EP0784689A1 - Microorganisms as therapeutic delivery systems - Google Patents

Microorganisms as therapeutic delivery systems

Info

Publication number
EP0784689A1
EP0784689A1 EP95935431A EP95935431A EP0784689A1 EP 0784689 A1 EP0784689 A1 EP 0784689A1 EP 95935431 A EP95935431 A EP 95935431A EP 95935431 A EP95935431 A EP 95935431A EP 0784689 A1 EP0784689 A1 EP 0784689A1
Authority
EP
European Patent Office
Prior art keywords
lra
protein
bacteria
administration
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95935431A
Other languages
German (de)
English (en)
French (fr)
Inventor
Aldo Tagliabue
Diana Boraschi
Paola Bossu'
Giovanni Macchia
Giovanni Maurizi
Stefano Porzio
Paolo Ruggiero
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dompe SpA
Original Assignee
Dompe SpA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dompe SpA filed Critical Dompe SpA
Publication of EP0784689A1 publication Critical patent/EP0784689A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates to the use of microorganisms as vehicles for delivery of therapeutic compounds to animals.
  • the present invention allows therefore, by suitably selecting and adapting the microorganism, the protein to be expressed and the expression vectors, previously used for the production in laboratory or industrial environment, to address specific therapeutic problems.
  • the present invention concerns therefore the therapeutic use of said engineered microorganisms and compositions containing the same, thereby satisfying a long felt need in the area of therapeutic delivery of drugs to an animal.
  • antigens comprise HIV proteins or fragments thereof (WO 92/21376, Nature, Vol. 351, p. 479-482, 1991), B. anthracis toxins (WO 92/19720), E7 protein from human papilloma virus type 16 (Infection and Immunity, £ ⁇ , 1902-1907, 1992), binding region BB of streptococcal protein G and a protein fragment from human Rous Sarcoma Virus (Gene, 128, 89-94, 1993).
  • these antigens are expressed on the cell surface of the transformed microorganism from which they are not released.
  • the microorganism act therefore as a carrier and adjuvant for the selected antigen which preferably should not be released in order to exert their immunogenic and vaccinogenic activity.
  • This approach which could be defined as vaccinological approach, has been up to now exploited using Staphylococcus xylosus, Bacillus anthracis, Streptococcus pyogenes or Mycobacteria (BCG) strains.
  • the invention refers to pharmaceutical compositions containing, as the active principle, engineered microorganisms expressing non-vaccinogenic pharmacologically active recombinant therapeutic proteins, wherein said microorganism is not Salmonella species.
  • Figure 1 is a schematic diagram of the IL-lra expressing plasmid, pSETA-IL-lra.
  • Figure 2 is a schematic diagram of the plasmid PSM441 .
  • Figure 3 depicts a densitometric analysis of proteins following SDS-PAGE of IL-lra-containing samples obtained from Bacillus subtilis expressing the same.
  • 1 Molecular weight (in kDa) markers obtained from Bio-Rad (15 ⁇ l; 2: Cell lysate supernatant (15 ⁇ l); 3: partially purified IL-lra obtained from cell lysate supernatant (15 ⁇ l); 4: Sporulation supernatant (15 ⁇ l); 5: partially purified IL-lra from sporulation supernatant (15 ⁇ l).
  • the arrows indicate the electrophoretic migration of IL-lra.
  • Figure 4 is the nucleotide and corresponding amino acid sequence of human IL-lra.
  • the numbering of the amino acid sequence refers to the complete protein including the signal peptide (first 25 amino acids).
  • the mature protein begins at the amino acid arginine, amino acid number 26 (R26).
  • Figure 5 comprising parts A, B and C depicts in (A) a schematic representation of the life cycle of Bacillus subtilis including sporulation; in (B) there is shown a photograph of a Western blot experiment detecting the presence of Il-lra in the sporulating supernatant of Bacillus subtilis. Lane 1, wild type Bacillus subtilis; lane 2, Bacillus subtilis comprising pSM539 and expressing recombinant IL-lra; in (C) there is shown a graph depicting detection of IL-lra in a sporulation supernatant as assessed by SDS-PAGE and laser scanning densitometry.
  • Figure 6 is a graph depicting the serum concentration of IL-lra in rabbits administered a single intracolonic instillation of 2 X 10 9 live Bacillus subtilis per rabbit comprising pSM539 or pSM214. Il-lra was assessed by ELISA.
  • Figure 7 is a graph depicting the serum concentration of IL-lra in rabbits administered two intracolonic instillation of 2 X 10 9 live Bacillus subtilis comprising pSM539 or pSM214. IL-lra was assessed by BIAcore. Each circle represents an individual rabbit.
  • Figure 8 is a graph depicting the increase in body temperature of rabbits treated intravenously with recombinant human IL-l ⁇ at 75 ng/kg one hour following a single intracolonic instillation of 2 X 10 9 live
  • Bacillus subtilis per rabbit comprising pSM539 or
  • Figure 9 is a graph depicting increase in body temperature of rabbits receiving a single intracolonic instillation of 2 x 10 9 live Bacillus subtilis per rabbit comprising pSM261 or pSM214. In the group treated with I'l-l ⁇ expressing bacteria, 40% of the animals died of hypotensive shock.
  • Figure 10 is a graph depicting hypoglycemia induced by IL-l ⁇ administered intraperitoneally at a dose of 100 ng/mouse.
  • the animals were also administered subcutaneously either saline (filled bar) or 100 ⁇ g of IL-lra (cross-hatched bar) or 5 x 10 8 live Escherichia coli comprising pT7MILRA-3 (hatched bar) each of which was administered 2 hours prior to IL-1J3 treatment.
  • saline filled bar
  • 100 ⁇ g of IL-lra cross-hatched bar
  • 5 x 10 8 live Escherichia coli comprising pT7MILRA-3 hatchched bar
  • the present invention relates to the preparation of pharmaceutical compositions comprising recombinantly engineered microorganisms, which microorganisms are useful for therapeutic treatment of a variety of disease states in animals.
  • the invention further includes methods of administration of such pharmaceutical compositions to an animal having a disease state requiring treatment with the pharmaceutical compositions of the invention.
  • the invention includes pharmaceutical compositions comprising recombinantly engineered microorganisms which are useful for therapeutic treatment of various pathological conditions.
  • the methods of the invention exploit the ability of certain microorganisms to survive in the mucosal surfaces of animals, which mucosae represent the interface between the exterior and interior regions of the body, and/or undergo sporulation or lyse and release the recombinant proteins expressed at said mucosal surfaces.
  • the recombinant microorganisms of the invention which encode the desired therapeutic protein, express and produce the same. The protein so produced then has the desired therapeutic effect either at the site of production, or is selectively transported to the desired anatomical site at which it then exerts the desired therapeutic effect.
  • microorganisms are manipulated to express desired recombinant proteins, which microorganisms have properties which render them particularly useful for generation of the compositions of the invention and in the methods of their use. Certain properties of bacteria and other microorganisms are exploited in order to render them useful as vehicles for administration of therapeutic recombinant proteins to animals. These properties include, but are not limited to, the ability of the microorganism to adhere to epithelial cells (Karlsson et al, 1989, Ann. Rev. Biochem. 58:309); microorganisms which form spores which are resistant to adverse conditions and which are capable of producing large quantities of proteins (Kaiser et al. , Cell 1993, 73:237).
  • Microorganisms are known to possess selective tropism for the mucosa of the intestinal tract, the mucosa of the mouth and oesophagus, the mucosa of the nose, pharynx, trachea, the vaginal mucosa, the skin, the bronchopul onary system, the eye, the ear.
  • a microorganism preferably a bacterium, is manipulated such that it comprises a desired gene, which gene encodes a desired protein useful for treatment of a particular disease state in an animal.
  • the microorganism is administered to the animal following which administration, the protein is produced therefrom to provide the desired therapeutic treatment in the animal.
  • the microorganism may also be manipulated to encode other sequence elements which facilitate production of the desired protein by the bacterium.
  • sequence elements include, but are not limited to, promoter/regulatory sequences which facilitate constitutive or inducible expression of the protein or which facilitate overexpression of the protein in the bacterium.
  • Additional sequence elements may also include those which facilitate secretion of the protein from the bacterium, accumulation of the protein within the bacterium, and/or programmed lysis of the bacterium in order to release the protein from the same.
  • Many of the sequence elements referred to above are known to those skilled in the art (Hodgson J. , 1993, Bio/Technology 11:887).
  • heat induction galactose induction
  • viral promoter induction viral promoter induction
  • heat shock protein induction systems are well described in the art and are readily understood by those skilled in the art.
  • Additional inducible expression systems include gene expression systems which respond to stress, metal ions, other metabolites and catabolites.
  • Other elements which may be useful in the invention will depend upon the type of bacterium to be used, the type of protein to be expressed and the type of target site in the animal. Such elements will be readily apparent to the skilled artisan once armed with the present disclosure.
  • This invention includes microorganisms which are capable of producing a pharmacologically active protein.
  • the pharmacologically active protein may be produced within the microorganism and be released upon lysis of the same: the protein may be excreted by the microorganism, or may be released by the microorganism upon sporulation, or upon germination of the spore to form a vegetative cell, or upon lysis.
  • microorganisms which are useful in the invention include, but are not limited to, yeast and bacteria.
  • yeast microorganisms suitable in the invention include, but are not limited to, Hansenula polymorpha, Kluiveromyces lactis, Kluivero yces marxianus subspecies lactis, Pichia pastoris, Saccharomyces cerevisiae and Schizosaccharo yces po be.
  • Bacterial microorganisms suitable for use in the invention include, but are not limited to, Bacillus subtilis and other suitable sporulating bacteria; members of the genus Bifidobacterium including but not limited to, Bifidobacterium adolescentis, Bifidobacterium angulatum, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium catenulatum, Bifidobacterium infantis, Bifidobacterium longum, and Bifidobacterium pseudocatenulatum; members of the genus Brevibacterium including but not limited to, Brevibacterium epidermis and Brevibacterium lactofermentum; members of the genus Enterobacter including but not limited to, Enterobacter aerogenes, Enterobacter cloacae; members of the genus Enterococcus including but not limited to Enterococcus faecalis; members of the
  • Lactobacillus acidophilus Lactobacillus amylovorus, Lactobacillus bulgaricus, Lactobacillus brevis, Lactobacillus casei, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus delbrueckii subspecies lactis, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus helveticus Lactobacillus hilgardii, Lactobacillus jensenii, Lactobacillus paracasei, Lactobacillus pentosus, Lactobacillus plantarum, Lactobacillus reuterii, Lactobacillus sake and Lactobacillus vaginalis; members of the genus Lactococcus including but not limited to, Lactococcus lactis, Lactococcus lactis
  • the microorganism of the invention is a bacterium. More preferably, the microorganism is an enteric microorganism or a member of the genus Bacillus, particularly B. subtilis and, even more preferably, the microorganism of the invention is either a member of the genus Lactobacillus or the organism is Bacillus subtilis encoding recombinant interleukin 1 receptor antagonist (IL-lra).
  • IL-lra interleukin 1 receptor antagonist
  • Examples of other microorganisms which are useful in the invention include Streptococcus pyogenes, Streptococcus mutans or Streptococcus gordonii, each being capable of colonizing the oral mucosa and expressing and releasing an anti-inflammatory protein capable of ameliorating inflammatory diseases of the gums and teeth.
  • spore-forming bacteria i.e., Clostridium and Bacillus
  • Clostridium and Bacillus spore-forming bacteria
  • Such bacteria when administered orally to an animal, should reach the intestinal mucosa in an intact, unchanged state. Upon germination, these bacteria then produce the desired active protein in the intestinal mucosa, which protein otherwise may not have survived the effects of the gastric acids.
  • Spore-forming bacteria may be additionally exploited for their ability to produce spores and thereby deliver proteins to target mucosal sites in the body.
  • vegetative state spore-forming bacteria encoding the desired protein are prepared in a formulation suitable for oral or rectal administration. Upon reaching the intestinal mucosa, such organisms are induced to sporulate wherein the vegetative cells lyse thereby releasing the expressed protein into the mucosa. In this manner, a well defined dose of the desired protein is released into the mucosa. Induction of sporulation by bacteria in the intestine or induction of germination of spores is accomplished by further manipulating the genes of these organisms which control such events.
  • spore-forming bacteria may be engineered such that they are induced to initiate the process of sporulation but are incapable of forming spores.
  • the cells containing the desired expressed protein lyse thereby releasing the protein; however, since spores are not in fact formed, no live bacteria remain in the host.
  • the therapeutic protein the gene of which is inserted into a suitable expression vector, must meet the following requisites in order to be effectively used: it must be non-toxic and non-pathogenic; it must be non-vaccinogenic, i.e. it should not induce a significant immune response which is protective for the host against the protein itself; it must be active in the expressed form or, at least, it must be converted into the active form once released by the microorganism.
  • proteins which may be administered according to the invention are mostly eukaryotic proteins, particularly those the expression of which in B. subtilis has been disclosed in Microbiol: Rev. 1993, 57:109. More particularly, genes encoding proteins which are useful in the invention as recombinant therapeutic proteins include, but are not limited to, the following genes.
  • interleukin family of genes including but not limited to IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14 and IL-15 and genes encoding receptor antagonists thereof.
  • Genes which encode hemopoietic growth factors including but not limited to, erythropoietin, granulocyte colony stimulating factor, granulocyte macrophage colony stimulating factor, macrophage colony stimulating factor, stem sell factor, leukaemia inhibitory factor and thrombopoietin are also contemplated in the invention.
  • Genes encoding neurotropic factors are also contemplated, including but not limited to, nerve growth factor, brain derived neurotropic factor and ciliary neurotropic factor.
  • genes which encode interferons including but not limited to IFN-alpha, IFN-beta and IFN-gamma are included.
  • genes encoding che okines such as the C-C family and the C-X-C family of cytokines, genes encoding hormones, such as proinsulin and growth hormone, and genes encoding thrombolytic enzymes, including tissue plasminogen activator, streptokinase, urokinase or other enzymes such as trypsin inhibitor.
  • the invention further includes genes which encode tissue repair factors, growth and regulatory factors such as, but not limited to, oncostatine M, platelet-derived growth factors, fibroblast growth factors, epidermal growth factor, hepatocyte growth factor, bone morphogenic proteins, insulin-like growth factors, calcitonin and transforming growth factor alpha and beta.
  • tissue repair factors such as, but not limited to, oncostatine M, platelet-derived growth factors, fibroblast growth factors, epidermal growth factor, hepatocyte growth factor, bone morphogenic proteins, insulin-like growth factors, calcitonin and transforming growth factor alpha and beta.
  • the gene to be used in the invention encodes an interleukin receptor antagonist, and most preferably, the gene encodes IL-1 receptor antagonist (IL-lra).
  • proteins which are active only in glycosylated form must be expressed in microorganisms such as yeast.
  • genes encoding eukariotic proteins active in non-glycosylated form as that they can be expressed in bacteria such as B. subtilis, E. coli or Lactobacillus species. It is also preferred the use of proteins which do not require an activation from a pro-form or post-expression processing.
  • Particularly preferred proteins which may be administered via engineered microorganisms according to the invention are IL-lra, interferons, IL-10, growth hormone, alpha 1-antitrypsin.
  • the gene to be used in the invention encodes an interleukin receptor antagonist, and most preferably, the gene encodes IL-1 receptor antagonist (IL-lra).
  • IL-lra IL-1 receptor antagonist
  • IL-lra does not have IL-1 biological activity; rather, IL-lra binds to IL-1 cell receptors without activating the cell, thereby functioning as an antagonist of IL-1 activity.
  • the preferred embodiment of the invention the use of IL-lra expressed in bacteria as a therapeutic treatment, should not be construed to be limited to wild type IL-lra protein.
  • the invention includes other forms of IL-lra having IL- Ira activity, which forms of IL-lra typically comprise mutations in the wild type protein.
  • Such mutations may confer enhanced IL-lra activity on the expressed protein or they may confer enhanced stability, enhanced mucosal absorption or other properties on the expressed protein which render it even more suitable as a therapeutic agent for use in the methods of the invention.
  • IL-lra as used herein is meant a protein having IL-lra activity, which protein includes the wild type protein and mutants thereof having Il-lra activity having characteristics substantially similar to wild type IL- Ira.
  • properties include, for example, the ability of the mutated protein to bind IL-1 receptor and to act as an antagonist of IL-1 biological activity.
  • Mutations of IL-lra which retain IL-lra activity include point mutations, deletions, insertions, frameshift mutations and other mutations which alter the primary sequence of the protein while preserving IL-lra activity.
  • the mutation in IL-lra comprises an amino acid subtitution at amino acid 91 (see Figure 4) wherein amino acid 91 is replaced by an amino acid selected from the group consisting of glutamine, arginine, lysine, histidine and tyrosine.
  • the mutation may also comprise an amino acid substitution at position 109 wherein the amino acid at position 109 is replaced by an amino acid selected front the group consisting of serine, alanine, phenylalanine, valine, leucine, isoleucine and methionine.
  • the protein may be mutated such that there is an amino acid substitution in the protein at both positions 91 and 109.
  • amino acid 91 is replaced by arginine and/or IL-lra amino acid 109 is replaced by alanine.
  • Other amino acid substitutions are also contemplated by the invention and include substitutions which comprise conservative amino acid sequence differences compared with the wild type protein at positions other than amino acids 91 and 109.
  • conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function.
  • Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine: valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.
  • the types of diseases in humans which are treatable by administration of the pharmaceutical compositions of the invention include, inflammatory bowel diseases including Crohn's disease and ulcerative colitis (treatable with IL-lra or IL-10); autoimmune diseases, including but not limited to psoriasis, rheumatoid arthritis, lupus erythematosus (treatable with IL-lra or IL-10); neurological disorders including, but not limited to Alzheimer's disease, Parkinson's disease and amyotrophic lateral sclerosis (treatable with brain devated neurotropic factor and ciliary neurotropic factor); cancer (treatable with IL-1, colony stimulating factors and interferon- t ); osteoporosis (treatable with transforming growth factor ⁇ ); diabetes (treatable with insulin); cardiovascular disease (treatable with tissue plas inogen activator); atherosclerosis (treatable with cytokines and cytokine antagonists); hemophilia (treatable with clotting factors);
  • the invention also contemplates treatment of diseases in other animals including dogs, horses, cats and birds.
  • Diseases in dogs include but are not limited to canine distemper (paramyxovirus) , canine hepatitis (adenovirus Cav-1), kennel cough or laryngotracheitis (adenovirus Cav-2), infectious canine enteritis (coronavirus) and haemorrhagic enteritis (parvovirus) .
  • Diseases in cats include but are not limited to viral rhinotracheitis (herpesvirus) , feline caliciviral disease (calicivirus) , feline infectious peritonitis (parvovirus) and feline leukaemia (feline leukaemia virus).
  • microorganisms expressing recombinant interferons are suspended in a pharmaceutical formulation for administration to the human or animal having the disease to be treated.
  • pharmaceutical formulations include live microorganisms and a medium suitable for administration.
  • the recombinant microorganisms may be lyophilized in the presence of common excipients such as lactose, other sugars, alkaline and/or alkali earth stearate, carbonate and/or sulfate (for example, magnesium stearate, sodium carbonate and sodium sulfate), kaolin, silica, flavorant ⁇ and aromas.
  • Microorganisms so lyophilized may be prepared in the form of capsules, tablets, granulates and powders, each of which may be administered by the oral route.
  • some recombinant bacteria, or even spores thereof may be prepared as aqueous suspensions in suitable media, or lyophilized bacteria or spores may be suspended in a suitable medium just prior to use, such medium including the excipients referred to herein and other excipients such as glucose, glycine and sodium saccharinate.
  • gastroresistant oral dosage forms may be formulated, which dosage forms may also include compounds providing controlled release of the microorganisms and thereby provide controlled release of the desired protein encoded therein.
  • the oral dosage form (including tablets, pellets, granulates, powders) may be coated with a thin layer of excipient (usually polymers, cellulosic derivatives and/or lipophilic materials) that resists dissolution or disruption in the stomach, but not in the intestine, thereby allowing transit through the stomach in favour of disintegration, dissolution and absorption in the intestine.
  • excipient usually polymers, cellulosic derivatives and/or lipophilic materials
  • the oral dosage form may be designed to allow slow release of the microorganism and of the recombinant protein thereof, for instance as controlled release, sustained release, prolonged release, sustained action tablets or capsules.
  • These dosage forms usually contain conventional and well known excipients, such as lipophilic, polymeric, cellulosic, insoluble, swellable excipients.
  • Controlled release formulations may also be used for any other delivery sites including intestinal, colon, bioadhesion or sublingual delivery (i.e., dental mucosal delivery) and bronchial delivery.
  • pharmaceutical formulations may include suppositories and creams.
  • the microorganisms are suspended in a mixture of common excipients also including lipids.
  • recombinant microorganisms encoding a desired gene may be administered to the animal or human via either an oral, rectal, vaginal or bronchial route. Dosages of microorganisms for administration will vary depending upon any number of factors including the type of bacteria and the gene encoded thereby, the type and severity of the disease to be treated and the route of administration to be used.
  • the dosage could be anyhow determined on a case by case way by measuring the serum level concentrations of the recombinant protein after administration of predetermined numbers of cells, using well known methods, such as those known as ELISA or Biacore (See examples).
  • the analysis of the kinetic profile and half life of the delivered recombinant protein provides sufficient information to allow the determination of an effective dosage range for the transformed microorganisms.
  • Bacillus subtilis encoding IL-lra may be administered to an animal at a dose of approximately 10 9 colony forming units (cfu)/kg body weight/day.
  • the recombinant gene is IL-lra and the bacterium is Bacillus subtilis.
  • IL-lra is a protein which is structurally similar to that of IL-1 which binds with high affinity to IL-1 receptor but which does not activate target cells (Dinarello et al,, 1991, Immunol. Today 11:404).
  • IL-lra therefore functions as an antagonist to the effects of IL-1 and has potential as a therapeutic agent useful for treatment of inflammatory and matrix-destruction diseases which are mediated through the action of IL-1.
  • diseases include rheumatoid arthritis, osteoporosis and septic shock.
  • Bacillus subtilis which has been manipulated to encode IL-lra is administered in vivo to an animal at various anatomical sites such as the peritoneal cavity, the small intestine or the large intestine.
  • Recombinant IL-lra, produced at the site of administration of the bacterium then functions in many cases, as a continuously produced therapeutic agent capable of counteracting the effects of IL-1 in that region of the animal.
  • Homologous refers to the subunit sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions, e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two compound sequences are homologous then the two sequences are 50% homologous, if 90% of the positions, e.g., 9 of 10, are matched or homologous, the two sequences share 90% homology.
  • the DNA sequences 3 ⁇ TTGCC5' and 3'TATGGC share 50% homology.
  • substantially homology refers to a nucleotide or amino acid sequence which is at least 50% homologous, preferably 60% homologous, more preferably 80% homologous and most preferably 90% homologous to a nucleotide or amino acid sequence described herein.
  • Example 1 Examples of systems for expression of heterologous genes in bacteria Bacillus subtilis. Constitutive expression of heterologous genes into Bacillus subtilis may be accomplished by cloning a cDNA encoding the protein to be expressed downstream of the bacteriophage T5 promoter region, comprising the sequence (Sequence Id N. 3): 5'TCTAGAAAAATTTATTTGCTTTCAGGAAAATTTTTTATGTATAATAGATT Xbal -35 -10
  • the T5 promoter is cloned into a suitable vector such as pSM214 (Velati Bellini et al., 1991, Biotechnol.
  • a suitable strain of B. subtilis is for example, SMS118.
  • the cDNA encoding the desired protein is cloned into the polylinker region shown above.
  • heterologous genes in B. subtilis is well known and is described, for example, in Sonenshein et al. (1993, Bacillus subtilis and Other Gram Positive Bacteria, American Society for Microbiology, Washington, D.C. ) .
  • Inducible expression of a heterologous gene in Bacillus subtilis is accomplished by cloning a cDNA encoding the desired protein downstream from a regulatory region comprising the T5 promoter region and the lac operator region.
  • Inducible expression of the desired protein is effected by IPTG-mediated inhibition of the Lad repressor gene expressed in an appropriate host strain (Schon et al. , 1994, Gene 147:91-94).
  • a minimal T5 promoter region may be used comprising approximately the following nucleotide (Sequence Id N. 4):
  • the lac operator region is cloned upstream and the heterologous gene is cloned downstream from this sequence.
  • the procedures to accomplish cloning are well known to those skilled in the art and are described, for example, in Sa brook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY). Procedures for induction of gene expression via the lac operator or other inducible expression systems are also well known in the art and are described in Sambrook (supra).
  • Escherichia coli constitutive expression of a heterologous protein in Escherichia coli may be accomplished in the same manner as described for Bacillus subtilis. Additional cloning vectors and expression systems are described in Sambrook (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
  • Inducible expression in Escherichia coli is accomplished using any number of procedures including that which is now described.
  • a cDNA encoding the desired heterologous protein is cloned downstream of the promoter region of gene 10 of the bacteriophage T7 (Studier et al., 1986, J. Mol. Biol. 189:113-130) "and the cDNA coding for the T7-specific RNA polymerase is cloned under the control of lac promoter in the bacterial host strain such as Escherichia coli BL21 (DE3)".
  • Inducible expression of the desired protein is effected by IPTG-mediated inhibition of the Lad repressor gene as described above.
  • the DNA sequence of the T7 promoter is as follows (Sequence Id N. 5) 5'TAATACGACTCACTATAGGGAGA. This region may be cloned into a suitable vector, such as the ones of the bluescript series (Stratagene, La Jolla, CA), expression vectors that use the T7 system (pRSET series Invitrogen Corporation, San Diego, CA or pET series Novagen Inc., Madison, WI) . Additional elements may be added to this sequence (and to that described above for expression of genes in Bacillus subtilis) which provide a ribosome binding site (RBS), and ATG translation start codon and a multiple cloning region as follows (Sequence Id N. 6): 5' GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAA
  • the Ndel site is the site of choice for cloning of a cDNA encoding a heterologous protein.
  • Lactococcus lactis Constitutive expression of heterologous genes cloned into Lactococcus lactis is accomplished using the p32 promoter which controls expression of Lactococcus lactis fructose- 1,6-diphosphate aldolase (Van de Guchte et al., 1990, Appl. Environ. Microbiol. 56:2606-2611). This region may be cloned into a suitable vector, for istance those derived essentially from pWVOl or from pSH71 (Kok et al., 1984, Appl. Environ. Microbiol. 48:726). Another suitable expression vector is pMG36e (Van de Guchte, supra .
  • sequences include a ribosome binding site and a translation start codon.
  • Inducible expression of heterologous genes in Lactococcus lactis is accomplished using the T7 gene 10 promoter as described above (Wells et al, 1993, Mol. Microbiol. 8:1155-1162).
  • Lactobacillus spp Constitutive expression of genes in Lactobacillus spp. is accomplished using the Lactobacillus casei L(+)-lactate dehydrogenase promoter (Pouwels et al., 1993, Genetics of lactobacilli: plasmids and gene expression, Antonie van Leeuwenhoek 64:85-107). This promoter has the following sequence (Sequence Id N. 7)
  • additional sequence elements may be added including a ribosome binding site and a translation start codon.
  • a cDNA encoding the desired heterologous gene is cloned downstream of this promoter region into a suitable vector, such as those disclosed in Pouwels et al., 1993, supra and in Posno et al. 1991, Appl. Environ. Microbiol. 57:1882.
  • Inducible expression of a heterologous gene in Lactobacillus spp. is accomplished using the alpha amylase promoter sequence of Lactobacillus amylovirus.
  • This promoter is induced in the presence of cellobiose and is repressed in the presence of glucose (Pouwels et al., 1993, Genetics of lactobacilli; plasmids and gene expression, Antonie van Leeuwenhoek 64:85-107).
  • the nucleotide sequence of the alpha amylase gene is as follows (Sequence Id N. 8) 5'GCAAAAAAATTTTCGATTTTTATGAAAACGGTTGCAAAGAAGTTAGCAAAAA glucose operator/-35
  • This sequence is cloned into a suitable vector, and as described above, additional elements may be added including a translation start codon.
  • D xylose isomerase promoter region of Lactobacillus pentosus. This promoter is induced in the presence of xylose (Pouwels et al., 1993, Genetics of lactobacilli: plasmids and gene expression, Antonie van Leeuwenhoek 64:85-107).
  • the nucleotide sequence of the D-xylose isomerase promoter region is as follows (Sequence Id N. 9) 5 'AGAAAGCGTTTACAAAAATAAGCCAATGCCGCTGTAATCTTAC 3' -35 -10
  • additional elements may also be added to this sequence including a ribosome binding site and a translation start codon.
  • recombinant protein expressed by colonizing bacteria can be obtained by providing locally the appropriate inducer, for example by giving cellobiose orally for the a y-driven expression system.
  • Example 2 Mutant and wild type forms of IL-lra having Il-lra activity
  • IL-lra Cloning and expression of human recombinant IL-lra in Escherichia coli was performed as follows.
  • a cDNA encoding IL-lra was obtained by performing RT-PCR on a cDNA pool of RNAs expressed in monocyte/macrophage cells using standard methods (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY).
  • the primers used for amplification were as follows (Sequence Id N. 10 and 11) IL-lra forward - 5' GATCATATGCGACCCTCTGGGAGAAAATCC 3'
  • the forward primer was designed to create an Ndel site having an ATG translation start codon, the Ndel site being immediately upstream from the first amino acid of the mature IL-lra protein (Arginine, R26).
  • the reverse primer was designed such that it contains a PstI site downstream from the translation stop codon in the IL-lra cDNA. The amplified fragment was cloned into the
  • a portion of the coding region of the IL-lra gene (that encoding amino acids 30-152) is excised from the plasmid pRSETA-IL-lra and is recloned into the mutagenesis Bluescript plasmid SK + beetween the PstI sites thereby generating the plasmid BSK-IL-lra.
  • Mutagenesis of the gene is effected using synthetic oligonucleotides obtained using an Applied Byosystems 392 oligonucleotide synthesizer and phosphoramidite chemistry.
  • the synthetic oligonucleotide was mixed with single stranded plasmid BSK-IL-lra DNA in a standard hybridization buffer (containing 5 pmol of oligonucleotide and 0,2 pmol of single stranded DNA in 10 ml of buffer).
  • a standard hybridization buffer containing 5 pmol of oligonucleotide and 0,2 pmol of single stranded DNA in 10 ml of buffer.
  • the mixture was heated to 70"C, it was cooled slowly to 30"C for 40 minutes and was placed on ice.
  • One Ml of standard synthesis buffer, 1 Ml (3 units) of T4 DNA ligase and 1 Ml (0,5 units) of T7 DNA polymerase were added to the mixture.
  • a different codon may be used to generate a mutated IL-lra having different amino acid substitutions at either or both of positions 91 or 109 using the procedures and oligonucleotides described above by inserting the desired codon at the appropriate position.
  • Each of the mutated sequences is then cloned into an expression vector, for example, the sequences may be cloned back into the vector pRSETA-IL-lra between sites Spel and PstI generating a variety of expression plasmids comprising mutated IL-lra.
  • the plasmid comprises a mutation in amino acid position 91 of IL-lra cloned into the vector RSETA-IL-lra.
  • This plasmid (T7MILRA-1) encodes an arginine residue at position 91 and expresses mutated IL-lra having biological activity of IL-lra (see below).
  • plasmid pT7MILRA-2 encodes mutated IL-lra comprising the amino acid substitution Ala in the place of Thr in position 109 and gives rise to plasmid BSK-MILRA-2
  • plasmid pT7MILRA- 3 encodes mutated IL-lra comprising both amino acid substitutions Arg in the place of Asn in position 91 and Ala in the place of Thr in position 109 and gives rise to plasmid BSK-MILRA-3.
  • Example 3 Generation of Bacillus subtilis capable of producing large amounts of recombinant protein
  • the examples given herein relate to the genus Bacillus, the invention should be construed to encompass other sporulating bacteria, such as those in the genus Clostridium.
  • Sporulation of Bacillus is induced by placing the bacteria in medium suitable for sporulation (Jongman et al., 1983, Proc. Natl. Acad. Sci. USA 80:2305). Both vegetative growth and sporulation may be obtained in the same medium, i.e., potato extract medium, provided the cell concentration is high (Johnson et al., 1981, J. Bacteriol. 146:972) During sporulation, the bacterial vegetative cells lyse; thus, following sporulation, expressed proteins are released from the lysed cells and recovered in the supernatant.
  • the forward primer was designed to create an EcoRI site just 5' to the initial ATG codon upstream of the first codon of the mature protein (R26).
  • the reverse oligonucleotide was designed to introduce a PstI site downstream of the translation stop codon of the protein.
  • the amplified fragment was cloned into the EcoRI PstI sites in the vector pSM214 thereby generating pSM441 ( Figure 2).
  • This plasmid was used to transform Bacillus subtilis strain SMS 18 (leu ⁇ , pyrDL, npr " , apr-) using standard techniques.
  • the transformed culture was maintained at -80"C in glycerol until use.
  • mutated IL-lra proteins in Bacillus subtilis is performed by cloning the Spel-PstI restriction fragments of BSK-MILRA-1, BSK-MILRA-2 or BSK-MILRA-3 in pSM441 between the same sites.
  • the forward primer which is used contains the forward primer sequence provided above, in addition to the sequence encoding the protein subtilis in which is essential for the secretion of the protein from cells.
  • the nucleotide sequence of this forward primer is as follows (Sequence Id N. 16) 5*GGGAATTCTTATGAGAAGCAAAAAATTGTGGATCAGCTTGTTGTTTGCGTTAA CGTTAATCTTTACGATGGCATTCAGCAACATGAGACGCGTCCGGCGACCCTCTGGG AGAAAATCC 3 '
  • the reverse primer in this reaction is as described above.
  • An amplified fragment comprising these sequences is cloned into the corresponding EcoRI and PstI sites in the expression vector pSM241 to generate the plasmid pSM441sec. Transformation of Bacillus subtilis with this plasmid is as described above for the plasmid pSM441.
  • IL-lra To generate IL-lra, two aliquots of 100 ml of Luria broth (LB) medium containing 5 mg/1 of chloramphenicol were inoculated with a 1:200 dilution (in LB) of primary inoculum derived from the glycerol stock. The cultures were incubated for 7 hours at 37*C with shaking. Bacteria were harvested by centrifugation at 3000 x g for 20 minutes at 4 * C. The cells were washed once in 50 mM Morpholinoethansulfonic acid (MES)-NaOH solution, pH 6.25 containing 1 mM EDTA (Buffer A).
  • MES Morpholinoethansulfonic acid
  • Buffer A Buffer A
  • cells were either stored at 80*C until preparation of lysates, or they were processed immediately for sporulation.
  • To prepare lysates the cells were thawed and were resuspended in 10 ml of Buffer A and were then disrupted using an XL2020 sonicator (Heat System, Farming dale, NY) at an output power of 80W for 14 cycles of 30 seconds of sonication and 30 seconds in ice water.
  • the cell lysate was centrifuged at 30,000 x g for 30 minutes at 4'C and the supernatant was recovered while avoiding the layer of lipid at the top of the centrifuge tube.
  • the lysate was stored at -80'C until use.
  • Sc This supernatant was termed "Sc”.
  • Difco sporulation medium without chlora phenicol 3 g/1 Bacto beef extract, 5 g/1 Peptone, 0.25 mM NaOH, 10 M MgS0 4 , 0.1% KC1, 0.1 mM MnCl 2 , 1 mM Ca(N0 3 ) 2 and 1 mM FeS0 4 at pH 6.8).
  • Cells were incubated for approximately 12 hours at 35"C with shaking. Spores which had formed were harvested by centrifugation at 3,000 x g for 20 minutes at 4 * C. The supernatant was stored at -80 ⁇ C until use. This supernatant was termed "Ss”.
  • Non-adsorbed material was collected and incubated as described above in the presence of 1 ml of S-Sepharose Fast Flow cationic exchanger (Pharmacia) which had been equilibrated in Buffer A. After washing in Buffer A, the S-Sepharose was batch eluited using 2 ml of Buffer A containing 0.5 M NaCl. The eluited material was concentrated to a volume of 0.25 ml using a Centricon 10 centrifugal concentrator (Amicon).
  • Proteins which were obtained as described above were analyzed by electrophoresis through 13.5% mini SDS-PAGE and were visualized by staining using standard technology. The protein bands were further analyzed by laser scanning using a Molecular Dynamics Personal Densitometer and a densitometric image was obtained using Image Quant software (Molecular Dynamics). The results of this analysis are summarized in Figure 3 and in Table 1. It is apparent from these results that IL- Ira was expressed in these cells.
  • Specific activity is expressed in inhibitory units (IU)/mg IL-lra.
  • Specific activity of an IL-lra standard preparation (human recombinant IL-lra from Escherichia coli) is 0.9 x 10 6 IU/mb. n.t. Not tested.
  • Bio-Rad protein standard I was used as the standard when assessing the amount of protein in the starting material.
  • a purified standard of recombinant IL-lra was used as a standard to assess the amount of IL-lra in the purified fractions.
  • the concentration of IL-lra was determined by measuring the absorption at 280 nm (A 2QQ ) °f tne protein in a 6 M guanidinium hydrochloride solution in 20 mM phosphate buffer, pH 6.5.
  • the A 2 g 0 °- 1% of IL-lra calculated using PC/GENE software (Intelligenetics) was 0.910.
  • the biological activity of IL-lra was measured in a murine thymocyte proliferation assay. Thymocytes plated at a concentration of 6 X 10 ⁇ cells per well of a 96 well plate were obtained from 5 to 7 week old C3H/HeJ mice (The Jackson Laboratories).
  • the thymocytes were cultured in RPMI-1640 (Gibco) and 5% heat-inactivated fetal bovine serum (Hyclone), 25 mM betamercaptoethanol, 50 mg/ml gentamicin (Sigma) and 1.5 mg/ l PHA (Wellcome).
  • a fixed concentration of recombinant human IL-1 beta (1 unit 30 pg/ml) either alone or in the presence of differing amounts of standard IL-lra or IL- lra containing fractions (at concentrations of 10 pg/ml to 100 ng/ml) was added to triplicate wells.
  • IL-lra is calculated as the amount which inhibits 50% of IL-1 induced proliferation.
  • Table 1 suggests that there are no significant differences between the activity of IL-lra in preparations of lysates or preparations of sporulating bacteria of the invention.
  • Example 4 Expression of IL-lra in Bacillus subtilis in vivo
  • the nucleotide and corresponding amino acid sequence of human IL-lra is given in Figure 4.
  • Bacillus subtilis encoding IL-lra was administered intraperitoneally to mice.
  • peritoneal samples were obtained by lavage of the peritoneum and in addition, serum samples were obtained.
  • Western blot analysis was performed on each sample using a rabbit anti-recombinant human IL-lra antibody.
  • Bacillus subtilis was propagated in LB medium in the presence of 5 mg/1 of chloramphenicol at 37*C overnight with continuous stirring. The bacteria were collected by centrifugation and the cells were resuspended in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • IL-lra is detectable in the mice, in particular, by 3 hours post administration.
  • Anti-IL-lra antibody was prepared in rabbits which were inoculated with recombinant IL-lra using standard procedures (Harlow et al., 1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, NY).
  • 10 ng of IL-lra was added to a sample of IL-lra- negative serum.
  • Table 2 reflect the relative amount of IL-lra which were detected in each sample using this method. It is evident that IL-lra may be detected in the mice, in particularly, by 3 hours post administration, following administration of bacteria expressing the same. 1 ⁇ E -----2 Identification of IL-lra BY Western blot analysys after in vivo administration of engineered Bacillus subtilis.
  • mice Male Sprague-Dawley rats weighing about 200-250 g were fasted for 24 to 48 hours. The rats were anaesthetized with phenobarbital (45 mg/kg administered intramuscularly) or with ether. The abdomen was opened along the linea alba to permit access to the gastrointestinal tract. The end portion of the colon and/or the end portion of the ileum (0.5-1 cm above the ileocaecal valve) were identified and isolated using a ligature.
  • X LB 0.25 X LB
  • 3 to 6 X 10 8 bacteria propagated as described herein
  • An occlusion was formed by surgical ligature immediately below to point of entry of the needle so as to prevent bacteria from entering the peritoneal cavity.
  • mice having a body weight of approximately 25 g were administered a single dose of Bacillus subtilis intraperitoneally as described.
  • the mice each received 3 X 10 ⁇ bacteria in 0.2 ml PBS.
  • Control mice included those which received wild type Bacillus subtilis and mice which received PBS alone.
  • All of the animals were administered 15-20 mg/kg of LPS by intraperitoneal injection.
  • Each test group comprised 10-20 animals.
  • the number of deaths in each group of mice was recorded until 5 to 7 days following administration of LPS when no further deaths occurred within a 48 hour period.
  • strains of Bacillus subtilis which were used in the experiments described below were as follows: Strain SMS118 containing the plasmid pSM539, encodes human IL- lra which is expressed intracellularly; strain SMS118 containing the plasmid pSM261, encodes human mature IL-1 beta which is expressed intracellularly; strain SMS118 containing the plasmid pSM214 deriving from pSM671 encodes beta-lactamase which is expressed in secreted form: each of these strains has the genotype leu-, pyrDL, npr ⁇ , apr " pSM261 and pSM214 are disclosed in Velati Bellini et al. 1991, J. Biotechnol. 18:177.
  • PSM539 is disclosed in IT-A-MI94001916. Bacteria were propagated and lysates were prepared therefrom as described herein.
  • mice having a body weight of 1.9 to 2.3 kg were maintained in standard cages at 22 ⁇ 1 * C under a 12 hour light 12 hour dark cycle.
  • the rabbits received 100 g of a standard diet daily and water ad libitum.
  • the rabbits were fasted for a period of 16 to 18 hour treatment.
  • the rabbits were than placed in standard stock restraints and were acclimated for 1 hour prior to treatment.
  • a rounded tip urethral catheter (Rush, Germany) was gently inserted into the distal colon via the anus. Approximately 10 cm of the catheter was inserted.
  • a suspension of Bacillus subtilis in 2 ml of PBS was administered through the catheter while the rabbits remained conscious.
  • rabbits were gently restrained in conventional stocks throughout the experiment and in each cave, prior to experimentation, were acclimated to the stocks for about 2 hours.
  • the body temperature of the animals was measured by means of a cutaneous thermistor probe (TM-54/S and TMN/S; L.S.I. Italy) which was positioned between the left posterior foot and the abdomen and was allowed to stabilize for 2 minutes.
  • a suspension of Bacillus subtilis (containing plasmids pSM214 or pSM539 at 2 X 10 9 cells per rabbit) was instilled in the distal colon 1 hour before intravenous administration of highly purified LPS-free recombinant human IL-1 beta in pyrogen-free saline through the marginal ear vein.
  • the temperature of the animals was recorded every 20 minutes for 3 hours beginning at the time of administration of IL-1 beta.
  • concentration of iron in the rabbits was assessed in samples obtained at 2, 4, 6, 8 and 24 hours following intravenous inoculation of 1 microgram/kg of recombinant human IL-1 beta.
  • the iron assay was a colorimetric assay using a commercially available kit (Fe; Boehringer Mannheim, Mannheim, Germany). Normal iron levels prior to administration of IL-1 beta was 134.7 ⁇ 6.6 micrograms/dl mean ⁇ of 25 animals). Hypoferremia (a 60-75% decrease in the level of iron in the plasma) was evident at about 4 to about 24 hours following IL-1 beta administration.
  • Bacillus subtilis strains containing pSM214 or pSM539 at a concentration of 2 X 10 9 cells per rabbit were instilled into the distal colon twice, once at 3 hours prior to administration of IL-1 beta and once at 10 minutes after IL-1 beta administration.
  • IL-lra To detect IL-lra in rabbit serum, serum was obtained from the animals through the marginal ear vein at 0, 1, 2, 4 and 8 hours following administration of Bacillus subtilis. Quantitative determination of IL-lra was accomplished in a specific ELISA (Amersham International, Amersham, UK) following the manufacturer's instructions. In this assay, the lower detection limit is 20 pg/ml. Purified IL-lra was used as a standard. IL-lra in serum was also measured using a Biosensor BIAcoreTM system (Pharmacia Biosensor AB, Uppsala, Sweden) which allows real time biospecific interaction analysis by means of the optical phenomenon of surface plasmon resonance (Lofas et al., 1990, J. Chem.
  • the carboxylated matrix of the sensor chip was first activated with 45 ⁇ l of a 1:1 mixture of N-hydroxysuccinimide and N-ethyl-N'-(3 diethylamino- propyl-) carbodiimide. Then 70 ⁇ l of antibody solution (150 ⁇ g/ml in 10 ml sodium acetate at pH 4.5) was injected. The free amino groups were blocked with 40 ⁇ l of 1 M ethanolamine hydrochloride. Samples containing IL-lra were introduced in a continuous flow passing over the surface of the sensor chip, allowing interaction with the immobilized antibodies. Interaction was detected in terms of resonance angles and was expressed in resonance units (RU).
  • RU resonance units
  • IL-lra concentration For evaluation of serum IL-lra concentration, a standard curve of IL-lra in HBS was constructed (from 0.1 ng/ml to 1 ⁇ g.ml at a flow rate of 3 ⁇ l/minute). Rabbit serum samples were filtered on Centricon Plus (Amicon, Beverly, MA) before analysis. The concentration of IL-lra in serum samples was calculated by comparing the sample RU to the standard curve using a Prefit program.
  • Example 8 Expression of IL-lra in Escherichia coli administered to mice To express IL-lra in this Escherichia coli, the Escherichia coli transformed with the plasmid, pT7MILRA- 3, were grown in LB containing 100 mg/1 ampicillin until an optical density of 0.4 to 0.7 at 600 nm was reached.
  • mice Female C3H/HeJ mice having a body weight of approximately 20-25 g were administered a single subcutaneous dose of Escherichia coli comprising the plasmid pT7MILRA-3.
  • the number of bacteria administered ranged from 5 x 10 7 to 1.5 x 10 10 cells/dose; the time of administration of Escherichia coli to the mice varied from 1 to 3 hours prior to administration of IL-l ⁇ to the mice. In all cases, the results obtained, i.e., the efficacies of the IL-lra in the mice were comparable.
  • mice were administered 4 ⁇ g/kg of recombinant human IL-l ⁇ intraperitoneally. Two hours post-administration of IL-l ⁇ , the mice were sacrificed and samples of serum were obtained. The level of glucose in the serum was assessed by reaction with glucose- oxidase using a commercially available kit (Glucose GOD Perid: Boehringer Mannheim). The results are presented in Figure 10. The extent of hypoglycemia induced by intraperitoneal IL-l ⁇ is shown (filled column). Hypoglycemia was markedly reduced in mice pretreated with IL-lra expressing Escherichia coli (hatched column).
  • mice were subcutaneously administered Escherichia coli strain BL21 (D3) containing the plasmid pRSET-A (i.e., a plasmid which does not encode IL-lra) prior to administration of IL-l ⁇ .
  • D3 Escherichia coli strain BL21
  • IL-l ⁇ induce hypoglycemia in these mice was unaffected by administration of Escherichia coli containing pRSET-A establishing that it is the expression of IL-lra in Escherichia coli which accounts for the observed reduction in hypoglycemia in the animals.
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Lactobacillus amylovorus
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Lactobacillus pentosus

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP95935431A 1994-10-05 1995-10-04 Microorganisms as therapeutic delivery systems Withdrawn EP0784689A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
ITMI942025 1994-10-05
ITMI942025A IT1270123B (it) 1994-10-05 1994-10-05 Composizioni farmaceutiche contenenti microorganismi ingegnerizzati e loro uso per terapia
PCT/EP1995/003921 WO1996011277A1 (en) 1994-10-05 1995-10-04 Microorganisms as therapeutic delivery systems

Publications (1)

Publication Number Publication Date
EP0784689A1 true EP0784689A1 (en) 1997-07-23

Family

ID=11369649

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95935431A Withdrawn EP0784689A1 (en) 1994-10-05 1995-10-04 Microorganisms as therapeutic delivery systems

Country Status (6)

Country Link
EP (1) EP0784689A1 (it)
JP (1) JPH10506791A (it)
AU (1) AU3745395A (it)
CA (1) CA2201721A1 (it)
IT (1) IT1270123B (it)
WO (1) WO1996011277A1 (it)

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6190657B1 (en) 1995-06-07 2001-02-20 Yale University Vectors for the diagnosis and treatment of solid tumors including melanoma
GB9521568D0 (en) * 1995-10-20 1995-12-20 Lynxvale Ltd Delivery of biologically active polypeptides
US6080849A (en) * 1997-09-10 2000-06-27 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
AU749695B2 (en) 1997-09-10 2002-07-04 Vion Pharmaceuticals, Inc. Genetically modified tumor-targeted bacteria with reduced virulence
DE69914932T2 (de) * 1998-10-20 2004-12-09 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw. Verwendung eines zytokine-produzierenden lactococcus stammes zur behandlung von kolitis
FR2791998B1 (fr) * 1999-04-07 2001-06-08 Agronomique Inst Nat Rech Lactocoques modifies exprimant une catalase et leurs utilisations
DK1739178T3 (da) * 1999-07-05 2010-11-22 Actogenix Nv Levering af trekløverpeptider
US6962696B1 (en) 1999-10-04 2005-11-08 Vion Pharmaceuticals Inc. Compositions and methods for tumor-targeted delivery of effector molecules
ATE381351T1 (de) * 2000-07-27 2008-01-15 Univ Pennsylvania Anwendung des herpes simplex virus glykoproteins- d zur unterdrückung von immunantworten
CA2342040C (en) 2000-09-21 2012-07-10 Kyowa Hakko Kogyo Co., Ltd. Anaerobic bacterium as a drug for cancer gene therapy
US7780961B2 (en) 2001-05-03 2010-08-24 Actogenix N.V. Self-containing Lactococcus strain
WO2003063786A2 (en) * 2002-01-31 2003-08-07 Symbigene, Inc. Methods and composition for delivering nucleic acids and/or proteins to the respiratory system
WO2004007695A2 (en) * 2002-03-08 2004-01-22 Osel, Inc. Lactobacilli expressing biologically active polypeptides and uses thereof
EP1513545B1 (en) * 2002-06-19 2008-03-19 Actogenix N.V. Methods and means to promote gut absorption
EP1590443A4 (en) * 2003-01-29 2009-01-07 Osel Inc SURFACE EXPRESSION OF BIOLOGICALLY ACTIVE PROTEINS IN BACTERIA
EP1786445B1 (en) 2004-08-25 2011-06-08 The Government of the United States of America as represented by The Secretary of the Department of Health and Human Services Live microbial microbicides
CA2579882C (en) 2004-09-10 2012-07-17 Asahi Glass Company, Limited Edible vaccine
US7456011B2 (en) 2005-01-12 2008-11-25 Osel, Inc. Modified cyanovirin-n polypeptide
EP1957100B1 (en) 2005-11-29 2016-07-13 Intrexon Actobiotics NV Induction of mucosal tolerance to antigens
BRPI0711119A2 (pt) * 2006-05-02 2011-08-30 Actogenix Nv administração microbiana de peptìdeos intestinais associados à obesidade
AU2008204442B2 (en) 2007-01-12 2013-03-14 Intrexon Actobiotics Nv Lactococcus promoters and uses thereof
EP2125010B1 (en) 2007-01-25 2014-06-04 Actogenix N.V. Treatment of immune disease by mucosal delivery of antigens using genetically modified lactobacillus
JP2012504116A (ja) 2008-09-29 2012-02-16 アクトジェニックス・エヌブイ 粘膜での微生物のコロニー形成の低減
DK2424972T3 (da) 2009-04-30 2013-10-14 Actogenix Nv Kryobeskyttende midler til frysetørring af mælkesyrebakterier
EP3192873A1 (en) 2009-09-29 2017-07-19 Intrexon Actobiotics NV Lactobacillus and streptococcus promoters and uses thereof
EP2451467B1 (en) * 2010-01-14 2016-12-21 INSERM - Institut National de la Santé et de la Recherche Médicale Recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (ibd) and irritable bowel syndrome (ibs)
US9597379B1 (en) 2010-02-09 2017-03-21 David Gordon Bermudes Protease inhibitor combination with therapeutic proteins including antibodies
FR2960001A1 (fr) * 2010-05-12 2011-11-18 Univ Rennes Vecteur recombinant pour la production et la secretion de sequences d'acides amines d'interet par les bacteries propioniques et ses applications
US9476056B2 (en) 2010-05-12 2016-10-25 Universite De Rennes 1 Recombinant vector for producing and secreting peptide or protein of interest by propionibacteria and applications thereof
AU2011268146A1 (en) 2010-06-17 2013-01-10 Actogenix Nv Compositions and methods for treating inflammatory conditions
CN101921725B (zh) * 2010-07-27 2013-06-05 浙江大学 一种口服免疫阻断鸡生长抑素作用的转化子及其应用
ES2676707T3 (es) 2011-09-23 2018-07-24 Intrexon Actobiotics Nv Bacterias gram positivas modificadas y usos de las mismas
HUE038336T2 (hu) 2011-09-23 2018-10-29 Intrexon Actobiotics Nv Módosított gram-pozitív baktériumok és alkalmazásaik
AU2013299605A1 (en) 2012-08-07 2015-03-26 TopGeniX, Inc. Topical composition comprising transformed bacteria expressing a compound of interest
US10064797B2 (en) 2014-06-17 2018-09-04 TopGeniX, Inc. Topical formulations for UV protection
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
HRP20240085T1 (hr) 2019-03-04 2024-03-29 Aurealis Therapeutics AG Prokariotski ekspresijski sustav indukciran kloridom

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1321962C (en) * 1985-03-20 1993-09-07 Aizo Matsushiro Dental caries preventive preparations and method for preparing said preparations

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9611277A1 *

Also Published As

Publication number Publication date
ITMI942025A1 (it) 1996-04-05
JPH10506791A (ja) 1998-07-07
AU3745395A (en) 1996-05-02
IT1270123B (it) 1997-04-28
WO1996011277A1 (en) 1996-04-18
CA2201721A1 (en) 1996-04-18
ITMI942025A0 (it) 1994-10-05

Similar Documents

Publication Publication Date Title
EP0784689A1 (en) Microorganisms as therapeutic delivery systems
EP1739178B1 (en) Delivery of trefoil peptides
JP4308916B2 (ja) 異種タンパク質の発現
US5591827A (en) Interleukin-6 receptor antagonists
EP3124614B1 (en) Lactococcus promoters and uses thereof
KR920010225B1 (ko) 인간암괴사인자 및 그를 코우드하는 dna의 제법
EP2344626B1 (en) Reduced colonization of microbes at the mucosa
JP2003000287A (ja) コレラトキシンの免疫原性無毒化変異体およびトキシンｌｔの免疫原性無毒化変異体、それらの調製、ならびにワクチンの調製のためのそれらの使用
JP2005287333A5 (it)
US20120183503A1 (en) Lactobacillus and streptococcus promoters and uses thereof
AU704594B2 (en) Production of recombinant peptides as natural hydrophobic peptide analogues
JPH04502260A (ja) Ｎ―アセチルムラミダーゼ　ｍ１
US6444202B1 (en) Processed polypeptides with IL-16 activity, processes for their production and their use
JP3288373B2 (ja) 安定および生体活性改変ソマトトロピン類
AU2003249855A1 (en) Cell wall mutants for delivery of biologically active compounds
AU2002357406B2 (en) Defective entities and uses therefor
EP1468076A1 (en) Defective entities and uses therefor
WO1999020652A1 (fr) Facteur stimulant les colonies de granulocytes de felins
JPH02169522A (ja) インターロイキン１ポリペプチドを有効成分とする抗潰瘍剤

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970319

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000503