EP0787147A1 - Compositions et traitement pour la sclerose en plaques - Google Patents

Compositions et traitement pour la sclerose en plaques

Info

Publication number
EP0787147A1
EP0787147A1 EP95941330A EP95941330A EP0787147A1 EP 0787147 A1 EP0787147 A1 EP 0787147A1 EP 95941330 A EP95941330 A EP 95941330A EP 95941330 A EP95941330 A EP 95941330A EP 0787147 A1 EP0787147 A1 EP 0787147A1
Authority
EP
European Patent Office
Prior art keywords
mbp
peptide
multiple sclerosis
composition
group
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95941330A
Other languages
German (de)
English (en)
Inventor
Dawn Smilek
Michael Samson
Malcolm Gefter
Di-Hwei Hsu
Jia-Dong Shi
Xavier Paliard
Brigitte Devaux
Jonathan Rothbard
Henry Franz N
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Immulogic Pharmaceutical Corp
Original Assignee
Immulogic Pharmaceutical Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immulogic Pharmaceutical Corp filed Critical Immulogic Pharmaceutical Corp
Publication of EP0787147A1 publication Critical patent/EP0787147A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/21Interferons [IFN]
    • A61K38/215IFN-beta
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4713Autoimmune diseases, e.g. Insulin-dependent diabetes mellitus, multiple sclerosis, rheumathoid arthritis, systemic lupus erythematosus; Autoantigens

Definitions

  • Autoimmune diseases are a significant human health problem and are relatively poorly understood. As there is no microbial or viral culprit apparently directly responsible, prevention, treatment and diagnosis of such diseases must be based on the etiology of the disease. This invariably involves a complex series of reactions of endogenous metabolic intermediates, structural components, cells and so forth. Implicit however in the nature of an autoimmune condition is the notion that at least one autoantigen must be involved in creating the sequence of events that results in the symptoms. Autoimmune demyelinating diseases such as multiple sclerosis are no exception.
  • MS usually presents in the form of recurrent attacks reflecting lesions within the central nervous system (CNS). Attacks recur, remit and recur, seemingly randomly over many years. The frequency of flare-ups is greatest during the first 3 to 4 years of disease, but a first attack, which may have been so mild as to have escaped medical attention and can barely be recalled, may not be followed by another attack for 10-20 years. The extent of recovery after an episode varies markedly between patients. Remission may be complete, particularly after early attacks; often, however remission is incomplete and as one attack follows another, a stepwise downward progression ensues with increasing permanent deficit.
  • the clinical picture of MS is determined by the location of foci of demyelination within the CNS.
  • a commonly used animal model for human multiple sclerosis is experimental allergic encephalomyelitis (EAE), a demyelinating disease of the central nervous system which can be induced in susceptible strains of mice by immunization with myelin basic protein (MBP), proteolipid protein (PLP), myelin oliogodendrocyte protein (MOG), or synthetic peptides based on the sequences of these myelin associated proteins.
  • MBP myelin basic protein
  • PGP proteolipid protein
  • MOG myelin oliogodendrocyte protein
  • synthetic peptides based on the sequences of these myelin associated proteins.
  • MS multiple sclerosis
  • Proteolipid protein (PLP) and myelin associated glycoprotein (MAG) have also been implicated as possible autoantigens in multiple sclerosis.
  • Studies describing the pathogenesis of the autoimmune response to PLP in multiple sclerosis have been described in Trotter et al., J. Neuroimmunol., 33:55-62 (1991); T cell epitopes of PLP have been described in Pelfrey et al., J. Neuroimmunol., 46:33-42 (1993).
  • Studies describing MAG as a potential autoantigen in multiple sclerosis are described in Johnson et al., J. Neuroimmunol., 13:99-108 (1986).
  • EAE Experimental autoimmune encephalomylitis
  • EAE is a CD4+ T cell-mediated autoimmune disease which resembles multiple sclerosis in some of its clinical and histological features, and serves as an experimental model for this and other autoimmune diseases.
  • EAE is an inflammatory disease of the central nervous system, resulting in paralysis and other neurologic abnormalities. It is typically induced with purified myelin proteins and peptides. Nevertheless, the EAE model has been used extensively to examine mechanisms of autoimmunity, and to investigate potential therapeutics for autoimmune disease.
  • MBP Ac 1-11 is the immunodominant encephalitogenic peptide for each of these strains, and is recognized bound to A ⁇ u A ⁇ u (Wraith, D.C. et al., supra).
  • MBP Ac 1-1 1 has been studied extensively by substitution analysis, and its requirements for T cell recognition and major histocompatibility complex (MHC) binding have been well established. Side chains of residues 3 and 6 contribute mainly to T cell recognition, while those of residues 4 and 5 contribute mainly to MHC binding.
  • Binding of MBP Acl-11 to A ⁇ u A ⁇ u can be dramatically improved by a variety of amino acid substitutions at residue 4, including alanine (Ac 1-1 1[4A]) and tyrosine (Ac 1-11 [4 Y]) (Wraith, D.C. et al., supra, Fairchild, P.J. et al., Int. Immunol., 1993, 5: 1 151).
  • the residue 4 substitutions, especially with tyrosine appear to improve the stability of the peptide-MHC complexes formed with these peptides.
  • Ac 1 - 1 1 [4A] and Ac 1 - 1 1 [4Y] retain the T cell receptor (TCR) contact residues necessary for antigenicity, and are more potent than MBP Ac 1-1 1 in stimulating MBP-specific T cells in vitro.
  • Acl-1 1 [4Y] is also encephalitogenic in vivo (Acl- 1 1 [4A] is poorly encephalitogenic, for unknown reasons). Both Acl-1 1 [4A] and Acl- 1 1 [4Y] have been shown to prevent EAE, and are thought to operate by antigen- specific mechanisms (Smilek, et al, supra, Wraith, D.C. et al., supra).
  • MBP peptides or peptide analogs administered in incomplete adjuvant just prior to disease onset prevented subsequent development of EAE (Smilek, et al, supra, Gaur et al., supra).
  • adoptively transferred EAE was prevented by early and aggressive administration of intravenous MBP prior to the onset of clinical signs (Critchfield, et al. supra).
  • the present invention overcomes the drawbacks described above and provides novel peptides, compositions and methods for treating multiple sclerosis, using preparations comprising at least one peptide having a sequence of amino acid residues which comprises T cell activity of MBP. Further, the present invention addresses the yet unsolved problem that, in order to be generally applicable, treatments for multiple sclerosis using peptides or peptide analogs must be effective even when administered late in the course or at an advanced stage of disease, either during remissions or relapses while the undesirable immune response is ongoing. O 96/12737 PC17US95/13682
  • the present invention provides isolated peptides and combinations of peptides derived from myelin autoantigens such as MBP, MOG, PLP, and MAG suitable for treating multiple sclerosis, including prophylactic and therapeutic compositions and methods for preventing or treating multiple sclerosis.
  • Preferred compositions of the invention comprise at least one isolated, purified peptide, substantially free from all other polypeptides or contaminants, the peptide comprising an amino acid sequence of the myelin autoantigen which has T cell activity.
  • a therapeutic composition of the invention is capable of down regulating the autoantigen specific immune response to the myelin autoantigen in a population of humans suffering from, or susceptible to multiple sclerosis, such that disease symptoms are reduced, eliminated, or reversed and/or the onset or progression of disease symptoms is prevented or slowed. Additionally, compositions and methods of the instant invention when administered in an advanced stage of disease, reverse ongoing paralysis or other signs of disease when administered during the acute phase of disease or prevents relapse when administered during remission.
  • Fig. 1 shows the full length amino acid sequence of human MBP, also indicating the numbering of amino acid residues as referred to herein.
  • Fig. 2 shows the amino acid sequence of preferred peptides derived from
  • Fig. 3 shows the amino acid sequence of overlapping peptides as well as longer peptides used in Example 1.
  • Fig. 4a is a graphic representation of the percent of total MBP response for each peptide shown in Fig. 3. MBP reactivity was calculated based on the percent of MBP positive microtiter cultures in each group of individual patients which also scored positive for one of the MBP peptides. Total MBP positive microtiter cultures ranged from 89-184 in each group of 19-43 patients tested for each peptide.
  • Fig. 4b is a graphic representation of the percent of MBP responders which recognize each peptide shown in Fig. 3. Patients were considered to MBP responders if at least one of their microtiter cultures scored positive for MBP reactivity. There were 12-31 MBP responder patients in each group of 19-43 patients tested for each peptide. Peptide reactivity was calculated based on the percent of MBP responder patients in each group with at least one microtiter culture which scored positive for one of the MBP peptides.
  • Fig. 5a is a graph of mean clinical scores over a period of 0-40 days after disease induction of mice treated with I.V. injections of MBP Acl -1 1 alone compared to a control.
  • Fig. 5b is a graph of mean clinical scores over a period of 0-40 days after disease induction of mice treated with I.V. injections of MBP Ac 1-1 1 combined with MBP 31 -47 compared to a control.
  • Fig. 5c is a graph of mean clinical scores over a period of 0-40 days after disease induction of mice treated with I.V. injections of OVA 323-339 compared to a control.
  • Fig. 6a is a graph of the mean clinical scores over a period of 0 to at least 30 days after disease induction of subjects treated with either 250 nmol injection of Acl- 1 1 [4Y] or Ac 1-1 1 as compared to a control.
  • Fig. 6b is a graph of the mean clinical scores over a period of 0 to at least 30 days after disease induction of mice treated with 2.5 nmol Ac l-1 1 [4Y] as compared to a control.
  • Fig. 6c is a graph of the mean clinical scores over a period of 0 to at least 30 days after disease induction of mice treated with 2.5 nmol Ac 1-1 1 as compared to a control.
  • Fig. 7 is a bar graph showing the mean histological scores of peptide treated mice versus control treated mice where a lower score means a reduced number and severity of inflammatory CNS infiltrates.
  • Fig. 8 is a bar graph representing relative T cell activation at periods of 0-10 hours after mice were injected with 250 nmol. Acl-1 1[4Y].
  • Fig. 9 is a graph showing a comparison of treatment of mice with 250 nmol Acl-1 1 [4Y] versus a control, PBS and OVA 323-337.
  • Fig. 10 is a graph showing a comparison of treatments initiated during remission with 25 nmol Acl-1 1 [4 Y] versus a control.
  • Fig. 1 la is a graph representing in vitro lymph node proliferation (as indicated by 3H-thymidine inco ⁇ oration) of mice receiving I.V. pretreatment with 250 nmoles MBP Acl-1 1 compared to controls.
  • Fig. 1 lb is a bar graph showing relative lymph node IL2 production in response to MBP Acl-1 1 in mice pretreated with Acl-1 1 [4Y] as compared to a control.
  • Fig. 12a is a graphic depiction of an experiment showing the effects of IFN- ⁇ on EAE in two groups of 10 (SJL x TLP) Fj adult female mice in which EAE was induced with guinea pig MBP in complete adjuvant plus pertussis toxin on day 0 and were administered either incomplete Freund's Adjuvant only (control) or were treated with 2000 units of IFN- ⁇ inte ⁇ eritoneally (i.p.) on days 9, 12, 16.
  • Fig. 12b is a graphic depiction of an experiment showing the effects of MBP peptide Ac 1-1 1 in two groups of 10 (SJL x TLP) F ⁇ adult female mice induced with EAE using guinea pig MBP in complete adjuvant plus pertussis toxin on day 0 and were administered either PBS (control) or were treated with 250 nmol Ac 1-1 1 intravenously on days 10, 13, 17, and 21 (indicated by arrows on the x axis), the Y axis represents the average mean clinical score for each group as described for Fig. la.
  • Fig. 12c is a graphic depiction of an experiment showing the effects of MBP peptide Ac 1-1 1 administered in combination with IFN- ⁇ on EAE in two groups of 10 (SJL x TLP) F] adult female mice who were induced EAE in complete adjuvant plus pertussis toxin on day 0 and were administered either PBS (control) or were treated with 250 nmol Ac 1-1 1 intravenously on days 10, 13, 17, and 21 (indicated by open arrows on the x axis), and were treated with 2000 units of IFN- ⁇ inte ⁇ eritoneally (i.p.) on days 9, 12, 16, and 20 (indicated by closed arrows on the x axis), the Y-axis indicates the mean clinical score as discussed for Fig.
  • Fig. 13 is a graphic depiction of an experiment showing the effects of various dose of IFN- ⁇ (10,000 units and 2,000 units respectively) on induced EAE in two groups of 10 (SJL x TLP) Fj adult female mice induced with EAE using guinea pig MBP plus pertussis toxin on day 0 and were administered either PBS (control) or were treated with 10,000 units and 2000 units respectively of IFN- ⁇ inte ⁇ eritoneally (i.p.) on days 9, 13, 16, (indicated by closed arrows on the x axis), the Y-axis indicates the mean clinical score as discussed for Fig. la.
  • Fig. 14 shows various peptides derived from MBP which may be suitable in compositions and methods of the invention.
  • Fig. 15 is a graphic representation of the positivity index (y axis) (the average S.I./MBP responder patient) multiplied the percentage of individuals responding to each peptide (x-axis) which is derived from the same experimental data shown in Figs. 4a and 4b and described in Example 1.
  • the present invention provides isolated peptides and combinations thereof derived from myelin autoantigens useful for treating multiple sclerosis as well as therapeutic compositions and methods for treating multiple sclerosis.
  • treating multiple sclerosis includes: prophylactic treatment of those mammals susceptible to MS; treatment at the initial onset of MS; and treatment of all "advanced stage" MS including relapsing-remitting MS, chronic progressive MS, primary progressive MS and benign MS.
  • Therapeutic compositions of the invention comprise at least one purified peptide, substantially free from all other proteins or contaminants, and comprising a defined sequence of amino acid residues of a myelin antigen having T cell stimulating activity, which peptide may also be an isolated peptide.
  • a "peptide” refers to a defined sequence of amino acid residues which is less than the amino acids of the native protein antigen.
  • a peptide of the invention preferably comprises at least approximately seven amino acid residues in length, and preferably at least about 12-40 amino acid residues in length, and more preferably at least 13-30 amino acid residues in length and which, when derived from a protein antigen, contains less than the amino acids of the entire protein antigen and preferably no more than about 75% of the amino acid residues of the entire protein antigen.
  • T cell activity may possess any one or more of the following characteristics: a) the ability to elicit a T cell response, such as stimulation (i.e. proliferation or lymphokine secretion); b) the ability to cause T cell non responsiveness or reduced T cell responsiveness of appropriate T cell subpopulations such that they do not participate in stimulating an immune response to the offending autoantigen (e.g.
  • c) the ability to modify the lymphokine secretion profile as compared with exposure to the naturally occurring autoantigen; d) the ability to cause induction of T suppressor cells; and e) is capable of causing down regulation of autoimmune disease symptoms by any mechanism; or f) is derived from a bystander antigen and possesses the ability to elicit suppressor T cells at the site of myelin autoimmune attack which in turn results in down regulating the immune responses in the locality of the myelin autoimmune attack.
  • T cell epitope have T cell activity and are capable of eliciting a T cell response such as T cell stimulation (i.e. T cell proliferation or lymphokine secretion) and/or are capable of down regulating the autoantigen specific T cell response which may result in autoantigen specific T cell non-responsiveness or a reduced level of autoantigen specific T cell responsiveness.
  • T cell stimulation i.e. T cell proliferation or lymphokine secretion
  • a T cell epitope is the basic element or smallest unit of recognition by a T cell receptor, where the epitope comprises amino acids essential to receptor recognition. T cell epitopes are believed to be involved in the initiation and pe ⁇ etuation of the immune response to an antigen or autoantigen.
  • T cell epitopes are thought to trigger early immune response events at the level of the T helper cell by binding to an appropriate HLA molecule on the surface of an antigen presenting cell and stimulating the relevant T cell subpopulation. These events lead to T cell proliferation, lymphokine secretion, local inflammatory reactions, recruitment of additional immune cells to the site, and activation of the B cell cascade leading to production of antibodies.
  • the antibodies produced are autoantibodies against an autoantigen such as MBP resulting in the clinical symptoms of an autoimmune disease.
  • Peptides having defined amino acid compositions and which comprise T cell epitopes may be identified for any myelin autoantigen, including MBP.
  • One method includes dividing the protein antigen into non-overlapping, or overlapping peptides of desired lengths and synthesizing, purifying and testing those peptides to determine whether the peptides comprise at least one T cell epitope of MBP using any number of assays (i.e. T cell proliferation assays, lymphokine secretion assays, and T cell non-responsiveness studies).
  • an algorithm is used for predicting those peptides which are likely to comprise T cell epitopes and then synthesizing, purifying and testing the peptides predicted by the algorithm in T cell assays or in vivo studies to determine if such predicted peptides cause T cell proliferation or lymphokine secretion, or T cell non-responsiveness and are therefore likely to O 96/12737 PCIYUS95/13682
  • T cell epitopes As discussed in many of the documents cited above, human T cell activity can be tested by culturing T cells obtained from an individual sensitive to an autoantigen such as MBP with a peptide derived from the antigen and determining whether proliferation of T cells occurs in response to the peptide as measured, e.g., by cellular uptake of tritiated thymidine. Stimulation indices for responses by T cells to peptides can be calculated as the maximum counts per minute (CPM) in response to a peptide divided by the control CPM.
  • a T cell stimulation index (S.I.) equal to or greater than two times, and preferably three times, the background level is considered "positive". Positive results are used in the analysis of a peptides potential therapeutic effectiveness as discussed later herein and in
  • Preferred peptides useful in accordance with this invention comprise at least one T cell epitope and preferably at least two or more T cell epitopes.
  • the general pattern for a peptide known to bind Class II MHC well as reported in the above- mentioned documents appears to contain a linear pattern composed of a charged amino acid residue or glycine followed by two hydrophobic residues. After determining if a peptide conforms to the general pattern, the peptide can then be tested for T cell reactivity.
  • Other algorithms that have been used to predict T cell epitopes of previously undefined proteins include an algorithm reported by Margalit et al, J. Immunol., 138:2213-2229 (1987), which is based on an amphipathic helix model.
  • peptides comprising "cryptic T cell epitopes” may be determined and are also useful in the methods and compositions of the invention.
  • Cryptic T cell epitopes are those determinants in a protein antigen which, due to processing and presentation of the native protein antigen to the appropriate MHC molecule, are not normally revealed to the immune system.
  • a peptide comprising a cryptic T cell epitope is capable of causing T cells to become non-responsive, and when a subject is primed with the peptide, T cells obtained from the subject will proliferate in vitro in response to the peptide or the protein antigen from which the peptide is derived.
  • Peptides which comprise at least one cryptic T cell epitope derived from a protein antigen are referred to herein as "cryptic peptides".
  • a T cell proliferation assay may be used as is known in the art in which antigen primed T cells are cultured in vitro in the presence of each peptide separately to establish peptide-reactive T cell lines.
  • a peptide is considered to comprise at least one cryptic T cell epitope if a T cell line can be established with a given peptide and T cells are capable of proliferation upon challenge with the peptide and the protein antigen from which the peptide is derived.
  • a peptide used in accordance with the method of this invention be derived from the amino acid sequence of the myelin autoantigen such as MBP.
  • Any peptide comprising a defined sequence of amino acid residues and which is capable of down-regulating an antigen specific immune response to the myelin autoantigen may be used in accordance with the method of the present invention.
  • peptides may be synthesized comprising a defined amino acid sequence not based on the myelin antigen amino acid sequence, and yet are capable of down regulating an antigen specific immune response e.g.
  • the peptide mimics a T cell epitope of the myelin autoantigen and causes down regulation of the immune response to the myelin autoantigen, or causes down regulation of the immune response for another reason, such as it is derived from a bystander antigen.
  • bystander antigens which are also tissue specific (but are not the target of immune or autoimmune attack) may possess the ability to elicit suppressor T cells at the site of immune attack which may in turn result in down regulating the immune responses in the locality of the immune attack (e.g. afflicted "self tissue in the case of autoimmune disease or nasal mucosa, skin and lung in the case of allergy).
  • Bystander antigens include but are not limited to portions of the antigen or autoantigen which are not themselves the target of immune attack, and which possess suppressive activity at the site of immune attack.
  • myelin antigen or “myelin autoantigen” includes bystander antigens which may possess suppressive activity at the site of myelin autoimmune attack.
  • any compound that mimics a peptide capable of down regulating an antigen specific immune response to a myelin autoantigen may be used in accordance with the invention (e.g. a peptidomimetic).
  • a compound may not be composed entirely of subunits joined by peptide bonds, but joined by other linkages (e.g. thiolester bonds, reduced bond analogs, amide bond isosterases), providing that the non-peptide compound mimics a peptide capable of down regulating an antigen specific immune response to the antigen of interest as indicated by effective therapeutic/prophylactic treatment of symptoms.
  • Peptidomimetics may be based on any of the peptides of the invention but may include for example, peptide bond analogs (e.g.
  • T-cell epitope-containing peptides have been identified, it is also possible to modify the structure of such peptides for use in accordance with the present invention for such pu ⁇ oses as increasing solubility (particularly desirable if the composition is to be injected), enhancing therapeutic or preventative efficacy (see discussion of peptide analogs having enhanced MHC binding below), or stability (e.g.. shelf life ex vivo, and resistance to proteolytic degradation in vivo) or for ease of peptide synthesis.
  • a modified peptide or peptide analog can be produced in which the amino acid sequence has been altered as compared to the native protein sequence from which it is derived, or as compared to the unmodified peptide from which the modified peptide is to be derived, such as by amino acid substitution, deletion, or addition, in order to modify immunogenicity, improve peptide solubility or increase the ease of peptide synthesis (e.g. automated peptide synthesis).
  • a peptide can be modified so that it at least maintains, if not improves, the ability to down regulate the autoimmune response in MS (e.g. by inducing T cell non-responsiveness or reduced T cell responsiveness) and still retains the ability to bind MHC proteins.
  • critical binding residues for the T cell receptor can be determined using known techniques (e.g., substitution of each residue and determination of the presence or absence of T cell reactivity).
  • Those residues shown to be essential to interact with the T cell receptor can be modified by replacing the essential amino acid with another, preferably similar amino acid residue (a conservative substitution) whose presence is shown to enhance, diminish but not eliminate or not affect T cell activity.
  • those amino acid residues which are not essential for T cell receptor interaction can be modified by being replaced by another amino acid whose inco ⁇ oration may enhance, diminish but not eliminate or not affect T cell activity but does not eliminate binding to relevant MHC.
  • peptides of the invention can be modified by replacing an amino acid shown to be essential to interact with the MHC protein complex with another, preferably similar amino acid residue (conservative substitution) whose presence is shown to enhance, diminish but not eliminate or not affect T cell activity.
  • amino acid residues which are not essential for interaction with the MHC protein complex but which still bind the MHC protein complex can be modified by being replaced by another amino acid whose inco ⁇ oration may enhance, not affect, or diminish but not eliminate T cell reactivity.
  • Preferred amino acid substitutions for non-essential amino acids include, but are not limited to substitutions with alanine, glutamic acid, or a methyl amino acid.
  • WO 94/06828 describes substituted peptides in which essentially every amino acid residue may be substituted with a conservative amino acid, an amino acid not found in nature, or alanine, and yet the substituted peptide is still capable of down regulating an antigen specific immune response.
  • Karin et al. J. Exp. Med. 180:2227-2237 (1994) describe studies using analogs of an immunodominant rat epitope of MBP having the amino acid sequence of 87-99 as shown in Fig. 14.
  • the analogs were a series of 13 substituted peptides based on the 87-99 sequence that differed from the original 87-99 peptide by a single alanine substitution at each position along the 87-99 peptides. These studies were designed to show putative sites where the immunodominant peptide interacts with MHC and TCR in the Lewis rat as well as elucidate modified peptides having improved desired characteristics for potential therapeutic use. These studies showed that substituting the lysine (K) at position 91 of the 87-99 peptide with alanine (A) (see, 87-99[K>A] in Fig. 14) prevented and reversed EAE in Lewis rats.
  • alanine (A) for lysine (K) at the only lysine(K) present in peptides which contain the 87-99 sequence within their amino acid sequences i.e. MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, and MBP-2.6, all as shown in Fig. 2, would also result in increased T cell activity of the substituted peptides.
  • MBP-2.1 substituted with alanine (A) for the lysine (K) at position 10 of the MBP-2.1 peptide i.e.
  • DENPVVHFFANIVTPRTPPPSQGK may have enhanced T cell activity resulting in enhanced therapeutic properties as compared to the "parent" MBP-2.1 peptide.
  • peptides can also be modified to inco ⁇ orate one or more polymo ⁇ hisms in the amino acid sequence of the protein antigen resulting from natural allelic variation.
  • D-amino acids, non- natural amino acids or non-amino acid analogs can be substituted or added to produce a modified protein or peptide within the scope of this invention.
  • peptides of the present invention can be modified using the polyethylene glycol (PEG) method of A. Sehon and co-workers (Wie et al. supra) to produce a protein or peptide conjugated with PEG.
  • PEG polyethylene glycol
  • Modifications of peptides or portions thereof can also include reduction/ alkylation (Tan * in: Methods of Protein Microcharacterization, J.E. Silver ed. Humana Press, Clifton, NJ, pp 155-194 (1986)); acylation (Tarr, supra); chemical coupling to an appropriate carrier (Mishell and Shiigi, eds., Selected Methods in Cellular Immunology, WH Freeman, San Francisco, CA (1980); U.S. Patent 4,939,239; or mild formalin treatment (Marsh International Archives of Allergy and Applied Immunology, 41: 199-215 ( 1971 )).
  • reporter group(s) to the peptide backbone.
  • poly-histidine can be added to a peptide to purify the peptide on immobilized metal ion affinity chromatography (Hochuli, E. et al., Bio/Technology, 6: 1321-1325 (1988)).
  • specific endoprotease cleavage sites can be introduced, if desired, between a reporter group and amino acid sequences of a peptide to facilitate isolation of peptides free of irrelevant sequences.
  • canonical protease sensitive sites can be recombinantly or synthetically engineered between regions, each comprising at least one T cell epitope.
  • charged amino acid pairs such as KK or RR, can be introduced between regions within a peptide during recombinant construction of the peptide.
  • the resulting peptide can be rendered sensitive to cathepsin and/or other trypsin-like enzymes cleavage to generate portions of the peptide containing one or more T cell epitopes.
  • peptides may be modified to increase the solubility of a peptide for use in buffered aqueous solutions such as pharmaceutically acceptable carriers or diluents by adding functional groups to the peptide, terminal portions of the peptide, or by not including hydrophobic regions in the peptides.
  • buffered aqueous solutions such as pharmaceutically acceptable carriers or diluents
  • charged amino acids or charged amino acid pairs or triplets may be added to the carboxy terminus or amino terminus or both, of the peptide.
  • Examples of charged amino acids include arginine (R), lysine (K), histidine (H), glutamic acid (E), and aspartic acid (D).
  • R arginine
  • K lysine
  • H histidine
  • E glutamic acid
  • D aspartic acid
  • the N-terminal or C terminal amino acid of the peptide is capable of cyclization, or may be subject to degradation either during or after peptide synthesis, such amino acids may be deleted, or substituted , or alternatively, one or more additional amino acid may be added to "block" the less desirable amino or carboxy terminal amino acid.
  • Such added amino acids may either be derived from the native protein sequence or may be a non-native amino acid residue.
  • Additional amino acids may be added to either the amino terminus, carboxy terminus or both, of a peptide for the pu ⁇ ose of increasing the peptide's T cell activity as defined above.
  • additional amino acids may be derived from the native protein sequence or be non- native amino acid residues.
  • Peptide compositions administered in accordance with the invention preferably comprise a sufficient percentage of the T cell epitopes of the myelin autoantigen (i.e. at least about 20%, more preferably about 30%, more preferably about 40%, and even more preferably about 60% or greater) of the total T cell reactivity to the myelin autoantigen in a population of individuals who respond to the autoantigen and who have multiple sclerosis (e.g. at least 10 individuals and more preferably at least 20 individuals) are included in the composition such that a therapeutic regimen of administration of the composition to an individual with MS in accordance with the invention, results in down regulation of the MS autoimmune response.
  • a sufficient percentage of the T cell epitopes of the myelin autoantigen i.e. at least about 20%, more preferably about 30%, more preferably about 40%, and even more preferably about 60% or greater
  • the total T cell reactivity to the myelin autoantigen in a population of individuals who respond to the autoantigen and who have multiple sclerosis
  • a peptide (preferred therapeutic candidate peptide) or a combination of candidate peptides are likely to contain a sufficient percentage of the total T cell reactivity of the myelin autoantigen to down regulate the MS autoimmune response in a substantial percentage of a population of individuals with MS, several analytical schemes may be used.
  • T cell epitope-containing peptides are ranked according to the number of MBP microtiter culture lines responding to epitope-containing peptides and according to the number of MS patients responding to them.
  • MBP -specific T cell frequency in the PBL of MS patients can be very low, it is often not possible to test all MBP peptides on every single MS patient. Therefore, the following means for determining the most useful therapeutic peptides is suitable and is further described in Example 1.
  • PBL are isolated from blood and cultures are initiated in 96 well microtiter plates
  • PBLs are purified from fresh peripheral blood specimens (approximately 75 cc) from patients with definite MS using a Ficoll density gradient.
  • Microtiter cultures are initiated with 2 x 10 5 PBL per well and 10 ug/ml purified human spinal cord MBP in RPMI 1640 culture medium supplemented with 5% human AB serum, penicillin-streptomycin, and L-glutamine. Cultures are supplemented with IL2 (20 units/ml) and with IL4 (5 units/ml) beginning at day 6-7. After 1 1-13 days, the microtiter cultures are washed, resuspended in fresh media, and split into 12 fresh microtiter wells. Autologous frozen PBLs are added as antigen presenting cells at 5 x 10 ⁇ PBL per well. Screening antigens are added in duplicate to the 12 replicate wells from each microtiter culture.
  • Media is always used as a negative control, and purified human recombinant MBP at 10 ug/ml is used as a positive control.
  • Each patient is also tested for reactivity with a maximum of 4 MBP peptides, each at a concentration of 10 uM.
  • the 15 assays are pulsed with 0.75 uCi of -- ⁇ -thymidine, and harvested after a 6-16 hour pulse. Cultures are scored as positive for each peptide according to the following criteria: stimulation index greater than 3.0, change in cpm greater than or equal to 500, and standard error of the mean less than the change in CPM.
  • cultures are scored as "peptide-positive" only if they respond to both MBP and to the peptide, and if they did not respond to more than one non- overlapping peptide.
  • Groups of about 10-50 patients are preferably tested with each of the MBP peptides and each group of patients is tested with a maximum of four peptides.
  • the peptides are then ranked in accordance with the following criteria: 1) the percent of MBP positive microtiter cultures in each group of patients (total MBP reactivity) which also scored positive for one of the MBP peptides; 2) the percent of MBP responder individuals in each group with at least one microtiter culture which scored positive for one of the MBP peptides, where an MBP responder individual is defined as a patient with at least one microtiter culture which scored positive for MBP.
  • Individual peptide candidates are then selected if 1) they contain at least 5%, more preferably at least 10%, and most preferably at least 20% of the total MBP reactivity; and 2) reactivity to them is found in at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50% and most preferably at least 60% of the MBP responder individuals.
  • additional criteria for ranking peptides may be considered such as the positivity index for a given peptide.
  • the positivity index represents both the strength of the T cell response to a peptide (S.I.) and the frequency of a T cell response to a peptide in a population of individuals who respond to the myelin autoantigen. For example as shown in Fig.
  • the positivity index of 141-165 is approximately 2500 which was calculated using data described in Example 1 herein.
  • the mean S.I. of peptide MBP-4 per MBP responder patient was multiplied by the percent of individuals responding to MBP-4 in a population of patients responding to MBP.
  • Highly purified peptides substantially free from all other polypeptides and contaminants having a defined sequence of amino acid residues comprising at least one T cell epitope, used in therapeutic compositions of this invention, may be produced synthetically by chemical synthesis using standard techniques.
  • Various methods of chemically synthesizing peptides are known in the art such as solid phase synthesis which has been fully or semi automated on commercially available peptide synthesizers.
  • Synthetically produced peptides may then be purified, preferably to homogeneity, more particularly at least 90%, more preferably at least 95% and even more preferably at least 97% purity, substantially free from all other polypeptides and contaminants using any number of techniques known in the literature for protein purification.
  • Synthetically produced peptides of the invention comprising up to approximately forty-five amino acid residues in length, and most preferably up to approximately thirty amino acid residues in length are particularly desirable as increases in length may result in difficulty in peptide synthesis.
  • Peptides of longer length may be produced by recombinant DNA techniques as discussed below.
  • Peptides useful in the methods of the present invention may also be produced using recombinant DNA techniques in a host cell transformed with a nucleic acid sequence coding for such peptide.
  • host cells transformed with nucleic acid encoding the desired peptide are cultured in a medium suitable for the cells and isolated peptides can be purified from cell culture medium, host cells, or both using techniques known in the art for purifying peptides and proteins including ion-exchange chromatography, ultra filtration, electrophoresis or immunopurification with antibodies specific for the desired peptide.
  • Peptides produced recombinantly may be isolated and purified, preferably to homogeneity, substantially free of cellular material, other polypeptides or culture medium for use in accordance with the methods described above for synthetically produced peptides.
  • peptides may also be produced by chemical or enzymatic cleavage of a highly purified full length or native protein of which the sites of chemical digest or enzymatic cleavage have been predetermined and the resulting digest is reproducible.
  • Peptides having defined amino acid sequences can be highly purified and isolated substantially free of any other polypeptides or contaminants present in the enzymatic or chemical digest by any of the procedures described above for highly purified, and isolated synthetically or recombinantly produced peptides.
  • peptides of the instant invention can be used in conjugates as disclosed, for example, in U.S. Patent 5,130,297 (Sharma et al.) where therapeutic agents are prepared using the formula X--MHC— peptide or MHC-peptide—X wherein X represents a functional moiety selected from a toxin and a labeling group; MHC is an effective portion of the MHC glycoprotein, said glycoprotein dissociated from the cell surface on which it normally resides; and "peptide" represents any of the peptides listed herein, more particularly MBP or MOG, even more particularly peptides shown in Figures 2 and 14. Still further, preferred peptides of the invention comprise at least one T-cell epitope of the full length protein, more particularly MBP or MOG. The peptides may contain tandem repeats of a single epitope and/or more than one epitope.
  • preferred peptides derived from MBP and are candidates for therapeutic use comprise the following peptides: MB P-l, MBP-2, MBP-3, MBP-4 and MBP-5 all as shown in Fig. 2 or any portion thereof or any modification thereof.
  • These peptides were tested for T cell activity as described in Example 1 , and shown to comprise at least one T cell epitope as indicated by proportion of MBP positive microtiter cultures which also scored positive for one of the MBP peptides (Fig. 4a). and the detectable response for each of the preferred peptides in a significant percentage of MBP patients tested (Fig.
  • MBP-4 (141-165) is the most reactive of the four peptides, accounting for 21 % of the total MBP response, and detectable in 64% of the MBP- responder patients tested. MBP-4 su ⁇ risingly showed dramatically more reactivity than the combined reactivities of MBP 141-160 and MBP 151-170 as shown in Fig. 3.
  • the present inventors are the first to identify this immunodominant peptide which appears to comprise multiple T cell epitopes. This novel peptide is particularly preferred for therapeutic use.
  • MBP-2.5, MBP-2.6 and MBP-3.1 as shown in Fig. 2 are also believed to be suitable candidate peptides for therapeutic use.
  • These peptides are modified versions of MBP- 1 , MBP-2, and MBP-3 respectively and are expected to have similar T cell activity as that of their respective "parent" peptides.
  • These peptides have been modified by amino acid deletion, addition or both in accordance with peptide modification techniques as described above, mainly for the pu ⁇ ose of ease of peptide synthesis.
  • Other peptides which have been shown to be immunodominant i.e.
  • Such peptides may also be suitable for therapeutic use in compositions and methods of this invention, particularly when combined with the preferred peptide candidates described above.
  • Such peptides include but are not limited to, all or a portion of the following peptides having residue numbers which correspond to the amino acid residues of human MBP protein shown in Fig. 1 and having individual amino acid sequences which are shown in Fig.
  • peptides even more preferably comprise the following peptides: 13-25, 87-99, 87-99 [91K>A], 82- 100, 82-100 [100P>Y], all as shown in Fig. 14.
  • Preferred portions of these peptides or preferred modifications would preferably have similar or greater T cell activity in the same or greater percentage of patients tested and/or have similar or greater therapeutic effectiveness in the methods of the invention as that of the "parent" peptide from which the modified peptide was derived.
  • One aspect of the present invention provides therapeutic compositions comprising at least one peptide derived from a myelin antigen having T cell activity, or a combination of peptides derived from a myelin antigen, each peptide having T cell activity, and a pharmaceutically acceptable carrier or diluent.
  • Preferred therapeutic compositions comprise a sufficient percentage of the T cell activity of the myelin autoantigen such when administered to an MS patient in a therapeutic regimen, preferably in a non-immunogenic form, are capable of down regulating the myelin autoantigen specific immune response in a population of humans subject to such antigen specific immune response.
  • downstream regulation includes, but is not limited to, preventing initial onset of disease symptoms, reducing the disease symptoms of multiple sclerosis caused by the antigen specific immune response to MBP or other myelin autoantigen, more particularly, reduction, reversal, non- progression or alleviation of symptoms.
  • Non-progression may be characterized by, but is not limited to (a) shorter periods of active disease or exacerbation, (b) less severe symptoms or disability, (c) delay in disease progression wherein the baseline health does not go down as quickly, (d) extension or elongation of the lengths of time between periods of active disease or exacerbation (e.g.
  • EDSS Expanded Disability Status Scale
  • Neurological Rating Scale are other assessment tools used by those skilled in the relevant art.
  • “advanced stage” is any point beyond clear clinical signs of overt disease whether the disease is relapsing-remitting MS, chronic progressive MS, benign MS or primary progressive MS. Further to this definition, “advanced stage” may comprise acute phase(s), remission(s) and exacerbation(s).
  • acute phase shall mean ongoing attack, acute disease, active disease, and exacerbation and are used interchangeably. As they are used herein, these terms generally refer to the state where the subject suffering from the disease (whether diagnosed or not) presents with active symptoms or signs commonly understood by those skilled in the art as associated with the specific immune response characteristic of multiple sclerosis.
  • a "relapse” is understood to mean an acute phase which follows a remission.
  • exacerbation if used in the appropriate in context, can also be inte ⁇ reted to mean new and worsening symptoms or signs.
  • Symptoms are those indicia of disease of which the patient complains.
  • Signs are those indicia observed or measured by the diagnostician. However, the terms symptoms and signs shall be used interchangeably unless otherwise indicated.
  • compositions of the invention preferably comprise at least one T cell epitope-containing peptide or modified peptide or peptide analog and a pharmaceutically acceptable carrier or diluent.
  • Such compositions may preferably comprise a MBP peptide selected from the following group of peptides: MBP- 1 , MBP- 1.1, MBP- 1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4 and MBP-5, more preferably an MBP peptide is selected from MBP-1.1 , MBP-2.1, MBP-4 and MBP-5, and even more preferably an MBP peptide is MBP-4.
  • compositions of the invention may comprise at least two peptides (e.g. a physical mixture of at least two peptides), each peptide having T cell activity and preferably comprising at least one T cell epitope of a myelin autoantigen such as MBP.
  • Such compositions can be administered in the form of a therapeutic composition with a pharmaceutically acceptable carrier or diluent.
  • a therapeutically effective amount of one or more of such compositions can be administered simultaneously or sequentially to an individual suffering from MS.
  • compositions comprise at least one and preferably comprise at least two peptides selected from the following group of peptides: MBP- 1 , MBP- 1.1, MBP- 1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, and MBP-5 all as shown in Fig 2, and even more preferably are selected from the following group of peptides: MBP- 1.1, MBP- 1.2, MBP-2.1 , MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3.1, MBP-4, and MBP-5 and most preferably is selected from the following group of peptides: MBP- 1.1, MBP-2.1 , MBP-4 and MBP-5.
  • compositions of the invention may further comprise peptides derived from MBP having residue numbers which correspond to the amino acid residues of the human MBP protein shown in Fig. 1 and have individual amino acid sequences as shown in Fig. 14: 13-25, 31-50, 61-80, 82-92, 82-96, 82-97, 82-98, 82-
  • compositions of the invention comprise at least two peptides wherein at least one peptide is MBP-4 and at least one peptide is selected from the following group of peptides: MBP-1 ,
  • MBP-2.6, MBP-3, MBP-3.1 , and MBP-5 all as shown in Fig. 2, and may further comprise at least one of the following peptides derived from MBP as shown in Fig.
  • compositions of the invention comprise the following peptides:
  • MBP-1 MBP-2, MBP-4, and MBP-5;
  • MBP-1 MBP-2.1 , and MBP-4
  • MBP- 1.1 MBP-2, and MBP-4;
  • MBP-1 a peptide selected from the group consisting of: MBP-2, MBP-2.1 ,
  • MBP-4 and a selected from the group consisting of: MBP-2, MBP-2.1, MBP-2.2,
  • MBP-4 and a peptide selected from the group consisting of: MBP- 1 , or MBP- 1.1 ; MBP- 1.1, MBP-4, and a peptide selected from the group consisting of: 82- 100, 82-
  • MBP-1.1, and MBP-4 100 [100P>Y], 87-99, and 87-99 [91K>A], all as shown in Fig. 14; MBP-1.1, and MBP-4, and a peptide selected from the group consisting of: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig. 2.
  • 87-99, and 87-99 [91K>A] all as shown in Fig. 14;.
  • the present invention also contemplates a treatment regimen comprising administering combinations of therapeutically effective peptides as a single treatment episode.
  • Such combinations of peptides may be administered simultaneously or sequentially as therapeutic compositions comprising only one peptide or comprising several peptides.
  • Such a treatment regimen may not necessarily be a physical mixture of more than one peptide, but does comprise a combination of peptides administered simultaneously or sequentially as a single treatment episode.
  • Preferred combinations of peptides in the form of one or more compositions each comprising one or more peptides which can be administered simultaneously or sequentially as a single treatment episode include the following combinations of peptides:
  • MBP-1 MBP-2, MBP-3, and MBP-4, and MBP-5;
  • MBP-1, MBP-2.1, and MBP-4 MBP-1, MBP-2.1, and MBP-4; MBP- 1.1, MBP-2, and MBP-4;
  • MBP-1 and a peptide selected from the group consisting of: MBP-2, MBP-2.1,
  • MBP-4 and a peptide selected from the group consisting of: MBP- 1 , or MBP- 1.1; MBP-1.1, MBP-4, and a peptide selected from the group consisting of: 82-100, 82- 100 [100P>Y], 87-99, and 87-99 [91K>A], all as shown in Fig.14;
  • MBP-1.1, and MBP-4 and a peptide selected from the group consisting of: MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig.2.
  • MBP-1.1, MBP-5, MBP-4 and a peptide selected from the group consisting of: 82- 100, 82-100 [100P>Y], 87-99, and 87-99 [91K>A], all as shown in Fig.14; MBP- 1.1, MBP-5, MBP-4, and a peptide selected from the group consisting of MBP- 2.2, MBP-2.3, MBP-2.4, MBP-2.5. or MBP-2.6, all as shown in Fig.2.
  • compositions and preferred combinations of MBP peptides which can be administered simultaneously and/or sequentially may include any of the above compositions and combinations and in addition, may also comprise at least one T cell epitope-containing peptide derived from myelin oligodendrocyte protein (MOG), another protein which is believed to be one of the autoantigens involved in multiple sclerosis (see, Lebar, et al., J. Immunol. (1976) 116:1439-1446; Lebar et al., J.Exp. Immunol (1986) 66:423-443; Linington and Lassman, Neuroimmunol. (1987) 17:61-69; Lassman et al., Acta Neuorpathol.
  • MOG myelin oligodendrocyte protein
  • the present invention further contemplates modifications or analogs (discussed earlier) of the above T cell epitope-containing MOG peptides which retain similar or greater T cell activity as the parent peptide from which the modification or analog is derived. It is believed that compositions comprising T cell epitope-containing peptides of both MOG and MBP, modifications thereof, analogs thereof, or peptidomimetics based thereon, and combinations of such peptides which can be administered simultaneously or sequentially have the advantage of maximizing the down-regulating effect on both MBP and MOG specific T cells participating in the autoimmune response in MS.
  • T cell epitope containing peptides derived from other myelin antigens believed to be autoantigens in MS may also be suitable in compositions and methods of the invention.
  • PLP proteolipid protein
  • MAG myelin associated glycoprotein
  • a therapeutic/prophylactic treatment regimen in accordance with the invention (which results in reversal of , prevention of, or delay in, the onset of disease symptoms caused by an offending autoantigen or results in reduction, non- progression, or alleviation of symptoms caused by an offending autoantigen i.e. down regulation of an autoantigen specific immune response) comprises administration, in non-immunogenic form of a therapeutic composition of the invention comprising at least one isolated peptide derived from an autoantigen responsible for the disease condition being treated (e.g. MBP, MOG, PLP, MAG).
  • an autoantigen responsible for the disease condition being treated e.g. MBP, MOG, PLP, MAG
  • administration of a therapeutic composition of the invention may: a) cause T cell non responsiveness of appropriate T cell subpopulations such that they become unresponsive to the offending antigen and do not participate in stimulating an immune response upon exposure to the offending protein antigen (e.g.
  • T cell subpopulations which normally participate in the response to the offending antigen may be drawn away from the sites of normal exposure towards the sites of administration of the composition (this redistribution of T cell subpopulations may ameliorate or reduce the ability of an individual's immune system to stimulate the usual immune response at the site of normal exposure to the offending antigen, resulting in diminution or reversal in symptoms); d) cause induction of T suppressor cells or e) cause induction of suppressor cells via a bystander antigen.
  • Highly purified and isolated peptides produced as discussed above may be formulated into therapeutic compositions of the invention suitable for human therapy.
  • a therapeutic composition of the invention is to be administered by injection (e.g. subcutaneous injection, intravenous injection)
  • the highly purified peptide be soluble in an aqueous solution at a pharmaceutically acceptable pH (i.e. pH range of about 4-9) such that the composition is fluid and easy syringability exists.
  • the composition also preferably includes a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes any and all excipients, solvents, dispersion media, coatings, antibacterial and antifungal agents, toxicity agents, buffering agents, abso ⁇ tion delaying or enhancing agents, surfactants, and micelle forming agents, lipids, liposomes, and liquid complex forming agents, stabilizing agents, and the like.
  • the use of such media and agents for pharmaceutically active substance is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated. Supplementary active compounds can also be inco ⁇ orated into the compositions.
  • compositions of the invention suitable for injectable use are preferably sterile aqueous solutions prepared by inco ⁇ orating active compound (i.e., one or more highly purified and isolated peptides as described above) in the required amount in an appropriate vehicle with one or a combination of ingredients enumerated above and below, as required, followed by filtered sterilization.
  • active compound i.e., one or more highly purified and isolated peptides as described above
  • Preferred pharmaceutically acceptable carriers include at least one excipient such as sterile water, sodium phosphate, mannitol, sorbitol, or sodium chloride or any combination thereof.
  • compositions which may be suitable include solvents or dispersion medium containing, for example, water, ethanol, polyol (for example glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • solvents or dispersion medium containing, for example, water, ethanol, polyol (for example glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained for example by the use of coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thirmerosol and the like.
  • Prolonged abso ⁇ tion of the injectable compositions can be brought about by including in the composition, an agent which
  • Preferable therapeutic compositions of the invention should be sterile, stable under conditions of manufacture, storage, distribution and use and should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • a preferred means for manufacturing a therapeutic composition which maintains the integrity of the composition is to prepare the formulation of peptide and pharmaceutically acceptable carrier(s) such that the composition may be in the form of a lyophilized powder which is reconstituted in a pharmaceutically acceptable carrier, such as sterile water, just prior to use.
  • a pharmaceutically acceptable carrier such as sterile water
  • the preferred methods of preparation are vacuum drying, freeze-drying or spin drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • a therapeutic composition of the invention may comprise more than one isolated peptide.
  • a therapeutic composition comprising a multipeptide formulation suitable for pharmaceutical administration to humans may be desirable for administration of several active peptides.
  • the multipeptide formulation includes at least two or more isolated peptides having a defined amino acid sequence and is capable of down regulating an antigen specific immune response. Any of the compositions described earlier which comprise at least two peptides may be suitable as a multipeptide formulation.
  • highly preferred peptides suitable for use in a multipeptide formulation include at least two of the following peptides: MBP-1, MBP-1.1, MBP- 1.2, MBP-2, MBP-2.1, MBP-2.2, MBP-2.3, MBP-2.4, MBP- 2.5, MBP-2.6, MBP-3, MBP-3.1 MBP-4 and MBP-5.
  • Special considerations when preparing a multipeptide formulation include maintaining the solubility, and stability of all peptides in the formulation in an aqueous solution at a physiologically acceptable pH. This requires choosing one or more pharmaceutically acceptable solvents and excipients which are compatible with all the peptides in the multipeptide formulation.
  • suitable excipients include sterile water, sodium phosphate, mannitol or both sodium phosphate and mannitol.
  • An additional consideration in a multipeptide formulation is the prevention of dimerization of the peptides if necessary.
  • Administration of the therapeutic compositions as described above to an individual, in a non-immunogenic form can be carried out using known procedures at dosages and for periods of time effective to cause down regulation of the MBP antigen specific immune response of the individual being treated for MS.
  • Down regulation of an antigen specific immune response to an antigen associated with a disease condition in humans may be determined clinically whenever possible, or may be determined subjectively (i.e. the patient feels as if some or all of the symptoms related to the disease condition being treated have been alleviated).
  • Effective amounts of the therapeutic compositions of the invention may vary according to factors such as the degree of sensitivity of the individual to the antigen, the age, sex, and weight of the individual, and the ability of peptide to cause down regulation of the antigen specific immune response in the individual.
  • a therapeutic composition of the invention may be administered in non-immunogenic form, in a convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, sublingual, inhalation, transdermal application, rectal administration, or any combination of routes of administration designed to enhance therapeutic effectiveness, or any other route of administration known in the art for administering therapeutic agents. It may be desirable to administer simultaneously or sequentially a therapeutically effective amount of one or more of the therapeutic compositions of the invention to an individual.
  • Each of such compositions for administration simultaneously or sequentially may comprise only one peptide or may comprise a multipeptide formulation as described above.
  • a peptide composition may be co-administered with enzyme inhibitors or in liposomes.
  • Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol.
  • Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., (1984) J. Neuroimmunol. 7:27).
  • the peptide may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
  • the peptide composition and other ingredients may also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or inco ⁇ orated directly into the individual's diet.
  • the active compound may be inco ⁇ orated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations should contain at least 1% by weight of active compound.
  • compositions and preparations may, of course, be varied and may conveniently be between about 5 to 80% of the weight of the unit.
  • the amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit contains between from about 10 ⁇ g to about 200 mg of active compound.
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring.
  • a binder such as gum gragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservative, a dye and flavoring such as cherry or orange flavor.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compound may be inco ⁇ orated into sustained-release preparations and formulations.
  • compositions of the invention preferably about 1 ⁇ g- 3 mg and more preferably from about 20 ⁇ g-1.5 mg, and even more preferably about 50 ⁇ g- 750 ⁇ g, and even more preferably about 75 ⁇ g to about 750 ⁇ g, of each active component (peptide) per dosage unit may be administered.
  • doses as high as 1500 ⁇ g or more may be used. It is especially advantageous to formulate parenteral compositions in unit dosage form for ease of administration and uniformity of dosage.
  • Unit dosage form refers to physically discrete units suited as unitary dosages for human subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the desired pharmaceutical carrier.
  • the specification for the novel unit dosage forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of human subjects. Dosage regimen may be adjusted to provide the optimum prophylactic or therapeutic response. For example, several divided doses may be administered over the course of days, weeks, months or years, or the dose may be proportionally increased or reduced with each subsequent injection as indicated by the exigencies of the therapeutic situation.
  • subcutaneous injections of therapeutic compositions are given once a day during an acute phase and once every other day during remission for the lifetime of the individual suffering from the disease.
  • Alternatives would include, weekly, monthly or other periodic injections.
  • the dosage may remain constant for each injection or may increase or decrease with each subsequent injection.
  • a continual, lifetime treatment program may be most desirable.
  • a booster injection may be administered at intervals of about three months to about one year after an initial treatment period and may involve only a single injection or may involve another series of injections similar to that of the initial treatment. Because of the highly individual immune system response of individuals suffering from either relapsing remitting MS, primary progressive MS, benign MS, and chronic progressive MS, careful and varied dosage regimens will need to be developed.
  • an intake evaluation of the presenting patient must be completed.
  • a complete exam is conducted looking for, among other things, impaired vision. nystagamus, dysarthria, decreased perception of vibration and position sense, ataxia and intention tremor, weakness or paralysis of one or more limbs, spasticity and bladder problems.
  • accepted tools such as EDSS, Neurological Rating Scale or other similar tools known in the art as well as the previously discussed indicia of disease state to determine a baseline from which any change, including disability progression, but preferably down regulation, could be measured.
  • the frequency of flare-ups or acute stages is greatest during the first 3 to 4 years of disease, but a first attack, may not be followed by another observable attack for 10 to 20 years (although lesion load detectable only by MRI might give a different clinical picture) .
  • a first attack may not be followed by another observable attack for 10 to 20 years (although lesion load detectable only by MRI might give a different clinical picture) .
  • symptoms worsen over a period of a few days to 2 to 3 weeks and then remit.
  • Recovery is usually rapid over a period of weeks, although at times it may extend over several months.
  • MS is a chronic disease and continual therapy is contemplated. On going, long term treatment may be the most effective treatment to stem the progression of disease and disability. A dosage regimen of every other day, at least once a week or once a month may be appropriate. Reasonable modifications are within the abilities of one skilled in the art. Intervention at onset of an attack is considered an important component in effective treatment.
  • the severity of attack must evaluated.
  • An initial injection may be given at the onset of the acute stage.
  • the obvious benefit would be to initiate treatment as early into the acute phase as possible. If desired, this therapy could be combined with simultaneous treatment with ⁇ - interferon, steroids and/or other therapies especially those designed to decrease inflammation.
  • the patient would be observed daily after the first treatment, preferably by injection. It is suggested that additional treatments be given every day, or at least every third day during the acute phase.
  • the treating physician should modify the dosage based upon clinical changes which indicate the need for modification. Any such discretion is within the scope of those skilled in the art using the suggested dosage schedule and amounts as guidelines.
  • compositions comprising at least one peptide having T cell activity and derived from a myelin autoantigen is suitable for treating advanced stage MS.
  • Compositions of MBP peptides, MOG peptides and combinations thereof described earlier are suitable for treating advanced stage MS.
  • these peptides include but are not limited to: MBP- 1 , MBP- 1.1, MBP- 1.2, MBP-2, MBP-2.1 , MBP-2.2, MBP-2.3, MBP-2.4, MBP-2.5, MBP-2.6, MBP-3, MBP-3.1, MBP-4, MBP-5, 13-25, 31-50, 61- 80, 82-92, 82-96, 82-97, 82-98, 82-100, 82-100 [100P>Y], 83-100, 83-101, 84-97, 84- 100, 85-100, 86-105, 87-99, 87-99 [91K>A], 88-100, 88-99, 1 1 1,-135, 122-140, 139- 170, 141-160, 142-166, 142-168, 146-160, and 153-170, and preferably MBP-1.1 , MBP-2.1, MBP-4, MBP-5, 13-25, 87-99,
  • the present inventors have are the first to make the su ⁇ sing discovery that intervention in the midst of an ongoing attack, actually improves the condition of a subject treated accordingly to the method of the instant invention. At a minimum, such intervention does not worsen the condition of the subject. Further, applicants show that intervention during remission down regulates the immune response and the condition does not become activated as a result of any such intervention. Thus, not only may the intervention cause improvement but appears to be entirely safe when administered according to the method of the instant invention. Using the EAE model as described above, applicants demonstrate that repeated intravenous administration of the immunodominant MBP peptide Acl-11 successfully treats EAE induced with the entire MBP protein.
  • suitable modified peptides may be identified by comparing binding affinities of the modified peptide with the native peptide.
  • a modified peptide which has a binding affinity lower than the native peptide would be a suitable candidate peptide for a therapeutic composition of the instant invention.
  • Assays for determining binding affinities can be identified according to the teachings of U.S.S.N.08/300,811 filed September 1, 1994 inco ⁇ orated herein by reference.
  • Acl-11 therapy was found to be successful.
  • Ac 1 - 11 therapy was then compared to therapy with Ac 1 - 11 [4 Y], an Ac 1 - 11 analog which binds to A ⁇ u A ⁇ u with higher affinity and greater stability (Wraith, D.C. et al., supra and Fairchild, P.J. et al. supra).
  • Acl-11 [4 Y] is effective at a 100-fold lower dose than Acl-11, and that its therapeutic effect is longer lasting indicating that selected modified peptides would be also suitable in a therapeutic composition .
  • applicants show that the particular peptide tested Acl-1 1 [4 Y] forms stable peptide-MHC complexes in vivo in the treated mice.
  • modified peptides which form stable peptide-MHC complexes in vivo are highly likely to be suitable peptides in the treatment of humans as their potency may be greatly increase with conservative amino acid substitutions (see also, Karin et al., J. Exp. Med., 180:2227-2237 (1994)).
  • MBP peptide analog Acl-11 [4Y] reversed ongoing paralysis when administered during the acute phase of EAE, and that it prevented relapses when administered during remission. This indicates that selected modified peptides and selected peptide analogs may reverse active symptoms and prevent relapses in humans suffering from MS.
  • mice When only one of the 13 mice showed minimal signs of disease, i.e., one mouse had a clinical score of 1 (see Example 2 for a discussion of clinical scoring. in mice), seven of the mice were injected intraperitoneally with MBP peptide mixture. The remaining six mice, one of which was the animal showing the signs of disease received no additional treatment. In this case, for those mice without clinical symptoms of disease, Gaur et al. is unable to draw any meaningful conclusion about their data. The presence of a low clinical score of 1 in one mouse cannot be inte ⁇ ieted to indicate active disease in any of the other mice. Accordingly, Gaur et al. discloses treatment before onset of the disease, and most definitely, before clinical signs of disease.
  • FIG 9 shows that therapy of ongoing EAE with Acl-1 1 [4 Y] leads to dramatic improvement in disease scores apparent within 48 hours of the initial injection of peptide. EAE nearly totally resolved in these treated mice by the fourth day after onset, and the effect of an 18 day course of peptide therapy was prolonged. In still another su ⁇ rising development, applicants discovered that intravenous peptide therapy initiated during the remission phase of EAE prevents relapses.
  • (PLJ x SJL)F1 mice develop relapsing EAE upon immunization with MBP (Fritz, R.B., et al., J. Immunol, 1983, 130: 1024).
  • EAE usually develops between 9 and 16 days following immunization, and the acute phase of disease in this model lasts from approximately 3 to 20 days. Twenty percent or more of the mice may die or become moribund during the acute phase, depending on disease severity in the experiment. Most of the acute phase survivors then enter a brief remission phase, displaying mild or no clinical signs of disease for several days. In some experiments, mice all enter the remission phase at about the same time (illustrated in Figure 5), but in most cases the length of the acute phase of disease is more variable. The remission phase is followed by a first relapse phase, which is generally equal in severity to the acute phase of disease. Subsequently, surviving mice develop residual chronic paralysis, which persists until termination of the experiment.
  • mice were followed throughout their initial episodes of paralysis which lasted from 3-19 days. As surviving mice entered the remission period individually (defined as a reduction in clinical score to 1 or 0 for at least two days), they were alternately assigned to two groups and intravenous therapy was initiated with 25 nmoles of Acl-11[4Y] or with the control PBS. Mice were treated individually beginning on their second day of remission.
  • Figure 10 shows that intravenous treatment with Acl-1 1 [4Y] beginning during the remission phase of EAE dramatically reduced the incidence and severity of relapse, and indicates that intravenous peptide therapy can be effective even when initiated late in the disease course.
  • Intravenous pretreatment with the immunodominant MBP peptide Acl-1 1 without adjuvant prior to immunization reduces the subsequent in vitro proliferative T cell response to MBP Acl-1 1. Similar results were obtained when mice were pretreated with intravenous injections of the MBP peptide analog Acl-1 1 [4Y] (data not shown). Moreover, lymph node IL2 production in response to MBP Acl-1 1 was prevented by intravenous pretreatment with Acl-1 1 [4Y] ( Figure l ib). The results confirm that intravenous pretreatment with MBP Ac 1-1 1 or Acl-1 1 [4Y] induces T cell non-responsiveness to MBP Acl-1 1.
  • the present inventors theorized that one criteria for the best peptide candidates would be those with T cell reactivity and higher MHC binding affinity than the native peptide which form stable complexes with class II MHC in vivo.
  • the MBP peptide analog which forms stable complexes with class II MHC in vivo is more effective than Acl - 1 1 in treating EAE. It has been shown previously that the MBP peptide analog Ac 1- 1 1 [4Y] binds to A ⁇ u A ⁇ u with a higher affinity, and that complexes formed in vitro between Ac 1 - 1 1 [4Y] and A ⁇ u A ⁇ u are more stable than those formed between Ac 1 - 1 1 and A ⁇ u A ⁇ u .
  • Acl-1 1 [4Y] also has been shown to prevent EAE when a large dose is inhaled prior to immunization (Metzler, B. et al., supra).
  • the instant invention discloses that a modified MBP peptide analog Acl-1 1 [4Y] is at least 100-fold more potent as a therapeutic agent than MBP Acl-1 1, and requires a less frequent dosing schedule. This increased potency results in a therapeutic which is both more practical and more efficacious.
  • Applicants have observed that intravenous administration of Ac 1 - 1 1 [4 Y] (but not Ac 1 - 1 1 ) results in the formation of stable peptide-MHC complexes in vivo.
  • the improved potency of Acl-1 1 [4Y] is believed to be related this formation of stable peptide-MHC complexes. These complexes are detectable on spleen cells using an MBP Acl-1 1 -specific hybridoma for up to ten hours after injection. Accordingly, it is believed that formation of stable peptide-MHC complexes may be one of the hallmarks of such a potent therapeutic peptide.
  • the present invention further provides methods for treating multiple sclerosis comprising administering a therapeutically effective amount of at least one peptide of MBP having T cell activity in a treatment regimen which includes a therapeutically effective amount of IFN- ⁇ .
  • a combination of at least one peptide having T cell activity derived from a myelin antigens (e.g. MBP), and IFN- ⁇ when administered in a therapeutic regimen, has a synergistic effect (Fig. 12c) which su ⁇ risingly diminishes the clinical symptoms of EAE in mice to a far greater extent than the effect of each on mitigating the symptoms of EAE when administered alone (Figs. 12a-b), and which is greater than what one would expect for a merely additive effect of the peptide plus IFN- ⁇ .
  • EAE serves as a mouse model of human MS and is induced by various myelin antigens (e.g.
  • the present invention provides a method of treating individuals who have multiple sclerosis or are susceptible to developing multiple sclerosis, which comprises administering an effective amount of a composition of the invention comprising at least one peptide having T cell activity derived from a myelin antigen preferably in non-immunogenic form, in a therapeutic regimen which also includes the administration of IFN- ⁇ .
  • a composition of the invention comprising at least one peptide having T cell activity derived from a myelin antigen preferably in non-immunogenic form, in a therapeutic regimen which also includes the administration of IFN- ⁇ .
  • Preferred compositions include those compositions of the invention discussed earlier comprising MBP peptides as well as MBP peptides combined with MOG peptides, in conjunction with simultaneously or sequentially administered IFN- ⁇ .
  • composition of the invention comprising at least one peptide having T cell activity of a myelin antigen in a therapeutic regimen which includes administration of IFN- ⁇
  • administration of IFN- ⁇ can be carried out using known procedures at dosages and for periods of time to effectively reduce, eliminate or prevent the symptoms associates with multiple sclerosis.
  • Effective amounts of either peptide or IFN- ⁇ when administered together in a therapeutic regimen vary according to factors discussed above.
  • the active compounds e.g. the MBP peptide or composition thereof and EFN- ⁇
  • may be administered in a convenient manner such as by injection (subcutaneous), intravenous etc.), oral administration, inhalation, transdermal application or rectal administration as discussed above.
  • peptide derived from a myelin antigen per dosage unit may be administered by injection.
  • a dosage unit of 100-10,000 units of IFN- ⁇ may be administered by injection.
  • the dosage regimen of these two compounds may be adjusted to provide the optimum therapeutic response.
  • IFN- ⁇ and a composition of the invention may be administered simultaneously or may preferably be administered at least six hours apart, preferably at least 12 hours apart, or more preferably at least 24 hours apart.
  • the therapeutic regimen of administering both antigenic peptide and IFN- ⁇ may continue over a period of days or weeks and may be reduced or extended as indicated by the exigencies of the therapeutic situation as discussed above.
  • the present invention also provides a novel composition
  • a novel composition comprising a physical mixture of a peptide having T cell activity derived from a myelin antigen such as MBP or MOG and IFN- ⁇ in a pharmaceutically acceptable carrier or diluent.
  • This composition may be used as part of a therapeutic regimen for treating or preventing multiple sclerosis in an individual.
  • T cell mediated autoimmune diseases such as Type I diabetes and rheumatoid arthritis are generally accepted as being the result of an antigen specific T cell mediated response against an autoantigen.
  • Various approaches to treating T cell mediated autoimmune diseases include administration of whole autoantigens or T cell epitope- containing peptides derived therefrom to the patient for the pu ⁇ ose of down regulating the T cell mediated response responsible for the adverse symptoms of the autoimmune disease
  • autoantigens In addition to myelin autoantigens which play a role in MS, a number of antigens (i.e. autoantigens) have been found to cause disease symptoms in other autoimmune diseases such as diabetes, Graves disease, myasthenia gravis, Good
  • Pasture's syndrome, psoriasis, thyroiditis, and rheumatoid arthritis e.g. autoantigens such as insulin; rh factor; acetylcholine receptors; thyroid cell receptors; basement membrane proteins; thyroid proteins; ICA-69 (PM-1 ); glutamic acid decarboxylase (64K or 65 K); proteolipid, Collagen (Type II), Heat Shock Protein and carboxypeptidase H).
  • autoantigens such as insulin; rh factor; acetylcholine receptors; thyroid cell receptors; basement membrane proteins; thyroid proteins; ICA-69 (PM-1 ); glutamic acid decarboxylase (64K or 65 K); proteolipid, Collagen (Type II), Heat Shock Protein and carboxypeptidase H).
  • compositions and methods similar to those described herein may be used to treat autoimmune diseases such as rheumatoid arthritis, diabetes, myasthenia gravis, Grave's disease, Good Pasture's syndrome, psoriasis, and thyroiditis, wherein the antigen responsible for the disease is a protein autoantigen.
  • autoimmune diseases such as rheumatoid arthritis, diabetes, myasthenia gravis, Grave's disease, Good Pasture's syndrome, psoriasis, and thyroiditis
  • the antigen responsible for the disease is a protein autoantigen.
  • Peptides comprising defined sequences of amino acid residues having T cell activity and preferably comprising at least one T cell epitope and/or which induce T cell nonresponsiveness or reduced T cell responsiveness, have been identified and isolated for many of the above named autoantigens.
  • peptides which are believed to be able to down regulate the antigen specific response to soluble Type II collagen, a protein antigen believed to be an autoantigen in rheumatoid arthritis have been identified in WO 94/07520.
  • WO 92/06704 describes methods for identifying peptides of insulin which are believed to comprise T cell epitopes and which may be useful in compositions and the methods analogous to the those of the of the present invention to treat Type I diabetes.
  • T cell epitope-containing peptides may be identified for an antigen or autoantigen presumed to be responsible for any of the above-named diseases by any of the procedures described above and in the examples for identifying T cell epitope containing peptides of a protein autoantigen. Once such T-cell epitope containing peptides have been identified for the targeted autoantigen, such peptides may be used in compositions and methods analogous to those described herein for treating multiple sclerosis.
  • EXAMPLE 1 Human Population Study of Multiple Sclerosis Immune Response to Myelin Basic Protein and Peptides and Selection of MBP Peptides 15 Suitable for Therapeutic Use.
  • PBLs were purified from fresh peripheral blood specimens (approximately 75 cc) from 222 patients with definite MS using a Ficoll density gradient.
  • 25 cultures were initiated with 2 x 10-5 PBL per well and 10 ug/ml purified human spinal cord MBP in RPMI 1640 culture medium supplemented with 5% human AB serum, penicillin-streptomycin, and L-glutamine. Cultures were supplemented with IL2 (20 units/ml) and with IL4 (5 units/ml) beginning at day 6-7. After 11-13 days, the microtiter cultures were washed, resuspended in fresh media, and split into 12 fresh
  • 35 tested for reactivity with a maximum of 4 MBP peptides, each at a concentration of 10 uM. After 48 hours, the assays were pulsed with 0.75 uCi of ⁇ H-thymidine, and harvested after a 6-16 hour pulse.
  • Cultures were scored as positive for each peptide according to the following criteria: stimulation index greater than 3.0, change in cpm greater than or equal to 500, and standard error of the mean less than the change in cpm.
  • stimulation index greater than 3.0
  • change in cpm greater than or equal to 500
  • standard error of the mean less than the change in cpm.
  • cultures were scored as "peptide-positive” only if they responded to both MBP and to the peptide, and if they did not respond to more than one non-overlapping peptide. Reactivity with each of the peptides was tested using a minimum of 19 and a maximum of 43 patients.
  • MBP responder status did not correlate with gender, category of MS (RR vs. CP), HLA-DR type, age, or whether or not the patient was taking Betaseron.
  • MBP peptides tested included a panel of 16 20-mers (Fig. 3) overlapping by 10 amino acids and covering the entire human MBP sequence (18.5 kD isoform). Two additional longer peptides were also tested (MBP sequence (MBP 83-105 and MBP 141 -165, Fig. 3). MBP peptide reactivity was then calculated based on the proportion of MBP positive microtiter cultures which also scored positive for one of the MBP peptides. Four of the peptides each accounted for at least 10% of the total MBP reactivity (MBP 1 1-30, MBP 81-100, MBP 83-105, and MBP 141 -165).
  • MBP 141-165 was the most reactive of the four peptides, accounting for 21% of the total MBP response, and detectable in 64% of the MBP-responder patients tested.
  • MBP 141-165 appears to include T cell epitopes from both MBP 141-160 and MBP 151-170, and su ⁇ risingly showed dramatically more reactivity than the two 20- mer peptides.
  • MBP 81-100 and MBP 83-105 are very similar in sequence and likely to include similar if not identical T cell epitopes. They correspond to a region previously thought to be associated with the HLA-DR2 haplotype. Our results indicate that both DR2 and non-DR2 MS patients have good reactivity to these peptides.
  • MBP 1 1-30 is an area of peptide reactivity that was previously not thought to be recognized frequently in MS patients.
  • Preferred MBP peptides have been selected based on two criteria:
  • MBP 83-105 MBP-2
  • MBP 141-165 MBP-4
  • MBP 141-165 MBP-4
  • MBP 1 1-30 (MBP-1) meets the second criteria, since the three peptides together account for 42% of the MBP reactivity.
  • MBP 1 1 1 - 130 (MBP-3) would also be suitable as a preferred peptide for therapeutic use particularly in combination with MBP-1 , MBP-2, and MBP-4.
  • MBP 81-100 appears equivalent to MBP 83-105 and may also be used in conjunction with the other peptides selected as preferred.
  • EXAMPLE 2 Administration of Peptides to Mammals for Treatment of EAE as a Model for Multiple Sclerosis
  • Peptides were prepared by automated peptide synthesis (ABI 430A, Applied Biosciences, Foster City, CA) using standard 9-fluorenylmethoxycarbonyl chemistry. Peptides were purified by high pressure liquid chromatography, and amino acid composition was confirmed. Peptide sequences selected were MBP Acl-1 1 ASQKRPSQRHG; MBP Acl-1 1 [4A] ASQARPSQRHG; MBP Acl-1 1 [4 Y] ASQYRPSQRHG; MBP 31-47 RHRDTGILDSIGRFFSG; Ova 323-339 ISQAVHAAHAEINEAGR; and Ova 323-337 ISQAVHAAHAEINEA.
  • MBP was prepared from guinea pig spinal cords (Keystone Biologicals, Cleveland, OH) using a modification of the method of Smith, M.E., J. Neurochem., 1969, 16:83. Briefly, MBP was extracted from isolated myelin membranes using chloroform and methanol, precipitated with potassium citrate, acid extracted, and lyophilized. SDS-PAGE analysis of this material showed a major band at the expected molecular weight of 18.5 Kd.
  • EAE induction, scoring, and peptide therapy EAE was induced in (PLJ x SJL) FI mice obtained from the Jackson
  • mice When the mice reached the age of 8-14 weeks, EAE was induced by immunization with 50-100 ⁇ g of MBP emulsified in complete Freund's adjuvant (Gibco Laboratories, Grand Island, NY), supplemented with an additional 400 ⁇ g per mouse M. tuberculosis H37Ra (Difco Laboratories, Detroit, MI). 200 ng pertussis toxin (JRH Biosciences, Lenexa, KS) was administered intravenously at the time of immunization and.48 hours later.
  • mice were scored based on clinical signs according to the following scale: 1 , tail paralysis; 2, partial hind limb paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or dead. Grade 5 mice were euthanized. After death, mice were excluded from subsequent calculations of mean clinical score. Peptides were administered intravenously as described in the individual examples below.
  • lymph node proliferation and IL2 production assays inguinal and para- aortic lymph node lymphocyte suspensions were prepared from mice immunized as described above for EAE induction (pertussis toxin was not included for the proliferation experiments). Lymphocytes were cultured in round-bottom microtiter plates at 5 x 10- ⁇ per well with MBP peptides and RPMI 1640 supplemented with 0.5% fresh normal mouse serum, Penicillin-Streptomycin, L-glutamine, and 5 x lO---* M 2-mercaptoethanol. Proliferation assay cultures were pulsed for 16 hours with -1H- thymidine following a 72-hour incubation.
  • IL2 assays culture supernatants were harvested at 24 hours and examined for their ability to support the growth of the In ⁇ dependent cell line HT2.
  • HT2 bioassays were performed in the presence of the monoclonal antibody 1 1.B.1 1 10% culture supernatant (O'Hara, J., et al., Nature, 1985, 315:333), which inhibits J 4- induced proliferation of the HT2 cells.
  • Results are shown in Figure 9 which indicates that Acl-1 1 [4 Y] reverses EAE when administered after the onset of paralysis.
  • MMS for the untreated control group was 4.6, and mortality was 64%.
  • MMS for the PBS treated group was 4.4, and mortality was 35%.
  • MMS for the Ova 323-337 treated group was 4.2, and mortality was 21%.
  • MMS for the Ac 1 - 1 1 [4Y] treated group was 3.2, and mortality was 7%.
  • FIG 10 shows that Acl-1 1 [4Y] prevents EAE relapses when administered during the remission phase of disease.
  • MBP (Fritz, R.B., et al., J. Immunol, 1983, 130: 1024). making this EAE model ideal for investigating therapeutic intervention.
  • MBP Ac 1 - 1 1 is the immunodominant encephalitogen in (PLJ x SJL)F1 mice
  • the subdominant epitope MBP 31-47 is also encephalitogenic in this strain.
  • the steps of Example 2 were followed except groups of mice were treated in an advanced stage of disease with intravenous injections of MBP Acl-1 1 and MBP 31- 47 together, or with Acl-11 alone.
  • mice Groups of control mice were treated with intravenous injections of PBS, or with the control peptide Ova 323-339, an A ⁇ u A ⁇ u binding peptide which is unrelated to MBP and which is non-immunogenic in (PLJxSJL)Fl mice.
  • Figure 5 shows that repeated intravenous injections of MBP Ac l -1 1. either alone (Figure 5a) or in combination with MBP 31 -47 ( Figure 5b). reduce the incidence, severity, and mortality of EAE. Treatment with the two peptides appeared to be somewhat more effective than treatment with MBP Ac 1 - 1 1 alone, consistent with the observations of others mentioned above. Mice were treated with six intravenous injections of peptide throughout the acute and first relapse phases. Mice then were followed until day 125, during the chronic, remitting phase, with no evidence of late disease in the MBP peptide-treated groups (data not shown). The control Ova 323-339 peptide had no effect on disease when administered by the intravenous route (Figure 5c).
  • FIGs. 5(a), (b) and (c) show the efficacy of intravenous treatment of mice with EAE induced with MBP.
  • EAE was induced with MBP as set out above in groups of 1 1-16 mice. Mice were treated with intravenous injection of 250 nmol of each peptide beginning on days 9, 12, 15, 21, 29 and 37. Small crosses as used on all figures herein indicate individual mice which died or were sacrificed for grade 5 EAE.
  • FIG. 6 shows that Acl-1 1 [4Y] treats EAE at a lower dose than Acl-1 1, and has a longer-lasting effect on disease.
  • EAE was induced with MBP in groups of 8-10 mice.
  • Figure 6a shows mice treated I.V. on days 12 and 15 with PBS (Phosphate Buffered Saline) (open circles), 250 nmol of Ac l- 1 1 (closed squares), or 250 nmol Acl-11 [4 Y] (open triangles).
  • MMS for PBS treated mice was 4.4, and mortality was 60%.
  • MMS for Acl-1 1 treated mice was 3.9, and mortality was 37.5%.
  • MMS for Acl-1 1 [4Y] treated mice was 2.1, and mortality was 0%.
  • Figure 6b shows mice treated I.V.
  • MMS for PBS treated mice was 2.9, and mortality was 20%.
  • MMS for peptide treated mice was 4.3, and mortality was 50%.
  • hybridoma cells were incubated at 5 x 10 ⁇ per well in flat-bottom microtiter plates with MBP peptides or peptide analogs.
  • Medium was the same as for the lymph node proliferation assays, except the serum supplement was 10% fetal calf serum rather than normal mouse serum.
  • Supernatants were harvested at 24 hours and examined for their ability to support the growth of HT2 cells.
  • FIG. 8 shows that spleen cells which have been "pulsed" in vivo with Acl- 11 [4Y] are highly effective at activating the 1934 hybridoma. Capacity to activate the hybridoma is maximal two hours after injection, then begins to decline by four to six hours after injection. Activation is minimal by ten hours after injection of Acl- 1 1[4Y], and is not present by twenty hours (data not shown).
  • Mouse MBP peptide Ac 1-1 1 was synthesized using standard Fmoc/tBoc synthesis and purified by HPLC.
  • the amino acid sequence for peptide Ac 1-1 1 is as follows:
  • EAE was induced in 6 to 8 week old female (SJL x PL)Fj mice (Jackson Labs, Bar Harbor, ME) by immunizing mice with 100 ⁇ g purified guinea pig MBP in CFA (GIBCO Lab., Grand Island, NY) containing 400 ⁇ g H37RA strain M. tuberculosis (DIFCO Lab., Detroit, MI) subcutaneously at the base of the tail. 200 ng Pertussis Toxin (JHL BIOSCJJ5NCE, Lenexa, Kansas) was given twice intravenously (i.v.) on the day of immunization and also 48 hours later.
  • 5 moribund. Data are expressed as the mean of the disease severity score on each day including all the animals in the group. Mice were followed for 26 days. Once a mouse died of EAE, a score of 5 was included in calculations for all subsequent days.
  • a titration experiment for the pu ⁇ oses of determining the effects of various dosages of IFN- ⁇ on EAE (Fig. 13).
  • One group of mice was treated intraperitoneally with PBS on days 9, 13, and 16 (control) after EAE induction, one group of mice were treated with 10,000 units of IFN- ⁇ on days 9, 13, and 16 (open circle) and one group of mice were treated with 2,000 units of IFN- ⁇ on days 9, 13, and 16 (closed circle).
  • the symptoms of EAE are similar at each time point for both dosages of IFN- ⁇ , thereby indicating that the lower dosage would be suitable for experiments with IFN- ⁇ and is a preferred dosage as the chances of toxicity due to a higher dose of IFN- ⁇ are less likely.
  • 2000 units of IFN- ⁇ were then used in the remaining experiments shown in Figs 12a- 12c as this dosage showed improvement in clinical score.
  • a control group of mice was treated with PBS and another group of mice were treated with 2000 units of IFN- ⁇ i.p. on days 9, 12, 16, and 20.
  • the group treated with IFN- ⁇ only had slightly less severe symptoms during the time course as those of the control group.
  • mice MBP peptide Ac 1-1 1 The effect of mouse MBP peptide Ac 1-1 1 was determined and the results are shown in Fig. 12b.
  • One group of mice was treated i.p. with PBS on days 10, 13, 17, and 21 (control) after EAE induction, and one group of mice was treated i.v. with 250 nmol of peptide Ac 1-1 1 on days 10, 13, 17, and 21.
  • the mice were monitored as described above.
  • the mice treated with Ac 1-1 1 had less severe symptoms than those of the control group.
  • Fig. 12c Effect of treatment with a combination of peptide Ac 1-1 1 and IFN- ⁇ on EAE
  • Fig. 12c One group of mice was treated i.p. with PBS (control) after EAE induction, and one group of mice was treated i.v. with 250 nmol of peptide Ac 1-1 1 on days 10, 13, 17 and 21 (open arrows) and treated i.p. with 2000 units of IFN- ⁇ on days 9, 12, 16, and 20.
  • PBS control
  • the group of mice treated with a combination of peptide and IFN- ⁇ showed a marked decrease in the severity of symptoms as compared with the control group as well as compared to treatment with either IFN- ⁇ alone or peptide alone as shown in Figs. 12a and 12b indicating a synergistic effect of the combination. Therefore, a treatment regimen which includes a combination of peptide and IFN- ⁇ provides an enhanced effect on diminishing the severity of the symptoms of EAE.
  • Peptides were prepared by automated peptide synthesis (ABI 430A, Applied Biosciences, Foster City, CA) using standard 9-fluorenylmethoxycarbonyl chemistry. Peptides were purified by high pressure liquid chromatography, and amino acid composition was confirmed. Peptide sequences selected were MBP Ac 1- 1 1 ASQKRPSQRHG; MBP Acl-1 1 [4A] ASQARPSQRHG; MBP Acl-1 1 [4Y] ASQYRPSQRHG; MBP 31-47 RHRDTGILDSIGRFFSG; Ova 323-339 ISQAVHAAHAEINEAGR; and Ova 323-337 ISQAVHAAHAEINEA.
  • SCH was prepared from guinea pig spinal cords (Keystone Biologicals, Cleveland, OH) using a modification of the method of Smith, M.E., J. Neurochem., 1969, 16:83.
  • the SCH protein mixture was lyophilized and used according to dry weight.
  • EAE was induced in (PLJ x SJL) FI mice obtained from the Jackson Laboratory (Bar Harbor, ME). When the mice reached the age of 8-14 weeks, EAE was induced by immunization with 500-1000 ⁇ g of SCH emulsified in complete Freund's adjuvant (Gibco Laboratories, Grand Island, NY), supplemented with an additional 400 ⁇ g per mouse M. tuberculosis H37Ra (Difco Laboratories, Detroit, MI). 200 ng pertussis toxin (JRH Biosciences, Lenexa, KS) was administered intravenously at the time of immunization and 48 hours later.
  • mice were scored based on clinical signs according to the following scale: 1, tail paralysis; 2, partial hind limb paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or dead. Grade 5 mice were euthanized. After death, mice were excluded from subsequent calculations of mean clinical score. Peptides were administered intravenously as described in the individual examples below.
  • Results are shown in Figure 16 which indicates that Acl-11 [4Y] reverses EAE when administered after the onset of paralysis.
  • Figure 17 shows that Acl-1 1 [4Y] prevents EAE onset when administeredbefore symptoms of the disease are exhibited.
  • EAE was induced with SCH. Therapy was initiated in each mouse individually, on the eighth day after disease induction with gpSCH. Data are plotted relative to initiation of therapy for each individual. Groups of surviving mice were treated on days 8, 10, 13. and 17. 25 nmol Acl-1 1 [4Y] i.v. (open triangles) or 25 nmol Ac l- 1 lp4Y] s.c. (closed circles). One group received no treatment (open squares).
  • Example 2 The same procedure was followed as in Example 2, however, no lymph node proliferation and IL2 production assays were performed. EAE was induced using gpMBP on day 0, thereafter Ac 1 - 1 1 [4Y] was administered to 3 groups of mice on day 8, 10, 13, and 17. The results are graphically represented on Fig. 18 for intravenous administration (open triangles), subcutaneous injection (closed circles) and a control (open circles). Pretreatment (e.g. treatment before display of symptoms) with Ac 1- 1 1 [4Y] can prevent gpMBP induced EAE disease.
  • Pretreatment e.g. treatment before display of symptoms
  • Ac 1- 1 1 [4Y] can prevent gpMBP induced EAE disease.
  • a human cDNA library was subjected to the polymerase chain reaction (PCR) using 3' and 5' primers designed from the published rat MOG coding sequence of Gardinier et al. (supra).
  • PCR polymerase chain reaction
  • the human MOG sequence could not be obtained in this manner, putatively due to insufficient homology at the 5' and/or 3' ends of the human and rat sequences. Therefore, four rat internal oligonucleotides were designed.
  • primers 166-183 (SEQ ID NO: 34) and 538-555 (SEQ ID NO: 35) were homologous to the top strand of the gene (primers 94-1 1 1 and 166-183 (SEQ ID NO: 34), base 1 starting at the ATG) and two were homologous to the bottom strand of the gene (primers 538-555 (SEQ ID NO: 35) and 685-702).
  • the combination of primers 166-183 (SEQ ID NO: 34) and 538-555 (SEQ ID NO: 35) was successful in effecting the amplification of a fragment of the approximately 400 bp expected size from a human brain cDNA library.
  • sequence of these primers was: a) 166-183: CAGAATCCGGGAAGAATGCCACGGGC(SEQID NO: 34);and b)538-555: CAGCGGCCGCACGGAGTTTTCCTCTCAG(SEQID
  • the 400 bp PCR product was cloned into expression vector pVL1393 by digesting pVL1393 (Pharmingen CA) with EcoRI and Notl, digesting the amplified product with the same enzymes and ligating the resulting fragments.
  • the insert was verified by digesting several clones derived from the ligated plasmids with EcoRI and Notl and sequencing the resulting 400 bp human MOG fragment.
  • the resulting insert putatively lacks 184 bp of 5' sequence and 201 bp of 3' sequence, based on the 738 bp rat open reading frame.
  • Two primers were designed from the 400 bp insert from positions 346- 363 top and bottom strands as follows:
  • the human MOG 346-363 top and bottom primers (SEQ ID NOS: 36 and 37) were used in combination with the above-mentioned 5' and 3' rat primers, respectively, to amplify the 5' and 3' missing ends of the gene from the same human brain cDNA library as previously used. A PCR product corresponding the 3' end of the gene was obtained, but the corresponding 5' end did not result.
  • the 3' fragment obtained had the expected 400 bp size and this fragment was cloned in pVL1393 and sequenced.
  • a human brain medulla ⁇ gtlO library obtained from Clontech which had been previously amplified and had a titer of 8xl0 10 pfu/ml was screened following the protocol described by the manufacturer.
  • the library was plated onto 12 large plates at 30,000 plaques/plate and the plaques were lifted onto nitrocellulose filters (2 replica filters/plate). Twelve filters lifted from the 12 different plates were then hybridized to a 32 P labelled probe corresponding to the human MOG internal 400 bp fragment initially cloned (positions 184-534).
  • the last two primers include a BamHI site
  • the primers were used in four different combinations: 1 ) forward top/internal MOG bottom; 2) reverse bottom internal MOG bottom; 3) internal MOG top/reverse bottom; and 4) internal MOG top/forward top.
  • the first two combinations provided the 5' end of the gene (up to the
  • the human MOG gene encodes a preprotein of 248 amino acids which has 87% homology with the 246 amino acids in the rat protein.
  • the mature protein contains 218 amino acids, numbered 1-218 in Figure 1 (SEQ ID NO: 2).
  • the mature protein begins at the glycine shown at position 1 and is derived from the 248 amino acid preprotein by cleavage from the presequence extending from the MET start codon to the alanine residue immediately preceding the glycine shown in position 1.
  • the PVL1393 transfer vector containing the truncated human MOG cDNA encoding amino acids 1-121 of human MOG was cotransfected into SF-9 cells along with Baculogold linearized
  • Baculovirus DNA (Pharmingen, San Diego, CA). The culture supernatant containing recombinant viruses was harvested after 4 days. The recombinant virus was plaque purified and subjected to 3 rounds of amplification to obtain a high titer viral stock. AF-9 cells were then infected with the viral stock at a MOI of 2.0. The supernatant from infected cells was harvested 48 hours after infection and applied to a NiNTA agarose column. The recombinant MOG protein was eluted under non-denaturing conditions using 250 mM Imidazole, dialyzed against 5% propionic acid and H 2 O and subsequently lypophilized. The protein concentration was estimated by BCA. The purified MOG protein was visualized on a 12.5% polyacrylamide gel stained with Coomassie blue.
  • Truncated human MOG was prepared as disclosed in Examples 9 and 9A.
  • MBP guinea pid
  • EAE was induced in three separate groups of mice by using 75 ⁇ g gpMBP and 100 ⁇ g huMOG (open triangles) and a combination of 75 ⁇ g gp MBP and 100 ⁇ g huMOG (closed squares).
  • the graph in Fig. 19 shows the course of disease for each for this example.
  • the disease induced with both MOG and MBP is much more severe than the disease induced by either alone.
  • the results indicate that both MOG and MBP contribute to the disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Rheumatology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Rehabilitation Therapy (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)

Abstract

L'invention concerne des peptides isolés et des combinaisons de peptides dérivés d'autoantigènes de myéline, tels que MBP, MOG, PLP et MAG, convenant au traitement de la sclérose en plaques, y compris des compositions prophylactiques et thérapeutiques et des procédés de prévention ou de traitement de la sclérose en plaques. Des compositions préférées de l'invention comprennent au moins un peptide purifié isolé, exempt de tous autres polypeptides ou contaminants, ce peptide comportant une séquence d'acides aminés de l'autoantigène de myéline possédant une activité de lymphocyte T. Une composition thérapeutique selon l'invention est capable de réguler négativement la réponse immune spécifique de l'autoantigène à l'autoantigène de myéline dans une population humaine atteinte de sclérose en plaques, ou exposée à la sclérose en plaques, de manière à diminuer, éliminer ou inverser les symptômes de la maladie et/ou à prévenir ou à ralentir l'apparition ou la progression de ces symptômes. De plus, ces compositions et ces procédés, quand on les applique à un stade avancé de la maladie, inversent la paralysie en progression ou d'autres signes pathologiques, quand on les administre pendant la phase aiguë de la maladie, ou empêchent la rechute, quand on les administre en période de rémission.
EP95941330A 1994-10-25 1995-10-25 Compositions et traitement pour la sclerose en plaques Withdrawn EP0787147A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US32822494A 1994-10-25 1994-10-25
US40422895A 1995-03-15 1995-03-15
US404228 1995-03-15
PCT/US1995/013682 WO1996012737A2 (fr) 1994-10-25 1995-10-25 Compositions et traitement pour la sclerose en plaques
US328224 2002-12-23

Publications (1)

Publication Number Publication Date
EP0787147A1 true EP0787147A1 (fr) 1997-08-06

Family

ID=26986277

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95941330A Withdrawn EP0787147A1 (fr) 1994-10-25 1995-10-25 Compositions et traitement pour la sclerose en plaques

Country Status (15)

Country Link
EP (1) EP0787147A1 (fr)
JP (1) JPH10504039A (fr)
AU (1) AU4278296A (fr)
BR (1) BR9509438A (fr)
CA (1) CA2203629A1 (fr)
CZ (1) CZ122697A3 (fr)
FI (1) FI971750A (fr)
HU (1) HUT77047A (fr)
IL (1) IL115766A0 (fr)
IS (1) IS4466A (fr)
NO (1) NO971900L (fr)
PL (1) PL324091A1 (fr)
SI (1) SI9520118A (fr)
SK (1) SK51297A3 (fr)
WO (1) WO1996012737A2 (fr)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6252040B1 (en) * 1991-10-22 2001-06-26 The Governors Of The University Of Alberta Peptide specificity of anti-myelin basic protein and the administration of myelin basic protein peptides to multiple sclerosis patients
US6156535A (en) 1995-08-04 2000-12-05 University Of Ottawa Mammalian IAP gene family, primers, probes, and detection methods
CA2247009C (fr) 1996-03-21 2009-08-04 Imperial College Of Science, Technology And Medicine Peptides cryptiques et leur procede d'identification
EP0939826A2 (fr) * 1996-08-15 1999-09-08 Agrivax Incorporated Administration d'antigenes tolerogeniques via des plantes comestibles ou des produits derives de plantes
CA2494338C (fr) * 1997-04-04 2007-07-17 The Governors Of The University Of Alberta Specificite des peptides de la proteine basique anti-myeline et administration de ces peptides aux patients atteints de sclerose en plaques
SE9703287D0 (sv) * 1997-09-11 1997-09-11 Astra Ab Peptides
CN1308671A (zh) * 1998-05-05 2001-08-15 科里克萨公司 髓磷脂碱性蛋白肽及其应用
US20020072493A1 (en) 1998-05-19 2002-06-13 Yeda Research And Development Co. Ltd. Activated T cells, nervous system-specific antigens and their uses
WO1999060021A2 (fr) * 1998-05-19 1999-11-25 Yeda Research And Development Co. Ltd. Lymphocytes t actives, antigenes specifiques du systeme nerveux et leur utilisation
EP1288226A1 (fr) * 2001-09-03 2003-03-05 Nederlandse Organisatie Voor Toegepast-Natuurwetenschappelijk Onderzoek Tno Modification de l'expression des gènes pour les récepteurs type "Toll" destinée à influencer la neurodégénérescence et la neuroprotection de système nerveux central de l'homme
GB0202399D0 (en) * 2002-02-01 2002-03-20 Univ Bristol Peptide
DE60327618D1 (de) 2002-03-27 2009-06-25 Aegera Therapeutics Inc Gegen iap gerichtete antisense-nukleobasen und deren verwendungen
DE10230381A1 (de) 2002-07-05 2004-01-22 Institut für Medizintechnologie Magdeburg GmbH, IMTM Verwendung von Inhibitoren der Alanyl-Aminopeptidasen und diese umfassende pharmazeutischen Zubereitungen
US8012944B2 (en) 2003-10-30 2011-09-06 Pharmascience Inc. Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent
WO2008130382A2 (fr) 2006-10-31 2008-10-30 East Carolina University Protéines de fusion à base de cytokine pour le traitement de troubles immunitaires
US8815794B2 (en) * 2008-08-28 2014-08-26 The Research Foundation For The State University Of New York Treatment of amyloidoses using myelin basic protein and fragments thereof
EP3348275A3 (fr) * 2009-03-31 2018-10-24 East Carolina University Cytokines et neuroantigènes utilisés dans le traitement de troubles immunitaires
EA024832B1 (ru) 2009-10-12 2016-10-31 ЛАЙФБИО ЛАБОРАТОРИС ЭлЭлСи Олигопептид, связывающий гидролизующие аутоантитела к основному белку миелина mbp, композиции и способ лечения рассеянного склероза
RU2448685C2 (ru) * 2009-11-30 2012-04-27 Российская Федерация в лице Министерства промышленности и торговли Российской Федерации Липосомы, содержащие олигопептиды - фрагменты основного белка миелина, фармацевтическая композиция и способ лечения рассеянного склероза
CA2830772C (fr) 2011-03-21 2020-04-28 Atlantic Cancer Research Institute Polypeptides presentant une affinite pour les proteines de choc thermique (hsp) et complexes associes a une hsp (hacs) et leur utilisation en diagnostic et en therapie
EP3094341B1 (fr) 2014-01-13 2019-10-02 Berg LLC Compositions d'énolase 1 (eno1) et leurs utilisations

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2512796B2 (ja) * 1987-06-24 1996-07-03 オートイミュン・インコーポレイテッド 自己抗原の経口投与による自己免疫疾患の治療法
US5260422A (en) * 1988-06-23 1993-11-09 Anergen, Inc. MHC conjugates useful in ameliorating autoimmunity
DK0506785T3 (da) * 1989-12-20 2000-07-24 Autoimmune Inc Forbedret behandling af autoimmune sygdomme ved aerosol-administration af autoantigener
EP0782859A1 (fr) * 1990-03-02 1997-07-09 Autoimmune, Inc. Amélioration de la régulation reductrice de maladies autoimmunes par administration orale d'autoantigènes
IL165071A (en) * 1990-03-30 2008-06-05 Autoimmune Inc A peptide with the ability to stimulate a subset of T cells from multiple sclerosis patients
CA2053799C (fr) * 1991-10-22 2002-03-12 Kenneth G. Warren Specificite pour les peptides synthetiques de la proteine basique anti-myeline presente dans le liquide cephalorachidien de patients atteints de la sclerose en plaques
EP0661996A4 (fr) * 1991-11-19 1997-05-21 Anergen Inc Conjugues d'une subunite du complexe majeur d'histocompatibilite utiles pour ameliorer les reponses immunitaires deleteres.
BR9306042A (pt) * 1992-02-28 1997-11-18 Autoimmune Inc Método para tratar uma doença auto-immune em um mamifero e formas de dosagens farmacêuticas oral e inalável
IL105153A (en) * 1992-03-25 1999-12-22 Immulogic Pharma Corp Therapeutic compositions comprising peptides derived from human t cell reactive feline protein
DE69320967T2 (de) * 1992-04-09 1999-05-12 Autoimmune Inc Unterdrückung der t-zell proliferation mittels peptidfragmenten des myelin basischen protein
WO1993025661A1 (fr) * 1992-06-10 1993-12-23 President And Fellows Of Harvard College Clones heterogenes de cellules t specifiques contre le peptide proteolipidique 139-151
WO1994004121A1 (fr) * 1992-08-17 1994-03-03 Autoimmune, Inc. Suppression par un antigene tiers d'une maladie neurologique associee a un retrovirus
NZ273813A (en) * 1993-09-03 1998-05-27 Immulogic Pharma Corp Myelin oligodendrocyte glycoprotein autoantigen
WO1995007096A1 (fr) * 1993-09-06 1995-03-16 La Trobe University Traitement de maladies auto-immunes
CA2172512A1 (fr) * 1993-09-22 1995-03-30 Lawrence Steinman Interaction de recepteurs de cellules t et d'antigenes dans des maladies auto-immunes
AU686797B2 (en) * 1994-04-08 1998-02-12 Brigham And Women's Hospital Treatment of autoimmune disease using oral tolerization and/or type I interferon
WO1995027500A1 (fr) * 1994-04-08 1995-10-19 Brigham And Women's Hospital TRAITEMENT DE MALADIES AUTO-IMMUNES AVEC DES AGENTS D'INDUCTION DE TOLERANCE ET/OU DES CYTOKINES DE RENFORCEMENT DES Th2 ADMINISTRES PAR VOIE ORALE
JPH10500109A (ja) * 1994-05-10 1998-01-06 イミユロジク・フアーマシユーチカル・コーポレーシヨン 多発性硬化症のための組成物および治療方法
JP3558347B2 (ja) * 1994-06-09 2004-08-25 ネーデルランセ オルハニサチエ フォール トゥーヘパスト−ナツールウェーテンシャッペルック オンデルズク テーエヌオー 自己免疫疾患、とくに多発性硬化症の診断および治療における使用のためのアルファbクリスタリン
US6329499B1 (en) * 1994-11-18 2001-12-11 Neurocrine Biosciences, Inc. Methods for treatment of multiple sclerosis using peptide analogues of human myelin basic protein
CA2205532A1 (fr) * 1994-11-18 1996-05-30 Neurocrine Biosciences, Inc. Methodes de traitement de la sclerose en plaques par l'emploi d'analogues peptidiques a la position 91 de la proteine basique de la myeline humaine

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9612737A2 *

Also Published As

Publication number Publication date
HUT77047A (hu) 1998-03-02
IS4466A (is) 1997-04-17
NO971900D0 (no) 1997-04-24
BR9509438A (pt) 1997-12-23
SK51297A3 (en) 1998-03-04
FI971750A0 (fi) 1997-04-24
NO971900L (no) 1997-06-25
CZ122697A3 (en) 1997-09-17
JPH10504039A (ja) 1998-04-14
WO1996012737A3 (fr) 1996-10-10
AU4278296A (en) 1996-05-15
WO1996012737A2 (fr) 1996-05-02
FI971750A (fi) 1997-06-24
IL115766A0 (en) 1996-01-19
PL324091A1 (en) 1998-05-11
SI9520118A (sl) 1998-08-31
CA2203629A1 (fr) 1996-05-02

Similar Documents

Publication Publication Date Title
US5858980A (en) Peptide fragments of myelin basic protein
EP0787147A1 (fr) Compositions et traitement pour la sclerose en plaques
WO1996012737A9 (fr) Compositions et traitement pour la sclerose en plaques
US8961986B2 (en) Peptide composition
EP1105419B1 (fr) Traitements de la sclerose en plaques au moyen d'analogues peptidiques de la proteine de base de la myeline humaine
EP0914333B1 (fr) Derives de peptides
JP3434510B2 (ja) ミエリン塩基性タンパク質のペプチドフラグメントを用いたt‐細胞増殖の抑制
WO1996016085A1 (fr) Methodes de traitement de la sclerose en plaques par l'emploi d'analogues peptidiques a la position 91 de la proteine basique de la myeline humaine
JP2005511518A (ja) 自己免疫疾患を抑制するためのコポリマー、及びその使用方法
JP2607751B2 (ja) 自己免疫性ブドウ膜網膜炎の治療予防薬
WO1997035879A1 (fr) Peptides de la glycoproteine d'oligodendrocyte de myeline et leurs utilisations
JPH09502346A (ja) 自己免疫疾患に関連するプロトコールにおけるミエリン希突起神経膠細胞糖蛋白質およびそのペプチド部分の使用
US6355617B1 (en) Peptide derivatives
WO1996020950A2 (fr) Compositions et therapies pour le traitement de la polyarthrite rhumatoide
JP2007507541A (ja) 修飾型の規則正しいペプチドによる脱髄性自己免疫性疾患の治療方法
JP2002521388A (ja) 自己免疫疾患の免疫療法に使用するための新規ペプチド
US20040038920A1 (en) Chlamydial peptides and their mimics in demyelinating disease
WO2003000718A2 (fr) Nouveau peptide et son utilisation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970522

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: LT;LV;SI

17Q First examination report despatched

Effective date: 19970910

RIN1 Information on inventor provided before grant (corrected)

Inventor name: ROTHBARD, JONATHAN

Inventor name: DEVAUX, BRIGITTE

Inventor name: PALIARD, XAVIER

Inventor name: SHI, JIA-DONG

Inventor name: HSU, DI-HWEI

Inventor name: GEFTER, MALCOLM

Inventor name: SAMSON, MICHAEL

Inventor name: SMILEK, DAWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000131

RIN1 Information on inventor provided before grant (corrected)

Inventor name: FRANZ N, HENRY

Inventor name: ROTHBARD, JONATHAN

Inventor name: DEVAUX, BRIGITTE

Inventor name: PALIARD, XAVIER

Inventor name: SHI, JIA-DONG

Inventor name: HSU, DI-HWEI

Inventor name: GEFTER, MALCOLM

Inventor name: SAMSON, MICHAEL

Inventor name: SMILEK, DAWN