WO2021251602A1 - Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물 - Google Patents

Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021251602A1
WO2021251602A1 PCT/KR2021/004056 KR2021004056W WO2021251602A1 WO 2021251602 A1 WO2021251602 A1 WO 2021251602A1 KR 2021004056 W KR2021004056 W KR 2021004056W WO 2021251602 A1 WO2021251602 A1 WO 2021251602A1
Authority
WO
WIPO (PCT)
Prior art keywords
phf20
muscle
expression
inhibitor
cells
Prior art date
Application number
PCT/KR2021/004056
Other languages
English (en)
French (fr)
Inventor
박종선
박지수
이현지
Original Assignee
주식회사 미토스테라퓨틱스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 미토스테라퓨틱스 filed Critical 주식회사 미토스테라퓨틱스
Priority to US17/791,764 priority Critical patent/US20230193283A1/en
Priority to EP21821480.7A priority patent/EP4070821A4/en
Priority to CN202180007800.4A priority patent/CN114929290A/zh
Priority to JP2022539268A priority patent/JP2023508689A/ja
Publication of WO2021251602A1 publication Critical patent/WO2021251602A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/153—Nucleic acids; Hydrolysis products or derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40—Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/0056—Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0087—Galenical forms not covered by A61K9/02 - A61K9/7023
    • A61K9/0095—Drinks; Beverages; Syrups; Compositions for reconstitution thereof, e.g. powders or tablets to be dispersed in a glass of water; Veterinary drenches
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1617—Organic compounds, e.g. phospholipids, fats
    • A61K9/1623—Sugars or sugar alcohols, e.g. lactose; Derivatives thereof; Homeopathic globules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A61K9/2004—Excipients; Inactive ingredients
    • A61K9/2009—Inorganic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A61K9/2004—Excipients; Inactive ingredients
    • A61K9/2013—Organic compounds, e.g. phospholipids, fats
    • A61K9/2018—Sugars, or sugar alcohols, e.g. lactose, mannitol; Derivatives thereof, e.g. polysorbates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/20—Pills, tablets, discs, rods
    • A61K9/2004—Excipients; Inactive ingredients
    • A61K9/2022—Organic macromolecular compounds
    • A61K9/205—Polysaccharides, e.g. alginate, gums; Cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/4816—Wall or shell material
    • A61K9/4825—Proteins, e.g. gelatin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/4841—Filling excipients; Inactive ingredients
    • A61K9/4858—Organic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/4841—Filling excipients; Inactive ingredients
    • A61K9/4866—Organic macromolecular compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/316—Foods, ingredients or supplements having a functional effect on health having an effect on regeneration or building of ligaments or muscles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Definitions

  • the present invention relates to the function of PHF20 (PHD finger protein 20) in a muscle differentiation mechanism, and more particularly, to the use of a PHF20 gene expression inhibitor or PHF20 protein activity inhibitor.
  • the mass of skeletal muscle accounts for 40 to 50% of the human body weight, and is the largest tissue in the body.
  • the development of skeletal muscle requires mechanisms that include myogenic lineage commitment, myoblast proliferation, and terminal differentiation.
  • the process of myogenesis serves as a terminal effector of the signaling cascade and is regulated by appropriate developmental stage-specific transcripts. Differentiation stages are controlled by a complex network of muscle-specific transcription factors, including the myogenic differentiation marker (MyoD) family, the myocyte enhancer factor-2 (MEF2) family, and other transcription factors.
  • MyoD myogenic differentiation marker
  • MEF2 myocyte enhancer factor-2
  • Sarcopenia which is caused by a decrease in muscle, is mainly caused by a decrease in muscle due to aging.
  • aging is emerging as an important problem not only in Korea but also worldwide, social interest in sarcopenia is growing.
  • WHO World Health Organization
  • the present inventors completed the present invention by elucidating the mechanism of PHF20 in muscle differentiation.
  • a pharmaceutical composition for preventing or treating diseases caused by muscle loss comprising a PHF20 (PHD finger protein 20) gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
  • Another object of the present invention PHF20 gene expression inhibitor or PHF20 protein activity inhibitor; Or YY1 promoter activity inhibitor; to provide a pharmaceutical composition for preventing or treating diseases, including, muscle loss.
  • Another object of the present invention is to provide a composition for increasing muscle or inhibiting muscle loss, comprising a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor as an active ingredient.
  • Another object of the present invention is to provide a method for treating a disease caused by muscle loss, comprising the step of treating an individual in need thereof with a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor.
  • the present invention provides a pharmaceutical composition for preventing or treating a disease caused by muscle loss, comprising a PHF20 (PHD finger protein 20) gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
  • a pharmaceutical composition for preventing or treating a disease caused by muscle loss comprising a PHF20 (PHD finger protein 20) gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
  • the present invention is a PHF20 gene expression inhibitor or PHF20 protein activity inhibitor; Or YY1 promoter activity inhibitor; provides a pharmaceutical composition for the prevention or treatment of diseases caused by muscle loss, including.
  • the present invention provides a health functional food composition for increasing muscle or inhibiting muscle loss comprising a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor as an active ingredient.
  • the present invention also provides a feed additive composition for increasing muscle or inhibiting muscle loss comprising a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor as an active ingredient.
  • the present invention also provides a method for treating a disease caused by muscle loss, comprising the step of treating an individual in need thereof with a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor.
  • the PHF20 gene expression inhibitor or the PHF20 protein activity inhibitor according to the present invention promotes muscle differentiation in vitro and in vivo, and thus is diverse in the field of prevention, improvement or treatment of diseases caused by muscle loss. can be utilized.
  • FIG. 1 is a diagram showing the results of confirming the expression of PHF20 during muscle differentiation of C 2 C 12 cells through qRT-PCR (Pre, premyocytes; D1-D5, cells according to the number of differentiated days).
  • FIG. 2 is a diagram showing the results of confirming the expression of PHF20 and MyoD during the muscle differentiation of C 2 C 12 cells through western blotting.
  • FIG. 3 is a diagram showing the result of confirming the expression of YY1 during muscle differentiation of C 2 C 12 cells through qRT-PCR.
  • FIG. 4 is a diagram showing the results of confirming the expression of YY1 and MyoD during the muscle differentiation of C 2 C 12 cells through Western blotting.
  • FIG. 5 is a diagram showing the results of confirming the effect of PHF20 expression on the differentiation of C 2 C 12 cells (-Doxy, doxycycline untreated cells; +Doxy, doxycycline treated cells). More specifically, FIG. 5A shows the results of analyzing the protein expression of PHF20, YY1 and MyoD in C 2 C 12 cells according to whether or not doxycycline was treated. 5B is a result of analyzing the mRNA expression of PHF20, YY1 and MyoD according to whether or not doxycycline was treated in C 2 C 12 cells.
  • FIG. 6 is a view showing the results of confirming the effect of the expression of PHF20 on the root canal formation through immunochemical staining analysis.
  • FIG. 7 is a diagram showing the results of confirming the effect of PHF20 expression inhibition on the expression of YY1 and MyoD through Western blotting.
  • FIG. 7A is the result of C 2 C 12 cells (Pre) before differentiation
  • FIG. 7B is the result of differentiated myofibers for 1 day.
  • FIG. 8A shows the result of confirming the expression of PHF20 according to the concentration of doxycycline treatment through Western blotting (upper panel) and the result of confirming the activity of the YY1 promoter according to the expression of the PHF20 through luciferase reporter gene analysis (lower panel). is the diagram shown.
  • Figure 8B shows the result of confirming the expression of PHF20 according to shRNA transfection through Western blotting (upper panel) and the result of confirming the activity of the YY1 promoter according to the expression of PHF20 through luciferase reporter gene analysis (lower panel). It is also
  • 9A is a diagram showing the results of confirming the activity of the YY1 promoter (upper panel) and the expression of PHF2, YY1 and MyoD (lower panel) according to the differentiation period in C 2 C 12 cells not treated with doxycycline.
  • 9B is a diagram showing the results of confirming the activity of the YY1 promoter (upper panel) and the expression of PHF2, YY1 and MyoD (lower panel) according to the differentiation period in C 2 C 12 cells treated with doxycycline.
  • FIG. 10 is a view showing the results of confirming the way PHF20 regulates the YY1 promoter through chromatin immunoprecipitation analysis.
  • FIG. 11 is a diagram showing the results of confirming the effect of YY1 expression on MyoD expression in C 2 C 12 cells (Pre) and cells differentiated for 3 days through Western blotting.
  • FIG. 12 is a diagram showing the results of confirming the effect of YY1 expression on myotube formation in C 2 C 12 cells differentiated for 1 day through immunochemical staining analysis.
  • FIG. 13 is a diagram showing the results of confirming the expression of PHF20, YY1 and MHC in PHF20 transgenic mice through Western blotting (WT, control; PHF20-TG, PHF20 transgenic mice).
  • 14A is a result of measuring the body weight of PHF20 transgenic mice.
  • 14B is a diagram showing the results of observing the thigh muscle of a PHF20 transgenic mouse.
  • FIG. 15 is a diagram showing the results of observing gastrocnemius tissues of PHF20 transgenic mice through histological analysis.
  • FIG. 15A is a cross-section of the gastrocnemius tissue
  • FIG. 15B is a result of observing a longitudinal cross-section.
  • 16 is a diagram showing the result of additional observation of a cross-section of gastrocnemius tissue of a transgenic mouse through histological analysis.
  • FIG. 17 is a diagram showing the results of observing gastrocnemius tissues of PHF20 transgenic mice through immunochemical staining analysis.
  • FIG. 17A is a longitudinal cross-section of the gastrocnemius tissue
  • FIG. 17B is a cross-sectional view of the result.
  • FIG. 18 is a diagram illustrating a mechanism by which expression of PHF20 affects muscle differentiation.
  • the present invention provides a pharmaceutical composition for preventing or treating a disease caused by muscle loss, comprising a PHF20 (PHD finger protein 20) gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
  • a pharmaceutical composition for preventing or treating a disease caused by muscle loss comprising a PHF20 (PHD finger protein 20) gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
  • the present invention also provides a method for treating a disease caused by muscle loss, comprising the step of treating an individual in need thereof with a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor.
  • PHF20 plant homeodomain finger protein 20, PHD finger protein 20
  • PHF20 is a multi-domain protein and subunit of a lysine acetyltransferase complex that acetylates histone H4.
  • PHF20 is a transcription factor and was first identified in glioma patients.
  • PHF20 knockout mice die shortly after birth and display diverse phenotypes within the skeletal and hematopoietic systems. However, the detailed mechanisms of these phenotypes in PHF20 knockout mice have not been reported.
  • the PFH20 affects muscle differentiation through the mechanism shown in FIG. 18 in muscle differentiation. More specifically, inhibition of the expression of PHF20 increases the expression of MyoD by isolating PHF20 bound to the YY1 promoter in vitro and in vivo, and increases the expression of the myogenic differentiation marker (MyoD). promotes muscle differentiation.
  • MyoD myogenic differentiation marker
  • the PHF20 gene expression inhibitor is preferably a YY1 promoter activity inhibitor.
  • the PHF20 gene expression inhibitor may promote muscle differentiation by increasing the expression of MyoD.
  • YY1 (Yin Yang 1) refers to a transcriptional repression protein that binds to DNA through four C-terminal zinc finger domains.
  • rapamycin an inhibitor of the mammalian target of rapamycin (mTOR)
  • mTOR increases mitochondrial transcriptional regulator gene expression, thereby reducing mitochondrial gene expression and oxygen consumption.
  • mTOR phosphorylation and its downstream targets YY1 and Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1 ⁇ ) are increased by FGF21 (fibroblast growth factor 21) treatment in C 2 C 12 myoblasts.
  • Activation of the mTOR-YY1-PGC1 ⁇ pathway by FGF21 in myoblasts was significantly increased by intracellular ATP synthesis, oxygen consumption rate, citrate synthase activity, glycolysis, mitochondrial DNA copy number, and expression of key energy. Regulates the manifested energy homeostasis.
  • the disease due to muscle loss is sarcopenia, dystonia, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, muscle Atrophic axonal sclerosis (amyotrophic lateral sclerosis), myasthenia (myasthenia) and preferably selected from the group consisting of cachexia (cachexia), but is not limited thereto.
  • prevention refers to any action that inhibits or delays the onset of a disease due to muscle loss by administration of the pharmaceutical composition according to the present invention.
  • treatment refers to any action that improves or beneficially changes the symptoms of a disease due to muscle loss by administration of the pharmaceutical composition according to the present invention.
  • the PHF20 gene expression inhibitor may be at least one selected from the group consisting of shRNA, siRNA, ribozyme, and antisense nucleotides complementary to the PHF20 gene.
  • the PHF20 gene expression inhibitor may be an shRNA represented by the nucleotide sequence of SEQ ID NO: 1, and a variant of the nucleotide sequence represented by SEQ ID NO: 1 is also included within the scope of the present invention.
  • a functional equivalent of the shRNA represented by SEQ ID NO: 1 of the present invention for example, a portion of the sequence represented by SEQ ID NO: 1 was modified by deletion, substitution, or insertion, but through this It is a concept including variants that can function the same as shRNA consisting of the nucleotide sequence of SEQ ID NO: 1.
  • the shRNA comprises a sequence having at least 70%, more preferably at least 80%, still more preferably at least 90%, and most preferably at least 95% sequence homology to the base sequence of each SEQ ID NO: 1, respectively. can do.
  • the "% sequence homology" for a polynucleotide or amino acid is identified by comparing the comparison region with two optimally aligned sequences.
  • the siRNA is composed of a sense sequence of 15 to 30 mers selected from the base sequence of the mRNA of the PHF20 gene and an antisense sequence complementary to the sense sequence, wherein the sense sequence is particularly limited thereto it is not
  • the inhibitor of PHF20 protein activity may be at least one selected from the group consisting of compounds, peptides and antibodies that specifically bind to PHF20 protein.
  • the compound includes any compound capable of specifically binding to and inhibiting the activity of the PHF20 protein.
  • the antibody can specifically and directly bind to the PHF20 protein and effectively inhibit the activity of the PHF20 protein.
  • a polyclonal antibody or monoclonal antibody is preferably used, and the antibody may be prepared by a known method known to those skilled in the art, and commercially available. Known antibodies can be purchased and used.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate. , lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid Calcium, sucrose, etc. may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention may be administered in various oral or parenteral formulations during actual clinical administration.
  • formulation commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents such as surfactants, or It can be prepared using excipients, and it is preferable to use suitable formulations known in the art.
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, and the like.
  • the solid preparation for oral administration includes tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose, or It is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • the liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included.
  • the formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • the parenteral administration can be made by using an injection method for external application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.
  • the dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of disease, and may be administered once a day. Or, it can be administered in several divided doses.
  • the pharmaceutical composition of the present invention may be administered to an individual by various routes.
  • the pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of diseases caused by muscle loss.
  • the present invention provides a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor; Or YY1 promoter activity inhibitor; provides a pharmaceutical composition for the prevention or treatment of diseases caused by muscle loss, including.
  • the YY1 promoter activity inhibitor may be siRNA, and is preferably represented by the nucleotide sequence of SEQ ID NO: 2.
  • the present invention provides a composition for increasing muscle or inhibiting muscle loss comprising a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor as an active ingredient.
  • the composition is preferably a health functional food composition or a feed additive composition, but is not limited thereto.
  • a feed additive refers to a substance added in a trace amount to a feed for nutritional or specific purposes.
  • the PHF20 gene expression inhibitor or the PHF20 protein activity inhibitor may be added as it is, or it may be used together with other foods or food ingredients, and used appropriately according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the PHF20 gene expression inhibitor or PHF20 protein activity inhibitor of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the total composition.
  • the active ingredient may be used in an amount above the above range.
  • the type of the health functional food There is no particular limitation on the type of the health functional food.
  • the health functional food include candies, snacks, gums, beverages, tea, drinks, alcoholic beverages and vitamin complexes, and include all health functional foods in a conventional sense.
  • the feed additive composition of the present invention is provided as a feed by appropriately mixing it with a feed raw material, and the feed raw material is grains, clams, vegetable oilseeds, animal origin Feed raw materials, other feed raw materials, refined products, etc. are used, but are not limited thereto.
  • Anti-PHF20 antibody was purchased from Cell Signaling Technology (Beverly, MA). Anti- ⁇ actin antibody was obtained from Sigma Aldrich (St. Louis, USA). Anti-YY1, anti-MyoD and anti-myosin heavy chain antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-myosin (MF20) antibody was obtained from DSHB, University of Iowa. HRP-conjugated anti-mouse, anti-rabbit and anti-goat IgG antibodies were obtained from Koma biotech (Seoul, Korea). pYY-luciferase was purchased from Panomics (California, USA). Luciferase assay system kit was purchased from Promega (Madison, USA). Tet-on advanced inducible gene expression system kit was obtained from Clontech (Takara Bio Company, USA).
  • Premyocytes C 2 C 12 cells, were cultured at 37° C. and 5% CO 2 conditions using DMEM medium.
  • the DMEM (WELGENE, Gyeongsan, Korea) medium contains 10% FBS (fetal bovine serum) (HyClone, Logan, USA) and 1% Antibiotic-Antimycotic (Gibco, Detroit, USA).
  • the medium was replaced with a differentiation medium (DM) and then cultured, and the medium was replaced every 2 days.
  • the differentiation medium contains 2% horse serum and 1% Antibiotic-Antimycotic (Gibco, Detroit, USA). The cell differentiation was initiated 24 hours after medium change.
  • C 2 C 12 /Tet-On induced PHF20 cells were prepared using C 2 C 12 cells. Specifically, to prepare C 2 C 12 -TET3G myoblasts, C 2 C 12 cells were treated with lentivirus-TET3G, and selected with G418 (1.2 mg/ml) to obtain C 2 C 12 -TET3G myoblasts. did The C 2 C 12 -TET3G cells were transiently transfected with pLVX-TRE3G-PHF20. Tet-On-induced PHF20 cells were selected among transiently transfected cells using puromycin (3 ⁇ g/ml). When the selected cells (C 2 C 12 /Tet-On induced PHF20 cells) are cultured in a medium containing doxycycline (Doxy), the expression of PHF20 is induced.
  • Doxy doxycycline
  • the prepared cells were placed on ice, and the cells were treated with a lysis buffer to prepare a cell lysate.
  • the lysis buffer was 50 mM Tris-HCl (pH7.5), 1% v/v Nonidet P-40, 120 mM NaCl, 25 mM sodium fluoride, 40 mM ⁇ phosphate, 0.1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 mM Contains ⁇ M microcystin-LR.
  • Cell lysates were centrifuged at 13000 rpm for 30 minutes to obtain proteins. The protein was developed by SDS-PAGE using a 10.0 to 7.5% gel.
  • the developed protein was transferred to an Immobilon-P membrane (Millipore). Thereafter, the membrane was treated with 1X TBS (tri-buffered saline buffer; 140 mM NaCl, 2.7 mM KCl, 250 mM Tris HCl, pH 7.4) containing 5% skim milk and 0.2% Tween-20 and blocked for 1 hour. Thereafter, the primary antibody for each protein diluted 1000-fold was treated and incubated overnight at 4°C. After the reaction, the membrane was washed with TBS.
  • 1X TBS tri-buffered saline buffer; 140 mM NaCl, 2.7 mM KCl, 250 mM Tris HCl, pH 7.4
  • the washed membrane was treated with a 2000-fold diluted secondary antibody (horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Komabiotech, Seoul, Korea)) and then cultured. After incubation, the membrane was washed with TBS, and protein was detected according to the manufacturer's manual.
  • a 2000-fold diluted secondary antibody horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Komabiotech, Seoul, Korea)
  • C 2 C 12 /Tet-On induced PHF20 cells were seeded in 6-well plates and cultured for 24 hours.
  • the C 2 C 12 /Tet-On induced PHF20 cells were treated with doxycycline.
  • the day after doxycycline treatment total RNA was extracted from the cells using a QuickGene RNA kit (Fujifilm's Life Science System, Tokyo, Japan).
  • cDNA was synthesized from the extracted total RNA using SuPrimeScript RT Premix (GeNet Bio, Cheonan, Korea).
  • cDNA amplification was performed with Prime Q-Mastermix (GeNet Bio, Cheonan, Korea) and CFX96T Real-time System (Bio-Rad, Hercules, CA, USA). qRT-PCR analysis of each cDNA measured duplex DNA formation using SYBR green dye and the StepOne Plus real-time PCR system (Invitrogen, Carlsbad, CA).
  • C 2 C 12 /Tet-On induced PHF20 cells were seeded in a 12-well plate containing sterile coverslips at a concentration of 1x10 5 cells/well, and cultured at 37° C. and 5% CO 2 conditions.
  • the doxycycline untreated group (-Doxy) cells were cultured for 24 hours without treatment with doxycycline, and the doxycycline-treated group (+Doxy) was cultured for 24 hours after replacing the medium with doxycycline-containing medium. After replacing the medium of each cultured cell with a differentiation medium, it was cultured for 1 day (D1) or 3 days (D3) to differentiate. The cells were then washed with PBS at 37°C.
  • the washed cells were incubated in 4% paraformaldehyde for 15 minutes, fixed on coverslips, and washed twice with PBS.
  • coverslips were treated with 1% bovine serum albumin (BSA) and then cultured with shaking at room temperature for 1 hour.
  • BSA bovine serum albumin
  • MF-20 an anti-myosin antibody was diluted at a ratio of 1:200 and added to the cells, followed by incubation with shaking at 4°C overnight. After shaking incubation, the coverslips were washed 3 times with PBS.
  • FITC secondary antibody (1:1000) in 5% skim milk was added and then cultured with shaking for 6 hours in the dark at room temperature. After shaking incubation, the coverslips were washed 3 times with PBS. After replacing the medium of the washed coverslip with a mounting medium containing DAPI VECTASHIELD (St. Louis, USA), it was bound to the slide and analyzed for fluorescence.
  • C 2 C 12 /Tet-On induced PHF20 cells were seeded in a 6-well plate at a concentration of 3 ⁇ 10 5 cells/ml.
  • the seeded cells were transfected with 1 ⁇ g of a plasmid containing YY1-luciferase according to the manufacturer's manual. Transfected cells were used for experiments after 24 hours.
  • Transfected cells were treated with reporter lysis buffer to lyse the cells.
  • the reporter lysis buffer is 25 mM Tris-phosphate, 2 mM DTT, 2 mM trans-1,2-cyclohexanediamine-N,N,N',N'-tetraacetic acid, 10% (v/v) glycerol and 1% ( v/v) Triton x-100.
  • Luciferase activity was cultured by adding luciferase assay substrate (Promega) to 20 ⁇ g of cell lysate, and luminescence for 10 seconds was measured using a luminometer (Duo Lumat LB 9507).
  • Chromatin immunoprecipitation analysis was performed according to the manufacturer's manual (Upstate Biotechnology, Lake Placid, NY, USA). Specifically, C 2 C 12 cells were differentiated for 3 days, and formaldehyde was treated for 7.5 minutes. Thereafter, the cells were washed twice with PBS containing a protease inhibitor and then transferred onto ice. Cells on ice were treated with SDS-lysis buffer and incubated for 10 minutes, and the lysate was harvested.
  • the lysis buffer contains 50 mM Tris-HCl (pH 8.0), 1% SDS, 10 mM EDTA, 1 mM PMSF, 1 ⁇ g/ml aprotinin and 2 ⁇ g/ml pepstatin.
  • the harvested lysates were incubated overnight at 4°C after treatment with primary antibody or control IgG. Then, 30 ⁇ l of protein A beads (containing 500 ⁇ g/ml BSA and 200 ⁇ g/ml salmon sperm DNA) were incubated together at 4° C. for 3 hours in the culture. After incubation, the DNA sample was purified using QIA quick PCR purification kit (Qiagen, Hilden, Germany), and quantified by qRT-PCT. qRT-PCT results were expressed as a percentage of the entered value.
  • the sequence of mouse YY1 (-200/-55), a promoter-specific primer used in this experiment, is as follows.
  • cDNA encoding human PHF20 was subcloned downstream of the CMV promoter of pcDNA3 vector, and WT C57BL/6 mice were transformed with the vector.
  • WT C57BL/6 mice were used and denoted as WT.
  • Mice PHF20-TG and WT were reared in an environment of 12h/12h long cycle, humidity of 50 to 60%, and ambient temperature of 22°C.
  • All animal experiments were performed in animal facilities in accordance with institutional guidelines. The experimental protocol was approved by the Chungnam National University (CNU-00890) review committee.
  • mice Muscles collected from mice were treated with 10% formalin and then cultured overnight at 4° C. and fixed. The fixed muscle samples were embedded in paraffin blocks. A 5 ⁇ m-thick section was prepared by cutting the paraffin block. Slices from adjacent sites were additionally prepared, and slides were prepared sequentially.
  • the prepared slides were stained with hematoxylin and eosin (H&E).
  • the slices on the slide were deparaffinized with xylene and rehydrated with ethanol. Thereafter, the slides were immersed in a peroxidase quenching solution and reacted for 10 minutes. After the reaction, the slides were washed twice with PBS for 5 minutes each, and 2 drops of reagent A were added to the slides for blocking and incubated for 30 minutes. After incubation, the slides were washed twice with PBS. The washed slides were treated with a primary antibody (anti-MHC) and then incubated at 4°C overnight. The cultured slides were washed with PBS and then treated with reagent B, a biotinylated secondary antibody, and incubated at room temperature for 1 hour.
  • a primary antibody anti-MHC
  • Example 1 Analysis of expression of YY1 and PHF20 during muscle differentiation
  • PHF20 PHF finger protein 20
  • YY1 Yin Yang 1
  • PHF20 mRNA and protein expression in muscle differentiation were analyzed by qRT-PCR and Western blotting.
  • C 2 C 12 cells were replaced with differentiation medium (DM) containing 2% horse serum 24 hours after seeding to induce muscle differentiation.
  • DM differentiation medium
  • Cellular PHF20 mRNA expression was measured daily during muscle differentiation by qRT-PCR.
  • protein expression of PHF20 and myoD during the muscle differentiation period was checked daily through western blotting. The results of analyzing PHF20 mRNA and protein expression are shown in FIGS. 1 and 2 , respectively.
  • YY1 expression is increased in cells overexpressing PHF20 through previous studies. Accordingly, mRNA and protein expression of YY1 were analyzed in the same manner as in Example 1-1. The results of analyzing the mRNA and protein expression of YY1 are shown in FIGS. 3 and 4 , respectively.
  • C 2 C 12 cells After preparing C 2 C 12 cells (Pre), they were divided into a doxycycline untreated group (-Doxy) and a treated group (+Doxy). After that, the doxycycline-untreated group (-Doxy) was cultured for 24 hours without treatment with doxycycline on the prepared cells, and the doxycycline-treated group (+Doxy) was replaced with a medium containing doxycycline and the prepared cells were cultured for 24 hours. C 2 C 12 cells untreated or treated with doxycycline were used in the experiment, and marked as Pre.
  • differentiated muscle fibers D1, D3, and D5
  • the medium of C 2 C 12 cells untreated or treated with doxycycline was replaced with a differentiation medium and then cultured.
  • Cultured cells were designated as D1, D3, and D5 according to the number of days of differentiation, respectively.
  • Each cell lysate was prepared by treating the prepared cells with a lysis buffer, and protein expression of PHF20, YY1 and MyoD was analyzed by Western blotting. The results of analyzing the protein expression of PHF20, YY1 and MyoD are shown in FIG. 5A.
  • myosin heavy chain was investigated through immunochemical staining analysis. Specifically, doxycycline-treated (+Doxy) or untreated (-Doxy) C 2 C 12 cells (Pre) and differentiated muscle fibers (D1 and D3) were prepared. Using the prepared cells, immunochemical staining analysis using an anti-MF antibody (green) was performed. The myosin heavy chain was stained with an anti-MF antibody and displayed in green, and the cell nucleus was stained with 4',6-diamidino-2-phenylindole (DAPI) and displayed in blue. The results of the immunochemical staining analysis are shown in FIG. 6 .
  • C 2 C 12 cells (Pre) and differentiated muscle fibers (D1) were prepared.
  • the prepared cells were transfected with a lentivirus expressing shRNA (shPHF20) for the PHF20 sequence represented by the nucleotide sequence of SEQ ID NO: 1.
  • shPHF20 lentivirus expressing shRNA
  • shRNA for the scrambled sequence represented by the nucleotide sequence of SEQ ID NO: 3 was used.
  • Transfected cells were cultured for 24 hours. Cells were lysed after culture, and Western blotting was performed using the cell lysate.
  • the results of pre-differentiated C 2 C 12 cells (Pre) are shown in FIG. 7A, and the results of differentiated myofibers (D1) are shown in FIG. 7B.
  • C 2 C 12 cells (Pre) were transfected with the YY1-luciferase gene. The transfected cells were treated with doxycycline at different concentrations (0, 50, 100 and 500 ng/ml) and then cultured for 24 hours. After culture, C 2 C 12 cells were subjected to Western blotting and luciferase reporter gene analysis. The Western blotting is to confirm the expression of PHF20, and the luciferase reporter gene analysis is to confirm the activity of the YY1 promoter. The results of Western blotting and analysis of the luciferase reporter gene are shown in FIG. 8A.
  • doxycycline induces the expression of PHF20, and it was confirmed that the expression of PHF20 was dependent on the concentration of doxycycline. In addition, it was confirmed that the activity of the YY1 promoter was dependent on the expression level of PHF20.
  • C 2 C 12 cells were prepared, and the prepared cells were transfected with a lentivirus expressing shRNA for a scrambled sequence (shRNA) or a PHF20 sequence (shPHF20). After culturing the transfected cells for 24 hours, the YY1-luciferase gene was further transfected. Thereafter, the cells were lysed, and Western blotting and luciferase reporter gene analysis were performed using the cell lysate, and the results are shown in FIG. 8B .
  • YY1 promoter analysis was performed using C 2 C 12 cells, which are progenitor cells. Specifically, C 2 C 12 cells (Pre) not treated with doxycycline were differentiated by culturing in a differentiation medium, and the YY1-luciferase gene was transfected at each differentiation time point (D1 and D3). Expressions of PHF2, YY1 and MyoD in the transfected cells were analyzed by Western blotting. In addition, the activity of the YY1 promoter was confirmed through luciferase reporter gene analysis.
  • C 2 C 12 cells (Pre) treated with doxycycline were tested in the same manner as above.
  • the experimental results using the C 2 C 12 cells not treated with doxycycline are shown in FIG. 9A, and the experimental results using the C 2 C 12 cells treated with doxycycline are shown in FIG. 9B.
  • Example 3 it was confirmed that PHF20 directly regulates YY1. Therefore, in this example, the effect of the expression of the YY1 promoter on the downstream gene MyoD was investigated.
  • doxycycline (100 ng/ml) treated (+Doxy) or untreated (-Doxy) C 2 C 12 cells were prepared.
  • the C 2 C 12 cells were cultured in a differentiation medium to differentiate them into muscles.
  • siRNA or siYY1 SEQ ID NO: 2 was transfected and cultured for 24 hours.
  • Cell lysates were prepared after incubation, and the expression of PHF20, YY1 and MyoD was analyzed by Western blotting.
  • doxycycline (100 ng/ml) treated (+Doxy) or untreated (-Doxy) C 2 C 12 cells (Pre) were used. Western blotting results are shown in FIG. 11 .
  • myosin heavy chain was investigated through immunochemical staining analysis. Specifically, differentiated muscle fibers (D1) treated with doxycycline (+Doxy) or untreated (-Doxy) were prepared. Prepared cells were transfected with siRNA or siYY1 and cultured for 24 hours. Immunochemical staining analysis using anti-myosin (MF20) antibody was performed using the cultured cells. The myosin heavy chain is stained with an anti-myosin (MF20) antibody and displayed in green, and the cell nucleus is stained with 4',6-diamidino-2-phenylindole (DAPI) and displayed in blue. The results of the immunochemical staining analysis are shown in FIG. 12 .
  • Skeletal muscle tissue was isolated from PHF20 transgenic mice.
  • Cell lysates were prepared by lysing the isolated skeletal muscle tissue.
  • the cell lysate was prepared, and the expression of PHF20, YY1 and myosin heavy chain (MHC) was analyzed through Western blotting.
  • the myosin heavy chain is a muscle differentiation marker, and its expression increases as differentiation progresses.
  • 5-month-old male WT mice were used as a control group. Western blotting results are shown in FIG. 13 .
  • the expression of PHF20 and YY1 was significantly increased in the PHF20 transgenic mice compared to the control group (WT). However, in the PHF20 transgenic mice, it was confirmed that the expression of myosin heavy chain (MHC), a marker of muscle differentiation, was reduced compared to the control group.
  • MHC myosin heavy chain
  • PHF20 transgenic mice were weighed before sacrifice for the next experiment. After that, the PHF transgenic mice were dissected and the thigh muscles and muscles were observed. The weight measurement results of the PHF20 transgenic mice are shown in FIG. 14A, and the results of observing the thigh muscle are shown in FIG. 14B.
  • the muscle of the dissected PHF20 transgenic mouse had a lighter muscle color than that of the control group (WT), which means that the muscle had less muscle than the control group and the amount of fat was greater.
  • a slide was prepared by slicing the gastrocnemius tissue of the PHF20 transgenic mouse (PHF20-TG) and the control group (WT) in the transverse direction (Cross section) or longitudinal direction (Longitudinal section).
  • Tissues of the prepared transverse or longitudinal slides were stained with hematoxylin and eosin (H&E).
  • H&E hematoxylin and eosin
  • the PHF20 transgenic mice had fewer muscle fibers than the control group. In addition, it was confirmed that the PHF20 transgenic mice had more round muscle fibers than the control group, and that there were many empty spaces (white color) between the muscle fibers.
  • control group (WT) had almost no adipose tissue between the muscles, whereas the PHF20 transgenic mice had adipose tissue between the muscles.
  • the gastrocnemius muscle tissue of the prepared transverse or longitudinal slide was observed through immunochemical staining analysis.
  • the results of observing the longitudinal cross-section of the gastrocnemius tissue are shown in FIG. 17A, and the results of observing the cross-sections are shown in FIG. 17B.
  • the PHF20 transgenic mice had fewer muscle fibers and a shorter length than the control group (WT). In addition, it was confirmed that the expression of MHC in the PHF20 transgenic mice was decreased compared to the control group (WT).
  • PHF20 gene knockout that is, suppression of the expression of PHF20, increases the expression of MyoD by isolating PHF20 bound to the YY1 promoter in vitro and in vivo, and increases the expression of MyoD was confirmed to promote muscle differentiation.
  • This PHF20 inhibitor can be used in various ways in the field of prevention or treatment of diseases caused by muscle loss.
  • formulation examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the formulation examples.
  • the above ingredients are mixed and filled in an airtight bag to prepare a powder.
  • tablets are prepared by tableting according to a conventional manufacturing method of tablets.
  • the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.
  • the content of the above ingredients per 1 ampoule (2 ml) is prepared.
  • each component is added to purified water to dissolve, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100ml by adding purified water, and then filled in a brown bottle to sterilize to prepare a liquid.
  • composition ratio of the above vitamin and mineral mixture is a composition that is relatively suitable for health food in a preferred embodiment, but the mixing ratio may be arbitrarily modified. , to prepare granules, and can be used for preparing health food compositions according to a conventional method.
  • the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized, then refrigerated. It is used to prepare the health beverage composition of the invention.
  • composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demanding class, demanding country, and use.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Animal Husbandry (AREA)
  • Biophysics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Wood Science & Technology (AREA)
  • Pediatric Medicine (AREA)
  • Physiology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Inorganic Chemistry (AREA)
  • Dermatology (AREA)

Abstract

본 발명은 근육 분화 메커니즘에서 PHF20(PHD finger protein 20)의 기능에 관한 것으로, 보다 상세하게는 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제의 용도에 관한 것이다. 본 발명에 따른 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제는 시험관 내(in vitro) 및 생체 내(in vivo)에서 근육의 분화를 촉진시키는바, 근육 감소로 인한 질환의 예방, 개선 또는 치료 분야에서 다양하게 활용될 수 있다.

Description

PHF20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물
본 발명은 근육 분화 메커니즘에서 PHF20(PHD finger protein 20)의 기능에 관한 것으로, 보다 상세하게는 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제의 용도에 관한 것이다.
골격근의 질량은 인체 체중의 40 내지 50%로, 신체에서 질량이 가장 큰 조직이다. 골격근의 발달은 myogenic lineage commitment, 근원세포의 증식 및 말단 분화를 포함하는 메커니즘이 요구된다. 근육 발생(myogenesis)의 과정은 신호 캐스케이드의 터미널 이펙터 역할을 하고, 적절한 발달 단계-특이적 전사체에 의해 조절된다. 분화 단계는 MyoD(myogenic differentiation marker) 패밀리, MEF2(myocyte enhancer factor-2) 패밀리 및 다른 전사인자를 포함하는 근육-특이적 전사 인자의 복잡한 네트워크에 의해 제어된다.
근육의 감소로 인해 발생되는 근육감소증(sarcopenia)은 주로 노화에 의한 근육의 감소로 인해 발병된다. 현재 우리나라뿐만 아니라 전세계적으로 고령화가 중요한 문제로 대두되고 있기 때문에, 근감소증에 대한 사회적 관심은 더욱 커지고 있다. 이를 반영하듯, 미국은 2016년 10월에 세계보건기구(WHO)의 질병분류체계에서 노인성 근감소증에 질병코드(M62.84)를 부여하였다. 하지만 현재까지 승인된 치료제는 전무하고, 개발 중인 약물도 타 질환에 비해 매우 적다. 특히, 미오스타틴-액티빈-폴리스타틴(myostatin-activin-follistatin) 시스템 및 안드로젠 수용체(androgen receptor)를 표적하는 대부분의 약물은 치료 효과가 크지 않거나 치명적인 부작용이 존재한다는 한계가 있는바, 근감소증의 치료 약물에 대한 연구가 필요한 실정이다.
이에 본 발명자들은 근육 분화에서 PHF20의 메커니즘을 밝힘으로써, 본 발명을 완성하였다.
본 발명의 목적은, PHF20(PHD finger protein 20) 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은, PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제; 또는 YY1 프로모터 활성 억제제;를 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은, PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는, 근육 증대용 또는 근육 손실 저해용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은, PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 이를 필요로 하는 개체에 처리하는 단계;를 포함하는 근육 감소로 인한 질환의 치료 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 PHF20(PHD finger protein 20) 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제; 또는 YY1 프로모터 활성 억제제;를 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는 근육 증대용 또는 근육 손실 저해용 건강기능식품 조성물을 제공한다.
또한 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는 근육 증대용 또는 근육 손실 저해용 사료 첨가제 조성물을 제공한다.
또한 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 이를 필요로 하는 개체에 처리하는 단계;를 포함하는 근육 감소로 인한 질환의 치료 방법을 제공한다.
본 발명에 따른 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제는 시험관 내(in vitro) 및 생체 내(in vivo)에서 근육의 분화를 촉진시키는바, 근육 감소로 인한 질환의 예방, 개선 또는 치료 분야에서 다양하게 활용될 수 있다.
도 1은 qRT-PCR을 통해 C 2C 12 세포의 근육 분화 동안 PHF20의 발현을 확인한 결과를 나타낸 도이다(Pre, 전근세포(premyocyte); D1-D5, 분화된 일 수에 따른 세포).
도 2는 웨스턴 블롯팅을 통해 C 2C 12 세포의 근육 분화 동안 PHF20 및 MyoD의 발현을 확인한 결과를 나타낸 도이다.
도 3은 qRT-PCR을 통해 C 2C 12 세포의 근육 분화 동안 YY1의 발현을 확인한 결과를 나타낸 도이다.
도 4는 웨스턴 블롯팅을 통해 C 2C 12 세포의 근육 분화 동안 YY1 및 MyoD의 발현을 확인한 결과를 나타낸 도이다.
도 5는 PHF20 발현이 C 2C 12 세포의 분화에 미치는 영향을 확인한 결과를 나타낸 도이다(-Doxy, 독시사이클린 미처리 세포; +Doxy, 독시사이클린 처리 세포). 보다 상세하게는, 도 5A는 C 2C 12 세포에서 독시사이클린 처리 여부에 따른 PHF20, YY1 및 MyoD의 단백질 발현을 분석한 결과이다. 또한 도 5B는 C 2C 12 세포에서 독시사이클린 처리 여부에 따른 PHF20, YY1 및 MyoD의 mRNA 발현을 분석한 결과이다.
도 6은 면역화학염색 분석을 통해 PHF20의 발현이 근관 형성에 미치는 영향을 확인한 결과를 나타낸 도이다.
도 7은 웨스턴 블롯팅을 통해 PHF20의 발현 억제가 YY1 및 MyoD의 발현에 미치는 영향을 확인한 결과를 나타낸 도이다. 보다 상세하게는, 도 7A는 분화 전 C 2C 12 세포(Pre)의 결과이며, 도 7B는 1일 동안 분화된 근섬유의 결과이다.
도 8A는 웨스턴 블롯팅을 통해 독시사이클린의 처리농도에 따른 PHF20의 발현을 확인한 결과(상부 패널) 및 루시퍼라제 리포터 유전자 분석을 통해 상기 PHF20의 발현에 따른 YY1 프로모터의 활성을 확인한 결과(하부 패널)를 나타낸 도이다.
도 8B는 웨스턴 블롯팅을 통해 shRNA 형질감염에 따른 PHF20의 발현을 확인한 결과(상부 패널) 및 루시퍼라제 리포터 유전자 분석을 통해 상기 PHF20의 발현에 따른 YY1 프로모터의 활성을 확인한 결과(하부 패널)를 나타낸 도이다.
도 9A는 독시사이클린을 처리하지 않은 C 2C 12 세포에서 분화 기간에 따른 YY1 프로모터의 활성(상부 패널) 및 PHF2, YY1 및 MyoD의 발현(하부 패널)을 확인한 결과를 나타낸 도이다.
도 9B는 독시사이클린을 처리한 C 2C 12 세포에서 분화 기간에 따른 YY1 프로모터의 활성(상부 패널) 및 PHF2, YY1 및 MyoD의 발현(하부 패널)을 확인한 결과를 나타낸 도이다.
도 10은 염색질 면역침전 분석을 통해 PHF20이 YY1 프로모터를 조절하는 방식을 확인한 결과를 나타낸 도이다.
도 11은 웨스턴 블롯팅을 통해 C 2C 12 세포(Pre) 및 3일 동안 분화된 세포에서 YY1의 발현이 MyoD의 발현에 미치는 영향을 확인한 결과를 나타낸 도이다.
도 12는 면역화학염색 분석을 통해 1일 동안 분화된 C 2C 12 세포에서 YY1의 발현이 근관 형성에 미치는 영향을 확인한 결과를 나타낸 도이다.
도 13은 PHF20 트랜스제닉 마우스에서 PHF20, YY1 및 MHC의 발현을 웨스턴 블롯팅을 통해 확인한 결과를 나타낸 도이다(WT, 대조군; PHF20-TG, PHF20 트랜스제닉 마우스).
도 14A는 PHF20 트랜스제닉 마우스의 체중을 측정한 결과이다.
도 14B는 PHF20 트랜스제닉 마우스의 대퇴근을 관찰한 결과를 나타낸 도이다.
도 15는 조직학적 분석을 통해 PHF20 트랜스제닉 마우스의 비복근 조직을 관찰한 결과를 나타낸 도이다. 보다 상세하게는, 도 15A는 상기 비복근 조직의 횡단면을 관찰한 것이며, 도 15B는 종단면을 관찰한 결과이다.
도 16은 조직학적 분석을 통해 트랜스제닉 마우스의 비복근 조직의 횡단면을 추가 관찰한 결과를 나타낸 도이다.
도 17은 면역화학염색 분석을 통해 PHF20 트랜스제닉 마우스의 비복근 조직을 관찰한 결과를 나타낸 도이다. 보다 상세하게는, 도 17A는 상기 비복근 조직의 종단면을 관찰한 것이며, 도 17B는 횡단면을 관찰한 결과이다.
도 18은 PHF20의 발현이 근육 분화에 미치는 메커니즘을 나타낸 도이다.
이하, 본 발명을 상세히 설명한다.
본 발명의 양태에 따르면, 본 발명은 PHF20(PHD finger protein 20) 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 이를 필요로 하는 개체에 처리하는 단계;를 포함하는 근육 감소로 인한 질환의 치료 방법을 제공한다.
본 발명에 있어서, PHF20(plant homeodomain finger protein 20, PHD finger protein 20)은 히스톤 H4을 아세틸화하는 리신 아세틸트랜스퍼라제 복합체(lysine acetyltransferase complex)의 다중 도메인 단백질 및 서브 유닛이다. PHF20은 전사인자이며, 신경교종 환자에서 처음으로 확인되었다. PHF20 녹아웃 마우스는 출생 직후 사망하며, 골격 및 조혈 시스템 내에서 다양한 표현형을 나타낸다. 그러나 PHF20 녹아웃 마우스에서 이들 표현형의 상세한 메커니즘은 보고되지 않았다.
본 발명의 실시예에서, 상기 PFH20은 근육 분화에서 도 18과 같은 메커니즘을 통해 근육 분화에 영향을 미친다는 것을 확인하였다. 보다 상세하게는, PHF20의 발현 억제는 시험관 내(in vitro) 및 생체 내(in vivo)에서 YY1 프로모터에 결합된 PHF20을 분리시켜 MyoD의 발현을 증가시키고, 상기 MyoD(myogenic differentiation marker)의 발현 증가는 근육 분화를 촉진한다.
본 발명의 구체예에서, 상기 PHF20 유전자 발현 억제제는 YY1 프로모터 활성 억제제인 것이 바람직하다.
본 발명의 구체예에서, 상기 PHF20 유전자 발현 억제제는 MyoD의 발현을 증가시켜 근육의 분화를 촉진시키는 것일 수 있다.
본 발명에 있어서, YY1(Yin Yang 1)은 4 개의 C-말단 징크 핑거 도메인을 통해 DNA에 결합하는 전사 억제 단백질을 의미한다. 골격근에서, mTOR(mammalian target of rapamycin)의 억제제인 라파마이신의 치료는 mitochondrial transcriptional regulator의 유전자 발현을 증가시켜 미토콘드리아 유전자 발현 및 산소의 소비를 줄인다. mTOR 인산화 및 이의 하류의 표적인 YY1 및 PGC-1α(Peroxisome proliferator-activated receptor gamma coactivator 1-alpha)는 C 2C 12 근원세포에서 FGF21(fibroblast growth factor 21)의 처리에 의해 증가된다. 근원세포에서 FGF21에 의한 mTOR-YY1-PGC1α 경로의 활성화는 세포 내 ATP 합성, 산소 소비율, 시트르산 합성효소(citrate synthase)의 활성, 당분해, 미토콘드리아 DNA 카피 수 및 주요 에너지의 발현의 현저한 증가에 의해 나타난 에너지 항상성을 조절한다.
본 발명의 구체예에서, 상기 근육 감소로 인한 질환은 근육감소증(sarcopenia), 긴장감퇴증(atony), 근위축증(muscular atrophy), 근이영양증(muscular dystrophy), 근육 퇴화, 근경직증(myotonic dystrophy), 근위축성 축삭경화증(amyotrophic lateral sclerosis), 근무력증(myasthenia) 및 악액질(cachexia)로 이루어진 군에서 선택되는 것이 바람직하나, 이에 제한되지 않는다.
본 발명에 있어서, 예방은 본 발명에 따른 약학적 조성물의 투여로 근육 감소로 인한 질환의 발병을 억제 또는 지연시키는 모든 행위를 말한다. 또한 본 발명에서 치료는 본 발명에 따른 약학적 조성물의 투여로 근육 감소로 인한 질환의 증세가 호전되거나 이롭게 변경하는 모든 행위를 의미한다.
본 발명의 구체예에서, 상기 PHF20 유전자 발현 억제제는 PHF20 유전자에 상보적으로 결합하는 shRNA, siRNA, 리보자임, 및 안티센스 뉴클레오티드로 이루어진 군으로부터 선택된 1종 이상일 수 있다.
본 발명의 바람직한 구체예에서, 상기 PHF20 유전자 발현 억제제는 서열번호 1의 염기서열로 표시되는 shRNA일 수 있으며, 서열번호 1로 표시되는 염기서열의 변이체 또한 본 발명의 범위 내에 포함된다. 본 발명의 서열번호 1로 표시되는 shRNA의 작용성 등가물, 예를 들어, 서열번호 1로 표시되는 서열 중 일부가 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 이를 통해 서열번호 1의 염기서열로 이루어진 shRNA와 기능적으로 동일한 작용을 할 수 있는 변이체(variants)를 포함하는 개념이다.
구체적으로, shRNA는 각 서열번호 1의 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 서열을 포함할 수 있다. 폴리뉴클레오티드 또는 아미노산에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인된다.
상기 siRNA는 PHF20 유전자의 mRNA의 염기서열 내에서 선택되는 15 내지 30머(mer)의 센스서열 및 상기 센스 서열에 상보적으로 결합하는 안티센스 서열로 구성되며, 이때, 상기 센스 서열은 특별히 이에 제한되는 것은 아니다.
본 발명의 구체예에서, 상기 PHF20 단백질 활성 억제제는 PHF20 단백질에 특이적으로 결합하는 화합물, 펩티드 및 항체로 이루어진 군으로부터 선택된 1종 이상일 수 있다.
상기 화합물은 PHF20 단백질에 특이적으로 결합하여 이의 활성을 억제할 수 있는 임의의 화합물을 모두 포함한다.
상기 항체는 PHF20 단백질에 특이적이고 직접적으로 결합하여 PHF20 단백질의 활성을 효과적으로 억제할 수 있다. 상기 PHF20 단백질에 특이적으로 결합하는 항체로는 폴리클로날(polyclonal) 항체 또는 모노클로날(monoclonal) 항체를 사용하는 것이 바람직하며, 상기 항체는 당업자에게 알려진 공지의 방법으로 제작할 수도 있으며, 상업적으로 알려진 항체를 구입하여 사용할 수 있다.
본 발명의 약학적 조성물은 약학적으로 허용 가능한 첨가제를 더 포함할 수 있으며, 이때 약제적으로 허용 가능한 첨가제로는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당 등이 사용될 수 있다. 본 발명에 따른 약제적으로 허용 가능한 첨가제는 상기 조성물에 대해 0.1 내지 90 중량부 포함되는 것이 바람직하나 이에 한정되는 것은 아니다.
또한 본 발명의 약학적 조성물은 실제 임상투여시에 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있으며, 당해 기술 분야에 알려진 적합한 제제를 이용하는 것이 바람직하다. 상기 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시 벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등이 있다.
상기 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘 카보네이트(Calcium carbonate), 수크로스(Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 또한, 상기 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
상기 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. 상기 비경구투여는 피부 외용 또는 복강 내 주사, 직장 내 주사, 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사 주입방식을 사용하여 이루어질 수 있다.
본 발명의 약학적 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도에 따라 그 범위가 다양하며, 하루에 한 번 투여할 수도 있고, 수 회 나누어 투여할 수도 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다.
본 발명의 약학적 조성물은 근육 감소로 인한 질환의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제; 또는 YY1 프로모터 활성 억제제;를 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 구체예에서, 상기 YY1 프로모터 활성 억제제는 siRNA일 수 있으며, 서열번호 2의 염기서열로 표시되는 것이 바람직하다.
본 발명의 또 다른 양태에 따르면, 본 발명은 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는 근육 증대용 또는 근육 손실 저해용 조성물을 제공한다.
상기 조성물은 건강기능식품 조성물 또는 사료 첨가제 조성물인 것이 바람직하나, 이에 제한되지 않는다.
본 발명에 있어서, 사료 첨가제는 영양적 또는 특정 목적을 위하여 사료에 미량으로 첨가되는 물질을 의미한다.
상기 근육 증대용 또는 근육 손실 저해용 조성물이 건강기능식품 조성물인 경우, PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조 시에 본 발명의 PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제는 전체 조성물에 대하여 15중량 % 이하, 바람직하게는 10 중량 % 이하의 양으로 첨가된다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 건강기능식품의 종류에는 특별한 제한은 없다. 상기 건강기능식품의 예로는 캔디류, 스낵류, 껌류, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
상기 근육 증대용 또는 근육 손실 저해용 조성물이 사료 첨가제 조성물인 경우, 본 발명의 사료 첨가제 조성물은 사료 원료에 적절하게 배합하여 사료로 제공되는데, 상기 사료 원료로 곡물류, 조강류, 식물성 유박류, 동물성 사료 원료, 기타 사료 원료, 정제품 등이 사용되고 있으나, 이에 한정되지 않는다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실험 재료
항-PHF20 항체는 Cell Signaling Technology(Beverly, MA)로부터 구입하였다. 항-β액틴 항체는 Sigma Aldrich(St. Louis, USA)로부터 얻었다. 항-YY1, 항-MyoD 및 항-미오신 중쇄 항체는 Santa Cruz Biotechnology(Santa Cruz, CA)로부터 구입하였다. 항-미오신(MF20) 항체는 아이오와 대학의 DSHB로부터 얻었다. HRP가 결합된 항-마우스, 항-토끼 및 항-염소 IgG 항체는 Koma biotech(Seoul, Korea)로부터 입수하였다. pYY-루시퍼라제는 Panomics(California, USA)에서 구입하였다. Luciferase assay system kit는 Promega(Madison, USA)에서 구입하였다. Tet-on advanced inducible gene expression system kit는 Clontech(Takara Bio Company, USA)로부터 입수하였다.
실험예 1. 세포배양
1-1. C 2C 12 세포 배양 및 분화
전근세포(premyocyte)인 C 2C 12 세포는 DMEM 배지를 사용하여 37℃및 5% CO 2 조건에서 배양하였다. 상기 DMEM(WELGENE, Gyeongsan, Korea) 배지는 10% FBS(fetal bovine serum)(HyClone, Logan, USA) 및 1% Antibiotic-Antimycotic(Gibco, Detroit, USA)을 포함한다.
세포 분화를 위해 배지를 분화 배지(differentiation medium, DM)로 교체한 후 배양하였으며, 배지는 매 2일 마다 교체하였다. 상기 분화 배지는 2% 말 혈청(horse serum) 및 1% Antibiotic-Antimycotic(Gibco, Detroit, USA)를 포함한다. 상기 세포 분화는 배지 교체 24시간 후 시작되었다.
1-2. C 2C 12/Tet-On 유도성 PHF20 세포
C 2C 12 세포를 이용하여 C 2C 12/Tet-On 유도성 PHF20 세포를 제조하였다. 구체적으로, C 2C 12-TET3G 근원세포를 제조하기 위해, C 2C 12 세포에 렌티바이러스-TET3G을 처리하고, G418(1.2 mg/ml)로 선택하여 C 2C 12-TET3G 근원세포를 수득하였다. 상기 C 2C 12-TET3G 세포를 pLVX-TRE3G-PHF20으로 일시적 형질감염시켰다. 퓨로마이신(3 μg/ml)을 이용하여 일시적 형질감염된 세포 중 Tet-On 유도성 PHF20 세포를 선택하였다. 선택된 세포(C 2C 12/Tet-On 유도성 PHF20 세포)는 독시사이클린(doxycycline, Doxy)이 포함된 배지에서 배양할 경우, PHF20의 발현이 유도된다.
후술되는 실험에서 C 2C 12 세포에서 PHF20의 발현을 유도하기 위해 독시사이클린을 100 ng/ml의 농도로 포함하는 배지로 배양하였다.
실험예 2. 웨스턴 블로팅
준비된 세포를 얼음 위에 두었으며, 상기 세포에 용해 버퍼를 처리하여 세포 용해물을 제조하였다. 상기 용해 버퍼는 50 mM Tris-HCl(pH7.5), 1% v/v Nonidet P-40, 120 mM NaCl, 25 mM sodium fluoride, 40 mM βphosphate, 0.1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine 및 2 μM microcystin-LR을 포함한다. 세포 용해물을 13000 rpm에서 30 분 동안 원심분리하여 단백질을 수득하였다. 상기 단백질을 10.0 내지 7.5% 겔을 이용한 SDS-PAGE로 전개하였다. 전개된 단백질을 Immobilon-P 멤브레인(Millipore)으로 옮겼다. 그 후 멤브레인을 5% 탈지유 및 0.2% Tween-20을 함유하는 1X TBS(tri-buffered saline buffer; 140mM NaCl, 2.7mM KCl, 250mM Tris HCl, pH7.4)을 처리하여 1시간 동안 블로킹하였다. 그 후 1000배 희석된 각 단백질에 대한 1차 항체를 처리한 후 4℃에서 밤새도록 배양하였다. 반응 후 TBS로 멤브레인을 세척하였다. 세척된 멤브레인에 2000배 희석된 2차 항체(horseradish peroxidase-conjugated anti-mouse IgG 또는 anti-rabbit IgG(Komabiotech, Seoul, Korea))를 처리한 후 배양하였다. 배양 후 멤브레인을 TBS로 세척하였으며, 제조사의 매뉴얼에 따라 단백질을 검출하였다.
실험예 3. 실시간 정량적 역전사 중합효소 연쇄반응(Real-time quantitative reverse transcription-polymerase chain reaction, qRT-PCR)
C 2C 12/Tet-On 유도성 PHF20 세포를 6웰 플레이트에 시딩하여 24시간 동안 배양하였다. PHF20의 발현을 유도하기 위하여, 상기 C 2C 12/Tet-On 유도성 PHF20 세포에 독시사이클린을 처리하였다. 독시사이클린을 처리한 다음날, QuickGene RNA kit(Fujifilm's Life Science System, Tokyo, Japan)을 사용하여 세포로부터 전체 RNA를 추출하였다. 또한 SuPrimeScript RT Premix(GeNet Bio, Cheonan, Korea)를 사용하여, 추출된 전체 RNA로부터 cDNA를 합성하였다. cDNA 증폭은 Prime Q-Mastermix(GeNet Bio, Cheonan, Korea) 및 CFX96T Real-time System(Bio-Rad, Hercules, CA, USA)으로 수행하였다. 각각의 cDNA의 qRT-PCR 분석은 SYBR 녹색 염료 및 StepOne Plus 실시간 PCR 시스템(Invitrogen, Carlsbad, CA)을 이용해 이중 DNA(duplex DNA) 형성을 측정하였다.
본 실험에서 사용한 프라이머는 표 1에 나타내었다.
프라이머 서열(5'-3')
mouse GAPDH forward(서열번호 4) TCCAGTATGACTCCACTC
mouse GAPDH reverse(서열번호 5) ATTTCTCGTGGTTCACAC
mouse PHF20 forward(서열번호 6) CATTGACTACGAAGAAGGGAG
mouse PHF20 reverse(서열번호 7) CTTCTCTAAAGGGCGCAGATA
mouse YY1 forward(서열번호 8) CAGAAGCAGGTGCAGATCAGACCCT
mouse YY1 reverse(서열번호 9) GCACCACCACCCACGGAATCG
mouse MyoD forward(서열번호 10) TACAGTGGCGACTCAGATGC
mouse MyoD reverse(서열번호 11) GAGATGCGCTCCACTATGCT
실험예 4. 면역화학염색 분석을 통한 미오신 중쇄(myosin heavy chain, MHC)의 검출
C 2C 12/Tet-On 유도성 PHF20 세포를 1x10 5 cells/well의 농도로 멸균된 커버슬립을 포함하는 12웰 플레이트에 시딩하였으며, 37℃및 5% CO 2 조건에서 배양하였다. 독시사이클린 미처리군(-Doxy)은 세포에 독시사이클린을 처리하지 않고 24시간 동안 배양하였으며, 독시사이클린 처리군(+Doxy)은 배지를 독시사이클린을 포함한 배지로 교체한 후 24시간 동안 배양하였다. 배양된 각 세포의 배지를 분화 배지로 교체한 후 1일(D1) 또는 3일(D3) 동안 배양하여 분화시켰다. 그 후 세포를 37℃인 PBS로 세척하였다. 세척된 세포를 4% 파라포름알데하이드에서 15분 동안 배양하여 커버슬립에 고정하였으며, PBS로 2회 세척하였다. 블로킹을 위하여, 커버슬립에 1% BSA(bovine serum albumin)를 처리한 후 실온에서 1시간 동안 진탕배양하였다. 또한 anti-myosin(MF-20) 항체를 1:200의 비율로 희석하여 세포에 첨가하였고, 4℃에서 밤새도록 진탕배양하였다. 진탕배양 후 커버슬립을 PBS로 3회 세척하였다. FITC 2차 항체(1:1000)(in 5% skim milk)를 첨가한 후 실온의 암실에서 6시간 동안 진탕배양하였다. 진탕배양 후 커버슬립을 PBS로 3회 세척하였다. 세척된 커버슬립의 배지를 DAPI VECTASHIELD(St. Louis, USA)를 포함하는 마운팅 배지로 교체한 후 슬라이드에 결합시켜 형광을 분석하였다.
실험예 5. 루시퍼라제 리포터 유전자 분석
C 2C 12/Tet-On 유도성 PHF20 세포를 3x10 5 cells/ml의 농도로 6웰 플레이트에 시딩하였다. 시딩된 세포에 YY1-루시퍼라제를 포함하는 플라스미드 1 μg을 제조사의 매뉴얼에 따라 형질감염시켰다. 형질감염된 세포는 24시간 후 실험을 위해 사용하였다.
형질감염된 세포에 리포터 용해 버퍼를 처리하여 세포를 용해시켰다. 상기 리포터 용해 버퍼는 25 mM Tris-phosphate, 2 mM DTT, 2 mM trans-1,2-cyclohexanediamine-N,N,N',N'-tetraacetic acid, 10%(v/v) glycerol 및 1%(v/v) Triton x-100을 포함한다. 루시퍼라제의 활성은 세포 용해물 20 μg에 luciferase assay substrate(Promega)을 첨가하여 배양하였고, 10초 동안의 발광을 luminometer(Duo Lumat LB 9507)를 이용하여 측정하였다.
실험예 6. 염색질 면역침전(Chromatin-immunoprecipitation, ChiP) 분석
염색질 면역침전 분석은 제조사의 매뉴얼(Upstate Biotechnology, Lake Placid, NY, USA)에 따라 수행하였다. 구체적으로, C 2C 12 세포는 3일 동안 분화시켰으며, 포름알데히드를 7.5분 동안 처리하였다. 그 후 프로테아제 억제제를 포함하는 PBS로 세포를 2회 세척한 후 얼음 위로 옮겼다. 얼음 상의 세포에 SDS-용해 버퍼를 처리한 후 10분 동안 배양하였으며, 용해물을 수확하였다. 상기 용해 버퍼는 50 mM Tris-HCl(pH 8.0), 1% SDS, 10 mM EDTA, 1 mM PMSF, 1 μg/ml aprotinin 및 2 μg/ml pepstatin을 포함한다. 상기 수확된 용해물은 1차 항체 또는 대조군 IgG를 처리한 후 4℃에서 밤새도록 배양하였다. 그 후 배양물에 단백질 A 비드(500 μg/ml BSA 및 200 μg/ml 연어 정자 DNA를 포함) 30 μl을 함께 4℃에서 3시간 동안 배양하였다. 배양 후 DNA 시료는 QIA quick PCR purification kit(Qiagen, Hilden, Germany)를 사용하여 정제하였고, qRT-PCT로 정량하였다. qRT-PCT 결과는 입력된 값의 백분율로 표시하였다. 본 실험에 사용한 프로모터 특이적 프라이머인 mouse YY1(-200/-55)의 서열은 다음과 같다.
- mouse YY1(-200/-55) : 5'-CGCTGCCTTCCTCCCTCT-3'(forward, 서열번호 12), 5'-CGTCCGTGGCGATGTAGA-3'(reverse, 서열번호 13)
실험예 7. PHF20 트랜스제닉 마우스 제조
PHF20 트랜스제닉 마우스를 제조하기 위해, pcDNA3 벡터의 CMV 프로모터의 하류에 인간 PHF20을 코딩하는 cDNA를 서브클로닝(subcloning)하였고, WT C57BL/6 마우스를 상기 벡터로 형진질전환시켰다. 대조군은 WT C57BL/6 마우스를 이용하였고, WT로 표시하였다. 마우스 PHF20-TG 및 WT는 12h/12h 장일주기, 습도 50 내지 60% 및 주변 온도 22℃인 환경에서 사육하였다. 또한 모든 동물 실험은 기관 지침에 따라 동물 시설에서 수행되었다. 실험 프로토콜은 충남대학교(CNU-00890) 검토위원회의 승인을 받았다.
실험예 8. 조직학적 분석 및 면역화학염색 분석
마우스에서 채취된 근육은 10% 포르말린을 처리한 후 4℃에서 밤새도록 배양하여 고정하였다. 고정된 근육 시료는 파라핀 블록에 포매하였다. 파라핀 블록을 잘라 5 μm 두께의 박편을 준비하였다. 인접 부위의 박편을 추가로 준비하여, 순서대로 슬라이드를 제작하였다.
일반적인 형태학적 분석을 위하여, 제작된 슬라이드를 헤마톡실린 및 에오신(hematoxylin 및 eosin, H&E)으로 염색하였다.
또한 면역화학염색 분석을 위하여, 슬라이드 상의 박편을 자일렌으로 탈파라핀화시켰으며, 에탄올을 이용하여 재수화시켰다. 그 후, 슬라이드를 과산화효소 퀀칭 용액(peroxidase quenching solution)에 담가 10분 동안 반응시켰다. 반응후 슬라이드를 PBS로 5분씩 2회 세척하였고, 블로킹을 위해 슬라이드에 시약 A를 2 방울 첨가한 후 30분 동안 배양하였다. 배양 후 슬라이드를 PBS로 2회 세척하였다. 세척된 슬라이드에 1차 항체(anti-MHC)를 처리한 후 4℃에서 밤새도록 배양하였다. 배양된 슬라이드를 PBS로 세척한 후 비오티닐화된(biotinylated) 2차 항체인 시약 B를 처리하였으며, 실온에서 1시간 동안 배양하였다. 배양된 슬라이드를 PBS로 세척한 후 효소가 결합된 시약 C를 슬라이드에 떨어뜨렸으며, PBS로 세척하였다. PBS로 세척한 후 DAB 발색체; 및 시약 D1, D2 및 D3의 혼합물;을 슬라이드에 떨어뜨렸으며, 형광 현미경으로 신호를 관찰하였다. 그리고 증류수로 반응을 멈춘 후, 형광 현미경으로 슬라이드 사진을 찍었다.
실험예 9. 통계학적 분석
데이터는 평균 ± S.E.로 표시하였다. 적어도 3회의 실험에서 그룹 간 차이는 Student's t-test를 사용하여 분석하였고, P<0.05는 통계적으로 유의한 것으로 간주하였다. 또한 결과의 정량 분석에는 Image J 소프트웨어(버전 1.47)를 사용하였다.
실시예 1. 근육 분화 동안 YY1 및 PHF20의 발현 분석
근육 분화에서 PHF20(PHD finger protein 20)의 변화를 평가하기 위하여, 근육 분화에서의 YY1(Yin Yang 1) 및 PHF20 mRNA 및 단백질 발현을 qRT-PCR 및 웨스턴 블롯팅으로 분석하였다.
1-1. PHF20
C 2C 12 세포를 시딩한지 24시간 후 2% 말 혈청을 포함하는 분화 배지(DM)로 교체하여 근육 분화를 유도하였다. 세포의 PHF20 mRNA 발현은 qRT-PCR을 통해 근육 분화 기간 동안 매일 측정하였다. 또한 상기 근육 분화 기간 동안 PHF20 및 myoD의 단백질 발현은 웨스턴 블롯팅을 통해 매일 확인하였다. PHF20 mRNA 및 단백질 발현을 분석한 결과는 각각 도 1 및 2에 나타내었다.
도 1 및 2에 나타낸 바와 같이, 근육 분화가 진행될수록 PHF20은 mRNA 및 단백질의 발현이 감소되는 것을 확인하였다. 반면에, MyoD는 근육의 분화가 진행될수록 단백질의 발현이 증가되는 것을 확인하였다. 상기 결과는 C 2C 12 세포에서 전사인자인 PHF20가 근육 분화에 관여할 수 있음을 시사한다.
1-2. YY1
YY1은 선행 연구를 통해 PHF20이 과발현되는 세포에서 발현이 증가된다는 것을 확인한바 있다. 이에, YY1의 mRNA 및 단백질 발현을 상기 실시예 1-1과 같은 방법으로 분석하였다. YY1의 mRNA 및 단백질 발현을 분석한 결과는 각각 도 3 및 4에 나타내었다.
도 3 및 4에 나타낸 바와 같이, YY1는 근육 분화가 진행될수록 mRNA의 발현이 감소하는 것을 확인하였다. 또한 근육 분화가 진행될수록 MyoD의 단백질 발현은 증가하였으나, YY1의 단백질 발현은 감소한 것을 확인하였다.
실시예 2. PHF20 발현이 C 2C 12 세포의 분화에 미치는 영향 조사
PHF20의 발현이 근육 분화에 미치는 영향을 추가로 평가하였다.
2-1. PHF20 발현이 myoD 단백질 발현에 미치는 영향
C 2C 12 세포(Pre)를 준비한 후 독시사이클린 미처리군(-Doxy) 및 처리군(+Doxy)으로 나누었다. 그 후 독시사이클린 미처리군(-Doxy)은 준비된 세포에 독시사이클린을 처리하지 않고 24시간 동안 배양하였으며, 독시사이클린 처리군(+Doxy)은 독시사이클린을 포함한 배지로 교체한 후 준비된 세포를 24시간 동안 배양하였다. 독시사이클린이 미처리 또는 처리된 C 2C 12 세포는 실험에 사용하였고, Pre로 표시하였다.
분화된 근섬유(D1, D3 및 D5)를 제조하기 위해, 상기 독시사이클린이 미처리 또는 처리된 C 2C 12 세포의 배지를 분화 배지로 교체한 후 배양하였다. 배양된 세포는 분화 일수에 따라 D1, D3 및 D5로 각각 표시하였다.
준비된 세포들에 용해 버퍼를 처리하여 각 세포 용해물을 제조하였으며, PHF20, YY1 및 MyoD의 단백질 발현을 웨스턴 블롯팅을 통해 분석하였다. PHF20, YY1 및 MyoD의 단백질 발현을 분석한 결과는 도 5A에 나타내었다.
도 5A에 나타낸 바와 같이, 대조군인 독시사이클린 미처리군(왼쪽 패널)은 근육 분화 동안 PHF20 및 YY1의 단백질 발현은 감소하고, MyoD의 발현은 증가하는 경향을 보였다. 반면에 독시사이클린 처리군(오른쪽 패널)은 PHF20의 발현이 유도된 것으로, MyoD의 발현이 대조군에 비해 낮은 것을 확인하였다.
2-2. PHF20 발현이 myoD mRNA 발현에 미치는 영향
상기 실시예 2-1의 독시사이클린 처리(+Doxy) 또는 미처리(-Doxy)된 C 2C 12 세포(Pre) 및 분화된 근섬유(D5)의 전체 RNA를 추출한 후 qRT-PCR을 통해 PHF20, YY1 및 MyoD의 mRNA 발현을 분석하였다. 상기 mRNA의 발현을 분석한 결과는 도 5B에 나타내었다.
도 5B에 나타낸 바와 같이, 근육 분화 동안 PHF20, YY1 및 MyoD의 발현은 단백질 발현과 같은 경향성, 즉, PHF20 발현이 유도된 세포는 MyoD의 발현이 감소된 것을 확인하였다.
2-3. PHF20의 발현이 근관 형성에 미치는 영향
PHF20이 근관(myotube) 형성에 미치는 영향을 확인하기 위하여, 면역화학염색 분석을 통해 미오신 중쇄의 발현을 조사하였다. 구체적으로, 독시사이클린이 처리(+Doxy) 또는 미처리(-Doxy)된 C 2C 12 세포(Pre) 및 분화된 근섬유(D1 및 D3)를 준비하였다. 준비된 세포를 이용하여, 항-MF 항체(녹색)를 사용한 면역화학염색 분석을 수행하였다. 미오신 중쇄는 항-MF 항체로 염색되어 녹색으로 표시되며, 세포 핵은 4′,6-diamidino-2-phenylindole(DAPI)로 염색되어 파란색으로 표시된다. 면역화학염색 분석 결과는 도 6에 나타내었다.
도 6에 나타낸 바와 같이, 독시사이클린에 의해 PHF20의 발현이 유도된 세포(+Doxy, D1 및 D3)는 근육 분화 동안 근관 형성이 억제된 것을 확인하였다. 반면에, 대조군인 독시사이클린 미처리군(-Doxy, D1 및 D3)은 C 2C 12 세포가 근관으로 분화된 것을 확인하였다.
2-4. PHF20의 발현 억제가 MyoD의 발현에 미치는 영향
PHF20의 발현 억제가 myoD의 발현에 미치는 영향을 확인하였다. 이를 위해 C 2C 12 세포(Pre) 및 분화된 근섬유(D1)를 준비하였다. 준비된 세포에 서열번호 1의 염기서열로 표시되는 PHF20 서열에 대한 shRNA(shPHF20)를 발현하는 렌티바이러스를 형질감염시켰다. 대조군은 서열번호 3의 염기서열로 표시되는 스크렘블드 서열에 대한 shRNA를 사용하였다. 형질감염된 세포는 24시간 동안 배양하였다. 배양 후 세포를 용해시켰으며, 세포 용해물을 사용하여 웨스턴 블롯팅을 수행하였다. 분화 전인 C 2C 12 세포(Pre)의 결과는 도 7A에 나타내었으며, 분화된 근섬유(D1)의 결과는 도 7B에 나타내었다.
도 7에 나타낸 바와 같이, 분화 전 C 2C 12 세포(Pre)에서, shRNA에 의한 PHF20의 발현 억제는 YY1의 발현 억제를 유도하였고, MyoD의 발현 증가를 야기하였다. 위와 같은 현상은 분화 1일차인 근섬유(D1)에서 더욱 두드러지는 것을 확인하였다.
실시예 3. PHF20 발현이 YY1 프로모터의 발현에 미치는 영향
상기 실시예 1 및 2를 통해 근육 분화 동안 PHF20의 발현 증가는 YY1의 발현을 증가시키고, MyoD의 발현을 감소시키는 것을 확인하였다. 이에, PHF20의 발현이 근육 분화에 미치는 영향을 YY1 프로모터 분석을 통해 추가적으로 평가하였다.
3-1. 독시사이클린의 처리농도에 따른 PHF20 및 YY1 프로모터의 발현 조사
독시사이클린의 처리농도에 따른 PHF20 및 YY1 프로모터의 발현을 조사하였다. C 2C 12 세포(Pre)에 YY1-루시퍼라제 유전자를 형질감염시켰다. 형질감염된 세포에 독시사이클린을 농도별(0, 50, 100 및 500 ng/ml)로 처리한 후 24시간 동안 배양하였다. 배양 후 C 2C 12 세포를 웨스턴 블롯팅 및 루시퍼라제 리포터 유전자 분석을 실시하였다. 상기 웨스턴 블롯팅은 PHF20의 발현을 확인하기 위한 것이며, 루시퍼라제 리포터 유전자 분석은 YY1 프로모터의 활성을 확인하기 위한 것이다. 웨스턴 블롯팅 결과 및 루시퍼라제 리포터 유전자 분석 결과는 도 8A에 나타내었다.
도 8A에 나타낸 바와 같이, 독시사이클린은 PHF20의 발현을 유도하는데, 상기 PHF20의 발현은 독시사이클린의 농도에 의존적인 것을 확인하였다. 또한 YY1 프로모터의 활성은 PHF20의 발현량에 의존하는 것을 확인하였다.
3-2. shRNA의 형질감염에 따른 PHF20 및 YY1 프로모터의 발현 조사
shRNA 형질감염에 따른 PHF20 및 YY1 프로모터의 발현을 조사하였다. 구체적으로, C 2C 12 세포(Pre)를 준비하였고, 준비된 세포에 스크렘블드 서열(shRNA) 또는 PHF20 서열(shPHF20)에 대한 shRNA를 발현하는 렌티바이러스를 형질감염시켰다. 형질감염된 세포를 24시간 동안 배양한 후 YY1-루시퍼라제 유전자를 추가 형질감염시켰다. 그 후 세포를 용해시켰으며, 세포 용해물을 사용하여 웨스턴 블롯팅 및 루시퍼라제 리포터 유전자 분석을 수행하였으며, 그 결과는 도 8B에 나타내었다.
도 8B에 나타낸 바와 같이, shRNA로 인한 PHF20 발현 감소는 YY1 프로모터의 활성을 억제하는 것을 확인하였다. 이는 PHF20이 전근세포의 YY1 발현을 전사체 수준에서 양성적으로 조절한다는 것을 의미한다.
3-3. 근육 분화 기간에 따른 PHF20 및 YY1 프로모터의 발현 조사
근육 분화 기간에 따른 PHF20의 발현 억제가 YY1 프로모터의 발현에 미치는 영향을 분석하였다. 이를 위한 YY1 프로모터 분석은 전근세포인 C 2C 12 세포를 사용하여 수행하였다. 구체적으로, 독시사이클린을 처리하지 않은 C 2C 12 세포(Pre)를 분화 배지에서 배양하여 분화시켰으며, 각 분화 시점(D1 및 D3)에서 YY1-루시퍼라제 유전자를 형질감염시켰다. 웨스턴 블롯팅을 통해 형질감염된 세포의 PHF2, YY1 및 MyoD의 발현을 분석하였다. 또한 루시퍼라제 리포터 유전자 분석을 통해 YY1 프로모터의 활성을 확인하였다. 독시사이클린을 처리한 C 2C 12 세포(Pre)를 이용하여 위와 같은 방법으로 실험하였다. 상기 독시사이클린을 처리하지 않은 C 2C 12 세포를 이용한 실험 결과는 도 9A에 나타내었으며, 독시사이클린을 처리한 C 2C 12 세포를 이용한 실험 결과는 도 9B에 나타내었다.
도 9A에 나타낸 바와 같이, C 2C 12 세포의 근육 분화가 진행될수록 YY1 프로모터 활성이 감소함에 따라 PHF20 및 YY1의 발현은 감소하였고, MyoD 발현은 증가하였다.
도 9B에 나타낸 바와 같이, 독시사이클린에 의해 유도된 PHF20 발현은 근육 분화 동안 YY1 프로모터 활성을 유도하였고, 이에 따라 MyoD의 발현은 감소된 것을 확인하였다.
상기 결과는 PHF20 발현량은 YY1 및 YY1 프로모터를 통한 근육 분화의 조절에 중요하다는 것을 의미한다.
3-4. PHF20에 의한 YY1 프로모터의 조절 방식 확인
염색질 면역침전(Chromatin-immunoprecipitation, ChiP) 분석을 통해 PHF20이 YY1 프로모터를 어떤 방식으로 조절하는지 확인하였다. 상기 염색질 면역침전 분석은 C 2C 12 세포(Pre) 및 분화된 근섬유(D1 및 D3)를 이용하였고, 프라이머 mouse YY1(-200/-55)을 사용하였다. 대조군으로는 IgG를 사용하였다. 염색질 면역침전 분석 결과는 도 10에 나타내었다.
도 10에 나타낸 바와 같이, C 2C 12 세포에서 PHF20은 근육 분화 동안 YY1 프로모터(-200/-55)에 결합하는 것이 감소하였다. 상기 결과는 PHF20이 근육 분화를 조절하기 위한 전사인자로써, YY1 프로모터에 직접 결합한다는 것을 시사한다.
실시예 4. YY1의 발현이 MyoD의 발현에 미치는 영향
상기 실시예 3을 통해 PHF20이 YY1을 직접 조절한다는 것을 확인하였다. 이에 본 실시예에서는 YY1 프로모터의 발현이 하류 유전자인 MyoD에 미치는 영향을 조사하였다.
4-1. 웨스턴 블롯팅
YY1 프로모터의 발현이 하류 유전자인 MyoD에 미치는 영향을 조사하기 위하여, 독시사이클린(100 ng/ml)이 처리(+Doxy) 또는 미처리(-Doxy)된 C 2C 12 세포(Pre)를 준비하였다. 상기 C 2C 12 세포를 분화 배지로 배양하여 근육으로 분화시켰다. 분화 3일차(D3)에서 siRNA 또는 siYY1(서열번호 2)을 형질감염시킨 후 24시간 동안 배양하였다. 배양 후 세포 용해물을 제조하였고, 웨스턴 블롯팅을 통해 PHF20, YY1 및 MyoD의 발현을 분석하였다. 대조군은 독시사이클린(100 ng/ml)이 처리(+Doxy) 또는 미처리(-Doxy)된 C 2C 12 세포(Pre)를 이용하였다. 웨스턴 블롯팅 결과는 도 11에 나타내었다.
도 11에 나타낸 바와 같이, PHF20의 과발현은 C 2C 12 세포(Pre)에서 MyoD의 발현 감소를 유도하였고, 분화 3일차(D3)에는 근육 분화뿐만 아니라 전근세포에서 YY1 발현을 유도하였다(각 조건에 대한 처음 2 개의 레인). 또한 shRNA에 의한 YY1의 발현 억제는 MyoD의 발현을 증가시켰다(각 조건에 대한 마지막 2 개 레인).
4-2. 면역화학염색 분석
YY1이 근관(myotube) 형성에 미치는 영향을 확인하기 위하여, 면역화학염색 분석을 통해 미오신 중쇄의 발현을 조사하였다. 구체적으로, 독시사이클린이 처리(+Doxy) 또는 미처리(-Doxy)된 분화된 근섬유(D1)를 준비하였다. 준비된 세포에 siRNA 또는 siYY1을 형질감염시킨 후 24시간 동안 배양하였다. 배양된 세포를 이용하여, 항-미오신(MF20) 항체를 사용한 면역화학염색 분석을 수행하였다. 미오신 중쇄는 항-미오신(MF20) 항체로 염색되어 녹색으로 표시되며, 세포 핵은 4′,6-diamidino-2-phenylindole(DAPI)로 염색되어 파란색으로 표시된다. 면역화학염색 분석 결과는 도 12에 나타내었다.
도 12에 나타낸 바와 같이, shRNA에 의한 YY1의 발현 감소는 근관 형성을 촉진하는 것을 확인하였다(+siYY1, -Doxy). 반면에 독시사이클린에 의해 PHF20의 발현이 유도될 경우 근관 형성이 억제되는 것을 확인하였다(-siYY1, +Doxy). 특히, PHF20의 과발현에도 불구하고 YY1의 발현이 억제될 때 분화가 회복된 것을 확인하였다(+siYY1, +Doxy). 상기 결과는 PHF20이 YY1을 통해 MyoD와 같은 분화 조절 인자를 조절한다는 것을 의미한다.
실시예 5. PHF20 트랜스제닉 마우스에서 PHF20 발현이 근육의 분화에 미치는 영향 조사
5-1. PHF20 트랜스제닉 마우스에서 PHF20, YY1 및 MHC 발현 분석 및 표현형 확인
PHF20 트랜스제닉 마우스로부터 골격근 조직을 분리하였다. 분리된 골격근 조직을 용해하여 세포 용해물을 제조하였다. 상기 세포 용해물을 제조하였고, 웨스턴 블롯팅을 통해 PHF20, YY1 및 미오신 중쇄(myosin heavy chain, MHC)의 발현을 분석하였다. 상기 미오신 중쇄는 근육의 분화 마커로, 분화가 진행될수록 발현이 증가한다. 대조군은 5개월령 수컷 WT 마우스를 이용하였다. 웨스턴 블롯팅 결과는 도 13에 나타내었다.
도 13에 나타낸 바와 같이, PHF20 트랜스제닉 마우스는 PHF20 및 YY1의 발현이 대조군(WT)에 비해 유의하게 증가하였다. 그러나 상기 PHF20 트랜스제닉 마우스는 근육 분화의 마커인 미오신 중쇄(MHC)의 발현은 대조군에 비해 감소한 것을 확인하였다.
PHF20 트랜스제닉 마우스를 다음 실험을 위해 희생시키기 전에 체중을 측정하였다. 그 후 PHF 트랜스제닉 마우스를 해부한 후 대퇴근 및 근육을 관찰하였다. PHF20 트랜스제닉 마우스의 체중 측정 결과는 도 14A에 나타내었고, 대퇴근을 관찰한 결과는 도 14B에 나타내었다.
도 14A에 나타낸 바와 같이, PHF20 트랜스제닉 마우스는 대조군(WT)에 비해 체중이 유의하게 증가한 것을 확인하였다.
도 14B에 나타낸 바와 같이, 해부된 PHF20 트랜스제닉 마우스의 근육은 근육의 색이 대조군(WT)에 비해 옅은 것을 확인하였으며, 이는 대조군보다 근육은 적고, 지방 축적량이 많다는 것을 의미한다.
상기 결과로부터 PHF20 트랜스제닉 마우스는 지방 축적으로 인해 체중이 증가한 것임을 알 수 있다.
5-2. 조직학적 분석 및 면역화학염색 분석
PHF20 트랜스제닉 마우스(PHF20-TG) 및 대조군(WT)의 비복근(gastrocnemius) 조직을 횡방향(Cross section) 또는 종방향(Longitudinal section)으로 슬라이스하여 슬라이드를 제작하였다.
상기 제작된 횡방향 또는 종방향 슬라이드의 조직을 헤마톡실린 및 에오신(H&E)으로 염색하였다. 비복근 조직의 횡단면을 관찰한 결과는 도 15A에 나타내었으며, 종단면을 관찰한 결과는 도 15B에 나타내었다.
도 15A에 나타낸 바와 같이, PHF20 트랜스제닉 마우스는 대조군보다 근섬유가 적은 것을 확인하였다. 또한 PHF20 트랜스제닉 마우스는 대조군보다 근섬유가 둥글고, 근섬유 사이에 다수의 빈 공간(흰 색)이 있는 것을 확인하였다.
도 15B에 나타낸 바와 같이, 근육의 종단면을 관찰한 결과, PHF20 트랜스제닉 마우스는 대조군에 비해 근섬유 압축이 덜 된 것을 확인하였으며, 이는 근육의 완전성이 낮다는 것을 의미한다.
또한 상기 헤마톡실린 및 에오신으로 염색된 횡단면 슬라이드를 추가 관찰하였으며, 그 결과는 도 16에 나타내었다.
도 16에 나타낸 바와 같이, 대조군(WT)은 근육 사이에 지방 조직이 거의없는 반면, PHF20 트랜스제닉 마우스는 근육 사이에서 지방 조직이 관찰되었다.
면역화학염색 분석을 통해 상기 제작된 횡방향 또는 종방향 슬라이드의 비복근 조직을 관찰하였다. 비복근 조직의 종단면을 관찰한 결과는 도 17A에 나타내었으며, 횡단면을 관찰한 결과는 도 17B에 나타내었다.
도 17A에 나타낸 바와 같이, PHF20 트랜스제닉 마우스는 대조군(WT)에 비해 근섬유가 적고, 길이가 짧은 것을 확인하였다. 또한 PHF20 트랜스제닉 마우스는 MHC의 발현이 대조군(WT)에 비해 감소된 것을 확인하였다.
도 17B에 나타낸 바와 같이, PHF20 트랜스제닉 마우스는 대조군(WT에 비해 근섬유 사이에 빈공간이 발견되었으며, 이는 근섬유의 압축 정도가 낮은 것을 의미한다.
상기 결과를 통해 PHF20이 생체 내에서 근육 발달에 부정적인 영향을 미친다는 것을 확인하였다.
종합적으로 상기 실험 결과를 통해 PHF20의 발현은 도 18과 같은 메커니즘을 통해 근육 분화에 영향을 미친다는 것을 확인하였다. 보다 상세하게는, PHF20 유전자 녹아웃, 즉 PHF20의 발현 억제는 시험관 내(in vitro) 및 생체 내(in vivo)에서 YY1 프로모터에 결합된 PHF20을 분리시켜 MyoD의 발현을 증가시키고, 상기 MyoD의 발현 증가는 근육 분화를 촉진한다는 것을 확인하였다. 이는 PHF20 억제제가 근육 감소로 인한 질환의 예방 또는 치료 분야에서 다양하게 활용될 수 있다.
이하, 제제예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 제제예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 제제예에 의해 제한되는 것으로 해석되지 않는다.
제제예 1. 약학적 조성물의 제조
1-1. 산제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 20 μg
유당 100 mg
탈크 10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.
1-2. 정제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 20 μg
옥수수전분 100 mg
유당 100 mg
스테아린산 마그네슘 2 mg
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.
1-3. 캡슐제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 20 μg
결정성 셀룰로오스 3 mg
락토오스 14.8 mg
마그네슘 스테아레이트 0.2 mg
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.
1-4. 주사제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 10 μg
만니톨 180 mg
주사용 멸균 증류수 2974 mg
인산이나트륨 이수화물 26 mg
통상의 주사제의 제조방법에 따라 1 앰플당 (2 ml) 상기의 성분 함량으로 제조한다.
1-5. 액제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 10 μg
이성화당 10 g
만니톨 5 g
정제수 적량
통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100ml로 조절한 후 갈색병에 충진하여 멸균시켜 액제를 제조한다.
제제예 2 식품 제제의 제조
2-1. 건강식품의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 10 μg
비타민 혼합물 적량
비타민 A 아세테이트 70 g
비타민 E 1.0 mg
비타민 B1 0.13 mg
비타민 B2 0.15 mg
비타민 B6 0.5 mg
비타민 B12 0.2 g
비타민 C 10 mg
비오틴 10 g
니코틴산아미드 1.7 mg
엽산 50 g
판토텐산 칼슘 0.5 mg
무기질 혼합물 적량
황산제1철 1.75 mg
산화아연 0.82 mg
탄산마그네슘 25.3 mg
제1인산칼륨 15 mg
제2인산칼슘 55 mg
구연산칼륨 90 mg
탄산칼슘 100 mg
염화마그네슘 24.8 mg
상기의 비타민 및 미네랄 혼합물의 조성비는 비교적 건강식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강식품 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강식품 조성물 제조에 사용할 수 있다.
2-2. 건강음료의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 10 μg
비타민 C 15 g
비타민 E(분말) 100 g
젖산철 19.75 g
산화아연 3.5 g
니코틴산아미드 3.5 g
비타민 A 0.2 g
비타민 B1 0.25 g
비타민 B2 0.3 g
물 정량
통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1 시간 동안 85 ℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 L 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강음료 조성물 제조에 사용한다.
상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만 수요계층이나, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.
제제예 3. 사료 첨가제의 제조
PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제 2.0%
글루코스 2.0 %
펩톤 1.0 %
효모추출물 1.0 %
제이인산 0.2 %
황산마그네슘 0.05 %
시스테인 0.05 %
정제수 to 100 %
부형제 탈지강 적량
이상, 본 발명내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다.

Claims (11)

  1. PHF20(PHD finger protein 20) 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 근육 감소로 인한 질환은 근육감소증(sarcopenia), 긴장감퇴증(atony), 근위축증(muscular atrophy), 근이영양증(muscular dystrophy), 근육 퇴화, 근경직증(myotonic dystrophy), 근위축성 축삭경화증(amyotrophic lateral sclerosis), 근무력증(myasthenia) 및 악액질(cachexia)로 이루어진 군에서 선택되는 것인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서,
    상기 PHF20 유전자 발현 억제제는 PHF20 유전자에 상보적으로 결합하는 shRNA, siRNA, 리보자임, 및 안티센스 뉴클레오티드로 이루어진 군으로부터 선택된 1종 이상인 것인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  4. 제3항에 있어서,
    상기 shRNA는 서열번호 1의 염기서열로 표시되는 것인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  5. 제1항에 있어서,
    상기 PHF20 유전자 발현 억제제는 YY1(Yin Yang 1) 프로모터 활성 억제제인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  6. 제1항에 있어서,
    상기 PHF20 유전자 발현 억제제는 MyoD(myogenic differentiation marker)의 발현을 증가시켜 근육의 분화를 촉진시키는 것인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서,
    상기 PHF20 단백질 활성 억제제는 PHF20 단백질에 특이적으로 결합하는 화합물, 펩티드 및 항체로 이루어진 군으로부터 선택된 1종 이상인 것인, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  8. PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제; 또는
    YY1 프로모터 활성 억제제;를 포함하는, 근육 감소로 인한 질환의 예방 또는 치료용 약학적 조성물.
  9. PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는, 근육 증대용 또는 근육 손실 저해용 건강기능식품 조성물.
  10. PHF20 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 유효성분으로 포함하는, 근육 증대용 또는 근육 손실 저해용 사료 첨가제 조성물.
  11. PHF20(PHD finger protein 20) 유전자 발현 억제제 또는 PHF20 단백질 활성 억제제를 이를 필요로 하는 개체에 처리하는 단계;를 포함하는 근육 감소로 인한 질환의 치료 방법.
PCT/KR2021/004056 2020-06-11 2021-04-01 Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물 WO2021251602A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US17/791,764 US20230193283A1 (en) 2020-06-11 2021-04-01 Composition for preventing or treating disease caused by muscle loss, comprising agent inhibiting phf20
EP21821480.7A EP4070821A4 (en) 2020-06-11 2021-04-01 COMPOSITION FOR PREVENTING OR TREATING A DISEASE CAUSED BY MUSCLE WASTING, CONTAINING A PHF20 INHIBITING AGENT
CN202180007800.4A CN114929290A (zh) 2020-06-11 2021-04-01 包含抑制phf20的制剂的用于预防或治疗因肌肉减少引起的疾病的组合物
JP2022539268A JP2023508689A (ja) 2020-06-11 2021-04-01 Ｐｈｆ２０を阻害する製剤を含む、筋肉減少による疾患の予防または治療用組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200070987A KR102454358B1 (ko) 2020-06-11 2020-06-11 Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물
KR10-2020-0070987 2020-06-11

Publications (1)

Publication Number Publication Date
WO2021251602A1 true WO2021251602A1 (ko) 2021-12-16

Family

ID=78845709

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/004056 WO2021251602A1 (ko) 2020-06-11 2021-04-01 Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물

Country Status (6)

Country Link
US (1) US20230193283A1 (ko)
EP (1) EP4070821A4 (ko)
JP (1) JP2023508689A (ko)
KR (1) KR102454358B1 (ko)
CN (1) CN114929290A (ko)
WO (1) WO2021251602A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150015076A (ko) * 2013-07-31 2015-02-10 한국생명공학연구원 ＭｙｏＤ 단백질을 포함하는 근육 분화 유도용 조성물
US20160017011A1 (en) * 2013-02-26 2016-01-21 Rongfu Wang Phf20 and jmjd3 compositions and methods of use in cancer immunotherapy
KR101949309B1 (ko) * 2017-06-16 2019-02-18 충남대학교산학협력단 Phf 20 억제제를 포함하는 지방간 예방 또는 치료용 약학적 조성물

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2679996A1 (en) * 2007-05-31 2014-01-01 AbbVie Inc. Biomarkers predictive of the responsiveness to TNF-alfa inhibitors in autoimmune disorders
US20090192114A1 (en) * 2007-12-21 2009-07-30 Dmitriy Ovcharenko miR-10 Regulated Genes and Pathways as Targets for Therapeutic Intervention
KR101847853B1 (ko) * 2016-04-15 2018-04-11 충남대학교 산학협력단 비만 동물모델 및 이의 용도
CN107937526B (zh) * 2017-12-26 2020-10-09 徐州维康生物科技有限公司 一种神经母细胞瘤相关的肿瘤标志物及其应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160017011A1 (en) * 2013-02-26 2016-01-21 Rongfu Wang Phf20 and jmjd3 compositions and methods of use in cancer immunotherapy
KR20150015076A (ko) * 2013-07-31 2015-02-10 한국생명공학연구원 ＭｙｏＤ 단백질을 포함하는 근육 분화 유도용 조성물
KR101949309B1 (ko) * 2017-06-16 2019-02-18 충남대학교산학협력단 Phf 20 억제제를 포함하는 지방간 예방 또는 치료용 약학적 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEE HYUNJI; HONG YOUNGEUN; KONG GYEYEONG; LEE DONG HOON; KIM MINHEE; TRAN QUANGDON; CHO HYEONJEONG; KIM CHAEYEONG; PARK SUNGJIN; K: "Yin Yang 1 is required for PHD finger protein 20-mediated myogenic differentiation in vitro and in vivo", CELL DEATH & DIFFERENTIATION, vol. 27, no. 12, 18 June 2020 (2020-06-18), pages 3321 - 3336, XP037312798, ISSN: 1350-9047, DOI: 10.1038/s41418-020-0580-6 *
LEI CHEN , TAO GUO2 , YAN YU , YEQING SUN , GUANGRONG YU , LIMING CHENG: "Heat shock cognate protein 70 promotes the differentiation of C2C12 myoblast and targets Yin Yang 1", ANNALS OF TRANSLATIONAL MEDICINE, vol. 7, no. 20, 551, 1 October 2019 (2019-10-01), pages 1 - 8, XP055878203, ISSN: 2305-5839, DOI: 10.21037/atm.2019.09.88 *
LIANG ZHOU, KUN SUN, YU ZHAO, SUYANG ZHANG, XUECONG WANG, YUYING LI, LEINA LU, XIAONA CHEN, FENGYUAN CHEN, XICHEN BAO, XIHUA ZHU, : "Linc-YY1 promotes myogenic differentiation and muscle regeneration through an interaction with the transcription factor YY1", NATURE COMMUNICATIONS, vol. 6, 10026, 1 December 2015 (2015-12-01), pages 1 - 16, XP055878201, DOI: 10.1038/ncomms10026 *
See also references of EP4070821A4 *

Also Published As

Publication number Publication date
KR102454358B1 (ko) 2022-10-14
EP4070821A4 (en) 2024-01-17
CN114929290A (zh) 2022-08-19
EP4070821A1 (en) 2022-10-12
KR20210153967A (ko) 2021-12-20
US20230193283A1 (en) 2023-06-22
JP2023508689A (ja) 2023-03-03

Similar Documents

Publication Publication Date Title
WO2017078499A2 (ko) 단백질 타이로신 탈인산화효소 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 조성물
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2015076621A1 (ko) 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2017022962A1 (ko) Ripk 억제제를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
WO2011052883A2 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
WO2017007162A1 (ko) 지방조직 중성지질 분해 효능을 가지는 아젤라산 조성물
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2022131791A1 (ko) 다중구리 산화효소 펩타이드를 포함하는 구리대사 관련 신경계 질환의 예방 또는 치료용 조성물
WO2021194281A1 (ko) 아커만시아 뮤시니필라 유래의 tars 또는 이의 단편 및 이의 용도
WO2021251602A1 (ko) Phf20을 억제하는 제제를 포함하는 근육 감소로 인한 질환의 예방 또는 치료용 조성물
WO2020226438A1 (ko) 염증성 장질환의 예방 또는 치료용 펩타이드
WO2020017788A1 (ko) Cd9를 이용한 당뇨병의 예방 또는 치료용 조성물과 당뇨병 치료제 스크리닝 방법
WO2020071641A1 (ko) Tsp1 단백질 억제제를 유효성분으로 함유하는 파브리 병의 예방 또는 치료용 약학적 조성물
WO2020116810A1 (ko) Ｆａｓ 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물
WO2017213435A1 (ko) Slit-robo 시스템을 이용한 근감소증 예방 또는 치료용 조성물
WO2018236194A1 (ko) Gas6 단백질 또는 이의 수용체 활성화제를 포함하는 섬유증의 예방 또는 치료용 조성물
WO2014157965A1 (ko) P34의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 치료 또는 전이 억제용 조성물
WO2019078381A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제
WO2020197304A1 (ko) 테트라스파닌-2 억제제를 유효성분으로 포함하는 췌장암 예방, 개선 또는 치료용 조성물
WO2011155643A1 (ko) 포그 ２ 다섯 번째 징크 핑거 도메인을 포함하는 포스파티딜이노시톨３키나아제 활성 조절제
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2020080641A1 (ko) 지노스테마 론기페스 vk1 추출물 또는 이로부터 분리한 화합물을 유효성분으로 포함하는 ampk 관련 질환 예방 또는 치료용 조성물
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2024215162A1 (ko) 단일 융합 단백질 및 이를 포함하는 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21821480

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022539268

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2021821480

Country of ref document: EP

Effective date: 20220706

NENP Non-entry into the national phase

Ref country code: DE