CA2250361A1 - Myelin oligodendrocyte glycoprotein peptides and uses thereof - Google Patents

Abstract

The present invention provides peptides of human myelin oligodendrocyte glycopeptide (MOG), an autoantigen related to demyelinating autoimmune diseases. The present invention also provides compositions including MOG
peptides or mixtures of MOG peptides and myelin basic peptide (MBP) peptides.
Also provided are therapeutic compositions useful for diagnosing and treating autoimmune diseases, and methods of treating multiple sclerosis using such therapeutic compositions.

Description

CA 022~0361 1998-09-28 MYEL~ OLIGODENDROCYTE GLYCOPROTEIN
1 ~l II~ES AND USES THEREOF

The invention is directed to autoantigens and their relevant epitopes. More specifically, the invention concerns myelin oligodendrocyte glycoprotein (MOG) and the peptide regions thereof useful in diagnosis, treatment, and prevention of 10 autoimmllnp conditions. Further, methods of screening for, and developing therapeutics useful in the treatmPnt of, autoimmune disease are also disclosed.

Autoimml-n~ ~lice~cec are a .cignific~nt human health problem and are relatively poorly understood. As there is no microbial or viral culprit a~l)arelllly 15 directly responsible, prevention, treatment and di~nosic of such diseases must be based on the etiology of the disease. This invariably involves a complex series of reactions of endogenous metabolic interm~ tes, structural components, cells, andso forth. Implicit, however, in the nature of an autoimmnnP condition is the notion that at least one alltoantigen must be involved in creating the sequence of 20 events that results in the symptoms. AutoimmlmP demyelinating f~ice~ceC, such as multiple sclerosis (MS), are no exception. MS is the most common cause of neurological disability associated with disease in Western countries. It is an infl~mm~tory disease of the central nervous system (CNS) characterized in part by destruction of myelin.
Macrophages, plasma cells, antigen-presenting cells, and cytokine-secreting T lymphocytes can be found in the CNS of MS patients, but activated. The etiology of MS is still unknown, but it is believed that activated T cells misdirected towards normal constituents of the nervous system are responsible for -30 the pathology of MS. Models for MS and compositions and methods for treating MS are thus needed.

CA 022~0361 1998-09-28 Wo 97/35879 PCTtUS96/06072 A commonly used animal model for MS is experimental allergic encephalomyelitis (EAE). EAE is a CD4+ T cell m.o~ ttqcl autoimmllnP
demyelin~ting disease of the CNS which resembles MS in some of its clinical and histological features. This disease can be in~ re~, for example, in guinea pigs by S ~rlmini~tration of whole brain homogenate, and has been inrl~lce(l in mice with myelin basic protein (MBP) and complete Freund's adjuvant. The mouse model has been accepted as a model of human MS. Animals so immnni7~fl exhibit symptoms of EAE, including, but not limited to, paralysis and often death.
Although MBP has been associated with EAE and MS, the search for other factors 10 and other ~-ltoantigens which may contribute to these diseases continues (Kuby (1994) Immunol. (2d Ed.) pp. 451-457).

The a~palcl.~ first indication of the ~lltoantigen which came to be known as myelin oligodendrocyte glycoplot~ (MOG) was disclosed by Lebar et al. (J.
Immunol. (1976) 116:1439-1446). This work reported the results of a study which identified an IgG2 antibody in the serum of EAE guinea pigs as responsible for the complement-dependent demyelin~ting activity of the serum. The relevant antibody reacted with the putative autoantigen present in the homogenate of CNS myelin.
This autoantigen was shown to be different from the encephalitogenic MBP of 20 CNS myelin.

In a subsequent paper, this unknown antigen, now designated M2, was identified as a relatively minor component of CNS myelin located on oligodendrocyte surfaces and in the outermost lamellae of myelin in mouse, rabbit, 25 rat, bovine and human CNS tissues as well as guinea pig (Lebar et al. (1986) J.
Exp. Immunol. 66:423-443). M2 appeared as two glycoprotein bands at 27 and 54 kD, and monoclonal antibodies putatively specific for M2 were also reported in this paper.

In 1987, the role of M2, now called MOG, was partially elucidated (Linington et al. (1987) J. Neuroimmunol. (1987) 17:61-69). In vivo demyelin~tin~ activity of serum in rats was correlated with its anti-MOG antibody -CA 022~0361 1998-09-28 W O 97135879 PCTrUS96/060n titer. The authors suggest that antibodies against MOG are involved in the pathogenesis of the model, in this case, chronic relapsing EAE. Further studies by this group further elucidated the relevant events in the EAE model (r ~s.sm~nn et al. (1988) Acta Neuropathol (Berl) 75:566-576). This study showed a 5 relationship between anti-MOG antibody and high numbers of T-cells in deterrnining the nature of the observed symptoms. In a still later paper, it wasshown that a monoclonal antibody directed against MOG in~ ced demyelination in aggregating brain cell cultures (Kerleio deRosbo et al. (1990) J. Neurochem.
55:583-587) .
Sun et al. (J. Immunol. (1991) 146:1490-1495), directly studied MS in patients and evaluated both B- and T-cell response to MOG. This paper established that the T-cell response to MOG is Class II restricted and confirmedthat MOG is an important antigen in MS.
Purified murine MOG has been shown to migrate as a 26-28 kD doublet band with a minor band at 53 kD on SDS-page immllnoblots (Matthieu et al.
(1990) Dev. Neurosci. 12:293-302). Amiguet et al. (J. Neurochem. (1992) 58:1676-1682), had shown that chPn~i~al and enzymatic deglycosylation of murine 20 MOG resulted in a single 25 kD peptide. Thus, murine MOG in its monomeric form is a 25 kD amino acid sequence. This article also disclosed the first approximately 26 amino acids at the N-te,-"il.-l~ of the murine protein. Gardinier et al. (J. Neurosci. Res. (1992) 33:177-187, isolated several rat MOG cDNAs and confirmed their identity by comparison with murine MOG N-terminal peptide 25 sequence. The rat cDNA obtained by Gardinier (supra) had an open reading frame that encoded a putative signal peptide of 27 amino acids followed by mature MOG peptide of 218 amino acids with a calc~ tçd molecular weight of 24 962 kD. The N-tçnnin~l amino acid sequences obtained for the murine protein were similar to those dçd~l~e~l from the rat cDNA.

CA 022~0361 1998-09-28 Wo 97/3~879 PCT/USg6/06072 SUMMARY OF THE INVENTION

The present invention provides recombinant materials for the production of the human MOG protein as well as the complete amino acid se~uence thereof.
S Using this information, the MOG protein or useful peptides representing portions of the amino acid sequence of MOG protein can be determined and are useful in the diagnosis and tre~tmrnt of demyelinating autoi"""~ diseases in hllm~n.~.
Further, methods of screening for, and developing therapeutics compositions for,and treating autoimmlmr disease are disclosed.
The invention provides the complete amino acid sequence of human MOG
protein (SEQ ID NO:2) as well as recombinant materials for the production of theprotein and fragments thereof. Knowledge of the amino acid sequence permits design of peptide portions thereof which are useful in diagnosis and treatment of autoilll"~l~nP diseases.

Accordingly, in one aspect, the invention is directed to isolated and purified human MOG protein, and to peptide fragments thereof which modulate the course of development of symptomology in demyelinating autoimmllnP
~ e~cPs. In one embodiment, the MOG peptides of the invention have an amino acid sequence selectec~ from the group con~i~ting of SEQ ID NOS:96-llO and 146-164. In another embodiment, the invention provides human MOG peptides including at least one T cell epitope-cont~ining region and comprising all or a portion of amino acid residues 1-95 (SEQ ID NO:205), 101-135 (SEQ ID
NO:207) including 111-135 (SEQ ID NO:102), or 171-215 (SEQ ID NO:206).

In yet another aspect, the invention is directed to recombinant materials and methods useful for the production of the MOG protein and peptide portions thereof. In still another aspect, the invention is directed to compositions including 30 ph~rm:~re~tic~1 compositions and methods of their use in mitigating the effects of demyelin~ting autoimm--n~ diseases such as MS.

.. . . .

CA 022~0361 1998-09-28 In another aspect, the invention is directed to isolated, purified, and modified human MOG protein and peptides in which conservative substitutions have been made which exhibit characteristics of T cell epitopes of the naturallyoccurring MOG protein and peptides. In one embodiment, a MOG peptide of the S invention has a first amino acid substituted for a second amino acid. The peptide so modified retains a biological activity which it possessed before modification. In another embodiment, a first amino acid is substituted for a second, a third, and/or a fourth amino acid in the MOG peptide. In yet another embodiment, the peptide is coupled to a polyethylene glycol, a moiety that enhances the solubility of the 10 peptide, a moiety that facilitates purification of the peptide, and/or a moiety including a proteolytic cleavage site.

Other embo~limPnt~ include a MOG peptide of the invention including at least one T-cell epitope. In some embodiments, such a MOG peptide includes at 15 least two T cell epitopes. In other embo~im~nt~, the MOG peptide includes tandem copies of the same or different T cell epitopes.

In yet another aspect, the invention discloses a method for screening for demyelin~ting autoimmllnl~ disease and identifying therapeutic compositions 20 co~ ised of MOG or fragments thereof which are capable diagnosing, preventing or treating MS in m~mm~ls, preferably, hllm~n~

The invention also provides compositions including at least one MOG
peptide. In some embo~tments, the MOG peptide of the composition of the 25 invention comprises at least one T cell epitope. In other embodiments, the composition further comprises a peptide of human MBP. In some embodiments, the composition includes tandem copies of a MOG peptide.

Multipeptide compositions are also provided by the invention. These 30 compositions include more than one MOG peptide of the invention or a combination of a MOG peptide of the invention and any other MOG peptide or peptide of human MBP.

CA 022~0361 1998-09-28 Wo 9713~879 PCT/US96/06072 In another aspect, such compositions and multipeptide compositions are part of thel~p~uLic compositions, including a ph~rm~re ~tir~lly acceptable carrier, for treating multiple sclerosis in a m~mm~l. In other embodirnents, a therapeutic composition is provided which includes a ph~rm~relltir~lly acceptable excipient 5 and a major histocompatibility complex (MHC) class II peptide complex capable of binding a T cell receptor and inducing anergy and/or apoptosis in a T cell bearing the receptor. In this embodiment, the complex includes an MHC class II
component comprises extracellular domains of an MHC class II molecule sufficientto form an antigenic binding pocket, is encoded by an allele associated with an 10 autoimmlmP disease such as MS, and is soluble under physiological conditions in the absence of detergent or lipids. The complex further includes a MOG peptide which is autoantigenic and bound to the antigen binding pocket. In some embodiments, the complex further includes at least a second MHC class II peptidecomplex. In yet oether embodiments, the the~ uLic formulations of the invention 15 include MOG or MBP + MOG, or MBP peptides.

In yet another aspect, the invention provides a method of treating MS
comprising the step of aAmini.ctering to a m~mm~l suffering from MS a therapeutic composition of the invention in an amount sufficient to down-regulate an 20 autoimm-ln~ response in the m~mm~l In some embo~limentc, the ~-lminictering step is carried out by intravenous injection, subcutaneous injection, hlllA.-,--sc~ r injection, oral a~lminictration, inhalation, sublingual ~(lminictration, transdermal a~lminictration, or rectal ~lminictration. In a particular embo~im~nt, the composition is ~(lminictered subcutaneously in non-immunogenic forrn in an 25 amount sufficient to down-regulate the autoimm~n~ response in the m~mm~l CA 022~0361 1998-09-28 W O 97/35879 rCTAUS96/06072 BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 shows the complete nucleotide sequence (SEQ ID NO: 1) of DNA
encoding human MOG protein and the amino acid sequence dedllced thererloln (SEQ ID NO:2), wherein the arrow inf~ir~t~s the first amino acid of the mature MOG protein;

FIG. 2 shows peptides, design~t~d by amino acid sequence which are useful in the invention (SEQ ID NOS:4-9, 11, 15, 16, and 42-72);

FIG. 3 is a table showing the effect of each of the natural amino acids at certain positions on peptides binding to the MHC Class II product of DR4;

FIG. 4 is a table showing a comparison of predicted and measured IC50 values for 12 peptides (SEQ ID NOS:19-32) binding to the MHC Class II product of DR4;

FIG. 5a shows peptides (20mers) designated by amino acid sequence (SEQ
ID NOS:73-93) which are useful in the invention;
FIG. Sb shows a peptide of human MOG 1-121, de~ign~ted by amino acid sequence, which contains at least one T cell epitope;
-CA 022~0361 1998-09-28 Wo 97/3~879 PCT/US96/06072 FIG. 6 is a bar graph of data from Example S where the X-axis in(lir.~tes wells cont~ining 4 different cell lines, the 7 peptides tested are inrlic~t~cl by the different legends and the Y-axis inrliç~tes counts per minute where the data is expressed as 3H-thymidine incorporated (CPM) by each cell line in response to 5 each individual peptide;

FIG. 7 is a sch~ tic representation of the identity of representative MOG
peptides compared with the complete MOG sequence;

FIG. 8A is a bar graph of data from Example 8 where the x axis indicates individual MOG peptides used to test short term MOG-selected T cell lines, and the y axis inrlie~tes the sum of ranks earned by each peptide;

FIG. 8B is a bar graph of data from Example 8 where the x axis in-lic~t~s 15 individual MOG peptides used to test short term MOG-selected T cell lines, and the y axis in~icat~s the average value for percent of total peptide reactivity accounted for by each individual peptide; and FIG. 9 is a bar graph of data from Example 9 where the x-axis indicates 20 individual MOG peptides used to test short term MOG-selected T cell lines, and the y axis (positivity index) in-lic~tes the average value for percent of total peptide activity accounted for by each individual peptide.

CA 022~0361 1998-09-28 Wo 97/3~879 PCT/US96/06072 DESCRIPTION OF THE PREFERRED EMBODIMENT

The patent and scientific liL~lalule referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patents, 5 allowed applications, published foreign applications, and ~felences cited herein are hereby incorporated by reference.

The present invention provides novel peptides of human MOG, an autoantigen involved in demyelinating autoimml]ne diseases. It also compositions10 including such peptides which are useful in moderating the auLoi~ n~ response.
Many of these peptides are characterized by their correspondence to the T-cell epitope regions of the human MOG.

While the etiology of development of the symptoms of an autoimm--nf~
15 disease such as MS far from clear, certain events are believed to be critical to the progression of the condition. Demyelin~ting autoimml~n~ diseases involve a T cell me~ ted attack by the imml~nP system on the myelin sheath, res~-lting in what amounts to short circuits in the nervous system. T-cell responses to the human MOG autoantigen require uptake and subsequent proteolytic cleavage of the 20 antigen by antigen presenting cells, followed by presentation of the antigen in the context of a Class II major histocompatibility complex (MHC)-encoded protein, thereby perrnitting their recognition by the T-cells. Thus, the T-cell epitope regions of the ~uto~ntigen are those which are presented by the Class II MHC
proteins to the T-cell receptors. The relevant T-cells can be rendered 25 nonresponsive in an antigen-specific fashion in protocols by providing the T-cell epitope regions of the autoantigen, as is further described below.

- A nucleic acid sequence encoding human MOG is shown in FIG. 1 (SEQ
ID NO: 1), along with the ~led-lce~l amino acid sequence (SEQ ID NO:2). The 30 encoded mature protein contains a 218 amino acids; the full length protein (including signal peptide) is 87% homologous with the rat MOG protein. As described above, the availability of the de~hlce~l amino acid sequence of human CA 022~0361 1998-09-28 wo 97t35879 PCT/USg6/06072 MOG provides the opportunity to design peptide fragments thereof which induce imm~ln~ responses in m~mm~l~ and peptide fragments which are T-cell epitopes, i.e., constitute those portions of the molecule which are recognized by human T-cell receptors. These peptides and fragments are also included within the 5 invention scope of the invention.

E~owever, the scope of the invention is not limited to the human MOG
protein encoded by the amino acid sequenre depicted in FIG. 1, or to the specific nucleic acid sequence ~r~sellled. Naturally occurring variants and deliberate 10 mutations designed to modify the nucleic acid sequence per se or to modify the encoded protein are also included in the scope of the invention as further described below. With respect to naturally occurring variants, DNA sequence polymorphisms, especially those resulting in "silent" mutations which do not affect the amino acid sequ~nre of the human MOG, but also sequenre polymorphisms 15 that do lead to changes in the amino acid sequence, are expected to exist in the human population. These variations in one or more nucleotides (up to about 1%
of the nucleotides) of the sequence encoding MOG are a result of natural allelicvariation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of the invention. Furthermore, there may be 20 one or more "family members" of MOG that are related in function and amino acid sequence to the MOG encoded by the DNA disclosed herein but encoded by separate genes. Such family members are also included within the definition of human MOG and the nucleotide sequen~es encoding it.

Isolated ~uto~ntigenic plOt~ S or fr~ment~ thereof, that are novel and that are immunologically related to human MOG or fragments thereof, other than those already identified, are within the scope of the invention. These can be identified by antibody cross-reactivity or T-cell cross-reactivity. Such proteins or fragments thereof bind antibodies specific for the protein and peptides of the invention, or stim~ t~ T-cells specific for the protein and peptides of this invention.

. .

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 "Antigenic fragmP~t~" refer to an amino acid sequence having fewer amino acid residues than the entire protein and include frA~m~ntc or peptides which induce an immllne response in m~mm~l~, preferably hllm~n~, such as eliciting theproduction of IgG and IgM antibodies, or eliciting a T-cell response such as 5 proliferation and/or lymphokine secretion and/or induction of T-cell anergy and/or apoptosis and/or modification of THI and TH2 subsets. Of particular interest areantigenic fr~m~nt~ that comprise T-cell epitopes. Peptides can be derived from the naturally occurring MOG sequence or and can be modified such that conservative amino acid substitutions have been made. These substitutions include 10 replacing another arnino acid (e.g., a second, third, fourth, or other amino acid), replacing more than one amino acid (e.g., a second and third, second, third and fourth, or other amino acids) with a first amino acid which does not interfere with a biological activity of the peptide; i.e., The peptide so modified retains a biological activity it possessed before mo-lifir~tion. Nonlimitin~ exarnples of 15 naturally occurring and modified peptides are shown in FIG. 2 (SEQ ID NOS:4-9, ll, l5, 16, 42-72. and 169), and in Tables l and 2 below.

SEQ ID
Peptide Sea~lPnrP (NH2 COOH) NO:

MOG 70-82, A78 ELLKDAIGAGKVT (analog of MOG 70-82) 8 MOG 88-100,K89,S98 VKFSDEGGFTSFF ~analog of MOG 88-100) 9 CA 022~0361 1998-09-28 WO 97/35879 PCTtUS96/06072 SEQ ID
~e~tide Seq~l~nr~ (NH2 COOH) NO:
s 1-25 (24C-24S) GQFRVIGPRHPIRALVGDEVELPSR 147 Preparation of Nucleic Acids Nucleic acid molecules cont~ining a sequence encoding human MOG or an 50 antigenic fragment thereof may be obtained by reverse transcription of mRNA
present in human brain or other CNS tissue, as well as from genomic DNA.

CA 022~0361 1998-09-28 WO 97/35879 PCTrUS96/06072 Various methods of cl~Pnlirally synthesizing polynucleotides are known, including standard solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al., U.S. Patent No. 4,598,049; Caruthers et al., U.S. Patent No. 4,458,066; and Itakura, U.S. Patent Nos. 4,401,796 and 4,373,071). The nucleic acid molecules of the invention also include RNA which can be transcribed from the DNA
prepared as above or syn~h~si7rd ch~ mir~lly.

Preparation of Human MOG and its Fr~m~n The present invention also provides expression systems and host cells transformed with these systems for production of the encoded protein. Host cellsinclude bacterial cells such as E. coli, yeast, or ~ n cells such as Chinese h~ ovary cells (CHO). Suitable host cells and expression vectors cont~ininf~
relevant promoters, enh~nrers and other expression control elements may be foundin Goeddel, Gene Expression Technology: Methods in Enz~ymology Vol. 185, Ac~demic Press, San Diego, California (1990). Other suitable host cells and expression vectors are known to those slcilled in the art.

Expression in eucaryotic cells such as m~mm~ n, yeast, or insect cells can lead to partial or complete glycosylation and/or formation of relevant inter- orintra-chain di~ulfil1e bonds of recombinant protein. Examples of vectors for expression in yeast S. cerevisae include pYepSecl (Baldari. et al., (1987) Embo J.
6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123), and pYES2 (Invitrogen Corp., San Diego, CA). Baculovirus vectors available for expression of proteins in culturedinsect cells (Sf9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol.
- 3:2156-2165) and the pVL series (Lucklow et al. (1989) Virol. 170:31-39).
Generally, COS cells (Gluzman (1981) Cell 23:175-182) are used in conjunction with such vectors as pCDM 8 (Aruffo et al. (1987) Proc. Natl. Acad. Sci. (USA) 84:8573-8577) for transient amplifir~ti(n/expression in ~ """~ n cells, while CHO-DHFR cells are used with vectors such as pMT2PC (~ fm~n et al. (1987), CA 022~0361 1998-09-28 Wo 97l35879 PcT/uss6lo6o72 EMBO J. 6:187-195) for stable amplification/expression in ~ n cells.
Vector DNA can be introduced into m~mm~ n cells via any known conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-me~ tecl transfection, or electroporation. Suitable methods for 5 transforrning host cells can be found in Sambrook et al. (Molecular Cloning: ALaboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press (1989)), and other laboratory textbooks.

Although those skilled in the art use various methods of expression, 10 expression in prokaryotes is most often carried out in E. coli with either fusion or non-fusion inducible expression vectors. Fusion vectors usually add a number of amino terminal amino acids to the ~ ssed target gene. These amino tell,~ al amino acids often are referred to as a reporter group. Such rel ol~er groups usually serve two purposes: 1) to increase the solubility of the target recombinant 15 protein; and 2) to aid in the purification of the target recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the reporter group and the target recombinant protein to enable separation of the target recombinant protein from the reporter group subsequent to purification of the fusion protein. Such 20 enzymes, and their cognate recognition sequences, include Factor Xa, thrombinand enterokinase. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New F.ngl~n~l Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase, maltose E
binding protein, or protein A, respectively, to the target recombinant protein.
Inducible non-fusion e~ cssion vectors include pTrc (Amann et al., (1988) Gene 69:301-315) and pET lld (Studier et al. (1990) Meth. Enz~ymol. 185:60-89).
While target gene expression relies on host RNA polymerase lldllscliption from the hybrid Trp-lac fusion promoter in pTrc, ~ ession of target genes inserted 30 into pET 11d relies on transcription from the T7 gnlO-lac 0 fusion promoter m~ s~d by coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident g CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 prophage harboring a T7 gnl under the L~ sc~ ional control of the lacUV 5 promoter.

One strategy to maximize e~ression in E. coli is to express the protein in 5 a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gotte~m~n (1990) Meth. Enz:ymol. 185:119-128). Another strategy is to alter the coding sequence of the gene so that the individual codons for each amino acid are those ~,cfelelltially utilized in highly expressed E. coli proteins (Wada et al. (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid 10 sequences of the invention can be carried out by standard DNA synthesis techniques.

Upon expression of the encoding gene, the recombinant protein, or peptide product may be secreted and harvested from the mP~ m. Alternatively, the 15 protein may be retained cytopl~smir~lly and the cells harvested, lysed, and the protein isolated and purified. Suitable media for cell culture are well known in the art. The protein and peptides of the invention can be purified from cell culturem~o~linm, host cells, or both using techniques known in the art for purifying proteins and peptides including ion-exchange chromatography, gel filtration 20 chromatography, metal affinity chromatography, ultrafiltration, electrophoresis, and immlln~ffinhy purification with specific antibodies. The terms isolated and purified are used interchangeably herein and refer to peptides, protein, proteinfragments, and nucleic acid molecules substantially free of cellular material orculture m~-lillm when produced by recombinant DNA tec-hniqlle~, or chemical 25 precursors or other ch.omir~l~ when chernic~lly synth~ci7~d. Accordingly, an isolated peptide is produced recombinantly or syn~h~tit~lly and is substantially free of cellular material and culture medium or subst~nti~lly free of chemical precursors or other ch~mi CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 Anti~enic Fragments and the "Antigenic" Response Fragments of the MOG protein that elicit a desired antigenic response (referred to interchangeably herein as antigenic fr~gm~ntc or peptides) may be 5 obtained, for example, by screening peptides corresponding to portions of the protein. These peptides may be çh~mi~lly synth~si7ed using techniques known in the art, produced recombinantly, or prepared through proteolysis of the whole orportion of the protein. For example, the protein may be a,l,illarily divided into fragments of desired length with no overlap of the fragments, or preferably 10 divided into overlapping fragments of a desired length (see, e.g., FIG. 7). The fr~gment~ are tested to determine their antigenicity (e.g., the ability of the fragment to induce an immnnf~ response in a ",~-,-",~l). If fragments of the protein are to be used for therapeutic purposes, then the fr~gm~nt~ which are capable of eliciting a T-cell response, such as stim~ tion (i.e., proliferation or 15 lymphokine secretion) and/or are capable of inducing T-cell tolerance, anergy, andlor apoptosis are particularly desirable.

The isolated protein or ~lefe~.ed antigenic fragments thereof, when a-imini~tçred to an individual subject to demyelin~ting autoil-"l~ disease, are 20 capable of modifying the B-cell response, T-cell response, or both the B-cell and the T-cell response of the individual to the a~lto~ntigen~ or can be shown to result in a fliminlltion of ~ylllptOIllS. As referred to herein, "a ~liminlltion in symptoms"
includes any reduction in infl~mm~tion or in infiltration of leukocytes and/or arrest of demyelination characteristic of the disease condition following a treatment 25 regimen with a peptide or protein of the invention. This (iimimltion in symptoms may be ~ e.,-,i"~d subjectively or clinically.

Human T-cell stim~ ting activity can be tested by culturing T-cells obtained from a subject having an autoi,-,l,-~.nP condition with the autoantigen30 and/or a peptide derived from the autoantigen and determining whether proliferation of T-cells occurs in response to the ~lto~ntigen and/or peptide asmeasured, e.g., by cellular uptake of tritiated thymidine. Stimulation indices for CA 022~0361 1998-09-28 responses by T-cells to peptides can be c~lr~ ted as the maximum counts per minute ~CPM) in response to a peptide divided by the control CPM. A
stim~ tion index (S.I.) equal to or greater than two times the background level is considered "positive". Positive results are used to calculate the mean stiml-l~tion 5 index for each peptide for the group of patients tested. Preferred peptides of this invention comprise at least one T-cell epitope and have a mean T-cell stim~ tionindex of greater than or equal to 1.5. A peptide having a mean T-cell stiml-l~tion index of greater than or equal to 1.5 in a significant number of patients tested (i.e.
at least 10% of patients tested) is considered useful as a the~ ulic agent.
10 Plerelled peptides have a mean T-cell stim~ tion index of at least 1.5, more preferably at least 2.0 to 3Ø

Preferred peptides can also be jllçntifiP~ by their ability to effect a relatively higher frequency of T-cells in a patient. This frequency is meas~l~;d by 15 generating multiple i-lentir~l cultures from one patient with limiting numbers of Iymphocytes and the autoantigen and/or a peptide from the allto~ntigen. Individual cultures are analyzed for positive reactivity with a peptide, as defined by stim~ tion index (described above). The frequency of peptide-reactive T-cells isthe percentage of cultures from the patient that show a positive stim~ tion index.
In addition, pl~fe.led peptides have a positivity index (P.I.) of at least about 100, more preferably at least about 200 and most preferably at least about300. The positivity index for a peptide is (l~ t~.,.,.i..~ by multiplying the mean T-cell stim~ tion index by the percent of individuals, in a population of 25 autoimml~ne patients (e.g., preferably at least 15 individuals, more preferably at least 30 individuals or more), who have a T-cell stim~ tion index to such peptide of at least 1.5, more preferably at least 2Ø Thus, the positivity index represents both the strength of a T-cell response to a peptide (S.I.) and the frequency of a T-cell response to a peptide in a population of autoimmlln~ individuals.
In order to determine precise T-cell epitopes by, for example, fine mapping techniques, a peptide having T-cell stim~ ting activity and thus comprising at least CA 022~0361 1998-09-28 Wo 97135879 PCT/US96/06072 one T-cell epitope as det~rmin~od by T-cell biology techniques is modified by addition or deletion of amino acid residues at either the amino or carboxy terminus of the peptide and tested to determine a change in T-cell reactivity to the modified peptide. If two or more peptides which share an area of overlap in the native protein sequence are found to have human T-cell s~im~ ting activity, as determined by T-cell biology teçhni~ es, additional peptides can be produced con~,isillg all or a portion of such peptides and these additional peptides can be tested by a similar procedure. Following this techni-lue, peptides are selected and produced recombinalllly or synth-oti~lly. Peptides are selected based on variousfactors, including the ~ll.,n~ of the T-cell response to the peptide (e.g., stim~ tion index) and the frequency of the T-cell response to the peptide in a population of autoimml-n~ subjects. The physical and chemical properties of these selected peptides (e.g., solubility, stability) are e~min~od to d~lel,llille whether the peptides are suitable for use in thel~peulic compositions or whether the peptides require modification as described herein. The ability of the selected peptides or selected modified peptides to stim~ te human T-cells (e.g., induce proliferation, Iymphokine secretion) is determin~d.

A T-cell epitope-cont~ining peptide of the invention, when ~tlmini~tered to a subject in a therapeutic treatment regimen is capable of modifying the response of the individual to the ~llto~ntigen.

Preferred peptides of the invention comprise at least one T-cell epitope of the full length protein. Accordingly the peptide comprises at least approximately 7, preferably at least about 12-40, and more preferably 13-30 amino acid residues.
The peptides may contain tandem repeats of a single epitope and/or more than one dirrtlc-l~ epitope. In other aspects, compositions of the invention contain tandem copies of MOG peptides. For purposes of therapeutic effectiveness, preferred l~ U~iC compositions of the invention preferably comprise at least two T-cell epitopes. Additionally, therapeutic compositions cu~ )lisillg one or more preferred isolated peptides of the invention preferably comprise a sufficient peluelltage of the T-cell epitopes of the entire protein such that a thela~ulic CA 022~0361 1998-09-28 regimen of ~lmini~tration of the composition results in amelioration of disease symptoms. Synth~tic~11y produced peptides of the invention comprising less than approximately 45 amino acid residues, and most preferably less than approximately 30 amino acid residues are particularly desirable for ease of peptide 5 synthesis. Peptides of the invention may also be produced recombinantly as described above. Preferable, peptides of 45 amino acids or longer greater are produced recombinantly.

Isolated antigenic peptide fr~gm~ont~ which have T-cell stim~ tin~ activity, 10 and thus comprise at least one T-cell epitope are particularly desirable. An "epitope" is the basic element, or smallest unit of recognition by a receptor, particularly immnnt globulins, histocnmp~tihility antigens, and T-cell receptors, where the epitope col1lplises amino acids of the native protein. Amino acid sequences which mimic those of the epitopes can also be used. A "T-cell epitope"15 is the basic element, or ~m~llçst unit of recognition by a T-cell receptor, where the epitope comprises amino acids in the anto~ntigen essential to receptor recognition.
Amino acid sequences which mimic those of the native T-cell epitopes are also within the scope of this invention. T-cell . ~ilopes are believed to be involved in initiation and perpetuation of the autoimm1~nP response. These T-cell epitopes are 20 thought to trigger early events at the level of the T helper cell by being presented by an apl,lop1iate HLA molecule on the surface of an antigen presenting cell, thereby stimtll~ting the T-cell subpopulation with the relevant T-cell receptor for the epitope. These events lead to T-cell proliferation, Iymphokine secretion, local infl~mm~tory reactions, recr~itm~qnt of additional immnn~ cells to the site of 25 antigen/T-cell interaction, and activation of the B-cell c~sc~(~e leading to the production of antibodies.

Exposure of a subject to a peptide or protein which comprises at least one T-cell epitope of the ~uto~ntigen may tolerize, anelgi~, induce apoptosis, or 30 otherwise modify applop1iale T-cell subpopulations such that they become non-responsive to the ~ntoantigen and do not participate in stim~ ting an imm--n~
response.

Wo 97l35879 PCT/US96/06072 As used herein, to "tolerize" is defined as to induce a state of non-responsiveness to subsequent challenge with antigen by any of a variety of mech~ni.cm~, including, but not limited to, clonal deletion or apoptosis of antigen-specific T cells, prevention of a~)ropliate presentation of the antigen by relevant 5 antigen presenting cells, or in~1uction of immnn~ cells with ~u~plessive, killer or anti-infl~mm~tory capabilities, having specificity for the antigen itself or for the relevant antigen-specific T cells. The term "angergize" refers to the induction of a state of non-responsiveness to subsequent challenge with an antigen, despite thecontimled presence of the T cells bearing the relevant antigen-specific receptors.
10 The term "apoptosis" refers to the programmed cell death characterized by degradation of the cell nuclear structure, m~ t~d by intracellular nucleases, and initi~t~d by any of a variety of extra-cellular signals, including those related to activation of the antigen~specific T cell.

In addition, ~Amini~tration of a protein or peptide which comprises at least one T-cell epitope may modify the Iymphokine secretion profile as compared with exposure to the naturally-occurring ~ o~ igen (e.g., result in a decrease of IL-4 and/or an increase in IL-2 c~lcing a mo(lifir~tinn of TH, and TH2 populations).
Furthermore, exposure to such a protein or peptide may influence T-cell 20 subpopulations which normally participate in the response to the ~llto~ntigen such that these T-cells are drawn away from the site(s) of normal exposure to the auto~ntigen (e.g., tissues of the CNS) to the site(s) of theldl~eulic a~1mini~tration of the protein or peptide derived thel~rl~lll. This redistribution of T-cell subpopulations may ameliorate or reduce the ability of an individual's i-n---~
25 system to stim~ te the usual imml-nP response at the site of normal exposure to the a~lto~ntigen, reslllting in a ~iminntion in symptoms.

In d~ which peptides are T cell epitope-cont~inin~ peptides for a specific disease, those skilled in the art can approach the task in many acceptable 30 ways. In the instant invention, the procedures selected are not meant to be limiting. The selection of one mode of approaching a task is not intended to exclude other modes which can accomplish the same end by alternative means by .

CA 022~0361 1998-09-28 wO 97/35879 PCT/US96/06072 those skilled in the art, for example, the selection of likely T cell epitope-cont~ining peptide from a group of peptides. Generally, in the instant application, as further explained in more detail herein, a protein is purified and analyzed, peptides are selected for testing, the selected peptides are produced, and the 5 selected peptides are tested for ~iopellies characteristic of T cell epitopes.
T-Cell Epitope Re~ions of Human MOG

Peptides derived from human MOG which moderate the response of a 10 subject to the MOG autoantigen are also included in the invention. Likely c~n~ tPs for such peptides can be tested for the effect on T cell proliferation, as previously ~liccl~ced and/or testing for a c~n~ te's affinity for binding HLA DRproteins (procedures for obtaining HLA DR proteil1s is ~ cllc~ed in detail in the section below entitled "Purification and Analysis of HLA DR p,oleills") . Such 15 peptides can be itlentifiP(l, for example, by ex~mining the ~lluclul~ and selecting applo~,~iate regions to be produced as peptides (via recombinant ~ ssion systems, synth~tic~lly or otherwise) to be ex~minPd for ability to influence B-cell and/or T-cell responses, and selecting peptides cont~ining epitopes recognized by these cells. One method of identifying such peptides inrl~l~es dividing the human 20 MOG protein antigen into non-overlapping, or overlapping peptides of desired lengths and synthPsi7.ing, ~ ulifyillg and testing those peptides to determine whether the peptides co~ lise at least one T cell epitope using any number of assays. Inanother method, an algo~ .n is used for predicting those peptides. Other methodsknown to those skilled in the art may also be employed. In the instant application, 25 certain of the peptides were selected using the algo.;ll--.l as di~cl~ssed in more detail herein.

A. Defining MOG Epilo~,es Using an MHC Binding Algorithm Thirty-seven naturally occurring 13mers (together with three analogs of the naturally occurring peptides) are shown in FIG. 2 (SEQ ID NOS:4-9, 11, 15, 16, 42-72, and 169); the amino acid length is arbitrarily chosen. These peptides were CA 022~0361 1998-09-28 Wo 97/35879 PCTtUS96/06072 chosen according to an algolilhll. that predicts optimal MHC class II binding. In order for the peptide to be able to bind an approl,liate T cell receptor, it is nPcess~ry that it be able to bind class II MHC proteins. It is possible to remove at least one or two amino acids from the N- and/or C-terminl-s of each and still S retain MHC binding activity. These peptides are design~tt-cl by amino acid sequence and lep~selll the in~lic~trd regions of the mature amino acid sequence shown as positions 1-218 of FIG. 1 (SEQ ID NO:2). The peptides are characterized by their ability to bind Class II MHC proteins so as to have the ability to be plesellled effectively as T-cell epitopes.(Rothbard et al. (1988) EMBO
J. 7:93-100). It has been found that a n-ocess~ry (but not n,ocess~rily sufficient) condition for binding to Class II MHC proteins is the presence of a hydrophobic side chain residue, most preferably a tyrosine, phenyl~l~ninr- or tryptophan residue, and preferably isoleucine, leucine, valine or methionine residue spaced at a four amino acid ~lict~nre from a small amino acid residue such as glycine, alanine, serine, threonine or cysteine. All of the MOG peptides shown in FIG. 2 (SEQ ID NOS:4-9, 11, 15, 16, 42-72, and 169) fulfill these mi"i",l~", conditions.
As further shown in FIG. 2, all of these peptides have been tested with respect to their ability to bind MHC proteins encoded by certain alleles. ~s shown by the IC50 values in the figure, most of these peptides bind tightly to both DRB1~0101and DR B1~1501. The specifics of peptide binding are described below. FIG. 2 is intended to be a non-limiting, repl~selllali~/e example of the algolilhlll for selection. However, other possible useful antigenic peptides may exist.

The requirement for the four amino acid spacing between the hydrophobic residue and small residue used as the basis for idelllifyillg the peptides as described in the prece~ing paragraph has been verified using experimental protocols as follows: The design of the experiments ~csumrd that all peptides bind in approximately iclentir~l locations, oriented by interactions with the peptidebackbone and adopt closely related conformations. The design of the experiments also ~csllm--d that the binding site of MHC Class II molecules can be divided into separate subsites that dirrelelllially conllib.ll~ to binding, that the overall free energy of binding is the sum of the advantageous and deleterious contacts a CA 022~0361 1998-09-28 wo 9713s879 PCT/US96/06072 peptide makes with the pockets, and that the interaction between the peptide in each of the pockets can be viewed independently. The results of the experiments support these postulates, as well as a model of free energy of binding as a simple polynomial with se~alate terms for backbone interactions in the side chains. Forpeptides of common length, the backbone terms would be constant while the contribution of side chains would vary depending on their structure and the chP~nic~l composition and size of the compl~m~n~ry pocket in the binding site.
The relative importance of each side chain position will vary depending on the allele and the isotype, but in general peptide binding can be viewed as the sum of separate independent events.

Thus, the results of applicants' experiments show that the a~alell~ affinity of any sequence of common length can be predicted within a factor of two or three of the experim~nt~lly determin~-d values based on a d~b~e of the relative effects of the natural amino acids in each position of model peptides. All possible monosubstituted analogs at the central 11 positions of the simplified peptide, AAYAAAKAAAAAA (SEQ ID NO:33) were ~ylllllPsi~Pd and assayed for binding to DRB1*0401 (fo~ ly called DR4DW4). From the measured IC50 values of each analog, a ratio relative to the parent simplified peptide was calculated. These ratios and the measured values are shown in FIG. 3. The ratios were then used topredict the affinity of 12 unrelated natural seqllen(es corresponding to peptides known to bind DRB1*0401 with a wide Mnge of affinity as shown in FIG. 4 (SEQ
ID NOS: 19-32). The data shown in FIGS. 3 and 4 verify that the model is useful in predictinE the four amino acid spacing and is con~i~tent with ~eli~.~.l~l results. Using this model, c~n~ tes of 13mers were selected as likely T cell epitope-cont~inin~ peptides.

The procedures used for dete.gelll solubilization and affinity purification of HLA-DR (human MHC protein) molecules were similar to those described by Gorga (J. Biol. Chem. (1987) 262:16087-16094) and Buelow (Eur. J. Immunol (1993) 23:69-76). Briefly, CHO cells transfected with the genes for the DRB1~0101 and DRB1~1501.alleles (Marshall et al. (1994) J. Immunol. 152:4946-CA 022~0361 1998-09-28 W O 97/3S879 PCTrUS96/06072 4957) were grown in RPMI 1640 m~ m suppleTn~nte~l with 10% heat inactivated fetal calf serum (FCS), 2 rnM gl~-t~min~, and antibiotics. Cells were harvested,washed in PBS, lysed with 1 % NP-40, and the supernatant separated from nuclear debris by cenllirugation. The solubilized MHC class II proteins were affinity 5 purified using the monoclonal antibody LB3.1, coupled to Sepharose CL4B. ClassII proteins were eluted with 1 % octyl-,B-D-glucopyranoside (octyl glucoside), 50 mM phosphate pH 11.5 and immediately neutralized using 1 M phosphate pH 6Ø
Purified o~ heterodimers were isolated by size exclusion using a 60 cm x 2.5 cm ~i~m~ter column of Bio-Gel A0.5. The fractions cont~inin~ the heterodimers were 10 concentrated using Amicon Centri-Prep~ 30 devices to a nominal concentration of 500 ~g/ml.

The purity of the material was assayed by SDS-PAGE, high perforrnance size exclusion chromatography (HPSEC), and Edman sequencing as previously described (Buelow et al., 1993). The HPSEC colurnn was a BIOSEP SEC-S3000 (300 x 7.5 mm) (Phenomenex), eluted using a buffer system of PBS cont~ining 1.0% octyl glllcositle and 1.0% acetonitrile at a flow rate of 0.800 ml/min (approximately 25 ~ lules per run). The fluorescence detector was set to monitortryptophan fluorescence ()~eX = 282 nm ~em = 348 nrn).
Peptide binding assays were performed as previously described (Hill et al.
(1994) J. Immunol. 152:2890-2898). Briefly, affinity purified class II proteins (10 nM) were inr~lhatP~l with serial dilutions of the test peptide and a fixed concentration of biotinylated HA 307-319 (2 nM) in PBS cont~ining 1.0% octyl 25 glucoside at pH 6.5 in 96 well polypropylene plates (Costar, Cambridge, MA) for 16 hours at 37~C. The DR-peptide complexes (50 ,ul) were ll~nsrelled, in duplicate, to wells of a 96-well microtiter plate precoated with the monoclonal antibody LB3.1 and blocked with fetal calf serum. Excess peptide was removed by washing with PBS cont~ining 0.02% Tween 20 and 0.05% NaN3. Europiu 30 labeled streptavidin (Pharrnacia, Piscataway, NJ) was added and incubated overnight. After washing, a solution of 0.1 M acetate/phth~l~t~ buffer, pH 3.2, cont~ining 0.1% Triton X-100, 15 ~M 2-naphthoyltrifluoroacetone and 50 ~M tri-CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 N-octylphosphine oxide was added to release the ch~!~ted europium from strepavidin. The resulting fluorescence (which was proportional to the amount ofbound biotinylated HA 307-319) was measured using a fluorescent plate reader (DELPHIA LKB/Pharmacia, Piscataway, NJ). The data were analyzed by fitting the data to a binding function that calculated the concentration of test peptide to bind to a specific class II protein can be ranked by the corresponding IC50 values, with the lower values coll~sl,ollding to better binding peptides.

T cell assays were performed to further refine the identifiration of T cell epitopes. Peripheral blood lymphocytes were isolated from the blood of a human volunteer HLA-DR2 positive donor using standard techniques outlined in Example 2 below. The MOG peptides selected for testing were MOG 1-13 (SEQ ID
NO:42), MOG 20-32 (SEQ ID NO:5), MOG 70-82, A78 (analog to MOG 70-82) (SEQ ID NO:8), MOG 88-100,K89,S98 (analog to MOG 88-100) (SEQ ID NO:9), MOG 103-115 (SEQ ID NO:55), MOG 118-130 (SEQ ID NO:56), and MOG 170-182 (SEQ ID NO:15).

Results of one such study of T cell response to human MOG peptides are illustrated in FIG. 6. These results in~icate that MOG 1-13 (SEQ ID NO:42) is a T cell epitope-conf~ining peptide. FulLhellllore, the same data strongly inflicates that MOG 103-115 (SEQ ID NO:55) contains at least one epitope. These results do not preclude the possibility that less than the entire 13mer peptide could be a T
cell epitope-cont~ini~ peptide.

B. Defining MOG Peptide Epitopes Using an Overlapping Peptide Set A second method of idelltiryillg peptides that constitute T cell epitope regions of human MOG involves dividing the human MOG protein sequence into a series of non-ov~lla~ g or overlapping peptides of desired lengths and 30 synthesi~ing, purifying, and testing those peptides to determine whether the peptides comprise at least one T cell epitope using any number of assays of T cell reactivity. Using this method, a series of peptides was prepared having equal CA 022~0361 1998-09-28 WO 97135879 Pcr/uss6lo6o72 length (e.g., 20mers or 25mers) and spanning the entire length of the MOG
protein sequence while overlapping the previous peptide by 10 or 15 amino acid residues. The peptides were synth~-si7~ using standard solid-phase technology and FastMOCTM chPmi~try.

Testing of the peptide sets for identific~tion of T cell epitopes was performed by two different methods. In the first, 2 x 105 T cells were plated into individual microtiter wells stim~ ted with the N-terminal fragment of recombinant human MOG or with various mixtures of the peptides. The recombinant MOG
10 contained residues 1-121 of the MOG sequence and was purified from the supernatant of insect cells infected with the MOG expression vector construct asdetailed in Example 2. The stim~ tecl cultures were supplemented with the cytokines IL2 and IL4 to promote expansion of activated clones. After approximately two weeks, the cells in each individual micloLiLer culture were 15 washed and split into four to twelve wells of a new assay plate for a second stiml-lAtion or challenge with various controls and test antigens. The proliferative response to the second antigen challenge was assessed by incorporation of tritiated thymidine.

Results from these studies inrlic~te that MS patients have T cell responses to epitopes in the N-terrnin~l half of the MOG protein, and that these epitopes can be encoded in peptides 20 or fewer amino acids in length. The results of one such study are detailed in Example 6A. Furthermore, the presence of an epitope in thefirst 25 amino acid of the MOG protein is confirmed by the application of this assay to a set of 21 MS patients. This peptide in~ e~ responses in 45.5% of the 11 MOG-responding patients in which it was tested. In addition, peptides 1-25 (SEQ ID NO:109), 41-65 (SEQ ID NO:97), and 71-95 (SEQ ID NO:100) all in~ ced a particularly high frequency of specific response, with greater than 7% of all MOG reactive lines responding to each of these peptides. These studies are detailed in Example 6B.

~ , CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 In the second method of testing the peptide sets for identific~tion of T cell epitopes, short-term MOG-reactive T cell lines were initi~tec7 from "bulk" cultures of 10 x 106 cells in a large tissue culture well. The antigen stim~ tion and cytokine expansion steps were similar to those employed in the microwell assay above, except that these cultures were all initi~t~d by stimul~tion with the full length MOG protein purified from human brain tissue as detailed in Example 7.
Because the starting cell number is large, the cells from a single culture can be washed after approximately two weeks of culture and split into over 100 wells of a microtiter assay plate for a second stim~ tion or challenge with various controls and test antigens. The proliferative response to the second antigen challenge was assessed by incorporation of tritiated thymidine, as above.

Stim~ tion of the initial culture with the full length protein enables testing for reactivity to a peptide set s~a~ in~ the entire MOG sequence. Such tests aredescribed in Examples 8 and 9 below. The peptides used in these studies are illustrated in FIG. 7, and are 20 or 25 amino acids in length, with overlaps of 5, 10 or 15 amino acids. The predominqnre of epitopes in the N-terminal half of theMOG protein was confirrnrd in a set of 84 MS patients. The data are illustrated in FIGS. 8A, 8B, and 9 and demonslld~e that three regions are major targets of Tcell response to MOG: regions including amino acid residues 1-95 (SEQ ID
NO:205) inrluAing a region encompassing amino acids 1-65 (SEQ ID NO:208), 101-135 (SEQ ID NO:207) inrl~ding a region encomp~sin~ amino acids 111-135 (SEQ ID NO:102), and 171-215 (SEQ ID NO:206). By several methods of data analysis, peptides 1-20 and 41-65 are confirmed as major targets of the T cell response to MOG. The peptides fl~nking these two seqllenres (11-35, 31-55, 51-75, 61-85, and 71-95) also induce significant reactivity, which may be directed at the same epitopes contained in 1-20 and 41-65, or may be due to additional epitopes that either overlap with or are completely separate from the epitopes contained in 1-20 and 41-65. Shifting, or e~p~n~ing the sequences in peptides 1-20 and 41-65 may result in even greater T cell reactivity. In addition, the presence of other epitopes, peptides 101-125, 111-135, 121-145, and 131-155, 171-195, and 191-215 (or region 171-215) in the carboxy terrninal half of the CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 protein, are also evident. Unlike all epilopes in the N-terlT-in~l half of the protein, 171-195 is predicted to lie in a transmembrane portion of the MOG molecule according to the structure predicted by Gardinier et al. (J. Neurosci. Res. (1992) 33:177-187). Thus, these data demonstrate that three regions are major targets of 5 T cell response to MOG: a region including amino acid residues 1-95 (SEQ ID
NO:205), and even more particularly, amino acid residues 1-65 (SEQ ID
NO:208); a region encompqssing amino acids 101-135 (SEQ ID NO:207) including in particular amino acids 111-135 (SEQ ID NO:102); and a region encomr~sing amino acids 171-215 (SEQ ID NO:206), including in particular amino acids 171-195 (SEQ ID NO:107).

Modification of MOG Peptides The structure of the protein or peptides of the invention can be modified 15 for such purposes as increasing solubility, enhancing therapeutic or prophylactic efficacy, or stability (e.g., shelf life ex vivo and resistance to proteolytic degradation in vivo), or generally by conservative substitutions and modifications.
A modified protein or peptide can be produced in which the amino acid sequence has been altered, such as by amino acid substitution, deletion, or addition, to 20 modify immllnogenicity, or to which a component has been added for the same purpose. FIG. 2 shows three such peptides, Human MOG 70-82, A78 (SEQ ID
NO:8); Human MOG 74-86,A78 (SEQ ID NO:53); and Human MOG 88-100, K89, S98 (SEQ ID NO:9). Modification must be made in such a way that the ability to recognize the ap~lopliate T-cell subset is not altered. It is generally 25 understood in the art which locations of amino acid side chains are oriented toward the upper surface of the APC and which point inward. Those that point inward are suitable c~n~ t~-s for modification since they are less likely to affect binding to the a~plopliate T-cell l~cel)tor.

One embodiment of the present invention features a peptide which comprises at least one T-cell epitope of the protein and includes the regions of the peptides as shown in FIGS. 2, 5a, 5b, and/or 7 that are significant for T-cell CA 022~0361 1998-09-28 Wo 97t35879 PCT/US96/06072 receptor binding or the modified forms thereof as above described, optionally extended at the N- and/or C-terminus with irrelevant amino acid sequence.

Another embodiment of the present invention provides peptides comprising 5 at least two T-cell epitopes as described above. The T-cell epitopes may be identical or may be dirrelel~t T-cell epitopes appropriate for human MOG. As further described above, the T-cell epitopes, or peptides including such T cell epitopes, are typically at least seven amino acids, preferably 12-40 amino acids, even more preferably 13-30 amino acids in length. If desired, the amino acid 10 sequences of the T-cell epitopes can be joined by a linker to increase sensitivity to procescing by antigen-~ie3~ g cells. Such linker can be any non-epitope amino acid seql~enre or other a~plopliate linking or joining agent. In ~rerell~d peptides comprising at least two T-cell epitopes, the epitopes are arranged in the same or a dirrerelll configuration from a naturally-occurring configuration of the epitopes in 15 the native human MOG protein. For example, the T-cell epitope(s~ can be arranged in a contiguous or noncontiguous configuration. Noncontiguous is defined as an arrangement of T-cell epitope(s) which contains additional residues between the epitopes. Furthermore, the T-cell epitopes can be arranged in a nonsequential order (e.g., in an order dir{~lenl from the order of the amino acids 20 of the native protein from which T-cell epitope(s) are derived). A peptide of the invention can comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 60% or more of the T-cell epitopes of human MOG. Some preferred peptides of the invention comprise various combinations of two or more of the above--li.cc~-cse(l T-cell ~l,iLopes. Preferred peptides conl~lisil,g a combination of 25 two or more epitopes are those wherein the peptides include sequences selected from those in FIG. 2 (SEQ ID NOS:4-9, 11, 15, 16, 42-72, and 169), FIG. 5a, FIG. 5b, and PIG. 7.

A modified protein or peptide of the invention m~int~inc its ability to 30 induce T-cell unresponsiveness and bind MHC proteins without the ability to induce a strong or any proliferative response when ~-lrnini~tered in ;,-",~ ogenic form. In this in.ct~nre, critical binding residues for T-cell receptor function can be CA 022~0361 1998-09-28 W O 9713~879 PCT/U',~'~6072 determined using known techniques (e.g., suhstitl~tinn of each residue and determination of the presence or absence of T-cell reactivity). Those residues shown to be essential to interact with the T-cell receptor can be modified by replacing the essential amino acid with another, preferably similar amino acid 5 residue (a conservative substitution) whose presence is shown to enhance or dimini~h, but not eliminqte T-cell reactivity. In addition, those amino acid residues which are not essential for T-cell receptor interaction can be modified by being replaced by another amino acid whose incorporation may enhance or ~limini~h T-cel} reactivity, but does not elimin~te binding to relevant MHC.
Additionally, peptides of the invention can be modified by replacing an amino acid shown to be essential to interact with the MHC protein complex with another, preferably similar amino acid residue (conservative substitution~ whosepresence is shown to enhqn~-e or (limini~h, but not to elii,~ te T-cell activity. It 15 is believed that peptides that bind MHC with higher affinity should render T-cells imInunopassive in vivo at lower co-~e~,l.nlions. In addition, amino acid residues which are not essential for interaction with the MHC protein complex but which are present on the bound peptide can be modified by being replaced by another amino acid whose incorporation may enhance or t1imini.~h, but not elimin~te T-cell , 20 reactivity. Pr~r.,.l~,d amino acid substitutions for non-essential amino acids include, but are not limited to substitutions with alanine, glutamic acid, or a methyl amino acid.

Another example of modification of proteins or peptides is substitution of 25 cysteine residues preferably with alanine, serine, threonine, leucine or glutamic acid residues to minimi7e dimerization via ~ ulf1-1e linkages. In addition, amino acid side chains of peptides of the invention can be chemically modified. Another modification is cycli_ation of the peptide.

In order to enhance stability and/or reactivity, the protein or peptides of the invention can be modified to incorporate one or more polymorphisms in the amino acid sequence of the protein ~llto~ntigen resulting from any natural allelic CA 022~0361 1998-09-28 Wo 97/35879 PCT/U$96/06072 variation. Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce a modified protein or peptide within the scope of this invention. Furthermore, proteins or peptides of the present invention can be modified using polyethylene glycol (PEG) according to the method of A. Sehon and co-workers (Wie et al., supra) to produce a protein or peptide conjugated with PEG. In addition, PEG can be added during ch~mic~l synthesis of a protein or peptide of the invention. Modification of proteins or peptides or portions thereof can also include reduction/alkylation (Tarr in: Methods of Protein Microcharacterization, J. E. Silver ed., Humana Press, Clifton NJ
(1986) pp. 155-194); acylation (Tarr, supra); ch~mi~l coupling to an a~ ,pliate carrier (Mishell and Shiigi, eds, Selecte~ Methods in Cellular Immunology, WH
Freeman, San Francisco, CA (1980), U.S. Patent 4,939,239); or mild formalin tre~tm~nt (Marsh (1971) Int. Arch. Allergy and Appl. Immunol. 41:199-215).

To facilitate purification and potentially increase solubility of protein or peptides of the invention, it is possible to add an amino acid reporter group to the peptide backbone. For example, h~ hi.~ti~inP can be added via known recombinant or synthetic methods to a protein or peptide for purification by immobilized metal ion affinity chromatography (Hochuli et al. (1988) Bio/Technol.
6:1321-1325). Such known methods include, e.g., cloning the nucleic acid sequences encoding the moiety to be added or syn~h~si7ing the moiety directly onto the peptide during the synthesis of the peptide. In addition, to facilitateisolation of protein or peptides free of irrelevant sequences, specific endoprotease cleavage sites can be introduced via known recombinant or synthetic methods between the sequences of the reporter group and the protein or peptide. In orderto successfully ~les~-nciti7~- an individual to a protein antigen, it may be nt~ceS~ry to increase the solubility of a protein or peptide by adding functional groups (e.g., charged amino acids such as Glu, Asp, or Arg) to the protein or peptide, or omithydrophobic regions of the protein. Hydrophobic regions may be characterized by the presence of Ile, Leu, Val, Phe, and sl)m~o~imes Tyr and Trp residues.

CA 022~0361 1998-09-28 Wo 97l35879 PCT/US96/06072 To potentially aid proper antigen processing of T-cell epitopes within a peptide, canonical protease sensitive sites can be engineered between regions, each colnplisillg at least one T-cell epitope via known recombinant or synthetic methods. For example, charged amino acid pairs, such as KK or RR, can be 5 introduced between regions within a peptide during recombinant construction ofthe peptide. The res~lting peptide can be rendered sensitive to cleavage by cathepsin and/or other trypsin-like enzymes which would generate portions of thepeptide cont~ining one or more T-cell epitopes. In addition, such charged amino acid residues can result in an increase in the solubility of a peptide.
Site-directed mutagenesis of DNA encoding a peptide or protein of the invention can be used to modify the structure of the peptide or protein by methods known in the art. Such methods may, among others, include polymerase chain reaction (PCR) with oligonucleotide primers bearing one or more mutations (Ho etal. (1989) Gene 77:51-59) or total synthesis of mnt~tt-d genes (Hostomsky et al.(1989) Biochem. Biophys. Res. Comm. 161:1056-1063). To enhance recombinant protein expression, the aforementioned methods can be applied to change the codons present in the cDNA sequ~n~e of the invention to those preferentially utilized by the host cell in which the recombinant protein is being expressed 20 (Wada et al., supra).

The isolated protein and/or antigenic fragments can be used in methods of diagnosing, treating, and preventing demyelinating autoimm--n~- responses. Thus,the present invention provides therapeutic compositions colllplisillg isolated human 25 MOG (SEQ ID NOS:1 and 2), or antigenic peptide fr~gmPntc thereof (SEQ ID
NOS:96-110 and 146-164) and a pharm~elltir~lly acceptable carrier, excipient, ordiluent. Furthermore, the isolated protein and/or fragments can be used in screening for the autoimml-n~ disease and for developing candidates for therapeutic compositions.

CA 022~0361 1998-09-28 Compositions Cont~inin~ MOG Peptides The invention provides compositions including at least one novel MOG
peptide of the invention having SEQ ID NOS:96-110 and 146-164). Preferably, 5 such compositions include at least two MOG peptides, at least one of which is a novel peptide of the present invention. At least one other MOG peptide having anamino acid sequence dirrt;lcllL than a novel MOG peptide of the invention may also be included. Such other MOG peptides may be any MOG peptide known in the art, for example having SEQ ID NOS:2, 42, 55, 73-80, 82, 83, 111-145, and 165-203 (see, e.g., U.S. Ser. no. 08/300,811; Bernard et al., WO 95/07096; Liningtonet al. (1993) Eur. J. Tmml~nol. 23:1364-1372; Amor et al. (1994) 153:43494356;
Mendel et al. (1995) Eur. J. Tmmlln~l. 25:1951-1959; Johns et al. (1995) J.
~mmllnol. 154:5536-5541).

15 Therapeutic Ph~ r-e~tir~l Compositions One example of a composition of the invention is a th~lal,eulic composition cont~ining at least one MOG peptide or one MBP peptide and a pharm~re-ltic~lly acceptable carrier, diluent, or excipient. In addition to compositions cont~ining a 20 single MOG peptide, a single MBP peptide, or MOG or MBP protein, other compositions of the invention also contain mixtures of at least two peptides (e.g., a physical mixture of at least two identical or different MOG peptides, at least two identical or different MBP peptides, or at least one MOG peptide of the invention and at least one human MBP peptide or other peptides). Therapeutic compositions 25 may contain MOG peptides or MBP peptides cont~ining at least one T-cell epitope of human MOG or human MBP, r~pec;li~ely. Still further, the thela~ulic composition may contain peptides comprising at least two regions, each region comprising at least one T cell epitope of MOG and which regions may be arranged in a configuration different from a naturally-occurring configuration of the regions 30 in human MOG. A therapeutically effective amount of one or more of such compositions can be ~tlmini~tered simlllt~neously or seql1enti~lly CA 022~0361 1998-09-28 W O 97/35879 PCTrUS96/06072 Some ~l~rel~d thêrapeutic compositions and prefellcd combinations of MOG peptides which can be ~llmini.ctered simultaneously or sequentially comprisepeptides comprising amino acid sequences set forth in Table 2 and having SEQ ID
NOS:96-110, 146-164, and 220-223. Other prefel~èd therapeutic compositions also include the MOG peptides shown in FIG. 2 (SEQ ID NOS:4-9, 11, 15, 16, 42-72, and 169), 5a (SEQ ID NOS. 73-80, 82,83~ and 5b (the first 121 amino acids of human MOG protein SEQ ID NO. 2), more preferably, MOG 1-13 (SEQ
ID NO. 42) and MOG 103-115 (SEQ ID NO. 55), as set forth in Table 1. Yet other therapeutic compositions include at least one novel MOG peptide from Table2 as well as at least one MOG peptide having SEQ ID NOS:96-110 and 146-164 with at least one of any other known MOG peptide (having, e.g., SEQ ID
NOS:42, 55, 73-80, 82, 83, 111-145, and 165-203). Yet other formulations and compositions include MBP peptides. Preferably, the MBP-cont~ining formulations and compositions include at least one of the MBP peptides listed below in Table 3. More preferably, these MBP-cont~ining compositions include at least one of MBP-1 to MBP-5 listed below. Most preferably, MBP-1.1, MBP-2.1, and/or MBP-4.

Peptide Name Amino Acid Seqllen~e SEO ID NO:
5 MBP-l (11-30) GSKYLATASTMDHARHGFIR
MBP-l .1 (11-29) GSKYLATASTMDHARHGFL
MBP-1.2 (11-31) GSKYLATASTMDHARHGFLPR
MBP-2 (83-105) ENPV~ 'KNIVTPRTPPPSQGK
MBP-2.1 (82-105) DENPV~IVTPRTPPPSQGK
MBP-2.2 (82-104) DENPV~K~IVTPRTPPPSQG
MBP-2.3 (80-98) TQDENPV~IVTPRT
MBP-2.4 (82-102) DENPV~K~IVTPRTPPPS
MBP-2.5 (80-104) TQDENPV~'KNIVTPRTPPPSQG
MBP-2.6 (80-102) TQDENPVVll~K~IVTPRTPPPS
MBP-3 (111-130) LSRFSWGAEGQRPGFGYGGR
MBP-3.1 (111-129) LSRFSWGAEGQRPGFGYGG
MBP-4 (141-165) FKGVDAQGTL~ KLGGRDSRSGS
MBP-5 (101-125) PSQGKGRGLSLSRFSWGAEGQRPGF
MBP-A (1-20) ASQKRPSQRHGSKYLATAST
MBP-B (11-30) GSKYLATASTMDHAKHGFLP
MBP-C (21-40) MDHARHGFLPRHRDTGILDS
MBP-D (31-50) RHRDTGILDSIGRFFGGDRG
MBP-E (41-60) IGRFFGGDRGAPKRGSGKDS
MBP-F (51-70) APKRGSGKDSHHPARTAHYG
MBP-G (61-80) HHPARTAHYGSLPQKSHGRT
MBP-H (71-90) SLPQKSHGRTQDENPVVHFF
MBP-I (81-100) QDENPV~ 'KNIVTPRTPP
MBP-J (91-110) KNIVTPRTPPPSQGKGRGLS
MBP-K (101-120) PSQGKGRGLSLSRFSWGAEG
MBP-L (111-130) LSRFSWGAEGQRPGFGYGGR
MBP-M (121-140) QRPGFGYGGRASDYKSAHKG
MBP-N (131-150) ASI)YKSAHKGFKGVDAQGTL
MBP-O (141-160) FKGVDAQGTL~ 'KLGGRD
MBP-P (151-170) ~ 'KLGGRDSRSGSPMARR
MBP-Q (82-100) DENPVV~ KNIVTPRTPP
MBP-R (83-105) ENPV~ KNIVTPRTPPPSQGK
MB-S (141-165) FKGVDAQGTL~Kl~KLGGRDSRSGS

CA 022~0361 1998-09-28 Wo 97/35879 PCT/USg6/06072 Highly purified and isolated peptides produced as discussed above may be forrn~ trcl into thelal,~uLic compositions of the invention suitable for human therapy. If a therapeutic composition of the invention is to be a~lmini.ctrred by injection (e.g. subcutaneous injection, intravenous injection), then it is preferable 5 that the highly purified peptide be soluble in an aqueous solution at a ph~rm~re~1ti~11y acceptable pH (i.e. pH range of about 4-9) such that the composition is fluid and easy syringability exists. The composition also preferably includes a ph~ reutir~l1y acceptable carrier. As used herein "ph~rm~re1ltir~11y acceptable carrier" includes any and all excipients, solvents, dispersion media,l0 coatings, antibacterial and antifungal agents, toxicity agents, burrelhlg agents, absorption delaying or enhancing agents, surfactants, and micelle forming agents, lipids, liposomes, and liquid complex forming agents, stabilizing agents, and the like. The use of such media and agents for ph~rm~re~1tir~11y active substance isknown in the art. Except insofar as any conventional media or agent is 15 incompatible with the active compound, use thereof in the therapeutic compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

As ~ c~lssed above, therapeutic compositions of the invention suitable for 20 injectable use are preferably sterile aqueous solutions prepared by incorporating active compound (i.e., one or more highly purified and isolated peptides as described above) in the required amount in an a~ropliate vehicle with one or a combination of ingredients enumerated above and below, as required, followed by filtered sterilization. Plerell~d ph~rm~re~1tir~11y acceptable carriers include at 25 least one excipient such as sterile water, sodium phosphate, m~nnitol, sorbitol, or sodium chloride or any combination thereof. Other pharm~ceutir~11y acceptable carriers which may be suitable include solvents or dispersion mrtli11m cont~ining, for example, water, ethanol, polyol (for example glycerol, propylene glycol, andliquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable 30 oils. The proper fluidity can be m~int~in.od for example by the use of coating such as lecithin, by the m~ r1-~nre of the required particle size in the case of dispersions and by the use of surfactants. Prevention of the action of -CA 022~0361 1998-09-28 W O 97/3~879 PCT~US96/06072 microorg~ni.cm.~ can be achieved by various ~ntibacterial and allLifungal agents, for example, parabens, chlol-~bulallol, phenol, ascorbic acid, thimerosol and the like.
Prolonged absorption of the injectable compositions can be brought about by including in the composition, an agent which delays absorption, for example, alllmim~m monostearate and gelatin.

Preferable the.al~ulic compositions of the invention should be sterile, stable under conditions of m~mlf~rtnre, storage, distribution and use and should be preserved against the cont~min~tin~ action of microolg~ "-.~ such as bacteria and fungi. A preferred means for m~mlf~ct~lring a therapeutic composition which m~int~inc the integrity of the composition (i.e. prevent cont~min~tion, prolong storage, etc.) is to prepare the formnl~tion of peptide and pharm~e~tic~lly acceptable carrier(s) such that the composition may be in the form of a Iyophilized powder which is rec~ ed in a phqrm~e~ltir~lly acceptable carrier, such as sterile water, just prior to use. In the case of sterile powders for the prepaMtion of sterile injectable solutions, the preferred methods of preparation are vacuumdrying, freeze-drying or spin drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
FIG. 10A and FIG. 10B show the PI for the additional MOG peptides synth~si~e~ to further define regions of high reactivity. These peptides were tested in the most recently assayed thirty-eight of the sixty-nine patients. FIG.
10A shows that peptide 41-60 elicits more T cell reactivity than peptide 41-65 and FIG. 10B shows that peptide 181-195 elicits more reactivity than peptide 171-195.
Based on the previously described results, most T cell reactivity is directed toward MOG peptides 1-20, 41-60, and 181-195.

As ~ cn~ecl above, a the~dl)elllic composition of the invention may comprise more than one isolated peptide. A therapeutic composition comprising a multipeptide formulation suitable for ph~rm~re~1ti~l a~Tninistration to h--m~n~ may be desirable for ~flmini~tration of several active peptides. The multipeptide CA 022~0361 1998-09-28 Wo 97/3s879 PcT/uss6lo6o72 formulation includes at least two or more isolated peptides having a defined amino acid sequence and is capable of down regulating an antigen specific immnn~
response. Any of the compositions described earlier which comprise at least two peptides may be suitable as a multipeptide formulation. Special considerations when preparing a multipeptide formulation include mAintAining the solubility, and stability of all peptides in the formulation in an aqueous solution at a physiologically acceptable pH. This requires choosing one or more phArmAcel~tir~lly acceptable solvents and excipients which are compatible with all the peptides in the ml-ltipeptide formulation. For example, suitable excipients include sterile water, sodium phosphate, mAnnitol or both sodium phosphate and m~nnitoh An additional consideration in a multipeptide formulation is the prevention of dimerization of the peptides if nlocec.~ry.

Atl~ lldlion of the thel~euLic compositions as described above to an individual, in a non-immllnogenic form, can be carried out using known procedures at dosages and for periods of time effective to cause down regulationof the MOG antigen specific immlmP response of the individual being treated for MS. Down-regulation of an antigen specific immlm-o response to an antigen associated with a disease condition in hllmAn~ may be determined clinically whenever possible, or may be determined subjectively (i.e., the patient feels as if some or all of the symptoms related to the disease condition being treated have been alleviated).

Effective amounts of the therapeutic compositions of the invention are in the range of 1 x 105 to 2.5 mg/kg of body weight per dosage. Of course, dosages may vary according to factors such as the degree of sensitivity of the individual to the antigen, the age, sex, and weight of the individual, and the ability of peptide to cause down regulation of the antigen specific immlln~ response in the individual. A therapeutic composition of the invention may be A-lmini~tered in non-immlm- genic form, in a convenient manner such as by injection (s~bclltAnl-ous, intMvenous, etc.), oral a~lmini~tration, sublingual, inhalation, transdermal application, rectal A.~mini~tration, or any co,l,bhl~lion of routes of CA 022~0361 1998-09-28 Wo 97/3S879 PCT/US96/06072 ~lmini.ctration c~esi~nrd to enhance therapeutic effectiveness, or any other route of ~llmini~tration known in the art for ~rlmini~tering thela~eu~ic agents. It may be desirable to a~lmini~ter ~iml-lt~nrously or sequentially a therape~tic~lly effective amount of one or more of the the~apcuLic compositions of the invention to an 5 individual. Each of such compositions for ~lmini~tration sin~l~lt~nPously or sequentially, may comprise only one peptide or may comprise a multipeptide formulation as described above.

To ~lmini~t~r peptide or peptide composition by other than palc.ll~.al 10 ~tlmini.ctration, it may be nece~ry to coat the peptide with, or co-~dmini~ter the peptide with, a material to prevent its inactivation. For example, a peptide composition may be co-~lmini.~tered with enzyme inhibitors or in liposomes.
Enzyme inhibitors include pall,lealic trypsin inhibitor, diisoplol,ylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (StreJan et al. (1984) J. Nellroimmunol. 7:27).
When a peptide is suitably protected, as described above, the peptide may be orally ar~mini~tered, for example, with an inert diluent or an ~c~imil~ble edible carrier. The peptide composition and other ingredients may also be enclosed in ahard or soft shell gelatin capsule, collll.lessed into tablets, or incorporated directly 20 into the individual's diet. For oral Lheld~ulic a~lmini~tration~ the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and plepalations should contain at least 1% by weight of active compound. The percellldge of the composition and preparations may, of 25 course, be varied and may conveniently be between about 5 to 80% of the weight of the unit. The amount of active compound in such thela~ ir~lly useful compositions is such that a suitable dosage will be obtained. Preferred compositions or ~repalalions according to the present invention are prepared so that an oral dosage unit contains b~lween from about 10 ,ug to about 200 mg of 30 active compound. The tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gr~g~r~nth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of winlelgleen, or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the 5 above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. Por in~t~nre, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservative, a dye and flavoring such as cherry or orange 10 flavor. Of course, any material used in plei)a,il1g any dosage unit form should be pharm~relltir~lly pure and subst~nsi~lly non-toxic in the amounts employed. In addition, the active compound may be incorporated into snst~inf~d-release preparations and fonmll~tions.

For injection, (subcu~lleous, intravenous, hlllA~ c~l~r, intraperitoneal) of one or more thc~ap~ulic compositions of the invention, preferably about 1 ~g - 3mg and more preferably from about 20 ~g to 1.5 mg, and even more preferably about 50 ~ug to 750 ,ug, and even more preferably about 75 ~g to about 750 ~g, of each active component (peptide) per dosage unit may be a~mini.~tered. Depending 20 upon the regimen as described below, doses as high as 1500 ~g or more may be used. It is especially advantageous to fonnl-l~te pa~ tel~l compositions in unitdosage form for ease of ~mini~tration and uniformity of dosage. "Unit dosage"
form as used herein refers to physically discrete units suited as unitary dosages for human subjects to be treated; each unit cont~ining a pred~te~ 1ed quantity of 25 active compound calc~ ted to produce the desired ther~eulic effect in association with the desired pharm~ce~ltir~l carrier. The specification for the novel unit dosage forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an 30 active conll)c und for the treatment of human subjects.

CA 022~0361 1998-09-28 wo 97/35879 PCTtUS96/06072 Dosage regimen may be adjusted to provide the o~ m prophylactic or therapeutic response. For example, several divided doses may be a~mini~tered over the course of days, weeks, months or years, or the dose may be proportionally increased or reduced with each subsequent injection as inrijc~t~d by 5 the exigencies of the the,al,euLic situation. In one plefelled therapeutic regimen, subcutaneous injections of therapeutic compositions are given once a day during an acute phase and once every other day during remission for the lifetime of the individual ~.urre~ g from the disease. Alternatives would include, weekly, monthly or other periodic injections. The dosage may remain constant for each 10 injection or may increase or decrease with each subsequent injection. A continual, lifetime treatment program may be most desirable. In the alternative, a booster injection may be ~timini~tered at intervals of about three months to about one year after an initial Ll.a~"r~-l period and may involve only a single injection or may involve another series of injections similar to that of the initial treatment.
1~
Disease Model The effects of peptides derived from proteins of the central nervous system (CNS) have been ~ses~ed in e~eli.llental allergic encephalomyelitis (EAE), an 20 animal model of MS. EAE is a paralytic disease which can be in~ ced by injecting several animal species wit'n either crude homogenates of CNS
components or peptides or proteins derived from the CNS in the presence of adjuvant. In EAE, T cell autoreactivity to CNS components such as MBP is also observed. Histologically, the CNS shows signs of infl~mm~tion and 25 demyelination. All of these r~Lul~,s are found in MS.

EAE inrl~ced by injecting MBP into susceptible strains of rats or mice has been ~Lensi~ely stll(liPd a severe, progressive paralysis of tail and limbs develops, which in mouse stMins such as (PL/J x SJL)Fl can undergo remission 30 and relapse. It has previously been shown that the injection in aqueous solution of a T cell epitope-cont~ining peptide derived from MBP can prevent or treat EAE
in~ ce~l by the entire MBP molecule. It has here been discovered that the CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 injection of MOG, or peptides derived from MOG, as well as the injection of MBP + MOG or MBP + MOG derived peptides, can also induce EAE (Examples 3 and 4). In contrast to the effects of MBP in (PS/J x SJL)Fl mice, the injection of recombinant MOG results in a dose-dependent monophasic disease which does 5 not relapse. Initial experiments were pelrol,lled to determine which peptides constitute the T cell epitopes of MOG in SJL and (PL/J x SJL)Fl mice (described in Examples 4A and 4B below). These studies show that there appears to be two major areas of T cell reactivity to recombinant human MOG 1-121, and that each region may encompass at least one epitope. These regions are found at the N-10 terminal end and the C-terminal end.

Mice inrlucsd with EAE in this manner are useful as an animal model for screening potential therapies for the treatment of MS.

One method for iden~iryillg therapeutic compositions useful for the treatment of MS includes first ~tlmini.ctering human MOG to mice in immnnogenic form to cause induction of EAE in the mice; then treating the mice in(luce~l with EAE with theldp~ulic compositions colll~lisillg at least one antigenic fragment of human MOG prior to the onset of symptoms of EAE or after the onset of 20 symptoms of EAE in said mice; and then ~iet~ if said therapeutic composition prevents the onset or progression of the symptoms of EAE in the mlce.

To demonsLldl~ the universality of peptide therapy, experiments were set up 25 to determine whether a T cell epitope-cont~inin~ peptide derived from the MOGsequence would inhibit the induction of EAE intluce~i by MOG in the same way that peptides derived from MBP inhibit EAE in~uce~ by MBP. These experiments are described below in Examples 4C and 4D. Furthermore, to establish a system more closely resembling MS, in which T cell reactivities to multiple CNS
30 components are found, EAE was in~ cecl by a combination of MBP and MOG in adjuvant. The paralytic disease intil~ced by this combination was severe and chronic, frequently resl~ltin~ in death. In Example 4E, the disease inf~l~recl by ....

CA 022~0361 1998-09-28 MBP and MOG was treated with a MOG-derived peptide, an MBP-derived peptide or both MBP- and MOG-derived peptides.

These experiments demol~lla~ that various MOG peptides, alone or in S combination with various MBP peptides, can reduce the clinical symptoms of EAEin mice. These results support the utility of MOG peptides and MOG peptides +
MBP peptides in thel~p~ulic compositions for the treatment of MS and other demyelin~ting r~ e~es similar to EAE.

10 Synthetic Pe~tide Epitopes Colnrl~YP(l with MHC Class II Mol~c~ q In the last few years the li~ dtu~ has described the phenomenon of the tolerization of T cell responses through the mP~ ni~m of the induction of T cellanergy, whereby specific peptide epitopes are l~lcsellLed to T cells by polymorphic 15 Class II MHC molecules in the absence of cellular co-stim~ tion (reviewed in Mueller et al. (1989) Ann. Rev. Immunol. 7:445-480). Such pl~,sell~Lion is believed to induce T cells into a state of functional non-responsiveness. One approach taken for the induction of anergy has been to purify specific Class II
glycoprotein, to allow peptide/Class II complexes to form, and to then ~rlmini~ter 20 these complexes to p~ti~nt.~ in order to down regulate T cell immlln~ responses (Sharma et al., U.S. Patent No. 5,130,297). For example, one proposed treatment for autoi.,.. l~e tlise~c~s involves the use of purified MHC Class II glycoproteins, or the portion of these glyc~lo~ins capable of binding the peptide epitopes, complexed either covalently or noncovalently with specific peptide epitopes 25 derived from a known autoantigen. However, this approach suffers from the requirement of purification of MHC Class II molecules of every haplotype known to present the peptide epi~opes in question. It is now well established that most peptide epitopes are not restricted to a very small number of Class II haplotypes (reviewed in Engelhard (1994) Ann. Rev. Immunol. 12: 181-207), and that 30 ~utoantigens can be plesellt~d by a wide spectrum of Class II molecules (Joshi et al. (1993) Ann. Neurol. 34:385-393; Valli et al. (1993) J. Clin. Invest. 91:616-628; Martin et al. (1991) J. Exp. Med. 173:19-24. Thus, use of this approach for CA 022~0361 1998-09-28 WO 97/3~879 PCT/US96106072 the treatment of large numbers of patients would be tilne and resource con.~l-min~.
Furtherrnore, this approach would be feasible only if one or a small number of disease causing peptide epitopes is itl~ntifi~d, and if the T cell response to these few epitopes is restricted to a very small number of Class II MHC haplotypes.
Such a situation does not yet and is not likely to exist in outbred human populations.

The present invention overcomes these problems through the a~lmini~tration of high doses of peptide(s) of the invention having T cel~ ~iL(~I)es and allowing for the natural ~ s~ ion of these epitopes by endogenous Class II molecules. Such a regimen results in anergy of T cell responses, and hence tolerization.

MOG peptides of ~e instant invention can be used in conjugates as disclosed, for example, in U.S. Patent 5,130,297 (Shanna et al.) where ~eld~tulic agents are ~le~d using the formula X--MHC--peptide or MHC--peptide--X, wherein X represents a functional moiety selected from a toxin and a labeling group; MHC is an effective portion of the MHC glycop~ in, the glycol)rotein dissociated from the cell surface on which it normally resides; and "peptide"
represents any of the MOG peptides listed herein. Particularly useful MOG
peptides include MOG 31-55 (SEQ ID NO:96), MOG 41-65 (SEQ ID NO:97), MOG 51-75 (SEQ ID NO:98), MOG 61-85 (SEQ ID NO:99), MOG 71-95(SEQ
ID NO:100), MOG 101-125 (SEQ ID NO:101), MOG 111-135 SEQ ID NO:102), MOG 131-155 (SEQ ID NO:103), MOG lS1-175 (SEQ ID NO:105), MOG 161-185 (SEQ ID NO:106), MOG 171-195 (SEQ ID NO:107), MOG 191-215 (SEQ
IDNO:108), MOG 1-25(SEQ ID NO:109), and MOG 21-45(SEQID NO:llO), MOG 1-22 (SEQ ID NO:146), MOG 1-25(24C~24S) (SEQ ID NO:147), MOG
11-35 (SEQ ID NO:148), MOG 36-60 (SEQ ID NO:149), MOG 46-70 (SEQ ID
NO:150), MOG 81-lOO(SEQ ID NO:151), MOG 81-105 (SEQ ID NO:152), MOG 91-115 (SEQ ID NO:153), MOG 111-130 (SEQ ID NO:154), MOG 121-140 (SEQ ID NO:155), MOG 121-145 (SEQ ID NO:156), MOG 131-150 (SEQ
ID NO:157), MOG 141-165 (SEQ IDNO:158), MOG 171-190 (SEQ ID NO:159), MOG 171-185 (SEQ IDNO:160), MOG 181-195(SEQ ID NO:161), MOG 176-, .

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 190 (SEQ ID NO:162), MOG 181-200 (SEQ ID NO:163), MOG 181-205 (SEQ
~D NO:164), MOG 191-210 (SEQ ID NO:104).

Other useful peptides include any known MOG peptides (see, e.g., U.S.
S Ser. No. 08/300,811; Bernard et al., WO 95/07096; Linington et al. (1993) Eur.
J. Tmmllno. 23:1364-1372; Amor et al. (1994) 153:4349-4356; Mendel et al.
(1995) Eur. J. Immunol. 2S:1951-1959; and Johns et al. (1995) J. Immunol.
154:5536-5541).

T Cell Receptor-Derived Peptides Several e~e~ e,lL~l animal models of autoimm-mP disease have associated certain T cell receptor (TCR) sequences with responses to specific anto~ntigen epitopes (reviewed in Gold (1994) Curr. Opin. lmmunol. 6:907-912). T cells bearing these particular TCRs have been shown to cause disease when transferred to naive recipients. Peptides derived from these particular TCRs have been used to i"",-~ experimental anim~l~, leading to the induction of an immllnP response directed against the specific T cells responsible for the disease. Such knowledge has led to the possibility that the control of particular TCR-bearing T cells might be accomplished through vaccination of individuals with TCR-derived peptides, which would result in the induction of regulatory T cell responses directed against the disease-c~ncing T cells. This approach requires knowledge of specific TCR
sequences recognizing disease-causing epitopes of specific ~lltoantigens. Thus, certain peptides derived from, and capable of interacting with a TCR for human MOG or MBP are useful for tre~tmPnt of MS.

Diagnosis The proLeins or peptides of the present invention can be used in "purified"
form for standardization of reagents for the diagnosis and treatment of autoimml-n~
disease. The isolated and purified protein or peptide is also useful to prepare antisera or monoclonal antibodies for use in diagnosis. An animal such as a CA 022~0361 1998-09-28 Wo 97/35879 PCT/u~ /0(072 mouse or rabbit can be il-",---"i~ed with an immlm-)genic form of the isolated protein or isolated peptide, if n~ce~s~ry, confe~ g imml-nngenicity on a proteinor peptide by coupling to carriers or by other techniques well known in the art.The protein or peptide can be ~lmini~tered in the presence of adjuvant, and 5 progress of illllll~ 7~tion can be monitored by detection of antibody titers in plasma or serum standard ELISA or other immlmo~ y can be used with the imml-nogen as antigen to assess the levels of antibodies.

Following i~lllu~ ;ltion~ antisera can be obtained and polyclonal antibodies 10 isolated, if desired, from the serum. To produce monoclonal antibodies, antibody producing cells (Iymphocytes) are harvested from an il~ Pcl animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myeloma cells to yield hybridoma cells. Hybridoma cells can be screened i"",.~ chPmic~lly for production of antibodies reactive with the invention protein 15 or peptide thereof. The all~isel~ or monoclonal antibodies can be used to standardize reagents in standard assays.

Protein, peptides, or antibodies of the present invention can also be used for cletecting and diagnosing autoimm~ln~ disease. For example, this could be 20 done by combining blood, or blood products, obtained from an individual with an isolated antigenic peptide under conditions ~p~o~liate for binding of componentsin the blood (e.g., antibodies, HLA molecules, T-cells and B-cells) with the peptide(s) or protein, and determinin~ the extent to which such binding occurs.
Other diagnostic methods for autoimmlln~ di~e~es which the protein, peptides or 25 antibodies of the present invention can be used include paper radioimm--nosorbent test (PRIST), enzyme linked immnnosorbent assays (ELISA), radioimmllnoassays (RIA), imm~lnnradiometric assays (IRMA), and lnminPscence imm~lnoassays (LIA).

_ . .

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/0~072 Primers~ Probes and Other Oli~omers The availability of the nucleotide sequence shown in FIG. 1 (SEQ ID
NO:1) and of its complement (SEQ ID NO:2) permit the design of various 5 oligonucleotides useful in therapeutic and ~ gnostic contexts. Modulation of the expression of the gene encoding MOG affects the progression of the autoimm--nP
disease; in addition, progression can be monitored by monitoring expression using probes for RNA. Also, oligomers based on the nucleotide sequence disclosed in FIG. 1 herein can be used in standard assay methods for llet~cting the MOG-10 encoding DNA or RNA.

By oligomers "based on" the sequence disclosed in FIG. 1 (SEQ ID NO: 1)is meant oligomers that contain portions of this sequence, that are complem~nt~ry to the seq~lenre or portions thereof, that lcpl~sellt primers used to amplify portions 15 of the sequence when large amounts of DNA are desirable (such as for genetic manipulation) as well as oligomers desi~nP~l on the basis of the disclosed sequence which effect triple helix formation with the relevant portion of the duplex lcl r~sçnli~-g the MOG gene. Relevant design parameters for PCR primers, oligomers capable of hybridizing to single strand targets, and oligomers capable of 20 triple helix formation with DNA duplexes are well known in the art. Thus, oligomers "based on" the DNA of FIG. 1 (SEQ ID NO:1) may have the same sequence as a portion of this DNA, the same sequence as the complement or portion thereof, or a dirrere.ll sequence but one which corresponds to that disclosed in FIG. 1 (SEQ ID NO:1) through art-known design parameters.
The oligomers having nucleotide sequences based on the nucleotide sequence shown in FIG. 1 (SEQ ID NO:1) may be conventional RNA or DNA
polymers, or may be modified forms thereof as generally known in the art. For example, the phosphodiester bonds of the oligomers may be substituted by 30 alternative linkages such as phosphorothioates, methylphosphonates and the like.
In addition, alternative scaffolding for nucleotide bases has also been disclosed and such modifications are included within the scope of oligomers claimed herein.

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96l06072 The following examples illustrate the lJlcr~lled modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

cDNA ENCODING HUMAN MOG PROTEIN

To obtain human DNA encoding MOG protein, a human cDNA library was subjected to the polymerase chain reaction (PCR) using internal primers designedfrom the published rat MOG coding sequence of Gardinier et al. (supra).

Two of the primers were homologous to the top (+) strand of the gene (primers 94-111 and 166-183 (SEQ ID NO:34), base 1 starting at the ATG) and two were homologous to the bottom (-) strand of the gene (primers 538-555 (SEQ
ID NO:35) and 685-702). The combination of primers 166-183 (SEQ ID NO:34) and 538-555 (SEQ ID NO:35) was succe.c~ful in effecting the amplification of a fragment of the approximately 400 bp expected size from a human brain cDNA
library. The sequence of these primers was:
166-183: CAGAATCCGGGAAGAATGCCACGGGC (SEQ ID NO:34);
and 538-555: CAGCGGCCGCACGGAC~'l"l"l"l'CCTCTCAG (SEQ ID NO:35).
An EcoRI site is present in the 166-183 primer (S~Q ID NO:34); and a NotI site is present in the 538-555 primer (SEQ ID NO:35). The 400 bp PCR
product was cloned into expression vector pVL1393 by digesting pVL1393 (Pl~ en CA) with EcoRI and NotI, digesting the amplified product with the same enzymes and lig~qting the resulting fragments. The insert was verified by digesting several clones derived from the ligated plasmids with EcoRI and NotI
and sequenring the resulting 400 bp human MOG fragment. The resulting insert CA 022~0361 1998-09-28 Wo 97l35879 PCT/US96/06072 putatively lacks 184 bp of 5 sequence and 201 bp of 3 sequence based on the 738 bp rat open reading frame. Two y~ were designed from the 400 bp insert from positions 346-363 top and bottom strands as follows:

5 -CAGAATTCTCAGGTTCTCAGATGAAGGA-3 (SEQ ID NO:36); and 5 -AAGCGGCCGCTATCCTTCATCTGAGAACCT-3 (SEQ ID NO:37).

wherein an EcoRI site is present in the first strand and a NotI site in the second.
10 Underlined regions correspond to the MOG sequence.

The human MOG 346-363 top and bottom primers (SEQ ID NOS:36 and 37) were used in combination with the above-mentioned 3 rat primer to amplify the 3 micsing end of the gene from the same human brain cDNA library as 15 previously used. A PCR product corresponding the 3 end of the gene was obtained. This 3 fragment obtained had the expected 400 bp size and this fragment was cloned in pVL1393 and sequenced.

To obtain the 5 portion of the gene a human brain mPd~ \gtlO library 20 obtained from Clontech which had been previously amplified and had a titer of8x10'~ pfu/ml was screened following the protocol described by the m~mlf~cturer.The library was plated onto 12 large plates at 30 000 plaques/plate and the plaques were lifted onto nitrocellulose filters (2 replica filters/plate). Twelve filters lifted from the 12 dir~ L plates were then hybridized to a 32p labelled probe 25 corresponding to the human MOG internal 400 bp fragment initially cloned (positions 184-534). Twenty-two strong positives ~vere obtained. A plug was picked for each positive from the original plates and inr~b~ted overnight with )dilution buffer to elute the phage from the agar. The tube was then centrifuged and the ~ul~cl~latant transferred.
The DNA was amplified from each individual pool using either a )\gtlO
forward primer with an SstII site:

CA 022~0361 1998-09-28 Wo 97l35879 PCT/USg6/06072 5'-(:l l l lGAGCAAGTTCAGCCTGGTTAAG-3' (SEQ ID NO:38) or a )~gtlO reverse primer with an XhoI site:

5 5'-ACCTCGAGGAGGTGGCTTATGAGTATTTCTTCCAGGGTA-3' (SEQ ID
NO:39) as well as a human MOG internal primer top or bottom strand:

10 5'-GGTGCGGGAAAGGTGACTCTCAGGATCCGGAAT-3' (SEQ ID NO:40) or 5'-ATTCCGGATCCTGAGAGTCACCTTTCCCGCACC-3' (SEQ ID NO:41).

15 The last two primers (SEQ ID NOS:40 and 41) include a BamHI site (underlined in the sequences) naturally present in the human MOG sequence.

The primers were used in four dirÇelclll combinations: 1) forward top/internal MOG bottom; 2) reverse bottom/internal MOG bottom; 3) internal 20 MOG top/reverse bottom; and 4) internal MOG top/forward top.

The first two combinations provided the 5' end of the gene (up to the BamHI site) and the last two, the 3' end of the gene. Both S' and 3' portions include untr~n~l~t~d regions. Which of the two members of each combination 25 actually resulted in the desired fragment depends on the orientation of the cDNAs cloned into ~gtlO.

The size of the fragm~nt~ obtained varied from one pool to another. Five of the largest S' fragments or 3' fr~gm~nt~ were subcloned into the SstII and 30 BamHI or BamHI and XhoI sites of the SK polylinker. Three clones from each pool were then sequenced to rule out the presence of PCR errors. This provided CA 022~0361 1998-09-28 Wo 97/3~879 PCT/US96/06072 the complete seq~enre of the gene coding region as well as 174 bp of the 5' untr~n~l~tP~l sequence.

The complete DNA sequence recovered (SEQ ID NO:l) and ~le~uced 5 amino acid sequence (SEQ ID NO:2) are shown in FIG. 1. The human MOG
gene encodes a plcpl'oLeill of 248 amino acids which has 87% homology with the 246 amino acids in the rat protein. The mature protein contains 218 amino acids,numbered 1-218 in FIG. 1 (SEQ ID NO:2). The mature protein begins at the glycine shown at position 1 and is derived from the 248 amino acid preprotein by10 cleavage from the preseqllenre extending from the MET start codon to the alanine residue immediately prece~ing the glycine shown in position 1.

Human MOG cDNA was also cloned into a pET H6 vector Novagen, Madison, WI for e~lcssion in E. coli. pET.H6 contains a sequence encoding six 15 hi.cti~1in~s which allows for purification of any recombinant protein over a Ni2+
column. A trl-nr~t~d human MOG cDNA (no leader sequence and no tr~n~mPmbrane domains) encoding amino acids 1-121 of human MOG (the first 121 amino acids of SEQ ID NO. 2) was amplified by PCR using the following oligonucleotides:
5' primer:
5'-AGCTCGAGCCGCGGAGGGCAGTTCAGAGTGATA-3' (SEQ ID NO:94) 3' primer:
25 5'-GACTCGAGTCACCAGTAGAAAGGATCTTC-3' (SEQ ID NO:95) The 363 bp PCR fragment was then cloned between the unique SstII and XhoI
sites of pET.H6. After cloning, the cDNA was entirely sequenced.

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 EXPRESS~ON OF TRUNCATED HUMAN MOG

A. Expression in Sf-9 The PVL1393 ~ l vector cont~ining the trllnr~te-l human MOG cDNA
encoding amino acids 1-121 of human MOG (the first 121 amino acids of SEQ ID
NO. 2) was cotransfected into Sf-9 cells along with Baculogold linearized 10 Baculovirus DNA (Pl,al,l,h~gen, San Diego, CA). The culture ~u~ellla~llL
cont~inin~ recombinant viruses was harvested after 4 days. The recombinant viruswas plaque purified and subjected to 3 rounds of amplification to obtain a high titer viral stock. Sf-9 cells were then infected with the viral stock at a MOI of 2Ø The supernatant from infected cells was hal~e~led 48 hours after infection 15 and applied to a NiNTA agarose column. The recombinant MOG protein was eluted under non-del~u,i"g conditions using 250 mM Tmi~ ole, dialyzed against 5 % propionic acid and H2O and subsequently Iyophilized. The protein concentration was estim~te~l by BCA. The purified MOG protein was vi~ li7~d on a 12.5% polyacrylamide gel stained with Coomassie blue.
B. Expression in E. coli The pET.H6 vector cont~ining the tr~mr~P~ human MOG cDNA was introduced into BL21(DE3) cells (Novagen, Madison, WI.) by transformation.
25 Several colonies were grown together in 2YT medium to an OD of 1Ø The bacteria were then infl~lced overnight with 1 mM IPTG. Cells were harvested and lysed with 6 M C~1~ni~lin~/100 mM Tris-HCl, pH 8.0 at room temperature overnight. The Iysate was centrifuged at 20.000 rpm for 30 minutes and the resulting ~u~ellla~ll applied to a NiNTA agarose column (Quiagen, Chatsworth, 30 CA). The protein was eluted with 6 M Guanidine/100 mM sodium phosphate, pH

4.5, dialyzed first against 5% propionic acid, then against H2O and subsequentlyIyophilized. The protein concentration was estim~t~d by BCA. The purified . .

CA 022~0361 1998-09-28 WO 97/3S879 ~CT/US96/06072 MOG protein was vi.c~ i7~o(1 on a 12.5% polyacrylamide gel stained with Coomassie blue.

Two groups of (PL/J x SJL)F1 mice were injected with 10 ~g and 50 ~g respectively N-le~ l fragment of recombinant human MOG e~ ssed in insect 10 (-TM, recombinant, Sf-9) which was prepared according to Example 2A herein.
The trllnr~ted MOG contains amino acids 1-121 (hereinafter intended to refer to MOG 1-121) and was selected, in part, because of its solubility relative to the solubility of amino acids 122-218 of the MOG protein (SEQ ID NO:2). Human MOG 122-218 (residues 121-218 of SEQ ID NO. 2) is extremely hydrophobic and 15 is believe to include two tran.~mPrnbrane regions. MOG 1-121 was emul.cifi~d in complete Freund's adjuvant and injected subcutaneously in mice. Emulsions were prepared using 1 volume of PBS or water cont~ining the stated quantity of MOG
1-121, as described above combined with one volume of CFA (Life Technologies, Grand Island, NY) cont~ining 400 ,ug H37Ra (Difco Laboratories, Detroit, MI) for20 a total infection volume of 100 ul per mouse. At the same time as the MOG 1-121 injection, 200 ng pertussis toxin (JRH Biosciences, Lenexa, KS or List Biomedical Labs., Campbell, CA) was also injecte~ intravenously. The 200 ng pertussis toxin i.v. injection was repeated 2 days later. Beginning at Day 8 after initial i",~ "~ ion, the mice were observed for signs of paralysis and scored 25 daily as an in~ic~or that EAE has been in~ cerl. Scoring was based on clinical signs according to the following scale: 1, tail paralysis; 2, partial hind limb paralysis; 3, complete hind limb paralysis; 4, forelimb paralysis; 5, moribund or dead.

The onset of symptoms began as early as 14 days for some mice. The mice were observed for 31 days, at which time the mice were sacrificed, the brains and spinal cords were harvested, and histological studies were undertaken to CA 022~0361 1998-09-28 WO 97/3S87g PCT/US96/06072 verify the clinical obsel~tions. Sixty percent (60%) of mice immllni7e~1 with 50,ug of MOG
(-TM, recombinant, Sf-9) and eighty percent (80%) of mice ~ i7~ with 10 ~g of recombinant MOG (-TM, recombinant, Sf-9) exhibited symptoms of EAE.

This procedure was repeated substituting recombinant N-terminal fragment of recombinant human MOG 1-121 expressed in E. coli (-TM, recombinant, E.
coli) for recombinant N-te. "~ l fragment of recombinant human MOG 1-121 expressed in insect cells (-TM, recombinant, Sf-9). Preliminary results in-lic~te 10 similar fintlin~.

T CELL RESPONSES AND PEPTIDE TREATMENT OF
MURINE EAE MODEL
A. (PL/J x SJL)Fl Mice with MOG-~n-h-retl EAE

(PL/J x SJL)F1 mice (obtained from Jackson Lab, Bar Harbor, ME) were illlllllllli7.~ at the base of the tail with 100 ~l of a 1:1 emulsion of 400 ,ugrecombinant MOG in PBS with Complete Freund's Adjuvant (CFA). Eight to ten days later, mice were sacrificed and a single cell suspension of lymph node cells was prepared. Triplicate wells cont~ining 4 x 105 cells were inrl~b~t~d with 0-100 L4g/ml of a set of MOG-derived 20mers sl)A~ g the length of recombinant MOG
(peptides 1-20 (SEQ ID NO:73), 11-30 (SEQ ID NO:74), 2140 (SEQ ID NO:75), 31-50 (SEQ ID NO:76), 41-60 (SEQ ID NO:77), 51-70 (SEQ ID NO:78), 61-80 (SEQ ID NO:79), 71-90 (SEQ ID NO:80), 81-100 (SEQ ID NO:151), 91-110 (SEQ ID NO:82), 101-120 (SEQ ID NO:83), and 111-130 (SEQ ID NO:154)).
Triplicate wells were also cultured with 2.5 ~g/ml Concanavalin A (Sigma, St.
Louis, MO) which stim~ tes all T cells, 100 ,ug/ml purified protein derivative (PPD), the antigen expressed by mycobacteria in the CFA or 1-100 ~g/ml of the i"~,.,uni~ing antigen, recombinant MOG. These three sets served as positive controls for T cell responses.

CA 022~0361 1998-09-28 Cells were cultured in RPMI 1640 medium (GIBCO, Grand Island, NY) supplemented with 10% fetal calf serum (Sigma, St. Louis, MO) or 0.5% fresh normal mouse serum, supple~n~nt~(l with 10 mM ghlt~minf, 100 U/ml penicillin, 100 U/ml streptomycin and 2 x 10-5 M 2-mercaptoethanol. Cultures were S m~int~in.orl at 37~C and 5% CO2, for various periods of time. To assess proliferative responses, cultures were m~int~in~-l for 96 hr with 1 ~4Ci 3H-thymidine (ICN Ph~ re~lti~ , Inc., Irvine, CA) added for the final 12-16 hours. Cells were then washed onto glass-fiber mats and 3H-thymidine incorporation into DNA measured by scintillation counting. To assess production of the cytokine Il-2, cultures were m~int~in.od for 24 hours, after which 50 ~l of culture supernatant was transferred to new wells cont~inin~ 5 x 103 CTLL2.3 cells, an IL-2 dependent, IL-4 independent cell line (Dr. David Raulet, UCal Berkeley). The CTLL2.3 cultures were m~int~in~d for 48 hours. One ~Ci of 3H-thymidine was added for the final 24 hr of the culture period and incorporation 15 into DNA was ~sec.~l as described above for proliferative responses. Standard curves for known levels of recombinant IL-2 were run in parallel.

Peptides 1-20 (SEQ ID NO:73), 11-30 (SEQ ID NO;74), 31-50 (SEQ ID
NO:76, and 41-60 (SEQ ID NO:77) stimul~ted proliferative responses at least 20 twice the background (i.e., had a Stimulation Index [SI] > 2) at two or more of the tested peptide concentrations. Responses to the positive controls recombinant MOG and PPD were very strong. A similar pattern of peptide effectiveness was observed for IL-2 secretion. Peptides 1-20, 11-30, 31-50 and 41-60 stimlll~ted Tcell responses with SI > 2 at at least two concentrations of tested peptide.
B. SJL Mice with MOG-Tn~lllce(l EAE

The eA~e~ lcllt described in (A) above, was repeated in the SJL strain of mouse (obtained from Jackson Lab, Bar Harbor, ME). Lymph node cells from 30 MOG-primed SJL mice were inrub~ted with 0-50 ~4M concentrations of the set ofMOG-derived 20mers described above. Proliferation was ~ essed as described above.

CA 022~0361 1998-09-28 W O 97/35879 PCT~US96/06~72 The highest responses over the background (no antigen) were found in wells stim~ t~d with peptides 1-20 (SEQ ID NO:73), 91-110 (SEQ ID NO:82), and 81-100 (SEQ ID NO:151); each of these peptides ~t-m~ ted responses that were five-fold greater than the background response (i.e., had an SI > 5) with at least one concentration of peptide. Peptide 11-30 (SEQ ID NO:74) stimtll~t~-l a T
cell response with an SI of approximately 2. Thus, there appear to be two major areas of T cell reactivity to recombinant human MOG in SJL mice, and each region may encompass at least one epitope. These regions are found at the N-terminus of the molecule at amino acids 1-30 and at the C-terminal end at amino acids 81-110.

C. SJL Mice with MOG-Tn~ ce~l EAE

Two groups of SJL mice were immllni7.~d at the base of the tail with 200 ~1 of a 1: 1 emulsion of 200 ~4g recombinant MOG in PBS with CFA, supplemented with 400 ~4g H37Ra Mycobacterium tuberculosis (Difco, Detroit, MI). 200-400 ng Pertussis Toxin was also injected i.v. on day 0 and day 2. One group of mice was injected i.v. with 250 mnoles MOG 91-110 (SEQ ID NO:82) in aqueous solution and the other group was injected with PBS on days 7, 9, 12 and 15 following i,~-"~ i,.Ation. Mice were scored daily to assess their degree of paralysis, using the scale described above.

Mice injected with PBS developed severe EAE around day 10 which rern~inf~cl at a high level for 30 days (mean clinical score of 3-4). In contrast, mice injected with MOG 91-110 did not develop as severe a disease (mean clinicalscore approximately 1) and the disease remitted to a mean clinical score of almost zero. In addition, MOG 91-110 decreased disease incidence (60% vs. 100%) and decreased the mortality which accompanied the severe disease (27% vs. 50%). By these criteria, the peptide MOG 91-110 reduced the severity of EAE in~ ced by 30 recombinant MOG in SJL mice.

CA 022~0361 1998-09-28 WO 97/~5879 PCT/US96/06072 D. (PL/J x SJE)F1 Mice with MOG-Tn~1llced EAE

EAE was induced in (PL/J x SJL)F1 mice by injecting 100 ,ul of an emulsion cont~ining 400 ~g recombinant MOG in CFA supplemented with S Mycobacteria and pertussis toxin, as described above. At days 6, 8, 10, 12, 14, and 16 following i.l,..",.~ rion~ groups of 10 mice were injected with 250 nmoles of the peptide MOG 41-60 (SEQ ID NO:77) in aqueous solution or with PBS.
Mice injected with MOG 41-60 had delayed disease onset, reduced mortality, and lower average daily clinical scores after tre~tm~nt compared to PBS-injected mice. Thus, in (PL/J x SJL)F1 mice, the peptide MOG 41-60 was effective at treating EAE in~ cecl by MOG.

E. (PL/J x SJL)F1 Mice With MBP+MOG-~n~ eecl EAE

(PL/J x SJL)F1 mice were i.~,.. l.i~sd with a mixture of 100 ,ug recombinant MOG and 75 ~g guinea pig MBP em~liified together in CFA, as described above. MBP was prepared from guinea pig spinal cords by a modifi~tion of the method of Smith (J. Neurochem. (1969) 16:83). Briefly, MBP
was extracted from isolated myelin membranes using chloroform and m~th~nol, preci~ ted with pot~c~ m citrate, acid extracted and lyophilized. SDS-PAGE
analysis of this material showed a major band at 18.5 kD.

Mice injected with MBP and MOG were scored daily based on clinical signs according to the scale described above. Mice were injected i.v. with 125-500 nmoles of MBP Ac1-11[4Y] (Sequence Ac-ASQYRPSQRSK (SEQ ID
NO:204)), 125-500 nmoles MOG 41-60 (SEQ ID NO:77), or a combination of 125 or 250 nmoles of each peptide in aqueous solution. Control mice received PBS. All mice were injected 7 times every other day starting around day 7 following i..~ n.
Disease intl~lee~l by injecting both recombinant human MOG and MBP
developed around day 10, was severe and chronic and resulted in high mortality.

CA 022~0361 1998-09-28 Wo 97t35879 PCT/US96l06072 Mice treated with coll-bhlations of 125 and 250 nmoles each MOG 41-60 and MBP Acl-11 ~4Y] reduced disease severity by several criteria: later day of disease onset, reduced clinical scores both during tre~tmPnt and after the cessation of therapy, and decreased mortality. MBP Ac1-11[4Y] alone also reduced disease severity by the same criteria. MOG 41-60 at 250 nmoles reduced disease severity as ~.sessed by reduced clinical scores during the tre~tment regimen. Thus, a peptide derived from MOG and a peptide derived from MBP, as well as a combination of both peptides, can treat disease in~ cecl by both MBP and MOG.

T cell RESPONSES TO HUMAN MOG PEPTIDE

Peptides were synth~qsi7~d using either an Applied Biosystems peptide synth~si7sr (Foster City, CA) or an Advanced Chemtech robotics system (Louisville, KY) lltili7ing FastMOCTM ch~mi~t~ry with commercially available Wang resins (Advanced ChP~ntPch, Louisville, KY or Bachem, Basel Swi~llalld), and Fmoc protected amino acids as described previously by Hill et al. (J.
Immunol. (1994) 52:2890-2898).

T cell assays were performed to further refine the identification of T cell epitopes. Peripheral blood lymphocytes were isolated from the blood of a human volunteer HLA-DR2 positive donor using Ficoll Hypaque. Twenty million lymphocytes were seeded into 96 wells of a microtiter dish at 2 x 105 per well in RPMI culture media supplemented with human AB serum. A mixture of selected MOG peptides listed in Table 1 was added at a final concentration of 50 ~M for each peptide. The MOG peptides selected were both naturally occurring peptides and analogs of naturally occurring peptides.

Cultures were inr~lbated in a hllmitlified CO2 at 37~C for twelve days, and were interrnittently supplemented with human IL-2 (20 U/ml) and IL-4 (5 U/ml) (Collaborative Biomedical Products, Bedford, MA). A sample from each culture well was removed, washed to remove previously added peptide, and reseedecl into CA 022~0361 1998-09-28 W O 97~879 PCT~US96/06072 four wells of a fresh microtiter dish (two wells with the peptide mixture and two wells without the peptide mixture for each sample). Autologous irradiated cryopreserved lymphocytes were added as antigen presenting cells. After further 3 days of incubation, 3H-thymidine incorporation was measured. Positive microtiter5 lines were scored if the mean incol~olalion in the peptide wells was greater than or equal to 1.5-fold higher than the wells without peptide. Positive microtiter lines were expanded with IL-2 and IL-4, and then reassayed the following week bythe same methods with the individual peptides rather than the peptide mix.

Using this method, MOG 1-13 (SEQ ID NO:42) 13mer and MOG 103-115 (SEQ ID NO:55) 13mer showed the strongest response. FIG. 6 shows the results of the assays pel~-llled.

HUMAN MS PATIENT T cell RESPONSE TO MOG PEPTIDES AND
N-TERMINAL FRAGMENT OF RECOMBINANT HUMAN MOG

A. Responses to 20mer Peptides Peptides (20 amino acids in length) were synth~si7ed using either an Applied Biosystems peptide synth~si7Pr or Advanced ChPmt~ch robotics system 25 lltili7ing FastMOCTM cll~mi~try with commercially available Wang resins, and Fmoc-protected amino acids as described previously by Hill et al. (J. Immunol.
(1994) 152:2890-2898). These peptides are 20 amino acid peptides of human MOG overlapping by 10 amino acids and are shown in FIG. 5a.

Following the procedures described above, the T cell response of a human patient suffering from MS was tested with the group of MOG 20mer peptides shown in FIG. 5a and a N-terminal fragment of recombinant human MOG 1-121 expressed in insect Sf-9 (-TM, recombinant, Sf-9), which is shown to induce EAE

CA 022~0361 1998-09-28 W O 97/35879 PCT~US96/06072 in mice in Example 3. One or more of the MOG peptides tested are suspected of cont~ining at least one T cell epitope for the auto~ntigen responsible for MS.

The PBLs of the patient were cultured in microtiter wells according to the protocol above, except that both recombinant MOG 1-121 (48 of 96 wells) and a mixture of 10 MOG fragmPrlt~ (20mer peptides shown in FIG. 5a) (48 of 96 wells) were used separdtely to initiate the cultures. A sample from each culturewell was removed, washed to remove previously added peptide, and r~see~led into six wells of a fresh microtiter dish. Six microtiter wells were subsequently found to react with both recombinant MOG and the peptide mixture (2 wells from the cultures initi~ted with recombinant MOG and 4 wells from the cultures initi~f~clwith the peptide ~ ure). The results confirm that MS patients can have T cells which can be activated by MOG and which recognize one or more T cell epitopes contained in the MOG peptide mixture. There were also a number of wells that reacted with the peptide mixture but not the recombinant MOG. The significance of these positives is less clear but it is believed that true MOG reactive T cells which recognize an epitope in MOG which is not readily processed in vilro.

B. Responses to 25mer Peptides The T cell les~onses of twenty-one MS patients were tested with eight MOG 25mer peptides derived from the N-tellllinal portion of MOG. The peripheral blood lymphocytes (PBL) of MS patients were prepared and cultured according to the protocol above, except that cultures were initi~t~d with 50 ~g/ml of the N-lel Illi "Al fragment of recombinant human MOG 1-121 (SEQ ID NO:2), ple~alcd according to the protocol in Example 2. After the expansion of the microtiter cultures with IL-2 and IL-4, the entire contents of each well was harvested, washed to remove residual MOG, and resee~lecl into twelve wells of a fresh microtiter dish. Each culture was tested (in duplicate wells) with no antigen, 50 ,ug/ml recombinant human MOG 1-121 (the initi:~ting antigen), or 25 ,uM each of four of the N-ttormin~l MOG 25mer peptides listed in Table 2. Peptide Test Group I included 1-25 (SEQ ID NO:109), 11-35 (SEQ ID NO:148), 21-45 (SEQ

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96t06072 ID NO:110), and 31-55 (SEQ ID NO:96). Peptide Test Group II included 41-65 (SEQ ID NO:97), 51-75 (SEQ ID NO:98), 61-85 (SEQ ID NO:99), and 71-95 (SEQ ID NO: 100). Autologous irradiated cryopreserved Iymphocytes were added as antigen presenting cells. After a further three days of incubation, 3H-thymidine 5 incorporation was measured. Positive microtiter lines were scored if the mean incorporation in the peptide wells was greater than or equal to 3-fold higher than the wells without peptide, and the incorporation in the peptide wells was at least 500 counts per minute higher than that in the wells without peptide.

Nineteen of the 21 p~tif~nt!~ produced cultures responding to recombinant human MOG 1-121, and these 19 produced a total of 133 MOG-responding T cell lines. Ninety-two lines were tested on the Group I peptides and 42 were tested on the Group II peptides outlined above. Peptides 1-25, 41-65, and 71-95 all elicited responses from more than 7% of the lines tested on them, and the..,fole would be15 considered major T cell ~ilopes. All of these r~p,esent signifir~rlt levels of reactivity.

PURIFICATION OF NATIVE MOG

A. Myelin Membrane Plcl~al~lion The procedures of myelin preparation were adapted from Smith (J.
25 Neurochem. (1969) 16:83-92). Human brain white matter was homogenised in a blender at the highest speed setting (about 1:2 wt/v) in 10.5% sucrose (wt/v) cont~ining 3 mM EDTA, 20 ~g/ml l~ulJeplil1, 10 ~g/ml soybean trysin inhibitor (STI) and 1 mM phenyl-methylsulfonyl fluoride (PMSF) (solution A). The homogenate was centrifuged at about 17,000 x g for 45 min. at 4~C. The red 30 blood cell and yellow histone portion of the reslllting pellet was carefully removed with a spatula and the re~n~ining pellet was homogenised in the blender at lowest speed in about 2x original volume with cold 30% sucrose cont~ining EDTA and protease inhibitors as above. The homogenate was poured into polycarbonate CA 022~0361 1998-09-28 W O 97/3~879 PCT/U~,~'C~072 ultracentrifuge tubes and an overlay of 10.5% sucrose was added. The myelin membranes were collected at the interface after centrifugation (68,000 x g for 50 min. at 4~C). The myelin was washed once with deionized water (DDW) and pelleted at 68,000 x g for 60 min. at 4~C. The res~lting pellet was resuspended in a small volume of DDW and stored in aliquots at -80~C for further purification.

About 1 g of myelin membranes, as d~Le~ od by the Peterson Protein Assay (Peterson (1977) Anal. Biochem. 83:346-356) was thawed out and brought to a final volume of 100 ml with DDW with protease inhibitors (solution A). The membranes were delipidated with 500 ml CHCl3:MeOH (2:1 v/v) by sh~kiny in a 1-liter flask. After ce~ ifugation at 14,000 x g for 20 min., the proteins at the interphase layer were collected and dried in the hood with a fan on until all the organic solvent had evaporated. The pellet was resuspended into 50 ml CHCl3:MeOH (2:1 v/v) by homogenization with a motor driven Potter-Elvehjem homogenizer. After centrifugation in Teflon tubes (14,000 x g for 20 min.), the solvent was ~lec~ntP~l and the pellet was dried in the hood as above.

B. Solubilization Each of the pellets in the Teflon tubes was resuspended in 25 ml LDAO
buffer (50 mM Hepes, pH 7.6, 0.5 mM DTT, gO mM NaCl, 1.2 %
lauryldimethyl amine oxide, 5 mM EDTA, 20 ~g/ml leupeptin, 10 ~g/ml soybean trypsin inhibitor and 1 mM phenyl-methylsulfonyl fluoride) and first tip sonicated for 3 x 10 sec. each at 4~C. Then the whole mixture was brought to 0.5 liter with LDAO buffer and sonicated in a bath sonicator for 15-30 min. The solubilized material was separated by ultrace"l,irugation (100,000 x g for 30 min.). The pellet was resolubilized in 50 ml LDAO buffer sonicated (tip and bath), and centrifugation was repeated as above. Both supern~t~nts were combined and stored at -80~C for further purification.

CA 022~0361 1998-09-28 wo 97/3s879 PCT/US96/06072 C. Affinity Chromatography Anti-MOG specific monoclonal antibody, 818C5 (Abo et al. (1993) Biochem. M ol. Biol. Int. 30:945-958) was used as the major chromatographic stepS in the purification of MOG. Purified mAb 8-18C5 was dialyzed against Sulfolink Sarnple Preparation Buffer (0.1 M sodium phosphate, 5 rnM EDTA, pH 6.0 at 4~C). The antibodies were reduced with 2-mercaptoethanolamine and ~les~ltecl with SWIFT Des~lting columns (Pierce, Rockford, IL) according to the m~nl~f~cturer's specifications. The IgG was coupled to the Sulfolink Gel (Pierce, Rockford, IL) at 5 mg IgG/ml resin. The slurry was mixed for 15 min. at room temperature and then incubated, without mixing, for at least 30 min., also at room te~ )el~ture. After washing the gel twice with 50 mM Tris, 5 mM EDTA, pH
8.5, the non-specific binding sites on the gel were blocked by cysteine-HC1, followed by low and high pH washes according to the m~mlf~ctllrer's procedures (Pierce). The resin was then equlibrated with 0.2 M sodium borate, pH 9.0 and 18M dimethylpimelimi~1~t~ was added to the mix, which was rocked for 30 min. at room temperature to crosslink the antibodies. The reaction was stopped by incl1h~ting the gel in 0.2 M ethanolamine, pH 8.0 for one hour.

Two 25 ml 8-18C5 Sulfolink colurnns were packed and all the procedures were performed at 4~C. The new columns were "aged" by going through 2 cycles of Chromatography Buffers (Buffer #1: 50 mM HEPES, 0.5 mM DTT, 1 mM
PMSF, 20 ~g/ml l~upepLill, 10 ~g/ml STI, 90 mM NaCl, pH 7.6); Buffer #2:
(same as #1, plus 3 mM EDTA & 0.4% LDAO); Buffer #3: (50 mM HEPES, 0.5 mM DTT, 1 mM PMSF, 20 ~g/ml l~ul~e~ l, 10 ~4g/ml STI, 0.5 mM EDTA, 0.5 M NaCl, 0.04% dodecyl maltoside, pH 7.6); Buffer #4: (same as #3 but no STI); Buffer #5: (150 mM glycine, 1 mM PMSF, 5 ug/mL l~Llpe~ , 0.04 %
dodecyl maltoside, pH 2.0); Buffer #6: 50 mM HEPES, pH 7.6).

About 1-1.5 liter of extract was passed over a 25 ml colurnn. The LDAO
extract was diluted two fold with dilution buffer (i.e. the LDAO buffer without LDAO) to decrease the concentration of LDAO to 0.6 % and tip sonicated for 3 -CA 022~0361 1998-09-28 Wo 97/35879 PCT/U~ 6072 5 sec. After sonication, the material was loaded onto the 8-18C5 Sulfolink columns, which had been equilibrated with Buffer 1, followed by Buffer 2. After loading, the columns were washed with Buffer 3, followed by Buffer 4. MOG
was eluted with Buffer 5. Fractions (4 ml) were collected in tubes cont~ining 205 ~4l of 3 M Tris, pH 9.0 to bring the pH to about neutral. The fractions were pooled according to SDS-PAGE analysis. Purity of the protein was de~~ ed by N-terminal seq~lenring.

Three to four runs of affinity purified material with purity ~ 90 %, as 10 determined by N-terminal sequencing, were pooled and further loaded onto a DEAE-Sepharose FF column (Biotech, Inc., Piscataway, NJ), which was pre-equilibrated in 50 mM HEPES, 1 mM DTT, 1 mM PMSF, 5 ~g/ml l~uyeylill, 50 rnM NaCl, 0.04 % dodecyl maltoside, pH 7.6 The flow-through material together with 1 column wash were collected and dialyzed extensively against DDW with 15 Spectra #2 dialysis tubing (VWR, Boston, MA) with a molecular weight cutoff of 12-14 kD. Most of the MOG protein was recovered in the precipitate. The protein in the supelna~llt was concentrated by lyophilization. Both the precipitate and the lyophilized material were combined together, washed a couple of times with DDW and stored as a suspension in DDW. Total proteins were determined 20 by amino acid analysis and purity was del~llllhled by N-terminal sequencing.

T CELL EPITOPE MAPPING OF HUMAN MOG

In order to establish MOG-reactive T cell lines for epitope lllayyillg, peripheral blood mononuclear cells were isolated from the blood of 46 MS patients recruited at the Rocky Mountain MS Center (Denver, CO) and Fairview Medical Center (Minneapolis, MN). These patients were selPcted based on the following 30 criteria. Newly diagnosed, relapsing-re~nitting~ and chronic-progressive MS
patients were included in the study. MS patients were included only if they had disease activity within the previous two years. Patients were excluded if they had .. , . . . ~ ..

CA 022~0361 1998-09-28 W O 97/35879 PCT~US96/06072 received steroids or other immnnQ~L~p~cssive medications within the four months prior to the study.

MOG-reactive T cell lines were illiti~tefl from each patient by culturing 10 x 106mononuclear cells in 2.5 ml of complete medium. On average, three cultures were set up for each subject, which were pooled before analysis. To ensure detection of naturally processed epitopes, the cultures were stim~ 1 withintact MOG (6 ~Lg/ml, >90% pure) isolated from human brain according to the protocol described in Example 7, and were supplemented after six days of culturewith IL-2 (Collaborative Biom~1ic~l Products, Becton Dickinson Labware, Bedford, MA) and IL-4 (Collaborative Biom~-lic~l Products, Becton Dickinson Labware, Bedford, MA). After two additions of IL-2 and IL~, the individual T
cell lines were assayed on day 14-18 for proliferative responses to titrating doses of MOG, an overlapping set of MOG peptides, or mP~1inm alone as a control.
Twenty thousand T cells from each T cell line were ch~llenged in triplicate in avolume of 200 ~41 with titrations of each MOG peptide or MOG protein in the presence of 5 x 104 gamma-irradiated (3500 Rads) peripheral blood mononuclear cells as antigen presenting cells (APC). After 3 days of culture at 37~C, each microwell received 1 ~LCurie titriated thymidine (ICN Radiochem Irvine, CA) for an additional 16-24 hours. Thymidine incorporation was then measured by liquid scintillation counting. The response to MOG or each MOG peptide is expressed as sfiml-lAtion index (SI), which is the ratio of the tritium counts per minute (CPM) incorporated in the presence of antigen to the tritium CPM incorporated inmP~ m alone as a negative control.
Overlapping peptides spanning the length of the MOG sequence were synthesized as described in Example 5, purified, and resuspended at 1 mM in PBS
pH 7.2. One lc~iesellLalive set of peptides used for epitope mapping is shown inFIG. 7. Fight~en peptides, 20 or 25 amino acids in length with overlaps of 5, 1030 or 15 amino acids were tested for the plcsellce of T cell epitopes by the challenge of MOG-reactive T cell lines described above.

CA 022~0361 1998-09-28 wo 97/35879 PCT/USg6/06072 Peripheral blood T cell reactivity to MOG, and to peptides sl)al,l~ing the MOG sequence, was evaluated in 46 MS patients. Thirty-one of these 46 cultures (67%) responded to MOG protein with ctim~ tion indices of 2 or greater in secondary proliferation assays, and were used to assess reactivity to MOG
peptides. Reactivity of the T cell lines to MOG peptides was evaluated based on the percent of MS patients recognizing each peptide and on the relative m~nitll-le of the responses to each peptide. In this preliminary map, three distinct regions of high reactivity were identified across the MOG molecule. Responses of these T
cell lines to the set of MOG peptides were ~cc~cced by sum of ranks analysis, inwhich the highest three responses of each cell line to peptides are ranked from highest to lowest (3,2,1). The ranks received by each peptide were then summed across the population, lepl~se.,~ g the relative strength and frequency of the responses to each individual peptide. As shown in FIG. 8A, major T cell epitopesare located in the N-terminal third of the MOG molecule, with other major areas of T cell reactivity at amino acids 111-135 and 171-195. FIG. 8B shows the mean percentage of T cell reactivity accounted for by each of the peptides in this population of 31 MS patients.

By this method of analysis, the same regions (1-95, 111-135, and 171-195) show the highest reactivity. These results suggest that combinations of more than one MOG peptide of the invention have the potential to down-regulate the immlln~response in subjects ~fflirted with MS.

EX~MPLE 9 ADDITIONAL T CELL EPITOPE MAPPING OF HUMAN MOG

In order to re-establish and further define major areas of T cell activity to the human MOG molecule, peripheral blood mononuclear cells were isolated from an additional 49 MS patients recruited at the same meclic~l centers and selected by 30 the same criteria as mentioned in Example 8. These additional T cell lines were established and assayed according to Example 8.

CA 022~0361 1998-09-28 Wo 97/35879 PCT/US96/06072 Additional peptides 20-25 amino acids in length shown below in Table 4 were tested. These peptides completed an overlapping set of 25 amino acid long peptides which span the entire MOG molecule, overlapping by 15 amino acids.
Also, a few peptides 15-22 amino acid long were included to further define the 5 major areas of T cell reactivity identified in Example 8.

TAB~E 4 Amino Acids SEQ ID
(peptides) NO:

Peripheral blood T cell reactivity to MOG, and to peptides s~ g the MOG sequence, was evaluated in a total of 95 MS pjq/tit'nt~, 46 patients from Example 8. Sixty-nine of the 95 cultures (73%) responded to MOG protein in secondary proliferation assays, and were used to assess reactivity to MOG peptides 35 as described in Example 8. The criteria used to define a positive response included an SI of 2 or greater, difference between antigen wells and m~ rn wellsto be 500 CPM or greater and standard deviation of antigen wells less than or equal to the difference in CPM between antigen wells and medium wells.

CA 022~036l l998-09-28 W O 97/3S879 PCTrUS96/06072 Reactivity of the T cell lines to MOG peptides was ev~ A1 by a method referred to as positivity index (PI). PI for a peptide is the mean SI multiplied by the percentage of positive responses to that peptide. PI takes into account both the SI (strength of response) and the frequency of response for each peptide. FIG. 95 shows the PI for each of the peptides in the total population of sixty-nine MSpatients. By this method of analysis, the regions of highest reactivity are 1-65 and 171-195, with other major areas of T cell reactivity at amino acids 61-85, 101-135, and 191-215.

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimA.ntation, llulllel~us equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the 15 scope of this invention, and are covered by the following claims.

Claims (106)

1. An isolated peptide of human MOG selected from the group consisting of

2. The MOG peptide of claim 1 comprising at least one T-cell epitope.

3. The MOG peptide of claim 2 comprising tandem copies of same T cell epitope.

4. The MOG peptide of claim 2 comprising at least two T cell epitopes.

5. The MOG peptide of claim 4 wherein the T-cell epitopes are different.

6. The MOG peptide of claim 1 which is modified forming a modified peptide wherein said modified peptide retains its ability to be recognized by a human T cell specific for human MOG.

7. The MOG peptide claim 1 which is modified, the modification comprising substitution of a first amino acid for a second amino acid, the peptide so modified retaining a biological activity.

8. The MOG peptide of claim 7 which is modified. the modification comprising substitution of a first amino acid for at least a second amino acid.

9. The MOG peptide of claim 1 which is modified, the modification comprising a moiety coupled to the peptide, the moiety being selected from the group consisting of polyethyleneglycol, a moiety that enhances the solubility of the peptide, a moiety which facilitates purification of the peptide, and a moiety which comprises a proteolytic cleavage site.

10. An isolated peptide of human MOG comprising at least one T cell epitope recognized by a human T cell specific for human MOG, said peptide selected from group consisting of:
amino acids 1-95 of human MOG wherein amino acid sequences 10-13 and 46-57 of human MOG are present;
amino acids 111-135 of human MOG wherein amino acid sequence 111-115 of human MOG is present; and all or a portion of amino acids 171-215 of human MOG wherein amino acid sequence 181-190 of human MOG is present, wherein the amino acid sequence for human MOG is shown in SEQ ID NO:2.

11. The peptide of claim 10 comprising amino acids 1-95 of human MOG wherein amino acid sequences 10-13 and 46-57 of human MOG are present.

12. The peptide of claim 10 comprising amino acids 111-135 of human MOG
wherein amino acid sequence 111-115 of human MOG is present.

13. The peptide of claim 10 comprising all or a portion of amino acids 171-215 of human MOG wherein amino acid sequence 181-190 of human MOG is present.

14. The peptide of claim 10 comprising amino acids 171-195 of human MOG.

15. A composition comprising at least one isolated peptide of human MOG
comprising at least one T cell epitope recognized by a human T cell specific for human MOG, said at least one peptide selected from the group consisting of:
amino acids 1-95 of human wherein amino acid sequences 10-13 and 46-57 of human MOG are present;
amino acids 111-135 of human MOG wherein amino acid sequence 111-115 of human MOG is present; and all or a portion amino acid 171-215 of human MOG wherein amino acid sequence 181-190 of human MOG is present, wherein the amino acid sequence for human MOG is shown in SEQ ID NO:2.

16. The composition of claim 15 comprising at least two isolated peptide consisting of all or a portion of amino acid 1-95 of human MOG, wherein said at least two peptide comprise amino acid sequence 10-13 and 46-57 of human MOG, and wherein the amino acid sequences 10-13 and 46-57 of human MOG are present separately or together in either or both of such at least two peptides, wherein each peptide comprises at least one T cell epitope recognized by a human T cell specific for human MOG.

17. The composition of claim 15 comprising at least two peptides consisting of all or a portion of amino acids 1-95 of human MOG, wherein said at least two peptides comprise amino acid sequences 10-13 and 46-57 of human MOG and wherein the amino acid sequences 10-13 and 46-57 of human MOG are present separately or together in either or both of such at least two peptides, and a peptide consisting of all or a portion of amino acids 111-135 of human MOG wherein amino acid sequence 111-115 of human MOG is present, wherein each peptide comprises at least one T cell epitope recognized by a human T cell specific for human MOG.

18. The composition of claim 15 comprising at least two peptides consisting of all or a portion of amino acids 1-95 of human MOG, wherein said at least two peptides comprise amino acid sequences 10-13 and 46-57 of human MOG and wherein the amino acid sequences 10-13 and 46-57 of human MOG are present separately or together in either or both of such at least two peptides, and a peptide consisting of all or a portion of amino acids 171-215 of human MOG wherein amino acid sequence 181-190 is present, wherein each peptide comprises at least one T cell epitope recognized by a human T cell specific for human MOG.

19. The composition of claim 15 comprising at least two peptides consisting of all or a portion of amino acids 1-95 of human MOG, wherein said at least two peptides comprise amino acid sequences 10-13 and 46-57 of human MOG and wherein the amino acid sequences 10-13 and 46-57 of human MOG are present separately or together in either or both of such at least two peptides, and a peptide consisting of all or a portion of amino acids 111-135 of human MOG wherein amino acid sequence 111-115 of human MOG is present, and a peptide consisting of all or a portion of amino acids 171-215 of human MOG wherein amino acid sequence 181-~0 of human MOG is present, wherein each peptide comprises at least one T cell epitope recognized by a human T cell specific for human MOG.

20. The composition of claim 15 comprising at least two peptides.

21. The composition of claim 16 wherein said at least two peptides are selected from the group consisting of:
MOG 1-20 (SEQ ID NO:--), MOG 1-25 (SEQ ID NO:--), MOG 36-60 (SEQ ID NO:--), MOG 41-60 (SEQ ID NO:--), MOG 41-65 (SEQ ID NO:--), and MOG 46-70 (SEQ ID NO:--).

22. The composition of claim 21 comprised of a first peptide and a second peptide, wherein said first peptide is selected from the group consisting of:
MOG 1-20 (SEQ ID NO:--), and MOG 1-25 (SEQ ID NO:--);
and wherein said second peptide is selected from the group consisting of:
MOG 41-60 (SEQ ID NO:--), and MOG 41-65 (SEQ ID NO:--).

23. The composition of claim 22 further comprising a third peptide, wherein said third peptide is selected from the group consisting of:
MOG 171-195 (SEQ ID NO:--), MOG 181-195 (SEQ ID NO:--), and MOG 176-190 (SEQ ID NO:--).

24. The composition of claim 15 wherein said at least one peptide is selected from the group consisting of:
MOG 171-195 (SEQ ID NO:--), MOG 181-195 (SEQ ID NO:--), and MOG 176-190 (SEQ ID NO:--).

25. The composition of claim 15 further comprising at least one additional peptide selected from the group consisting of:
MOG 11-35 (SEQ ID NO:--), MOG 21-40 (SEQ ID NO:--), MOG 21-45 (SEQ ID NO:--), MOG 31-55 (SEQ ID NO:--), MOG 51-75 (SEQ ID NO:--), MOG 61-85 (SEQ ID NO:--), MOG 71-95 (SEQ ID NO:--), MOG 81-105 (SEQ ID NO:--), MOG 91-110 (SEQ ID NO:--), MOG 91-115 (SEQ ID NO:--), MOG 101-125 (SEQ ID NO:--), MOG 121-145 (SEQ ID NO:--), MOG 131-155 (SEQ ID NO:--), MOG 141-160 (SEQ ID NO:--), MOG 151-175 (SEQ ID NO:--), MOG 161-185 (SEQ ID NO:--), MOG 171-185 (SEQ ID NO:--), MOG 181-205 (SEQ ID NO:--), MOG 191-215 (SEQ ID NO:--), and MOG 199-218 (SEQ ID NO:--).

26. The composition of claim 16 further comprising at least one additional peptide selected from the group consisting of:
MOG 11-35 (SEQ ID NO:--), MOG 21-40 (SEQ ID NO:--), MOG 21-45 (SEQ ID NO:--), MOG 31-55 (SEQ ID NO:--), MOG 51-75 (SEQ ID NO:--), MOG 61-85 (SEQ ID NO:--), MOG 71-95 (SEQ ID NO:--), MOG 81-105 (SEQ ID NO:--), MOG 91-110 (SEQ ID NO:--), MOG 91-115 (SEQ ID NO:--), MOG 101-125 (SEQ ID NO:--), MOG 121-145 (SEQ ID NO:--), MOG 131-155 (SEQ ID NO:--), MOG 141-160 (SEQ ID NO:--), MOG 151-175 (SEQ ID NO:--), MOG 161-185 (SEQ ID NO:--), MOG 171-185 (SEQ ID NO:--), MOG 181-205 (SEQ ID NO:--), MOG 191-215 (SEQ ID NO:--), and MOG 199-218 (SEQ ID NO:--).

27. The composition of claim 15 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

28. The composition of claim 27 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

29. The composition of claim 28 wherein said human myelin protein consists of MBP.

30. The composition of claim 16 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

31. The composition of claim 30 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

32. The composition of claim 31 wherein said human myelin protein consists of MBP.

33. The composition of claim 17 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

34. The composition of claim 33 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

35. The composition of claim 34 wherein said human myelin protein consists of MBP.

36. The composition of claim 18 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

37. The composition of claim 36 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

38. The composition of claim 37 wherein said human myelin protein consists of MBP.

39. The composition of claim 19 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

40. The composition of claim 39 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

41. The composition of claim 40 wherein said human myelin protein consists of MBP.

42. A composition comprising a MOG peptide of claim 1.

43. The composition of claim 42, wherein the peptide comprises at least one T
cell epitope.

44. A composition comprising at least two peptides of human MOG, at least one of which is a peptide of claim 1.

45. The composition of claim 42 further comprising a peptide of human myelin basic protein.

46. The composition of claim 43 further comprising a peptide of human myelin basic protein.

47. A composition comprising tandem copies of a MOG peptide of claim 1.

48. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising a peptide of claim 1 and a pharmaceutically acceptable carrier.

49. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising a peptide of claim 10 and a pharmaceutically acceptable carrier.

50. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 15 and a pharmaceutically acceptable carrier.

51. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 16 and a pharmaceutically acceptable carrier.

52. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 17 and a pharmaceutically acceptable carrier.

53. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 18 and a pharmaceutically acceptable carrier.

54. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 19 and a pharmaceutically acceptable carrier.

55. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 21 and a pharmaceutically acceptable carrier.

56. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 22 and a pharmaceutically acceptable carrier.

57. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 23 and a pharmaceutically acceptable carrier.

58. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 25 and a pharmaceutically acceptable carrier.

59. A therapeutic composition for treatment of multiple sclerosis in a mammal comprising the composition of claim 27 and a pharmaceutically acceptable carrier.

60. A multipeptide therapeutic composition for treating multiple sclerosis in a mammal comprising the composition of claim 42 and a pharmaceutically acceptable carrier.

61. A multipeptide therapeutic composition for treating multiple sclerosis in a mammal comprising the composition of claim 43 and a pharmaceutically acceptable carrier.

62. A multipeptide therapeutic composition for treating multiple sclerosis in a mammal comprising the composition of claim 44 and a pharmaceutically acceptable carrier.

63. A multipeptide therapeutic composition for treating multiple sclerosis in a mammal comprising the composition of claim 45 and a pharmaceutically acceptable carrier.

64. A multipeptide therapeutic composition for treating multiple sclerosis in a mammal comprising the composition of claim 46 and a pharmaceutically acceptable carrier.

65. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 48 in an amount sufficient to down-regulate an autoimmune response in the mammal.

66. The method of claim 65 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

67. The method of claim 66 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

68. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 60 in an amount sufficient to down-regulate the autoimmune response in the mammal.

69. The method of claim 68 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

70. The method of claim 69 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

71. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 61 in an amount sufficient to down-regulate the autoimmune response in the mammal.

72. The method of claim 71 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

73. The method of claim 72 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

74. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 62 in an amount sufficient to down-regulate the autoimmune response in the mammal.

75. The method of claim 74 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

76. The method of claim 75 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

77. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 63 in an amount sufficient to down-regulate the autoimmune response in the mammal.

78. The method of claim 77 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

79. The method of claim 78 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

80. A method of treating multiple sclerosis in a mammal comprising the step of administering to the mammal the composition of claim 64 in an amount sufficient to down-regulate the autoimmune response in the mammal.

81. The method of claim 80 wherein the administering step is selected from the group consisting of intravenous injection, subcutaneous injection, intramuscularinjection, oral administration, inhalation, sublingual administration, transdermal administration, and rectal administration.

82. The method of claim 81 wherein the composition is administered subcutaneously in non-immunogenic form in an amount sufficient to down-regulate the autoimmune response in the mammal.

83. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 49 in an amount sufficient to down-regulate an autoimmune response in the mammal.

84. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 50 in an amount sufficient to down-regulate an autoimmune response in the mammal.

85. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 51 in an amount sufficient to down-regulate an autoimmune response in the mammal.

86. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 52 in an amount sufficient to down-regulate an autoimmune response in the mammal.

87. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 53 in an amount sufficient to down-regulate an autoimmune response in the mammal.

88. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 54 in an amount sufficient to down-regulate an autoimmune response in the mammal.

89. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 55 in an amount sufficient to down-regulate an autoimmune response in the mammal.

90. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 56 in an amount sufficient to down-regulate an autoimmune response in the mammal.

91. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 57 in an amount sufficient to down-regulate an autoimmune response in the mammal.

92. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 58 in an amount sufficient to down-regulate an autoimmune response in the mammal.

93. A method of treating multiple sclerosis in a mammal comprising administering to said mammal the therapeutic composition of claim 59 in an amount sufficient to down-regulate an autoimmune response in the mammal.

94. An isolated peptide comprising at least two regions each having human T cell stimulating activity, said regions each comprising at least one T cell epitope of a human myelin protein, said epitope recognized by a T cell specific for said human myelin protein wherein the regions are arranged in a configuration different from a naturally-occurring configuration of the regions in the human myelin protein.

95. An isolated peptide of claim 94 wherein said human myelin protein consists of MOG.

96. An isolated peptide of claim 95 wherein the regions are selected from the group consisting of:
MOG 1-20 (SEQ ID NO:--), MOG 1-25 (SEQ ID NO:--), MOG 11-35 (SEQ ID NO:--), MOG 21-40 (SEQ ID NO:--), MOG 21-45 (SEQ ID NO:--), MOG 31-55 (SEQ ID NO:--), MOG 36-60 (SEQ ID NO:--), MOG 41-60 (SEQ ID NO:--), MOG 41-65 (SEQ ID NO:--), MOG 46-70 (SEQ ID NO:--), MOG 51-75 (SEQ ID NO:--), MOG 61-85 (SEQ ID NO:--), MOG 71-95 (SEQ ID NO:--), MOG 81-105 (SEQ ID NO:--), MOG 91-110 (SEQ ID NO:--), MOG 91-115 (SEQ ID NO:--), MOG 101-115 (SEQ ID NO:--), MOG 121-145 (SEQ ID NO:--), MOG 131-155 (SEQ ID NO:--), MOG 141-160 (SEQ ID NO:--), MOG 151-175 (SEQ ID NO:--), MOG 161-185 (SEQ ID NO:--), MOG 171-185 (SEQ ID NO:--), MOG 176-190 (SEQ ID NO:--), MOG 181-195 (SEQ ID NO:--), MOG 181-205 (SEQ ID NO:--), MOG 191-215 (SEQ ID NO:--), and MOG 199-218 (SEQ ID NO:--).

97 An isolated peptide of claim 94 including a proteolytic site inserted between at least two of said regions.

98. An isolated peptide of claim 95 including a proteolytic site inserted between at least two of said regions.

99. An isolated peptide of claim 96 including a proteolytic site inserted between at least two of said regions.

100. A peptide of human MBP comprising at least one T cell epitope recognized by a human T cell specific for human MBP, said peptide having an amino acid sequence selected from the group consisting of: MBP-1 (11-30)(SEQ ID NO:--), MBP-1.1 (11-29)(SEQ ID
NO:--), MBP 1.2(11-31)(SEQ ID NO:--), MBP-2 (83-105)(SEQ ID NO:--, MBP-2.1 (82-105)(SEQ ID NO:--), MBP-2.2 (82-104)(SEQ ID NO:--), MBP-2.3 (80-98) (SEQ ID NO:--), MBP-2.4 (82-102)(SEQ ID NO:--), MBP-2.5 (80-104)(SEQ ID NO:00), MBP-2.6 (80-102)(SEQ ID NO:--), MBP-3 (111-130)(SEQ ID NO:--), MBP-3.1 (111-129) (SEQ ID NO:--), MBP-4 (141-165)(SEQ ID NO:--) and MBP-5 (101-125)(SEQ ID NO:--).

101 A composition comprising at least one peptide of human MBP comprising at least one T cell epitope recognized by a human T cell specific for human MBP, said at least one peptide selected from the group consisting of: MBP-1 (11-30)(SEQ ID NO:--), MBP-1.1 (11-29)(SEQ ID NO:--), MBP 1.2 (11-31)(SEQ ID NO:--), MBP-2 (83-105) (SEQ ID NO:--, MBP-2.1 (82-105)(SEQ ID NO:--), MBP-2.2 (82-104)(SEQ ID NO:--), MBP 2.3 (80-98) (SEQ ID NO:--), MBP-2.4 (82-102)(SEQ ID NO:--), MBP-2.5 (80-104)(SEQ ID NO:00), MBP-2.6 (80-102)(SEQ ID NO:--), MBP-3 (111-130)(SEQ ID NO:--), MBP-3.1 (111-129)(SEQ ID NO:--), MBP-4 (141-165)(SEQ ID NO:--) and MBP-5 (101-125)(SEQ ID NO:--).

102. The composition of claim 101 further comprising an additional peptide of a human myelin protein said additional peptide comprising at least one T cell epitope recognized by a human T cell specific for said human myelin protein.

103. The composition of claim 102 wherein said human myelin protein is selected from the group consisting of MBP, MOG, MAG and PLP.

104. The composition of claim 103 wherein said human myelin protein consists of MOG.

105. The composition of claim 102 wherein said additional peptide of a human myelin protein is selected from the group consisting of:
MOG 1-20 (SEQ ID NO:--), MOG 1-25 (SEQ ID NO:--), MOG 11-35 (SEQ ID NO:--), MOG 21-40 (SEQ ID NO:--), MOG 21-45 (SEQ ID NO:--), MOG 31-55 (SEQ ID NO:--), MOG 36-60 (SEQ ID NO:--), MOG 41-60 (SEQ ID NO:--), MOG 41-65 (SEQ ID NO:--), MOG 46-70 (SEQ ID NO:--), MOG 51-75 (SEQ ID NO:--), MOG 61-85 (SEQ ID NO:--).
MOG 71-95 (SEQ ID NO:--), MOG 81-105 (SEQ ID NO:--), MOG 91-110 (SEQ ID NO:--), MOG 91-115 (SEQ ID NO:--), MOG 101-125 (SEQ ID NO:--), MOG 121-145 (SEQ ID NO:--), MOG 131-155 (SEQ ID NO:--), MOG 141-160 (SEQ ID NO:--), MOG 151-175 (SEQ ID NO:--), MOG 161-185 (SEQ ID NO:--), MOG 171-185 (SEQ ID NO:--), MOG 171-195 (SEQ ID NO:--), MOG 176-190 (SEQ ID NO:--), MOG 181-195 (SEQ ID NO:--), MOG 181-205 (SEQ ID NO:--), MOG 191-215 (SEQ ID NO:--), and MOG 199-218 (SEQ ID NO:--).

106. A therapeutic composition for treatment of mulitple sclerosis in a mammal comprising a peptide of claim 100 and a pharmaceutically acceptable carrier.