WO2024085637A1 - 혈장 유래 단백질을 포함하는 노화 방지용 조성물 - Google Patents

혈장 유래 단백질을 포함하는 노화 방지용 조성물 Download PDF

Info

Publication number
WO2024085637A1
WO2024085637A1 PCT/KR2023/016116 KR2023016116W WO2024085637A1 WO 2024085637 A1 WO2024085637 A1 WO 2024085637A1 KR 2023016116 W KR2023016116 W KR 2023016116W WO 2024085637 A1 WO2024085637 A1 WO 2024085637A1
Authority
WO
WIPO (PCT)
Prior art keywords
aging
map1s
gclc
eno1
kng1
Prior art date
Application number
PCT/KR2023/016116
Other languages
English (en)
French (fr)
Inventor
김종필
김준엽
황예림
Original Assignee
동국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020230061859A external-priority patent/KR20240054856A/ko
Application filed by 동국대학교 산학협력단 filed Critical 동국대학교 산학협력단
Publication of WO2024085637A1 publication Critical patent/WO2024085637A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/16—Blood plasma; Blood serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to an anti-aging composition
  • an anti-aging composition comprising GCLC, ENO1, Map1s, KNG1 and various combinations thereof derived from plasma treated with Oct4, Sox2, Klf4 and c-Myc, and its use.
  • differentiated somatic cells can be reprogrammed into pluripotent stem cells (induced pluripotent stem cells, iPSCs) through overexpression of the four Yamanaka factors Oct4, Sox2, Klf4 and c-Myc (OSKM).
  • iPSCs induced pluripotent stem cells
  • OSKM Yamanaka factors Oct4, Sox2, Klf4 and c-Myc
  • Partial cell dedifferentiation refers to partially expressing OSKM in vivo for a short period of time to partially dedifferentiate and reprogram aged cells and tissues in vivo, without completely dedifferentiating them, thereby allowing them to grow in specific areas. It can specifically treat aging-related diseases.
  • the present inventors demonstrated that specific proteins derived from plasma treated with OSKM directly in vivo and their combinations improve aging-related phenotypes in vitro and in vivo, and prevent degenerative brain diseases and stroke caused by aging.
  • the present invention was completed by confirming that aging-related diseases can be prevented, improved, or treated by improving the symptoms of liver failure.
  • One object of the present invention is to provide a pharmaceutical composition for preventing or treating aging-related diseases, which contains as an active ingredient a composition containing two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or polynucleotides encoding the proteins. It is done.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating aging-related diseases, which contains as an active ingredient a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1.
  • Another object of the present invention is to provide an anti-aging method comprising administering the pharmaceutical composition of the present invention to an entity other than a human.
  • Another object of the present invention is to provide a composition comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or a polynucleotide encoding the proteins; or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1;
  • a composition for inhibiting cellular aging comprising any one selected from the group consisting of:
  • a combination of two or more selected from GCLC, ENO1, Map1s, and KNG1 derived from plasma treated with Oct4, Sox2, Klf4, and c-Myc (OSKM) of the present invention improves aging-related phenotypes in vitro and in vivo, and reduces aging. It improves diseases induced by aging of vascular endothelial cells, diseases induced by organ aging, diseases induced by nerve aging, and degenerative brain diseases, and can prevent, improve or treat age-related diseases.
  • Figure 1 shows the results of LC/MS to analyze proteins in plasma (OSKM-treated plasma) derived from 4F2A mice in which OSKM was induced.
  • (a) is a schematic diagram showing the process of screening for proteins specifically induced in OSKM-treated plasma.
  • (b-c) is data analyzing LC/MS analysis and protein expression patterns of OSKM-treated plasma.
  • (d) is a list of proteins specifically induced in OSKM-treated plasma.
  • Figure 2 shows the results of analysis of aging-related indicators in cells treated with OSKM-treated plasma or cells that induced the expression of GCLC, MAP1S, ENO1, and KNG1 derived from OSKM-treated plasma.
  • (a) shows the results of analyzing the expression levels of aging-related histone markers H3K9me3 and H4k20me3 after treating cells with OSKM-treated plasma, and (b) shows quantified data.
  • (c) shows the results of analyzing the expression levels of H3K9me3 and H4k20me3 after inducing the expression of GCLC, MAP1S, ENO1, and KNG1 derived from plasma derived from OSKM treatment in cells, and (d) shows quantified data.
  • Figure 3 shows the results of quantifying the level of senescent cell reduction through senescence markers including beta galactosidase after overexpressing GCLC, MAP1S, ENO1, or KNG1 alone and various combinations thereof in wild-type mouse tail tip fibroblasts.
  • senescence markers including beta galactosidase after overexpressing GCLC, MAP1S, ENO1, or KNG1 alone and various combinations thereof in wild-type mouse tail tip fibroblasts.
  • combinations of two or more of the various combinations not only reduced aging markers but also induced changes in aging-related epigenetic markers.
  • H3K9me3 epigenetic marker
  • Figure 4 shows the results of analysis of aging-related indicators in premature aging model mice caused by administration of OSKM-treated plasma or GCLC, MAP1S, ENO1, and KNG1 derived from OSKM-treated plasma.
  • (d-e) are data analyzed through H&E, VVG, MT, and ORO staining for symptoms of stiffness and fibrosis in the aorta 4 weeks after injection of OSKM-treated plasma into early aging model mice.
  • (f-g) shows data analyzed through H&E staining for aging symptoms in the liver, spleen, kidney, and skin 4 weeks after injection of OSKM-treated plasma into early aging model mice.
  • Figure 5 shows an open field test performed after injecting OSKM-treated plasma into 6-month-old (young), 18-month-old (mid-aged), and 24-month-old (old) wild-type C57BL/6 mice with naturally induced aging. It's data.
  • (b) shows data analyzing the expression levels of aging-related genes through qRT-PCR after injection of OSKM-treated plasma into 6-month-old (young) and 24-month-old (old) mice in which aging was naturally induced.
  • Figure 6 shows H&E staining of aging symptoms in the liver, spleen, and kidney after injection of a composition containing GCLC, MAP1S, ENO1, and KNG1 into 24-month-old wild-type C57BL/6 mice in which aging was induced naturally. This is data analyzed through .
  • (b) is data analyzing stiffness and fibrosis symptoms in the aorta through H&E staining 4 weeks after injection of a composition containing GCLC, MAP1S, ENO1, and KNG1 in 24-month-old (old) wild-type C57BL/6 mice, and (c) ) This was quantified.
  • Figure 7 shows Alzheimer's disease-specific amyloid-beta (A ⁇ ) plaques in brain tissue 2 weeks after injecting a composition containing OSKM-treated plasma-derived GCLC, MAP1S, ENO1, and KNG1 into 12-month-old Alzheimer's model mice (a) and data analyzing the level of A ⁇ 42/40 ratio (b).
  • a ⁇ Alzheimer's disease-specific amyloid-beta
  • Figure 8 shows the dopaminergic neuron-specific genes Map2(a) and synapsin ( Synapsin (b), DAT (c), and TH (d) mRNA expression levels were analyzed through qRT-PCR.
  • Figure 9 shows the infarct volume (a) and neurological deficit score of brain tissue 2 weeks after injecting a composition containing OSKM-treated plasma-derived GCLC, MAP1S, ENO1, and KNG1 into stroke model mice. It is (b).
  • Figure 10 shows the levels of alanine transaminase (ATL), aspartate transaminase (AST), and albumin (ALB) in plasma 2 weeks after injecting a composition containing GCLC, MAP1S, ENO1, and KNG1 derived from OSKM-treated plasma into liver failure model mice. This is the data analyzed.
  • ATL alanine transaminase
  • AST aspartate transaminase
  • ARB albumin
  • One aspect of the present invention provides a pharmaceutical composition for preventing or treating aging-related diseases, which contains as an active ingredient a composition containing two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or polynucleotides encoding the proteins. do.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating aging-related diseases, which contains as an active ingredient a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1.
  • Two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 of the present invention are a combination of 2, 3 or 4 of the above proteins, specifically, the two combinations are GCLC and ENO1 (GE); GCLC and KNG1 (GK); GCLC and MAP1S(GM); ENO1 and MAP1S(EM); MAP1S and KNG1(MK); or ENO1 and MAP1S (EK), and the three combinations are GCLC, ENO1 and MAP1S (GEM); GCLC, ENO1, and KNG1 (GEK); GCLC, MAP1S and KNG1 (GMK); or ENO1, MAP1S and KNG1 (EMK), and the four combinations are GCLC, MAP1S, ENO1 and KNG1 (GEMK).
  • one embodiment of the present invention is a combination of two of the above proteins, namely GCLC and ENO1(GE); GCLC and KNG1 (GK); GCLC and MAP1S(GM); ENO1 and MAP1S(EM); MAP1S and KNG1(MK); and a combination selected from ENO1 and MAP1S (EK), or a polynucleotide encoding the above protein.
  • Another embodiment of the present invention is a combination of three of the above proteins, namely GCLC, ENO1 and MAP1S (GEM); GCLC, ENO1 and KNG1 (GEK); GCLC, MAP1S and KNG1 (GMK); and a combination selected from ENO1, MAP1S, and KNG1 (EMK), or a polynucleotide encoding the above protein.
  • GEM GCLC, ENO1 and MAP1S
  • GEK ENO1 and KNG1
  • GMK MAP1S and KNG1
  • EK ENO1, MAP1S, and KNG1
  • Another embodiment of the present invention is a pharmaceutical for the prevention or treatment of age-related diseases comprising a combination of four of the above proteins, that is, a combination of GCLC, MAP1S, ENO1 and KNG1 (GEMK), or a polynucleotide encoding the above proteins.
  • a composition is provided.
  • Glutamate-Cysteine Ligase Catalytic Subunit refers to a subunit of glutamate-cysteine ligase (GCL), which includes glutathione (GSH) It is a rate-limiting enzyme that determines the overall speed of the synthetic pathway.
  • the GCLC protein may have, include, or consist of the amino acid sequence shown in SEQ ID NO: 1, or may consist essentially of the amino acid sequence.
  • the GCLC protein may be composed of a polypeptide described in the amino acid sequence of GenBank Protein ID, 183039. UniProtKB ID, P48506 or SEQ ID NO: 1.
  • the GCLC protein can be obtained from a known database, such as the U.S. National Institutes of Health GenBank.
  • the amino acid sequence of the GCLC protein can refer to information in GenBank Protein ID, 183039. UniProtKB ID, P48506.
  • the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein containing the amino acid sequence of GenBank Protein ID, 183039.
  • UniProtKB ID, P48506 or SEQ ID NO. 1 some of the sequences may be deleted, modified, substituted, It is obvious that proteins with conservatively substituted or added amino acid sequences are also included within the scope of the present invention.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing to all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with a polynucleotide containing a common codon or a codon taking codon degeneracy into account.
  • Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA” program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the polynucleotide encoding the GCLC protein may be the Gclc gene.
  • the polynucleotide encoding the GCLC protein of the present invention may include a base sequence encoding the amino acid sequence shown in the above-mentioned GenBank Protein ID: 183039. UniProtKB ID: P48506 or SEQ ID NO: 1.
  • the polynucleotide encoding the GCLC protein of the present invention may have or include the sequence identified from Gene ID: 2729 or the sequence of SEQ ID NO: 2.
  • the polynucleotide encoding the GCLC protein of the present invention may consist of or consist essentially of the sequence of SEQ ID NO: 2.
  • the GCLC protein may be encoded by the polynucleotide shown in the base sequence of SEQ ID NO: 2.
  • the polynucleotide encoding the Gclc gene of the present invention is within the range of not changing the amino acid sequence of the GCLC protein, taking into account codon degeneracy or the preferred codon in organisms intended to express the Gclc gene of the present invention.
  • Various modifications may be made to the coding region.
  • the polynucleotide encoding the GCLC protein of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, at least 96% homology or identity with the sequence of SEQ ID NO: 2.
  • microtubule-associated protein S1 refers to a protein that has DNA binding ability and mediates the aggregation of mitochondria that leads to cell death and genome destruction (MAGD), and is a protein that mediates microtubule organization. It is known to play a role in anchoring the center to the centromere.
  • the MAP1S protein can be obtained from a known database, such as the National Institutes of Health GenBank.
  • the sequence of the MAP1S protein can refer to the sequence information of GenBank: AAH80547.1, UniProt ID Q66K74.
  • the MAP1S protein may have, include, consist of, or consist essentially of the amino acid sequence shown in SEQ ID NO: 3.
  • the MAP1S protein may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 3.
  • the amino acid sequence of the MAP1S protein is at least 70%, 75%, 80%, 85%, 90%, 95%, It may include an amino acid sequence having more than 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity.
  • the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 3, the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.
  • the polynucleotide encoding the MAP1S protein may be the Map1s gene.
  • the polynucleotide encoding the MAP1S protein of the present invention may include a base sequence encoding the amino acid sequence described in GenBank: AAH80547.1, UniProt ID Q66K74, or SEQ ID NO: 3.
  • the polynucleotide encoding the MAP1S protein of the present invention may have or include the sequence identified from GeneID: 55201 or the sequence of SEQ ID NO: 4.
  • the polynucleotide encoding the MAP1S protein of the present invention may consist of or essentially consist of the sequence of SEQ ID NO: 4.
  • the MAP1S protein may be encoded by the polynucleotide shown in the base sequence of SEQ ID NO: 4.
  • the polynucleotide encoding the Map1s gene of the present invention is added to the coding region within the range of not changing the amino acid sequence of the MAP1S protein, taking into account the codon degeneracy or the preferred codon in the organism in which the Map1s gene of the present invention is to be expressed.
  • the polynucleotide encoding the MAP1S protein of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, at least 96% homology or identity with the sequence of SEQ ID NO: 4.
  • Enolase 1 refers to an enzyme that has the activity of converting 2-phosphoglycerate to phosphoenolpyruvate, -Also called enolase (alpha-Enolase, ⁇ -Enolase).
  • ENO1 protein can be obtained from a known database, the National Institutes of Health GenBank, etc.
  • sequence information of the ENO1 protein may refer to NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733, etc.
  • it may have, include, consist of, or consist essentially of the amino acid sequence shown in SEQ ID NO: 5.
  • the ENO1 protein may be composed of a polypeptide shown in the amino acid sequence of SEQ ID NO: 5.
  • the amino acid sequence of the ENO1 protein is at least 70%, 75%, 80%, 85%, 90%, 95% identical to the amino acid sequence described in NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733 or SEQ ID NO: 5. %, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more.
  • the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 5
  • the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.
  • the polynucleotide encoding the ENO1 protein may be the Eno1 gene.
  • the polynucleotide encoding the ENO1 protein of the present invention may include a base sequence encoding the amino acid sequence shown in the above-mentioned NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733, or SEQ ID NO: 5.
  • the polynucleotide encoding the ENO1 protein of the present invention may have or include the sequence identified from Gene ID: 2023 or the sequence of SEQ ID NO: 6.
  • the polynucleotide encoding the ENO1 protein of the present invention may consist of or consist essentially of the sequence of SEQ ID NO: 6.
  • the ENO1 protein may be encoded by the polynucleotide shown in the base sequence of SEQ ID NO: 6.
  • the polynucleotide encoding the Eno1 gene of the present invention is added to the coding region within the range of not changing the amino acid sequence of the ENO1 protein, taking into account codon degeneracy or the preferred codon in organisms intended to express the Eno1 gene of the present invention.
  • the polynucleotide encoding the ENO1 protein of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, and at least 96% homology or identity with the sequence of SEQ ID NO: 6.
  • KNG1 Kninogen 1
  • KNG1 Kninogen 1
  • the high molecular weight kininogen is known to be an essential element in blood coagulation and the composition of the kallikrein-kinin system.
  • KNG1 protein can be obtained from a known database, NIH GenBank, etc.
  • sequence information of the KNG1 protein may refer to the sequence information of UniProt ID: P01042.
  • the KNG1 protein may have, include, consist of, or consist essentially of the amino acid sequence shown in SEQ ID NO: 7.
  • the KNG1 protein may be composed of a polypeptide described in the amino acid sequence of SEQ ID NO: 7.
  • the amino acid sequence of the KNG1 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% of the amino acid sequence set forth in UniProt ID: P01042 or SEQ ID NO: 7. , may include an amino acid sequence having more than 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity.
  • the amino acid sequence has such homology or identity and shows efficacy corresponding to the protein containing the amino acid sequence of SEQ ID NO: 7, the protein has an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present invention.
  • the polynucleotide encoding the KNG1 protein may be the Kng1 gene.
  • the polynucleotide encoding the KNG1 protein of the present invention may include a base sequence encoding the amino acid sequence shown in UniProt ID: P01042 or SEQ ID NO: 7.
  • the polynucleotide encoding the KNG1 protein of the present invention may have or include the sequence identified from Gene ID: 3827 or the sequence of SEQ ID NO: 8.
  • the polynucleotide encoding the KNG1 protein of the present invention may consist of or essentially consist of the sequence of SEQ ID NO: 8.
  • the KNG1 protein may be encoded by the polynucleotide shown in the base sequence of SEQ ID NO: 8.
  • the polynucleotide encoding the Kng1 gene of the present invention is added to the coding region within the range of not changing the amino acid sequence of the Kng1 protein, taking into account codon degeneracy or the preferred codon in organisms intended to express the Kng1 gene of the present invention.
  • the polynucleotide encoding the KNG1 protein of the present invention has at least 70%, at least 75%, at least 76%, at least 85%, at least 90%, at least 95%, at least 96% homology or identity with the sequence of SEQ ID NO: 8.
  • composition that increases the expression of a protein may include a vector containing a polynucleotide encoding the protein, or an enhancer that increases the expression of the protein.
  • the composition for increasing the expression of two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 of the present invention includes a polynucleotide encoding the GCLC protein, a polynucleotide encoding the MAP1S protein, and a polynucleotide encoding the ENO1 protein. and a vector containing two or more polynucleotides selected from the group consisting of polynucleotides encoding KNG1 protein.
  • the vector may be a separate vector containing each gene, or one vector may contain any two or more of the above polynucleotides.
  • vector refers to the transfer of a desired DNA fragment to a host cell. DNA that can be introduced and proliferated is also called a cloning vehicle. “Expression vector” refers to a recombinant DNA molecule containing a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the operably linked coding sequence in a specific host organism. In the present invention, the vector may be used in the same sense as an expression vector.
  • the vector used in the present invention is not particularly limited as long as it can replicate within the host cell, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used.
  • pBluescriptII series pGEM series, pTZ series, pCL series, and pET series
  • viral vectors adeno-associated virus (AAV) vectors, adenovirus vectors, herpes virus vectors, retrovirus vectors, lentivirus vectors, and vaccinia vectors
  • AAV adeno-associated virus
  • adenovirus vectors adenovirus vectors
  • herpes virus vectors retrovirus vectors
  • lentivirus vectors lentivirus vectors
  • vaccinia vectors vaccinia vectors
  • Niavirus vectors, poxvirus vectors, herpes simplex virus vectors, etc. can be used.
  • Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • the term “transformation” refers to introducing a recombinant vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoding the polynucleotide can be expressed within the host cell.
  • the transformed polynucleotide can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art depending on the host cell.
  • electroporation calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Examples include, but are not limited to, the lithium acetate-DMSO method.
  • operably linked means that the polynucleotide sequence is functionally connected to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present invention. do. Operable linkages can be prepared using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art, but are not limited thereto.
  • a composition comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 of the present invention or a polynucleotide encoding the proteins; or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1; a composition that increases the endogenous expression and/or activity of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1, such as wild-type GCLC, MAP1S, ENO1, and It can be increased compared to the endogenous expression and/or activity of two or more proteins selected from KNG1.
  • aging is a concept that generally encompasses the phenomenon of deteriorating changes that occur as the structure and function of the body deteriorates with age. Changes due to aging include the weight and weight of each tissue due to a decrease in the number of parenchymal cells. Loss of body weight, change in connective tissue, change in body composition, decrease in elasticity of blood vessels and skin, decrease in the function of each organ, decrease in anti-disease recovery ability including immune ability, decrease in sensory function, memory, cognitive function, learning ability, etc. There are many reasons, including a decrease in comparative ability.
  • “Ageing inhibition” of the present invention refers to any act of suppressing or preventing or improving or delaying the above-described aging symptoms by administering the composition of the present invention, and specifically, the above-described aging-related parameters, such as symptoms of It refers to all actions that at least reduce the degree, and includes actions in which aging symptoms are improved, alleviated, or beneficially changed by administration of the composition of the present invention. Additionally, the above term may be used interchangeably with “anti-aging.” The “inhibition of aging” may also be expressed as “treating aging” and also includes treatment and/or improvement of diseases related to aging.
  • aging-related disease may include a disease that induces premature aging or a disease induced by aging.
  • diseases that induce premature aging include, for example, Hutchinson Guilford progeria syndrome (HGPS), premature aging associated with HIV infection, muscle dystrophy, and Charcot-Marie-Tooth disease.
  • HGPS Hutchinson Guilford progeria syndrome
  • -Tooth disease Werner syndrome, insulin resistance type II diabetes, osteoporosis, skin aging and restrictive dermopathy, etc., but are not limited to these, and include pathological features of premature aging.
  • Any disease can be included.
  • the disease that induces premature aging may be Hutchinson-Gilford Progeria Syndrome, but is not limited thereto.
  • the diseases induced by aging include, for example, arteriosclerosis, liver failure, stroke, degenerative brain disease, Alzheimer's disease, Parkinson's disease, hypertension, cognitive dysfunction, sarcopenia, dry eye, macular degeneration, hyperopia, Myopia, cataracts, tinnitus, hearing loss, indigestion, diarrhea, autoimmune disease, pneumonia, influenza, tetanus, infectious endocarditis, pneumonia, influenza, tetanus, infectious endocarditis, cancer, overactive bladder, urinary incontinence, prostatic hyperplasia, lower urinary tract symptoms, glomeruli.
  • This may include, but is not limited to, nephritis, chronic renal failure, stroke, osteoporosis, arthritis, diabetes, renal failure, chronic obstructive pulmonary disease, and pulmonary fibrosis, and includes any disease that includes pathological characteristics caused by aging.
  • the diseases induced by aging may include diseases induced by vascular endothelial cell aging, diseases induced by organ aging, diseases induced by nerve aging, and degenerative brain diseases. More specifically, arteriosclerosis, It may be one or more selected from liver failure, stroke, Alzheimer's disease, and Parkinson's disease, but is not limited thereto.
  • prevention refers to any action that suppresses or delays the onset of an age-related disease by administering the composition
  • treatment refers to improving symptoms caused by an age-related disease or improving symptoms by administering the composition. It refers to all actions that are beneficially changed.
  • the term "improvement” refers to any action that improves or benefits the symptoms of an individual suspected of or suffering from an age-related disease using the composition.
  • the pharmaceutical composition of the present invention may further include appropriate carriers, excipients, or diluents commonly used in the preparation of pharmaceutical compositions.
  • the content of the active ingredient included in the pharmaceutical composition is not particularly limited, but may include 0.0001% by weight to 10% by weight, specifically 0.001% by weight to 1% by weight, based on the total weight of the composition.
  • the pharmaceutical composition may be any selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. It may have one dosage form, or may be of several oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc.
  • Solid preparations contain one or more compounds and at least one excipient, such as starch, calcium carbonate, sucrose, or lactose ( It is prepared by mixing lactose, gelatin, etc.
  • excipients such as starch, calcium carbonate, sucrose, or lactose
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurel, glycerogelatin, etc. can be used.
  • the pharmaceutical composition of the present invention may further include other substances that prevent or treat age-related diseases.
  • the pharmaceutical composition of the present invention may further include OSKM, a vector expressing OSKM, or OSKM-processed plasma.
  • the pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.
  • the term "pharmaceutically effective amount” refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the individual, age, gender, and severity of the disease. It can be determined based on factors including the type, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be administered single or multiple times.
  • the preferred dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but for desirable effects, the pharmaceutical composition of the present invention is administered at 0.0001 to 500 mg/day. It may be better to administer in kg, specifically 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered several times.
  • the pharmaceutical composition can be administered to various mammals such as rats, livestock, and humans by various routes, and the method of administration includes without limitation any method conventional in the art, for example, orally, rectally, or intravenously. It may be administered by intramuscular, subcutaneous, intrauterine, intrathecal, or intracerebrovascular injection.
  • composition of the present invention can be used not only in the form of a medicine for humans, but also in the form of an animal medicine.
  • animals are a concept that includes livestock and companion animals.
  • a composition comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 of the present invention or a polynucleotide encoding the proteins; Or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1; may have a cell aging inhibition effect.
  • the cellular aging inhibition effect according to the present invention may be achieved by the intrinsic expression and/or activity of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1 following treatment with the composition provided by the present invention.
  • the aging-related gene of i) may be any one or more selected from the group consisting of a stress response gene, an extracellular matrix (ECM) remodeling gene, a Senescence-Associated Secretory Phenotype (SASP) gene, and an aging-related gene.
  • ECM extracellular matrix
  • SASP Senescence-Associated Secretory Phenotype
  • stress response genes examples include Ccl8, p16, p21, Btg2, and Atf, but are not limited thereto.
  • the ECM remodeling genes may be, for example, MMP12, MMP13, and IL-6, but are not limited thereto.
  • the SASP gene may be, for example, Cdkn2a, Cdkn1a, and IL-a, but is not limited thereto.
  • the aging-related genes Ccl8, IL-6, Cdkn2a, Btg2, Atf3, MMP12, MMP13, p16 and p21 in aged fibroblasts.
  • the expression level of was significantly increased, but was recovered by introduction of the dCas9-activator vector (Figure 2e).
  • the dCas9-activator vector can efficiently improve aging-related molecular phenotypes by activating endogenous Oct4 activation in aging fibroblasts.
  • LMNA laminA/C
  • H3K9me3 and H4K20me3 histone markers H3K9me3 and H4K20me3
  • OSKM-treated plasma induced the expression of GCLC, MAP1S, ENO1, and KNG1
  • vectors expressing GCLC, MAP1S, ENO1 or KNG1 alone and various combinations thereof [GCLC+ENO1(GE), GCLC+ KNG1(GK), GCLC+MAP1S(GM), ENO1+MAP1S(EM), MAP1S+KNG1(MK), ENO1+MAP1S(EK), GCLC+ENO1+MAP1S(GEM), GCLC+ENO1+KNG1(GEK) , GCLC+MAP1S+KNG1(GMK), ENO1+MAP1S+KNG1(EMK), GCLC+MAP1S+ENO1+KNG1(GEMK) vector] were each transfected into wild-type mouse tail tip fibroblasts, and 3 days later, aging-related beta The number of galactosidase-positive cells was measured.
  • beta-galactosidase-positive cells were reduced when GCLC, MAP1S, ENO1 or KNG1 was treated alone, but the effect of reducing beta-galactosidase-positive cells was better when treated with a combination of 2 or 3 of them, and GCLC When treated with +MAP1S+ENO1+KNG1 (GEMK), the effect of reducing beta-galactosidase-positive cells was the best, and it was confirmed that the reduction was reduced to a level similar to that of control wild-type mouse fibroblasts (Figure 3).
  • aging-related markers were improved in cells when expressing a combination containing two or more of the GCLC, MAP1S, ENO1, and KNG1 proteins rather than the GCLC, MAP1S, ENO1, or KNG1 proteins alone, and when containing all three or all four proteins. Aging-related indicators were significantly improved, confirming that a combination of proteins containing two or more of GCLC, MAP1S, ENO1, and KNG1 had a significant anti-aging effect.
  • a composition comprising the GCLC, MAP1S, ENO1 and KNG1 proteins of the present invention.
  • a composition that increases the expression of GCLC, MAP1S, ENO1, and KNG1 proteins may have the effect of improving aging-related diseases.
  • OSKM-treated plasma containing GCLC, MAP1S, ENO1, and KNG1 was administered to 6-month-old (young), 18-month-old (mid-aged), and 24-month-old (old) mice with naturally induced aging.
  • locomotor activity increased in mice after injection compared to the control group ( Figure 5a).
  • aging symptoms in the liver, spleen, kidney, and skin are analyzed through H&E staining 4 weeks after injection of OSKM-treated plasma containing GCLC, MAP1S, ENO1, and KNG1 in premature aging model mice.
  • OSKM-treated plasma containing GCLC, MAP1S, ENO1, and KNG1 in premature aging model mice.
  • symptoms of organ and skin aging were improved in mice after injection compared to the control group (5-month-old mice) ( Figure 4f-g).
  • cardiomyocytes (Cardiac Myofibroblasts) were formed in cardiac aortic tissue.
  • ⁇ -SMA immunofluorescence staining it was confirmed that the number of ⁇ -SMA positive cells increased in mice after injection compared to the control group, and the number of cardiomyocytes increased ( Figure 6d-e).
  • the aging-related disease may include a disease that induces premature aging or a disease induced by aging.
  • the disease that induces premature aging is as described above, and may specifically be Hutchinson-Gilford Progeria Syndrome, but is not limited thereto.
  • the diseases induced by aging are as described above. Specifically, the diseases induced by aging include diseases induced by vascular endothelial cell aging, diseases induced by organ aging, and diseases induced by nerve aging. , degenerative brain disease, etc., and more specifically, arteriosclerosis, liver failure, stroke, Alzheimer's disease, and Parkinson's disease, but is not limited thereto.
  • a composition comprising two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1 of the present invention or a polynucleotide encoding the same; Or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1; may have the effect of improving diseases induced by vascular endothelial cell aging.
  • the disease induced by the aging of vascular endothelial cells may specifically be arteriosclerosis, but is not limited thereto.
  • the improvement in arteriosclerosis may be achieved by reducing stiffness of the aorta and/or reducing fibrosis of the aorta.
  • symptoms of stiffness and fibrosis in the aorta were analyzed through H&E, VVG, MT, and ORO staining 4 weeks after injection of OSKM-treated plasma containing GCLC, MAP1S, ENO1, and KNG1 in premature aging model mice.
  • OSKM-treated plasma containing GCLC, MAP1S, ENO1, and KNG1 in premature aging model mice.
  • aortic stiffness and fibrosis symptoms were improved in mice after injection compared to the control group ( Figure 4d-e).
  • stiffness and fibrosis symptoms in the aorta were analyzed through H&E staining 4 weeks after injection of a composition containing GCLC, MAP1S, ENO1, and KNG1 into 24-month-old wild-type C57BL/6 mice in which aging was induced naturally.
  • aortic stiffness and fibrosis symptoms were improved in mice compared to the control group (6-month-old mice) ( Figure 6b-c).
  • a composition comprising the GCLC, MAP1S, ENO1 and KNG1 proteins of the invention.
  • a composition that increases the expression of GCLC, MAP1S, ENO1, and KNG1 proteins may have the effect of improving diseases induced by organ aging.
  • the disease induced by aging of the above organs may specifically be liver failure, but is not limited thereto.
  • AST aspartate transaminase
  • mice after injection showed ATL (alanine) compared to the control group.
  • transaminase) AST (aspartate transaminase) levels decreased
  • plasma ALB albumin
  • a composition comprising the GCLC, MAP1S, ENO1 and KNG1 proteins of the invention.
  • a composition that increases the expression of GCLC, MAP1S, ENO1, and KNG1 proteins may have the effect of improving diseases induced by nerve aging.
  • the disease induced by the aging of the nerves may specifically be stroke, but is not limited thereto.
  • the improvement in stroke may be achieved by reducing infarct volume and/or reducing neurological deficit score.
  • a composition comprising the GCLC, MAP1S, ENO1 and KNG1 proteins of the invention; Or a composition that increases the expression of GCLC, MAP1S, ENO1, and KNG1 proteins may have the effect of improving degenerative brain diseases.
  • the degenerative brain disease may specifically be Alzheimer's disease or Parkinson's disease, but is not limited thereto.
  • Alzheimer's disease or Parkinson's disease is achieved by reducing the level of amyloid-beta (A ⁇ ) plaques and A ⁇ 42/40 ratio or the expression level of dopaminergic neuron-specific genes Map2, Synapsin, DAT, and TH. This may be achieved through a reduction effect.
  • a ⁇ amyloid-beta
  • Alzheimer's disease-specific amyloid-beta (A ⁇ ) was detected in brain tissue two weeks later. )
  • a ⁇ plaques and A ⁇ 42/40 ratio were reduced in mice after injection compared to the control group, showing that administration of a composition containing GCLC, MAP1S, ENO1, and KNG1 improved Alzheimer's disease symptoms. This was confirmed ( Figure 7).
  • Map2 a dopaminergic neuron-specific gene
  • Map2 a dopaminergic neuron-specific gene
  • Another aspect of the present invention provides an anti-aging method comprising administering the pharmaceutical composition of the present invention to a subject.
  • the method of the present invention may be a method of preventing or treating diseases that induce premature aging or diseases induced by aging.
  • compositions comprising the GCLC, MAP1S, ENO1 and KNG1 proteins of the invention; Or a composition that increases the expression of GCLC, MAP1S, ENO1 and KNG1 proteins; has an anti-aging effect and/or an effect of improving diseases that induce premature aging or diseases induced by aging, and a pharmaceutical composition containing the same. It can be used for the purpose of preventing or improving aging, preventing, improving or treating diseases that induce premature aging or diseases induced by aging.
  • the disease that induces premature aging may be, but is not limited to, Hutchinson-Gilford Progeria Syndrome. This is the same as described above.
  • the diseases induced by aging may include diseases induced by vascular endothelial cell aging, diseases induced by organ aging, diseases induced by nerve aging, degenerative brain diseases, etc., and more specifically, arteriosclerosis, liver failure, and stroke. , Alzheimer's disease, and Parkinson's disease, but are not limited thereto. This is the same as described above.
  • the term “individual” may mean any animal, including humans.
  • the animal may be not only a human, but also a mammal such as a cow, horse, sheep, pig, goat, camel, antelope, dog, or cat that requires treatment for similar symptoms. It may also refer to animals other than humans, but is not limited thereto.
  • the term "administration” means introducing the pharmaceutical composition of the present invention into a subject suspected of having an age-related disease by any appropriate method, and the route of administration is various oral or parenteral routes as long as it can reach the target tissue. It can be administered through.
  • composition of the present invention can be administered in a pharmaceutically effective amount, as described above.
  • the pharmaceutical composition of the present invention is not particularly limited and can be applied to any entity as long as it is intended to prevent or treat aging-related diseases.
  • non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds and fish can be used, and the pharmaceutical composition can be administered parenterally, subcutaneously, etc. It can be administered intraperitoneally, intrapulmonaryly and intranasally, and for topical treatment, if necessary, by any suitable method, including intralesional administration.
  • the preferred dosage of the pharmaceutical composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. For example, it may be administered orally, rectally, or by intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection, but is not limited thereto.
  • the pharmaceutical composition of the present invention may further include other substances that prevent or treat age-related diseases.
  • the pharmaceutical composition of the present invention may further include OSKM, a vector expressing OSKM, or OSKM-processed plasma.
  • composition provided by the present invention contains Fgf17, Gpld1, GDF11, superoxide dismutase (SOD), Catalase (CAT), Glutathione (GSH), Glutathione peroxidase (GPx), and oxidized glutathione (GSSG).
  • Glutathione S-transferase Glutathione S-transferase (GST), Ascorbic acid (vitamin C), ⁇ -tocopherol (vitamin E), Folic acid (vitamin B), Polyphenols, carotenoids, Flavonoids, Phenolic Acids, Ferulic acid, Tannin, Catechinic acid, Rosmarinic acid, Apiolin, Hesperetin, Agathisflavone, Monodehydroascorbate reductase (MDHAR), Dehydroscorbate reductase (DHAR), Ascorbate peroxidase (APx), Glutathione reductase (GR), Albumins, Lactoferrin, Metallothioneins, Polyamines, Vitamin K, Ubiquinone, Zinc, Selenium, copper (Cu ), iron (Fe) and manganese (Mn), selenium (Se)Allium, Allyl sulfides, Coenzyme Q10
  • compositions comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or a polynucleotide encoding the proteins; or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1;
  • a health functional food composition for preventing or improving aging-related diseases comprising any one selected from the group consisting of:
  • composition of the present invention may be used to prevent or improve diseases that induce premature aging or diseases induced by aging.
  • the composition provided by the present invention has an anti-aging effect and/or an effect of improving diseases that induce premature aging or diseases induced by aging, and the pharmaceutical composition containing the same is effective in preventing or improving aging.
  • the pharmaceutical composition containing the same is effective in preventing or improving aging.
  • It can be used for the purpose of preventing or improving diseases that induce premature aging or diseases induced by aging.
  • the disease that induces premature aging may be, but is not limited to, Hutchinson-Gilford Progeria Syndrome. This is the same as described above.
  • the diseases induced by aging may include diseases induced by vascular endothelial cell aging, diseases induced by organ aging, diseases induced by nerve aging, degenerative brain diseases, etc., and more specifically, arteriosclerosis, liver failure, and stroke. , Alzheimer's disease, and Parkinson's disease, but are not limited thereto. This is the same as described above.
  • the health functional food of the present invention can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and components commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a food.
  • the health functional food composition of the present invention can be manufactured in various formulations, and unlike general drugs, it is made from food and has the advantage of not having any side effects that may occur when taking the drug for a long period of time. It is also highly portable and can be used on a daily basis. It is very useful because it can be ingested, and it can be ingested as a supplement to inhibit, prevent, improve or delay aging.
  • the health functional food is an essential ingredient and there are no particular restrictions on other ingredients other than the CRISPR/dCas9 complex. Like ordinary health functional foods, it may contain various herbal extracts, food supplements, or natural carbohydrates as additional ingredients.
  • the food auxiliary additives include food auxiliary additives common in the art, such as flavoring agents, flavors, colorants, fillers, stabilizers, etc.
  • natural carbohydrates examples include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents e.g., rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the health functional food composition of the present invention contains various nutrients, vitamins, water (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid, and salts thereof. , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated drinks, and other natural fruit juices, fruit juice drinks and vegetables. May contain pulp for the manufacture of beverages. These ingredients can be used independently or in combination.
  • health functional foods include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, gum, ice cream, soup, beverages, tea, functional water, drinks, alcoholic beverages, and vitamin complexes. It can be.
  • the above-mentioned health functional food may additionally contain food additives, and its suitability as a “food additive” is determined in accordance with the general provisions of the Food Additives Code and General Test Methods approved by the Food and Drug Safety Administration, unless otherwise specified. Judgment is made according to specifications and standards.
  • the content of the composition added to food can be appropriately adjusted as needed.
  • compositions comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or a polynucleotide encoding the proteins; or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1;
  • an injectable composition for preventing or treating aging-related diseases comprising any one selected from the group consisting of:
  • composition of the present invention may further include any suitable excipients commonly used in injectable compositions, such as preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents, or isotonic agents, etc. It is not limited to this.
  • compositions comprising two or more proteins selected from GCLC, MAP1S, ENO1 and KNG1 or a polynucleotide encoding the proteins; or a composition that increases the expression of two or more proteins selected from GCLC, MAP1S, ENO1, and KNG1;
  • a composition for inhibiting cellular aging comprising any one selected from the group consisting of:
  • the inhibition of cellular aging may be ex vivo, in vivo, or in vitro.
  • the composition may inhibit cellular aging ex vivo, in vivo, or in vitro.
  • the composition may inhibit cellular aging ex vivo or in vitro, but is not limited thereto.
  • 4F2A mice were fed drinking water containing doxycycline for 4 weeks to induce Oct4, Sox2, Klf4, and c-Myc (OSKM) gene expression in vivo. Afterwards, blood was separated from 4F2A mice in which OSKM was induced, centrifuged at 3000 rpm for 30 minutes, and plasma (OSKM-treated plasma) was separated.
  • OSKM Oct4, Sox2, Klf4, and c-Myc
  • mice overexpressing Progerin As a mouse model for premature aging, mice overexpressing Progerin (Progerin mouse, Jackson laboratory) were used.
  • the Alzheimer's mouse model used 5xFAD (Jackson laboratory) mice that overexpressed five amyloid-beta (A ⁇ )-related mutant genes (three APP-related genes and two PSEN1-related genes).
  • a stroke mouse model was created by inducing middle cerebral artery occlusion (MCAO) using nylon thread.
  • MCAO middle cerebral artery occlusion
  • the Parkinson's disease mouse model was created by injecting 20 mg/kg of MPTP (1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine) into the mouse abdominal cavity.
  • a liver failure mouse model was created by administering a 1:3 (v/v) mixture of CCl4 (dimethylnitrosamine, thioacetamide):olive oil into the mouse abdominal cavity twice a week at a concentration of 1 ⁇ L/g.
  • Wild-type C57BL/6 male mice were obtained from the Korea Research Institute of Bioscience and Biotechnology.
  • mice had free access to food and water, and were maintained under 12-hour/12-hour light/dark cycle conditions at 23 ⁇ 1°C.
  • Mice were anesthetized with tribromoethanol (Avertin, 120 mg/kg) and OSKM-treated plasma diluted in 0.9% saline (containing 0.9% w/v sodium chloride);
  • vectors expressing GCLC, MAP1S, ENO1, and KNG1, constructed in polycistronic form were injected into the tail vein.
  • the lentivirus pelleted through ultracentrifugation was resuspended in 20ul of PBS, and then 5ul of the virus was mixed with 300ul of the suspension and injected into the mouse tail vein.
  • the titer of 5 ul of virus used here refers to the number of virus particles after monitoring GFP expression using FUW-GFP as a control and calculating the multiplicity of infection before the virus titer (infection unit mL -1 ) is determined.
  • the vector expressing GCLC, MAP1S, ENO1, and KNG1 expressed GCLC, MAP1S, ENO1, and KNG1 at the same ratio. After injection, mice were kept warm until fully recovered from anesthesia. Mice were analyzed biochemically and behaviorally 2 or 4 weeks after injection.
  • TTFs Tail-tip fibroblasts
  • PBS phosphate-buffered saline
  • EDTA ethylene-diamine-tetraacetic acid
  • Membranes were blocked in 5% bovine serum albumin (BSA) and incubated with primary antibodies overnight at 4°C. The membrane was washed three times with PBS and then incubated with secondary antibodies for 2 hours at room temperature. Each protein band was visualized using an ECL kit (DG-WF200; Dogen) and quantified using ImageJ (NIH) software. The antibodies used were anti-H3K9me3 (abcam, #ab8898), anti-H4K20me3 (abcam, #ab78517), ⁇ -SMA (Alpha Smooth Muscle Actin), and anti- ⁇ -actin (abfrontier, #LF-PA0207). -Actin was used as a loading control.
  • BSA bovine serum albumin
  • mice For behavioral analysis, an open field test was performed on model mice. The mouse was placed in a rectangular chamber (width 50 cm, length 50 cm, height 38 cm), and the locomotor of the mouse was measured by counting the frequency with which the mouse moved to the central area of the rectangular chamber (width 25 cm, height 25 cm) for 15 minutes. .
  • the mouse aorta was isolated, the cells were fixed with 4% paraformaldehyde (PFA), the paraffin block was made into a paraffin block, and the aorta tissue was finely cut using a microtome. Afterwards, the cut paraffin tissue samples were H&E stained using hematoxylin and eosin. In addition, VVG (Verhoeff Van Gieson), MT (Masson's Trichrome), and ORO (Oil Red O) staining were performed using cut paraffin tissue samples and kits (Verhoeff Van Gieson Elastic Stain Kit, Masson's Trichrome Stain Kit, Oil Red O - Lipid Stain Kit). ) was used to stain according to the manufacturer's protocol.
  • Cells were transfected with OSKM-treated plasma or GCLC, Map1s, ENO1, and KNG1 expression vectors and then cultured in 24-well plates for 24 hours.
  • For immunofluorescence staining cells were washed with PBS, treated with 4% paraformaldehyde, and fixed for 10 minutes at room temperature. After washing twice with PBS, the cells were blocked with PBS containing 3% BSA and 0.1% Triton X-100 at room temperature for 3 hours. Primary antibodies were used at the dilution recommended by the manufacturer.
  • Cells were stained with primary antibody for 24 hours at 4°C, then incubated with secondary antibody conjugated to Alexa488 or Alexa 594 (Invitrogen), and stained with DAPI (4',6-diamidino-2-phenylindole).
  • DAPI 4',6-diamidino-2-phenylindole.
  • Cell counts in 10 randomly selected fields on the plate were calculated at 200X magnification using a versatile confocal microscope (LSM-800, Zeiss).
  • the antibodies used were anti-H3K9me3 (abcam, #ab8898), anti-H4K20me3 (abcam, #ab78517), ⁇ -SMA (Alpha Smooth Muscle Actin), and anti- ⁇ -actin (abfrontier, #LF-PA0207).
  • -Actin was used as a loading control.
  • Blood was collected from the mouse, centrifuged at 3000 rpm for 30 minutes to separate the supernatant serum, and then qualitative and quantitative analysis of protein molecules in the separated serum was performed using LC/MS.
  • Base sequences corresponding to the coding regions of Gclc, Eno1, Map1s, and Kng1 proteins were amplified by PCR from mouse genomic DNA. Base sequences corresponding to each combination of Gclc, Eno1, Map1s, and Kng1 proteins (GEMK, GEM, GEK, GMK, EMK, GE, GM, GK, EM, EK, MK) were introduced into the lentiviral vector, and the 2A sequence was introduced into the lentiviral vector. Vectors for each combination were created through . The CMV promoter was used to express each gene and combined genes. The created vector was later made into a lentivirus.
  • lentiviral vector containing mouse complementary DNA (cDNA) for FUW-TetO-mutant laminA/C (LMNA) and overexpressing Progerin was constructed.
  • HEK293T cells were cultured in DMEM medium containing 10% FBS and 1% P/S. The day before transfection, 2X10 7 cells were seeded in a 15 cm culture dish containing medium. The next day, cells were cotransfected with lentiviral constructs psPAX2, pMD2.G, and FUW-tetO-mutant LMNA via calcium phosphate co-precipitation. The medium was changed 24 hours after transfection, and virus was obtained 72 hours after transfection.
  • cDNA mouse complementary DNA
  • LMNA laminA/C
  • the supernatant containing lentivirus was collected, centrifuged to remove cell debris, and then filtered through a 0.45 ⁇ m filter. Lentivirus was pelleted via standard ultracentrifugation and resuspended in cold PBS. FUW-GFP was used as a control to monitor GFP expression and calculate the multiplicity of infection before the virus titer (infectious units mL -1 ) was determined.
  • Cells were fixed with 4% paraformaldehyde for 5 minutes at room temperature and then washed twice with PBS. 37°C in staining solution containing 40mM citric acid/Na phosphate buffer, 5mM K4[Fe(CN)6] 3H2O, 5mM K3[Fe(CN)6], 150mM sodium chloride, 2mM magnesium chloride and 1mg/ml X-gal. and cultured overnight. The cells were washed twice with PBS and once with methanol, dried, and photographed using a bright field microscope.
  • NSS Neurological severity score
  • infarcted area volume were measured.
  • the Zea-longa score was assigned by measuring whether the mouse showed normal motility using its forelimbs in the cage.
  • an evaluation of the ability to grab and hold a bar with a height of 70 cm and a diameter of 0.5 cm with the front legs were performed.
  • the mouse brain was separated, the cells were fixed with 4% PFA, and then cut into 0.45 um thick pieces and stained with TTC (Triphenyltetrazolium chloride) and CV (cresyl violet).
  • TTC Triphenyltetrazolium chloride
  • CV cresyl violet
  • Example 1 Screening of proteins in OSKM-treated plasma and improvement of aging-related indicators of OSKM-treated plasma and proteins derived from OSKM-treated plasma
  • LC/MS was performed to analyze proteins in plasma derived from 4F2A mice in which OSKM was induced (OSKM-treated plasma) and compared with plasma from 4F2A mice in which OSKM was not induced (control group) ( Figures 1a-c). .
  • the remaining 4 proteins (GCLC, MAP1S, ENO1, and KNG1) were selected, excluding 13 cancer-related proteins.
  • LMNA mutant laminA/C
  • OSKM-treated plasma at a concentration of 10 ⁇ l/ml and cultured for 5 days, or 4 out of 17 proteins (GCLC, MAP1S) were cultured for 5 days.
  • ENO1 and KNG1 to induce the expression of GCLC, MAP1S, ENO1 and KNG1, and 5 days later
  • the expression levels of aging-related histone markers (H3K9me3 and H4K20me3) in each cell were immunofluorescently stained. It was analyzed through .
  • vectors expressing various combinations including GCLC, MAP1S, ENO1, or KNG1 which were confirmed to have anti-aging effects [GCLC+ENO1(GE), GCLC+KNG1(GK) ), GCLC+MAP1S(GM), ENO1+MAP1S(EM), MAP1S+KNG1(MK), ENO1+MAP1S(EK), GCLC+ENO1+MAP1S(GEM), GCLC+ENO1+KNG1(GEK), GCLC+ MAP1S+KNG1(GMK), ENO1+MAP1S+KNG1(EMK), GCLC+MAP1S+ENO1+KNG1(GEMK) vector] were each transfected into wild-type mouse tail tip fibroblasts, and 3 days later, senescence-related beta-galactosidase The number of positive cells and the intensity of cleaved-Caspase3 and the intensity of cleaved-Caspase
  • beta-galactosidase-positive cells were reduced when GCLC, MAP1S, ENO1, or KNG1 was treated alone, but the effect of reducing beta-galactosidase-positive cells was better when treated with a combination of two or more of these, especially 3.
  • Example 2 Improvement of aging-related indicators in aging model mice by administration of OSKM-treated plasma and proteins derived from OSKM-treated plasma
  • OSKM-treated plasma was injected into 10-month-old premature aging model mice to investigate whether aging-related indicators in appearance, aorta, and organs were improved.
  • stiffness and fibrosis symptoms in the aorta were analyzed through H&E staining 4 weeks after injection of a composition containing GCLC, MAP1S, ENO1, and KNG1 into 24-month-old wild-type C57BL/6 mice in which aging was induced naturally.
  • aortic stiffness and fibrosis symptoms were improved in mice compared to the control group (6-month-old mice) ( Figure 6b-c).
  • OSKM-treated plasma and a composition containing OSKM-treated plasma-derived GCLC, MAP1S, ENO1, and KNG1 improved aging-related indicators in the appearance, aorta, and organs of premature aging model mice and aging mice.
  • Example 3 Improvement of Alzheimer's disease-related indicators in Alzheimer's disease model mice by administration of protein derived from OSKM-treated plasma
  • a ⁇ plaques and A ⁇ 42/40 ratio decreased in mice after injection compared to the control group, confirming that administration of a composition containing GCLC, MAP1S, ENO1, and KNG1 improved Alzheimer's disease symptoms (FIG. 7).
  • Example 4 Improvement of Parkinson's disease-related indicators in Parkinson's disease model mice by administration of protein derived from OSKM-treated plasma
  • mice after injection compared to the control group, the levels of ATL (alanine transaminase) and AST (aspartate transaminase) decreased, and the level of plasma ALB (albumin) increased, resulting in administration of a composition containing GCLC, MAP1S, ENO1, and KNG1. It was confirmed that liver failure symptoms were improved (Figure 10).
  • OSKM-treated plasma and OSKM-treated plasma-derived GCLC, MAP1S, ENO1, and KNG1 improve aging-related phenotypes in vitro and in vivo, and prevent aging-related diseases such as progeria, Alzheimer's disease, Parkinson's disease, stroke, and liver failure. By improving symptoms such as, it can prevent, improve or treat aging-related diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 Oct4, Sox2, Klf4 및 c-Myc가 처리된 혈장으로부터 유래한 GCLC, ENO1, Map1s, KNG1과 이들의 다양한 조합을 포함하는 노화 방지용 조성물 및 이의 용도에 관한 것이다. 본 발명의 GCLC, ENO1, Map1s, KNG1 의 다양한 조합은 in vitro 및 in vivo에서 노화 관련 표현형을 개선하고, 노화에 의해 발병하는 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등을 개선하는바, 노화 관련 질병을 예방, 개선 또는 치료할 수 있다.

Description

혈장 유래 단백질을 포함하는 노화 방지용 조성물
본 발명은 Oct4, Sox2, Klf4 및 c-Myc가 처리된 혈장으로부터 유래한 GCLC, ENO1, Map1s, KNG1과 이들의 다양한 조합을 포함하는 노화 방지용 조성물 및 이의 용도에 관한 것이다.
최종적으로 분화된 체세포는 4개의 야마나카 인자 Oct4, Sox2, Klf4 및 c-Myc(OSKM)의 과발현을 통해 만능 줄기 세포(유도 만능 줄기 세포, iPSC)로 재프로그래밍될 수 있다. 수많은 연구에서 세포 운명이 상기 인자의 강제 발현에 의해 변경될 수 있음이 입증되어 많은 질병의 치료를 위해 세포 재프로그래밍을 이용한 접근법의 가능성을 확인하였으며, 노화 방지에 대해서도 이러한 접근법의 가능성이 확인된 바 있다.
상기 OSKM을 이용한 노화 방지 기술로, 부분적 세포 역분화가 연구된 바 있다. 부분적 세포 역분화란, 생체 내에서 OSKM을 부분적으로 짧은 시간 동안 발현시켜, 생체 내에서 노화된 세포 및 조직을 완전히 역분화 리프로그래밍시키지 않고, 부분적으로 역분화 리프로그래밍시키는 것으로, 이를 통해 특정 부위에 발병하는 노화 관련 질환을 특이적으로 치료할 수 있다.
그러나, 생체 내 OSKM의 일시적인 발현은 다양한 조직에서 종양 형성을 유발하는 것으로 보고된 바 있으며(K. Ohnishi et al., Cell 156, 663-677, 2014), 세포 재프로그래밍을 위한 Klf4 및 c-Myc과 같은 인자의 과발현시 역분화 과정에서 기형종(teratoma) 형성을 유발할 위험성이 있음이 보고된 바 있다(M. Abad et al., Nature 502, 340-345, 2013). 또한, 역분화 리프로그래밍 초기 단계의 이소성(ectopic) Oct4 유전자의 발현은 무분별한 전사체 네트워크(transcriptome network)를 유도하기 때문에 표적 외 리프로그래밍이 진행된다. 이로 인하여, 생체 내 OSKM의 발현을 통한 세포 리프로그래밍 기반 노화 방지 기술은 안정성과 효율성 측면에서 여전히 큰 한계가 존재하는 기술이다.
이에, 생체 내에서 직접적으로 OSKM을 발현시키지 않으면서, OSKM을 이용한 효율적이고 안전한 노화 방지 방법이 요구되고 있는 실정이다.
이러한 배경 하에서, 본 발명자들은 생체 내에서 직접적으로 OSKM이 처리된 혈장으로부터 유래한 특정 단백질들 및 이의 조합이 in vitro 및 in vivo에서 노화 관련 표현형을 개선하고, 노화에 의해 발병하는 퇴행성 뇌질환, 뇌졸중 및 간부전의 증상을 개선함으로써 노화 관련 질병을 예방, 개선 또는 치료할 수 있음을 확인하여, 본 발명을 완성하였다.
본 발명의 하나의 목적은 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 본 발명의 약학적 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, 노화 방지 방법을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물; 중 선택되는 어느 하나를 포함하는, 세포 노화 억제용 조성물을 제공하는 것이다.
본 발명의 Oct4, Sox2, Klf4 및 c-Myc(OSKM)이 처리된 혈장으로부터 유래한 GCLC, ENO1, Map1s, KNG1 중 선택되는 2 이상의 조합은 in vitro 및 in vivo에서 노화 관련 표현형을 개선하고, 노화에 의해 발병하는 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등을 개선하는바, 노화 관련 질병을 예방, 개선 또는 치료할 수 있다.
도 1은 OSKM이 유도된 4F2A 마우스로부터 유래하는 혈장(OSKM 처리 혈장) 내 단백질을 분석하기 위하여 LC/MS을 수행한 결과이다. (a)는 OSKM 처리 혈장에서 특이적으로 유도되는 단백질을 스크리닝 하는 과정을 나타낸 모식도이다. (b-c)는 OSKM 처리 혈장의 LC/MS 분석 및 단백질 발현 패턴을 분석한 데이터이다. (d)는 OSKM 처리 혈장에서 특이적으로 유도된 단백질의 목록이다.
도 2는 OSKM 처리 혈장을 처리한 세포 또는 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도한 세포에서 노화 관련 지표를 분석한 결과이다. (a)는 세포에 OSKM 처리 혈장 처리 후 노화 관련 히스톤 마커인 H3K9me3 및 H4k20me3의 발현 수준을 분석한 결과, 및 (b)는 이를 정량화한 데이터이다. (c)는 세포에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도 후 H3K9me3 및 H4k20me3의 발현 수준을 분석한 결과, (d)는 이를 정량화한 데이터이다.
도 3은 야생형 마우스 꼬리 끝 섬유아세포에 GCLC, MAP1S, ENO1 또는 KNG1 단독과 이들의 다양한 조합을 과발현시킨 후 베타 갈락토시다제를 포함한 노화마커를 통한 노화 세포 감소 수준을 정량화한 결과이다. 또한, 다양한 조합 중 2가지 이상의 조합에서 노화 마커 감소뿐만 아니라 노화 관련 후성유전학적 마커의 변화가 유도됨을 확인하였다. 예를 들어 도3-c 데이터에서 GCLC, MAP1S, ENO1 또는 KNG1 단독 처리하였을 때는, 노화가 되었을 때 감소한다고 알려진 후성 유전학적 마커 (H3K9me3)의 변화가 없었으나, 2가지 이상의 조합을 처리하였을 때에, H3K9me3 의 양의 현격한 증가가 관찰되었다. 다시 말해서, 2가지 이상의 조합을 사용하였을 때 세포의 노화의 수준을 크게 억제 및 되돌릴 수 있다는 점을 보여준다.
도 4는 OSKM 처리 혈장 또는 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 투여에 의한 조기 노화 모델 마우스에서의 노화 관련 지표를 분석한 결과이다. 10개월령 조기 노화 모델 마우스에 OSKM 처리 혈장을 주사 후 체중 감소 억제(a), 수명 증가(b) 및 척추 곡률 감소(c)를 확인한 데이터이다. (d-e)는 조기 노화 모델 마우스에 OSKM 처리 혈장 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E, VVG, MT 및 ORO 염색을 통해 분석한 데이터이다. (f-g)는 조기 노화 모델 마우스에 OSKM 처리 혈장 주사 후 4주 뒤 간, 비장, 신장 및 피부에서의 노화 증상을 H&E 염색을 통해 분석한 데이터이다.
도 5는 (a)는 6개월(young), 18개월(mid-aged) 및 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 OSKM 처리 혈장을 주사 후 오픈 필드 테스트를 수행한 데이터이다. (b)는 6개월(young) 및 자연적으로 노화가 유도된 24개월령(old) 마우스에 OSKM 처리 혈장을 주사 후 노화 관련 유전자의 발현 수준을 qRT-PCR을 통해 분석한 데이터이다.
도 6은 (a)는 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 간, 비장 및 신장에서의 노화 증상을 H&E 염색을 통해 분석한 데이터이다. (b)는 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E 염색을 통해 분석한 데이터, 및 (c) 이를 정량화하였다. 10개월령 조기 노화 모델 마우스(d) 및 24개월령 야생형 C57BL/6 마우스(e)에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 심장 대동맥 조직에서 심근세포(Cardiac Myofibroblast) 수를 α-SMA 면역형광 염색을 통해 분석한 데이터이다.
도 7은 12개월령 알츠하이머 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직에서 알츠하이머병 특이 아밀로이드 베타(amyloid-beta, Aβ) 플라크(a) 및 Aβ42/40 비율(b)의 수준을 분석한 데이터이다.
도 8은 12개월령 파킨슨 질환 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 중뇌 조직에서 도파민성 신경세포 특이 유전자인 Map2(a), 시냅신(Synapsin) (b), DAT(c) 및 TH(d)의 mRNA 발현 수준을 qRT-PCR을 통해 분석한 데이터이다.
도 9는 뇌졸중 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직의 경색(infarct) 용적(a) 및 신경학적 결손 점수(neurological deficit score) (b)이다.
도 10은 간부전 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 혈장 내 ATL(alanine transaminase), AST(aspartate transaminase) 및 혈장 ALB(albumin)의 수준을 분석한 데이터이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
본 발명의 하나의 양태는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 하나의 양태는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질은, 상기 단백질 중 2, 3 또는 4개 조합으로서, 구체적으로, 2개 조합은 GCLC 및 ENO1(GE); GCLC 및 KNG1(GK); GCLC 및 MAP1S(GM); ENO1 및 MAP1S(EM); MAP1S 및 KNG1(MK); 또는 ENO1 및 MAP1S(EK)이고, 3개 조합은 GCLC, ENO1 및 MAP1S(GEM); GCLC, ENO1 및 KNG1(GEK); GCLC, MAP1S 및 KNG1(GMK); 또는 ENO1, MAP1S 및 KNG1(EMK)이고, 4개 조합은 GCLC, MAP1S, ENO1 및 KNG1(GEMK) 이다.
따라서, 본 발명의 일 구현예는 상기 단백질의 2개의 조합, 즉 GCLC 및 ENO1(GE); GCLC 및 KNG1(GK); GCLC 및 MAP1S(GM); ENO1 및 MAP1S(EM); MAP1S 및 KNG1(MK); 및 ENO1 및 MAP1S(EK) 중에서 선택되는 조합, 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 일 구현예는 상기 단백질의 3개의 조합, 즉 GCLC, ENO1 및 MAP1S(GEM); GCLC, ENO1 및 KNG1(GEK); GCLC, MAP1S 및 KNG1(GMK); 및 ENO1, MAP1S 및 KNG1(EMK) 중에서 선택되는 조합, 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 일 구현예는 상기 단백질의 4개의 조합, 즉 GCLC, MAP1S, ENO1 및 KNG1(GEMK)의 조합, 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에서 용어, "글루타메이트-시스테인 리가제 촉매 서브유닛(Glutamate-Cysteine Ligase Catalytic Subunit, GCLC)"란 글루타메이트-시스테인 리가제(Glutamate-cysteine ligase, GCL)의 서브유닛으로, 글루타티온(Glutathione, GSH) 합성 경로의 전체 속도를 결정하는 속도 제한(rate-limiting) 효소이다.
본 발명에 있어서, GCLC 단백질은 서열번호 1로 기재된 아미노산 서열을 가지거나, 포함하거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어질 수 있다. 구체적으로, 상기 GCLC 단백질은 GenBank Protein ID, 183039. UniProtKB ID, P48506 또는 서열번호 1의 아미노산 서열로 기재된 폴리펩티드로 이루어지는 것일 수 있다.
상기 GCLC 단백질은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank) 등에서 얻을 수 있다. 그 예로, 본 발명에 있어서, 상기 GCLC 단백질의 아미노산 서열은 GenBank Protein ID, 183039. UniProtKB ID, P48506의 정보를 참조할 수 있다. 다른 예로, 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 GenBank Protein ID, 183039. UniProtKB ID, P48506 또는 서열번호 1의 아미노산 서열을 포함하는 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 발명의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 발명의 단백질의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 발명에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ET AL.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스(또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티(또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 발명에 있어서, 상기 GCLC 단백질을 코딩하는 폴리뉴클레오티드는 Gclc 유전자일 수 있다.
본 발명의 GCLC 단백질을 코딩하는 폴리뉴클레오티드는 전술한 GenBank Protein ID: 183039. UniProtKB ID: P48506 또는 서열번호 1로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 발명의 일 예로, 본 발명의 GCLC 단백질을 코딩하는 폴리뉴클레오티드는 Gene ID: 2729로부터 식별되는 서열 또는 서열번호 2의 서열을 가지거나 포함할 수 있다. 또한, 본 발명의 GCLC 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 2의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 구체적으로, 상기 GCLC 단백질은 서열번호 2의 염기서열로 기재된 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 발명의 Gclc 유전자를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 발명의 Gclc 유전자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, GCLC 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 발명의 GCLC 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열을 가지거나 포함하거나, 또는 서열번호 12의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "미세소관 관련 단백질 1S(Microtubule-associated protein S1, MAP1S)"란 DNA 결합능을 가지며, 세포 사멸 및 게놈 파괴(MAGD)를 초래하는 미토콘드리아의 응집을 매개하는 단백질로, 미세소관 조직화 센터를 중심체에 고정시키는 역할을 하는 것으로 알려져 있다.
본 발명에 있어서, MAP1S 단백질은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank) 등에서 얻을 수 있다. 그 예로, 본 발명에 있어서, 상기 MAP1S 단백질의 서열은 GenBank: AAH80547.1, UniProt ID Q66K74의 서열정보를 참조할 수 있다. 다른 예로, 상기 MAP1S 단백질은 서열번호 3으로 기재된 아미노산 서열을 가지거나, 포함하거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어질 수 있다. 구체적으로, 상기 MAP1S 단백질은 서열번호 3의 아미노산 서열로 기재된 폴리펩티드로 이루어지는 것일 수 있다.
본 발명에 있어서, 상기 MAP1S 단백질의 아미노산 서열은 상기 GenBank: AAH80547.1, UniProt ID Q66K74 또는 서열번호 3으로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 서열번호 3의 아미노산 서열을 포함하는 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에 있어서, 상기 MAP1S 단백질을 코딩하는 폴리뉴클레오티드는 Map1s 유전자일 수 있다.
본 발명의 MAP1S 단백질을 코딩하는 폴리뉴클레오티드는 전술한 GenBank: AAH80547.1, UniProt ID Q66K74, 또는 서열번호 3으로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 발명의 일 예로, 본 발명의 MAP1S 단백질을 코딩하는 폴리뉴클레오티드는 GeneID: 55201로부터 식별되는 서열 또는 서열번호 4의 서열을 가지거나 포함할 수 있다. 또한, 본 발명의 MAP1S 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 4의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 구체적으로, 상기 MAP1S 단백질은 서열번호 4의 염기서열로 기재된 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 발명의 Map1s 유전자를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성 또는 본 발명의 Map1s 유전자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, MAP1S 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 발명의 MAP1S 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 4의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열을 가지거나 포함하거나, 또는 서열번호 4의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "에놀라제 1(Enolase 1, ENO1)"이란 2-포스포글리세르산(2-phosphoglycerate)을 포스포에놀피루베이트(phosphoenolpyruvate)로 전환하는 활성을 갖는 효소로, 알파-에놀라제(alpha-Enolase, α-Enolase)로도 명명된다.
본 발명에 있어서, ENO1 단백질은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank) 등에서 얻을 수 있다. 그 예로, 본 발명에 있어서, 상기 ENO1 단백질의 서열정보는 NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733 등을 참조할 수 있다. 다른 예로, 서열번호 5로 기재된 아미노산 서열을 가지거나, 포함하거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어질 수 있다. 구체적으로, 상기 ENO1 단백질은 서열번호 5의 아미노산 서열로 기재된 폴리펩티드로 이루어지는 것일 수 있다.
본 발명에 있어서, 상기 ENO1 단백질의 아미노산 서열은 상기 NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733 또는 서열번호 5로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 서열번호 5의 아미노산 서열을 포함하는 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에 있어서, 상기 ENO1 단백질을 코딩하는 폴리뉴클레오티드는 Eno1 유전자일 수 있다.
본 발명의 ENO1 단백질을 코딩하는 폴리뉴클레오티드는 전술한 NCBI Accession No: NP_001340275, XP_006710496, Uniprot ID P06733, 또는 서열번호 5로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 발명의 일 예로, 본 발명의 ENO1 단백질을 코딩하는 폴리뉴클레오티드는 Gene ID: 2023으로부터 식별되는 서열 또는 서열번호 6의 서열을 가지거나 포함할 수 있다. 또한, 본 발명의 ENO1 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 6의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 구체적으로, 상기 ENO1 단백질은 서열번호 6의 염기서열로 기재된 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 발명의 Eno1 유전자를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성 또는 본 발명의 Eno1 유전자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, ENO1 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 발명의 ENO1 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 6의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열을 가지거나 포함하거나, 또는 서열번호 6의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "키니노겐 1(Kininogen 1, KNG1)"이란 저분자량 키니노겐, 고분자량 키니노겐(kininogen) 및 이로부터 분비되는 브래디키닌(bradykinin)의 전구체 단백질이다. 상기 고분자량 키니노겐은 혈액 응고 및 칼리크레인-키닌(kallikrein-kinin) 시스템의 구성에 필수적인 요소로 알려져 있다.
본 발명에 있어서, KNG1 단백질은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank) 등에서 얻을 수 있다. 그 예로, 본 발명에 있어서, 상기 KNG1 단백질의 서열 정보는 UniProt ID: P01042 의 서열정보를 참조할 수 있다. 다른 예로, 상기 KNG1 단백질은 서열번호 7로 기재된 아미노산 서열을 가지거나, 포함하거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어질 수 있다. 구체적으로, 상기 KNG1 단백질은 서열번호 7의 아미노산 서열로 기재된 폴리펩티드로 이루어지는 것일 수 있다.
본 발명에 있어서, 상기 KNG1 단백질의 아미노산 서열은 상기 UniProt ID: P01042 또는 서열번호 7로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 서열번호 7의 아미노산 서열을 포함하는 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명에 있어서, 상기 KNG1 단백질을 코딩하는 폴리뉴클레오티드는 Kng1 유전자일 수 있다.
본 발명의 KNG1 단백질을 코딩하는 폴리뉴클레오티드는 전술한 UniProt ID: P01042 또는 서열번호 7로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 발명의 일 예로, 본 발명의 KNG1 단백질을 코딩하는 폴리뉴클레오티드는 Gene ID: 3827 으로부터 식별되는 서열 또는 서열번호 8의 서열을 가지거나 포함할 수 있다. 또한, 본 발명의 KNG1 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 8의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 구체적으로, 상기 KNG1 단백질은 서열번호 8의 염기서열로 기재된 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 발명의 Kng1 유전자를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성 또는 본 발명의 Kng1 유전자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, KNG1 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 발명의 KNG1 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 8의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열을 가지거나 포함하거나, 또는 서열번호 8의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 단백질의 발현을 증대시키는 조성물은 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터, 또는 상기 단백질의 발현을 증대시키는 인핸서(enhancer) 등을 포함할 수 있다.
일 예로, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물은, GCLC 단백질을 코딩하는 폴리뉴클레오티드, MAP1S 단백질을 코딩하는 폴리뉴클레오티드, ENO1 단백질을 코딩하는 폴리뉴클레오티드 및 KNG1 단백질을 코딩하는 폴리뉴클레오티드로 이루어지는 군으로부터 선택되는 2 이상의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다. 상기 벡터는 각각의 유전자를 포함한 별개의 벡터이거나, 하나의 벡터에 상기 폴리뉴클레오티드 중 어느 2 이상을 포함할 수 있다.본 발명에서 용어, "벡터(vector)"란 목적하는 DNA 단편을 숙주 세포에 도입시켜 증식할 수 있는 DNA로써 클로닝 운반체(cloning vehicle)라고도 한다. "발현 벡터"는 목적하는 코딩서열과, 특정 숙주생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 본 발명에서 상기 벡터는 발현 벡터와 동일한 의미로 사용될 수 있다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 제한되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있고, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있으며, 바이러스 벡터로서 아데노-연관 바이러스(AAV) 벡터, 아데노바이러스 벡터, 헤르페스 바이러스 벡터, 레트로바이러스 벡터, 렌티바이러스 벡터, 백시니아바이러스 벡터, 폭스바이러스 벡터, 단순포진바이러스 벡터 등을 사용할 수 있다.
상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동 재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "형질전환"은 목적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 재조합 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드가 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열 또는 발현조절영역과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물;은 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 내재적 발현 및/또는 활성을 야생형 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 내재적 발현 및/또는 활성에 비해 증대시킬 수 있다.
본 발명의 용어, "노화"는 일반적으로 나이가 들면서 신체의 구조와 기능이 저하되어 일어나는 쇠퇴적인 변화현상을 포괄하는 개념으로, 노화로 인한 변화는 실질세포수의 감소에 의한 각 조직의 중량 및 체중의 감소, 결합조직의 변화, 체조성의 변화, 혈관이나 피부 등의 탄력성 저하, 각 장기기능의 감퇴, 면역능력을 비롯한 항병회복능의 저하, 감각기 기능의 저하, 기억력, 인지기능, 학습능력 및 비교능력의 저하 등 매우 다양하다.
본 발명의 "노화 억제"는 본 발명의 조성물의 투여에 의해 전술한 노화 증상을 억제 또는 방지 또는 개선 또는 지연시키는 모든 행위를 의미하며, 구체적으로, 전술한 노화와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미하며, 본 발명의 조성물의 투여에 의해 노화 증상이 호전, 완화되거나 이롭게 변경되는 행위를 포함한다. 또한, 상기 용어는"노화 방지"와 혼용되어 사용될 수 있다. 상기 "노화 억제"는 "노화의 치료(treating)"로도 표현 될 수 있으며, 노화와 관련된 질환의 치료 및/또는 개선 역시 포함한다.
본 발명에서, 용어 "노화 관련 질환"은 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환을 포함하는 것일 수 있다.
본 발명에 있어서, 상기 조기 노화를 유도하는 질환은 일 예로, 허친슨 길포드(Hutchinson Guilford) 조로증 증후군(HGPS), HIV 감염과 관련된 조기 노화, 근육 퇴행 위축, 샤르코-마리-투스 질환(Charcot-Marie-Tooth disease), 베르너(Werner) 증후군, 인슐린 내성 타입 II 당뇨병, 골다공증, 피부 노화 및 제한 피부병증(restrictive dermopathy) 등을 포함할 수 있으나, 이에 제한되지 않으며, 조기 노화의 병리학적 특징을 포함하는 질환이라면 모두 포함될 수 있다. 구체적으로, 상기 조기 노화를 유도하는 질환은 허친슨 길포드 조로증 증후군일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 노화에 의해 유도되는 질환은 일 예로, 동맥경화, 간부전, 뇌졸중, 퇴행성 뇌질환, 알츠하이머병, 파킨슨병, 고혈압, 인지기능장애, 근감소증, 안구건조증, 황반변성, 원시, 근시, 백내장, 이명, 난청, 소화불량, 설사, 자가면역질환, 폐렴, 독감, 파상풍, 감염성 심내막염, 폐렴, 독감, 파상풍, 감염성 심내막염, 암, 과민성 방광, 요실금, 전립선 비대증, 하부요로증상, 사구체 신염, 만성 신부전, 뇌졸중, 골다공증, 관절염, 당뇨병, 신부전, 만성폐쇄성 폐질환 및 폐섬유화증 등을 포함할 수 있으나, 이에 제한되지 않으며, 노화에 의해 발생되는 병리학적 특징을 포함하는 질환이라면 모두 포함될 수 있다. 구체적으로, 상기 노화에 의해 유도되는 질환은 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등일 수 있고, 보다 구체적으로, 동맥경화, 간부전, 뇌졸중, 알츠하이머병 및 파킨슨병 중 선택되는 1 이상일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "예방"은 상기 조성물의 투여에 의해 노화 관련 질환을 억제하거나 발병을 지연시키는 모든 행위를 의미하며, "치료"는 상기 조성물의 투여에 의해 노화 관련 질환에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서 용어, "개선"은 상기 조성물을 이용하여 노화 관련 질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 되는 모든 행위를 말한다.
본 발명의 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형체 또는 희석제를 추가로 포함할 수 있다. 이때, 상기 약학적 조성물에 포함되는 유효성분의 함량은 특별히 이에 제한되지 않으나, 조성물 총 중량에 대하여 0.0001 중량% 내지 10 중량%로, 구체적으로는 0.001 중량% 내지 1 중량%를 포함할 수 있다.
상기 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있으며, 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 약학적 조성물은 노화 관련 질환을 예방 또는 치료하는 다른 물질을 추가로 포함할 수 있다. 그 예로, 본 발명의 약학적 조성물은 OSKM, OSKM을 발현하는 벡터 또는 OSKM이 처리된 혈장을 추가로 포함할 수 있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여할 수 있다.
본 발명에서 용어, "약학적으로 유효한 양"은 의학적 치료에 적용가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 질병의 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다. 본 발명의 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물 형태, 투여경로 및 기간에 따라 다르지만, 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 1일 0.0001 내지 500mg/kg으로, 구체적으로는 0.001 내지 100mg/kg으로 투여하는 것이 좋을 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 약학적 조성물은 쥐, 가축, 인간 등의 다양한 포유동물에 다양한 경로로 투여할 수 있으며, 투여의 방식은 당업계의 통상적인 방법이라면 제한없이 포함하며, 예를 들어, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있다.
또한, 본 발명의 약학적 조성물은 인간에 적용되는 의약품뿐만 아니라, 동물 의약품의 형태로도 사용될 수 있다. 여기에서, 동물이란 가축 및 반려동물을 포함하는 개념이다.
본 발명에 있어서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물;은 세포 노화 억제 효과를 갖는 것일 수 있다.
본 발명에 따른 세포 노화 억제 효과는 본 발명에서 제공하는 조성물의 처리에 따른 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 내재적 발현 및/또는 활성에 의해 달성되는 것일 수 있다.
상기 세포 노화 억제 효과는 다음 중 선택되는 어느 하나 이상의 효과일 수 있다:
i) 노화 관련 유전자의 발현 수준 감소;
ii) DNA 이중 가닥 파손 수준 감소; 및
iii) 베타 갈락토시다제 양성 세포 수 감소.
상기 i)의 노화 관련 유전자는 스트레스 반응 유전자, ECM(extracellular matrix) 리모델링 유전자, SASP(Senescence-Associated Secretory Phenotype) 유전자 및 노화 관련 유전자로 이루어지는 군으로부터 선택되는 어느 하나 이상일 수 있다.
상기 스트레스 반응 유전자는 일 예로, Ccl8, p16, p21, Btg2 및 Atf 등일 수 있으나, 이에 제한되지 않는다.
상기 ECM 리모델링 유전자는 일 예로, MMP12, MMP13 및 IL-6 등일 수 있으나, 이에 제한되지 않는다.
상기 SASP 유전자는 일 예로, Cdkn2a, Cdkn1a 및 IL-a 등일 수 있으나, 이에 제한되지 않는다.
상기 i) 노화 관련 유전자의 발현 수준 감소와 관련하여, 본 발명의 일 구현예에서, 노화된 섬유아세포에서 노화 관련 유전자인 Ccl8, IL-6, Cdkn2a, Btg2, Atf3, MMP12, MMP13, p16 및 p21의 발현 수준이 현저히 증가되었으나, dCas9-activator 벡터의 도입에 의해 회복되었다(도 2e).
이로부터 노화 섬유아세포에서 dCas9-activator 벡터가 내인성 Oct4 활성화를 활성화함으로써 노화 관련 분자 표현형을 효율적으로 개선할 수 있음을 알 수 있다.
상기 ii) DNA 이중 가닥 파손 수준 감소와 관련하여, 본 발명의 일 구현예에서, GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도한 돌연변이 laminA/C(LMNA)가 형질도입되어 노화된 마우스 섬유아세포에서 세포 노화와 관련된 DNA 이중 가닥 파손 수준을 평가하기 위해 히스톤 마커 H3K9me3 및 H4K20me3의 발현 수준을 분석한 결과, OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도하는 경우(도 2c-d), H3K9me3의 발현 수준은 증가하고 H4K20me3의 발현 수준이 감소하여 노화 관련 지표가 개선됨을 확인하였다.
특히, GCLC, MAP1S, ENO1 또는 KNG1 단독 처리하였을 때는 노화가 되었을 때 감소한다고 알려진 후성 유전학적 마커 (H3K9me3)의 변화가 없었으나, 2가지 이상의 조합을 처리하였을 때에, H3K9me3 의 양의 현격한 증가가 관찰되었다. 이는 상기 4종 단백질 중 2 이상의 조합을 사용하였을 때, 세포의 노화의 수준을 크게 억제할 수 있음을 나타내는 결과이다.
상기 iii) 베타 갈락토시다제 양성 세포 수 감소와 관련하여, 본 발명의 일 구현예에서, GCLC, MAP1S, ENO1 또는 KNG1 단독 및 이의 다양한 조합을 발현하는 벡터[GCLC+ENO1(GE), GCLC+KNG1(GK), GCLC+MAP1S(GM), ENO1+MAP1S(EM), MAP1S+KNG1(MK), ENO1+MAP1S(EK), GCLC+ENO1+MAP1S(GEM), GCLC+ENO1+KNG1(GEK), GCLC+MAP1S+KNG1(GMK), ENO1+MAP1S+KNG1(EMK), GCLC+MAP1S+ENO1+KNG1(GEMK) 벡터]를 야생형 마우스 꼬리 끝 섬유아세포에 각각 형질전환하고 3일 후, 노화 관련 베타 갈락토시다제 양성 세포 수를 측정하였다.
그 결과, GCLC, MAP1S, ENO1 또는 KNG1 단독 처리에서 베타 갈락토시다제 양성 세포가 감소하였으나, 이들의 2 또는 3개의 조합을 처리하였을 때 베타 갈락토시다제 양성 세포 감소 효과가 더 우수하였으며, GCLC+MAP1S+ENO1+KNG1(GEMK)을 처리하였을 때 베타 갈락토시다제 양성 세포 감소 효과가 가장 우수하여, 대조군인 야생형 마우스 섬유아세포와 유사한 수준으로 감소함을 확인하였다(도 3).
이로부터 GCLC, MAP1S, ENO1 또는 KNG1 단백질 단독 및 이의 조합의 발현을 유도하는 경우, 세포에서 노화 관련 지표가 개선됨을 확인하여, 노화 억제 효과가 있음을 확인하였다.
특히, GCLC, MAP1S, ENO1 또는 KNG1 단백질 단독보다 GCLC, MAP1S, ENO1 및 KNG1 단백질을 2 이상 포함하는 조합을 발현시켰을 때 세포에서 노화 관련 지표가 개선되었고, 3가지 또는 4가지 단백질 모두를 포함하는 경우 노화 관련 지표가 현저히 개선되어, GCLC, MAP1S, ENO1 및 KNG1 중 2 이상을 포함하는 단백질의 조합에서 노화 억제 효과가 현저함을 확인하였다.
본 발명에 있어서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 단백질을 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 단백질의 발현을 증대시키는 조성물;은 노화 관련 질환을 개선하는 효과를 갖는 것일 수 있다.
상기 노화 관련 질환을 개선하는 효과는 다음 중 선택되는 어느 하나 이상의 효과일 수 있다:
i) 척추 곡률 감소;
ii) 체중 감소 억제;
iii) 수명 증가;
iv) 운동 활성 증가; 및
v) 장기 및 피부의 노화 개선.
본 발명의 일 구현예에서, 조기 노화 모델 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 OSKM 처리 혈장을 주사한 결과, 대조군 대비 척추 곡률 감소를 포함하여 외관이 상당히 개선되었으며(도 4c), 체중 감소가 억제되고(도 4a), 수명이 증가됨을 확인하였다(도 4b).
본 발명의 다른 일 구현예에서, 6개월(young), 18개월(mid-aged) 및 자연적으로 노화가 유도된 24개월령(old) 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 OSKM 처리 혈장을 주사 후 오픈 필드 테스트를 수행한 결과, 주사 후 마우스에서는 대조군 대비 운동 활성이 증가하였다(도 5a).
본 발명의 또 다른 일 구현예에서, 조기 노화 모델 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 OSKM 처리 혈장 주사 후 4주 뒤 간, 비장, 신장 및 피부에서의 노화 증상을 H&E 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군(5개월령 마우스) 대비 장기 및 피부 노화 증상이 개선되었다(도 4f-g).
또한, 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 간, 비장 및 신장에서의 노화 증상을 동일하게 분석한 결과, 주사 후 마우스에서는 대조군(6개월령 마우스) 대비 장기 노화 증상이 개선되었다(도 6a).
본 발명의 또 다른 일 구현예에서, 조기 노화 모델 마우스 및 24개월령 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 심장 대동맥 조직에서 심근세포(Cardiac Myofibroblast) 수를 α-SMA 면역형광 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군 대비 α-SMA 양성 세포가 증가하여, 심근세포의 수가 증가하는 것을 확인하였다(도 6d-e).
또한, 조기 노화 모델 마우스 및 24개월령 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 심장 대동맥 조직에서 심근세포(Cardiac Myofibroblast) 수를 α-SMA 면역형광 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군 대비 α-SMA 양성 세포가 증가하여, 심근세포의 수가 증가하는 것을 확인하였다(도 6d-e).
본 발명에 있어서, 상기 노화 관련 질환은 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환을 포함할 수 있다.
상기 조기 노화를 유도하는 질환에 대해서는 전술한 바와 같으며, 구체적으로 허친슨 길포드 조로증 증후군일 수 있으나, 이에 제한되지 않는다.
상기 노화에 의해 유도되는 질환에 대해서는 전술한 바와 같으며, 구체적으로, 상기 노화에 의해 유도되는 질환은 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등일 수 있고, 보다 구체적으로, 동맥경화, 간부전, 뇌졸중, 알츠하이머병 및 파킨슨병일 수 있으나, 이에 제한되지 않는다.
전술한 구현예 중 어느 하나의 구현예에서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물;은 혈관내피세포 노화로 유도되는 질환을 개선하는 효과를 갖는 것일 수 있다.
상기 혈관내피세포 노화로 유도되는 질환은 구체적으로 동맥경화일 수 있으나, 이에 제한되지 않는다.
상기 동맥경화의 개선은 대동맥의 경직 감소 및/또는 대동맥의 섬유화 감소 효과에 의해 달성되는 것일 수 있다.
본 발명의 일 구현예에서, 조기 노화 모델 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 OSKM 처리 혈장 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E, VVG, MT 및 ORO 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군 대비 대동맥 경직 및 섬유화 증상이 개선되었다(도 4d-e).
또한, 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군(6개월령 마우스) 대비 대동맥 경직 및 섬유화 증상이 개선되었다(도 6b-c).
전술한 구현예 중 어느 하나의 구현예에서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 단백질을 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 단백질의 발현을 증대시키는 조성물;은 장기의 노화로 유도되는 질환을 개선하는 효과를 갖는 것일 수 있다.
상기 장기의 노화로 유도되는 질환은 구체적으로 간부전일 수 있으나, 이에 제한되지 않는다.
상기 간부전의 개선은 다음 중 선택되는 어느 하나 이상의 효과에 의해 달성되는 것일 수 있다:
i) ATL(alanine transaminase)의 수준 감소
ii) AST(aspartate transaminase)의 수준 감소;
iii) 혈장 ALB(albumin)의 수준 감소.
본 발명의 일 구현예에서, 간부전 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 혈장 단백질을 분석한 결과, 주사 후 마우스에서는 대조군 대비 ATL(alanine transaminase), AST(aspartate transaminase)의 수준이 감소하고, 혈장 ALB(albumin)의 수준이 증가하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 간부전 증상을 개선함을 확인하였다(도 10).
전술한 구현예 중 어느 하나의 구현예에서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 단백질을 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 단백질의 발현을 증대시키는 조성물;은 신경의 노화로 유도되는 질환을 개선하는 효과를 갖는 것일 수 있다.
상기 신경의 노화로 유도되는 질환은 구체적으로 뇌졸중일 수 있으나, 이에 제한되지 않는다.
상기 뇌졸중의 개선은 경색(infarct) 용적 감소 및/또는 신경학적 결손 점수(neurological deficit score) 감소 효과에 의해 달성되는 것일 수 있다.
본 발명의 일 구현예에서, 뇌졸중 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직을 신경학적 분석한 결과, 주사 후 마우스에서는 대조군 대비 경색 용적과 신경학적 결손 점수가 감소하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 뇌졸중 증상을 개선함을 확인하였다(도 9).
전술한 구현예 중 어느 하나의 구현예에서, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 단백질을 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 단백질의 발현을 증대시키는 조성물;은 퇴행성 뇌질환을 개선하는 효과를 갖는 것일 수 있다.
상기 퇴행성 뇌질환은 구체적으로 알츠하이머병 또는 파킨슨병일 수 있으나, 이에 제한되지 않는다.
상기 알츠하이머병 또는 파킨슨병의 개선은 아밀로이드 베타(amyloid-beta, Aβ) 플라크 및 Aβ 42/40 비율의 수준 감소 또는 도파민성 신경세포 특이 유전자인 Map2, 시냅신(Synapsin), DAT 및 TH의 발현 수준 감소 효과에 의해 달성되는 것일 수 있다.
본 발명의 일 구현예에서, 12개월령 알츠하이머 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직에서 알츠하이머병 특이 아밀로이드 베타(amyloid-beta, Aβ) 플라크 및 Aβ42/40 비율의 수준을 분석한 결과, 주사 후 마우스에서는 대조군 대비 Aβ 플라크 및 Aβ 42/40 비율이 감소하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 알츠하이머병 증상을 개선함을 확인하였다(도 7).
본 발명의 다른 일 구현예에서, 12개월령 파킨슨 질환 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 중뇌 조직에서 도파민성 신경세포 특이 유전자인 Map2, 시냅신(Synapsin), DAT 및 TH의 mRNA 발현 수준을 확인한 결과, 주사 후 마우스에서는 대조군 대비 도파민성 신경세포 특이 유전자인 Map2, 시냅신, DAT 및 TH의 mRNA 발현 수준이 증가하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 파킨슨병 증상을 개선함을 확인하였다(도 8).
본 발명의 또 다른 하나의 양태는 본 발명의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 노화 방지 방법을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 방법은 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환의 예방 또는 치료 방법일 수 있다.
전술한 바와 같이, 본 발명의 GCLC, MAP1S, ENO1 및 KNG1 단백질을 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 단백질의 발현을 증대시키는 조성물;은 노화 억제 효과 및/또는 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환을 개선하는 효과를 갖는바, 이를 포함하는 약학적 조성물은 노화 방지 또는 개선, 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환의 예방, 개선 또는 치료를 목적으로 사용할 수 있다.
상기 조기 노화를 유도하는 질환은 허친슨 길포드 조로증 증후군일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
상기 노화에 의해 유도되는 질환은 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등일 수 있고, 보다 구체적으로, 동맥경화, 간부전, 뇌졸중, 알츠하이머병 및 파킨슨병일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
본 발명에서 용어, "개체"는 인간을 포함한 모든 동물을 의미할 수 있다. 상기 동물은 인간뿐만 아니라 이와 유사한 증상의 치료를 필요로 하는 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있다. 또한 인간을 제외한 동물을 의미할 수 있으나, 이에 제한되지는 않는다.
본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 노화 관련 질환의 의심 개체에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여할 수 있으며, 이에 대해서는 전술한 바와 같다.
본 발명의 약학적 조성물은 노화 관련 질환을 예방 또는 치료하는 것을 목적으로 하는 개체이면 특별히 한정되지 않고, 어떠한 개체에든 적용가능하다. 예를 들면, 원숭이, 개, 고양이, 토끼, 모르모트, 랫트, 마우스, 소, 양, 돼지, 염소 등과 같은 비인간동물, 조류 및 어류 등 어느 것이나 사용할 수 있으며, 상기 약학적 조성물은 비경구, 피하, 복강 내, 폐 내 및 비강 내로 투여될 수 있고, 국부적 치료를 위해, 필요하다면 병변 내 투여를 포함하는 적합한 방법에 의하여 투여될 수 있다. 본 발명의 상기 약학적 조성물의 바람직한 투여량은 개체의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 예를 들어, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관 내 주사에 의해 투여될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 약학적 조성물은 노화 관련 질환을 예방 또는 치료하는 다른 물질을 추가로 포함할 수 있다. 그 예로, 본 발명의 약학적 조성물은 OSKM, OSKM을 발현하는 벡터 또는 OSKM이 처리된 혈장을 추가로 포함할 수 있다.
다른 일 예로, 본 발명에서 제공하는 조성물은 Fgf17, Gpld1, GDF11, superoxide dismutase (SOD), Catalase (CAT), Glutathione(GSH), Glutathione peroxidase(GPx), oxidized glutathione (GSSG). Glutathione S-transferase (GST), Ascorbic acid (vitamin C), α-tocopherol (vitamin E), Folic acid (vitamin B), Polyphenols, carotenoids, Flavonoids, Phenolic Acids, Ferulic acid, Tannin, Catechinic acid, Rosmarinic acid, Apiolin, Hesperetin, Agathisflavone, Monodehydroascorbate reductase (MDHAR), Dehydroscorbate reductase (DHAR), Ascorbate peroxidase (APx), Glutathione reductase (GR), Albumins, Lactoferrin, Metallothioneins, Polyamines, Vitamin K, Ubiquinone, Zinc, Selenium, copper (Cu), iron (Fe) and manganese (Mn), selenium (Se)Allium, Allyl sulfides, Coenzyme Q10, Uric acid, Hydroxycinnamic acid, Hydroxybenzoic acid, lycopene, zeaxanthine, proanthocyanidins, Albumin, Ceruloplasmin, Ferritin, Myoglobin, Transferrin, NADPH, NADH, Lipoic acid, FGF21, insulin-like growth factor-1 (IGF-1), Nicotinamide mononucleotide (NMN), Resveratrol, Metformin, Vitamin D3, Statin, Aspirin, Alpha lipoic acid (ALA), Spermidine, Quercetin, Fisetin, TMG (trimethylglycine or betaine) 중 선택되는 1 이상의 성분을 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 발명의 또 다른 하나의 양태는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물; 중 선택되는 어느 하나를 포함하는, 노화 관련 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 조성물은 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환의 예방 또는 개선 용도를 갖는 것일 수 있다.
전술한 바와 같이, 본 발명에서 제공하는 조성물은 노화 억제 효과 및/또는 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환을 개선하는 효과를 갖는바, 이를 포함하는 약학적 조성물은 노화 방지 또는 개선, 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환의 예방 또는 개선을 목적으로 사용할 수 있다.
상기 조기 노화를 유도하는 질환은 허친슨 길포드 조로증 증후군일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
상기 노화에 의해 유도되는 질환은 혈관내피세포 노화로 유도되는 질환, 장기의 노화로 유도되는 질환, 신경의 노화로 유도되는 질환, 퇴행성 뇌질환 등일 수 있고, 보다 구체적으로, 동맥경화, 간부전, 뇌졸중, 알츠하이머병 및 파킨슨병일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
본 발명의 건강기능식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 본 발명의 건강기능식품 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나 일상적으로 섭취하는 것이 가능하기 때문에 매우 유용하며, 노화 억제 또는 방지 또는 개선 또는 지연 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
상기 건강기능식품은 필수 성분으로 상기 CRISPR/dCas9 복합체 외에는 다른 성분에는 특별히 제한이 없으며 통상의 건강기능식품과 같이 여러가지 생약추출물, 식품 보조 첨가제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 또한, 상기 식품 보조 첨가제는 당업계에 통상적인 식품 보조 첨가제, 예를 들어 향미제, 풍미제, 착색제, 충진제, 안정화제 등을 포함한다.
상기 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외에 향미제로서 천연 향미제(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.
상기 성분 외에도 본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있으며, 그 밖에 천연 과일쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 또한, 건강기능식품은 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 껌류, 아이스크림류, 스프, 음료수, 차, 기능수, 드링크제, 알콜 음료 및 비타민 복합제 중 어느 하나의 형태일 수 있다.
또한 상기 건강기능식품은 식품첨가물을 추가로 포함할 수 있으며, "식품첨가물"로서의 적합여부는 다른 규정이 없는 한 식품의약품안정청에 승인된 식품첨가물공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.
이때, 건강기능식품을 제조하는 과정에서 식품에 첨가되는 조성물은 필요에 따라 그 함량을 적절히 가감할 수 있다.
본 발명의 또 다른 하나의 양태는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물; 중 선택되는 어느 하나를 포함하는, 노화 관련 질환의 예방 또는 치료용 주사제 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
본 발명의 조성물은 주사제 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 하나의 양태는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물; 중 선택되는 어느 하나를 포함하는, 세포 노화 억제용 조성물을 제공한다.
여기에서 사용되는 용어는 전술한 바와 같다.
상기 세포 노화 억제는 ex vivo, in vivo 또는 in vitro에서의 노화일 수 있다.
상기 조성물은 ex vivo, in vivo 또는 in vitro에서 세포 노화를 억제하는 것일 수 있고, 일 예로, ex vivo 또는 in vitro에서 세포 노화를 억제하는 것일 수 있으나, 이에 제한되지 않는다.
이하, 본 발명의 이해를 돕기 위하여 실시예 등을 들어 상세하게 설명하기로 한다. 그러나, 본 발명에 따른 실시예들은 여러가지 다른 형태로 변형될 수 있으며, 본 발명의 범위가 하기 실시예들에 한정되는 것으로 해석되어서는 안된다. 본 발명의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
실험예
<실험예 1> Oct4, Sox2, Klf4 및 c-Myc(OSKM) 처리 혈장 제조
4F2A 마우스에 4주 간 독시사이클린(Doxycycline)이 포함된 식수를 섭식시켜 생체 내에서 Oct4, Sox2, Klf4 및 c-Myc(OSKM) 유전자 발현을 유도하였다. 이후 OSKM이 유도된 4F2A 마우스에서 혈액을 분리한 후 3000rpm에서 30분간 원심분리 한 뒤 혈장(OSKM 처리 혈장)을 분리하였다.
<실험예 2> 모델 마우스 제작 및 OSKM 처리 혈장 및 OSKM 처리 혈장 유래 단백질 주입
조기 노화 마우스 모델은 프로게린(Progerin)을 과발현하는 마우스(프로게린 마우스, Jackson laboratory)를 사용하였다. 알츠하이머 마우스 모델은 아밀로이드 베타(amyloid-beta, Aβ) 관련 돌연변이 유전자 5종(APP 관련 유전자 3종, PSEN1 관련 유전자 2종)이 과발현된 5xFAD(Jackson laboratory) 마우스를 사용하였다. 뇌졸중(Stroke) 마우스 모델은 나일론 실을 이용하여 중대뇌동맥 폐색(middle cerebral artery occlusion, MCAO)을 유도하여 제작하였다. 상기 MCAO 유도는 이전 방법(임병철 외, 한국콘텐츠학회논문지, Vol. 19, No. 7, 2019)을 참고할 수 있다. 파킨슨병 마우스 모델은 마우스 복강에 20 mg/kg의 MPTP(1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine)를 주사하여 제작하였다. 간부전(Liver failure) 마우스 모델은 CCl4(dimethylnitrosamine,thioacetamide):올리브유를 1:3 (v/v)으로 혼합한 혼합물을 1 μL/g 농도로 주 2회 마우스 복강에 투여하여 제작하였다. 야생형 C57BL/6 수컷 마우스는 한국생명공학연구원에서 입수하였다.
모든 마우스는 음식과 물에 자유롭게 접근할 수 있었으며, 23 ± 1℃에서 12시간/12시간 명암 주기 조건을 유지하였다. 마우스를 트리브로모에탄올(Avertin, 120 mg/kg)로 마취시키고, 0.9% 식염수(0.9% w/v 소듐 클로라이드(sodium chloride) 함유)에 희석한 OSKM 처리 혈장; 또는 polycistronic 형태로 제작한, GCLC, MAP1S, ENO1 및 KNG1을 발현하는 벡터;를 꼬리 정맥에 주사하였다. 구체적으로, 초원심분리를 통해 펠렛화된 렌티바이러스를 20ul PBS로 재현탁시킨 후 바이러스 5ul를 현탁액 300ul를 섞어 마우스 꼬리 정맥으로 주입하였다. 여기서 사용한 바이러스 5ul의 역가(titer)는 바이러스 역가(감염 단위 mL-1)가 결정되기 전에 FUW-GFP를 대조군으로 사용하여 GFP 발현을 모니터링하고 감염 다중도를 산출 후의 바이러스 입자수를 의미한다. 상기 GCLC, MAP1S, ENO1 및 KNG1을 발현하는 벡터는 GCLC, MAP1S, ENO1 및 KNG1을 동일 비율로 발현하였다. 주사 후, 마우스는 마취에서 완전히 회복될 때까지 따뜻하게 유지하였다. 주사 후 2주 또는 4주 뒤 마우스를 생화학적 및 행동학적으로 분석하였다.
<실험예 3> 세포 배양
모든 세포는 10% FBS(fetal bovine serum) 및 1% 페니실린/스트렙토마이신(P/S)이 보충된 DMEM 배지(Gibco)에서 37℃ 5% CO2 조건으로 배양하였다. 꼬리 끝(tail-tip) 섬유아세포(TTFs)는 꼬리 끝의 1-2mm 절편을 마우스로부터 수득하고 30초 동안 70% 에탄올로 세척하였다. 조직을 신선한 PBS(phosphate-buffered saline)로 세척하고 멸균 면도날을 사용하여 10cm 조직 배양 접시에서 잘게 다진 다음 EDTA(ethylene-diamine-tetraacetic acid)가 포함된 0.25% 트립신(Gibco)과 함께 37℃에서 30분 동안 배양하였다.
<실험예 4> RNA 분리 및 RT-qPCR
모든 RNA는 eCube 조직 RNA 미니 키트(Philekorea)를 사용하여 제조업체의 지침에 따라 수집 및 정제되었다. 그런 다음 AccuPower® CycleScript RT PreMix(Bioneer, #K-2044-B)를 사용하여 RNA를 cDNA로 역전사시켰다. RT-qPCR 분석은 하기 표 1의 프라이머와 함께 AccuPower® PCR PreMix(Bioneer, #K-2016)를 사용하여 수행하였다. 모든 반응은 Rotor-Gene Q real-time PCR cycler(Qiagen)를 사용하여 수행하였다.
서열번호 서열명 서열(5' - > 3')
9 P21_F CGGTGTCAGAGTCTAGGGGA
10 P21_R ATCACCAGGATTGGACATGG
11 Atf3_F CTCTGGCCGTTCTCTGGA
12 Atf3_R GGTCGCACTGACTTCTGAGG
13 Btg2_F GCGAGCAGAGACTCAAGGTT
14 Btg2_R TAGCCAGAACCTTTGGATGG
15 Mmp13_F TGATGAAACCTGGACAAGCA
16 Mmp13_R GGTCCTTGGAGTGATCCAGA
17 Mmp12_F AGTCCAGCCACCAACATTAC
18 Mmp12_R GCTCCTGCCTCACATCATAC
19 IL-6_F TGATGCACTTGCAGAAAACA
20 IL-6_R ACCAGAGGAAATTTTCAATAGGC
21 IL-1a_F GAAGAAGAGACGGCTGAGTTT
22 IL-1a_R AACCAAGTGGTGCTGAGATAG
23 Cdkn1a_F CGTGGACAGTGAGCAGTT
24 Cdkn1a_R GACACCAGAGTGCAAGACA
25 Cdkn2a_F CGTTCACGTAGCAGCTCTT
26 Cdkn2a_R ATCGCACGATGTCTTGATGT
27 Cxcl1_F CCGCTCGCTTCTCTGTG
28 Cxcl1_R GACCATTCTTGAGTGTGGCTAT
29 Cxcl2_F GTGAACTGCGCTGTCAATG
30 Cxcl2_R GCCTTGCCTTTGTTCAGTATC
<실험예 5> 웨스턴 블롯
세포 및 조직을 RIPA 완충액(1% NP-40, 0.5% DOC(sodium deoxycholate), 0.1% SDS 및 150mmol/L NaCl를 포함하는 50mmol/L Tris, pH 8.0, Sigma-Aldrich) 및 1x 프로테아제 억제제와 혼합하여 균질화하였다. 다음으로, 샘플을 5x 로딩 버퍼와 혼합하고 100℃에서 10분 동안 끓였다. 10 ug의 추출된 단백질을 12% 폴리아크릴아미드 겔에서 SDS-PAGE를 수행하여 분리하고 니트로셀룰로오스 막(10600001, GE Healthcare)으로 옮겼다. 단백질 농도는 Quick Start Bradford 단백질 분석(Bio-Rad)을 사용하여 정량하였다. 막을 5% BSA(Bovine serum albumin)에서 차단하고 4℃에서 일차 항체와 함께 밤새 배양하였다. 막을 PBS로 3회 세척한 다음, 실온에서 2시간 동안 이차 항체와 함께 배양하였다. 각 단백질 밴드는 ECL kit (DG-WF200; Dogen)를 사용하여 시각화하였고, ImageJ(NIH) 소프트웨어로 정량하였다. 사용된 항체는 항-H3K9me3(abcam, #ab8898), 항-H4K20me3(abcam, #ab78517), α-SMA(Alpha Smooth Muscle Actin) 및 항-β-액틴(abfrontier, #LF-PA0207)이며, β-액틴을 로딩 대조군으로 사용하였다.
<실험예 6> 동물 행동 실험
행동 분석을 위해 모델 마우스를 대상으로 오픈 필드 테스트를 수행하였다. 마우스를 직사각형 챔버(가로 50cm, 세로 50cm, 높이 38cm)에 놓고, 15분 동안 마우스가 직사각형 챔버의 중앙영역(가로 25cm, 세로 25cm)으로 이동하는 빈도를 계수하여 마우스의 운동성(Locomotor)을 측정하였다.
<실험예 7> 세포 염색
마우스 대동맥(Aorta)를 분리하고 4% 파라포름알데하이드(paraformaldehyde, PFA)로 세포를 고정한 다음 이를 파라핀 블록으로 제작하여 마이크로톰으로 대동맥 조직을 미세 절단하였다. 이 후 절단된 파라핀조직 샘플을 헤마톡실린(Hematoxylin) 및 에오신(Eosin)을 이용하여 H&E 염색하였다. 그 외 VVG(Verhoeff Van Gieson), MT(Masson's Trichrome) 및 ORO(Oil Red O) 염색은 절단된 파라핀조직 샘플과 키트(Verhoeff Van Gieson Elastic Stain Kit, Masson's Trichrome Stain Kit, Oil Red O - Lipid Stain Kit)를 이용하여 제조사의 프로토콜에 따라 염색하였다.
<실험예 8> 면역형광 염색
세포를 OSKM 처리 혈장 또는 GCLC, Map1s, ENO1 및 KNG1 발현 벡터로 형질전환시킨 후 24시간 동안 24 웰 플레이트에서 배양하였다. 면역형광 염색을 위해 PBS로 세포를 세척한 후 4% 파라포름알데히드(paraformaldehyde) 처리하여 상온에서 10분간 고정하였다. 이후 PBS로 두 번 세척한 후 3% BSA와 0.1% Triton X-100이 포함된 PBS로 상온에서 3시간 동안 차단하였다. 일차 항체는 제조사에서 권장하는 희석도로 사용하였다. 세포를 일차 항체로 4℃에서 24시간 동안 염색한 다음, Alexa488 또는 Alexa 594(Invitrogen)와 접합된 이차 항체와 배양하고, DAPI(4',6-diamidino-2-phenylindole) 염색하였다. 다용도 공초점 현미경(LSM-800, Zeiss)을 사용하여 200X 배율에서 플레이트에서 무작위로 선택된 10개 필드의 세포 수를 산출하였다. 사용된 항체는 항-H3K9me3(abcam, #ab8898), 항-H4K20me3(abcam, #ab78517), α-SMA(Alpha Smooth Muscle Actin) 및 항-β-액틴(abfrontier, #LF-PA0207)이며, β-액틴을 로딩 대조군으로 사용하였다.
<실험예9> 액체 크로마토그래피 질량분석기(liquid chromatography-tandem mass spectrometry, LC/MS) 분석
마우스로부터 혈액을 수득하고 3000rpm으로 30분간 원심분리하여 상층액인 혈청을 분리한 다음, LC/MS를 이용하여 분리된 혈청 속 단백질 분자의 정성 및 정량적 분석을 수행하였다.
<실험예 10> 벡터 제작
마우스 게놈 DNA에서 Gclc, Eno1, Map1s 및 Kng1 단백질의 코딩 영역에 해당하는 염기서열을 PCR로 증폭시켰다. Gclc, Eno1, Map1s 및 Kng1 단백질의 각각의 조합(GEMK, GEM, GEK, GMK, EMK, GE, GM, GK, EM, EK, MK)에 해당하는 염기서열을 렌티바이러스 벡터에 도입하고, 2A sequence를 통하여 각 조합별 벡터를 제작하였다. 각 유전자 및 조합 유전자 발현을 위하여 CMV 프로모터를 사용하였다. 제작된 벡터는 이후 렌티바이러스로 제작되었다.
<실험예 11> 렌티바이러스 벡터 제작
FUW-TetO-돌연변이 laminA/C(LMNA)에 대한 마우스 상보적 DNA(cDNA)를 포함하고, 프로게린(Progerin)을 과발현하는 렌티바이러스 벡터를 제작하였다. HEK293T 세포를 10% FBS 및 1% P/S를 함유하는 DMEM 배지에서 배양하였다. 형질감염 전날, 2X107 개의 세포를 배지를 포함하는 15 cm 배양 접시에 시딩하였다. 다음날, 세포를 인산칼슘 공동 침전을 통해 렌티바이러스 구축물 psPAX2, pMD2.G 및 FUW-tetO-돌연변이 LMNA로 공동 형질감염시켰다. 형질감염 24시간 후에 배지를 교체하고, 형질감염 72시간 후에 바이러스를 수득하였다. 렌티바이러스를 함유하는 상층액을 수집하고, 원심분리하여 세포 파편을 제거한 다음, 0.45 μm 필터를 통해 여과하였다. 렌티바이러스를 표준 초원심분리를 통해 펠렛화하고 차가운 PBS로 재현탁시켰다. 바이러스 역가(감염 단위 mL-1)가 결정되기 전에 FUW-GFP를 대조군으로 사용하여 GFP 발현을 모니터링하고 감염 다중도를 산출하였다.
<실험예 12> 형질감염
형질감염 전날, 세포를 플레이트에 대해 75-80%의 밀도로 시딩하였다. 리포펙타민 3000(Lipofectamine 3000) 시약(Thermo Fisher)을 사용하여 72시간 동안 3회 연속 형질감염을 수행하였다. 6 웰 플레이트에 있는 세포의 단층을 리포펙타민 3000 시약 대 DNA의 5:2 또는 6:2 비율의 구조물로 형질감염시킨 다음 제조업체의 프로토콜에 따라 12시간 동안 배양하였다. 형질감염 12시간 후에 배지를 교체하였다.
<실험예 13> 노화 연관 베타-갈락토시다제(Senescence-associated beta-galactosidase, SA-β-gal) 분석
세포를 4% 파라포름알데히드로 실온에서 5분 동안 고정시킨 다음, PBS로 2회 세척하였다. 40mM 시트르산/Na 인산염 완충액, 5mM K4[Fe(CN)6] 3H2O, 5 mM K3[Fe(CN)6], 150mM 염화나트륨, 2mM 염화마그네슘 및 1mg/ml X-gal을 포함하는 염색 용액에서 37℃로 밤새 배양하였다. 세포를 PBS로 2회 세척한 다음 메탄올로 1회 세척하고, 세포를 건조시킨 다음 명시야 현미경을 사용하여 촬영하였다.
<실험예 14> 신경학적 분석
뇌졸중 마우스 모델의 신경학적 분석을 위해 NSS(Neurological severity score) 측정 및 경색(Infarcted) 부위 부피를 측정하였다. NSS 측정을 위해 케이지 안에서 마우스가 앞다리를 이용하여 정상적인 운동성을 보이는지 측정하여 Zea-longa score를 매겼다. 또한, 높이 70 cm, 0.5 cm 직경의 바(Bar)를 앞다리로 잡고 유지하는 능력 평가(Grab and hold ability test), 앞다리로 바닥과 접촉을 유지하는 능력 평가(Circling behavior Test)를 수행하였다. 경색 부위 부피를 측정하기 위해, 마우스 뇌를 분리하여 4% PFA로 세포를 고정한 뒤 이를 0.45 um 두께로 절단하여 TTC(Triphenyltetrazolium chloride) 및 CV(cresyl violet) 염색을 수행하였다.
실시예
<실시예 1> OSKM 처리 혈장 내 단백질 스크리닝 및 OSKM 처리 혈장 및 OSKM 처리 혈장 유래 단백질의 노화 관련 지표 개선
OSKM이 유도된 4F2A 마우스로부터 유래하는 혈장(OSKM 처리 혈장) 내 단백질을 분석하기 위하여 LC/MS를 수행하고, OSKM이 유도되지 않은 4F2A 마우스 유래의 혈장(대조군)과 비교하였다(도 1a-c).
그 결과, OSKM 처리 혈장에서는 대조군 혈장 대비 특이적으로 17종의 혈장 단백질(GCLC, MAP1S, ENO1, KNG1, AFP, A2m, SAA2, YWHAG, PFKM, GDI2, ORM2, PCSK9, PSMD9, SNAP91, SLC17A9, PRG4, 및 SLC16A7)이 유도됨을 확인하였다(도 1d).
이에, 17종 단백질 중 암 관련 단백질 13종을 제외한 나머지 4종 단백질(GCLC, MAP1S, ENO1 및 KNG1)을 선정하였다.
다음으로, 돌연변이 laminA/C(LMNA)가 형질도입되어 노화된 마우스 섬유아세포를 OSKM 처리 혈장을 10㎕/ml 농도로 처리하여 5일간 배양하거나, 17종의 단백질 중 4종의 단백질(GCLC, MAP1S, ENO1 및 KNG1)을 코딩하는 벡터로 세포 내 형질전환하여 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도하고 5일 후, 각 세포에서 노화 관련 히스톤 마커(H3K9me3 및 H4K20me3)의 발현 수준을 면역형광 염색을 통해 분석하였다.
그 결과, 세포에 OSKM 처리 혈장을 처리하거나(도 2a-b), OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도하는 경우(도 2c-d), H3K9me3의 발현 수준은 증가하고, H4K20me3의 발현 수준이 감소하여 노화 관련 지표가 개선됨을 확인하였다.
다음으로, 6개월(young) 및 자연적으로 노화가 유도된 24개월령(old) C57BL/6 마우스에 OSKM 처리 혈장을 주사 후, 각 장기 유래 세포에서 노화 관련 유전자의 발현 수준을 평가하기 위해 스트레스 반응 유전자인 p21, Btg2 및 Atf, ECM(extracellular matrix) 리모델링 유전자인 MMP12, MMP13 및 IL-6, SASP(Senescence-Associated Secretory Phenotype) 유전자인 IL-1a, Cdkn1a 및 Cdkn2a, 노화 관련 유전자인 Cxcl1 및 Cxcl2에 대한 qRT-qPCR 분석을 수행하였다.
그 결과, 노화 마우스 유래 섬유아세포에서 노화 관련 유전자의 발현 수준이 현저히 증가되었으나, OSKM 처리 혈장을 처리한 세포에서는 노화 관련 유전자의 발현 수준이 감소되었다(도 5b).
이로부터 OSKM 처리 혈장을 처리하거나, OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1의 발현을 유도하는 경우, 세포에서 노화 관련 지표가 개선됨을 확인하여, OSKM 처리 혈장에서 특이적으로 발현되는 17종의 단백질 중 상기 4종의 단백질이 노화 억제 효과가 있음을 확인하였다.
OSKM 처리 혈장에서 특이적으로 발현되는 17종의 단백질 중 노화 억제 효과가 있는 것으로 확인된 GCLC, MAP1S, ENO1 또는 KNG1을 포함한 다양한 조합을 발현하는 벡터[GCLC+ENO1(GE), GCLC+KNG1(GK), GCLC+MAP1S(GM), ENO1+MAP1S(EM), MAP1S+KNG1(MK), ENO1+MAP1S(EK), GCLC+ENO1+MAP1S(GEM), GCLC+ENO1+KNG1(GEK), GCLC+MAP1S+KNG1(GMK), ENO1+MAP1S+KNG1(EMK), GCLC+MAP1S+ENO1+KNG1(GEMK) 벡터]를 야생형 마우스 꼬리 끝 섬유아세포에 각각 형질전환하고 3일 후, 노화 관련 베타 갈락토시다제 양성 세포 수와 노화가 진행됨에 따라 증가하는 세포 노화 마커인 cleaved-Caspase3 및 gamma-H2AX의 intensity를 측정하였다.
그 결과, GCLC, MAP1S, ENO1 또는 KNG1 단독 처리에서 베타 갈락토시다제 양성 세포가 감소하였으나, 이들의 2 이상의 조합을 처리하였을 때 베타 갈락토시다제 양성 세포 감소 효과가 더 우수하였으며, 특히, 3개 조합 GCLC+ENO1+MAP1S(GEM), GCLC+ENO1+KNG1(GEK), GCLC+MAP1S+KNG1(GMK), ENO1+MAP1S+KNG1(EMK)과 4개 조합 GCLC+MAP1S+ENO1+KNG1(GEMK)을 처리하였을 때, 베타 갈락토시다제 양성 세포 및 cleaved-Caspase3 와 gamma-H2AX의 intensity 감소 효과가 가장 우수하여, 대조군인 야생형 마우스 섬유아세포와 유사한 수준으로 감소함을 확인하였다(도 3).
이로부터 GCLC, MAP1S, ENO1 또는 KNG1 단독 및 이의 조합의 발현을 유도하는 경우, 세포에서 노화 관련 지표가 개선됨을 확인하여, OSKM 처리 혈장에서 특이적으로 발현되는 17종의 단백질 중 상기 4종의 단백질이 노화 억제 효과가 있음을 확인하였다.
특히, GCLC, MAP1S, ENO1 또는 KNG1 단독보다 4가지 단백질 중 2 이상을 포함하는 다양한 조합을 통하여 발현시켰을 때 세포에서 노화 관련 지표가 현저히 개선되어, 4종의 단백질의 조합에서 노화 억제 효과가 현저함을 확인하였다.
<실시예 2> OSKM 처리 혈장 및 OSKM 처리 혈장 유래 단백질 투여에 의한 노화 모델 마우스에서의 노화 관련 지표 개선
OSKM 처리 혈장 투여를 통해 in vivo에서 노화 관련 표현형을 개선할 수 있는지를 조사하였다.
10개월령 조기 노화 모델 마우스에 OSKM 처리 혈장을 주사하여 외관, 대동맥 및 장기에서의 노화 관련 지표가 개선되는지를 조사하였다.
주사 후 마우스에서는 대조군 대비 척추 곡률 감소를 포함하여 외관이 상당히 개선되었으며(도 4c), 체중 감소가 억제되고(도 4a), 수명이 증가됨을 확인하였다(도 4b).
다음으로, 조기 노화 모델 마우스에 OSKM 처리 혈장 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E, VVG, MT 및 ORO 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군 대비 대동맥 경직 및 섬유화 증상이 개선되었다(도 4d-e).
또한, 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 대동맥에서 경직 및 섬유화 증상을 H&E 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군(6개월령 마우스) 대비 대동맥 경직 및 섬유화 증상이 개선되었다(도 6b-c).
다음으로, 조기 노화 모델 마우스에 OSKM 처리 혈장 주사 후 4주 뒤 간, 비장, 신장 및 피부에서의 노화 증상을 H&E 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군(5개월령 마우스) 대비 노화가 진행됨에 따라 증가하는 거대(enlarged) 세포가 간에서 감소하였고, 비장의 생식 중심(germinal center)의 크기가 증가하였다. 또한, 신장의 사구체(glomeruli) 수가 증가하였고, 피부에서는 표피(epidermis) 두께가 증가함에 따라 노화 증상이 개선되었다(도 4f-g).
또한, 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 간, 비장 및 신장에서의 노화 증상을 동일하게 분석한 결과, 주사 후 마우스에서는 대조군(6개월령 마우스) 대비 장기 노화 증상이 개선되었다(도 6a).
다음으로, 6개월(young), 18개월(mid-aged) 및 자연적으로 노화가 유도된 24개월령(old) 야생형 C57BL/6 마우스에 OSKM 처리 혈장을 주사 후 오픈 필드 테스트를 수행한 결과, 주사 후 마우스에서는 대조군 대비 운동 활성이 증가하였다(도 5a).
다음으로, OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1 투여를 통해 in vivo에서 심장 노화 관련 표현형을 개선할 수 있는지를 조사하였다.
10개월령 조기 노화 모델 마우스 및 24개월령 야생형 C57BL/6 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주사 후 4주 뒤 심장 대동맥 조직에서 심근세포(Cardiac Myofibroblast) 수를 α-SMA 면역형광 염색을 통해 분석한 결과, 주사 후 마우스에서는 대조군 대비 α-SMA 양성 세포가 증가하여, 심근세포의 수가 증가하는 것을 확인하였다(도 6d-e).
이로부터 OSKM 처리 혈장 및 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 조기 노화 모델 마우스 및 노화 마우스의 외관, 대동맥 및 장기에서 노화 관련 지표가 개선됨을 확인하였다.
<실시예 3> OSKM 처리 혈장 유래 단백질 투여에 의한 알츠하이머병 모델 마우스에서의 알츠하이머병 관련 지표 개선
12개월령 알츠하이머 모델 마우스에 GCLC, MAP1S, ENO1 및 KNG1을 발현하는 벡터를 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직에서 알츠하이머병 특이 아밀로이드 베타(amyloid-beta, Aβ) 플라크 및 Aβ 42/40 비율의 수준을 분석하였다.
그 결과, 주사 후 마우스에서는 대조군 대비 Aβ 플라크 및 Aβ 42/40 비율이 감소하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 알츠하이머병 증상을 개선함을 확인하였다(도 7).
<실시예 4> OSKM 처리 혈장 유래 단백질 투여에 의한 파킨슨병 모델 마우스에서의 파킨슨병 관련 지표 개선
12개월령 파킨슨 질환 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 중뇌 조직에서 도파민성 신경세포 특이 유전자인 Map2, 시냅신(Synapsin), DAT 및 TH의 mRNA 발현 수준을 확인하였다.
그 결과, 주사 후 마우스에서는 대조군 대비 도파민성 신경세포 특이 유전자인 Map2, 시냅신, DAT 및 TH의 mRNA 발현 수준이 증가하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 파킨슨병 증상을 개선함을 확인하였다(도 8).
<실시예 5> OSKM 처리 혈장 유래 단백질 투여에 의한 뇌졸중 모델 마우스에서의 뇌졸중 관련 지표 개선
뇌졸중 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 뇌 조직을 신경학적 분석하였다.
그 결과, 주사 후 마우스에서는 대조군 대비 경색(infarct) 용적과 신경학적 결손 점수(neurological deficit score)가 감소하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 뇌졸중 증상을 개선함을 확인하였다(도 9).
<실시예 6> OSKM 처리 혈장 유래 단백질 투여에 의한 간부전 모델 마우스에서의 간부전 관련 지표 개선
간부전 모델 마우스에 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물을 주입한 후 2주 뒤 혈장 단백질을 분석하였다.
그 결과, 주사 후 마우스에서는 대조군 대비 ATL(alanine transaminase), AST(aspartate transaminase)의 수준이 감소하고, 혈장 ALB(albumin)의 수준이 증가하여, GCLC, MAP1S, ENO1 및 KNG1을 포함하는 조성물 투여가 간부전 증상을 개선함을 확인하였다(도 10).
상기 실시예의 결과로부터, OSKM 처리 혈장 및 OSKM 처리 혈장 유래 GCLC, MAP1S, ENO1 및 KNG1은 in vitro 및 in vivo에서 노화 관련 표현형을 개선하고, 노화 관련 질환인 조로증, 알츠하이머병, 파킨슨병, 뇌졸중 및 간부전 등의 증상을 개선하는바, 노화 관련 질병을 예방, 개선 또는 치료할 수 있다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 다른 당 업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변경된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (17)

  1. GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질; 또는 상기 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물.
  2. GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물을 유효성분으로 하는 노화 관련 질환의 예방 또는 치료용 약학적 조성물.
  3. 제1항 또는 제2항에 있어서, 상기 GCLC 단백질은 서열번호 1의 아미노산 서열을 포함하는 것인, 조성물.
  4. 제1항 또는 제2항에 있어서, 상기 MAP1S 단백질은 서열번호 3의 아미노산 서열을 포함하는 것인, 조성물.
  5. 제1항 또는 제2항에 있어서, 상기 ENO1 단백질은 서열번호 5의 아미노산 서열을 포함하는 것인, 조성물.
  6. 제1항 또는 제2항에 있어서, 상기 KNG1 단백질은 서열번호 7의 아미노산 서열을 포함하는 것인, 조성물.
  7. 제2항에 있어서, 상기 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물은 GCLC 단백질을 코딩하는 폴리뉴클레오티드, MAP1S 단백질을 코딩하는 폴리뉴클레오티드, ENO1 단백질을 코딩하는 폴리뉴클레오티드 및 KNG1 단백질을 코딩하는 폴리뉴클레오티드 중 2 이상을 포함하는 벡터인 것인, 조성물.
  8. 제1항 또는 제2항에 있어서, 상기 약학적 조성물은 세포 노화 억제 효과를 갖는 것인 것인, 조성물.
  9. 제8항에 있어서, 상기 세포 노화 억제 효과는 다음 중 선택되는 어느 하나 이상의 효과인 것인, 조성물:
    i) 노화 관련 유전자의 발현 수준 감소;
    ii) DNA 이중 가닥 파손 수준 감소; 및
    iii) 베타 갈락토시다제 양성 세포 수 감소.
  10. 제1항 또는 제2항에 있어서, 상기 약학적 조성물은 노화 관련 질환을 개선하는 효과를 갖는 것인 것인, 조성물.
  11. 제10항에 있어서, 상기 노화 관련 질환의 개선 효과는 다음 중 선택되는 어느 하나 이상의 효과인 것인, 조성물:
    i) 척추 곡률 감소;
    ii) 체중 감소 억제;
    iii) 수명 증가;
    iv) 운동 활성 증가; 및
    v) 장기 및 피부의 노화 개선.
  12. 제1항 또는 제2항에 있어서, 상기 노화 관련 질환은 조기 노화를 유도하는 질환 또는 노화에 의해 유도되는 질환 중 선택되는 어느 하나 이상인 것인, 조성물.
  13. 제12항에 있어서, 상기 조기 노화를 유도하는 질환은 허친슨 길포드(Hutchinson Guilford) 조로증 증후군(HGPS), 조로증, HIV 감염과 관련된 조기 노화, 근육 퇴행 위축, 샤르코-마리-투스 질환(Charcot-Marie-Tooth disease), 베르너(Werner) 증후군, 인슐린 내성 타입 II 당뇨병, 골다공증, 피부 노화 및 제한 피부병증(restrictive dermopathy)으로부터 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  14. 제12항에 있어서, 상기 노화에 의해 유도되는 질환은 동맥경화, 간부전, 뇌졸중, 퇴행성 뇌질환, 알츠하이머병, 파킨슨병, 고혈압, 인지기능장애, 근감소증, 안구건조증, 황반변성, 원시, 근시, 백내장, 이명, 난청, 소화불량, 설사, 자가면역질환, 폐렴, 독감, 파상풍, 감염성 심내막염, 폐렴, 독감, 파상풍, 감염성 심내막염, 암, 과민성 방광, 요실금, 전립선 비대증, 하부요로증상, 사구체 신염, 만성 신부전, 뇌졸중, 골다공증, 관절염, 당뇨병, 신부전, 만성폐쇄성 폐질환 및 폐섬유화증으로부터 이루어지는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.
  15. 제1항 또는 제2항의 약학적 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, 노화 방지 방법.
  16. GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질 또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 조성물; 또는 GCLC, MAP1S, ENO1 및 KNG1 중 선택되는 2 이상의 단백질의 발현을 증대시키는 조성물; 중 선택되는 어느 하나를 포함하는, 세포 노화 억제용 조성물.
  17. 제16항에 있어서, 상기 조성물은 in vitro 또는 ex vivo에서 세포 노화를 억제하는 것인, 세포 노화 억제용 조성물.
PCT/KR2023/016116 2022-10-18 2023-10-18 혈장 유래 단백질을 포함하는 노화 방지용 조성물 WO2024085637A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20220134415 2022-10-18
KR10-2022-0134415 2022-10-18
KR1020230061859A KR20240054856A (ko) 2022-10-18 2023-05-12 혈장 유래 단백질을 포함하는 노화 방지용 조성물
KR10-2023-0061859 2023-05-12

Publications (1)

Publication Number Publication Date
WO2024085637A1 true WO2024085637A1 (ko) 2024-04-25

Family

ID=90738231

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/016116 WO2024085637A1 (ko) 2022-10-18 2023-10-18 혈장 유래 단백질을 포함하는 노화 방지용 조성물

Country Status (1)

Country Link
WO (1) WO2024085637A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080057233A (ko) * 2005-08-23 2008-06-24 가부시키가이샤환케루 피부 노화 마커와 그의 이용기술
JP2018520211A (ja) * 2015-05-28 2018-07-26 セルラリティ インコーポレイテッド 再生機関を回復させる、プロテオームの欠陥を補正する、寿命を延長するための、胎盤由来幹細胞およびその使用
KR20210008817A (ko) * 2019-07-15 2021-01-25 사회복지법인 삼성생명공익재단 에티오나마이드를 이용한 줄기세포의 효능 강화방법
WO2022074066A1 (en) * 2020-10-06 2022-04-14 European Molecular Biology Laboratory Screening method for the identification of novel therapeutic compounds
KR102451938B1 (ko) * 2021-12-29 2022-10-07 줄리아 연구소 주식회사 프로테오믹 분석 및 바이오마커를 이용한 노인황반변성 진단용 조성물, 노인황반변성 진단을 위한 정보제공방법 및 노인황반변성 치료용 물질의 스크리닝 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080057233A (ko) * 2005-08-23 2008-06-24 가부시키가이샤환케루 피부 노화 마커와 그의 이용기술
JP2018520211A (ja) * 2015-05-28 2018-07-26 セルラリティ インコーポレイテッド 再生機関を回復させる、プロテオームの欠陥を補正する、寿命を延長するための、胎盤由来幹細胞およびその使用
KR20210008817A (ko) * 2019-07-15 2021-01-25 사회복지법인 삼성생명공익재단 에티오나마이드를 이용한 줄기세포의 효능 강화방법
WO2022074066A1 (en) * 2020-10-06 2022-04-14 European Molecular Biology Laboratory Screening method for the identification of novel therapeutic compounds
KR102451938B1 (ko) * 2021-12-29 2022-10-07 줄리아 연구소 주식회사 프로테오믹 분석 및 바이오마커를 이용한 노인황반변성 진단용 조성물, 노인황반변성 진단을 위한 정보제공방법 및 노인황반변성 치료용 물질의 스크리닝 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALEXEY MOSKALEV: "The Neuronal Overexpression of Gclc in Drosophila melanogaster Induces Life Extension With Longevity-Associated Transcriptomic Changes in the Thorax", FRONTIERS IN GENETICS, FRONTIERS RESEARCH FOUNDATION, SWITZERLAND, vol. 10, 1 January 2019 (2019-01-01), Switzerland , XP093161028, ISSN: 1664-8021, DOI: 10.3389/fgene.2019.00149 *
ALEXEY MOSKALEV;MIKHAIL SHAPOSHNIKOV;EKATERINA PROSHKINA;ALEXEY BELYI;ALEXANDER FEDINTSEV;SVETLANA ZHIKRIVETSKAYA;ZULFIYA GUVATOVA: "The influence of pro-longevity gene overexpression on the age-dependent changes in transcriptome and biological functions", BMC GENOMICS, BIOMED CENTRAL LTD, LONDON, UK, vol. 17, no. 14, 28 December 2016 (2016-12-28), London, UK , pages 273 - 289, XP021264126, DOI: 10.1186/s12864-016-3356-0 *

Similar Documents

Publication Publication Date Title
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
AU2017335084B2 (en) Compositions containing protein loaded exosome and methods for preparing and delivering the same
WO2019182370A1 (ko) Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
AU2020203955B2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2024085637A1 (ko) 혈장 유래 단백질을 포함하는 노화 방지용 조성물
WO2019143201A1 (ko) 재조합 백시니아 바이러스 및 이를 포함하는 약학 조성물
WO2018026212A2 (ko) 섬유증 질환 모델의 제조방법 및 섬유증 질환 모델의 용도
WO2020226438A1 (ko) 염증성 장질환의 예방 또는 치료용 펩타이드
WO2020017788A1 (ko) Cd9를 이용한 당뇨병의 예방 또는 치료용 조성물과 당뇨병 치료제 스크리닝 방법
WO2020055129A1 (ko) 베르베논 유도체를 포함하는 암 치료 또는 예방용 조성물
WO2020071641A1 (ko) Tsp1 단백질 억제제를 유효성분으로 함유하는 파브리 병의 예방 또는 치료용 약학적 조성물
WO2015072708A1 (ko) 성체 섬유모세포를 형질전환(이형분화)시켜 혈관내피세포를 제조하는 방법 및 이의 용도
EP2714896A1 (en) An adult stem cell line introduced with hepatocyte growth factor gene and neurogenic transcription factor gene with basic helix-loop-helix motif and uses thereof
WO2018236194A1 (ko) Gas6 단백질 또는 이의 수용체 활성화제를 포함하는 섬유증의 예방 또는 치료용 조성물
WO2021002664A1 (ko) 암의 예방, 개선 또는 치료용 조성물
WO2017213435A1 (ko) Slit-robo 시스템을 이용한 근감소증 예방 또는 치료용 조성물
WO2016068616A1 (ko) C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물
WO2018038539A2 (ko) Eprs 단백질 또는 이의 단편을 포함하는 항rna-바이러스용 조성물
WO2022025455A1 (ko) 염증성 질환의 예방 또는 치료용 조성물 및 이의 용도
WO2022071753A1 (ko) Plgf를 포함하는 신경정신질환의 예방 또는 치료용 조성물
WO2022102984A1 (ko) 다낭성 신장질환 치료제 및 이의 스크리닝 방법
WO2024072143A1 (ko) 4r 타우병증의 치료 또는 예방용 펩티드
WO2022045775A1 (ko) 알츠하이머 치매 예방 또는 치료용 펩타이드 조성물
WO2021251602A1 (ko) Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물