CN101897964B - Medicament for preventing autoimmune disease - Google Patents
Medicament for preventing autoimmune disease Download PDFInfo
- Publication number
- CN101897964B CN101897964B CN 200910083049 CN200910083049A CN101897964B CN 101897964 B CN101897964 B CN 101897964B CN 200910083049 CN200910083049 CN 200910083049 CN 200910083049 A CN200910083049 A CN 200910083049A CN 101897964 B CN101897964 B CN 101897964B
- Authority
- CN
- China
- Prior art keywords
- dna
- autoimmune disease
- p2mog
- cell
- recombiant plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a medicament for preventing an autoimmune disease. The medicament comprises active ingredients of functional DNA and prograf. The functional DNA is the following DNA of (a) and/or the following recombinant plasmid of (b): (a) proteantigen or coded DNA of epitope polypeptide thereof of the autoimmune disease; and (b) a recombinant plasmid containing the DNA of (a). The medicament is also used for protecting application of the prograf in preparing an adjuvant of the medicament for preventing the autoimmune disease. By using the medicament of the invention to immune animals, the medicament can inhibit the maturation of antigen presenting cells in bodies of the animals, induce the generation of regulatory T cells, and inhibit Th17 cell reaction to fulfill the aim of preventing the autoimmune disease.
Description
Technical field
The present invention relates to a kind of medicine of preventing autoimmune disease.
Background technology
Autoimmune disease is that autoimmune response acquires a certain degree and the disease that causes.The most basic function of immune system is understanding self and identification allosome, reaches protection self and the purpose of repelling allosome.Can have multiple antibody for autoantigen in normal human's serum, but their level is extremely low, is not enough to destroy self component, can remove the autologous tissue of old and feeble regression, Here it is autoimmune response.Excessively strong when this reaction, cause serious tissue injury, when showing clinical symptoms, just be called autoimmune disease.Autoimmune disease has polytype, such as multiple sclerosis, autoimmune oophoritis, system lupus erythematosus, rheumatoid arthritis, insulin dependent diabetes mellitus (IDDM), myasthenia gravis, acute multiple polyneuritis etc.
Regulatory T cells (regulatory T cells, Treg) be the T cell of keeping the function maturation of immunity of organism balance, Treg is by antigen non-specific or specific amplification, the function of downward modulation responsiveness immunocyte also weakens its multiplication capacity, suppresses or control the degree of immune response.The quantity minimizing of Treg or the generation that dysfunction all may cause autoimmune disease are found in research.
Multiple sclerosis (multiple sclerosis; MS) be a kind of autoimmune disease; be the inflammation of the central nervous system demyelination, be because T cellular abnormality activation and enter the central nervous system, autoantigen produced immunne response causes.The autoimmune oophoritis main manifestations is the T lymphocyte, a large amount of infiltrations to ovary such as a small amount of bone-marrow-derived lymphocyte, macrophage and NKT (NK) cell.
Summary of the invention
The medicine that the purpose of this invention is to provide a kind of preventing autoimmune disease.
The invention provides a kind of new purposes of Prograf (FK506).
New purposes provided by the invention is that Prograf is used in the adjuvant of the medicine of preparation preventing autoimmune disease; The medicine of described preventing autoimmune disease can be the DNA of following (a) and/or the recombiant plasmid of following (b):
(a) coding DNA of the proteantigen of autoimmune disease or its epitope polypeptide;
(b) recombiant plasmid that contains (a) described DNA.
Described autoimmune disease can be multiple sclerosis, system lupus erythematosus, rheumatoid arthritis, type 1 diabetes (insulin dependent diabetes mellitus (IDDM)), myasthenia gravis, acute multiple polyneuritis or autoimmune oophoritis etc.
When the prevention purpose was the prevention multiple sclerosis, the medicine of described preventing autoimmune disease can be myelin oligodendrocyte glycoprotein polypeptide from amino terminal the 35th to 55 amino acids residue.
As a unit, the medicine of described preventing autoimmune disease both can be the DNA of a unit, also can be the DNA of several repetitives with the coding DNA of the proteantigen of autoimmune disease or its epitope polypeptide.
When the prevention purpose is prevention during multiple sclerosis, can be with the sequence 1 that contains ordered list from the DNA of 5 ' terminal the 7th to 66 nucleotide as a unit.The medicine of described preventing autoimmune disease both can be the DNA of a unit, also can be the DNA of several repetitives.
When the prevention purpose is prevention during multiple sclerosis, the medicine of described preventing autoimmune disease specifically can be the sequence 1 that contains ordered list from DNA and/or the recombiant plasmid p2MOG of 5 ' terminal the 7th to 132 nucleotide
35Described p2MOG
35That the sequence 1 that will contain ordered list imports the recombiant plasmid that the pVAX1 plasmid obtains from the DNA of 5 ' terminal the 7th to 132 nucleotide.
When the prevention purpose was the prevention autoimmune oophoritis, the medicine of described preventing autoimmune disease specifically can be recombiant plasmid pCDNA-ZP3 shown in Figure 11.
Prograf is a kind of nonspecific immunosuppressive agent, when the clinical use of autoimmune disease sufferer, not only the autoimmune of sufferer is produced inhibitory action, also can produce inhibitory action for the immunity of exotic antigen, so have larger side effect.The inventor finds, with Prograf as adjuvant, with the proteantigen of autoimmune disease or the encoding gene of its epitope polypeptide recombiant plasmid of its encoding gene (or carry) co-immunization animal, the autoimmune disease that can specific inhibition be brought out by proteantigen or its epitope polypeptide of immunity, thereby the generation of preventing autoimmune disease.
The present invention also protects a kind of medicine of preventing autoimmune disease, and its active ingredient is function DNA and as the Prograf of adjuvant; Described function DNA is the DNA of following (a) and/or the recombiant plasmid of following (b):
(a) coding DNA of the proteantigen of autoimmune disease or its epitope polypeptide;
(b) recombiant plasmid that contains (a) described DNA.
Described autoimmune disease can be multiple sclerosis, system lupus erythematosus, rheumatoid arthritis, insulin dependent diabetes mellitus (IDDM), myasthenia gravis, acute multiple polyneuritis or autoimmune oophoritis etc.
When the prevention purpose of described medicine was the prevention multiple sclerosis, described function DNA can be myelin oligodendrocyte glycoprotein polypeptide from amino terminal the 35th to 55 amino acids residue.
When the prevention purpose of described medicine during for the prevention multiple sclerosis, can be with the sequence 1 that contains ordered list from the DNA of 5 ' terminal the 7th to 66 nucleotide as a unit.The medicine of described preventing autoimmune disease both can be the DNA of a unit, also can be the DNA of several repetitives.
When the prevention purpose is prevention during multiple sclerosis, described function DNA specifically can be the sequence 1 that contains ordered list from DNA and/or the recombiant plasmid p2MOG of 5 ' terminal the 7th to 132 nucleotide
35Described p2MOG
35That the sequence 1 that will contain ordered list imports the recombiant plasmid that the pVAX1 plasmid obtains from the DNA of 5 ' terminal the 7th to 132 nucleotide.
When the prevention purpose of described medicine was the prevention autoimmune oophoritis, the medicine of described preventing autoimmune disease specifically can be recombiant plasmid pCDNA-ZP3 shown in Figure 11.
In the medicine of described preventing autoimmune disease, described adjuvant and described function DNA both can be made into intermixture animal had been carried out immunity, also can pack separately, respectively animal were carried out immunity.
In the described medicine, the mass ratio of described function DNA and described adjuvant can be 10: (0.5-10), specifically can be 10: 3.According to practical situation, described adjuvant can be divided into several times to be used, and described function DNA can be divided into several times to be used.
During administration, dosage can be: 30 microgram FK506/ per course for the treatment of, 100 microgram function DNAs/per course for the treatment of; Be 7 days per course for the treatment of, totally two courses for the treatment of.Administering mode be generally first course for the treatment of and second the course for the treatment of interval 14 days.
The present inventor finds by great many of experiments, after utilizing the proteantigen of FK506 and MS or the encoding gene of its epitope polypeptide recombiant plasmid of encoding gene (or carry) co-immunization mice, the T cell proliferation is suppressed, induce to have produced the Treg cell, and suppressed the maturation of DC cell.Mice after the immunity is induced autoimmunity encephalomyelitis (EAE) model, finds significantly to have suppressed the morbidity of EAE, and the pathological section of spinal cord shows lymphocyte and the CD4 that infiltrates
+IL-17
+Cell obviously reduce, and the Treg cell proportion increases.Simultaneously the expression of spleen CD4 T cell IFN-g, IL-4 and IL-17 detected, the expression of finding IFN-g, IL-17 reduces, and the expression of IL-4 significantly increases, after being described, FK506 and dna vaccination immunity induce the EAE model, pathogenic Th1 and Th17 cell immune response have been weakened, strengthen the Th2 cell immune response, finally suppressed the morbidity of EAE.Behind the proteantigen of FK506 and oophoritis or its epitope polypeptide (or its encoding gene or carry the recombiant plasmid of encoding gene) the co-immunization mice, can prevent the generation of autoimmune oophoritis.
The present invention compared with prior art has the following advantages:
1, the function DNA preparation technology of the present invention's use is simple, safe and convenient to use.
2, the FK506 of the present invention's use uses safety originally as clinical application, and consumption does not have side effect far less than quantity.
3, medicine of the present invention can be induced the generation of Treg cell effectively, suppresses the maturation of DC cell, suppresses the pathogenic immunoreation of Th17 cell, the generation of preventing autoimmune disease.
4, medicinal usage of the present invention is extensive, and the autoimmune disease that can be used for prevention has: the serious autoimmune diseasees such as multiple sclerosis, autoimmune oophoritis, system lupus erythematosus, rheumatoid arthritis, insulin dependent diabetes mellitus (IDDM), myasthenia gravis, acute multiple polyneuritis.
5, medicine of the present invention does not require special reaction condition, and the conventional equipment in general pharmaceutical factory can be produced, and production method is simple, purifies easily, is easy to suitability for industrialized production.
The proteantigen of autoimmune disease or its epitope polypeptide can cause the strong immunization reaction of autoimmune disease sufferer.FK506 is adjuvant when employing, the proteantigen of compound autoimmune disease or the encoding gene of its epitope polypeptide recombiant plasmid of encoding gene (or carry) co-immunization animal, the probability that can make animal suffer from autoimmune disease reduces greatly, plays preventive effect.
Description of drawings
Fig. 1 is recombiant plasmid p2MOG
35Enzyme action identify; 1:p2MOG
35The enzyme action result; 2:DNA Marker.
Fig. 2 is recombiant plasmid p2MOG
35The RT-PCR qualification result of expression in bhk cell; 1:p2MOG
35RT-PCR result after the transfection; 2:p2MOG
35The RT-PCR result who does not add reverse transcription after the transfection.
Fig. 3 is T cell proliferative response testing result.
Fig. 4 is the flow cytometer testing result of Treg cell; Vertical coordinate is CD4
+CD25
+Foxp3
+The relative CD4 of cell
+The percentage composition of cell (%).
Fig. 5 is the flow cytometer testing result of DC cell; (A): CD11C
+MHCII
+(B) CD11C
+IL-10
+(A) in, vertical coordinate is CD11C
+MHCII
+The relative CD11C of cell
+The percentage composition (%) of DC cell; (B) in, vertical coordinate is CD11C
+IL-10
+The relative CD11C of cell
+The percentage composition (%) of DC cell.
Fig. 6 is the myeloid tissue's section after mice is induced EAE; (A) the 5th group of processing; (B) the 4th group of processing; (C) second group of processing; (D) the 3rd group of processing; (E) first group of processing; (F) do not do the C57BL/6 mice of any processing.
Fig. 7 is the flow cytometer testing result after mice is induced EAE; (A): lymphocyte; (B) CD4
+CD25
+(C) CD4
+IL-17
+(A) in, vertical coordinate is the percentage composition (%) of the relatively total cord cell of lymphocyte; (B) in, vertical coordinate is CD4
+CD25
+The relative CD4 of cell
+The percentage composition of T cell (%); (C) in, vertical coordinate is CD4
+IL-17
+The relative CD4 of cell
+The percentage composition of T cell (%).
Fig. 8 is the flow cytometer testing result that mice is induced the Treg cell behind the EAE; Vertical coordinate is CD4
+CD25
+Foxp3
+The relative CD4 of cell
+The percentage composition of T cell (%).
Fig. 9 is the cytokine-expressing analysis result after mice is induced EAE; (A): IFN-γ; (B) IL-4; (A) in, vertical coordinate is CD4
+IFN-γ
+The relative CD4 of T cell
+The percentage composition of T cell (%); (B) in, vertical coordinate is CD4
+IL-4
+The relative CD4 of T cell
+The percentage composition of T cell (%).
Figure 10 is the morbidity feelings after mice is induced EAE; Vertical coordinate is appraisal result, and abscissa represents different grouping.
Figure 11 is the collection of illustrative plates of pCDNA-ZP3.
Figure 12 is the incidence after mice is induced autoimmune oophoritis.Vertical coordinate is appraisal result, and abscissa represents different grouping, and each round dot represents a mice.
The specific embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is conventional method.Used test material among the following embodiment if no special instructions, is and purchases available from routine biochemistry reagent shop.Used antibody is all available from BDPharMingen (San Diego, CA, USA) in following examples.
One, the preparation of function DNA
1, the myelin oligodendroglia glycoprotein 35-55 (MOG of 2 copies of chemosynthesis
35-55) DNA sequence, add respectively the recognition sequence of restricted enzyme HindIII (AAGCTT) and BamHI (GGATCC) at two ends, DNA sequence is as follows:
5′-AAGCTTATGGAGGTGGGTTGGTACCGTTCTCCCTTCTCAAGAGTGGTTCAC
CTCTACCGAAATGGCAAGATGGAGGTGGGTTGGTACCGTTCTCCCTTCTCAAGAGTG
GTTCACCTCTACCGAAATGGCAAGTAAGGATCC-3 ' (seeing the sequence 1 of sequence table).
2, with restricted enzyme HindIII and the synthetic DNA sequence of BamHI enzyme action step 1, it is building up on the corresponding restriction enzyme site of pVAX1 carrier for expression of eukaryon (Invitrogen, CA, USA, V26020), obtains recombiant plasmid p2MOG
35Recombiant plasmid p2MOG
35Enzyme action evaluation figure see Fig. 1.
3, with p2MOG
35Be transfected into BHK eukaryotic cell (ATCC, USA, QK10031), transfection is after 48 hours, and TRIZOL extracts total RNA, after reverse transcription is cDNA, determines its expression of results with the method for RT-PCR, sees Fig. 2.
Two, the immunoreation of immune animal detects
1, immunity
50 female C57BL/6 mices (available from the consonance institute of lab animals) are divided into five groups, 10 every group, are handled as follows respectively:
First group of (p2MOG
35+ FK506 group):
Initial immunity: utilized respectively the FK506 intramuscular injection to process mice at the 1st, 4,7 day, wherein utilized simultaneously the p2MOG of step 1 preparation on the 4th day
35The intramuscular injection immune mouse;
Booster immunization: began to carry out booster immunization, the same initial immunity of process on the 15th day;
Per injection, p2MOG
35Consumption is every mice 100 μ g, and the FK506 consumption is every mice 10 μ g.
Second group (FK506 group):
Initial immunity: utilized respectively the FK506 intramuscular injection to process mice at the 1st, 4,7 day;
Booster immunization: began to carry out booster immunization, the same initial immunity of process on the 15th day;
Per injection, FK506 consumption are every mice 10 μ g.
The 3rd group of (p2MOG
35Group):
Initial immunity: the p2MOG that in the time of the 4th day, utilizes the step 1 preparation
35The intramuscular injection immune mouse;
Booster immunization: the 18th day booster immunization;
Per injection, p2MOG
35Consumption is every mice 100 μ g.
The 4th group (pVAX1 group):
Initial immunity: utilized respectively the FK506 intramuscular injection to process mice at the 1st, 4,7 day, wherein utilize simultaneously pVAX1 intramuscular injection immune mouse the 4th day the time;
Booster immunization: began to carry out booster immunization, the same initial immunity of process on the 15th day;
Per injection, pVAX1 consumption are every mice 100 μ g, and the FK506 adjuvant is every mice 10 μ g.
The 5th group (normal saline group): respectively at the 1st, 4,7,15,18,21 day injecting normal saline.
2, immunoreation detects
The test the 29th day, carry out respectively several following detection:
(1) T cell amplification experiment
The aseptic spleen of getting is made the individual cells suspension.Wash three times with PBS liquid, centrifugal and carry out cell counting, adjust cell concentration to 1 * 10
6/ ml, every group of cell suspension divide 4 parts to add that (portion adds the ConA of 100 μ l, and final concentration is 5 μ g/ml in 96 well culture plates; Portion adds MOG
35-55Polypeptide, final concentration are 2 μ g/ml; Portion adds the BSA of 100 μ l, and final concentration is that 2 μ g/ml organize in contrast; Another part does not add stimulus object).Behind the 24h, it is 5mg/ml to final concentration that every hole adds 100 μ l MTT, and behind the 4h, every hole adds 100 μ l SDS-DMSO (20%SDS is dissolved in 50%DMSO, pH2.0), and it is dissolved fully, reads the OD value at 570nm place in microplate reader.
Calculate the stimulation index (SI) of different disposal by the OD value; During each is processed, MOG
35-55The stimulation index of polypeptide is got the meansigma methods of every group of 10 mices; ConA, the stimulation index that does not add stimulus object and BSA are got the meansigma methods of all mices.The computing formula of stimulation index is: stimulation index=(test group antigenic stimulus OD value-culture medium background OD value)/(not adding stimulus object OD value-culture medium background OD value).
The results are shown in Figure 3.The result shows: with p2MOG
35Group is compared, p2MOG
35The stimulation index of+FK506 group significantly descends, and shows that the T cell proliferative response is suppressed significantly.
(2) analysis of Treg cell
Adopt the antibody staining analysis of CD4, CD25, Foxp3, CD4
+CD25
+Foxp3
+The T cell be the Treg cell, specific as follows: the aseptic spleen of getting is made the individual cells suspension.Paraformaldehyde with 4% is fixed, and behind 0.1% the Saponin rupture of membranes, utilizes mice CD4, CD25, Foxp3 antibody staining, detects with flow cytometer.During each is processed, the Treg cell contain the meansigma methods of measuring every group of 10 mices.
The results are shown in Figure 4.The result shows: with p2MOG
35Group is compared, p2MOG
35The ratio of the Treg cell of+FK506 group obviously increases, and shows FK506 and p2MOG
35Co-immunization can be induced and be produced the Treg cell.
(3) analysis of dendritic cell (Dendritic Cells, DC)
Adopt the antibody staining analysis of CD11c, MHCII, specific as follows: the aseptic spleen of getting is made the individual cells suspension.Paraformaldehyde with 4% is fixed, and behind 0.1% the Saponin rupture of membranes, utilizes mice CD11c, MHCII antibody staining, detects with flow cytometer.During each is processed, CD11C
+MHCII
+Cell contain the meansigma methods of measuring every group of 10 mices.
Adopt the antibody staining analysis of CD11c, IL-10, specific as follows: the aseptic spleen of getting is made the individual cells suspension.Paraformaldehyde with 4% is fixed, and behind 0.1% the Saponin rupture of membranes, utilizes mice CD11c, IL-10 antibody staining, detects with flow cytometer.During each is processed, CD11C
+IL-10
+Cell contain the meansigma methods of measuring 10 mices.
The results are shown in Figure 5.The result shows: with p2MOG
35Group is compared, p2MOG
35The CD11C of+FK506 group
+MHCII
+Express significantly decline, and CD11C
+IL-10
+Express and significantly increase, show that the antigen presentation of DC cell is suppressed, the IL-10 increasing expression shows that this type of DC may have the function of inducing the Treg cell.
Three, immunosuppressant is as the preventive effect evaluation of adjuvant to multiple sclerosis
1, immunity
2, induce EAE
Experimental autoimmune encephalomyelitis (experimental autoimmune encephalomyelitis, EAE) is acknowledged as the ideal animals model of central nervous system's autoimmunity demyelination.
The MOG polypeptide is mixed with complete Freund's adjuvant, as derivant.Behind the immunologic function DNA the 21st day for the first time, utilize derivant at the mouse back multi-point injection, every mice per injection MOG polypeptide 200 micrograms, the pertussis toxin, PT of while lumbar injection 200 nanograms, every mice is injected the pertussis toxin, PT (ListBiological Laboratories via Cedarlane Ltd.) of 200 nanograms again after 48 hours, obtain EAE (list of references: Tompkins, S.M., J.Padilla, M.C.Dal Canto, J.P.Y.Ting, L.Van Kaer, and S.D.Miller.2002.De Novo Central Nervous System Processing of Myelin AntigenIs Required for the Initiation of Experimental Autoimmune Encephalomyelitis.J Immunol 168:4173-4183).
3, preventive effect evaluation
For the first time inject derivant after 21 days, carry out respectively several following detection:
(1) myeloid tissue's slice analysis
Get spinal cord, fix with 4% paraformaldehyde, carry out the specimens paraffin embedding slices analysis, the results are shown in Figure 6.Section shows, with p2MOG
35Group is compared, p2MOG
35The lymphocyte that infiltrates in+FK506 group the spinal cord significantly reduces, and shows FK506 and p2MOG
35Can prevent the generation of EAE behind the immune mouse.
(2) the spinal cord lymphocytic infiltration is analyzed
Get spinal cord, with collagenase and dnase digestion, then utilize percoll density gradient centrifugation, collect middle layer cells, flow cytometer detects the lymphocyte that infiltrates.
Get spinal cord, with collagenase and dnase digestion, then utilize percoll density gradient centrifugation, collect middle layer cells, paraformaldehyde with 4% is fixed, and behind 0.1% the Saponin rupture of membranes, utilizes mice D4 and CD25, CD4 and IL-17 antibody staining, detect with flow cytometer, analyze CD4 in the lymphocyte that infiltrates
+CD25
+And CD4
+IL-17
+Ratio.During each is processed, CD4
+CD25
+Cell (or CD4
+IL-17
+) contain the meansigma methods of measuring 10 mices.
The results are shown in Figure 7.The result shows: with p2MOG
35Group is compared, p2MOG
35+ FK506 group myeloid tissue's lymphocyte infiltration and CD4
+IL-17
+T reduces, CD4
+CD25
+The T cell increases, and shows FK506 and p2MOG
35Can effectively reduce lymphocytic infiltration behind the immune mouse.
(3) analysis of Treg cell
Get and induce the mouse spleen of EAE model after 20 days, prepare single cell suspension after the splitting erythrocyte, adopt the antibody staining analysis of CD4, CD25, Foxp3, CD4
+CD25
+Foxp3
+The T cell be the Treg cell, specific as follows: the aseptic spleen of getting is made the individual cells suspension.Paraformaldehyde with 4% is fixed, and behind 0.1% the Saponin rupture of membranes, utilizes mice CD4, CD25, Foxp3 antibody staining, detects with flow cytometer.During each is processed, the Treg cell contain the meansigma methods of measuring 10 mices.
The results are shown in Figure 8.The result shows: with p2MOG
35Group is compared, p2MOG
35The Treg cell proportion of+FK506 group still keeps certain level, shows FK506 and p2MOG
35The Treg cell of inducing can continue the regular hour.
(4) cytokine-expressing analysis
Induce the EAE model after 20 days, the aseptic spleen of getting is made the individual cells suspension, paraformaldehyde with 4% is fixed, behind 0.1% the Saponin rupture of membranes, utilize the antibody of mice CD4 and IFN-γ, CD4 and IL-4, CD4 and IL-17 to carry out dyeing in the born of the same parents, detect the expression of the analysis of cells factor with flow cytometer.During each was processed, the result got the meansigma methods of 10 mices.
The results are shown in Figure 9.The result shows: with p2MOG
35Group is compared, p2MOG
35The CD4 of+FK506 group
+IFN-γ
+Express and reduce, and CD4
+IL-4
+Expressing increases, and shows that the Th1 cell effect is suppressed, and the Th2 cell effect then strengthens, and can be conducive to prevent the generation of EAE.
(5) incidence analysis
Observe ill marking situation, unite use to detect FK506 as adjuvant and function DNA, to the preventive effect of multiple sclerosis.Standards of grading: 0 minute, do not fall ill; 1 minute, afterbody tension force reduced; 2 minutes, afterbody was unable without tension force or hind leg moderate; 3 minutes, acroparalysis behind the bilateral; 4 minutes, the weak or paralysis of rear acroparalysis companion forelimb power; 5 minutes, be at death's door or death.
The results are shown in Figure 10.The result shows: with p2MOG
35Group is compared, p2MOG
35The mouse invasion marking of+FK506 group significantly reduces.
One, the preparation of function DNA
PcD-mZP3 (function DNA) preparation list of references [Li J, Jin H, Zhang A, et al.Enhancedcontraceptive response by co-immunization of DNA and protein vaccinesencoding the mouse zona pellucida 3 with minimal oophoritis in mouse ovary.JGene Med 2007; 9:1095-1103.].The collection of illustrative plates of pcD-mZP3 is seen Figure 11.
Two, immunosuppressant is as the evaluation of effect of adjuvant to autoimmune oophoritis
1, immunity
Replace p2MOG with pcD-mZP3
35, replace pVAX1 with pcDNA3, every group of 9 mices, 1 of the step 2 of the other the same as in Example 1.
2, inducing mouse causes oophoritis
With mice zona pellucida antigen 3 (ZP3, the polypeptide of mouse sperm receptor) immune mouse causes autoimmune oophoritis, method is referring to [Li J, Jin H, Zhang A, et al.Enhanced contraceptive responseby co-immunization of DNA and protein vaccines encoding the mouse zonapellucida 3 with minimal oophoritis in mouse ovary.J Gene Med 2007; 9:1095-1103.].
3, preventive effect evaluation
Behind the guidance model after 14 days, get ovary tissue cut into slices scoring and statistics sickness rate.Standards of grading are as follows: 1 minute, atretic follicle, growth or the mature follicle of 2-3 cellular infiltration are arranged; 2 minutes, 5-6 atretic follicle, growth or mature follicle that damages arranged; 3 minutes, extensively be distributed with the follicle of cellular infiltration on the ovarian sections; 4 minutes, ovarian atrophy did not have follicle fully.
The results are shown in Figure 12, carry out ovarian sections behind the guidance model, sickness rate is every group and suffers from the mice of oophoritis with respect to the percentage ratio (%) of total mice, and ovarian sections is marked, and marking is the meansigma methods of every group of 9 mouse ovarians section.Vertical coordinate is appraisal result, and abscissa represents different grouping.Each round dot represents a mice.Compare with pCDNA-ZP3 group, the sickness rate of pCDNA-ZP3+FK506 group significantly descends, and meansigma methods also significantly descends simultaneously, shows that the method can prevent the generation of oophoritis.
Sequence table
＜110〉China Agricultural University
＜120〉a kind of medicine of preventing autoimmune disease
<130>CGGNARY92231
<160>1
<210>1
<211>141
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
aagcttatgg aggtgggttg gtaccgttct cccttctcaa gagtggttca cctctaccga 60
aatggcaaga tggaggtggg ttggtaccgt tctcccttct caagagtggt tcacctctac 120
cgaaatggca agtaaggatc c 141
Claims (7)
1. the application of Prograf in the adjuvant of the medicine of preparation preventing autoimmune disease; The medicine of described preventing autoimmune disease is the DNA of following (a) and/or the recombiant plasmid of following (b):
(a) coding DNA of the Protein Epitopes polypeptide of autoimmune disease;
(b) recombiant plasmid that contains (a) described DNA;
The Protein Epitopes polypeptide of described autoimmune disease is that myelin oligodendrocyte glycoprotein polypeptide is from amino terminal the 35th to 55 amino acids residue.
2. application as claimed in claim 1 is characterized in that: described autoimmune disease is multiple sclerosis.
3. application as claimed in claim 1 or 2 is characterized in that: the medicine of described preventing autoimmune disease is to contain the sequence 1 of ordered list from DNA and/or the recombiant plasmid p2MOG of 5 ' terminal the 7th to 132 nucleotide
35Described recombiant plasmid p2MOG
35That the sequence 1 that will contain ordered list imports the recombiant plasmid that the pVAX1 plasmid obtains from the DNA of 5 ' terminal the 7th to 132 nucleotide.
4. the medicine of a preventing autoimmune disease, its active ingredient are function DNA and as the Prograf of adjuvant; Described function DNA is the DNA of following (a) and/or the recombiant plasmid of following (b):
(a) coding DNA of the Protein Epitopes polypeptide of autoimmune disease;
(b) recombiant plasmid that contains (a) described DNA;
The Protein Epitopes polypeptide of described autoimmune disease is that myelin oligodendrocyte glycoprotein polypeptide is from amino terminal the 35th to 55 amino acids residue.
5. medicine as claimed in claim 4, it is characterized in that: described autoimmune disease is multiple sclerosis.
6. such as claim 4 or 5 described medicines, it is characterized in that: described function DNA is to contain the sequence 1 of ordered list from DNA and/or the recombiant plasmid p2MOG of 5 ' terminal the 7th to 132 nucleotide
35Described recombiant plasmid p2MOG
35That the sequence 1 that will contain ordered list imports the recombiant plasmid that the pVAX1 plasmid obtains from the DNA of 5 ' terminal the 7th to 132 nucleotide.
7. such as claim 4 or 5 described medicines, it is characterized in that: in the described medicine, the mass ratio of described function DNA and described adjuvant is 10: (0.5-10).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910083049 CN101897964B (en) | 2009-04-27 | 2009-04-27 | Medicament for preventing autoimmune disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910083049 CN101897964B (en) | 2009-04-27 | 2009-04-27 | Medicament for preventing autoimmune disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101897964A CN101897964A (en) | 2010-12-01 |
| CN101897964B true CN101897964B (en) | 2013-04-10 |
Family
ID=43224104
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910083049 Expired - Fee Related CN101897964B (en) | 2009-04-27 | 2009-04-27 | Medicament for preventing autoimmune disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101897964B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112426524A (en) * | 2020-12-21 | 2021-03-02 | 中国医学科学院生物医学工程研究所 | Application of plant polysaccharide as adjuvant in preparation of medicine for treating autoimmune disease |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995006727A2 (en) * | 1993-09-03 | 1995-03-09 | Immulogic Pharmaceutical Corporation | Uses of myelin oligodendrocyte glycoprotein and peptide portions thereof in protocols related to autoimmune disease |
| CN1162919A (en) * | 1994-08-25 | 1997-10-22 | 赫彻斯特股份公司 | Combination preparation, containing cyclosporin a or FK506 or rapamycin and a xanthine derivative |
| WO2000047625A2 (en) * | 1999-02-12 | 2000-08-17 | Genetics Institute, Inc. | Humanized immunoglobulin reactive with b7 molecules and methods of treatment therewith |
| CN1636013A (en) * | 2000-07-14 | 2005-07-06 | 宾夕法尼亚州立大学托管会 | DNA vaccines encoding HIV accessory proteins |
| CN101175481A (en) * | 2005-03-17 | 2008-05-07 | 伊兰制药国际有限公司 | Injectable compositions of nanoparticulate immunosuppressive compounds |
| CN101288643A (en) * | 2008-06-17 | 2008-10-22 | 杨喜鸿 | Gel composition containing tacrolimu and its preparation method and medicinal application |
| WO2008129426A2 (en) * | 2007-04-24 | 2008-10-30 | Diamyd Therapeutics Ab | Medicaments and methods to treat autoimmune disease and cancer |
-
2009
- 2009-04-27 CN CN 200910083049 patent/CN101897964B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995006727A2 (en) * | 1993-09-03 | 1995-03-09 | Immulogic Pharmaceutical Corporation | Uses of myelin oligodendrocyte glycoprotein and peptide portions thereof in protocols related to autoimmune disease |
| CN1162919A (en) * | 1994-08-25 | 1997-10-22 | 赫彻斯特股份公司 | Combination preparation, containing cyclosporin a or FK506 or rapamycin and a xanthine derivative |
| WO2000047625A2 (en) * | 1999-02-12 | 2000-08-17 | Genetics Institute, Inc. | Humanized immunoglobulin reactive with b7 molecules and methods of treatment therewith |
| CN1636013A (en) * | 2000-07-14 | 2005-07-06 | 宾夕法尼亚州立大学托管会 | DNA vaccines encoding HIV accessory proteins |
| CN101175481A (en) * | 2005-03-17 | 2008-05-07 | 伊兰制药国际有限公司 | Injectable compositions of nanoparticulate immunosuppressive compounds |
| WO2008129426A2 (en) * | 2007-04-24 | 2008-10-30 | Diamyd Therapeutics Ab | Medicaments and methods to treat autoimmune disease and cancer |
| CN101288643A (en) * | 2008-06-17 | 2008-10-22 | 杨喜鸿 | Gel composition containing tacrolimu and its preparation method and medicinal application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101897964A (en) | 2010-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Doniach et al. | Planar induction of anteroposterior pattern in the developing central nervous system of Xenopus laevis | |
| Nelson et al. | The loss of macrophages from peritoneal exudates following the injection of antigens into guinea-pigs with delayed-type hypersensitivity | |
| Gabryšová et al. | Antigenic strength controls the generation of antigen‐specific IL‐10‐secreting T regulatory cells | |
| DE69737969T2 (en) | DNA VACCINATION TO INTRODUCE A SUPPRESSIVE T CELL RESPONSE | |
| CN103272227B (en) | Peptides for desensibilization against allergens | |
| Tabi et al. | Apoptotic elimination of Vβ8. 2+ cells from the central nervous system during recovery from experimental autoimmune encephalomyelitis induced by the passive transfer of Vβ8. 2+ encephalitogenic T cells | |
| Yoshimoto et al. | Nonredundant roles for CD1d-restricted natural killer T cells and conventional CD4+ T cells in the induction of immunoglobulin E antibodies in response to interleukin 18 treatment of mice | |
| Isakova et al. | Cell-dose− dependent increases in circulating levels of immune effector cells in rhesus macaques following intracranial injection of allogeneic MSCs | |
| Gyülvészi et al. | IL‐23‐driven encephalo‐tropism and Th17 polarization during CNS‐inflammation in vivo | |
| Rao et al. | Experimental autoimmune encephalomyelitis | |
| Cravens et al. | Lymph node-derived donor encephalitogenic CD4+ T cells in C57BL/6 mice adoptive transfer experimental autoimmune encephalomyelitis highly express GM-CSF and T-bet | |
| Kobayashi et al. | Preventative effects of the flowers of Inula britannica on autoimmune diabetes in C57BL/KsJ mice induced by multiple low doses of streptozotocin | |
| Grimm et al. | Mechanism of Cell-Mediated Cytotoxicity at the Single Cell Level: II. Evidence for First-Order Kinetics of T Cell-Mediated Cytolysis and for Heterogeneity of Lytic Rate | |
| Falk et al. | Induction and suppression of an autoimmune disease by oligomerized T cell epitopes: enhanced in vivo potency of encephalitogenic peptides | |
| CN101897964B (en) | Medicament for preventing autoimmune disease | |
| Shiohara et al. | Fixed drug eruption: the dark side of activation of intraepidermal CD8+ T cells uniquely specialized to mediate protective immunity | |
| CA2164326A1 (en) | Cryptic peptides for use in inducing immunologic tolerance | |
| Keahey et al. | Delayed vibratory angioedema: insights into pathophysiologic mechanisms | |
| Ali et al. | Peptide-based immunotherapy: a novel strategy for allergic disease | |
| Jacobs et al. | Role of IL-2 and IL-4 in exacerbations of murine antigen-induced arthritis. | |
| Mott et al. | Role of interleukin-2 and herpes simplex virus 1 in central nervous system demyelination in mice | |
| Gillman et al. | STUDIES ON THE PATHOGENESIS OF FEVER: VIII. Further Observations on the Role of Endogenous Pyrogen in Endotoxin Fever | |
| Kang et al. | FK506 as an adjuvant of tolerogenic DNA vaccination for the prevention of experimental autoimmune encephalomyelitis | |
| Hoy et al. | T cell response to soluble cryptococcal antigens after recovery from cryptococcal infection | |
| Thibodeaux et al. | Autocrine regulation of IL-12 receptor expression is independent of secondary IFN-γ secretion and not restricted to T and NK cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130410 Termination date: 20190427 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |