properties when the surfaces are coated with the proteins.
  • the change in surface properties can be determined experimentally, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
  • contact angle measurements is known in principle to the person skilled in the art.
  • the measurements refer to room temperature and water drops of 5 ⁇ l and the use of glass slides as substrate.
  • the exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • hydrophobins for practicing the present invention are the dewA, rodA, hypA, hypB, sc3, basfi, basf2 hydrophobins which are structurally characterized in the Sequence Listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
  • fusion proteins yaad-XadewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1-his (SEQ ID NO: 24) with the polypeptide sequences given in parentheses and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • yaad-Xa-dewA-his proteins which, starting from the amino acid sequences shown in SEQ ID NO.
  • the biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
  • Particularly suitable derivatives for carrying out the invention are yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his
  • yaad residues residues derived by truncation of the yaad fusion partner.
  • the truncated residue should comprise at least 20, preferably at least 35, amino acids.
  • a truncated radical having 20 to 293, preferably 25 to 250, particularly preferably 35 to 150 and for example 35 to 100 amino acids can be used.
  • An example of such a protein is yaad40-Xa-dewA-his (SEQ ID NO: 26) which has a 40 amino acid truncated yaad residue.
  • a cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example, by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage, etc.).
  • fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA, in succession.
  • hydrophobin fragments for example N- or C-terminal truncations
  • muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the liquid phases to be separated.
  • hydrophobins used for textile washing according to the invention can be prepared chemically by known methods of peptide synthesis, such as by Merrifield solid phase synthesis.
  • Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • fusion proteins can preferably be effected by genetic engineering processes in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence ,
  • a manufacturing method is disclosed, for example, in PCT / EP2006 / 050719.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Asperg
  • the invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operatively linked to the coding sequence.
  • an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.
  • a preferred nucleic acid construct advantageously also contains one or more so-called “enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers such as antibiotic resistance or auxotrophic complementing genes, optionally for selection on the construct.
  • Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, transposon JS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.
  • vectors can be autonomously replicated in the host organism or replicated chromosomally.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIII-III "3-B1, tgt11 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Cory- nebacterium pSA77 or pAJ667, in fungi pALS1, plL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or p
  • the plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences for increasing expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
  • enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA can consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • an expression cassette is carried out by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • a suitable promoter for this purpose, common recombination and cloning techniques are used, as described, for example, in T. Maniatis, E.Fritsch and J.
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used in the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • Homologously recombined microorganisms can also be produced.
  • a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is e.g. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.
  • the host organ used is microorganisms such as bacteria, fungi or yeasts.
  • gram-positive or gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, more preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are used.
  • the organisms used in the production process for fusion proteins just described are attracted or cultivated, depending on the host organism, in a manner known to the person skilled in the art.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 0 C, preferably be- see 10 attracted to 60 0 C while passing in oxygen.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • the hydrophobins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production, wherein a polypeptide-producing microorganism is cultivated, if appropriate, the expression of the proteins is induced and these are isolated from the culture.
  • the proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the fusion partners greatly facilitate the production of hydrophobins. Fusion hydrophobins are produced with significantly better yields than hydrophobins without fusion partners.
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation techniques.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by a Effect of detergents, lytic enzymes or organic solvents, be homogenized by homogenizers or by combining several of the listed methods.
  • Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as other conventional methods, such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Methoden, Verlag Water de Gruyer, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • the fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers.
  • Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be increased significantly.
  • separation methods are also known as affinity chromatography.
  • anchor groups can be used in the production of proteins vector systems or oligonucleotides that extend the cDNA to certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors.
  • fusion hydrophobins modified with histidine anchors can be chromatographically purified using columnar nickel-Sepharose.
  • the fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.
  • the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be digested by means of suitable methods, for example by means of the methods already mentioned above, and the cell debris can be separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents.
  • the inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH.
  • the purity of the after The fusion hydrophobin obtained in this simplified process is generally from 60 to 80% by weight, based on the amount of all proteins.
  • the solutions obtained by the described, simplified purification process can be used without further purification to carry out this invention.
  • the fusion hydrophobins can also be isolated from the solutions as a solid. This can be done, for example, in a manner known in principle by freeze-drying or spray-drying.
  • the isolation can be carried out by spray drying.
  • the spray drying can be carried out with the solution purified by chromatography, but it is also possible with preference to use the solutions obtained by the purification process of the inclusion bodies (inclusion bodies).
  • the solutions can optionally be neutralized.
  • a pH range of 7 to 9 has been found to be particularly advantageous.
  • the solution can be spray-dried in a manner known in principle. Suitable apparatus for spray-drying are commercially available. The optimum spray drying conditions vary with device type and desired throughput. Inlet temperatures from 130 to 180 0 C and
  • hydrophobin solutions Starting temperatures of 50 to 80 0 C have been found in hydrophobin solutions as favorable.
  • spray-drying auxiliaries such as sugar, mannitol, dextran or maltodextrin can be used.
  • An amount of from 0 to 30% by weight, preferably from 5 to 20% by weight, of such auxiliaries with respect to the hydrophobin has proven useful.
  • hydrophobins prepared as described can be used as "pure" hydrophobins both directly as fusion proteins and after cleavage and separation of the fusion partner.
  • a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur either in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools.
  • BrCN cleavage is particularly suitable Methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin or TEV cleavage (Tobacca etch virus protease).
  • the surface-active, non-enzymatic proteins can, on the one hand, be used as a component of a detergent and be added in this form to the wash liquor.
  • the separate addition may be by the addition of the protein in solid form, as a solution or as a suitable formulation. Of course, both methods of addition can also be combined.
  • the amount of surface-active, non-enzymatic protein in the wash liquor is determined by the skilled person depending on the desired effect. As a rule, an amount of 0.05 to 50 ppm, preferably 0.1 to 30 ppm, more preferably 0.2 to 20 ppm, very particularly preferably 0.5 to 10 ppm and for example 1 to 6 ppm, has proven useful.
  • the detergents according to the invention comprise at least one washing-active substance and at least one surface-active, non-enzymatic protein.
  • the at least one surface-active, non-enzymatic protein is preferably a protein which causes the above-mentioned change in the contact angle, more preferably at least one hydrophobin.
  • a protein which causes the above-mentioned change in the contact angle more preferably at least one hydrophobin.
  • mixtures of different proteins can also be used.
  • hydrophobins are used, they can be used as "pure" hydrophobin or else in the form of the abovementioned fusion proteins.
  • fusion proteins of the type yaad-Xa-dewA-his SEQ ID NO: 20
  • yaad-Xa-rodA-his SEQ ID NO: 22 yaad-Xa-basf1-his
  • SEQ ID NO: 24 Especially useful has been yaad-Xa-dewA-his (SEQ ID NO: 20) with complete yaad Fusion partner or else with truncated fusion partner, such as yaad40-Xa-dewA-his (SEQ ID NO: 26).
  • Detergent for textile washing is self-explanatory and restrictive at the same time
  • Detergents for washing textiles are used, for example, in the form of powders, granules, beads, pastes, tablets, gels or liquids, usually in aqueous solution (wash liquor)
  • Detergents comprise at least one, but as a rule a plurality of different, washing-active substances which co-operate to form an optimum washing result. and builders, co-builders, bleach systems, and detergent enzymes.
  • typical additives such as fragrances, corrosion inhibitors, color transfer inhibitors, foam inhibitors or optical brighteners can be used as components of detergents.
  • Surfactants may be anionic, nonionic, cationic or amphorous surfactants.
  • Suitable nonionic surfactants are, in particular:
  • Alkoxylated C 8 -C 22 -alcohols such as fatty alcohol alkoxylates, oxo alcohol alkoxylates and Guerbet alcohol ethoxylates:
  • the alkoxylation can be carried out with ethylene oxide, propylene oxide and / or butylene oxide.
  • Preferred alkylene oxide is ethylene oxide.
  • the alcohols preferably have 10 to 18 carbon atoms.
  • Alkylphenolalkoxylate in particular alkylphenol ethoxylates containing C6-Ci4-alkyl chains and 5 to 30 moles of alkylene oxide / mol.
  • N-alkylglucamides fatty acid amide alkoxylates, fatty acid alkanolamide alkoxylates and block copolymers of ethylene oxide, propylene oxide and / or butylene oxide.
  • Suitable anionic surfactants are, for example:
  • Sulfated alkoxylated Ce-C22-alcohols (alkyl ether sulfates): Compounds of this type are prepared, for example, by first obtaining a C8-C22, preferably a Cio-C16-alcohol, e.g. a fatty alcohol or an oxo alcohol, alkoxylated and then the alkoxylation product sulfated.
  • a C8-C22 preferably a Cio-C16-alcohol, e.g. a fatty alcohol or an oxo alcohol
  • alkoxylation product sulfated For the alkoxylation is preferably used ethylene oxide.
  • Linear C8 -C2o alkyl benzene sulfonates LAS
  • LAS linear C 9 -C 3 alkyl benzene sulfonates and Cg-Cis-alkyltoluene.
  • Alkanesulfonates in particular C8-C24-, preferably Cio-Ci8-alkanesulfonates.
  • Soaps such as the Na and K salts of Ce-C24 carboxylic acids.
  • the anionic surfactants are preferably added to the detergent in the form of salts.
  • Suitable salts are e.g. Alka Ii metal salts such as sodium, potassium and lithium salts, and ammonium salts such as hydroxyethylammonium, di (hydroxyethyl) ammonium and tri (hydroxyethyl) ammonium salts.
  • cationic surfactants may be mentioned:
  • Imidazolinquats in particular 1-Alkylimidazoliniumsalze of the formulas II or IM
  • R 3 Ci-C 2 H 5 alkyl or C 2 -C 5 2-alkenyl;
  • R 4 is C 1 -C 4 -alkyl or hydroxy-C 1 -C 4 -alkyl;
  • R 5 is C 1 -C 4 -alkyl, hydroxy-C 1 -C 4 -alkyl or a radical R 1 - (CO) -X- (CH 2 ) m - (X: -O- or -NH-; m: 2 or 3)
  • R 3 is C 7 -C 22 alkyl
  • Suitable amphoteric surfactants are, for example, alkylbetaines, alkylamidbetaines, aminoproparates, aminoglycinates and amphoteric imidazolium compounds.
  • Builders (builders, also referred to as heterogeneous inorganic builders, HABs) function in the washing process to soften the water. They support the washing action by their Alka Ii tat as well as the dissolution of Ca and Mg ions from dirt or fiber bridges and promote the dispersion of pigment dirt in the wash liquor.
  • Suitable inorganic builders are, in particular:
  • Crystalline and amorphous aluminosilicates with ion-exchanging properties in particular zeolites:
  • zeolites Various types are suitable, in particular the zeolites A, X, B, P, MAP and HS in their Na form or in forms in which Na partially opposes other cations such as Li, K, Ca, Mg or ammonium are exchanged.
  • Crystalline silicates in particular disilicates and phyllosilicates, e.g. ⁇ - and ß-Na2Si2 ⁇ 5.
  • the silicates may be in the form of their alkali metal, alkaline earth metal or
  • Ammonium salts are used, preferred are the Na, Li and Mg silicates.
  • Amorphous silicates such as sodium metasilicate and amorphous disilicate.
  • Carbonates and bicarbonates can be used in the form of their alkali metal, alkaline earth metal or ammonium salts. Preference is given to Na, Li and Mg carbonates and hydrogen carbonates, in particular sodium carbonate and / or sodium bicarbonate.
  • Polyphosphates such as pentasodium triphosphate.
  • cobuilders work in concert with the buildem by, for example, storing Ca- or Mg-ions faster than the builders, and then passing them on to the builders. In addition, they can prevent their growth by adsorption on crystal germs.
  • organic cobuilders are particularly suitable:
  • Low molecular weight carboxylic acids such as citric acid, hydrophobically modified citric acid, e.g. G., Agaricic acid, malic acid, tartaric acid, gluconic acid, glutaric acid, succinic acid, imidodibemic acid, oxydisuccinic acid, propanetricarboxylic acid, butanetetracarboxylic acid, cyclopentanetetracarboxylic acid, alkyl- and alkenylsuccinic acids and aminopolycarboxylic acids, eg nitrilotriacetic acid, .beta.-alaninediacetic acid, ethylenediaminetetraacetic acid, serinediacetic acid, isoserine-diacetic acid, N- (2-hydroxyethyl) iminoacetic acid, ethylenediamine dibasic acid and methyl and ethylglycinediacetic acid.
  • G. Agaricic acid, malic acid
  • Oligomeric and polymeric carboxylic acids such as homopolymers of acrylic acid and aspartic acid, oligomaleic acids, copolymers of maleic acid with acrylic acid, methacrylic acid or C 2 -C 22 -olefins, for example isobutene or long-chain ⁇ -olefins, vinyl-C 1 -C 6 -alkyl ethers, vinyl acetate, vinyl propionate, (Meth) acrylic esters of C 1 -C 6 -alcohols and styrene.
  • Preferred are the homopolymers of acrylic acid and copolymers of acrylic acid with maleic acid.
  • the oligomeric and polymeric carboxylic acids are used in acid form or as the sodium salt.
  • Suitable bleaching agents are, for example, adducts of hydrogen peroxide with inorganic salts, such as sodium perborate monohydrate, sodium perborate tetrahydrate and sodium carbonate perhydrate, and percarboxylic acids, such as phthalimidopercaproic acid.
  • Suitable bleach activators are e.g. N.N.N'.N'-tetraacetylethylenediamine (TAED), sodium p-nonanoyloxybenzenesulfonate and N-methylmorpholinium acetonitrile methylsulfate.
  • TAED N.N.N'.N'-tetraacetylethylenediamine
  • Enzymes preferably used in detergents are proteases, lipases, amylases, cellulases, oxidases and peroxidases.
  • Suitable color transfer inhibitors are, for example, homo-, co- and graft polymers of 1-vinylpyrrolidone, 1-vinylimidazole, 4-vinylpyridine-N-oxide, or homo- and copolymers of 4-vinylpyridine reacted with chloroacetic acid.
  • the type and amount of components used will be determined by one skilled in the art depending on the desired use of the detergent.
  • bleaches are commonly used in heavy duty detergents, but not in colored laundry detergents. Further details on the composition of detergents and components of detergents are described, for example, in “Detergents” in Rompp Chemie-Lexikon, Online Edition, Version 2.6, Georg-Thieme-Verlag, Stuttgart, New York, Feb. 2005 or in "Detergents” in Ullmann's Encyclopedia of Industrial Chemistry, 6 th Edt., 2000, Electronic Release, Wiley-VCH-Verlag, Weinheim, 2000.
  • Preferred surfactants for carrying out the present invention are anionic surfactants and / or nonionic surfactants.
  • the surface-active, non-enzymatic proteins, in particular hydrophobins, used according to the invention can be used particularly advantageously with a combination of linear alkylbenzenesulfonates or fatty alcohol sulfates with alkyl ether sulfates or alkyl alkoxylates.
  • alkoxy radicals are preferably those which essentially comprise ethylene oxide units and / or propylene oxide units, preferably ethylene oxide units. They may, for example, be radicals of from 1 to 25 ethylene oxide units, preferably from 3 to 20 and particularly preferably from 5 to 15 units or groups comprising ethylene oxide and propylene oxide units, the latter in each case based on at least 50 mol%, preferably 60 mol% ethylene oxide units should include the total number of all alkoxy units.
  • surfactants examples include alkoxylated Ce-Cie alcohols, such as Fettalkoho- lalkoxylate, Oxoalkoholalkoxylate, Guerbetalkoholalkoxylate, sulfates of C 8 -C 8 alcohols, sulfated alkoxylated C 8 -C 8 alcohols (alkyl ether sulfates) or linear
  • C 8 -C 8 alkyl benzene sulfonates LAS
  • LAS preferably linear C 9 -C alkyl benzene sulfonates and Cg-Cis-3-alkyltoluene.
  • the amount of surface-active, non-enzymatic proteins in the detergent is measured by the skilled person according to the desired properties of the detergent.
  • the amount is chosen so that when properly dosing the detergent, the above-mentioned concentrations of the surface-active, non-enzymatic protein are obtained.
  • an amount of from 0.002 to 2.5% by weight of the surface-active, non-enzymatic proteins, based on the total amount of all components of the detergent, has proven useful.
  • the amount is 0.01 to 1, 5 wt.%, Particularly preferably 0.025 to 1, 0 wt.%, Very particularly preferably 0.05 to 0.5 wt.% And for example 0.1 to 0.3 wt. %.
  • the detergents according to the invention comprise
  • surfactants preferably anionic and / or nonionic surfactants
  • component (c) lipases and / or amphophilic polymers, for example ethylene oxide-propylene oxide block copolymers can be used.
  • the detergents according to the invention can be prepared by methods known in principle to those skilled in the art. Details of preparation processes for detergents are shown, for example, in the cited references "Römpp Chemie-Lexikon” or “Ullmann's”.
  • the surface-active, non-enzymatic proteins can be used to prepare the detergent as a solution or as a solid. Solid proteins can be obtained starting from solutions of the proteins by methods known to those skilled in the art, such as, for example, spray-drying or freeze-drying.
  • the temperature load on the surface-active, non-enzymatic proteins is not too high.
  • the limit depends of course on the type of protein. In the case of the use of hydrophobins, it has been proven not to exceed a product temperature of 120 0 C.
  • the process temperature for example, the temperature of the gas stream in a spray dryer, of course, can also be higher, provided that the product temperature does not exceed the critical limit.
  • the preparation of pulverulent detergents can be carried out, for example, by preparing in a first step from aqueous slurries of the thermally stable components of the detergent by spray drying a crude product and mixing this crude product in a second step under mild conditions with the thermally sensitive components. It is generally advisable to introduce the surface-active, non-enzymatic proteins used according to the invention in this second step, without the invention being restricted thereto.
  • the process according to the invention for washing textile materials comprises at least the steps:
  • the washing device used may be all types of washing machines.
  • the term is also intended to include vessels that are typically used in hand washing, such as washtub or sink.
  • the washing device is first filled with the textiles and an aqueous wash liquor, whereby the order does not matter.
  • the wash liquor comprises, in a manner known in principle, at least one wash-active substance.
  • the aqueous wash liquor further comprises min. at least one surfactant, nonenzymatic protein.
  • Preferred proteins have already been mentioned.
  • the addition of surfactant non-enzymatic proteins can be done via the detergent, or it can be done separately. It preferably takes place at the beginning of the wash cycle, but it can of course also be carried out at a later time.
  • the washing process is supported in process step (b) in a known manner by the action of mechanical energy on the mixture of textile materials and wash liquor.
  • Mechanical energy can be introduced by washing machines, e.g. by rotating drums, or in the case of hand washing by hands and / or other aids.
  • the temperature in the course of the washing process is selected by the skilled person depending on the circumstances.
  • the temperature may be 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 ° C.
  • the particular advantages of the invention are particularly significant in laundry at medium or low temperatures.
  • the washing process is carried out at a temperature of not more than 60 ° C., in particular not more than 50 ° C.
  • a particularly advantageous temperature range for carrying out the washing process according to the invention is 5 to 45 ° C, very particularly preferably 15 to 35 ° C and for example 20 to 30 0 C.
  • concentration of surface-active, non-enzymatic proteins in the course of the washing process is selected by the person skilled in the art. Preferred concentration ranges have already been mentioned above.
  • the detergents according to the invention are usually very particularly preferred in an amount of 0.05 to 25 g / l, preferably 0.25 to 15 g / l, particularly preferably 0.5 to 10 g / l 1 to 6 g / l and for example 1, 5 to 4 g / l, in each case based on the wash liquor used.
  • the wash liquor is removed in a manner known in principle.
  • the textile materials are then rinsed by one or more rinsing operations and finally dried (process steps (d) and (e)).
  • rinsing softener can be used as an additive.
  • the inventive method is suitable for cleaning all types of textile materials.
  • textile materials may be textile fibers, semi-finished and semi-finished textile products and finished goods made from them.
  • This may be conventional textiles for clothing, but also home textiles such as carpets, curtains, tablecloths and technical purposes serving textile structures.
  • This also includes unshaped structures such as flakes, linear formations such as twine, threads, yarn, linen, cords, ropes, threads and body structures such as felts, fabrics, knitted fabrics, nonwovens and wadding.
  • Textile materials can be made of materials of natural origin, such as cotton, wool or flax or of synthetic materials such as polyacrylonitrile, polyamide, or polyester. Of course, it may also be mixed fabrics, such as cotton / polyester or cotton / polyamide.
  • oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) a polymerase chain reaction was carried out.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used for the expression of proteins consisting of, YAAD :: HIS6 or YAAE :: H
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • the template DNA used was the plasmid HypA in pCR2.1, manufactured by Nadicom.
  • the fragment obtained contained the coding sequence of the hydrophobin HypA gene without start and stop codon.
  • the PCR fragment was purified by gel electrophoresis and cut with the restriction endonucleases NcoI and BamHI. This fragment was used as an insert and ligated into the pQE60 vector cut previously with NcoI and BglII.
  • KaM449 GTTACCCCATGGCGATCTCTCGCGTCCTTGTCGCT
  • KaM450 GCCTGAGGATCCGAGGTTGACATTGACAGGAGAGC
  • PCR was performed.
  • the template DNA used was the plasmid HypA in pCR2.1, manufactured by Nadicom.
  • the fragment obtained contained the coding sequence of the hydrophobin HypA gene without start and stop codon.
  • the PCR fragment was purified by gel electrophoresis and cut with the restriction endonucleases BglII and BamHI. This fragment was used as an insert and ligated into the previously cut with Bgl II vector pQE60 + YAAD.
  • KaM451 CGTAGTAGATCTATGATCTCTCGCGTCCTTGTCGCTGC
  • KaM452 CGACTAGGATCCGAGGTTGACATTGACAGGAGAGC
  • PCR was performed.
  • the template DNA used was the plasmid HypB in puC19, manufactured by Nadicom.
  • the fragment obtained contained the coding sequence of the hydrophobin HypB gene without start and stop codon.
  • the PCR fragment was purified by gel electrophoresis and cut with the restriction endonucleases Ncol and BamHI. This fragment was used as an insert and ligated into the pQE60 vector cut previously with NcoI and BglII.
  • KaM453 GCTTATCCATGGCGGTCAGCACGTTCATCACTGTCG
  • KaM454 GCTATAGGATCCCACATTGGCATTAATGGGAGTGC
  • KaM455 / KaM456 a PCR was performed.
  • the template DNA used was the plasmid HypB in puC19, manufactured by Nadicom.
  • the fragment obtained contained the coding sequence of the hydrophobin HypB gene without start and stop codon.
  • the PCR fragment was purified by gel electrophoresis and cut with the restriction endonucleases BglII and BamHI. This fragment was used as an insert and ligated into the previously cut with Bgl II vector pQE60 + YAAD.
  • KaM456 CTATGAGGATCCCACATTGGCATTAATGGGAGTGC
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA was an artificially synthesized DNA sequence - hydrophobin
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • the template DNA used was Schyzophyllum commune cDNA (see Appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, an hour a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • Figure 1 shows the purification of the prepared hydrophobin
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of the hydrophobin.
  • Example 10 The fusion hydrophobin of Example 10 was used.
  • Hydrophobin concentration 100 ⁇ g / mL in aqueous solution; Additive: 50 mM Na-acetate pH 4 + 0.1% polyoxyethylene (20) -sorbitanmonolaureat (Tween ® 20).
  • the samples are air-dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water at room temperature is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • test fabrics mentioned was cut into pieces of 30 ⁇ 30 mm and sewn onto knitted undyed bleached cotton.
  • the fabric was rinsed in 250 ml of tap water for 5 minutes and then dried.
  • the evaluation of the washing effect was carried out by remission measurements at 420 nm before and after the wash.
  • IE hereby means in each case the remission of the test tissue after, U the remission before the test wash. 0 denotes the comparative experiment without inventive addition of proteins. Leiss marks the remission of pure tissue without staining.
  • Amount of wash liquor 250 ml per can be any amount of wash liquor 250 ml per.
  • Amount of wash liquor 250 ml per can be any amount of wash liquor 250 ml per.
  • Protein used hydrophobin fusion protein yaad40-Xa-dew A-his (SEQ ID NO: 26)
  • anionic surfactant 400 ppm Na-Ci2 / i4 "fatty alcohol nonionic co-sulfate respectively 30 ppm of a C13 / 15-Oxoalkoholethoxylates
  • Amount of wash liquor 250 ml per can be any amount of wash liquor 250 ml per.
  • Amount of wash liquor 250 ml per can be any amount of wash liquor 250 ml per.
  • EO ethylene oxide
  • PO propylene oxide
  • the fusion hydrophobin with a truncated yaad fusion partner (B) (40 amino acids) achieved better results than the fusion hydrophobin (A) with a complete yaad fusion partner (294 amino acids).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Detergent Compositions (AREA)
  • Treatments For Attaching Organic Compounds To Fibrous Goods (AREA)
  • Chemical Or Physical Treatment Of Fibers (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Verwendung grenzflächenaktiver, nicht-enzymatischer Proteine für die Textilwäsche. Waschmittel für die Textilwäsche, die grenzflächenaktive, nicht-enzymatische Proteine enthalten sowie Verfahren zum Waschen unter Verwendung derartiger Proteine.

Description

Verwendung von grenzflächenaktiven, nicht-enzymatischen Proteinen für die Textilwä- sche
Beschreibung
Die vorliegende Erfindung betrifft die Verwendung grenzflächenaktiver, nicht-enzyma- tischer Proteine für die Textilwäsche. Sie betrifft weiterhin Waschmittel für die Textilwä- sche, die grenzflächenaktive, nicht-enzymatische Proteine enthalten sowie ein Verfahren zum Waschen unter Verwendung derartiger Proteine.
Die Entfernung von Schmutz, insbesondere von hydrophoben Verschmutzungen in der Textilwäsche gelingt heutzutage nur bei höheren Temperaturen in befriedigendem Ausmaße. Bei moderaten Temperaturen und insbesondere bei Raumtemperatur besteht noch erheblicher Bedarf an einer Verbesserung der Waschleistung. Nach dem Stand der Technik wird die Entfernung hydrophober Anschmutzungen vor allem mit Tensiden und lipolytischen Enzymen erreicht.
Die Verwendung von enzymatisch wirkenden Proteinen als Zusatz zu Waschmitteln ist prinzipiell bekannt. In Waschmitteln werden insbesondere Proteasen eingesetzt, es ist aber auch bekannt Amylasen, Ce I Iu lasen oder Lipasen einzusetzen. Nähere Einzelheiten sind beipielsweise dargestellt in „Waschmittel-Enzyme" in Römpp Chemie-Lexikon, OnlineAusgabe, Version 2.6, Georg-Thieme-Verlag, Stuttgart, New- York, Febr. 2005.
Es ist auch bekannt, Proteine zu verwenden, um Wasch hilfsmittel wie beispielsweise Fixiermittel, UV-Schutzmittel, parfümierende Substanzen oder schmutzablösende Hilfsmittel auf der Faser zu fixieren. WO 98/00500 offenbart zu diesem Zwecke die Verwendung von Cellulasen, Cellulase-Derivaten oder CeIIu läse ähnlichen Proteinen, und WO 01/46357 offenbart zu diesem Zwecke ein Fusionsprotein mit einer Bindungsstelle für Cellulose sowie einer Bindungsstelle für andere Verbindungen.
Grenzflächenaktive Proteine sind prinzipiell bekannt. Eine Klasse von Proteinen mit besonders starker Grenzflächenaktivität sind die so genannten „Hydrophobine". Hydrophobine weisen eine ausgeprägte Affinität zu Grenzflächen auf und eignen sich daher zur Beschichtung von Oberflächen. So lässt sich beispielsweise Teflon hydrophi- lieren, indem man die Teflon-Oberfläche mit Hydrophobinen beschichtet.
Hydrophobine sind kleine Proteine von etwa 100 bis 150 Aminosäuren, die charakteristisch für filamentöse Pilze, beispielsweise Schizophyllum commune, sind. Sie weisen in aller Regel 8 Cystein-Einheiten auf. Hydrophobine können einerseits aus natürlichen Quellen isoliert werden. Sie können aber auch mittels gentechnischer Verfahren gewonnen werden. Unsere ältere Anmeldung PCT/EP2006/050719 offenbart ein derartiges Herstellverfahren für Hydrophobine.
Im Stand der Technik ist die Verwendung von Hydrophobinen für verschiedene Anwendungen vorgeschlagen worden.
WO 96/41882 schlägt die Verwendung von Hydrophobinen als Emulgatoren, Verdicker, oberflächenaktive Substanzen, zum Hydrophilieren hydrophober Oberflächen, zur Ver- besserung der Wasserbeständigkeit hydrophiler Substrate, zur Herstellung von Öl-inWasser-Emulsionen oder von Wasser-in-ÖI-Emulsionen vor. Weiterhin werden pharmazeutische Anwendungen wie die Herstellung von Salben oder Cremes sowie kosmetische Anwendungen wie Hautschutz oder die Herstellung von Haarshampoos oder Haarspülungen vorgeschlagen.
EP 1 252 516 offenbart die Beschichtung von Fenstern, Kontaktlinsen, Biosensoren, medizinischen Vorrichtungen, Behältern zur Durchführung von Versuchen oder zur Lagerung, Schiffrümpfen, festen Teilchen oder Rahmen oder Karosserie von Personenkraftwagen mit einer Hydrophobine enthaltenden Lösung bei einer Temperatur von 30 bis 800C.
WO 03/53383 offenbart die Verwendung von Hydrophobin zum Behandeln von Keratin- Materialien in kosmetischen Anwendungen.
WO 03/10331 offenbart einen mit Hydrophobin beschichteten Sensor, beispielsweise eine Messelektrode, an den nicht kova Ie nt weitere Substanzen, z.B. elektroaktive Substanzen, Antikörper oder Enzyme gebunden sind.
Die Verwendung von grenzflächenaktiven, nicht-enzymatischen Proteinen, insbeson- dere von Hydrophobinen, als schmutzablösender Zusatz zu Waschmitteln ist bislang nicht beschrieben worden.
Aufgabe der Erfindung war es verbesserte Waschmittel sowie verbesserte Verfahren zur Wäsche von Textilien zu Verfügung zu stellen. Sie sollten sich insbesondere durch eine verbesserte Waschleistung beim Waschen bei tiefen Temperaturen auszeichnen.
Dementsprechend wurde die Verwendung grenzflächenaktiver, nicht-enzymatischer Proteine für die Textilwäsche gefunden.
In einem zweiten Aspekt der Erfindung wurden Waschmittel gefunden, welche grenzflächenaktive, nicht-enzymatische Proteine umfassen. In einem dritten Aspekt der Erfindung wurde ein Verfahren zum Waschen gefunden, bei dem eine Waschflotte eingesetzt wird, die grenzflächenaktive, nicht-enzymatische Proteine umfasst. In einer besonderen Ausführungsform des Verfahrens wird die Wäsche bei einer Temperatur von nicht mehr als 600C vorgenommen.
In einer besonders bevorzugten Ausführungsform der Erfindung handelt es sich bei den grenzflächenaktiven, nicht-enzymatischen Proteinen jeweils um Hydrophobine.
Überraschenderweise wurde gefunden, dass sich durch den Zusatz von grenzflächen- aktiven, nicht-enzymatischen Proteinen zur Waschflotte eine signifikante Steigerung der Waschwirkung ergibt. Besonders überraschend war, dass dieser Effekt bereits bei niedrigen Waschtemperaturen und weiterhin schon bei der Verwendung von äußerst geringen Mengen an Proteinen gefunden wird. So wurde bereits bei einer Konzentration von nur ca. 2,5 ppm Protein in der Waschflotte in Kombination mit einem handelsüblichen Waschmittel bei einer Waschtemperatur von nur 25°C eine Steigerung der Waschwirkung von bis zu 8 % gefunden.
Neben der Steigerung der schmutzablösenden Wirkung wird auch eine vergrauungsin- hibiernde Wirkung bei farbigen ölartigen Anschmutzungen beobachtet. Hydrophobe Anschmutzungen, die bei der Wäsche von den Textilien abgelöst werden können sich in fein verteilter Form wieder auf dem Waschgut ablagern und dadurch zu einer Vergrauung oder Verfärbung führen. Dieser Effekt ist naturgemäß bei weißen oder schwach gefärbten Geweben besonders ausgeprägt. Dieses Problem tritt insbesondere auf, wenn die Tenside und das Buildersystem niedrig dosiert werden. Der erfin- dungsgemäße Zusatz von grenzflächenaktiven, nicht-enzymatischen Proteinen verringert diese Wiederablagerung und verbessert dadurch den Weißgrad der gewaschenen Gewebe im Vergleich zu Geweben, welche ohne Zusatz derartiger Proteine gewaschen wurden.
Zu der Erfindung ist im Einzelnen das Folgende auszuführen:
Zur Ausführung der Erfindung werden grenzflächenaktive, nicht-enzymatische Proteine eingesetzt. Der Begriff „nicht-enzymatisch" soll bedeuten, dass die Proteine bevorzugt keine oder zumindest keine wesentliche enzymatische Wirkung aufweisen.
Der Begriff „grenzflächenaktiv" soll bedeuten, dass das eingesetzte Protein die Fähigkeit besitzt, die Eigenschaften von Grenzflächen zu beeinflussen. Bei den zu betrachtenden Grenzflächen kann es sich um fest-fest-, fest-flüssig-, fest-gasförmig-, flüssigflüssig- oder flüssig-gasförmig-Grenzflächen handeln. Insbesondere kann es sich um fest-flüssig- oder flüssig-flüssig-Grenzflächen handeln. Bei der Eigenschaft kann es sich für den Fall einer fest-flüssig-Grenzfläche beispielsweise um die Hydrophilie oder Hydrophobie der festen Oberfläche handeln, welche sich unter dem Einfluss des verwendeten Proteins ändert. Die Veränderung der Hydrophilie oder Hydrophobie kann in bekannter Art und Weise durch die Messung des Kon- taktwinkels eines Wassertropfens auf der beschichteten und un beschichteten Oberfläche gemessen werden. Eine weitere Grenzflächeneigenschaft ist die Veränderung der Oberfächenspannung einer Flüssigkeit, welche mit bekannten Methoden gemesssen werden kann.
Bevorzugt zur Ausführung der Erfindung werden Proteine eingesetzt, die bereits bei geringen Konzentrationen grenzflächenaktiv wirken. Geeignet sind insbesondere solche Proteine, welche in wässriger Lösung bereits bei Konzentrationen von 0,05 bis 50 ppm signifikante grenzflächenaktive Eigenschaften aufweisen.
In einer bevorzugten Ausführungsform der Erfindung werden solche Proteine verwendet, die durch die Eigenschaft ausgezeichnet sind, dass sie nach dem Aufbringen auf eine Glasoberfläche bei Raumtemperatur eine Vergrößerung des Kontaktwinkels eines Wassertropfens (5 μl) von mindestens 20°, verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der un beschichteten Glasoberfläche hervorrufen. Bevorzugt werden Proteine eingesetzt, bei denen die Kontaktwinkelvergrößerung mindestens 25°, besonders bevorzugt mindestens 30° beträgt. Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die genauen experimentellen Bedingungen für eine beispielhaft geeignete Methode zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt.
In einer besonders bevorzugten Ausführungsform der Erfindung handelt es sich bei den eingesetzten Proteinen um Hydrophobine.
Unter dem Begriff „Hydrophobine" im Sinne der vorliegenden Erfindung sollen im FoI- genden Polypeptide der allgemeinen Strukturformel (I)
Xn-C^Xi-so-C^Xo-s-CS-Xi-ioo-C^Xi-ioo-Cδ-Xi-so-Ce-Xo-s-C^Xi-so-Cβ-Xm (I)
verstanden werden, wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann. Dabei können die Reste X jeweils gleich oder verschieden sein. Hierbei stellen die bei X stehenden Indizes jeweils die Anzahl der Aminosäuren in der jeweiligen Teilsequenz X dar, C steht für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin, wobei mindestens vier der mit C benannten Reste für Cystein stehen, und die Indizes n und m stehen unabhängig voneinander für natürliche Zahlen zwischen 0 und 500, bevorzugt zwischen 15 und 300. Die Polypetide gemäß der Formel (I) sind weiterhin durch die Eigenschaft charakterisiert, dass sie bei Raumtemperatur nach Beschichten einer Glasoberfläche eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, bevorzugt mindestens 25° und besonders bevorzugt 30° bewirken, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche.
Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemäßen Proteinen entweder reduziert vorliegen oder miteinander Di- sulfidbrücken ausbilden. Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevorzugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der einzelnen C-Positionen in den allgemeinen Formeln entsprechend verändern.
Bevorzugt werden Hydrophobine der allgemeinen Formel (II)
Xn-C1-X3-25-C2-Xθ-2-C3-X5-5O-C4-X2-35-C5-X2-15-C6-Xθ-2-C7-X3-35-C8-Xm (II)
zur Ausführung der vorliegenden Erfindung eingesetzt, wobei X, C und die bei X und C stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 350, bevorzugt 15 bis 300 stehen, sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, und es sich weiterhin bei mindestens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Reste C um Cystein.
Besonders bevorzugt werden Hydrophobine der allgemeinen Formel (IM)
Xn-C1-X5-9-C2-C3-Xi 1-39-C4-X2-23-C5-X5-9-C6-C7-X6-18-C8-Xm (111)
eingesetzt, wobei X, C und die bei X stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 200 stehen, sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, und es sich bei mindes- tens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Resten C um Cystein.
Bei den Resten Xn und Xm kann es sich um Peptidsequenzen handeln, die natürlicher- weise auch mit einem Hydrophobin verknüpft sind. Es kann sich aber auch bei einem oder bei beiden Resten um Peptidsequenzen handeln, die natürlicherweise nicht mit einem Hydrophobin verknüpft sind. Darunter sind auch solche Reste Xn und/oder Xmzu verstehen, bei denen eine natürlicherweise in einem Hydrophobin vorkommende Pep- tidsequenz durch eine nicht natürlicherweise in einem Hydrophobin vorkommende Peptidsequenz verlängert ist.
Falls es sich bei Xn und/oder Xm um natürlicherweise nicht mit Hydrophobinen verknüpfte Peptidsequenzen handelt, sind derartige Sequenzen in der Regel mindestens 20, bevorzugt mindestens 35 und besonders bevorzugt mindestens 50 Aminosäuren und beispielsweise mindestens 100 Aminosäuren lang. Es kann sich beispielsweise um Sequenzen aus 20 bis 500, bevorzugt 30 bis 400 und besonders bevorzugt 35 bis 100 Aminosäuren handeln. Ein derartiger, natürlicherweise nicht mit einem Hydrophobin verknüpfter Rest soll im Folgenden auch als Fusionspartner bezeichnet werden. Damit soll ausgedrückt werden, dass die Proteine aus mindestens einem Hydrophobinteil und einem Fusionspartnerteil bestehen können, die in der Natur nicht zusammen in dieser Form vorkommen.
Der Fusionspartnerteil kann aus einer Vielzahl von Proteinen ausgewählt werden. Es kann nur ein einziger Fusionspartner mit dem Hydrophobinteil verknüpft sein, oder es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xm) des Hydropho- binteils. Es können aber auch beispielsweise zwei Fusionspartner mit einer Position (Xn oder Xm) des erfindungsgemäßen Proteins verknüpft werden.
Besonders geeignete Fusionspartner sind Proteine, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartner sind die Sequenzen yaad (SEQ ID NO: 15 und 16), yaae (SEQ ID NO: 17 und 18), und Thioredoxin. Gut geeignet sind auch Fragmente oder Derivate dieser genannten Sequenzen, die nur einen Teil, beispielsweise 70 bis 99 %, bevorzugt 5 bis 50 %, und besonders bevorzugt 10 bis 40 % der genannten Sequenzen umfassen, oder bei denen einzelne Aminosäuren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind, wobei sich die Prozentangaben jeweils auf die Anzahl der Aminosäuren bezieht.
In einer weiterhin bevorzugten Ausführungsform weist das Fusion-Hydrophobin neben dem genannten Fusionspartner als eine der Gruppen Xn oder Xmoder als terminaler Bestandteil einer solchen Gruppe noch eine sogenannte Affinitätsdomäne (affin ity tag / affin ity tail) auf. Hierbei handelt es sich in prinzipiell bekannter Art und Weise um Ankergruppen, welche mit bestimmten komplementären Gruppen wechselwirken können und der leichteren Aufarbeitung und Reinigung der Proteine dienen können. Beispiele derartiger Affinitätsdomänen umfassen (His)k- , (Arg)k-, (Asp)k-, (Phe)k- oder (Cys)k- Gruppen, wobei k im allgemeinen für eine natürliche Zahl von 1 bis 10 steht. Bevorzugt kann es sich um eine (His)k-Gruppe handeln, wobei k für 4 bis 6 steht. Hierbei kann die Gruppe Xn und/oder Xm ausschließlich aus einer derartigen Affinitätsdomäne bestehen oder aber ein natürlicherweise oder nicht natürlicherweise mit einem Hydrophobin verknüpfter Rest Xn bzw. Xm wird um eine terminal angeordnete Affinitätsdomäne verlän- gert.
Die erfindungsgemäß als Hydrophobine oder Derivate davon verwendeten Proteine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielswei- se mit Glutardialdehyd.
Eine Eigenschaft der erfindungsgemäß verwendeten Hydrophobine bzw. deren Derivate ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Proteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich ex- perimentell beispielsweise dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung der Oberfläche mit dem Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird.
Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die Messungen beziehen sich auf Raumtemperatur sowie Wassertropfen von 5 μl und die Verwendung von Glasplättchen als Substrat. Die genauen experimentellen Bedingungen für eine beispielhaft geeignete Methode zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt. Unter den dort genannten Bedingungen besitzen die erfindungsgemäß verwendeten Fusionsproteine die Eigenschaft, den Kontaktwinkel um mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30° zu vergrößern, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche.
Besonders bevorzugte Hydrophobine zur Ausführung der vorliegenden Erfindung sind die Hydrophobine des Typs dewA, rodA, hypA, hypB, sc3, basfi , basf2, die im nachfolgenden Sequenzprotokoll strukturell charakterisiert sind. Es kann sich auch nur um Teile oder Derivate davon handeln. Es können auch mehrere Hydrophobinteile, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft und mit einer entsprechenden geeigneten Polypeptidsequenz, die natürlicherweise nicht mit einem Hydrophobin verbunden ist, verknüpft werden. Erfindungsgemäß insbesondere geeignet sind weiterhin die Fusionsproteine yaad-Xa- dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf 1 - his (SEQ ID NO: 24) mit den in Klammern angegebenen Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäß SEQ ID NO: 19, 21 , 23. besonders bevorzugt kann yaad-Xa-dewA-his (SEQ ID NO: 20) eingesetzt werden. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 20, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deleti- on von mindestens einer, bis hin zu 10, bevorzugt 5, besonders bevorzugt 5% aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50% besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die bereits beschriebene Änderung des Kontaktwinkels um mindestens 20° verstanden.
Besonders zur Ausführung der Erfindung geeignete Derivate sind von yaad-Xa-dewA- his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa-basf 1 -his
(SEQ ID NO: 24) durch Verkürzung des yaad-Fusionspartners abgeleitete Reste. Anstelle des vollständigen yaad-Fusionspartners (SEQ ID NO: 16) mit 294 Amino-säuren kann vorteilhaft ein verkürzter yaad-Rest eingesetzt werden. Der verkürzte Rest sollte aber zumindest 20, bevorzugt mindestens 35 Aminosäuren umfassen. Beispielsweise kann ein verkürzter Rest mit 20 bis 293, bevorzugt 25 bis 250, besonders bevorzugt 35 bis 150 und beispielsweise 35 bis 100 Aminosäuren eingesetzt werden. Ein Beispiel für ein derartiges Protein ist yaad40-Xa-dewA-his (SEQ ID NO: 26), welches einen auf 40 Aminosäuren verkürzten yaad-Rest aufweist.
Eine Spaltstelle zwischen dem Hydrophobin und dem Fusionspartner bzw. den Fusionspartnern kann dazu genutzt, das reine Hydrophobin in underivatisierter Form freizusetzen (beispielsweise durch BrCN-Spaltung an Methionin, Faktor Xa-, Enterokinase-, Thrombin-, TEV-Spaltung etc.).
Es ist weiterhin möglich, Fusionsproteine aus einem Fusionspartner, beispielsweise yaad oder yaae, und mehreren Hydrophobinen, auch unterschiedlicher Sequenz, beispielsweise DewA-RodA oder Sc3-DewA, Sc3-RodA, hintereinander zu generieren. Ebenso können Hydrophobinfragmente (beispielsweise N- oder C-terminale Verkürzungen) oder Mutein, die bis zu 70% Homologie aufweisen, eingesetzt werden. Die Auswahl der optimalen Konstrukte erfolgt jeweils in Bezug auf die jeweilige Verwendung, d.h. die zu trennenden flüssigen Phasen.
Die erfindungsgemäß verwendeten zur Textilwäsche verwendeten Hydrophobine lassen sich chemisch durch bekannte Verfahren der Peptidsynthese, wie beispielsweise durch Festphasensynthese nach Merrifield herstellen. Natürlich vorkommende Hydrophobine lassen sich aus natürlichen Quellen mittels geeigneter Methoden isolieren. Beispielhaft sei auf Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) oder WO 96/41882 verwiesen.
Ein gentechnisches Herstellverfahren für Hydrophobine ohne Fusionspartner aus TaIa- romyces thermophilus ist von US 2006/0040349 beschrieben.
Die Herstellung von Fusionsproteinen kann bevorzugt durch gentechnische Verfahren erfolgen, bei denen eine für den Fusionspartner und eine für den Hydrophobinteil co- dierende Nukleinsäuresequenz, insbesondere DNA-Sequenz, so kombiniert werden, dass in einem Wirtsorganismus durch Genexpression der kombinierten Nukleinsäuresequenz das gewünschte Protein erzeugt wird. Ein derartiges Herstellverfahren ist beispielsweise in PCT/EP2006/050719 offenbart.
Geeignete Wirtsorganismen (Produktionsorganismen) für das genannte Herstellverfahren können dabei Prokaryonten (einschließlich der Archaea) oder Eukaryonten sein, besonders Bakterien einschließlich Halobacterien und Methanococcen, Pilze, Insektenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Asper- gillus niger, Pichia pastoris, Pseudomonas spec, Lactobacillen, Hansenula poly- morpha, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a..
Gegenstand der Erfindung ist außerdem die Verwendung von Expressionskonstrukten, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen, eine für ein erfindungsgemäß verwendetes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte.
Vorzugsweise umfassen eingesetzte Konstrukte 5'-stronnaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.
Unter einer "operativen Verknüpfung" wird im Rahmen der vorliegenden Erfindung die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebe- nenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann, verstanden.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie En- hancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene Expression Technology : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesen Regulationssequenzen kann die natürliche Regulation dieser Se- quenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.
Ein bevorzugtes Nukleinsäurekonstrukt enthält vorteilhaft auch eine oder mehrere so- genannte "Enhancer"-Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 3'-Ende der DNA- Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren.
Die Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Auxotro- phien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein.
Vorteilhafte Regulationssequenzen für die Herstellung sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, Iaclq-T7-, T5-, T3-, gal-, trc-, ara- , rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhaft in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulationssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1 , MFalpha, AC, P-60, CYC1 , GAPDH, TEF, rp28, ADH enthalten.
Es können auch künstliche Promotoren für die Regulation verwendet werden.
Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhafterweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind außer Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, TransposonsJS- EIe- mente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium- System zu verstehen.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden. Geeignete Plasmide sind beispielsweise in E. coli pLG338, pACYC184, pBR322, pUC18,pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290,plN-lll"3-B1 , tgt11 oder pBdCI, in Streptomyces plJ101 , plJ364, plJ702 oder plJ361 , in Bacillus pUB110, pC194 oder pBD214, in Cory- nebacterium pSA77 oder pAJ667, in Pilzen pALS1 , plL2 oder pBB116, in Hefen 2alpha, pAG-1 , YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23,pGHIac+, pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann bekannt und kön- nen beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.
Vorteilhaft enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3'-und/oder 5'-terminale regulatorische Sequenzen zur Steige- rung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Genexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.
In einer weiteren Ausgestaltungsform des Vektors kann der das Nukleinsäurekonstrukt oder die Nukleinsäure enthaltende Vektor auch vorteilhaft in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Rekombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nuk- leinsäurekonstrukt oder der Nukleinsäure bestehen.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage" zu verändern. Der "codon usage" lässt sich anhand von Computeraus- Wertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminatoroder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F.Fritsch und J.
Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) und in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus, vorteilhaft in einen wirtsspezifischen Vektor inser- tiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden.
Mit Hilfe der Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Hydrophobine oder Derivate davon eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfek- tion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielswei- se in Current Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscience, New York 1997, oder Sambrook et al. Molecular Cloning : A Laboratory Manual. 2. Aufl., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989 beschrieben.
Es sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Vektor hergestellt, der zumindest einen Abschnitt eines zu verwendenden Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure- Deletion, -Addition oder -Substitution eingebracht worden ist, um die Sequenz zu verändern, z. B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Se- quenz kann z. B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe- oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombination mutiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z. B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endogenen Proteins verändert wird). Der veränderte Abschnitt des erfindungsgemäß verwendeten Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z. B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.
Als rekombinante Wirtsorganismen für derartige Nukleinsäuren oder derartige Nukleinsäure konstrukte kommen prinzipiell alle prokaryontischen oder eukaryontischen Orga- nismen in Frage. Vorteilhafterweise werden als Wirtsorgan ismen Mikroorganismen wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden gram-positive oder gramnegative Bakterien, bevorzugt Bakterien der Familien Enterobacteriaceae, Pseudomo- nadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevor- zugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.
Die im soeben beschriebenen Herstellverfahren für Fusionsproteine verwendeten Organismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise ange- zogen bzw. gezüchtet. Mikroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoffquelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan- und Magnesiumsalze sowie gegebenenfalls Vitamine enthält, bei Temperaturen zwischen 0 und 100 0C, bevorzugt zwi- sehen 10 bis 60 0C unter Sauerstoffbegasung angezogen. Dabei kann der pH-Wert der Nährflüssigkeit auf einem festen Wert gehalten werden, das heißt während der Anzucht reguliert werden oder nicht. Die Anzucht kann "batch"-weise, "semi-batch"-weise oder kontinuierlich erfolgen. Nährstoffe können zu Beginn der Fermentation vorgelegt oder semikontinuierlich oder kontinuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebenen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reaktion verwendet werden.
Die erfindungsgemäß verwendeten Hydrophobine oder funktionelle, biologisch aktive Fragmente davon können mittels eines Verfahrens zur rekombinanten Herstellung her- gestellt werden, wobei man einen Polypeptide-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Proteine induziert und diese aus der Kultur isoliert. Die Proteine können so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Verfahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB- oder LB-Medium und bei einer Temperatur von 20 bis 400C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) beschrieben.
Die Fusionspartner erleichtern die Herstellung der Hydrophobine erheblich. Fusions- Hydrophobine werden mit deutlich besseren Ausbeuten produziert als Hydrophobine ohne Fusionspartner.
Die Zellen werden dann, falls die Proteine nicht in das Kulturmedium sezemiert wer- den, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z. B. in einer French-Druckzelle, durch Osmolyse, durch Ein- Wirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.
Eine Aufreinigung der Proteine kann mit bekannten, chromatographischen Verfah- ren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q- Sepharose- Chromatographie, lonenaustausch-Chromatographie und hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden bei- spielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Water de Gruy- ter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin beschrieben.
Besonders vorteilhaft kann es sein, die Fusions-Hydrophobine zur Erleichterung der Isolierung und Reinigung mit speziellen Ankergruppen zu versehen, die an entsprechende komplementäre Gruppen an festen Trägern, insbesondere geeigneten Polymeren anbinden können. Derartige feste Träger können beispielsweise als Füllung für Chromatographiesäulen verwendet werden, und auf diese Art und Weise kann die Effizienz der Trennung in der Regel deutlich gesteigert werden. Solche Trennverfahren sind auch als Affinitätschromatographie bekannt. Zum Einbau der Ankergruppen kann man bei der Herstellung der Proteine Vektorsysteme oder Oligonukleotide verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit veränderte Proteine oder Fusionsproteine kodieren. Zur leichteren Reinigung modifierte Proteine umfassen als Anker fungierende sogenannte "Tags", wie beispielsweise die als Hexa- Histidin-Anker bekannte Modifikation. Mit Histidin-Ankern modifizierte Fusions-Hydrophobine lassen sich beispielsweise unter Verwendung von Nickel-Sepharose als Säulenfüllung chromatographisch reinigen. Das Fusions-Hydrophobin kann anschließend mittels geeigneten Mitteln zum Eluieren, wie beispielsweise einer Imidazol-Lösung, wieder von der Säule eluiert werden.
In einem vereinfachten Reinigungsverfahren kann auf die chromatographische Reinigung verzichtet werden. Hierzu werden die Zellen zunächst mittels einer geeigneten Methode aus der Fermetationsbrühe abgetrennt, beispielsweise durch Mikrofiltration oder durch Zentrifugieren. Anschließend können die Zellen mittels geeigneter Metho- den, beispielsweise mittels der bereits oben genannten Methoden, aufgeschlossen, und die Zelltrümmer von den Einschlusskörpern (inclusion bodies) getrennt werden. Letzteres kann vorteilhaft durch Zentrifugieren erfolgen. Schließlich können die Einschlusskörper in prinzipiell bekannter Art und Weise aufgeschlossen werden, um die Fusions - Hydrophobine freizusetzen. Dies kann beispielsweise durch Säuren, Basen und/oder Detergentien erfolgen. Die Einschlusskörper mit den erfindungsgemäß verwendeten Fusion-Hydrophobinen können in der Regel schon unter Verwendung von 0,1 m NaOH innerhalb von ca. 1 h vollständig gelöst werden. Die Reinheit der nach diesem vereinfachten Verfahren erhaltenen Fusions-Hydrophobine liegt in der Regel bei 60 bis 80 Gew. % bzgl. der Menge aller Proteine.
Die nach dem beschriebenen, vereinfachten Reinigungsverfahren erhaltenen Lösun- gen können ohne weitere Reinigung zur Ausführung dieser Erfindung eingesetzt werden. Die Fusions-Hydrophobine können aus den Lösungen aber auch als Feststoff isoliert werden. Dies kann beispielsweise in prinzipiell bekannter Art und Weise durch Gefrier- oder Sprühtrocknen erfolgen.
In einer bevorzugten Ausführungsform der Erfindung kann die Isolierung mittels Sprühtrocknen erfolgen. Das Sprühtrocknen kann mit der chromatographisch gereinigten Lösung vorgenommen werden, bevorzugt können aber auch die nach dem vereinfachten Reinigungsverfahren durch Aufbereitung der Einschlusskörper (inclusion bodies) erhaltenen Lösungen eingesetzt werden.
Zur Durchführung des Sprühtrocknens können die Lösungen ggf. neutralisiert werden. Ein pH-Bereich von 7 bis 9 hat sich als besonders vorteilhaft herausgestellt.
Weiterhin empfiehlt es sich im Regelfalle, die Ausgangslösungen etwas aufzukonzent- rieren. Bewährt hat sich in der Ausgangslösung eine Feststoffkonzentration von bis zu 30 Gew. %. Ein Feststoffanteil von > 5% führt im Allgemeinen zu einem feinpulverigem Produkt. Anschließend kann die Lösung in prinzipiell bekannter Art und Weise sprühgetrocknet werden. Geeignete Apparaturen zum Sprühtrocknen sind kommerziell erhältlich. Die optimalen Sprühtrocknungsbedingungen variieren mit Gerätetyp und angestrebtem Durchsatz. Eingangstemperaturen von 130 bis 1800C und
Ausgangstemperaturen von 50 bis 800C haben sich bei Hydrophobinlösungen als günstig herausgestellt. Optional können zum Sprühtrocknen Hilfsstoffe wie beispielsweise Zucker, Mannitol, Dextran oder Maltodextrin eingesetzt werden. Bewährt hat sich eine Menge von 0 bis 30 Gew. %, bevorzugt 5 bis 20 Gew. % derartiger Hilfsstoffe bezüglich des Hydrophobins.
Die wie beschrieben hergestellten Hydrophobine können sowohl direkt als Fusionsproteine als auch nach Abspaltung und Abtrennung des Fusionspartners als „reine" Hydrophobine verwendet werden.
Wenn eine Abtrennung des Fusionspartners vorgesehen ist, empfiehlt es sich eine potentielle Spaltstelle (spezifische Erkennungsstelle für Proteasen) in das Fusionsprotein zwischen Hydrophobinteil und Fusionspartnerteil einzubauen. Als Spaltstelle geeignet sind insbesondere solche Peptidsequenzen, die ansonsten weder im Hydropho- binteil noch im Fusionspartnerteil vorkommen, was sich mit bioinformatischen Tools leicht ermitteln lässt. Besonders geeignet sind beispielsweise BrCN-Spaltung an Methionin, oder durch Protease vermittelte Spaltlung mit Faktor Xa-, Enterokinase-, Thrombin oder TEV-Spaltung (Tobacca etch virus Protease).
Für die erfindungsgemäße Verwendung zur Textilwäsche können die grenzflächenakti- ven, nicht-enzymatischen Proteine einerseits als eine Komponente eines Waschmittels verwendet und in dieser Form der Waschflotte zugegeben werden. Es ist aber auch möglich, das grenzflächenaktive, nicht-enzymatische Protein der Waschflotte separat zuzusetzen, und ein Waschmittel einzusetzen, welches frei von grenzflächenaktiven, nicht-enzymatischen Proteinen ist. Die separate Zugabe kann durch die Zugabe des Proteins in fester Form, als Lösung oder als geeignete Formulierung erfolgen. Selbstverständlich können beide Methoden der Zugabe auch kombiniert werden.
Die Menge des grenzflächenaktiven, nicht-enzymatischen Proteins in der Waschflotte wird vom Fachmann je nach dem gewünschten Effekt bestimmt. Bewährt hat sich im Regelfalle eine Menge von 0,05 bis 50 ppm, bevorzugt 0,1 bis 30 ppm, besonders bevorzugt 0,2 bis 20 ppm, ganz besonders bevorzugt 0,5 bis 10 ppm und beispielsweise 1 bis 6 ppm.
Die erfindungsgemäßen Waschmittel umfassen mindestens eine waschaktive Sub- stanz sowie mindestens ein grenzflächenaktives, nicht-enzymatisches Protein.
Bei dem mindestens einen grenzflächenaktiven, nicht-enzymatischen Protein handelt es sich bevorzugt um ein Protein, welches die eingangs erwähnte Änderung des Kontaktwinkels hervorruft, besonders bevorzugt um mindestens ein Hydrophobin. Selbst- verständlich können auch Gemische verschiedener Proteine eingesetzt werden.
Falls Hydrophobine eingesetzt werden, können diese als „reines" Hydrophobin eingesetzt werden oder aber in Form der oben erwähnten Fusionsproteine. Bewährt zur Ausführung der vorliegenden Erfindung haben sich beispielweise Fusionsproteine des Typs yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his SEQ ID NO: 22) oder yaad-Xa-basf1-his (SEQ ID NO: 24). Besonders bewährt hat sich yaad-Xa-dewA-his (SEQ ID NO: 20) mit vollständigem yaad-Fusionspartner oder auch mit verkürztem Fusionspartner, wie beispielsweise yaad40-Xa-dewA-his (SEQ ID NO: 26).
Der Begriff „Waschmittel für die Textilwäsche" ist selbsterklärend und beschränkend zugleich. Waschmittel zum Waschen von Textilien werden beispielsweise in Form von Pulvern, Granulaten, Perlen, Pasten, Tabletten, Gelen oder Flüssigkeiten im Regelfalle in wässriger Lösung (Waschflotte) eingesetzt. Ihre Wirkung besteht aus einem relativ komplexen Zusammenspiel chemischer sowie physikalisch-chemischer Vorgänge. Waschmittel umfassen mindestens eine, im Regelfalle aber mehrere verschiedene waschaktive Substanzen, die zu einem optimalen Waschergebnis zusammenwirken. Als wesentliche waschaktive Komponenten von Waschmitteln sind insbesondere Ten- side zu nennen, sowie weiterhin Gerüststoffe (Builder), Co-Builder, Bleichsysteme und Waschmittelenzyme. Weiterhin können typische Zusatzstoffe wie beispielsweise Duftstoffe, Korrosionsinhibitoren, Farbübertragungsinhibitoren, Schauminhibitoren oder optische Aufheller als Komponenten von Waschmitteln eingesetzt werden.
Bei Tensiden kann es sich um anionische, nichtionische, kationische oder um ampho- tere Tenside handeln.
Als nichtionische Tenside eignen sich dabei vor allem:
Alkoxylierte C8-C22-Alkohole, wie Fettalkoholalkoxylate, Oxoalkoholalkoxylate und Guerbet-alkoholethoxylate: Die Alkoxylierung kann mit Ethylenoxid, Propylenoxid und/oder Butylenoxid erfolgen. Es können Blockcopolymerisate oder statistische Copolymere vorliegen. Pro mol Alkohol enthalten sie üblicherweise 2 bis 50 mol, vorzugsweise 3 bis 20 mol, mindestens eines Alkylenoxids. Bevorzugtes Alkylen- oxid ist Ethylenoxid. Die Alkohole haben vorzugsweise 10 bis 18 Kohlenstoffatome.
Alkylphenolalkoxylate, insbesondere Alkylphenolethoxylate, die C6-Ci4-Alkyl- ketten und 5 bis 30 mol Alkylenoxid/mol enthalten.
Alkylpolyglucoside, die C8-C22-, vorzugsweise Cio-Ci8-Alkylketten und in der Regel 1 bis 20, vorzugsweise 1,1 bis 5, Glucosideinheiten enthalten.
- N-Alkylglucamide, Fettsäureamidalkoxylate, Fettsäurealkanolamidalkoxylate sowie Blockcopolymere aus Ethylenoxid, Propylenoxid und/oder Butylenoxid.
Geeignete anionische Tenside sind beispielsweise:
- Sulfate von (Fett)alkoholen mit 8 bis 22, vorzugsweise 10 bis 18, Kohlenstoffatomen, insbesondere CgCn-Alkoholsulfate, Ci2Ci4-Alkoholsulfate, Ci2-Ci8-Al- koholsulfate, Laurylsulfat, Cetylsulfat, Myristylsulfat, Palmitylsulfat, Stearylsulfat und Talgfettalkoholsulfat.
- Sulfatierte alkoxylierte Ce-C22-Alkohole (Alkylethersulfate): Verbindungen dieser Art werden beispielsweise dadurch hergestellt, daß man zunächst einen C8-C22-, vorzugsweise einen Cio-Ciβ-Alkohol, z.B. einen Fettalkohol oder einen Oxoalkohol, alkoxyliert und das Alkoxylierungsprodukt anschließend sulfatiert. Für die Alkoxylierung verwendet man vorzugsweise Ethylenoxid.
Lineare C8-C2o-Alkylbenzolsulfonate (LAS), vorzugsweise lineare C9-Ci3-Alkyl- benzolsulfonate und Cg-Cis-Alkyltoluolsulfonate. Alkansulfonate, insbesondere C8-C24-, vorzugsweise Cio-Ci8-Alkansulfonate.
Seifen, wie die Na- und K-Salze von Ce-C24-Carbonsäuren.
Die anionischen Tenside werden dem Waschmittel vorzugsweise in Form von Salzen zugegeben. Geeignete Salze sind dabei z.B. Alka Ii metallsalze, wie Natrium-, Kalium- und Lithiumsalze, und Ammoniumsalze, wie Hydroxyethylammonium-, Di(hydroxy- ethyl)ammonium- und Tri(hydroxyethyl)ammoniumsalze.
Als geeignete kationische Tenside seien genannt:
C7-C25-Alkylamine;
- N,N-Dimethyl-N-((C2-C4-hydroxy alkyl)(C7-C25-alkyl)ammoniumsalze;
mit Alkylierungsmitteln quatemisierte Mono- und Di-(C7-C25-alkyl)dimethylammo- niumverbindungen;
- Esterquats, insbesondere quatemäre veresterte Mono-, Di- und Trialkanolamine, die mit Ce-C22-Carbonsäuren verestert sind;
Imidazolinquats, insbesondere 1-Alkylimidazoliniumsalze der Formeln Il oder IM
» '"
in denen die Variablen folgende Bedeutung haben:
R3 Ci-C25-Alkyl oder C2-C25-Alkenyl; R4 Ci-C4-Alkyl oder Hydroxy-Ci-C4-alkyl;
R5 Ci-C4-Alkyl, Hydroxy-Ci-C4-alkyl oder ein Rest R1-(CO)-X-(CH2)m- (X:-O- oder -NH-; m: 2 oder 3),
wobei mindestens ein Rest R3 C7-C22-Alkyl ist.
Geeignete amphotere Tenside sind z.B. Alkylbetaine, Alkylamidbetaine, Aminopro- pinate, Aminoglycinate und amphotere Imidazoliumverbindungen. Gerüststoffe (Builder, auch heterogene anorganische Builder, HAB, genannt) fungieren im Waschprozess zur Enthärtung des Wassers. Sie unterstützen die Waschwirkung durch ihre Alka Ii tat sowie das Herauslösen von Ca- und Mg-Ionen aus Schmutz- bzw. Faserbrücken und fördern das Dispergieren von Pigmentschmutz in der Waschflotte.
Als anorganische Builder eignen sich insbesondere:
Kristalline und amorphe Alumosilikate mit ionenaustauschenden Eigenschaften, wie vor allem Zeolithe: Verschiedene Typen von Zeolithen sind geeignet, insbe- sondere die Zeolithe A, X, B, P, MAP und HS in ihrer Na-Form oder in Formen, in denen Na teilweise gegen andere Kationen wie Li, K, Ca, Mg oder Ammonium ausgetauscht ist.
Kristalline Silikate, wie insbesondere Disilikate und Schichtsilikate, z.B. δ- und ß- Na2Si2θ5. Die Silikate können in Form ihrer Alkalimetall-, Erdalkalimetall- oder
Ammoniumsalze eingesetzt werden, bevorzugt sind die Na-, Li- und Mg-Silikate.
Amorphe Silikate, wie Natriummetasilikat und amorphes Disilikat.
- Carbonate und Hydrogencarbonate: Diese können in Form ihrer Alkalimetall-, Erd-alkalimetall- oder Ammoniumsalze eingesetzt werden. Bevorzugt sind Na-, Li- und Mg-Carbonate und -Hydrogencarbonate, insbesondere Natriumcarbonat und/oder Natriumhydrogencarbonat.
- Polyphosphate, wie Pentanatriumtriphosphat.
Cobuilder wirken unterstützend mit den Buildem zusammen, beispielsweise, indem sie als eine Art Speicher Ca- oder Mg-Ionen rascher als die Builder aufnehmen und danach an die Builder weitergeben. Außerdem können sie durch Adsorption an Kristall- keimen deren Wachstum verhindern.
Als organische Cobuilder eignen sich vor allem:
Niedermolekulare Carbonsäuren, wie Citronensäure, hydrophob modifizierte Citronensäure, z. B. Agaricinsäure, Äpfelsäure, Weinsäure, Gluconsäure, Glutar- säure, Bernsteinsäure, Imidodibemsteinsäure, Oxydibernsteinsäure, Propantri- carbonsäure, Butantetracarbonsäure, Cyclopentantetracarbonsäure, Alkyl- und Alkenylbemsteinsäuren und Aminopolycarbonsäuren, z.B. Nitrilotriessigsäure, ß-Alanindiessigsäure, Ethylendiamintetraessigsäure, Serindiessigsäure, Isoserin- diessigsäure, N-(2-Hydroxyethyl)imino-essigsäure, Ethylendiamindibemsteinsäu- re und Methyl- und Ethylglycindiessigsäure. Oligomere und polymere Carbonsäuren, wie Homopolymere von Acrylsäure und Asparaginsäure, Oligomaleinsäuren, Copolymere der Maleinsäure mit Acrylsäure, Methacrylsäure oder C2-C22-Olefinen, z.B. Isobuten oder langkettigen α-Ole- finen, Vinyl-Ci-Cβ-alkylether, Vinylacetat, Vinylpropionat, (Meth)Acrylsäureester von Ci-Cβ-Alkoholen und Styrol. Bevorzugt sind die Homopolymere der Acrylsäure und Copolymere von Acrylsäure mit Maleinsäure. Die oligomeren und po- lymeren Carbonsäuren werden in Säureform oder als Natriumsalz eingesetzt.
Geeignete Bleichmittel sind beispielsweise Addukte von Wasserstoffperoxid an anor- ganische Salze, wie Natriumperborat-Monohydrat, Natriumperborat-Tetrahydrat und Natriumcarbonat-Perhydrat, und Percarbonsäuren, wie Phthalimidopercapronsäure.
Als Bleichaktivatoren eignen sich z.B. N.N.N'.N'-Tetraacetylethylendiamin (TAED), Na- trium-p-nonanoyloxybenzolsulfonat und N-Methylmorpholiniumacetonitrilmethylsulfat.
Vorzugsweise in Waschmitteln eingesetzte Enzyme sind Proteasen, Lipasen, Amyla- sen, Cellulasen, Oxidasen und Peroxidasen.
Als Farbübertragungsinhibitoren geeignet sind beispielsweise Homo-, Co- und Pfropf- polymere von 1-Vinylpyrrolidon, 1-Vinylimidazol, 4-Vinylpyridin-N-oxid, oder mit Chloressigsäure umgesetzte Homo- und Copolymere des 4-Vinylpyridins.
Die Art und Menge der verwendeten Komponenten wird vom Fachmann je nach dem gewünschten Einsatzzweck des Waschmittels bestimmt. So werden beispielsweise Bleichmittel üblicherweise in Vollwaschmitteln verwendet, nicht aber in Buntwaschmitteln. Nähere Einzelheiten zur Zusammensetzung von Waschmitteln und Komponenten von Waschmitteln sind beispielsweise in „Waschmittel" in Römpp Chemie-Lexikon, Online Ausgabe, Version 2.6, Georg-Thieme-Verlag, Stuttgart, New-York, Febr. 2005 oder in „Detergents" in Ullmann's Encyclopedia of Industrial Chemistry, 6th Edt., 2000, Eelectronic Release, Wiley-VCH-Verlag, Weinheim, 2000 zu finden.
Bevorzugte Tenside zur Ausführung der vorliegenden Erfindung sind anionische Ten- side und/oder nichtionische Tenside.
Die erfindungsgemäß eingesetzten grenzflächenaktiven, nicht-enzymatischen Proteine, insbesondere Hydrophobine, lassen sich besonders vorteilhaft mit einer Kombination aus Linear-Alkylbenzolsulfonaten oder Fettalkoholsulfaten mit Alkylethersulfaten oder Alkylalkoxylaten einsetzen.
Besonders vorteilhaft lassen sich anionische und/oder nichtionische Tenside auf Basis von Cβ-Ciβ-Alkoholen und/oder deren Alkoxylierungsprodukten, optional in Mischung mit weiteren Tensiden einsetzen. Bei den Alkoxyresten handelt es sich bevorzugt um solche, welche im Wesentlichen Ethylenoxideinheiten und/oder Propylenoxideinheiten, bevorzugt Ethylenoxideinheiten umfassen. Es kann sich beispielsweise um Reste von 1 bis 25 Ethylenoxideinheiten, bevorzugt 3 bis 20 und besonders bevorzugt 5 bis 15 Einheiten oder um Ethylenoxid- und Propylenoxideinheiten umfassende Reste han- dein, wobei Letztere jeweils zumindest 50 mol %, bevorzugt 60 mol % Ethylenoxideinheiten bezogen auf die Gesamtzahl aller Alkoxyeinheiten umfassen sollten.
Beispiele bevorzugter Tenside umfassen alkoxylierte Ce-Cie-Alkohole, wie Fettalkoho- lalkoxylate, Oxoalkoholalkoxylate, Guerbetalkoholalkoxylate, Sulfate von C8-Ci8-Al- koholen, sulfatierte alkoxylierte C8-Ci8-Alkohole (Alkylethersulfate) oder lineare
C8-Ci8-Alkylbenzolsulfonate (LAS), vorzugsweise lineare C9-Ci3-Alkyl-benzolsulfonate und Cg-Cis-Alkyltoluolsulfonate.
Besonders bevorzugt sind Alkoxylierungsprodukte von 2-Propylheptanol und Trideca- nol und deren Sulfate.
Die Menge der grenzflächenaktiven, nicht enzymatischen Proteine im Waschmittel wird vom Fachmann je nach den gewünschten Eigenschaften des Waschmittels bemessen. Vorteilhaft wird die Menge hierbei so gewählt, dass bei ordnungsgemäßer Dosierung des Waschmittels die oben angegebenen Konzentrationen des grenzflächenaktiven, nicht-enzymatischen Proteins erhalten werden.
Bewährt hat sich eine Menge von 0,002 bis 2,5 Gew. % der grenzflächenaktiven, nicht- enzymatischen Proteine, bezogen auf die Gesamtmenge aller Komponenten des Waschmittels. Bevorzugt beträgt die Menge 0,01 bis 1 ,5 Gew. %, besonders bevorzugt 0,025 bis 1 ,0 Gew. %, ganz besonders bevorzugt 0,05 bis 0,5 Gew. % und beispielsweise 0,1 bis 0,3 Gew. %.
In einer bevorzugten Ausführungsform umfassen die erfindungsgemäßen Waschmittel
0,01 bis 1,5 Gew.% grenzflächenaktive, nicht-enzymatische Proteine,
0,5 bis 40 Gew.% Tenside, bevorzugt anionische und/oder nichtionische Tenside
59 bis 99,45 Gew.% weitere waschaktive Zusätze oder Formulierungshilfsmittel.
Bevorzugt können als Komponente (c) Lipasen und/oder amphophile Polymere, beispielsweise Ethylenoxid-Propylenoxid-Blockcopolymere eingesetzt werden.
Die erfindungsgemäßen Waschmittel können nach dem Fachmann prinzipiell bekannten Methoden hergestellt werden. Einzelheiten zu Herstellverfahren für Waschmittel sind beispielsweise in den oben zitierten Literaturstellen „Römpp Chemie-Lexikon" oder „Ullmann's" dargestellt. Die grenzflächenaktiven, nicht-enzymatischen Proteine können zur Herstellung des Waschmittels als Lösung oder als Feststoff eingesetzt werden. Feste Proteine können ausgehend von Lösungen der Proteine mittels dem Fachmann bekannter Methoden, wie beispielsweise Sprühtrocknen oder Gefriertrocknen, gewonnen werden.
Bei der Herstellung der Waschmittel sollte darauf geachtet werden, dass die Temperaturbelastung der grenzflächenaktiven, nicht-enzymatischen Proteine nicht zu hoch ist. Die Grenze richtet sich selbstverständlich nach der Art des Proteins. Im Falle der Verwendung von Hydrophobinen hat es sich bewährt, eine Produkttemperatur von 1200C nicht zu überschreiten. Die Prozesstemperatur, also beispielsweise die Temperatur des Gasstromes in einem Sprühtrockner, kann selbstverständlich auch höher sein, sofern die Produkttemperatur die kritische Grenze nicht überschreitet.
Techniken zur schonenden Einarbeitung von Komponenten in Waschmittel sind dem Fachmann bekannt. Die Herstellung pulverförmiger Waschmittel kann beispielsweise erfolgen, indem man in einem ersten Schritt aus wässrigen Slurrys der thermisch stabilen Komponenten des Waschmittels mittels Sprühtrocknen ein Rohprodukt herstellt und dieses Rohprodukt in einem zweiten Schritt unter schonenden Bedingungen mit den thermisch empfindlichen Komponenten mischt. Es ist im Regelfalle empfehlens- wert, die erfindungsgemäß eingesetzten grenzflächenaktiven, nicht-enzymatischen Proteine in diesem zweiten Schritt einzubringen, ohne dass die Erfindung darauf beschränkt sein soll.
Das erfindungsgemäße Verfahren zum Waschen von textilen Materialien umfasst min- destens die Schritte:
Befallen einer Waschvorrichtung mit den zu waschenden textilen Materialien sowie mit einer wässrigen Waschflotte,
Einwirken von mechanischer Energie auf die Mischung aus textilen Materialien und Waschflotte,
Entfernen der wässrigen Waschflotte und optional Spülen der textilen Materialien, sowie Trocknen der textilen Materialien.
Bei der eingesetzten Waschvorrichtung kann es sich um alle Arten von Waschmaschinen handeln. Der Begriff soll aber auch Gefäße umfassen, die tyischerweise bei der Handwäsche eingesetzt werden, wie beispielsweise Waschzuber oder Waschbecken. In Schritt (a) wird die Waschvorrichtung zunächst mit den Textilien und einer wässrigen Waschflotte befüllt, wobei es auf die Reihenfolge nicht ankommt.
Die Waschflotte umfasst in prinzipiell bekannter Art und Weise mindestens eine waschaktive Substanz. Erfindungsgemäß umfasst die wässrige Waschflotte weiterhin min- destens ein grenzflächenaktives, nicht-enzymatisches Protein. Bevorzugte Proteine wurden bereits genannt. Die Zugabe der grenzflächenaktiven, nicht-enzymatischen Proteine kann über das Waschmittel vorgenommen werden, oder sie kann auch separat erfolgen. Sie erfolgt bevorzugt zu Beginn des Waschganges, aber sie kann selbst- verständlich auch zu einem späteren Zeitpunkt vorgenommen werden.
Der Waschvorgang wird in Verfahrensschritt (b) in bekannter Art und Weise durch die Einwirkung von mechanischer Energie auf die Mischung aus textilen Materialien und Waschflotte unterstützt. Mechanische Energie kann durch Waschmaschinen einge- bracht werden, z.B. durch rotierende Trommeln, oder im Falle der Handwäsche durch die Hände und/oder sonstige Hilfsmittel.
Die Temperatur im Zuge des Waschvorganges wird vom Fachmann je nach den Gegebenheiten gewählt. Beispielsweise kann die Temperatur 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 70, 75, 80, 85, 90, 95 oder 1000C betragen. Die besonderen Vorteile der Erfindung kommen aber ganz besonders bei der Wäsche bei mittleren oder tiefen Temperaturen zum Tragen. In einer bevorzugten Ausführungsform der Erfindung nimmt man den Waschvorgang bei einer Temperatur von nicht mehr als 600C, insbesondere bei nicht mehr als 500C vor. Ein besonders vorteilhafter Temperaturbereich zur Ausführung des erfindungsgemäßen Waschverfahrens ist 5 bis 45°C, ganz besonders bevorzugt sind 15 bis 35°C und beispielsweise 20 bis 300C.
Die Konzentration der grenzflächenaktiven, nicht-enzymatischen Proteine im Zuge des Waschvorganges wird vom Fachmann gewählt. Bevorzugte Konzentrationsbereiche wurden bereits oben genannt.
Falls die Zugabe über die erfindungsgemäßen Waschmittel erfolgt, so werden diese üblicherweise in einer Menge von 0,05 bis 25 g/l, bevorzugt 0,25 bis 15 g/l, besonders bevorzugt 0,5 bis 10 g/l, ganz besonders bevorzugt 1 bis 6 g/l und beispielsweise 1 ,5 bis 4 g/l, jeweils bezogen auf die Waschflotte, eingesetzt.
Nach dem eigentlichen Waschvorgang wird die Waschflotte in prinzipiell bekannter Art und Weise entfernt. Im Regelfalle werden die textilen Materialien anschließend durch einen oder mehrere Spülvorgänge gespült und schließlich getrocknet (Verfahrens- schritte (d) und (e)). Beim Spülen können Weichspüler als Zusatz verwendet werden.
Das erfindungsgemäße Verfahren eignet sich zur Reinigung von allen Arten von textilen Materialien. Hierbei kann es sich um Textilfasem, textile Halb- und Fertigfabrikate und daraus hergestellte Fertigwaren handeln. Hierbei kann es sich um übliche Textilien zur Bekleidung handeln, aber auch um Heimtextilien wie beispielsweise Teppiche, Gardinen, Tischdecken sowie technischen Zwecken dienende textile Gebilde. Dazu gehören auch ungeformte Gebilde wie beispielsweise Flocken, linienförmige Gebilde wie Bindfäden, Fäden, Garne, Leinen, Schnüre, Seile, Zwirne sowie Körpergebilde wie beispielsweise Filze, Gewebe, Gewirke, Vliesstoffe und Watten. Textile Materialien können aus Materialien natürlichen Ursprungs bestehen, wie beispielsweise Baumwolle, Wolle oder Flachs oder aus synthetischen Materialien wie Polyacrylnitril, Polyamid, oder Polyester. Selbstverständlich kann es sich auch um Mischgewebe handeln, wie beispielsweise Baumwolle/Polyester oder Baumwolle/Polyamid.
Die folgenden Beispiele sollen die Erfindung näher erläutern:
TeN A:
Herstellung und Test erfindungsgemäß verwendeter Hydrophobine
Beispiel 1
Vorarbeiten für die Klonierung von yaad-Hisβ/ yaaE-HiS6
Mit Hilfe der Oligonukleotide Hal570 und Hal571 (HaI 572/ HaI 573) wurde eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Gens yaaD / yaaE aus Bacillus subtilis, und an den Enden je eine Ncol bzw. BgIII Restriktionsschnittstelle. Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen Ncol und BgIII geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit den Restriktionsendonukleasen Ncol und BgIII linearisierten Vektor pQE60 der Firma Qiagen kloniert. Die so enstandenen Vektoren pQE60YAAD#2 / pQE60YaaE#5 können zur Expression von Proteinen be- stehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.
Hal570: gcgcgcccatggctcaaacaggtactga Hal571 : gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc
Beispiel 2
Klonierung von yaad-Hydrophobin DewA-Hisβ
Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Schimmelpilzes Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa Proteinase Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea- se BamHI geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 kloniert. Der so enstandene Vektor #508 kann zur Expressions eines Fusionsproteins bestehend aus, YAAD::Xa::dewA::HIS6 verwendet werden.
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
Beispiel 3
Klonierung von yaad-Hydrophobin RodA-Hisβ
Die Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 434 und KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4
Klonierung von yaad-Hydrophobin HypA-HiS6
Klonierung HypA in pQE60 (#522)
Mit den Oligonukleotiden KaM449/KaM450 wurde eine PCR durchgeführt. Als Template DNA wurde das Plasmid HypA in pCR2.1, hergestellt von der Firma Nadicom, verwendet. Das erhaltene Fragment enthielt die codierende Sequenz des Hydrophobin HypA Gens ohne start und Stop codon. Das PCR Fragment wurde über Gelelektrophorese aufgereinigt und mit den Restriktionsendonucleasen Ncol und BamHI geschnitten. Dieses Fragment wurde als Insert verwendet und in den zuvor mit Ncol und BgIII geschnittenen Vektor pQE60 ligiert.
KaM449: GTTACCCCATGGCGATCTCTCGCGTCCTTGTCGCT KaM450: GCCTGAGGATCCGAGGTTGACATTGACAGGAGAGC
Klonierung HypA in pQE60+YAAD (#523)
Mit den Oligonukleotiden KaM451/KaM452 wurde eine PCR durchgeführt. Als Template DNA wurde das Plasmid HypA in pCR2.1 , hergestellt von der Firma Nadicom, verwendet. Das erhaltene Fragment enthielt die codierende Sequenz des Hydrophobin HypA Gens ohne start und Stop codon. Das PCR Fragment wurde über Gelelektrophorese aufgereinigt und mit den Restriktionsendonucleasen BgIII und BamHI geschnitten. Dieses Fragment wurde als Insert verwendet und in den zuvor mit BgIII geschnittenen Vektor pQE60+YAAD ligiert.
KaM451 : CGTAGTAGATCTATGATCTCTCGCGTCCTTGTCGCTGC KaM452: CGACTAGGATCCGAGGTTGACATTGACAGGAGAGC
Beispiel 5
Klonierung von yaad-Hydrophobin HypA-HiS6
Klonierung HypB in pQE60 (#524)
Mit den Oligonukleotiden KaM453/KaM454 wurde eine PCR durchgeführt. Als Template DNA wurde das Plasmid HypB in puC19, hergestellt von der Firma Nadicom, verwendet. Das erhaltene Fragment enthielt die codierende Sequenz des Hydrophobin HypB Gens ohne start und Stop codon. Das PCR Fragment wurde über Gelelektropho- rese aufgereinigt und mit den Restriktionsendonucleasen Ncol und BamHI geschnitten. Dieses Fragment wurde als Insert verwendet und in den zuvor mit Ncol und BgIII geschnittenen Vektor pQE60 ligiert.
KaM453: GCTTATCCATGGCGGTCAGCACGTTCATCACTGTCG KaM454: GCTATAGGATCCCACATTGGCATTAATGGGAGTGC
pT5/lac Operator
Klonierung HypB in pQE60+YAAD (#525)
Mit den Oligonukleotiden KaM455/KaM456 wurde eine PCR durchgeführt. Als Template DNA wurde das Plasmid HypB in puC19, hergestellt von der Firma Nadicom, ver- wendet. Das erhaltene Fragment enthielt die codierende Sequenz des Hydrophobin HypB Gens ohne start und Stop codon. Das PCR Fragment wurde über Gelelektrophorese aufgereinigt und mit den Restriktionsendonucleasen BgIII und BamHI geschnitten. Dieses Fragment wurde als Insert verwendet und in den zuvor mit BgIII geschnittenen Vektor pQE60+YAAD ligiert. KaM455: GCTAACAGATCTATGGTCAGCACGTTCATCACTGTC KaM456: CTATGAGGATCCCACATTGGCATTAATGGGAGTGC
Beispiel 6
Klonierung von yaad-Hydrophobin BASFI-Hisβ
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF1 -eingesetzt (siehe Anhang).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 7
Klonierung von yaad-Hydrophobin BASF2-HiS6
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin
BASF2 -eingesetzt (siehe Anhang).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
GAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG Beispiel 8
Klonierung von yaad-Hydrophobin SC3-HiS6
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.
Als Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe Anhang).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 9
Fermentation des rekombinanten E. coli Stammes yaad-Hydrophobin DewA-Hisβ
Inokulation von 3ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-Hisβ expri- mierenden E. coli Stamm in 15ml Greiner Röhrchen. Inkubation für 8h bei 37°C auf einem Schüttler mit 200 UpM. Je 2 11 Erlenmeyer Kolben mit Schikanen und 250ml LB Medium (+ 100μg/ml Ampicillin) werden mit jeweils 1ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert. 13.51 LB-Medium (+100μg/ml Ampicillin) in einem 2Ol Fermenter mit 0,51 Vorkultur
(OD6oonm 1 :10 gegen H2O gemessen) animpfen. Bei einer ODβonm von -3.5 Zugabe von 140ml 10OmM IPTG. Nach 3h Fermenter auf 100C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.
Beispiel 10
Reinigung des rekombinanten Hydrohobin-Fusionsproteins
(Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)
100 g Zellpellet (100 - 500 mg Hydrophobin) werden mit 50 mM Natriumphosphatpuffer, pH 7,5 auf 200 ml Gesamtvolumen aufgefüllt und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25 (Janke und Kunkel; IKA-Labortechnik) für 10 Minuten behandelt und anschliessend für 1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck, Darmstadt; Best.-Nr. 1.01697.0001) zum Abbau der Nukleinsäuren inkubiert. Vor dem Zellaufschluss wird mit einer Glaskartusche (P1) filtriert. Zum Zellaufschluß und für das Scheren der restlichen genomischen DNA werden zwei Homogenisatorläufe bei 1.500 bar durchgeführt (Microfluidizer M-110EH; Microfluidics Corp.). Das Homogenisat wird zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g), der Überstand auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer, pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung 1 % SDS enthält. Nach der Resuspension wird für eine Stun- de gerührt und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA- Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g). Gemäß SDS-PAGE Analyse ist das Hydrophobin nach der abschliessenden Zentrifugation im Überstand enthalten (Abbildung 1). Die Versuche zeigen, dass das Hydrophobin wahr- scheinlich in Form von Einschlusskörpern in den entsprechenden E. coli Zellen enthalten ist. 50 ml des Hydrophobin-enthaltenden Überstandes werden auf eine 50 ml Ni- ckel-Sepharose High Performance 17-5268-02 Säule aufgetragen (Amersham), die mit 50 mM Tris-Cl pH 8,0 Puffer äquilibriert wurde. Die Säule wird mit 50 mM Tris-Cl pH 8,0 Puffer gewaschen und das Hydrophobin anschliessend mit 50 mM Tris-Cl pH 8,0 Puffer, der 200 mM Imidazol enthält, eluiert. Zur Entfernung des Imidazols wird die Lösung gegen 50 mM Tris-Cl pH 8,0 Puffer dialysiert.
Abbildung 1 zeigt die Reinigung des hergestellten Hydrophobins:
Spur 1 : Auftrag Nickel-Sepharose Säule (1 :10 Verdünnung)
Spur 2: Durchlauf = Eluat Waschschritt
Spuren 3 - 5: OD 280 Maxima der Elutionsfraktionen
Das Hydrophobin der Abbildung 1 besitzt ein Molekulargewicht von ca. 53 kD. Die klei- neren Banden repräsentieren zum Teil Abbauprodukte des Hydrophobins.
Beispiel 11
Anwendungstechnische Prüfung; Charakterisierung des Hydrophobins durch Kontakt- Winkeländerung eines Wassertropfens auf Glas
Substrat:
Glas (Fensterglas, Süddeutsche Glas, Mannheim)
Es wurde das Fusions-Hydrophobin aus Beispiel 10 verwendet.
Konzentration Hydrophobin: 100 μg/mL in wässriger Lösung; Zusatz: 50 mM Na-Acetat pH 4 + 0,1 % Polyoxyethylen(20)-sorbitanmonolaureat (Tween® 20).
Inkubation von Glasplättchen über Nacht (Temperatur 800C), danach Beschich- tung waschen in destilliertem Wasser,
- danach Inkubation 10min / 800C / 1 % Natrium-Dodecylsulfat (SDS) -Lösung in dest. Wasser,
- Waschen in dest. Wasser
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser bei Raumtemperatur bestimmt. Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; eine Beschichtung mit dem funktionellen Hydrophobin gemäss Beispiel 8 (yaad-dewA-hisβ) ergab Kontaktwinkel von 75 ± 5°.
TeN B:
Verwendung grenzflächenaktiver, nicht-enzymatischer Proteine zur Textilwäsche
Allgemeine Versuchsbeschreibung:
Zur Prüfung der Wirkung wurden Waschversuche in einer kommerziell erhältlichen Testvorrichtung (Launder-o-meter, Fa. Atlas, USA) durchgeführt. Es wurden jeweils Versuche mit und ohne Zusatz des Proteins zu der Waschflotte durchgeführt
Für die Tests wurden kommerziell erhältliche und selbst hergestellte Testgewebe ein- gesetzt.
Durchführung der Waschtests:
Von den genannten Testgeweben wurden jeweils Stücke von 30 x 30 mm ausgeschnitten und auf gestrickte ungefärbte gebleichte Baumwolle aufgenäht.
Im Falle der käuflichen Testgewebe wurden jeweils 2 Streifen (50 mm x 200 mm) mit je 4 (bei Geweben 1-4) bzw. je 2 (im Falle der Gewebe 5 und 6) verschiedenen aufgenähten Testgeweben zusammen mit 5 g weißem Baumwolle/Polyester- Mischgewebe unter den unten angegebenen Bedingungen gewaschen.
Im Falle der selbst hergestellten Testgewebe wurden je 2 Flecken mit 0,1 g gefärbtem Fett bzw. Öl auf einem Baumwollstreifen (50 mm x 200 mm gestrickte ungefärbte gebleichte Baumwolle) aufgetropft und 30 min bei 500C behandelt. Zur Anfärbung wurde Sudanrot verwendet.
Nach der Wäsche wurde das Gewebe in 250 ml Leitungswasser 5 Minuten gespült und anschließend getrocknet.
Die Bewertung der Waschwirkung erfolgte durch Remissionsmessungen bei 420 nm vor und nach der Wäsche.
Es wurde jeweils ein Versuch mit Zusatz von grenzflächenaktiven, nicht-enzymatischen Proteinen durchgeführt und zu Vergleichsbedingungen ein Versuch ohne einen solchen Zusatz aber ansonsten unter exakt gleichen Bedingungen.
Die in den Ergebnistabellen aufgeführten Prozentsätze geben die Steigerung der Waschwirkung im Versuch mit Proteinzusatz im Vergleich zum Versuch ohne Proteinzusatz wieder, berechnet gemäß folgender Formel:
Steigerung Waschwirkung [%] = (lE-loE)/(lw8iss-lA)*1OO
IE bedeutet hierbei jeweils die Remission des Testgewebes nach, U die Remission vor Durchführung der Testwäsche. 0 kennzeichnet den Vergleichversuch ohne erfindungsgemäßen Zusatz von Proteinen. Leiss kennzeichnet die Remission der reinen Gewebe ohne Anschmutzung.
Die Wiederablagerung von Schmutz wurde entsprechend durch Vergleich der Remission des reinen, weißen Gewebes ohne Verschmutzungen vor der Wäsche und nach der Wäsche beurteilt, jeweils für den Versuch ohne Zusatz und mit Zusatz der Protei- ne. Beispiel 12:
Versuchsparameter: Eingesetztes Protein Hydrophobin-Fusionsprotein yaad-Xa-dew A-his (SEQ
ID NO: 19)
Konzentration des Proteins: Siehe Tabelle 1 Waschmittel Kommerziell erhältliches Pulverwaschmittel (White Cat,
China, 2003)
Menge Waschflotte 250 ml pro Büchse
Dosierung des Waschmittels 2,0 g/l
Flottenverhältnis 20:1
Wasserhärte 2,5 mmol/l (Molverhältnis Ca:Mg = 3:1)
Waschtemperatur 25°C
Waschdauer 30 Minuten
Das Protein wurde als verdünnte, wässrige Lösung zugegeben. Die Testwäsche wurde gemäß der oben angegebenen allgemeinen Beschreibung durchgeführt und ausgewertet. Die Ergebnisse sind in Tabelle 1 zusammengefasst:
Beispiel 13:
Versuchsparameter: Eingesetztes Protein Hydrophobin-Fusionsprotein yaad-Xa-dew A-his (SEQ ID NO: 19)
Konzentration des Proteins: Siehe Tabelle 1 Waschmittel Kommerziell erhältliches Pulverwaschmittel (Ariel, China, 2004, Fa. Procter & Gamble)
Menge Waschflotte 250 ml pro Büchse
Dosierung des Waschmittels 2,0 g/l
Flottenverhältnis 20:1
Wasserhärte 2,5 mmol/l (Molverhältnis Ca: Mg = 3:1)
Waschtemperatur 25°C
Waschdauer 30 Minuten
Die Testwäsche wurde gemäß der oben angegebenen allgemeinen Beschreibung durchgeführt und ausgewertet. Die Ergebnisse sind in Tabelle 1 zusammengefasst: Tabelle 1 : Ergebnisse der Testwäsche
Bei allen Versuchen wurde eine deutliche Steigerung der Waschwirkung erzielt.
Beispiel 14:
Für den folgenden Waschversuch wurde jeweils eine Modellformulierung für ein Waschmittel aus einem anionischen Tensid, einem nichtionischen Tensid sowie einem Builder eingesetzt.
Versuchsparameter:
Eingesetztes Protein Hydrophobin-Fusionsprotein yaad40-Xa-dew A-his (SEQ ID NO: 26)
Konzentration des Proteins: Siehe Tabelle 2
anionisches Tensid 400 ppm Na-Ci2/i4"Fettalkoholsulfat nichtionisches Cotensid jeweils 30 ppm eines C13/15-Oxoalkoholethoxylates,
Art des Alkoxylatrestes siehe Tabelle 2
Builder 250 ppm Natriumcarbonat
Menge Waschflotte 250 ml pro Büchse
Flottenverhältnis 20:1
Wasserhärte 2,5 mmol/l (Molverhältnis Ca: Mg = 3:1)
Waschtemperatur 25°C
Waschdauer 30 Minuten
Die Testwäsche wurde gemäß der oben angegebenen allgemeinen Beschreibung durchgeführt und ausgewertet. Die Ergebnisse sind in Tabelle 2 zusammengefasst.
Tabelle 2: Ergebnisse der Testwäsche
EO = Ethylenoxid, PO = Propylenoxid Beispiel 15:
Für den folgenden Waschversuch wurde jeweils eine Modellformulierung für ein Waschmittel aus einem anionischen Tensid, einem nichtionischen Tensid sowie einem Builder eingesetzt.
Versuchsparameter:
Eingesetzte Proteine Protein A:
Hydrophobin-Fusionsprotein yaad-Xa-dew A-his (SEQ
ID NO: 19)
Protein B:
Hydrophobin-Fusionsprotein yaad40-Xa-dew A-his
(SEQ ID NO: 26)
Konzentration des Proteins: siehe Tabelle 3
anionisches Tensid 400 ppm Na-n-Dodecylbenzolsulfonat
Cotensid jeweils 30 ppm, Art siehe Tabelle 3
Builder 250 ppm Natriumcarbonat
Menge Waschflotte 250 ml pro Büchse
Flottenverhältnis 20:1
Wasserhärte 2,5 mmol/l (Molverhältnis Ca: Mg = 3:1)
Waschtemperatur 25°C
Waschdauer 30 Minuten
Die Testwäsche wurde gemäß der oben angegebenen allgemeinen Beschreibung durchgeführt und ausgewertet. Die Ergebnisse sind in Tabelle 3 zusammengefasst.
Tabelle 3: Ergebnisse der Testwäsche
EO = Ethylenoxid, PO = Propylenoxid
Bei allen Versuchen wurde jeweils eine Steigerung der Waschwirkung erzielt. Das Fu- sions-Hydrophobin mit einem verkürzten yaad-Fusionspartner (B) (40 Aminosäuren) erreichte jeweils bessere Ergebnisse als das Fusions-Hydrophobin (A) mit einem vollständigen yaad-Fusionspartner (294 Aminosäuren).
Zuordnung der Sequenznamen zu DNA- und Polypeptidsequenzen im Sequenzprotokoll

Claims

Patentansprüche
1. Verwendung grenzflächenaktiver, nicht-enzymatischer Proteine für die Textilwä- sche.
2. Verwendung gemäß Anspruch 1 , dadurch gekennzeichnet, dass die Proteine durch die Eigenschaft charakterisiert sind, dass sie nach dem Aufbringen auf eine Glasoberfläche bei Raumtemperatur eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, verglichen mit dem Kontaktwinkel ei- nes gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche, bewirken.
3. Verwendung nach Anspruch 2, dadurch gekennzeichnet, dass es sich bei dem Proteinen um ein Hydrophobin handelt.
4. Verwendung nach Anspruch 3, dadurch gekennzeichnet, dass es sich bei dem Protein um ein Fusions-Hydrophobin handelt, wobei der Fusionspartner 20 bis 500 Aminosäuren umfasst.
5. Verwendung nach Anspruch 3, dadurch gekennzeichnet, dass es sich bei dem Hydrophobin um mindestens eines ausgewählt aus der Gruppe von yaad-Xa- dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa- basfl-his (SEQ ID NO: 24) handelt, mit der Maßgabe, dass es sich bei yaad jeweils auch um einen verkürzten yaad-Fusionspartner mit 20 bis 293 Aminosäu- ren handeln kann.
6. Verwendung nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass das Protein in einer Konzentration von 0,05 bis 50 ppm in der Waschflotte eingesetzt wird.
7. Verwendung nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass man die Proteine in Kombination mit anionischen und/oder nichtionischen Tensi- den einsetzt, wobei es sich um eine Kombination aus Linear-Alkylbenzolsulfo- naten oder Fettalkoholsulfaten mit Alkylethersulfaten oder Alkyl-alkoxylaten han- delt.
8. Waschmittel für die Textilwäsche umfassend mindestens eine waschaktive Substanz, dadurch gekennzeichnet, dass das Waschmittel weiterhin mindestens ein grenzflächenaktives, nicht-enzymatisches Protein umfasst.
9. Waschmittel gemäß Anspruch 8, dadurch gekennzeichnet, dass die Proteine durch die Eigenschaft charakterisiert sind, dass sie nach dem Aufbringen auf ei- ne Glasoberfläche bei Raumtemperatur eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche, bewirken.
10. Waschmittel gemäß Anspruch 9, dadurch gekennzeichnet, dass es sich bei dem Protein um ein Hydrophobin handelt.
11. Waschmittel gemäß Anspruch 10, dadurch gekennzeichnet, dass es sich bei dem Protein um ein Fusions-Hydrophobin handelt, wobei der Fusionspartner 20 bis 500 Aminosäuren umfasst.
12. Waschmittel gemäß Anspruch 11 , dadurch gekennzeichnet, dass es sich bei dem Hydrophobin um mindestens eines ausgewählt aus der Gruppe von yaad- Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-
Xa-basfl-his (SEQ ID NO: 24) handelt, mit der Maßgabe, dass es sich bei yaad jeweils auch um einen verkürzten yaad-Fusionspartner mit 20 bis 293 Aminosäuren handeln kann.
13. Waschmittel gemäß einem der Ansprüche 8 bis 12, dadurch gekennzeichnet, dass die Menge der grenzflächenaktiven nicht-enzymatische Proteine 0,002 bis 2,5 Gew.% bezüglich aller Komponenten des Waschmittels beträgt.
14. Waschmittel gemäß Anspruch 13, dadurch gekennzeichnet, dass es
(a) 0,01 bis 1,5 Gew.% grenzflächenaktive, nicht-enzymatische Proteine,
(b) 0,5 bis 40 Gew.% Tenside, sowie
(c) 59 bis 99,45 Gew.% weitere waschaktiver Zusätze oder Formulierungshilfsmittel
enthält.
15. Waschmittel gemäß Anspruch 14, dadurch gekennzeichnet dass es sich bei den Tensiden um anionische und/oder nichtionische Tenside handelt.
16. Waschmittel gemäß Anspruch 15, wobei es sich bei den Tensiden um eine Kombination aus Linear-Alkylbenzolsulfonaten oder Fettalkoholsulfaten mit Alky- lethersulfaten oder Alkylalkoxylaten handelt.
17. Verfahren zum Waschen von textilen Materialien umfassend mindestens die folgenden Schritte:
(a) Befüllen einer Waschvorrichtung mit den zu waschenden textilen Materia- lien sowie einer wässrigen Waschflotte,
(b) Einwirken von mechanischer Energie auf die Mischung aus textilen Materialien und Waschflotte,
(c) Entfernen der wässrigen Waschflotte und optional Spülen der textilen Materialien, sowie (d) Trocknen der textilen Materialien,
dadurch gekennzeichnet, dass die wässrige Waschflotte mindestens ein grenzflächenaktives, nicht-enzymatisches Protein umfasst.
18. Verfahren gemäß Anspruch 17, dadurch gekennzeichnet, dass die Proteine durch die Eigenschaft charakterisiert sind, dass sie nach dem Aufbringen auf eine Glasoberfläche bei Raumtemperatur eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche, be- wirken.
19. Verfahren gemäß Anspruch 18, dadurch gekennzeichnet, dass es sich bei dem Protein um ein Hydrophobin handelt.
20. Verfahren gemäß Anspruch 19, dadurch gekennzeichnet, dass es sich bei dem Protein um ein Fusions-Hydrophobin handelt, wobei der Fusionspartner 20 bis 500 Aminosäuren umfasst.
21. Verfahren gemäß Anspruch 20, dadurch gekennzeichnet, dass es sich bei dem Hydrophobin um mindestens eines ausgewählt aus der Gruppe von yaad-Xa- dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) oder yaad-Xa- basfl-his (SEQ ID NO: 24) handelt, mit der Maßgabe, dass es sich bei yaad jeweils auch um einen verkürzten yaad-Fusionspartner mit 20 bis 293 Aminosäuren handeln kann.
22. Verfahren gemäß einem der Ansprüche 17 bis 21 , dadurch gekennzeichnet, dass man die Proteine in Kombination mit anionischen und/oder nichtionischen Tensi- den einsetzt, wobei es sich um eine Kombination aus Linear-Alkylbenzolsulfo- naten oder Fettalkoholsulfaten mit Alkylethersulfaten oder Alkyl-alkoxylaten han- delt.
23. Verfahren gemäß einem der Ansprüche 17 bis 22, dadurch gekennzeichnet, dass man den Waschvorgang bei einer Temperatur von nicht mehr als 600C vornimmt.
24. Verfahren gemäß einem der Ansprüche 17 bis 22, dadurch gekennzeichnet, dass man den Waschvorgang bei einer Temperatur von 5 bis 45°C vornimmt.
25. Verfahren gemäß einem der Ansprüche 17 bis 22, dadurch gekennzeichnet, dass man den Waschvorgang bei einer Temperatur von 15 bis 35°C vornimmt.
26. Verfahren gemäß einem der Ansprüche 17 bis 15, dadurch gekennzeichnet, dass das Protein in einer Konzentration von 0,05 bis 50 ppm in der Waschflotte eingesetzt wird.
EP06792583A 2005-08-01 2006-07-27 Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche Not-in-force EP1913123B1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005036586 2005-08-01
PCT/EP2006/064720 WO2007014897A1 (de) 2005-08-01 2006-07-27 Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche

Publications (2)

Publication Number Publication Date
EP1913123A1 true EP1913123A1 (de) 2008-04-23
EP1913123B1 EP1913123B1 (de) 2010-10-20

Family

ID=37118364

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06792583A Not-in-force EP1913123B1 (de) 2005-08-01 2006-07-27 Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche

Country Status (14)

Country Link
US (1) US20090101167A1 (de)
EP (1) EP1913123B1 (de)
JP (1) JP5105441B2 (de)
KR (1) KR20080041228A (de)
CN (1) CN101233220B (de)
AT (1) ATE485359T1 (de)
AU (1) AU2006274836B2 (de)
BR (1) BRPI0614703A2 (de)
CA (1) CA2617092A1 (de)
DE (1) DE502006008140D1 (de)
ES (1) ES2352970T3 (de)
MX (1) MX2008001056A (de)
WO (1) WO2007014897A1 (de)
ZA (1) ZA200801881B (de)

Families Citing this family (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
KR20080004555A (ko) * 2005-03-31 2008-01-09 바스프 악티엔게젤샤프트 접착 촉진제로서의 폴리펩티드의 용도
CN101228249B (zh) 2005-04-01 2011-11-30 巴斯福股份公司 含疏水蛋白的钻井液
CA2603374C (en) 2005-04-01 2013-05-28 Basf Aktiengesellschaft Use of hydrophobin as a phase stabiliser
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
ES2374320T3 (es) * 2006-08-15 2012-02-15 Basf Se Procedimiento para la producción de preparaciones de hidrofobina secas de flujo libre.
CN101627076B (zh) * 2007-03-06 2012-05-23 巴斯夫欧洲公司 用疏水蛋白改性的开孔泡沫
EP2134901B1 (de) * 2007-03-12 2016-01-06 B.R.A.I.N. Biotechnology Research and Information Network AG Verfahren zur behandlung zellulosischer materialien mit hydrophobinen
KR20100022482A (ko) * 2007-05-24 2010-03-02 바스프 에스이 고체의 결정화에서 보조제로서의 히드로포빈의 용도
RU2491096C9 (ru) * 2007-09-13 2014-02-10 Басф Се Применение гидрофобин-полипептидов в качестве усилителя пенетрации
EP2042155A1 (de) * 2007-09-28 2009-04-01 Basf Se Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen
WO2009101017A1 (de) 2008-02-14 2009-08-20 Basf Se Verwendung von hydrophobinen zur verhinderung der eisbildung auf oberflächen
WO2010092088A2 (de) 2009-02-10 2010-08-19 Basf Se Verwendung von hydrophobin als spreitmittel
JP2012519767A (ja) * 2009-03-09 2012-08-30 ビーエーエスエフ ソシエタス・ヨーロピア 水相増粘用の水溶性ポリマーとハイドロフォビンの相乗性混合物の利用
WO2011101457A1 (en) * 2010-02-18 2011-08-25 B.R.A.I.N. Biotechnology Research And Information Network Ag Chimeric surface active proteins
WO2011157497A1 (en) * 2010-06-17 2011-12-22 Unilever Plc Oral care compositions
WO2012004255A1 (de) * 2010-07-07 2012-01-12 Basf Se Zusammensetzung enthaltend ein hydrophobin und verfahren zum reinigen von hydrophoben oberflächen
CN103003972A (zh) 2010-07-30 2013-03-27 巴斯夫欧洲公司 印刷电子器件中的两亲性蛋白质
WO2012049250A2 (de) 2010-10-13 2012-04-19 Basf Se Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen
CN103502265A (zh) * 2011-04-08 2014-01-08 丹尼斯科美国公司 组合物
AR085845A1 (es) 2011-04-08 2013-10-30 Danisco Us Inc Composiciones
WO2013149801A1 (en) * 2012-04-05 2013-10-10 Basf Plant Science Company Gmbh Fungal resistant plants expressing hydrophobin
WO2014063097A1 (en) 2012-10-19 2014-04-24 Danisco Us Inc. Stabilization of biomimetic membranes
EP2821473B1 (de) * 2013-07-01 2018-03-28 Becker, Bernhard Verfahren zur Reinigung einer Oberfläche und Reinigungskonzentrat zur Verwendung dafür
EP3083936B1 (de) 2013-12-19 2018-07-04 Danisco US Inc. Verwendung von hydrophobinen zur erhöhung des gastransfers in einem aeroben fermentationsprozess
EP3243894A1 (de) * 2016-05-10 2017-11-15 The Procter and Gamble Company Reinigungszusammensetzung
WO2019094913A2 (en) 2017-11-13 2019-05-16 The Procter & Gamble Company Personal care composition
EP3483246A1 (de) 2017-11-13 2019-05-15 The Procter & Gamble Company Reinigungszusammensetzung
CN109400907A (zh) * 2018-10-27 2019-03-01 嘉兴珠韵服装有限公司 糖基化蟹壳蛋白的制备及在棉织物防皱整理中的应用

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19942539A1 (de) * 1999-09-07 2001-03-08 Cognis Deutschland Gmbh Waschmittel
DE19956802A1 (de) * 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002663D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
DE10061280A1 (de) * 2000-12-08 2002-06-13 Novaprot Gmbh Reinigungswirksame, grenzflächenaktive Kombination aus nachwachsenden Rohstoffen mit hoher Fettlösekraft
FR2833490B1 (fr) * 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
DE10342794A1 (de) * 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
CN1909979A (zh) * 2004-01-16 2007-02-07 应用超微系统股份有限公司 在低温下用疏水蛋白涂覆物体的方法
US7241734B2 (en) * 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
WO2006082253A2 (de) * 2005-02-07 2006-08-10 Basf Aktiengesellschaft Verfahren zum beschichten von oberflächen mit hydrophobinen
MX2007012023A (es) * 2005-03-30 2007-11-16 Basf Ag Uso de hidrofobina para tratamiento repelente a suciedad de superficies duras.
ES2345627T3 (es) * 2005-03-30 2010-09-28 Basf Se Uso de hidrofinas para el tratamiento superficial de materiales minerales de construccion endurecidos, piedra natural, piedra artificial y ceramicas.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007014897A1 *

Also Published As

Publication number Publication date
BRPI0614703A2 (pt) 2011-08-23
CN101233220B (zh) 2012-11-21
JP2009503280A (ja) 2009-01-29
JP5105441B2 (ja) 2012-12-26
KR20080041228A (ko) 2008-05-09
ZA200801881B (en) 2009-08-26
WO2007014897A1 (de) 2007-02-08
CN101233220A (zh) 2008-07-30
US20090101167A1 (en) 2009-04-23
CA2617092A1 (en) 2007-02-08
ES2352970T3 (es) 2011-02-24
MX2008001056A (es) 2008-03-19
AU2006274836A1 (en) 2007-02-08
EP1913123B1 (de) 2010-10-20
ATE485359T1 (de) 2010-11-15
DE502006008140D1 (de) 2010-12-02
AU2006274836B2 (en) 2012-02-09

Similar Documents

Publication Publication Date Title
EP1913123B1 (de) Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche
EP1866401B1 (de) Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
WO2006131478A2 (de) Verfahren zur beschichtung von oberflächen von faserigen substraten
EP3638780A1 (de) Microbulbifer thermotolerans lipase und ihre verwendung
EP1848734A2 (de) Verfahren zum beschichten von oberflächen mit hydrophobinen
WO2019243071A1 (de) Xylosecarbamate als schmutzablösevermögende wirkstoffe
WO2019243108A1 (de) Chitosanderivate als schmutzablösevermögende wirkstoffe
EP3810740A1 (de) Pullulanderivate als schmutzablösende wirkstoffe
EP3049508A1 (de) Cellulosecarbamate als schmutzablösevermögende wirkstoffe
EP2836580A1 (de) Mikrofibrilläre cellulose als schmutzablösevermögender wirkstoff
EP3673035A1 (de) Verbesserte pflegeeigenschaften von polyester textilien ii
DE69722647T2 (de) Farbaufhellungsmethoden
EP3083918B1 (de) Siloxangruppen-haltige copolymere als schmutzablösevermögende wirkstoffe
DE102005030786A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005026143A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
EP2977506B1 (de) Siloxangruppen-haltige copolymere als hydrophobierende wirkstoffe zur ausrüstung von texilier materlialien und waschzusammensetzung enthaltend das selbe
DE102022200882A1 (de) Polymere schmutzablösevermögende Wirkstoffe
DE102019218831A1 (de) Verwendung von Copolymeren als elastizitätsverbessernde Wirkstoffe
WO2016146429A1 (de) Polymere ester aromatischer dicarbonsäuren als schmutzablösevermögende wirkstoffe
WO2015155194A1 (de) Glycerinesterderivate als schmutzablösevermögende wirkstoffe
DE102005014844A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080303

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20080728

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

DAX Request for extension of the european patent (deleted)
GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

Free format text: NOT ENGLISH

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

Free format text: LANGUAGE OF EP DOCUMENT: GERMAN

REF Corresponds to:

Ref document number: 502006008140

Country of ref document: DE

Date of ref document: 20101202

Kind code of ref document: P

REG Reference to a national code

Ref country code: NL

Ref legal event code: T3

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Effective date: 20110214

LTIE Lt: invalidation of european patent or patent extension

Effective date: 20101020

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

REG Reference to a national code

Ref country code: IE

Ref legal event code: FD4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110220

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110221

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110120

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20110121

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: IE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

26N No opposition filed

Effective date: 20110721

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20110801

Year of fee payment: 6

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 502006008140

Country of ref document: DE

Effective date: 20110721

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20110731

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20120731

Year of fee payment: 7

Ref country code: SE

Payment date: 20120731

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20120814

Year of fee payment: 7

Ref country code: BE

Payment date: 20120831

Year of fee payment: 7

Ref country code: IT

Payment date: 20120725

Year of fee payment: 7

Ref country code: ES

Payment date: 20120829

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20120727

Year of fee payment: 7

Ref country code: DE

Payment date: 20121001

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 20120726

Year of fee payment: 7

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20101020

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20110727

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20101020

BERE Be: lapsed

Owner name: BASF SE

Effective date: 20130731

REG Reference to a national code

Ref country code: NL

Ref legal event code: V1

Effective date: 20140201

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

REG Reference to a national code

Ref country code: AT

Ref legal event code: MM01

Ref document number: 485359

Country of ref document: AT

Kind code of ref document: T

Effective date: 20130727

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20130727

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

Effective date: 20140331

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20140201

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20140201

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130731

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130727

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130731

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130731

Ref country code: SE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130728

REG Reference to a national code

Ref country code: DE

Ref legal event code: R119

Ref document number: 502006008140

Country of ref document: DE

Effective date: 20140201

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130731

Ref country code: AT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130727

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130727

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20140909

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130728