NZ273813A

NZ273813A - Myelin oligodendrocyte glycoprotein autoantigen

Info

Publication number: NZ273813A
Application number: NZ273813A
Authority: NZ
Inventors: Brigitte Devaux; Jonathan B Rothbard; Dawn Smilek
Original assignee: Immulogic Pharma Corp
Priority date: 1993-09-03
Filing date: 1994-09-01
Publication date: 1998-05-27
Also published as: WO1995006727A3; FI961000A0; NO960858D0; AU7725894A; CA2170901A1; EP0716696A1; FI961000A; WO1995006727A2; NO960858L; KR960705038A; JPH09502346A

Description

<div class="application article clearfix" id="description"> New Zealand No. International No. 273813 PCT/US94/10257 TO BE ENTERED AFTER ACCEPTANCE AND PUBLICATION Priority dates: 03.09.1893; Complete Specification Filed: 01.00.1994 Classification:® C12N15/12.10; C07K14/47; A01K38/17; G01N33/53.68 Publication date: 27 May 1098 Journal No.: 1428 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of Invention: Uses of myelin oligodendrocyte glycoprotein and peptide portions thereof in protocols related to autoimmune disease Name, address and nationality of applicant(s) as in international application form: IMMULOGIC PHARMACEUTICAL CORPORATION, 610 Lincoln Street, Waltham, Massachusetts 02154, United States of America WO 95/06727 PCT/US 273813 r/US$4/10B7 v 5 10 USES OF MYELIN OLIGODENDROCYTE GLYCOPROTEIN AND PEPTIDE PORTIONS THEREOF 15 IN PROTOCOLS RELATED TO AUTOIMMUNE DISEASE Technical Field The invention is directed to autoantigens and their relevant epitopes. More 2 0 specifically, the invention concerns myelin oligodendrocyte glycoprotein (MOG) and the peptide regions thereof useful in diagnosis, treatment, and prevention of autoimmune conditions. Further, methods of screening for, and developing therapeutics useful in the treatment of, autoimmune disease are also disclosed. 25 Background Art Autoimmune diseases are a significant human health problem and are relatively poorly understood. As there is no microbial or viral culprit apparently directly responsible, prevention, treatment and diagnosis of such diseases must be based on the etiology of the disease. This invariably involves a complex series of reactions of 3 0 endogenous metabolic intermediates, structural components, cells, and so forth. Implicit, however, in the nature of an autoimmune condition is the notion that at least one autoantigen must be involved in creating the sequence of events that results in the symptoms. Autoimmune demyelinating diseases, such as multiple sclerosis, are no exception. Multiple sclerosis is an autoimmune disease in which T lymphocytes destroy 3 5 central nervous system myelin. Multiple sclerosis is the most common cause of neurological disability associated with disease in Western countries. A commonly used animal model for multiple sclerosis is experimental allergic encephalomyelitis (EAE) which can be induced, for example, in guinea pigs by administration of whole brain homogenate. EAE, a demyelinating disease of the central 4 0 nervous system, has been induced in mice with myelin basic protein (MBP) and has been accepted as a mouse model of human multiple sclerosis. It is well known in the art the EAE can be induced by immunization with MBP and complete Freund's adjuvant. I WO 95/06727 PCT/US94/10257 Animals so immunized exhibit symptoms of EAE, including, but not limited to, paralysis and often death. MBP is an autoantigen associated with human multiple sclerosis which continues to be studied. However, the search for other factors and other autoantigens which may contribute to this disease continues {Immunology, 2d Ed. J. Kuby,(1994) p. 451-457). 5 The apparent first indication of the autoantigen which came to be known as myelin oligodendrocyte glycoprotein (MOG) was disclosed in a paper by Lebar, R. et al. (J Immunol (1976) 116:1439-1446). This work reported the results of a study which identified an IgG2 antibody in the serum of EAE guinea pigs as responsible for the complement-dependent demyelinating activity of the serum. The relevant antibody reacted with the 10 putative autoantigen present in the homogenate of central nervous system (CNS) myelin. This autoantigen was shown to be different from the encephalitogenic basic protein (BP) of CNS myelin. In a subsequent paper, this unknown antigen, now designated M2, was identified as a surface antigen and detected in mouse, r&bbit, rat, bovine and human CNS 15 tissues as well as guinea pig. Further studies published as Lebar, R. et al, J Exp Immunol (1986) 66:423-443, reported that M2 appeared as two bands at 27 and 54 kd, which bands represented glycoproteins. Monoclonal antibodies putatively specific for M2 were also reported in this paper. In a 1987 paper (Linington, C. and Lassman, H. J Neuroimmunol (1987) 17:61-2 0 69) the role of M2, now called MOG, was partially elucidated. It was found that in vivo demyelinating activity of serum in rats was correlated with its anti-MOG antibody titer. The authors suggest that antibodies against MOG are involved in the pathogenesis of the model, in this case, chronic relapsing EAE. Further studies by this group reported a year later in Lassmann, H. et al Acta Neuropathol (Berl) (1988) 75:566-576t further elucidated the 2 5 relevant events in the EAE model. This study showed a relationship between anti-MOG antibody and high nnmbers of T-cells in determining the nature of the observed symptoms. In a still later paper by Kerleio deRosbo, N. et al JNeurochem (1990) 55:583-587, it was shown that a monoclonal antibody directed against MOG induced demyelination in aggregating brain cell cultures. Piddelsden, S. et al Clin Exp Immunol (1991) 83:245-250, 3 0 further studied the importance of complement activation as significant in the course of EAE. Sun, J. et al. J Immunol (1991) 146:1490-1495, directly studied MS in patients and evaluated both B- and T-cell response to MOG. This paper established that the T-cell response to MOG is Class II restricted and confirmed that MOG is an important antigen 35 in multiple sclerosis. 2 2738 1* Purified murine MOO has been shown to migrate as a 26-28 kd doublet band with a minor band at S3 kd on SDS-page immunoblots as reported by Matthieu, J.-M. and Amiguet, P. DevNeurosci (1990) 12:293-302. Amiguet, P. et al. JNeunchem (1992) 58:167$-1682, had shown that chemical and enzymatic deglycosylation of marine MOO resulted in a single 25 kd peptide. Thus, murine MOG -n its monomelic form is a 25 kd amino acid sequence. This article also disclosed the first approximately 26 amino acids at the N-terminus of the murine protein. Gardinier, M.V. et aL JNeurosd Res (1992) 33:177-187, isolated several rat MOG cDNAs and confirmed their identity by comparison with murine MOG N-terminal peptide sequence. The rat cDNA obtained by Gardinier (supra) had an open reading frame that encoded a putative signal peptide of 27 amino acids followed by mature MOG peptide of 218 amino acids with a calculated molecular weight of24,962 daltons. The N-terminal amino acid sequences obtained for the murine protein were similar to those deduced from the rat cDNA. The present invention provides recombinant materials for die production of the human MOG protein as well as the complete amino acid sequence thereof. Using this information, the MOG protein or useful peptides representing portions of the amino acid sequence of MOG protein can be determined and are useful in the diagnosis and treatment of demyelinating autoimmune diseases in humans. Further, methods of screening for, and developing therapeutics compositions for, autoimmune disease is disclosed. Disclosure of the Invention The invention provides the complete amino add sequence of human MOG protein (SEQ ID NO: 2) as well as recombinant materials for the production of the protein and fragments thereof. Knowledge of the amino add sequence permits design of peptide portions thereof which are useful as well in diagnosis and treatment of flntnimmim#* diseases. Accordingly, in one aspect, the invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence encoding human myelin oligodendrocyte glycoprotein (MOG) or at least one antigenic fragment thereof. In another aspect, the invention is directed to isolated and purified human MOG protein, optionally produced recombinantly, and to fragments thereof. These may be used to modulate the course of development of symptomology in demyelinating autoimmune diseases. In another aspect, the invention is directed to recombinant host cells, expression systems, and methods useful for the production of the MOG protein or peptide portions thereof all as set forth in the accompanying claim set. In stiHt&Opth^j^sp^ctj e rty Oii.'ce of NZ 3 2 0 JAN 1323 RECEIVED the invention is directed to a therapeutic composition comprising i human MOG and/or at least one antigenic fragment thereof and/or at least one peptide of the invention and/or a peptide produced by the method of the invention and a pharmaceutical acceptable carrier or diluent. The compositions are useful in methods of mitigating the effects of demyelinating autoimmune diseases. In another aspect, the invention is directed to a peptide comprising at least one T-cell epitope of human MOG or tandem copies thereof. Also provided is a peptide comprising at least two T-cell epitopes of human MOG. Further provided is a modified form of human MOG, or antigenic fragment thereof wherein said modification comprises substituting for one or more amino acids of said peptide or protein a different amino acid which does not interfere with the biological activity of said peptide or protein. Protein and peptides in which conservative substitutions have been made which exhibit characteristics of T-cell epitopes of the naturally occurring MOG protein and peptides are also disclosed. In yet another aspect, the invention discloses a method of diagnosing a demyelinating autoimmune disease comprising combining a blood sample obtained from a subject to be tested with isolated human MOG, or antigenic fragment thereof or a peptide of the invention and/or a peptide produced by the method of the invention under conditions appropriate for binding of blood components with MOG or fragment thereof, and determining the extent to which such binding occurs. In another aspect, the invention provides a method for identifying therapeutic compositions for the treatment of multiple sclerosis comprising the steps of: administering human MOG to mice in immunogenic form to cause induction of EAE in said mice; treating said mice induced with EAE with at least one therapeutic composition comprising at least one antigenic fragment of human MOG prior to die onset of symptoms of EAE or after the onset of symptoms of EAE in said mice; and determining if said at least one therapeutic composition prevents the onset or progression of the symptoms of EAE in said mice induced with EAE. 1738 o^S3'J&»y 3a htelh.^rj, Of NZ 2 0 J AH f333 R£c E/Ved 273813 Brief Description of the Drawings Figure 1 shows the complete nucleotide sequence (SEQ ID NO:l) and deduced amino acid sequence (SEQ ID NO: ?.) of DNA encoding human MOG protein. Figure 2 shows peptides, designated by amino acid sequence, which are useful in the invention (SEQ ID NOS: 4-9,11, IS, 16, and 42-72). Figure 3 is a table showing the effect of each of the natural amino acids at certain positions on peptides binding to the MHC Qass II product of DR4. Figure 4 is a table showing a comparison of predicted and measured ICjq values for 12 peptides (SEQ ED NOS: 19-32) binding to the MHC Class II product of DR4. Figure 5a shows peptides (20 mers) designated by amino acid sequence which correspond to SEQ ID NOS: 73-93.and are useful in the invention. Figure 5b shows a peptide of human MOG 1-121,designated by amino acid sequence, which contains least one T-cell epitope. Figure 6 is a bar graph of data from Example 3 where the X-axis indicates wells containing 4 different cell lines, the 7 peptides tested are indicated by the different legends and the Y-axis indicates counts per minute where the data is expressed as 3H-thmidine incorporated (CFM) by each cell line in response to each individual peptide. Modes of Carrying Out the Invention The present invention provides nucleic acid sequences encoding human MOG, an autoantigen involved in demyelinating autoimmune diseases. It also provides peptides which represent subunits of the human MOG encoded by die nucleic acid molecules of the invention which are useful in moderating the autoimmune response. These subunits, which generally include on the order of at least 12-13 amino acids, are characterized by their correspondence to the T-cell epitope regions of die human MOG. While the etiology of development of the symptoms of an autoimmune disease such as multiple sclerosis, is far from clear certain events are believed to be WO 95/06727 PCT/DS94/10257 critical to the progression of the condition. Demyelinating autoimmune diseases involve an attack by the immune system on the myelin sheath, resulting in what amounts to short circuits in the nervous system. The attack by the immune system is mediated by T-cells. T-cell responses to a particular antigen, in this case the human MOG autoantigen which is 5 a part of myelin, require uptake and subsequent proteolytic cleavage of the antigen by antigen presenting cells and presentation of the antigen in the context of a Class II major histocompatibility complex (MHC) encoded protein which permits their recognition by the T-cells. Thus, the T-cell epitope regions of the autoantigen are those which are presented by the Class II MHC proteins to the T-cell receptors. The relevant T-cells can 10 be rendered nonresponsive in an antigen-specific fashion in protocols by providing the T-cell epitope regions of the autoantigen, as is further described below. One embodiment of the nucleic acid sequence encoding human MOG is shown in Fig. 1 (SEQ ID NO: 1), along with the deduced amino acid sequence (SEQ ID NO: 2). The encoded mature protein contains a 218 amino acids; the full length protein 15 (including signal peptide) is 87% homologous with the rat MOG protein. As described above, the availability of the deduced amino acid sequence of human MOG provides the opportunity to design peptide fragments thereof which induce immune responses in mammals and peptide fragments which are T-cell epitopes - i.e., constitute those portions of the molecule which are recognized by T-cell receptors. These peptides and fragments 20 are also included within the invention scope. A host cell transformed with a vector (PVL1393, Pharmingen, CA) containing the nucleic acid sequence encoding human MOG was deposited with the American Type Culture Collection on September 8,1994 and has accession number 75554. 25 However, the scope of the invention is not limited to the human MOG protein encoded by the amino acid sequence depicted in Figure 1, or to the specific nucleic acid sequence presented. Naturally occurring variants and deliberate mutations designed to modify the nucleic acid sequence per se or to modify the encoded protein are also included in the scope of the invention as further described below. With respect to 3 0 naturally occurring variants, DNA sequence polymorphisms, especially those resulting in "silent" mutations which do not affect the amino acid sequence of the human MOG, but also sequence polymorphisms that do lead to changes in the amino acid sequence, are expected to exist in the human population. These variations in one or more nucleotides (up to about 1% of the nucleotides) of the sequence encoding MOG are a result of natural 3 5 allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of the invention. Furthermore, there may be one or 5 WO 95/06727 PCT/US94/10257 more "family members" of MOG that are related in function and amino acid sequence to the MOG encoded by the DNA disclosed herein but encoded by separate genes. Such family members are also included within the definition of human MOG and the nucleotide sequences encoding it 5 Isolated autoantigenic proteins or fragments thereof, that are novel and that are immunologically related to human MOG or fragments thereof, other than those already identified, are within the scope of the invention. These can be identified by antibody cross-reactivity or T-cell cross-reactivity. Such proteins or fragments thereof bind antibodies specific for the protein and peptides of the invention, or stimulate T-cells 10 specific for the protein and peptides of this invention. "Antigenic fragments" refer to an amino acid sequence having fewer amino acid residues than the entire protein and include fragments or peptides which induce an immune response in mammals, preferably humans, such as eliciting the production of IgG and IgM antibodies, or eliciting a T-cell response such as proliferation 15 and/or lymphokine secretion and/or induction of T-cell anergy and/or modification of THj and TH2 subsets. Of particular interest are antigenic fragments that comprise T-cell epitopes. Peptides can be derived from the naturally occurring MOG sequence or peptides in which conservative amino acid substitutions have been made. Examples of each are shown in Figure 2 (SEQ ID NOS: 4-9,11,15,16, and 42-72). 20 Preparation of Nucleic Acids Nucleic acid molecules containing a sequence encoding human MOG or an antigenic fragment thereof may be obtained by reverse transcription mRNA present in human brain or other CNS tissue, as well as from genomic DNA, and can most 2 5 conveniently be prepared using standard solid phase techniques. Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura etal. U.S. Patent No. 4,598,049; Caruthers et al U.S. Patent No. 4,458,066; and Itakura U.S. Patent Nos. 4,401,796 and 4,373,071, 3 0 incorporated by reference herein). The nucleic acid molecules of the invention also include RNA which can be transcribed from the DNA prepared as above. Preparation of Human MQG and its Fragments The present invention also provides expression systems and host cells 3 5 transformed with these systems for production of the encoded protein. Host cells include bacterial cells such as E. coli, insect cells (baculovirus), yeast, or mammalian cells such as WO 95/06727 PCT/US94/10257 Chinese hamster ovary cells (CHO). Suitable host cells and expression vectors containing relevant promoters, enhancers and other expression control elements may be found in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990). Other suitable host cells and expression vectors are known to those 5 skilled in the art. Expression in eucaiyotic cells such as mammalian, yeast, or insect cells can lead to partial or complete glycosylation and/or formation of relevant inter- or intra-chain disulfide bonds of recombinant protein. Examples of vectors for expression in yeast 5. cerevisae include pYepSecl (Baldari. et aL, (1987) Embo J. 6:229-234), pMFa (Kuijan 10 .and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et aL, (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). Baculovirus vectors available for expression of proteins in cultured insect cells (SF 9 cells) include the pAc series (Smith et al., (1983) Mol Cell Biol 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, MD., (1989) Virology 170:31-39). Generally COS cells (Gluzman, Y., (1981) Cell 23:175-182) are used 15 in conjunction with such vectors as pCDM 8 (Aruffo, A. and Seed, B., (1987) Proc Natl Acad Sci USA 84:8573-8277) for transient amplification/expression in mammalian cells, while CHO (dhfr Chinese Hamster Qvary) cells are used with vectors such as pMT2PC (Kaufman et al. (1987), EMBO J. 6:187-195) for stable amplification/expression in mammalian cells. Vector DNA can be introduced into mammalian cells via conventional techniques 2 0 such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, or electroporation. Suitable methods for transforming host cells can be found in Sambrook et aL (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks. Although those skilled in the art use various methods of expression, expression in 2 5 procaiyotes is most often carried out in E coli with either fusion or non-fusion inducible expression vectors. Fusion vectors usually add a number of NH2 terminal amino acids to the expressed target gene. These NH2 terminal amino acids often arc referred to as a reporter group. Such reporter groups usually serve two purposes: 1) to increase the solubility of the target recombinant protein; and 2) to aid in the purification of the target 30 recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the reporter group and the target recombinant protein to enable separation of the target recombinant protein from the reporter group subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and 35 enterokinase. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRIT5 WO 95/06727 PCT/US94/10257 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase, maltose E binding protein, or protein A, respectively, to the target recombinant protein. Inducible non-fusion expression vectors include pTrc (Amann etal., (1988) Gene 69:301-315) and pET lid (Studier et aL, Gene Expression Technology^Jiethods in Enzymology 5 185, Academic Press, San Diego, California (1990) 60-89). While target gene expression relies on host RNA polymerase transcription from the hybrid trp-lac fusion promoter in pTrc, expression of target genes inserted into pET 1 Id relies on transcription from the 17 gnlO-lac 0 fusion promoter mediated by coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident 10 g prophage harboring a T7 gnl under the transcriptional control of the lacUV 5 promoter. One strategy to maximize expression in & coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy would be to alter the coding sequence of the 15 gene so that the individual codons for each amino acid would be those preferentially utilized in highly expressed E. coli proteins (Wada et al., (1992) Nuc Acids Res 20:2111-2118). Such alteration of nucleic acid sequences of the invention could be carried out by standard DNA synthesis techniques. Upon expression of the encoding gene, the recombinant protein or peptide 20 product may be secreted and harvested from the medium. Alternatively, the protein may be retained cytoplasmically and the cells harvested, lysed and the protein isolated and purified. Suitable media for cell culture are well known in the art. The protein and peptides of the invention can be purified from cell culture medium, host cells, or both using techniques known in the art for purifying proteins and peptides including ion- 2 5 exchange chromatography, gel filtration chromatography, metal affinity chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with specific antibodies. The terms isolated and purified are used interchangeably herein and refer to peptides, protein, protein fragments, and nucleic acid molecules substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical 3 0 precursors or other chemicals when chemically synthesized. Accordingly, an isolated peptide is produced recombinantly or synthetically and is substantially free of cellular material and culture medium or substantially free of chemical precursors or other chemicals. 8 WO 95/06727 PCT/US94/10257 Antigenic Fragments and the; "Antigenic" Response Fragments of the invention protein that elicit a desired antigenic response (referred to interchangeably herein as antigenic fragments or peptides) may be obtained, 5 for example, by screening peptides corresponding to portions of the protein . These peptides may be chemically synthesized using techniques known in the art, or produced recombinantly, or through proteolysis. For example, the protein may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments are tested to 10 determine their antigenicity (e.g., the ability of the fragment to induce an immune response in a mammal). If fragments of the protein are to be used for therapeutic purposes, then the fragments which are capable of eliciting a T-cell response, such as stimulation (i.e., proliferation or lymphokine secretion) and/or are capable of inducing T-cell anergy are particularly desirable. 15 The isolated protein or preferred antigenic fragments thereof, when administered to an individual subject to demyelinating autoimmune disease, are capable of modifying the B-cell response, T-cell response, or both the B-ccll and the T-cell response of the individual to the autoantigen, or can be shown to result in a diminution of symptoms. As referred to herein, a diminution in symptoms includes any reduction in 2 0 demyelination characteristic of the disease condition following a treatment regimen with a peptide or protein of the invention. This diminution in symptoms may be determined subjectively or clinically. Human T-cell stimulating activity can be tested by culturing T-cells obtained from a subject having an autoimmune condition with the autoantigen and/or a 2 5 peptide derived from the autoantigen and determining whether proliferation of T-cells occurs in response to the autoantigen and/or peptide as measured, e.g., by cellular uptake of tritiated thymidine. Stimulation indices for responses by T-cells to peptides can be calculated as the maximum CPM in response to a peptide divided by the control CPM. A stimulation index (S.I.) equal to or greater than two times the background level is 3 0 considered "positive". Positive results are used to calculate the mean stimulation index for each peptide for the group of patients tested. Preferred peptides of this invention comprise at least one T-cell epitope and have a mean T-cell stimulation index of greater than or equal to l.S. A peptide having a mean T-cell stimulation index of greater than or equal to 1.5 in a significant number of patients tested (i.e. at least 10% of patients tested) 35 is considered useful as a therapeutic agent Preferred peptides have a mean T-cell stimulation index of at least 1.5, more preferably at least 2.0 to 3.0. 9 WO 95/06727 PCT/US94/10257 Preferred peptides can also be identified by their ability to effect a relatively higher frequency of T-cells in a patient. This frequency is measured by generating multiple identical cultures from one patient with limiting numbers of lymphocytes and the autoantigen and/or a peptide from the autoantigen. Individual 5 cultures are analyzed for positive reactivity with a peptide, as defined by stimulation index (described above). The frequency of peptide-reactive T-cells is the percentage of cultures from the patient that show a positive stimulation index. In addition, preferred peptides have a positivity index (P.I.) of at least about 100, more preferably at least about 200 and most preferably at least about 300. The 10 positivity index for a peptide is determined by multiplying the mean T-cell stimulation index by the percent of individuals, in a population of autoimmune patients (e.g., preferably at least 15 individuals, more preferably at least 30 individuals or more), who have a T-cell stimulation index to such peptide of at least 1.5, more preferably at least 2.0. Thus, the positivity index represents both the strength of a T-cell response to a peptide 15 (S.I.) and the frequency of a T-cell response to a peptide in a population of autoimmune individuals. In order to determine precise T-cell epitopes by, for example, fine mapping techniques, a peptide having T-cell stimulating activity and thus comprising at least one T-cell epitope as determined by T-cell biology techniques is modified by 2 0 addition or deletion of amino acid residues at either the amino or carboxy terminus of the peptide and tested to determine a change in T-cell reactivity to the modified peptide. If two or more peptides which share an area of overlap in the native protein sequence are found to have human T-cell stimulating activity, as determined by T-cell biology techniques, additional peptides can be produced comprising all or a portion of such 2 5 peptides and these additional peptides can be tested by a similar procedure. Following this technique, peptides are selected and produced recombinantly or synthetically. Peptides are selected based on various factors, including the strength of the T-cell response to the peptide (e.g., stimulation index) and the frequency of the T-cell response to the peptide in a population of autoimmune subjects. The physical and chemical 3 0 properties of these selected peptides (e.g., solubility, stability) are examined to determine whether the peptides are suitable for use in therapeutic compositions or whether the peptides require modification as described herein. The ability of the selected peptides or selected modified peptides to stimulate human T-cells (e.g., induce proliferation, lymphokine secretion) is determined. 10 WO 95/06727 PCT/US94/10257 A T-cell epitope-containing peptide of the invention, when administered to a subject in a therapeutic treatment regimen is capable of modifying the response of the individual to the autoantigen. Preferred peptides of the invention comprise at least one T-cell epitope of 5 the full length protein and accordingly the peptide comprises at least approximately 7, preferably at least about 12-40, and more preferably 13-30 amino acid residues. The peptides may contain tandem repeats of a single epitope and/or more than one epitope. For purposes of therapeutic effectiveness, preferred therapeutic compositions of the invention preferably comprise at least two T-cell epitopes. Additionally, therapeutic 10 compositions comprising one or more preferred isolated peptides of the invention preferably comprise a sufficient percentage of the T-cell epitopes of the entire protein such that a therapeutic regimen of administration of the composition results in amelioration of disease symptoms. Synthetically produced peptides of the invention comprising less than approximately forty-five amino acid residues, and most preferably 15 less than approximately thirty amino acid residues are particularly desirable as increases in length may result in difficulty in peptide synthesis. Peptides of the invention may also be produced recombinantly as described above, and it is preferable that peptides of 45 amino acids or longer be produced recombinantly. Isolated antigenic peptide fragments which have T-cell stimulating 20 activity, and thus comprise at least one T-cell epitope are particularly desirable. In referring to an epitope, the epitope will be the basic element, or smallest unit of recognition by a receptor, particularly immunoglobulins, histocompatibility antigens, and T-cell receptors, where the epitope comprises amino acids of the native protein. Amino acid sequences which mimic those of the epitopes can also be used. A T-cell epitope is 25 the basic element, or smallest unit of recognition a T-cell receptor, where the epitope comprises amino acids in the autoantigen essential to receptor recognition. Amino acid sequences which mimic those of the native T-cell epitopes are also within the scope of this invention. T-cell epitopes are believed to be involved in initiation and perpetuation of the autoimmune response. These T-cell epitopes are thought to trigger early events at 30 the level of the T helper cell by being presented by an appropriate HLA molecule on the surface of an antigen presenting cell, thereby stimulating the T-cell subpopulation with the relevant T-cell receptor for the epitope. These events lead to T-cell proliferation, lymphokine secretion, local inflammatory reactions, recruitment of additional immune cells to the site of antigen/T-cell interaction, and activation of the B-cell cascade leading 35 to the production of antibodies. 11 WO 95/06727 PCT/13S94/10257 Exposure of a subject to a peptide or protein which comprises at least one T-cell epitope of the autoantigen may tolerize, anergize or otherwise modify appropriate T-cell subpopulations such that they become non-responsive to the autoantigen and do not participate in stimulating an immune response. In addition, administration of a protein or peptide which comprises at least one T-cell epitope, may modify the lymphokine secretion profile as compared with exposure to the naturally-occurring autoantigen (e.g., result in a decrease of TL-4 and/or an increase in IL-2 causing a modification of TH, and THj populations). Furth more, exposure to such a protein or peptide may influence T-cell subpopulations which normally participate in the response to the autoantigen such that these T-cells are drawn away from the site(s) of normal exposure to the autoantigen (e.g., tissues of the CNS) to the site(s) of therapeutic administration of the protein or peptide derived therefrom. This redistribution of T-cell subpopulations may ameliorate or reduce the ability of an individual's imnuie system to stimulate the usual immune response at the site of normal exposure to the autoantigen, resulting in a diminution in symptoms. In determining which peptides are T-cell epitope-containing peptides for a specific disease, those skilled in the ait might approach the task in many ways each of which is acceptable. In the instant invention, the procedures selected are not meant to be limiting. The selection of one mode of approaching a task is not intended to exclude other modes which can accomplish the same end by alternative means by those skilled in the art, for example, the selection of likely T-cell epitope-containing peptide from a group of peptides. Generally, in the instant application, as further explained in more detail herein, a protein is purified and analyzed, peptides are selected for testing, the selected peptides are produced, and the selected peptides are tested for properties characteristic of T-cell epitopes. T-Cell Epitope Regions of Human MOG Peptides derived from human MOG which moderate the response of a subject to the MOG autoantigen are also included in the invention. Likely candidates for such peptides can be tested for the effect on T-cell proliferation, as previously discussed and/or testing for a candidate's affinity for binding HLA DR proteins (procedures for obtaining HLA DR proteins is discussed in detail in the section below entitled "Purification and Analysis of HLA DR proteins"). Such peptides can be identified, for example, by examining the structure and selecting appropriate regions to be produced as peptides (via recombinant expression systems, synthetically or otherwise) to be examined 12 WO 95/06727 PCT/US94/10257 for ability to influence B-cell and/or T-cell responses, and selecting peptides containing epitopes recognized by these cells. One method of identifying such peptides includes dividing the human MOG protein antigen into non-overlapping, or overlapping peptides of desired lengths and synthesizing, purifying and testing those peptides to determine whether the peptides comprise at least one T cell epitope using any number of assays. In another method, an algorithm is used for predicting those peptides. Other methods known to those skilled in the art may also be employed. In the instant application, certain of the peptides were selected using the algorithm as discussed in more detail herein. Thirty-seven (37) naturally occurring 13-mers (together with three analogs of the naturally occurring peptides) are shown in Fiigure 2 (SEQ ID NOS: 4-9,11,15,16, and 42-72).; the amino acid length is arbitrarily chosen. These peptides were chosen according to an algorithm that predicts optimal MHC class II binding. In order for the peptide to be able to bind an appropriate T-cell receptor, it is necessary that it be able to bind class n MHC proteins. It is possible to remove 1-2 amino acids from the N- and/or C-terminus of each and still retain MHC binding activity. These peptides are designated by amino acid sequence and represent the indicated regions of the mature amino acid sequence shown as positions 1-218 of Figure 1 (SEQ ID NO: 2). These subunit peptides are characterized by their ability to bind Class n MHC proteins so as to have the ability to be presented effectively as T-cell epitopes.(Rothbud, et al., The EMBO Journal 7:93-100,1988). It has been found that a necessary (but not necessarily sufficient) condition for binding to Class II MHC proteins is the presence of a hydrophobic side chain residue, preferably a tyrosine, phenylalanine or tryptophan residue, and less desirably isoleucine, leucine, valine or methionine residue spaced at a 4-amino acid distance from a small amino acid residue such as glycine, alanine, serine, threonine or cysteine. All of the MOG peptides shown in Figure 2 (SEQ ID NOS: 4-9,11,15,16, and 42-72) fulfill these minimum conditions. As further shown in Figure 2, all of these peptides have been tested with respect to their ability to bind MHC proteins encoded by certain alleles. As shown by the ICjo values in the figure, most of these peptides bind tightly to both DRB 1*0101 and DR Bl*1501. The specifics of peptide binding are contained in the section on Inhibition assays described below. Figure 2 is intended to be a representative example of die algorithm for selecting and is quite useful. It is, however, not all inclusive as otter possible useful antigenic peptides may exist The requirement for the 4 amino acid spacing between the hydrophobic residue and small residue used as the basis for identifying the peptides as described in the preceding paragraph has been verified using experimental protocols as follows: The design of the experiments assumed that all peptides bind in approximately identical 13 WO 95/06727 PCT/US94/10257 locations, oriented by interactions with the peptide backbone and adopt closely related conformations. The design of the experiments also assumed that the binding site of MHC Class II molecules can be divided into separate subsites that differentially contribute to binding, that the overall free energy of binding is the sum of the advantageous and 5 deleterious contacts a peptide makes with the pockets, and that the interaction between the peptide in each of the pockets can be viewed independently. The results of the experiments support these postulates, as well as a model of free eneigy of binding as a simple polynomial with separate terms for backbone interactions in the side chains. For peptides of common length, the backbone terms would be constant while the contribution 10 of side chains would vary depending on their structure and the chemical composition and size of the complementary pocket in the binding site. The relative importance of each side chain position will vary depending on the allele and the isotype, but in general peptide binding can be viewed as the sum of separate independent events. Thus, the results of applicants' experiments show that the apparent affinity 15 of any sequence of common length can be predicted within a factor of 2 or 3 of the experimentally determined values based on a database of the relative effects of the natural amino acids in each position of model peptides. All possible monosubstituted analogs at the central 11 positions of the simplified peptide, AAYAAAKAAAAAA (SEQ ID NO: 33) were synthesized and assayed for binding to DRB 1*0401 (formerly called 2 0 DR4DW4). From the measured ICjo values of each analog, a ratio relative to the parent simplified peptide was calculated. These ratios and the measured values are shown in Figure 3. The ratios were then used to predict the affinity of 12 unrelated natural sequences corresponding to peptides known to bind DRB 1*0401 with a wide range of affinity as shown in Figure 4 (SEQ ID NOS: 19-32). The data shown on Figures 3 and 4 2 5 verify that the model is useful in predicting the 4 amino acid spacing and is consistent with experimental results. Using this model, candidates of 13mers were selected as likely T-cell epitope-containing peptides. Purification and Analysis of HLA DR proteins 3 0 The procedures used for detergent solubilization and affinity purification of HLA-DR (human MHC protein) molecules were similar to those described by Gorga (J.BioLChem. 262:16087-16094,1987) and Buelow (EurJJmimmoll3:69-76,1993). Briefly, CHO cells transfected with the genes for the DRBl'0101 and DRB 1*1501.alleles (Marshall et al., J.Immunol„ 152:4946-4957,1994) were grown in RPMI1640 medium supplemented with 10% 35 heat inactivated fetal calf serum (FCS),2mM glutamine, and anitbiotics. Cells were harvested, washed in PBS< lysed with 1% NP-40 and the supernatant separated from 14 WO 95/06727 PCT/US94/10257 nuclear debris by centrifugation. The solubilized MHC class n proteins were affinity purified using the monoclonal antibody LB3.1, coupled to Sepharose CL4B. Qass II proteins were eluted with 1% octyl-jJ-D-glucopyranoside (octyl glucoside), 50mM phosphate pH 11.5 and immediately neutralized using 1M phosphate pH 6.0. Purified a0 heterodimers were isolated by size exclusion using a 60 cm x 2.5 cm diameter column of Bio-Gel A0.5. The fractions containing the heterodimers were concentrated using Amicon Centri-Prep® 30 devices to a nominal concentration of 500 Jig/ml. The purity of the material was assayed by SDS-PAGE, high performance size exclusion chromatography (HPSEC), and Edman sequencing as previously described (Buelow et al., 1993). The HPSEC column was a BIOSEP SEC-S3000 (300 x 7.5 mm) (Phenomenex), eluted using a buffer system of PBS containing 1.0% octyl glucoside and 1.0% acetonitrile at a flow rate of 0.800 ml/min (approximately 25 minutes per run). The fluorescence detector was set to monitor tryptophan fluorescence (A^,® 282 nm. = 348 nm). Inhibition assays Peptide binding assays were performed as previously described (Hill et al.,1994). Briefly, affinity purified class II proteins (lOnM) woe incubated with serial dilutions of the test peptide and a fixed concentration of biotinylated HA 307-319 (2 nM) in PBS containing 1.0% octyl glucoside at pH 6.5 in 96 well polypropylene plates (Costar) for 16 hours at 37°C. The DR-peptide complexes (50fil) were transferred, in duplicate, to wells of a 9&>well microtiter plate precoated with the monoclonal antibody LB3.1 and blocked with fetal calf serum. Excess peptide was removed by washing with PBS containing 0.02% Tween 20 and 0.05%NaN3. Europium labeled streptavidin (Pharmacia) was added and incubated overnight After washing, a solution of 0.1M acetate/phthalatebuffer, pH 3.2, containing 0.1% Triton X-100,15 |iM 2-naphthoyltrifluoroacetone and 50 flM tri-N-octylphosphine oxide was added to release the chelated europium from strepavidin. The resulting fluorescence (which was proportional to the amount of bound biotinylated HA 307-319) was measured using a fluorescent plate reader (DELPHIA LKB/Pharmacia). The data were analyzed by fitting the data to a binding function that calculated the concentration of test peptide to bind to a specific class II protein can be ranked by die corresponding ICjq values, with the lower values corresponding to better binding peptides. 15 WO 95/06727 PCT/U894/10257 T-cell assay used to identify MOG epitopes T-cell assays were performed to further refine the identification of T-cell epitopes. Peripheral blood lymphocytes were isolated from the blood of a human 5 volunteer HLA-DR2 positive donor using the techniques outlined in Example 2 herein. The MOG peptides selected for testing were: MOO 1-13 GQFRVIGPRHPIR (SEQ ID NO: 42) MOO 20-32 VELPCRISPGKNA (SEQ ID NO: 5) 10 MOO 70-82, A78 ELLKDAIGAGKVT (analog to MOG 70-82) (SEQ ID NO: 8) MOO 88-100JC89^98 VKFSDEGGFTSFF (analog to MOG 88-100) (SEQ ID NO: 9) MOG 103-115 HSYQEEAAMELKV (SEQ ID NO: 55) MOG 118-130 PFYWVSPGVLVLL (SEQ ID NO: 56) MOG 170-182 PHFLRVPCWKTIL (SEQ ID NO: 15) 15 Results of one such study of T-cell response to human MOG peptides is illustrated in Figure 6. The results have been interpreted and indicate that MOG 1-13 (SEQ ID NO: 42) is a borderline T-cell epitope-containing peptide. Furthermore, the same data strongly indicates that MOG 103-115 (SEQ ID NO: 55) contains at least one epitope. Still further, 2 0 these results do not preclude the possibility that less than the entire 13 mer peptide could be a T-cell epitope-containing peptide. Further, T-cell response of a human patient suffering from Multiple Sclerosis is discussed in Example 4, where a mixture of MOG peptides (20 amino acids in length and shown in Figure 5a) was found to contain at least one T-cell epitope for the 25 auto antigen responsible for Multiple Sclerosis. Furthermore, these results do not preclude the possibility that less than an entire 20 mer peptide could be a T-cell epitope-containing peptide. The structure of the protein or peptides of the invention can be modified for such purposes as increasing solubility, enhancing therapeutic or prophylactic efficacy, 30 or stability (e.g., shelf life ex vivo and resistance to proteolytic degradation in vivo), or generally by conservative substitutions and modifications. A modified protein or peptide can be produced in which the amino acid sequence has been altered, such as by amino acid substitution, deletion, or addition, to modify immunogenicity, or to which a component has been added for the same purpose. Figure 2 shows 3 such amino acids, 3 5 Human MOG 70-82^78 (SEQ ID NO: 8); Human MOG 74-86^78 (SEQ ID NO: 53); and Human MOG 88-100, K89, S98 (SEQ ID NO: 9). Modification must be made in such a way that the ability to recognize the appropriate T-cell subset is not altered. It is generally understood in the art which 16 WO 95/06727 PCT/US94/10257 locations of amino acid side chains are oriented toward the upper surface of the APC and which point inward. Those that point inward are suitable candidates for modification since they clearly are less likely to affect binding to the appropriate T-cell receptor. One embodiment of the present invention features a peptide which 5 comprises at least one T-cell epitope of the protein and includes the regions of the peptides as shown in Figures 2, Sa and/or Sb that are significant for T-cell receptor binding or the modified forms thereof as above described, optionally extended at the N-and/or C-terminus with irrelevant amino acid sequence. Another embodiment of the present invention provides peptides 10 comprising at least two T-cell epitopes as described above. The T-cell epitopes may be identical or may be different T-cell epitopes appropriate for human MOO. As further described above, the T-cell epitopes are typically at least 7 amino acids, preferably 12-40 amino acids, even more preferably 13-30 amino acids in length. If desired, the amino acid sequences of the T-cell epitopes can be joined by a linker to increase sensitivity to 15 processing by antigen-presenting cells. Such linker can be any non-epitope amino acid sequence or other appropriate linking or joining agent In preferred peptides comprising at least two T-cell epitopes, the epitopes are arranged in the same or a different configuration firom a naturally-occurring configuration of the epitopes in the native human MOG protein. For example, the T-cell cpitope(s) can be arranged in a contiguous 20 or noncontiguous configuration. Noncontiguous is defined as an arrangement of T-cell epitope(s) which contains additional residues between the epitopes. Furthermore, the T-cell epitopes can be arranged in a nonsequential order (e.g., in an order different firom the oider of the amino acids of the native protein from which T-cell epitope(s) are derived). A peptide of the invention can comprise at least 10%, at least 20%, at least 25 30%, at least 40%, at least 60% or more of the T-cell epitopes of human MOG. Preferred peptides comprise various combinations of two or more of the above-discussed T-cell epitopes. Preferred peptides comprising a combination of two or more epitopes are those wherein the peptides include sequences selected from those in Figure 2 (SEQ ID NOS: 4-9,11,15,16, and 42-72), Figure 5a and Figure 5b. 30 A protein or peptide of the invention can be modified so that it maintains the ability to induce T-cell unresponsiveness and bind MHC proteins without the ability to induce a strong or any proliferative response when administered in immunogenic form. In this instance, critical binding residues for T-cell receptor function can be determined using known techniques (e.g., substitution of each residue and determination of the 35 presence or absence of T-cell reactivity). Those residues shown to be essential to interact with the T-cell receptor can be modified by replacing the essential amino acid with 17 WO 95/06727 PCT/IJS94/10257 another, preferably similar amino acid residue (a conservative substitution) whose presence is shown to enhance or diminish, but not eliminate T-cell reactivity. In addition, those amino acid residues which are not essential for T-cell receptor interaction can be modified by being replaced by another amino acid whose incorporation may enhance or 5 diminish T-cell reactivity, but does not eliminate binding to relevant MHC. Additionally, peptides of the invention can be modified by replacing an amino acid shown to be essential to interact with the MHC protein complex with another, preferably similar amino acid residue (conservative substitution) whose presence is shown to enhance or diminish, but not to eliminate T-cell activity. It is believed that 10 peptides that bind MHC with higher affinity should render T-cells immunopassive in vivo at lower concentrations. In addition, amino acid residues which are not essential for interaction with the MHC protein complex but which are present on the bound peptide can be modified by being replaced by another amino acid whose incorporation may enhance or diminish, but not eliminate T-cell reactivity. Preferred amino acid 15 substitutions for non-essential amino acids include, but are not limited to substitutions with alanine, glutamic acid, or a methyl amino acid. Another example of modification of proteins or peptides is substitution of cysteine residues preferably with alanine, serine, threonine, leucine or glutamic acid residues to minimize dimerization via disulfide linkages. In addition, amino acid side 20 chains of peptides of the invention can be chemically modified. Another modification is cyclization of the peptide. In order to enhance stability and/or reactivity, the protein or peptides of the invention can be modified to incorporate one or more polymorphisms in the amino acid sequence of the protein autoantigen resulting firom any natural allelic variation. 2 5 Additionally, D-amino acids, non-natural amino adds, or non-amino acid Bialogs can be substituted or added to produce a modified protein or peptide within the srop? of this invention. Furthermore, proteins or peptides of the present invention can be modified using polyethylene glycol (PEG) according to the method of A. Sehon and co-workers (Wie et aL, supra) to produce a protein or peptide conjugated with PEG. In addition, 30 PEG can be added during chemical synthesis of a protein or peptide of the invention. Modification of proteins or peptides or portions thereof can also include reduction/alkylation (Tarr in: Methods of Protein Microcharacterization, J. E Silver eA, Hmnm» Press, Clifton NJ155-194 (1986)); acylation (Tan, supra); chemical coupling to an appropriate carrier (MitheU and Shiigi, eds, Selected Methods in CellularImmunology, WH Freeman, San Francisco, 35 CA (1980), U.S. Patent 4,939,239; or mild formalin treatment (Marsh (1971), IntArch of Allergy andAppl Immunol 41:199-215). 18 WO 95/06727 PCT/US94/10257 To facilitate purification and potentially increase solubility of protein or peptides of the invention, it is possible to add an amino acid reporter group to the peptide backbone. For example, hexahistidine can be added to a protein or peptide for purification by immobilized metal ion affinity chromatography (Hochuli, E. et al., (1988) 5 Bio/Technology 6:1321-1325). In addition, to facilitate isolation of protein or peptides free of irrelevant sequences, specific endoprotease cleavage sites can be introduced between the sequences of the reporter group and the protein or peptide. In order to successfully desensitize an individual to a protein antigen, it may be necessary to increase the solubility of a protein or peptide by adding functional groups to the protein or peptide, or 10 by omitting hydrophobic regions of the protein. To potentially aid proper antigen processing of T-cell epitopes within a peptide, canonical protease sensitive sites can be engineered between regions, each comprising at least one T-cell epitope via recombinant or synthetic methods. For example, charged amino acid pain, such as KK or RR, can be introduced between regions 15 within a peptide during recombinant construction of the peptide. The resulting peptide can be rendered sensitive to cleavage by cathepsin and/or other trypsin-like enzymes which would generate portions of the peptide containing one or more T-cell epitopes. In addition, such charged amino acid residues can result in an increase in the solubility of a peptide. 2 0 Site-directed mutagenesis of DNA encoding a peptide or protein of the invention can be used to modify the structure of the peptide or protein by methods known in the art Such methods may, among others, include polymerase chain reaction (PCR) with oligonucleotide primers bearing one or more mutations (Ho et al, (1989) Gene 77:51-59) or total synthesis Of mutated genes (Hostomsky, Z. et al., (1989) Biodiem Biophys Res Comm 2 5 161:1056-1063). To enhance recombinant protein expression, the aforementioned methods can be applied to change the codons present in the cDNA sequence of the invention to those preferentially utilized by the host cell in which the recombinant protein is being expressed (Wada et al., supra). 3 0 The isolated protein and/or antigenic fragments can be used in methods of diagnosing, treating, and preventing demyelinating autoimmune responses. Thus, the present invention provides therapeutic compositions comprising isolated human MOG (SEQ ID NOS: 1 and 2), or antigenic fragment thereof, and a pharmaceutical^ acceptable carrier or diluent Furthermore, the isolated protein and/or fragments can be used in 3 5 screening for the autoimmune disease and for developing candidates for therapeutic compositions. 19 WO 95/06727 PCT/US94/10257 Pharmaceutical Compositions Administration of the therapeutic compositions of the present invention can be carried out using known procedures, at dosages and for periods of time effective to 5 ameliorate the disease. In addition to compositions containing a single peptide or protein, mixtures of at least two peptides (e.g., a physical mixture of at least two peptides), each comprising at least one T-cell epitope of human MOG can also be provided such compositions can be administered in the form of a therapeutic composition with a pharmaceutically acceptable carrier of diluentStill further, the therapeutic composition 10 may contain peptides comprising at least two regions, each region comprising at least one T-cell epitope of MOG and which regions may be arranged in a configuration different from a naturally-occurring configuration of the regions in human MOG. A therapeutically effective amount of one or more of such compositions can be administered simultaneously or sequentially. 15 Preferred compositions and preferred combinations of peptides which can be administered simultaneously or sequentially comprise peptides comprising amino acid sequences shown in Figures 2 (SEQ ID NOS: .4-9,11,15,16, and 42-72), 5a (SEQ ID NOS. 73-80,82,83) and 5b (the first 121 amino acids of human MOG protein SEQ ID NO. 2), more preferably, MOG 1-13 (SEQ ID NO. 42) and MOG103-115 (SEQ ID NO. 20 55). Effective amounts of the therapeutic compositions will vary according to factors such as the degree of susceptibility of the individual, the age, sex, and weight of the individual, and the ability of the protein or fragment thereof to elicit an antigenic response in the individual. Dosage regime may be adjusted to provide the optimum 25 therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. The protein, peptide or pharmaceutical composition thereof may be administered in a convenient manner such as by injection (subcutaneous, intravenous, 3 0 etc.), oral administration, sublingual administration, inhalation, transdermal application, or rectal administration. Depending on the route of administration, composition may include a coating with in a material to protect from the action of enzymes, acids and other natural conditions which may cause inactivation. For administration by injection, for example, about l^g-3mg and 3 5 preferably from about 20^g-750^g of protein or peptide per dosage unit is typical. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions 20 WO 95/06727 PCT/CS94/10257 (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the 5 contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintain^, for example, by the use of a coating such as lecithin, by the maintenance of the required 10 particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabenz, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged 15 absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active ingredient in the required amount in an appropriate solvent with one or a combination of 20 ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-diying 2 5 which yields a powder of the active ingredient (i.e., protein or peptide) plus any additional desired ingredient from a previously sterile-filiered solution thereof. The protein or fragment thereof may be administered to an individual in an appropriate diluent or adjuvant, co-administered with enzyme inhibitors or in an appropriate carrier such as liposomes. Phannaceutically acceptable diluents include 3 0 saline and aqueous buffer solutions. Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water 3 5 CGF emulsions as well as conventional liposome^ (Strcjan et aL, (1984) J. Neuroimmunol. 7:27). For purposes of inducing T-cell nonresponsiveness, the therapeutic composition is 21 WO 95/06727 PCT/US94/10257 preferably administered in non-immunogenic form, e.g., one that does not contain adjuvant When protein or peptide is suitably protected, as described above, the protein or peptide may be orally administered, for example, with an inert diluent or an 5 assimilable edible earner. The protein and other ingredients may also be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions 10 and preparations contain an effective amount. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit contains between from about 10 |i.g to about 200 mg of active compound. 15 As used herein "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the 2 0 therapeutic compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the 2 5 mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieve, and (b) the 3 0 limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals. The present invention also provides compositions comprising at least two peptides (e.g., a physical mixture of at least two peptides), each comprising at least one T-cell epitope. Such compositions can be administered to an individual in the form of a 3 5 therapeutic comp osition with a pharmaceutically acceptable carrier or diluent as 22 WO 95/06727 PCT/US94/10257 hereinbefore described. A therapeutically effective amount of one or more of such compositions can be administered simultaneously or sequentially. Diagnosis 5 The proteins or peptides of the present invention can be used in "purified" form for standardization of reagents for the diagnosis and treatment of autoimmune disease. The isolated and purified protein or peptide is also useful to prepare antisera or monoclonal antibodies for use in diagnosis. An animal such as a mouse or rabbit can be immunized with an immunogenic form of the isolated protein or isolated peptide, if 10 necessary, conferring immunogenicity on a protein or peptide by coupling to carriers or by other techniques well known in the art The protein or peptide can be administered in the presence of adjuvant, and progress of immunization can be monitored by detection of antibody titers in plasma or serum standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies. 15 Following immunization, antisera can be obtained and polyclonal antibodies isolated, if desired, from the serum. To produce monoclonal antibodies, antibody producing cells (lymphocytes) are harvested from an immunized animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Hybridoma cells can be screened 2 0 immunochemically for production of antibodies reactive with the invention protein or peptide thereof. The antisera or monoclonal antibodies can be used to standardize reagents in standard assays. Protein, peptides, or antibodies of the present invention can also be used for detecting and diagnosing autoimmune disease. For example, this could be done by 2 5 combining blood, or blood products, obtained from an individual with an isolated antigenic peptide under conditions appropriate for binding of components in the blood (e.g., antibodies, HLA molecules, T-cells and B-cells) with the peptide(s) or protein, and determining the extent to which such binding occurs. Other diagnostic methods for autoimmune diseases which the protein, peptides or antibodies of the present invention 30 can be used include paper radioimmunosorbent test (PRIST), enzyme linked immunosorbent assays (ELISA), radioimmunoassays (RIA), immunoradiometric assays (IRMA), and luminescence immunoassays (LIA). Primers. Probes and Other Oligomers 3 5 The availability of the nucleotide sequence shown in Figure 1 (SEQ ED NO: 1) and of its complement (SEQ ID NO: 2) permit the design of various 23 WO 95/06727 PCT/US94/10257 oligonucleotides useful in therapeutic and diagnostic contexts. Modulation of the expression of the gene encoding MOG affects the progression of the autoimmune disease; in addition, progression can be monitored by monitoring expression using probes for RNA. Also, oligomers based on the nucleotide sequence disclosed in Figure 1 herein can 5 be used in standard assay methods for detecting the MOG-encoding DNA or RNA. By oligomers "based on" the sequence disclosed in Figure 1 (SEQ ID NO: 1) is meant oligomers that contain portions of this sequence, that are complementary to the sequence or portions thereof, that represent primers used to amplify portions of the sequence when large amounts of DNA are desirable (such as for genetic manipulation) as 10 well as oligomers designed on the basis of the disclosed sequence which effect triple helix formation with the relevant portion of the duplex representing the MOG gene. Relevant design parameters for PCR primers, oligomers capable of hybridizing to single strand targets, and oligomers capable of triple helix formation with DNA duplexes are well known in the art. Thus, oligomers "based on" the DNA of Figure 1 (SEQ ID NO: 1) 15 may have the same sequence as a portion of this DNA, the same sequence as the complement or portion thereof, or a different sequence but one which corresponds to that disclosed in Figure 1 (SEQ ID NO: 1) through art-known design parameters. The oligomers having nucleotide sequences based on the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) may be conventional RNA or DNA 2 0 polymers, or may be modified forms thereof as generally known in the art For example, the phosphodiester bonds of the oligomers may be substituted by alternative linkages such as phosphorothioates, methylphosphonates and the like. In addition, alternative scaffolding for nucleotide bases has also been disclosed and such modifications are included within the scope of oligomers claimed herein. 25 The following examples are intended to illustrate, but not to limit the invention. Example 1 30 cDNA Encoding Human MOG Protein In an initial attempt to obtain human DNA encoding MOG protein, a human cDNA library was subjected to the polymerase chain reaction (PCR) using 3' and 5' primers designed from the published rat MOG coding sequence of Gardinier et al. (supra). The human MOG sequence could not be obtained in this manner, putatively due 35 to insufficient homology at the 5' and/or 3' ends of the human and rat sequences. 24 WO 95/06727 FCT/US94/10257 Therefore, four rat internal oligonucleotides were designed. Two of them were homologous to the top strand of the gene (primers 94-111 and 166-183 (SEQ ID NO: 34), base 1 starting at the ATG) and two were homologous to the bottom strand of the gene (primers 538-555 (SEQ ID NO: 35) and 685-702). The combination of primers 5 166-183 (SEQ ID NO: 34) and 538-555 (SEQ ID NO: 35) was successful in effecting the amplification of a fragment of the approximately 400 bp expected size from a human brain cDNA library. The sequence of these primers was: a) 166-183: CAGAATCCGGGAAGAATGCCACGGGC (SEP ID NO: 34); and 10 b) 538-555: CAGCGGCCGCACGGAGTTTTCCTCTCAO fSFti ID NO: 35). An EcoRI site is present in the 166-183 primer (SEQ ID NO: 34); a NotI site is present in the 538-555 primer (SEQ ID NO: 35). The 400 bp PCR product was cloned into expression vector pVL1393 by 15 digesting pVL1393 (Pharmingen CA) with EcoRI and NotI, digesting the amplified product with the same enzymes and ligating the resulting fragments. The insert was verified by digesting several clones derived from the ligated plasmids with EcoRI find NotI and sequencing the resulting 400 bp human MOG fragment The resulting insert putatively lacks ! 84 bp of 5' sequence and 201 bp of 3' sequence, based on the 738 bp rat 2 0 open reading frame. Two primers were designed from the 400 bp insert from positions 346-363 top and bottom strands as follows: 5'-r^GAATTCTCAGGTTCTrAGATGAAGGA-3' (SEQ ID NO: 36); and 25 5'-AAGCGGCCGCTATCCTTCATCTG AG A ACCT-3' (SEQ ID NO: 37). wherein an EcoRI site is present in the first strand and a NotI site in the second. Underlined regions correspond to the MOG sequence. The human MOG 346-363 top and bottom primers (SEQ ID NOS: 36 and 37) were used in combination with the above-mentioned 5' and 3' rat primers, 3 0 respectively, to amplify the 5' and 3' missing ends of the gene from the same human brain cDNA library as previously used. A PCR product corresponding the 3' end of the gene was obtained, but the corresponding 5' end did not result. The 3' fragment obtained had the expected 400 bp size and this fragment was cloned in pVL1393 and sequenced. 35 To obtain the 5' portion of the gene, a human brain medulla AgtlO library obtained from Clontech which had been previously amplified and had a titer of 8x10to 25 WO 95/06727 PCT/DS94/10257 pfu/ral was screened following the protocol described by the manufacturer. The library was plated onto 12 large plates at 30,000 plaques/plate and the plaques were lifted onto nitrocellulose filters (2 replica filters/plate). Twelve filters lifted from the 12 different plates were then hybridized to a "P labelled probe corresponding to the human MOG 5 internal 400 bp fragment initially cloned (positions 184-534). Twenty-two strong positives were obtained. A plug was picked for each positive from the original plates and incubated overnight with X dilution buffer to elute the phage from the agar. The tube was then centrifuged and the supernatant transferred. The DNA was amplified from each individual pool using either a XgtlO 10 forward primer with an SstH site: 5'-CnTTGAGCAAGTTCAGCCTGGTTAAG-3' (SEQ ID NO: 38) or a XgtlO reverse primer with an Xhol site: 5ACCTCGAGGAGGTGGCTTATGAGTAl'lTC'l" 1CCAGGGTA-3' (SEQ ID NO: 39) as well as a human MOG internal primer top or bottom strand: 5'-GGTGCGGGAAAGGTGACTCTC AGG ATCCGGAAT-3' (SEQ ID NO: 40) 15 or 5'-ATTCCGGATCCTGAGAGTCACCTTTCCCGCACC-3' (SEQ ID NO: 41). The last two primers (SEQ ID NOS: 40 and 41) include a BamHI site (underlined in the sequences) naturally present in the human MOG sequence. The primers were used in four different combinations: 1) forward 2 0 top/internal MOG bottom; 2) reverse bottom/internal MOG bottom; 3) internal MOG top/reverse bottom; and 4) internal MOG top/forward top. The first two combinations provided the 5' end of the gene (up to the BamHI site) and the last two, the 3' end of the gene. Both 5* and 3' portions include untranslated regions. Which of the two members of each combination actually resulted in 25 the desired fragment depends on the orientation of the cDNAs cloned into XgtlO. The size of the fragments obtained varied from one pool to another. Five of the largest 5' fragments or 3* fragments were subcloned into the Sstll and BamHI or BamHI and Xhol sites of the SK polylinker. Three clones from each pool were then sequenced to rule out the presence of PCR errors. This provided the complete sequence 30 of the gene coding region as well as 174 bp of the 5' untranslated sequence. The complete DNA sequence recovered (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) are shown in Figure 1. The human MOG gene encodes a preprotein of 248 amino acids which has 87% homology with the 246 amino acids in the rat protein. The mature protein contains 35 218 amino acids, numbered 1-218 in Figure 1 (SEQ ID NO: 2). The mature protein begins at the glycine shown at position 1 and is derived from the 248 amino add 26 WO 95/06727 PCT/US94/10257 preprotein by cleavage from the presequence extending firom the MET start codon to the alanine residue immediately preceding the glycine shown in position 1 • In addition, human MOO cDNA was cloned into a pET H6 vector for expression in E. coli. The pET.H6, obtained from Novagen (Madison, WI.), contains a sequence 5 encoding six histidines which allows for purification of any recombinant protein over a Ni-n- column. A truncated human MOG cDNA (no leader sequence and no transmembrane domains) encoding amino acids 1-121 of human MOG (the first 121 amino acids of SEQ ID NO. 2) was amplified by PCR using the following oligonucleotides: 10 5' primer: S'-AGCTCGAGCCGCGGAGGGCAGTTCAGAGTGATA-S' (SEQ ID NO: 94) 3' primer 5'-GACTCGAGTCACCAGTAGAAAGGATCTTC-3' (SEQ ID NO: 95) The 363 bp PCR fragment was then cloned between the unique Sstll and Xhol sites of 15 pETH6. After cloning, the cDNA was entirely sequenced. Example 1A Expression of truncated human MOG in SF-9 Insect cells and E. mli 20 SF-9 Expression The PVL1393 transfer vector containing the truncated human MOG cDNA encoding amino acids 1-121 of human MOG (the first 121 amino acids of SEQ ID NO. 2) was cotransfected into SF-9 cells along with Baculogold linearized Baculovirus DNA (Pharmingen, San Diego, CA). The culture supernatant containing recombinant viruses 25 was harvested after 4 days. The recombinant virus was plaque purified and subjected to 3 rounds of amplification to obtain a high titer viral stock. AF-9 cells were then infected with the viral stock at a MOI of 2.0. The supernatant from infected cells was harvested 48 hours after infection and applied to a NiNTA agarose column. The recombinant MOG protein was eluted inder non-denaturing conditions using 250 mM Imidazole, dialyzed 30 against 5% propionic acid and H2O and subsequently lypophilized. The protein concentration was estimated by BCA. The purified MOG protein was visualized on a 12.5% polyacrylamide gel stained with Coomassie blue. E. coli Expression 3 5 The pETJi6 vector containing the truncated human MOG cDNA was introduced into BL21(DE3) cells (Novagen, Madison, WL) by transformation. Several 27 WO 95/06727 PCT/US94/10257 10 colonies were grown together in 2YT medium to an OD of 1.0. The bacteria were then induced overnight with ImM IPTG. Cells were harvested and lysed with 6M Guanidine/lOOmM Tris.HCl pH 8.0 at room temperature overnight. The lysate was centrifuged at 20.000 rpm for 30 minutes and the resulting supernatant applied to a NiNTA agarose column (Quiagen, Chatsworth, CA). The protein was eluted with 6M Guanidine/lOOmM sodium phosphate pH 4.5, dialyzed first against 5% propionic acid, then against H2O and subsequently lypophilized. The protein concentration wa estimated by BCA. The purified MOG protein was visualized on a 12.5% polyaciylamide gel stained with Coomassie blue. Example 2 Human MOG Expressed in Insect SF-9 to Induce EAE in viva Two groups of (PLJxSJL)Fl mice were injected with 10 jig and 50 H-g respectively N-terminal fragment of recombinant human MOG expressed in insect SF-9 (-15 TM, recombinant, SF-9) which was prepared according to Examples 1 and 1A herein. The truncated MOG contains amino acids 1-121 (hereinafter intended to refer to MOG 1-121) and was selected, in part, because of its solubility relative to the solubility of amino acids 122-218 of the MOG protein (SEQ ID NO: 2). Human MOG 122-218 (residues 121-218 of SEQ ID NO. 2) is extremely hydrophobic and is believe to include two 2 0 transmembrane regions. MOG 1-121 was emulsified in complete Freund's adjuvant and injected subcutaneously in mice. At the same time as the MOG 1-121 injection, 200ng pertussis toxin was also injected intravenously. The 200ng pertussis toxin I.V. injection was repeated 2 days later. Emulsions were prepared using MOG 1-121, (-TM, recombinant, SF-9), as described above combined with 400 }ig H37Ra (Difco 25 Laboratories, Detroit, MI) in CFA. Beginning at Day 8 after initial immunization, the mice were observed for signs of paralysis and scored daily as an indicator that EAE has been contracted. Mice were scored based on clinical signs according to the following scale: 1, tail paralysis; 2, partial hind limb paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or dead. 3 0 The onset of symptoms began as early as 14 days for some mice. The mice were observed for 31 days when the mice were sacrificed, the brains and spinal cords were harvested and histological studies were undertaken to verify the clinical observations. Sixty percent (60%) of mice immunized with 50 jig of rMOG (-TM, recombinant, SF-9) and eighty percent (80%) of mice immunized with 10|ig of rMOG (-3 5 TM, recombinant, SF-9)exhibited symptoms of EAE. 28 WO 95/06727 PCT/D894/10257 This procedure was repeated substituting recombinant N-terminal firagmentofrecombmant human MOO 1-121 expressed in E.coli (-TM, recombinant, Exoli) for recombinant N-terminal fragment of recombinant human MOO 1-121 expressed in insect SF-9 (-!?' > scombinant, SF-9). Preliminary, yet unconfirmed, results 5 indicate similar findings. Thus, mice induced with EAE in this manner may be useful as an animal model for screening potential therapeutics for treatment of multiple sclerosis. The following is one method for identifying therapeutic compositions for the treatment of multiple sclerosis which comprises the steps of: 10 administering human MOG to mice in immunogenic form to cause induction of EAE in said mice; treating said mice induced with EAE with therapeutic compositions comprising at least one antigenic fragment of human MOG prior to the onset of symptoms of EAE or after the onset of symptoms of EAE in said mice; and 15 determining if said therapeutic composition prevents the onset or progression of the symtoms of EAE in said mice induced with EAE. Example 3 T-Cell Responses to human MOG Peptide 20 Peptides were synthesized using either an Applied Biosystems peptide synthesizer or Advanced Chemtech robotics system utilizing FastMOC™ chemistry with commercially available Wang resins, and Fmoc protected amino acids as described previously by Hill et sl.(j,lmmunol. 52:2890-2898,1994). The teachings of Hill, Buelow, 25 Gorga and Marshall above cited are incorporated herein by reference. T-cell assays were performed to further refine the identification of T-cell epitopes. Peripheral blood lymphocytes were isolated from the blood of a human volunteer HLA-DR2 positive donor using Ficoll Hypaque. Twenty (20) million lymphocytes were seeded into 96 wells of a microliter dish at 2 x 10s per well in RPMI 3 0 culture media supplemented with human AB serum. A mixture of selected MOG peptides was added at a final concentration of 50}iM for each peptide. The MOG peptides selected were both naturally occurring peptides and analogs of naturally occurring peptides and were: 35 MOO 1-13 GQFRVIGPRHPIR (SEQ ID NO: 42) MOG 20-32 VELPCRISPGKNA (SEQ ID NO: 5) MOG 70-82, A78 ELLKDAIGAGKVT (analog to MOG 70-82) (SEQ ID NO: 8) 29 WO 95/06727 PCT/US94/10257 MOG 88-100,K89.S98 VKFSDEGQFTSFF (analog to MOO 88-100) (SEQ ID NO: 9) MOO 103-115 HSYQEEAAMELKV (SEQ ID NO: 55) MOO 118-130 PFYWVSPOVLVLL (SEQ ID NO: 56) MOO 170-182 PHFLRVPCWKITL (SEQ ID NO: 15) 5 Cultures were incubated in a humidified C02 37°C incubator for twelve days, intermittently supplemented with human IL2 (20U/ml) and IL4 (5U/ml). A sample from each culture well was removed, washed to remove previously added peptide, and reseeded into four wells of a fresh microtiter dish (two wells with the peptide mixture and 10 two wells without the peptide mixture for each sample). Autologous irradiated cryopreserved lymphocytes were added as antigen presenting cells. After further 3 days of incubation, 3H-thymidine incorporation was measured. Positive microtiter lines were scored if the mean incorporation in the peptide wells was greater than or equal to 1.5-fold higher than the wells without peptide. Positive microtiter lines were expanded with JL2 15 and IL4, and then reassayed the following week by the same methods with the individual peptides rather than the peptide mix. The peptides identified as T-cell epitopes-conatining peptides using this method were MOG 1-13 (SEQ ID NO: 42) and MOG 103-115 (SEQ ID NO: 55). Figure 20 6 shows the results of the assays performed. Example 4 Human MS Patient T-cell Response to MOG 20mer peptides and N-terminal Fragment of Recombinant Human MOG Expressed in Insect SF-9 MM. recombinant SF-91 25 Peptides (20 amino acids in length) were synthesized using either an Applied Biosystems peptide synthesizer or Advanced Chemtech robotics system utilizing FastMOC™ chemistry with commercially available Wang resins, and Fmoc protected amino acids as described previously by Hill et al.(JJmmunol. 52:2890-2898,1994). The teachings of Hill, Buelow, Gorga and Marshall above cited are incorporated herein by 3 0 reference. These peptides are 20 ammo acid peptides of human MOG overlapping by 10 amino acids and are shown in Figure 5a. Following the procedures of Example 3, the T-cell response of a human patient suffering from Multiple Sclerosis was tested with the group of MOG 20mer peptides shown in Figure 5a and N-terminal fragment of recombinant human MOG 1-121 3 5 expressed in insect SF-9 (-TM, recombinant, SF-9), which is shown to induce EAE in mice in Example 2. One or more of the MOG peptides tested are suspected of containing at least one T-cell epitope for the autoantigen responsible for Multiple Sclerosis. 30 WO 95/06727 PCT/US94/10257 The MS patient's PBL were cultured in microtiter wells according to the protocol in Example 3, except that both recombinant MOO 1-121 (48 of 96 wdls) and a mixture of 10 MOG fragments (20-mer peptides shown in Figure Sa) (48 of 96 wells) were used separately to initiate the cultures. A sample from each culture well was removed, washed to remove previously added peptide, and reseeded into six wells of a fresh microtiter dish. Six microtiter wells were subsequently found to react with both rMOG and the peptide mixture (2 wells from the cultures initiated with rMOO and 4 wells from the cultures initiated with the peptide mixture). The results confirm that MS patients can have T-cells which can be activated by MOG and which recognize one or more T cell epitopes contained in the MOG peptide mixture. There were also a number of wells that reacted with the peptide mixture but not the recombinant MOG. The significance of these positives is less clear but it is believed that true MOG reactive T cells which recognize an epitope in Ml G which is not readily processed in vitro. 31 WO 95/06727 PCT/US94/10257 SEQUENCE LISTING (1) GENERAL INFORMATION: 5 (i) APPLICANT: DEVAUX, BRIGITTE ROTHBARO, JONATHAN SKILEK, DAMN 10 (ii) TITLE OF INVENTION: USES OF MYELIN OLIOODSNDROCYTB GLYCOPROTEIN AND PEPTIDE PORTIONS THSRBOF IN PROTOCOLS RELATED TO AUTOIMMUNE DISBASB (iii) NUMBER OF SEQUENCES: 95 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: IMMULOGIC PHARMACEUTICAL CORPORATION (B) STREET: 610 LINCOLN STREET (C) CITY: WALTHAM (D) STATEi Massachusetts (E) COUNTRY: USA (F) ZIP: 02154 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC conpatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: ASCII text (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 08/116,824 (B) FILING DATE: 03-SBP-1993 (C) CLASSIFICATION: 40 (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: ANNE I. CRAIG (B) REGISTRATION NUMBER: 32,976 (C) REFERENCE/DOCKET NUMBER: 071.1 45 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (617) 466-6000 (B) TELEFAX: (617) 466-6040 15 20 25 30 35 50 (2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1080 base pairs (B) TYPE: nucleic acid 55 (C) STRANDEMJESS: single (D) TOPOLOGY: linear (ix) FEATURE: 60 (A) NAME/KEY: CDS (B) LOCATION: 184..927 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: 32 WO 95/06727 PCT/CS94/10257 OAATTCCGGG OOQCTOTTTC TOCOOOCACA GCTOCAOCAA TTACCGGAOT OOAGOCAOGO 60 CCAGQCAGCA CTOCCTCCAA OATCTTCCCT TOGGCTTTTC AGCAOTAAOG OOACATOCAC 5 120 CCCAAOOOCC TCCACTTOGC CTOACCTTOC TOCQQGGGCT CTCTGTCCCC AOOAACAOTA 180 10 OAO ATO OCA AOC TTA TCA AOA CCC TCT CTO CCC AOC TOC CTC TOC TCC 228 Met *' % Ser Leu Sar Arg Pro Sar Leu Pro Ser Cys Leu Cya Sar 15 10 15 15 TTC CTC CTC CTC CTC CTC CTC CAA OTO TCT TCC AOC TAT OCA OOO CAO 276 Phe Lau Lau Lau Lau Leu Lau Oln Val Sar Sar Ser Tyr Ala Oly Oln 20 25 30 20 TTC AOA OTO ATA GGA CCA AOA CAC CCT ATC COO OCT CTO OTC OOO OAT 324 Phe Arg Val lie Oly Pro Arg His Pro He Arg Ala Leu Val Oly Asp 35 40 45 25 GAA OTO GAA TTG CCA TOT COC ATA TCT CCT OOO AAO AAC OCT ACA OOC 372 Glu Val Olu Leu Pro Cya Arg lie Ser Pro Oly Lys Asn Ala Thr Oly 50 55 60 30 ATO OAO OTO OOO TOO TAC COC CCC CCC TTC TCT AGO OTO OTT CAT CTC 420 Met Glu Val Oly Trp Tyr Arg Pro Pro Phe Ser Arg Val Val His Lau 65 70 75 35 TAC AOA AAT OOC AAO GAC CAA OAT OGA OAC CAO OCA CCT OAA TAT COO 468 Tyr Arg Asn Gly Lys Asp Oln Asp Oly Asp Oln Ala Pro Olu Tyr Arg 80 85 90 95 40 GGC COO ACA GAG CTO CTO AAA OAT OCT ATT GOT GAO OGA AAG GTG ACT 516 Gly Arg Thr Glu Leu Leu Lys Asp Ala lie Gly Glu Oly Lys Val Thr 100 105 110 45 CTC AGO ATC COG AAT GTA AGO TTC TCA GAT GAA GGA OGT TTC ACC TOC 564 Leu Arg lie Arg Asn Val Arg Phe Ser Asp Glu Gly Oly Phe Thr Cys 115 120 125 50 TTC TTC COA GAT CAT TCT TAC CAA GAG OAG OCA OCA ATO GAA TTG AAA 612 Phe Phe Arg Asp His Ser Tyr Gin Glu Olu Ala Ala Met Glu Leu Lys 130 135 140 55 GTA GAA GAT CCT TTC TAC TOG GTG AGO CCT GGA GTG CTO OTT CTC CTC 660 Val Glu Asp Pro Phe Tyr Trp Val Ser Pro Gly Val Leu Val Leu Leu 145 150 155 60 GCG GTG CTO CCT GTG CTC CTC CTO CAO ATC ACT GTT GGC CTO GTC TTC 708 Ala Val '.eu Pro Val Leu Leu Leu Gin lie Thr Val Gly Leu Val Phe 160 165 170 175 65 CTC TOC CTO CAG TAC AGA CTG AGA GGA AAA CTT CGA OCA OAG ATA GAO 756 33 WO 95/06727 PCT/US94/10257 Leu Cys Leu Oln Tyr Arg Leu Arg Oly Lye Leu Arg Ala Olu lie Olu 180 185 190 AAT CTC CAC COO ACT TTT OAT CCC CAC TTT CTO AOO OTO CCC TOC TOO 5 804 Asn Leu His Arg Thr Phe Asp Pro His Phe Leu Arg Val Pro Cys Trp 195 200 205 AAO ATA ACC CTO TTT OTA ATT OTO CCO OTT CTT OOA CCC TTO OTT OCC 10 852 Lys lie Thr Leu Phe Val lie Val Pro V%1 Leu Oly Pro Leu Val Ala 210 215 220 TTO ATC ATC TOC TAC AAC TOO CTA CAT CGA AOA CTA OCA OOO CAA TTC 15 900 Leu lie lie Cys Tyr Asn Trp Leu His Arg Arg Leu Ala Oly Oln Phe 225 230 235 CTT OAA OAO CTA CQA AAT CCC TTC TOAOTGATGT CACATCTTOO CAOOOOTOOA 20 954 Leu Olu Olu Leu Arg Asn Pro Phe 240 245 OOAOAOCCTO OTTOCCCAOO OATTTOTCCT TGOQOACATC TCATCCATCA AOTTOCACAC 25 1014 TCACTCOCAT CTTTOCTATO OOOACATTCC AATTTOCACT TTCAQOAACA CTCTOAATTC 1074 30 CAAOTA 1080 35 40 50 65 (2) INFORMATION FOR SEQ ID NO:2 s (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 247 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: 45 Met Ala Ser Leu Ser Arg Pro Ser Leu Pro Ser Cys Leu Cys Ser Phe 15 10 15 Leu Leu Leu Leu Leu Leu Oln Val Ser Ser Ser Tyr Ala Oly Oln Phe 20 25 30 Arg Val lie Oly Pro Arg His Pro lie Arg Ala Leu Val Oly Asp Glu 35 40 45 Val Glu Leu Pro Cys Arg lie Ser Pro Oly Lys Asn Ala Thr Oly Met 55 50 55 60 Olu Val Oly Trp Tyr Arg Pro Pro Phe Ser Arg Val Val His Leu Tyr 65 70 75 80 60 Arg Asn Oly Lys Asp Oln Asp Gly Asp Gin Ala Pro Olu Tyr Arg Gly 85 90 95 Arg Thr Olu Leu Leu Lys Asp Ala lie Oly Olu Oly Lys Val Thr Leu 100 105 110 Arg lie Arg Asn Val Arg Phe Ser Asp Glu Gly Gly Phe Thr Cys Phe 34 WO 95/06727 PCT/US94/10257 115 120 125 Phe Arg Asp His Ser Tyr Oln Olu Olu Ala Ala Met Olu Leu Lys Val 130 135 140 5 Olu Asp Pro Phe Tyr Trp Val Ser Pro Oly Val Leu Val Leu Leu Ala 145 150 155 160 Val Leu Pro Val Leu Leu Leu Oln lie Thr Val Oly Leu Val Phe Leu 10 165 170 175 Cys Leu Oln Tyr Arg Leu Arg Oly Lys Leu Arg Ala Olu lie Olu Asn 180 185 190 15 Leu His Arg Thr Phe Asp Pr > His Phe Leu Arg Val Pro Cys Trp Lys 195 200 205 20 50 lie Thr Leu Phe Val lie Val Pro Val Leu Oly Pro Leu Val Ala Leu 210 215 220 lie lie Cys Tyr Asn Trp Leu His Arg Arg Leu Ala Oly Oln Phe Leu 225 230 235 240 Olu Olu Leu Arg Asn Pro Phe 25 245 (2) INFORMATION FOR SEQ ID NO:3: 30 Ci) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acid* (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: 40 Oly Gin Phe Arg Val lie Oly Fro Arg His Pro lie 15 10 (2) INFORMATION FOR SEQ ID NO:4: 45 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: 55 His Pro lie Arg Ala Leu Val Oly Asp Glu Val Glu Leu 15 10 (2) INFORMATION FOR SEQ ID NO:5: 60 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 65 35 WO 98/06727 PCI7US94/102S7 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: Val Olu Leu Pro Cys Arg lie Ser Pro Gly Lys Asn Ala 5 1 5 10 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: 3 0 (A) LENGTH: 13 amino acids (B) TYPE: amino aoid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 15 30 45 60 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Met Olu Val Gly Trp Tyr Arg Pro Pro Phe Ser Arg Val 20 1 5 10 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: 25 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: Oly Trp Tyr Arg Pro Pro Phe Ser Arg Val Val His Leu 35 1 5 10 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: 40 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: Olu Leu Leu Lys Asp Ala lie Gly Ala Gly Lys Val Thr 50 1 5 10 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: 55 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: Val Lys Phe Ser Asp Glu Gly Gly Phe Thr Ser Phe Phe 65 1 5 10 36 WO 95/06727 PCT/DS94/10257 10 15 25 30 40 45 55 60 (2) INFORMATION FOR SEQ 10 NO:10J (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: His Ser Tyr Gin Glu Glu Ala Ala Met Glu Leu Lys 15 10 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 20 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: Asp Pro Phe Tyr Trp Val Ser Pro Gly Val Met Val Leu 15 10 (2) INFORMATION FOR SEQ ID NO:l2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 35 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: Pro Ph.* Tyr Trp Val Ser Pro Gly Val Met Val Leu Met 1 5 10 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 50 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: Pro Gly Val Leu Val Leu Leu Ala Val Leu Pro Val Leu 15 10 (2) INFORMATION FOR SEQ ID N0:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 65 (B) TYPE: amino acid (C) STRANDEDNESS: single 37 WO 95/06727 FCT/US94/10257 (O) TOPOLOGY: linear 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Leu Leu Leu Oln lie Thr Val Oly Leu Val Phe Leu Cye 15 10 10 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 15 (C) STRANDEDNESS: single (D) TOPOLOGY: linear 20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: Pro His Arg Leu Arg Val Pro Cys Trp Lys lie Thr Leu 15 10 25 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 30 (C) STRANDEDNESS: single (D) TOPOLOGY: linear 35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: lie Thr Leu Phe Val lie Val Pro Val Leu Gly Fro Leu 15 10 40 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 45 (C) STRANDEDNESS: single (D) TOPOLOGY: linear 50 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: Pro Leu Val Ala Lau lie lie Cys Tyr Asn Trp Leu His 15 10 55 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 60 (C) STRANDEDNESS: single (D) TOPOLOGY: linear 65 (xi) SEQUENCE DESCRIPTION: SEQ ID I.o:18: 38 5 10 15 20 25 30 35 40 45 50 WO 95/06727 PCT/US94/10257 Asn Tip Leu His Arg Arg Leu Ala Oly Oln Phe Leu Olu 15 10 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3 2 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val Ala Ser 15 10 (2) INFORMATION FOR SEQ ID N0:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: Pro Lys Tyr Val Lys Gin Asn Thr Leu Lys Leu Ala Thr 15 10 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: Lys lie Tyr Ser Tyr Phe Pro Ser Val lie Ser Lys Val 15 10 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: His Phe Phe Lys Asn lie Val Thr Pro Arg Thr Pro Pro 1 5 10 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: 39 WO 95/06727 PCTAJS94/10257 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: 10 Ser Arg Tyr Trp Ala lie Arg Thr Arg Ser Gly Gly lie 15 10 (2) INFORMATION FOR SEQ ID NO:24: 15 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: 25 His Phe Phe Lys Asn lie Val Thr Pro Arg Thr Pro Pro 15 10 (2) INFORMATION FOR SEQ ID NO:25: 30 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: 40 Ser Arg Tyr Vrp Ala lie Arg Thr Arg Ser Gly Gly lie 15 10 (2) INFORMATION FOR SEQ ID NO:26: 45 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 50 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: 55 Met Gin tyr lie Lys Ala Asn Ser Lys Phe lie Gly lie 15 10 (2) INFORMATION FOR SEQ ID NO:27: 60 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 65 40 WO 95/06727 PCT/US94/10257 (xi) SEQUENCE DESCRIPTION: SEQ ID MO:27: Oly Pro Leu Lys Ala Olu lie Ala Oln Arg Leu Olu Asp 5 1 5 10 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: 10 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 15 30 45 60 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: Asn Val Leu Asp His Leu Thr Cys Arg Ser Ser Oln Val 20 1 5 10 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: 25 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID MO:29: Thr Val Leu Thr Ala Leu Gly Ala lie Leu Lys Lys Lys 35 1 5 10 (2) INFORMATION FOR SEQ ID N0:30: (i) SEQUENCE CHARACTERISTICS: 40 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: Thr Leu Leu Gin Ala Ala Pro Ala Leu Asp Lys Leu Lys 50 1 5 10 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: 55 (A) LENGTH: 13 amino acids 'B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: Met Arg Val Lys Arg Gly Leu Thr Val Ala Val Ala Gly 65 1 5 10 41 WO 95/06727 PCT/US94/10257 10 15 25 30 40 55 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPJs: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ IDNO:32: oly Thr Leu Val Lys Thr lie Thr Asp Asp Qln lie Olu 15 10 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LQJQTH: 13 amino acids 20 (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Ala Ala Tyr Ala Ala Ala Lys Ala Ala Ala Ala Ala Ala 15 10 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs 35 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: 45 CAGAATCCGG GAAGAATGCC ACGGGC 26 (2) INFORMATION FOR SEQ ID NO:35: 50 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA 60 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: CAGCGGCCGC ACGGAGTTTT CCTCTCAG 28 65. (2) INFORMATION FOR SEQ ID NO:36: 42 5 10 15 20 25 30 35 40 45 50 55 WO 95/06727 PCT/US94/10257 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2fl base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: ■ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: CASAATTCTC AGGTTCTCAG ATGAAGGA 28 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: AAGCOGCCGC TATCCTTCAT CTGAGAACCT 30 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: CDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: CTTTTGAGCA AGTTCAGCCT GGTTAAG 27 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: ACCTCGAGGA GGTGGCTTAT GAGTATTTCT TCCAGGGTA 39 43 WO 95/06727 PCT/US94/10257 10 25 45 65 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESSi single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: 15 GGTGCGGGAA AOGTGACTCT CAGGATCCGG AAT 33 (2) INFORMATION FOR SEQ ID NO:41: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS; single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA 30 (Xi) SEQUENCE DESCRIPTION: SEQ ID NOt41: ATTCCOOATC CTGAGAGTCA CCTTTCCCGC ACC 33 35 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 40 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (V) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: 50 Gly Gin Phe Arg Val He Gly Pro Arg His Pro lie Arg 15 10 (2) INFORMATION FOR SEQ ID NO:43: 55 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 60 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: 44 WO 95/06727 PCTAJS94/10257 Phe Arg Val lie Oly Pro Arg His Pro lie Arg Ala Leu 15 10 5 (2) INFORMATION FOR SEQ ID NO:44: / (i) SEQUENCE CHARACTERISTICSt {A) LENGTH: 13 amino acid* (B) TYPE: amino acid 10 (l» TOPOLOGY: linear 15 35 40 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: 20 Arg Val He Gly Pro Arg His Pro lie Arg Ala Leu Val 15 10 (2) INFORMATION FOR SEQ ID NO:45: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B! TYPE: amino acid (D) TOPOLOGY: linear 30 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: Cys Arg lie Ser Pro Gly Lys Asn Ala Thr Gly Met Glu 15 10 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 45 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 50 (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: Thr Gly Met Glu Val Gly Trp Tyr Arg Pro Pro Phe Ser 1 5 10 (2) INFORMATION FOR SEQ ID NO:47: 60 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 65 (ii) MOLECULE TYPE: peptide 45 WO 95/06727 PCT/US94/10257 10 25 30 35 40 55 (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTIONi SEQ ZD NO:47a Val Oly Trp Tyr Arg Pro Pro Phe Ser Arg Val Val Hi* 15 10 (2) INFORMATION FOR SEQ ZD NO:48: (i) SEQUENCE CHARACTERZSTICS: (A) LENGTH: 13 amino acid* 15 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 20 (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SBQ ZD NO:48: Pro Pro Phe Ser Arg Val Val His Leu Tyr Arg Asn Oly 15 10 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (S) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTION: SEQ ZD N0:49: Arg Val Val His Leu Tyr Arg Asn Oly Lys Asp Oln Asp 45 1 5 10 (2) INFORMATION FOR SEQ ID N0:50: (i) SEQUENCE CHARACTERISTICS: 50 (A) LENGTH: 13 amino acid* (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 60 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: Pro Glu Tyr Arg Gly Arg Thr Glu Lau Leu Lys Asp Ala 15 10 65 (2) INFORMATION FOR SEQ ID NO:51: 46 WO 95/0(5727 PCT/U894/10257 10 25 45 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH; 13 amino acid* (B) TYPE: amino acid (D) TOPOLOGYt linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: Glu Leu Leu Lya Aap Ala lie Oly Olu Oly Lya Val Thr 15 1 5 10 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: 20 (A) LENGTH: 13 amino acid* (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 30 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: Asp Ala lie Oly Olu Oly Lya Val Thr Leu Arg lie Arg 15 10 35 (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 40 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: 50 Asp Ala lie Gly Ala Gly Lys Val Thr Leu Arg lie Arg 15 10 (2) INFORMATION FOR SEQ ID NO:54: 55 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 60 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: 47 WO 95/06727 PCT/D894/10257 Oly Qly Phe Thr Cya Phe Phe Arg Asp His Ser Tyr Ola 15 10 5 (2) INFORMATION FOR SEQ ID NOi55i (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 10 (D) TOPOLOGY: linear (11) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: 15 20 His Ser Tyr oln Glu Glu Ala Ala Met Glu Leu Lys Val 15 10 (2) INFORMATION FOR SEQ ID NO:56: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) type: amino acid (D) topology: linear 30 (11) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 35 40 (Xl) SEQUENCE DESCRIPTION: SEQ ID NO:56: Pro Phe Tyr Trp Val Ser Pro Gly Val Leu Val Leu Leu 15 10 (2) INFORMATION FOR SEQ ID NO:57: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids 45 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 50 (v) FRAGMENT TYPE: internal 55 60 65 (xl) SEQUENCE DESCRIPTION: SEQ ID NO:57: Leu Val Leu Leu Ala Val Leu Pro Val Leu Leu Leu Gin 15 10 (2) INFORMATION FOR SEQ ID NO:58: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid' (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 48 WO 95/06727 PCT/U894/10257 10 25 30 35 40 55 (v) FRAGMENT TYPE: internal (Xi) SBQUXNCB DESCRIPTION( SXQ ZD NO:58: Pro Val Lau Leu Leu Oln Zle Thr Val Oly Leu Val Phe 15 10 (2) INFORMATION FOF. SBQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acidi 15 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 20 (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SBQ ID NO:59: lie Thr Val Oly Leu Val Phe Leu Cys Leu Gin Tyr Arg 15 10 (2) INFORMATION FOR SBQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: Val Gly Leu Val Phe Zktu Cys Leu oln Tyr Arg Leu Arg 45 1 5 10 (2) INFORMATION FOR SBQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: 50 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 60 (xi) SEQUENCE DESCRIPTION: SBQ ID NO:61: Gly Leu Val Phe Leu Cys Leu Gin Tyr Arg Leu Arg Gly 1 5 10 65 (2) INFORMATION FOR SEQ ID NO:62: 49 WO 95/06727 PCT/US94/10257 10 25 (i) SEQUENCE CHARACTERISTICS I (A) LENGTH: 13 amino acids (B) TYPEi amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPEi internal (Xi) SEQUENCE DESCRIPTIONI SBQ ID NO«62: Lau Val Pha Lau Cys Lau Gin Tyr Arg Leu Arg Gly Lys 15 1 5 10 (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: 20 (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linaar (ii) MOLECULE TYPE: paptide (V) FRAGMENT TYPE: internal 30 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: Leu Cys Leu Gin Tyr Arg Lau Arg Gly Lys Leu Arg Ala 15 10 35 (2) INFORMATION FOR SEQ ID NO:64: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 40 (D) TOPOLOGY: linear 45 65 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: 50 Leu Gin Tyr Arg Leu Arg Gly Lys Leu Arg Ala Glu lie 15 10 (2) INFORMATION FOR SBQ ID NO:65: 55 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acirt (D) TOPOLOGY: licet. . 60 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: 50 WO 95/06727 PCT/US94/10257 Oly Lya Lau Arg Ala Olu 11* olu Aan Lau Hla Arg Thr 15 10 5 (2) INFORMATION FOR SEQ ID NO:66: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino *eida (B) TYPE: amino aciS 10 (D) TOPOLOGY: llnrir (11) MOLECULE TYPES peptide (v) FRAGMENT TYPE: internal (xl) SEQUENCE DESCRIPTION: SEQ ID NO*66: 15 20 Arg Thr Phe Aap Pro Hla Phe Leu Arg Val Pro cya Trp 15 10 (2) INFORMATION FOR SEQ ID NO:67s 25 (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acida (B) TYPE: amino acid (D) TOPOLOGY: linear 30 (il) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 35 40 (xl) SEQUENCE DESCRIPTION: SBQ ID NO:67: Gly Pro Leu Val Ala Leu lie lie Cya Tyr Aan Trp Leu 15 10 (2) INFORMATION FOR SEQ ID NO:68: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acida 45 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 50 (v) FRAGMENT TYPE: internal 55 60 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68: Val Ala Leu lie lie Cya Tyr Aan Trp Leu Hie Arg Arg 15 10 (2) INFORMATION FOR SEQ ID NO:69: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 51 WO 95/06727 PCT/US94/10257 10 20 60 65 (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO169J Ala Leu lie lie Cya Tyr Aan Trp Leu Mia Arg Arg Leu IS 10 (2) INFORMATION FOR SEQ ID N0:70: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 13 amino acida (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:70: Leu lie lie Cya Tyr Asn Trp Leu Hia Arg Arg Leu Ala 15 10 30 (2) INFORMATION FOR SBQ ID NO:71: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid 35 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 40 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71: 45 lie Cys Tyr Asn Trp Leu His Arg Arg Leu Ala Gly Gin 15 10 (2) INFORMATION FOR SEQ ID NO:72: 50 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 55 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72: Tyr Asn Trp Leu His Arg Arg Leu Ala Gly Gin Phe Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO:73: 52 WO 95/06727 PCMJS94/10257 10 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTHi 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73: 15 Gly Gin Phe Arg Val lie Gly Pro Arg Hie Pro lie Arg Ala Leu Val 15 10 15 Gly Asp Glu Val 20 (2) INFORMATION FOR SEQ ID NO:74: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids 25 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 30 (v) FRAGMENT TYPE: internal 35 50 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: Pro lie Arg Ala Leu Val Gly Asp Glu Val Glu Lau Pro Cys Arg lie 15 10 15 Ser Pro Gly Lys 40 20 (2) INFORMATION FOR SEQ ID NO:75: (i) SEQUENCE CHARACTERISTICS: 45 (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 55 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75: Glu Leu Pro Cys Arg lie Ser Pro Gly Lys Asn Ala Thr Gly Met Glu 15 10 15 60 Val Gly Trp Tyr 20 (2) INFORMATION FOR SBQ ID NO:76: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids 53 WO 95/06727 PCT/US94/102S7 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPEi peptide (v) FRAGMENT TYPE: internal 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76: Asn Ala Thr Gly Met Glu Val Oly Trp Tyr Arg Pro Pro Phe Ser Arg 15 10 15 15 Val Val His Leu 20 (2) INFORMATION FOR SEQ ID NO:77: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 25 (ii) MOLECULE TYPE: peptide (V) FRAGMENT TYPE: internal 30 35 40 45 50 (xi) SEQUENCE DESCRIPTION: SBQ ID NO:77: Arg Pro Pro Phe Ser Arg Val Val His Leu Tyr Arg Asn Gly Lys Asp 15 10 15 Gin Asp Gly Asp 20 (2) INFORMATION FOR SEQ ID NO:78: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78: Tyr Arg Asn Gly Lys Asp Gin Asp Gly Asp Gin Ala Pro Glu Tyr Arg 55 1 5 10 15 Gly Arg Thr Glu 20 60 (2) INFORMATION FOR SEQ ID NO:79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid 65 (D) TOPOLOGY: linear 54 WO 95/06727 PCT/US94/1Q257 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79: Gin Ala Pro Glu Tyr Arg Gly Arg Thr Glu Leu Leu Lya Asp Ala lie 10 1 5 10 15 Gly Glu Gly Lys 20 15 (2) INFORMATION FOR SEQ ID NO:80: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid 20 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 25 (xi) SEQUBNCE DESCRIPTION: SBQ ID NO: 80: 30 Leu Leu Lys Asp Ala lie Gly Olu Oly Lys Val Thr Leu Arg lie Arg 15 10 15 35 Asn Val Arg Phe 20 (2) INFORMATION FOR SEQ ID NO:81: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids 40 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 45 (v) FRAGMENT TYPE: internal 50 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81: Val Thr Leu Arg lie Arg Asn Val Arg Phe Ser Asp Glu Oly oly Phe 15 10 15 Thr Cys Phe Phe 55 20 (2) INFORMATION FOR SEQ ID NO:82: (i) SEQUENCE CHARACTERISTICS: 60 (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 55 WO 95/06727 PCT/US94/10257 (xi) SEQUBNCE DESCRIPTION: SEQ ID NO:82: 5 Ser Asp Glu Gly Gly Phe Thr Cys Phe Phe Arg Asp His Ser Tyr Gin 15 10 IS Glu Glu Ala Ala 10 20 (2) INFORMATION FOR SEQ ID MO:83: (i) SEQUENCE CHARACTERISTICS: ,\5 (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 20 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 25 (xi) SEQUENCE DESCRIPTION: SEQ ID MO:83: Arg Asp His Ser Tyr Gin Glu Glu Ala Ala Met Glu Leu Lys Val Glu 15 10 15 30 Asp Pro Phe Tyr 20 (2) INFORMATION FOR SEQ ID 110:84: 35 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 40 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 45 50 55 60 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84: Met Glu Leu Lys Val Glu Asp Pro Phe Tyr Trp Val Ser Pro Gly Val 15 10 15 Leu Val Leu Leu 20 (2) INFORMATION FOR SEQ ID NO:85: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 56 WO 95/06727 PCT/US94/10257 10 15 20 50 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85: Trp Val Ser Pro Qly Val Lau Val Lau Leu Ala Val Leu Pro Val Leu 15 10 15 Leu Leu Oln lie 20 (2) INFORMATION FOR SEQ ID NO:86: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acida (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86: Ala Val Leu Pro Val Leu Leu Leu Gin lie Thr Val Gly Leu Val Phe 25 1 5 10 15 Leu Cys Leu Gin 20 30 (2) INFORMATION FOR SEQ ID NO:87: (i) SEQUENCE CHARACTERISTICS: * (A) LENGTH: 20 amino acids (B) TYPE: amino acid 35 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 40 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87: 45 Thr Val Gly Leu Val Phe Leu Cys Leu Gin Tyr Arg Leu Arg Gly Lys 15 10 15 Leu Arg Ala Glu 20 (2) INFORMATION FOR SEQ ID NO:88: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids 55 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 60 (v) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88: Tyr Arg Leu Arg Gly lya Leu Arg Ala Glu lie Glu Asn Leu His Arg 57 WO 95/06727 PCT/US94/10257 10 15 Thr Phe Asp Pro 20 5 (2) INFORMATION FOR SEQ ID NO:89: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids 10 (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide 15 (v) FRAGMENT TYPE: internal 20 35 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89: lie Glu Asn Leu His Arg Thr Phe Asp Pro His Phe Leu Arg Val Pro 15 10 15 Cys Trp Lys lie 25 20 (2) INFORMATION FOR SBQ ID NO:90: (i) SEQUENCE CHARACTERISTICS: 30 (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (11) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 40 (xl) SEQUENCE DESCRIPTION: SEQ ID NO:90: His Phft Leu Arg Val Pro Cys Trp Lys lie Thr Leu Phe Val lie Val 1 5 10 15 45 Pro Val Leu Gly 20 (2) INFORMATION FOR SEQ ID NO:91: 50 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 55 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 60 65 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:91: Thr Leu Phe Val lie Val Pro Val Leu Gly Pro Leu Val Ala Leu lie 15 10 15 lie Cys Tyr Asn 58 WO 95/06717 PCT/US94/102S7 20 (2) INFORMATION FOR SBQ ID NO:92: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENQTHs 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear 10 (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: internal 15 20 25 30 35 55 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92: Pro Leu Val Ala Leu lie lie Cys Tyr Asn Trp Leu His Arg Arg Leu 15 10 15 Ala Gly Gin Phe 20 (2) INFORMATION FOR SEQ ID NO:93: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (V) FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ .ID NO:93: Trp Leu His Arg Arg Leu Ala Gly Gin Phe Leu Glu Glu Leu Arg Asn 40 1 5 10 15 Pro Phe 45 (2) INFORMATION FOR SEQ ID NO:94: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid 50 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 94: AGCTCSAGCC GCGGAGGGCA GTTCAGAGTG ATA 60 33 (2) INFORMATION FOR SEQ ID NO:95: (i) SEQUENCE CHARACTERISTICS: 65 (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid 59 WO 95/06727 PCT/US94/10257 (C) STRANDEDNESS: single (D) TOPOLOGY: linaar (ii) MOLECULE TYPE: cDNA (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:95: GACTCQAGTC ACCAGTAGAA AOOATCTTC 29 I 60 273R13 10 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> Claims

1. An isolated nucleic acid molecule comprising a nucleotide sequence encoding human myelin oligodendrocyte glycoprotein (MOG) or at least one antigenic fragment thereof.

2. The nucleic add molecule of claim 1 wherein said nucleotide sequence consists essentially of nucleotides encoding amino adds 1-218 of Fig. 1 (SEQ ED NO: 2) or an allelic variant thereof:

3. An oligomer comprising a portion of a nucleotide sequence shown in Fig. 1 (SEQ ID NO:l), or which is complementary to the nucleotide sequence shown in Fig. 1 (SEQ ID NO: 1) or a portion thereof.

4. An expression system which is a DNA molecule comprising a 15 nucleotide sequence encoding human MOG or an antigenic fragment thereof operably linked to control sequences for expression in a compatible host

5. The expression system of claim 4 wherein said nucleotide sequence encodes amino acids 1-218 of Figure 1 (SEQ ID NO: 2) or an antigenic fragment portion 20 thereof.

6. A recombinant host cell modified to contain die expression system of claim 4. 25

7. Isolated and purified human MOG or an antigenic fragment thereof. ~

8. A method to produce human MOG, or an antigenic fragment thereof, comprising the steps of: 30 a) culturing a host cell modified to contain an expression system directing expression of a nucleotide sequence encoding human MOG or fragment thereof in an appropriate medium, to produce a culture containing human MOG or fragment thereof; and b) recovering said human MOG or fragment thereof from the culture. 35 273813

9. A peptide comprising at least one T-cell epitope of human MOG or tandem copies thereof.

10. The peptide of claim 9 wherein said peptide comprises any of amino add sequences as shown in Figure 2 (SEQ ID NOS: 4-9,11,15,16, and 42-72), Figure 5a and 5b.

11. A peptide comprising at letst two T-cell epitopes of human MOG.

12. A modified form of human MOG, or antigenic fragment thereof wherein said modification comprises substituting for one or more amino adds of said peptide or protein a different amino add which does not interfere with the biological activity of said peptide or protein.

13. A nudeic acid molecule comprising a nucleotide sequence encoding the peptide of any one of claims 9-12.

14. An expression system which is a DNA molecule comprising a nudeodde sequence encoding the peptide of any one of claims 9-12 operably linked to control sequences for expression in a compatible host

15. A recombinant host cell modified to contain the expression system of claim 14.

16. A method to produce the peptide of any one of claims 9-12 which comprises: " . a) culturing a host cell modified to contain an expression system directing expression of a nucleotide sequence encoding said peptide in an appropriate medium to produce a culture containing said peptide; and b) recovering the peptide from the culture.

17. A modified form of human MOG or an antigenic fragment thereof or of a peptide of any one of claims 9-12 wherein said modification comprises coupling said protein, fragment or peptide to an additional moiety selected from the group consisting of polyethyleneglycol, a moiety that enhances the solubility of die protein, fragment or I '6 ApK 199S I / RP p c <.. — I 273813 peptide, a moiety which facilitates purification of said protein, fragment or peptide and a moiety which comprises a proteolytic cleavage site.

18. A therapeutic composition comprising isolated human MOO and/or at least one antigenic fragment thereof and/or at least one peptide of any one of claims 9-12 and/or a peptide produced by the method of claim 16 and a pharmaceutically acceptable carrier or diluent.

19. The therapeutic composition of claim 18 wherein said human MOO comprises the amino acid sequence of positions 1-218 shown in Figure 1 (SEQ ID NO: 2) or an amino acid sequence encoded by an allelic variant of the nucleotide sequence of Figure 1 (SEQ ID NO: 1) or an antigenic fragment thereof.

20. A use of an isolated human MOG and/or at least one antigenic fragment thereof and/or at least one peptide of any one Of claims 9-12 and/or a peptide produced by the method of claim 16 in the preparation of a medicament for treating a demyelinating autoimmune disease in a subject in need thereof

21. Use of claim 20 wherein said human MOG comprises the amino acid sequence of positions 1-218 shown in Figure 1 (SEQ ID NO:2) or an amino acid sequence encoded by an allelic variant of the nucleotide sequence of Figure 1 (SEQ ID NO: 0 or an antigenic fragment thereof.

22. A method of diagnosing a demyelinating autoimmune disease ~ comprising combining a blood sample obtained from a subject to be tested with isolated human MOG, or antigenic fragment thereof or a peptide of any one of claims 9-12 and/or a peptide produced by the method of claim 16 under conditions appropriate for binding of blood components with MOO or fragment thereof, and determining the extent to which such binding occurs.

23. The method of claim 22 wherein the extent to which binding occurs is determined by assessing T-cell function, T-cell proliferation, B-cell function, binding of die protein or fragment thereof to antibodies present in the blood or a combination thereof.

24. A monoclonal antibody or immiinoreactive fragment thereof, specifically reactive with human MOG or antigenic ficagment thereof or a peptide of any one of claims 9-12 and/or a peptide produced by the method of claim 16.

25. A method to identify a T-cell epitope of human MOG whic op method comprises Is Si UJ identifying a hydrophobic amino acid contained in human MOG; jSal a: I it ii i| determining the nature of the amino acid in the human MOG seqv "*;a r separated N, C from said hydrophobic amino acid by an intervening four aminoi ti* 273813 determining whether said amino add is a small amino acid selected firom the group consisting of glycine, alanine, serine, threonine, and cysteine or is a different amino acid; and identifying as a T-cell epitope a peptide which contains said hydrophobic 5 and small amino acid wherein said small amino add is separated by 4 amino adds N C from said hydrophobic amino add.

26. An isolated peptide of human MOG said peptide comprising at least one T-cell epitope, said peptide comprising a sequence of amino add residues selected from the 10 group consisting of MOG 1-13 (SBQ ID NO. 42), MOG 103-115 (SBQ. ID NO. 55), MOG 1-121 (first 121 amino adds of SEQ ID NO. 2), MOG 1-20 (SEQ ID NO. 73), MOG 11-30 (SEQ ID NO. 74), MOG 21-40 (SEQ. ID N0.75), MOG 31-50 (SEQ ID N0.76), MOG 41-60 (SEQ ID N0.77), MOG 51-70 (SEQ ED NO 78), MOG 61-80 (SEQ ID NO 79), MOG 71-90 (SEQ ID N0.80), MOG 91-110 (SEQ ID NO. 82), and MOG 15 101-120 (SEQ ID NO. 83).

27. A mixture of peptides human MOG , said xnixntre comprising MOG 1-20 (SEQ ID NO. 73), MOG 11-30 (SBQ ID NO. 74), MOG 21-40 (SEQ. ID N0.75), MOG 31-50 (SEQ ID N0.76), MOG 41-60 (SEQ ID N0.77), MOG 51-70 (SEQ ID NO 78), 20 MOG 61-80 (SEQ ID NO 79), MOG 71-90 (SEQ ID N0.80), MOG 91-110 (SEQ ID NO. 82), and MOG 101-120 (SEQ ID NO. 83) wherein said mixture comprises at least one T-cell epitope.

28. A method for identifying therapeutic compositions for the treatment of 25 multiple sderosis comprising the steps of: administering human MOG to mice in immunogenic form to cause induction of EAE in said mice; treating said mice induced with EAE with at least one therapeutic composition comprising at least one antigenic fragment of human MOG prior to the onset of 30 symptoms of EAE or after the onset of symptoms of EAE in said mice; and determining if said at least one therapeutic composition prevents the onset or progression of the symptoms of EAE in said mice induced with EAE. 64

29. An isolated nucleic acid molecule as defined®,cj6inQ ( • substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

30. An oligomer as defmed in claim 3 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

31. An expression system as defined in claim 4 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

32. A recombinant host cell as defmed in claim 6 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

33. Isolated and purified human MOG or an antigenic fragment thereof substantially as herein described with reference to any example thereof. or an antigenic fragment thereof substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

35. A peptide as defined in claim 9 or claim 11 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. thereof as defined in claim 12 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

37. A nucleic acid molecule as defined in claim 13 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

38. An expression system as defined in claim 14 substantially as herein described with reference to any example thereof and with or without

34. A method as defined in claim 8 to produce human MOG,

36. A modified form of human MOG, or antigenic fragment reference to the accompanying drawings. fnt<j jj p(0p0rty Oii.ce of 65 29 JAN J9!?8 27 3 rt 3

39. A recombinant host cell as defined in claim 15 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

40. A method as defined in claim 16 to produce a peptide substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

41. A modified form of human MOG or an antigenic fragment thereof of or a peptide as defined in claim 17 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

42. A therapeutic composition as defined in claim 18 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

43. A use as defined in claim 20 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

44. A method as defmed in claim 22 of diagnosing a demyelinating autoimmune disease substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

45. A monoclonal antibody or immunoreactive fragment thereof as defined in claim 24 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

46. A method as defined in claim 25 to identify a T-cell epitope of human MOG substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

47. An isolated peptide of human MOG as defined in claim 26 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. P-'operty Oi,.co of MZ 66 2 D JAM ?3.?3 R £ Q £ | y g Q 273813

48. A mixture of peptides human MOG as defined in claim 27 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

49. A method as defined in claim 28 for identifying therapeutic compositions for the treatment of multiple sclerosis substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. ay mjumortMd A J " SND OF CLAIMS </div>