WO2016068616A1 - C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물 - Google Patents

C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물 Download PDF

Info

Publication number
WO2016068616A1
WO2016068616A1 PCT/KR2015/011493 KR2015011493W WO2016068616A1 WO 2016068616 A1 WO2016068616 A1 WO 2016068616A1 KR 2015011493 W KR2015011493 W KR 2015011493W WO 2016068616 A1 WO2016068616 A1 WO 2016068616A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
pdc
cell
placental
disease
Prior art date
Application number
PCT/KR2015/011493
Other languages
English (en)
French (fr)
Inventor
문지숙
김철
박지민
배상훈
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Priority to US15/523,160 priority Critical patent/US20180280447A1/en
Priority to EP15855075.6A priority patent/EP3214171A4/en
Publication of WO2016068616A1 publication Critical patent/WO2016068616A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells

Definitions

  • Placenta-derived cells secreting C3 or C1r complement pharmaceutical compositions comprising the same, and methods for treating diseases using the same.
  • Alzheimer's disease As the average life expectancy has increased in recent years and the aging society has progressed, there has been a growing interest in aging and diseases related to aging, especially degenerative and neurological diseases related to brain nerve cell damage such as stroke, dementia, Alzheimer's disease, and Parkinson's disease. It is increasing.
  • the neurological diseases are characterized by the death or degeneration of certain brain cells over a temporary or long period of time. Brain cells that once died are not regenerated, resulting in fatal brain loss.
  • Alzheimer's disease which is a representative neurological disease, suffers from about 50% of elderly people over 80 years of age, and is the fourth cause of death of the elderly following cancer, heart disease and stroke.
  • the treatment of Alzheimer's disease has been the only treatment, mainly indirect treatment focused on lightening the symptoms of patients and slowing the progression of the disease.
  • Angiogenesis is a biological process that provides new blood vessels to tissues or organs. Normal angiogenesis is strictly regulated by angiogenesis regulators, but disease occurs when angiogenesis is not autonomously controlled and grows pathologically.
  • the diseases that are related to angiogenesis in pathological conditions can be classified into inflammatory diseases such as arthritis, ophthalmic diseases such as diabetic retinopathy, dermatological diseases such as psoriasis, and cancer.
  • inhibition of angiogenesis may be a fundamental treatment, but many current angiogenesis inhibitors have a problem in that they are toxic in the body.
  • mesenchymal stem cells can proliferate autonomously and can be differentiated into various tissues according to conditions, and thus have various therapeutic effects, and thus are excellent candidates for treating the above diseases.
  • mesenchymal stem cells are not only very small in adult human bone marrow, but also rapidly decrease in number as they age. Therefore, since mesenchymal stem cells are insufficient for future cell therapy, an alternative is needed.
  • placenta has been recognized as a temporary organ that is discarded after giving birth until recently, but recently, various cells such as mesenchymal cells, decidual cells, amnion, and endothelial cells have been found for each placenta. It is revealed that it exists. Placenta-derived cells can solve ethical problems and have the advantage of obtaining large amounts of cells. In addition, if placenta-derived cells exhibiting good characteristics for disease treatment can be secured, they can be used as a good cell therapy that can solve the existing shortcomings.
  • the present inventors have isolated and cultured new cells derived from the placenta, and confirmed the characteristics of expressing complement, and the new cells have therapeutic effects and anti-aging effects on cerebral nervous system diseases and angiogenic diseases. Was completed.
  • One purpose is to provide placental derived cells.
  • Another object is to provide a pharmaceutical composition for the treatment or prevention of neurological diseases or angiogenesis-related diseases, including placental cells.
  • Another object is to provide a composition for reducing aging comprising placental cells.
  • Another object is to provide a method of treating neurological disease, angiogenesis related disease or symptoms associated with aging of an individual by administering to the individual a composition comprising placental derived cells.
  • One aspect provides a placental derived cell that secretes C3 or C1r complement protein.
  • placenta refers to an organ that occurs in the womb of a pregnant mammalian animal, and is composed of a decidual membrane derived from the uterine mucosa of the mother and a chorionic membrane, amnion, etc. derived from the fertilized egg, and a material between the mother and the fetus. It means the place where the exchange takes place.
  • placental derived cell means a cell that is separated from the placenta and has the ability to differentiate into various tissue cells including ectoderm cells such as bone, cartilage, fat, muscle cells or ectoderm cells such as neurons. do.
  • the placenta from which the cells of the present invention are derived may comprise amnion, chorionic, decidual and umbilical cord or combinations thereof.
  • the placental cells may be derived from the amnion of the placenta.
  • the placental cells may be derived from the chorionic valve of the placenta. In this case, since it is derived from a single extra-embryonic mesoderm, it may have further value as a raw material for cell therapy.
  • Placental derived cells according to the invention are characterized by secreting C3 or C1r complement proteins.
  • complement refers to a protein component of a body fluid (mainly serum) that binds to an antigen antibody complex nonspecifically and is mobilized for infection, inflammatory response, immune response, etc. and expresses various biological activities.
  • the complement contains nine components (complementary components) from C1 to C9, in the case of C1 can be divided into C1q, C1r, C1r complex according to the decomposition products of the complement component.
  • the activation of the complement system to generate an immune response is divided into three pathways: the classical pathway of complement system, the alternative pathway of complement system, and the lectin pathway of complement system.
  • C3 activation causes C3 activation, one of nine complement components, which causes C3b to accumulate on the surface of the pathogen, causing phagocytosis and destroying the target pathogen.
  • the deficiency of C3 is reported to be susceptible to bacterial infection, and abnormal reduction or increase of C3 is reported to be involved in various immunodeficiency diseases as well as degenerative neurological diseases such as Alzheimer's disease and Parkinson's disease.
  • the placental derived cells can additionally secrete one or more proteins selected from the group consisting of EPPK1, PTX3, EEF1A1, LGALS3BP (Galectin-3-binding protein), FLJ53478, PXDN and TGF ⁇ .
  • the placental derived cells can secrete, for example, EPPK1, PTX3, EEF1A1, LGALS3BP, FLJ53478, PXDN and TGF.
  • C3, C1r, PTx3, EEF1A1, LGALS3BP, and FLJ53478 secreted from the placental derived cells according to the present invention.
  • C3, C1r, PTx3, EEF1A1, LGALS3BP, and FLJ53478 were not measured.
  • C3, C1r, PTx3, EEF1A1, LGALS3BP, and FLJ53478 are immune related proteins.
  • EPPK1 an age-related protein, was found to be secreted from neural progenitor cells, but the measured amount in placental-derived cells was about 7 times higher than that of neural progenitor cells.
  • Placental derived cells of the present invention may express the C3 or C1r complement protein in an amount of 0.1 to 1000 pg / ml / 1 ⁇ 10 6 cells.
  • the placental-derived cells may express C3 or C1r complement proteins in an amount of 1 to 1000 pg / ml / 1 ⁇ 10 6 cells, or 10 to 1000 pg / ml / 1 ⁇ 10 6 cells.
  • placental-derived cells may express EPPK1 at least 7 times more than neuronal progenitor cells (based on expression).
  • the placental cells are CD9 + , CD13 + , CD90 + and Of CD200 + It can have a phenotype.
  • the placental-derived cells may be SSEA4 ⁇ , TRA-1-60 ⁇ , TRA-1-81 ⁇ , and CD34 ⁇ .
  • the term "phenotype of +" as used herein means that the label is present in greater amounts, or in higher concentrations, as compared to the other cells on which it is based. That is, a cell becomes a phenotype of + for that label if a label is present inside or on the surface of the cell and the label can be used to distinguish the cell from one or more other cell types.
  • the cell has its label in an amount sufficient to signal a signal greater than the background value, for example a signal from a cytometry device.
  • phenotype of- means that even when an antibody specific for a particular cell surface label is used, the label cannot be detected compared to the background value.
  • Another aspect provides a pharmaceutical composition comprising said placental derived cells.
  • Placental-derived cells included in the pharmaceutical composition are as described above.
  • One embodiment provides a pharmaceutical composition for treating or preventing neurological diseases comprising the placental cells.
  • the neurological disease may be, for example, Alzheimer's disease, Parkinson's disease, HIV dementia, epilepsy, schizophrenia, depression, mood swings, neurodegenerative disorders, autism, stroke, Lou Gehrig's disease, Huntington's disease, multiple sclerosis, brain injury, cerebral palsy or spinal cord injury.
  • the neurological disease may be Alzheimer's disease.
  • the placenta-derived cells according to the present invention were administered to an Alzheimer's disease-induced mouse model, effectively demonstrating the treatment of Alzheimer's disease.
  • Another embodiment provides a pharmaceutical composition for preventing or treating angiogenesis-related diseases including the placental-derived cells.
  • the angiogenesis-related diseases include, for example, cancer, diabetic retinopathy, prematurity retinopathy, corneal graft rejection, neovascular glaucoma, melanoma, proliferative retinopathy, psoriasis, hemophiliac joints, capillary proliferation in atherosclerotic plaques, Keloids, wound granulation, vascular adhesion, rheumatoid arthritis, osteoarthritis, autoimmune diseases, Crohn's disease, restenosis, atherosclerosis, intestinal adhesion, cat scratch disease, ulcers, cirrhosis, glomerulonephritis, diabetic nephropathy, malignant neurosis, Thrombotic microangiopathy, organ transplant rejection, renal glomerulopathy or diabetes.
  • the angiogenesis-related disease may be a retinopathy-related disease such as diabetic retinopathy, premature infant retinopathy, or proliferative retinopathy.
  • the placental-derived cells according to the present invention when administered in the retina of the OIR model mouse, it was confirmed that the inhibition of neovascularization and increased the normal vascularization part in proliferative retinopathy compared to the control group. .
  • Another embodiment provides a composition for reducing aging comprising the placenta-derived cells.
  • reducing aging includes delaying or preventing aging of a cell or individual, or converting senescent cells into younger cells.
  • spontaneous of a cell refers to a decrease in proliferative capacity of cells, accumulation of lipofucin, increased ⁇ -galactosidase activity, increased mitochondrial reactive oxygen species, compared to a reference cell, One or more of a decrease in mitochondrial membrane potential, and a decrease in the duration of the G0 and / or G1 phase of the cell.
  • Young cell refers to an increase in cell proliferative capacity, a decrease in lipofucin accumulation, a decrease in ⁇ -galactosidase activity, a decrease in mitochondrial reactive oxygen species, an increase in mitochondrial membrane potential, and a cell compared to a reference cell. At least one of an increase in the duration of the G0 and / or G1 phases.
  • reducing the aging of the cell is to increase the proliferative capacity of the cell, to reduce the lipofuscin accumulation, to reduce the ⁇ -galactosidase activity, to reduce mitochondrial free radical species, mitochondria Increasing the membrane potential, and reducing the duration of the G0 and / or G1 phase of the cell.
  • the cells may be muscle cells, including myoblasts, fibroblasts, cells from a subject suffering Hutchinson-Gilford progeria syndrome, or neurons.
  • a composition for treating a condition associated with aging of an individual or cell comprising said placental derived cells.
  • the symptoms associated with cellular aging may be skin wrinkles, decreased wound regeneration, myopathy, premature aging (Hutchinson-Gilford progeria syndrome), or a combination thereof.
  • the symptoms associated with cellular aging may be those associated with the accumulation of lipofucin.
  • Symptoms associated with the accumulation of lipofuscin include neuronal ceroid lipofuscinoses (NCL), age-related macular degeneration, neurofibrillary tangles, and brown atrophy of the heart (Brown).
  • lipid accumulation muscle disease lipid myopathy
  • COPD chronic obstructive pulmonary disease
  • the pharmaceutical composition comprising the placental derived cells may include a medium obtained in a culture of placental derived cells in addition to the placental derived cells.
  • the medium may be obtained by culturing placenta-derived cells in Alpha-MEM including FGF4, and heparin, and then culturing in serum-free medium.
  • the placental derived cells of the present invention secrete C3, so the medium contains C3. Therefore, it has a better effect in the treatment of neurological diseases, treatment of neovascular diseases, reduction of aging or treatment of aging-related symptoms.
  • the medium may include not only C3, but also immune-related proteins C1r, EEF1A1, LGALS3BP, FLJ53478 and aging-related proteins EPPK1.
  • the pharmaceutical composition comprising the placenta-derived cells may further include a pharmaceutically acceptable additive in addition to the placenta-derived cells as an active ingredient, and may be a unit suitable for administration in the body of a patient according to a conventional method in the pharmaceutical field. It may be formulated in a dosage form. Suitable formulations for this purpose include parenteral formulations, such as injections or formulations for topical administration. For example, it can be used parenterally in the form of injections of sterile solutions or suspensions using water or other pharmaceutically acceptable solvents as necessary.
  • pharmaceutically acceptable carriers or media such as sterile water, physiological saline, vegetable oils, emulsifiers, suspending agents, surfactants, stabilizers, excipients, vehicles, preservatives, binders, etc.
  • sterile water physiological saline
  • vegetable oils emulsifiers
  • suspending agents e.g
  • composition of the present invention includes one or more stabilizers such as compounds that promote engraftment (eg, anti-T cell receptor antibodies, immunosuppressants, etc.), albumin, dextran 40, gelatin, hydroxyethyl starch, and the like. can do
  • stabilizers such as compounds that promote engraftment (eg, anti-T cell receptor antibodies, immunosuppressants, etc.), albumin, dextran 40, gelatin, hydroxyethyl starch, and the like. can do
  • the agent may be administered orally or parenterally according to a conventional method, specifically, parenterally.
  • parenteral administration includes topical or systemic administration.
  • the local administration may be to administer directly to or around the lesion, for example, to the brain or spinal cord, which is the lesion, or directly to or around the site.
  • systemic administration includes administration to spinal fluid, veins or arteries.
  • the spinal fluid includes cerebrospinal fluid.
  • the artery may be a site for supplying blood to the lesion.
  • the daily dosage of the composition may be in accordance with the weight 1x10 4 to 1x10 7 cells / kg, for example 5x10 5 to 5x10 6 cells / kg.
  • the number of administrations may be administered once or in divided doses.
  • the actual dosage of the composition may be increased or decreased in consideration of various related factors such as the disease to be treated, the severity of the disease, the route of administration, the weight, age and sex of the patient.
  • compositions of the present invention can be used alone or in combination with other pharmaceutically active compounds, as well as in a suitable collection. It can also be prepared in pharmaceutical formulations using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. In the preparation of the formulation, it is preferred that the active ingredient is mixed or diluted with the carrier or enclosed in a carrier in the form of a container.
  • kits for treating neurological diseases, angiogenesis related diseases, and aging related symptoms comprising the pharmaceutical composition.
  • the kit may further comprise components necessary for culturing placental derived cells.
  • the placenta-derived cells, the pharmaceutical composition and the neurological disease, angiogenesis-related diseases, and aging-related symptoms are as described above.
  • Another aspect provides a method of treating a neurological disease, angiogenesis related disease, aging related symptoms comprising administering to a subject a pharmaceutical composition comprising said placental derived cells.
  • Placenta-derived cells and pharmaceutical compositions to be administered to the subject in the treatment method are as described above, respectively.
  • the placental-derived cells can be used not only from the patient but also from cells of another person or other medical animal.
  • the cells may be cryopreserved.
  • the method comprises culturing the placental derived cells in a dish coated with polyornithine and fibronectin; And incubating the cultured cells in a medium containing FGF4 and heparin at a CO 2 condition of 1% to 7%.
  • the CO 2 conditions may be from 2% to 5%, may be 3%.
  • the administration can be local or systemic administration.
  • it may be oral, rectal, intravenous, nasal, intraperitoneal, subcutaneous or topical administration, and topical administration may be, for example, directly to or around the lesion.
  • the administration may be to administer an effective amount for preventing or treating the disease.
  • Such effective amounts can be readily selected by those skilled in the art depending on the condition of the disease selected.
  • the pharmaceutical composition of the present invention can be administered using any device capable of delivering the active ingredient to the target cell.
  • the treatment method of the present invention is not necessarily limited to humans.
  • the term “individual” means an animal including, but not limited to, mammals including monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, mice, rabbits or guinea pigs, humans In one embodiment, it may be a mammal. Normally, it is possible to perform the method of the present invention using placental-derived cells in mammals other than humans.
  • Another embodiment provides neural progenitor cells derived from placental derived cells.
  • the placental derived cells are derived from the fetus or the mother (ie fetal or maternal genotype).
  • the placental cell group or the cell group containing the placental cells may include placental-derived cells solely derived from a fetus or only from a mother, and may also include a mixed placental cell population in which a fetus and a mother-derived mixture are mixed.
  • the placental-derived cells and the cell population containing the placental-derived cells can be identified and selected according to the morphological labels and culture characteristics described below.
  • Placental-derived cells of the invention may be derived from amnion, chorionic, decidual and umbilical cords or combinations thereof.
  • the cells may be derived from the amnion of the placenta.
  • neural progenitor cell or neuronal precursor cell means a cell capable of differentiating into various types of neurons.
  • the neural progenitor cells may be used interchangeably with neural stem cells or Neural progenitor cells or Neural precursor cells.
  • the neural progenitor cells may refer to cells derived from neural stem cells.
  • the neural progenitor cells are CD9 + , CD13 + , and CD 90 + .
  • the neural progenitor cells may be SSEA-4 ⁇ , TRA-1-60 ⁇ , TRA-1-81 ⁇ , SSEA-1 ⁇ , CD34 ⁇ , and CD44 + .
  • the neural progenitor cells may be derived from placental derived cells in a high density culture in the presence of FGF4.
  • the neural progenitor cells may be differentiated from placental cells.
  • the placental-derived cells are as described above.
  • the neural progenitor cells derived from the placental derived cells may be cells derived from the placenta by high density cell culture methods.
  • the high density cell culture method is 10,000 cells / cm 2 in a dish coated with 15 ug / mL polyornithine (Sigma) and 4 ⁇ g / mL fibronectin (Sigma) Density, at the center of the plate, is plated with cell spotting starting at about one third of the total plate space, followed by culturing the cells in complete medium containing 25 ng / mL FGF4 and 1 ⁇ g / mL heparin Can be.
  • placental-derived cells were ground to placenta, 2 mg / ml trypsin (Sigma), 20 ug / ml DNase I (Sigma), 1.2 U / ml Dispase (Gibco) and 1 mg / ml collagenase IV (Sigma) After digestion with a solution comprising 10% fetal bovine serum (FBS, Gibco) and penicillin / streptomycin (Gibco), 25 ng / mL FGF4 (R & D Systems), and 1 ⁇ g / mL heparin (Sigma) It may be cultured in Alpha-MEM medium containing (Gibco, New York, USA).
  • Another aspect is to provide a pharmaceutical composition for treating or preventing neurological diseases comprising the neuroprogenitor cells.
  • the neurological disease may be Alzheimer's disease, Parkinson's disease, HIV dementia, epilepsy, schizophrenia, depression, mood swings, neurodegenerative disorders, autism, stroke, Lou Gehrig's, Huntington's disease, multiple sclerosis, brain injury, cerebral palsy or spinal cord injury.
  • the neurological disorder may be Alzheimer's disease.
  • neuroprogenitor cells derived from placental derived cells according to the present invention were administered to Parkinson's disease model mice.
  • Placenta-derived cells according to one aspect are effective in reducing neurological disease, angiogenesis-related diseases, and aging, and thus, new drug development for the treatment of neurological diseases, angiogenesis-related diseases, or aging-related symptoms. Not only can be used as a material, but also widely used in the field of basic research related to the treatment of neurological diseases and angiogenesis-related diseases, or aging-related symptoms.
  • FIG. 1 is a diagram showing the placental derived cells.
  • A Morphology of placental derived cells of the present invention obtained in passage 4
  • B FACS analysis of immunophenotypic surface profiles of placental derived cells.
  • FIG. 2 shows the effect of placental derived cells (PDCs) on microglia stimulated with A ⁇ 25 -35 .
  • PDCs placental derived cells
  • a ⁇ 25 -35 activated microglial cells showed strongly aggregated cell masses, whereas they did not show huge masses when co-cultured with PDC.
  • B The pro-inflammatory cytokine, Tumor Necrosis factor (TNF- ⁇ and Interleukin 1; IL-1), were significantly reduced in microglia co-cultured with PDC Scale bar, 100 ⁇ m. **, P ⁇ 0.01 in each comparison.Data are presented as mean ⁇ SEM values.
  • A High-priced cross-section maze experiment
  • B Light / dark traffic experiment
  • C Open field experiment
  • D Locomotor experiment results.
  • FIG. 6 shows the effect of PDC administration on A ⁇ plaque distribution in the brain.
  • A Tissues of the hippocampus and cortical areas of the brain. Frozen sections (low magnification (x40, B and C), high magnification (x100, D, E, F and G) of the cortex and hippocampus of the mouse brain) were stained with thioflavin S (green).
  • H Quantitative analysis of A ⁇ in APPswe (Tg2576) mice injected with PDC or PBS. Scale bar, 100 ⁇ m. **, P ⁇ 0.01 in each comparison; *, P ⁇ 0.05. Data are mean ⁇ S.E.M. It is represented by a value.
  • FIG. 8 shows the effect of PDC administration on the regulation of microglial cells.
  • A Immunofluorescence staining was performed using primary antibody (Iba-1) to label microglial cells. The pattern of microglial cells in the cerebral cortex area in APPswe mice injected with PDC or PBS.
  • B Quantitative image analysis of the average number of microglia cells per mm 2 at 1 and 12 weeks after transplantation.
  • C The ratio of Iba-1 positive cells at 1 and 12 weeks after transplantation is shown. Scale bar, 20 ⁇ m. *, P ⁇ 0.05 in each comparison. Data are shown as mean ⁇ SEM values.
  • FIG. 10 shows ED-1 immunoreactivity of microglia. Resident microglial cells did not detect ED-1 activity (A and C). Activated microglial cells (Iba-1) in close proximity to A ⁇ plaques show ED-1 immunoreactivity (B and D). Scale bar, 20 ⁇ m.
  • FIG. 11 shows a time course of PDC detection in the brain and spleen.
  • HuNu was not detected in brain tissues one day and one week after injection, whereas the spleen was detected one day and one week and not at 12 weeks.
  • HuNu positive cells in the spleen one day and one week after injection were reconfirmed by DAB staining. Scale bar 20 ⁇ m (A); 100 ⁇ m (B).
  • MRNA expression levels of inflammatory cytokines and proteolytic enzymes in PBS or PBS-injected APPswe mice were quantified.
  • A mRNA expression levels of IL-1, TNF- ⁇ transforming growth factor (TGF- ⁇ ), and interleukin 10 (IL-10) 1 week after injection
  • B 12 weeks after injection.
  • C were determined by matrix metallopeptidase 9 (MMP9) and insulin-degrading enzyme (IDE) 1 week after injection. It indicates the level of mRNA expression. **, P ⁇ 0.01 in each comparison; *, P ⁇ 0.05; #, P ⁇ 0.06; ##, P ⁇ 0.08.
  • Data are mean ⁇ S.E.M. Indicates by value
  • FIG. 13 shows in vitro response of PDC to inflammatory stimuli.
  • A Comparison of mRNA expression of TGF- ⁇ , MMP9, and IDE of unstimulated PDCs with TNF- ⁇ and interferon gamma (IFN- ⁇ ).
  • B Comparison of protein expression of TGF- ⁇ and MMP9 of non-stimulated PDC with TNF- ⁇ and IFN- ⁇ stimulated using ELISA. ***, P ⁇ 0.001 in each comparison; **, P ⁇ 0.01; *, P ⁇ 0.05. Data are mean ⁇ S.E.M. Indicates by value
  • FIG. 14 shows the effect of PDC administration on the regulation of regulatory T cells (Treg) in Alzheimer's mice. Distribution of regulatory T cells (Treg) in spleen mononuclear cells (SMNC).
  • A In Alzheimer's mice injected with salt or PDC, Treg CD4 + CD25 high 1 and 1 week after injection Represent cells.
  • B Shows the frequency of Tregs (%) at each time point compared to mice injected with salt. ***, P ⁇ 0.001 in each comparison; **, P ⁇ 0.01;##, P ⁇ 0.08. Data are expressed as mean ⁇ SEM values
  • FIG. 15 shows the form of PDC obtained in passage 6 (left panel), and DiI stained PDC (right panel).
  • B shows a comparison of Angiopoietin-1 (Ang-1) and Pigment epithelium-derived factor (PEDF) in human Bone marrow-MSC (hBM-MSC), hPDC and human Adipocyte-MSC (hAdipo-MSC).
  • Ang-1 Angiopoietin-1
  • PEDF Pigment epithelium-derived factor
  • FIG. 16 shows the characteristics of the PDC.
  • A It is a figure which shows the result of FACS analysis of the immunophenotype profile of PDC.
  • PDC is negative for SSEA4, TRA-1-81, TRA-1-60 (ES marker) and CD34 (hematopoietic and endothelial marker), positive for CD9 (non-nutrient membrane marker) and CD13, CD90 (MSC marker) to be.
  • B Comparison of TGF- ⁇ expression in PDC, hBM-MSC and hAdipo-MSC.
  • FIG. 17 shows the profile of inflammatory cytokines in the retina of OIR induced mice. Inflammatory cytokines were increased in the retina of the OIR group compared to the normal group. IFN- ⁇ and TNF- ⁇ levels were significantly increased. ***, p ⁇ 0.001 in each comparison; *, p ⁇ 0.05. Data are shown as mean ⁇ S.E.M.
  • FIG. 19 is a diagram showing the inhibitory effect of PDC on the proliferation of Human Umbililcal Vein Endothelial Cells (HUVEC).
  • A HUVEC co-cultured with PDC showed reduced proliferation compared to when HUVEC was cultured alone. PDCs pretreated with IFN- ⁇ and TNF- ⁇ showed a stronger inhibitory effect on HUVECs compared to normal PDCs.
  • B Transfection of TGF- ⁇ siRNA interfered with the inhibitory effect of IFN- ⁇ and TNF- ⁇ treated PDC, but the inhibitory effect of untreated normal PDC was not affected by transfection of TGF- ⁇ siRNA . ***, p ⁇ 0.001 in each comparison; *, p ⁇ 0.05. Data are shown as mean ⁇ SEM.
  • FIG. 21 shows expression of PEDF and Ang-1 after TGF- ⁇ siRNA transfection.
  • the expression levels of PEDF and Ang-1 did not change after TGF- ⁇ siRNA transfection.
  • FIG. 22 shows the effect of PDC on in vivo anti-neovascular factor expression.
  • A Retinal mRNA expression levels of the indicated anti-neurovascular factors were determined by quantitative real time PCR. There was a significant increase in TGF- ⁇ retina in mice treated with PDC.
  • FIG. 23 shows the effect of PDC on retinal angiogenesis.
  • Representative retinal flat mounts at P17 were made.
  • Retinal neovascular bundle formation sites (magnification ⁇ 200, A) and vaso-obliteration sites (magnification ⁇ 40, C) were determined by computer-assisted image analysis. Quantified sites are grayed out (inset).
  • the analyzed data shows the ratio of vascular occlusion site (B) and neovascular bundle formation site (D) in the retina.
  • Vascular occlusion and neovascular stroma were decreased in the PDC treated group compared to the control.
  • TGF- ⁇ siRNA-treated PDCs did not reduce angiogenesis compared to non-transfected PDCs, but vascular occlusion was slightly reduced in the retina of mice treated with TGF- ⁇ siRNA-treated PDCs compared to controls.
  • Data are shown as mean ⁇ SEM.
  • FIG. 25 shows the characteristics of human placenta derived cells (hPDCs) in passage 1.
  • B hPDC morphology
  • C hPDC growth curve
  • D hPDCs population doubling level
  • E shows FACS for immunophenotypic surface profiles of hPDC, respectively.
  • hPDC is negative for CD34 (hematopoietic and endothelial cell markers) and positive for SSEA4, TRA-1-60, TRA-1-81 (ES markers), CD9 and CD44, CD13, CD90 (MSC markers).
  • F-H mRNA and protein levels of stem cell markers such as OCT4, NANOG, KLF4 and SOX2 were analyzed by reverse transcription-PCR, immunofluorescence staining and immunoblotting.
  • hPDC 26 shows the differentiation potential of hPDCs.
  • B hPDC was treated with the indicated growth factors (10 ng / ml bFGF, 10 ng / ml EGF, 25 ng / ml FGF4) for 3 days. MRNA expression of Nestin and Musashi under 25 ng / mL FGF4 conditions was detected using reverse transcription-PCR.
  • FIG. 27 shows that FGF4 directly induces hPDCs into neural progenitor cells. Recognized concentrations of FGF4 were treated with hPDC for 3 days.
  • E The expression and activity of FGF4-mediated ERK1 / 2 and JNK were analyzed by immunoblot with suitable antibodies for a short period of time after FGF4 treatment on hPDC.
  • hPDCs were incubated with U0126 and SP600125 for 3 days in the presence of FGF4. Cells were then analyzed by immunoblot and immunofluorescence staining for antibodies. Nestin protein was decreased in U0126 and SP600125. The proportion of Ki-67 decreased in JNK inhibition. Scale bar is 100 um. ***, P ⁇ 0.0001 in each comparison. Data are shown as mean ⁇ SEM.
  • FIG. 28 shows FACS analysis of immunophenotypic surface profiles of hPDCs in FGF4 ( ⁇ ) or FGF4 (25ng).
  • hPDCs are negative for CD34 (hematopoietic and endothelial cell markers) and positive for CD9 and CD44, CD13, CD90 (MSC markers).
  • CD34 hematopoietic and endothelial cell markers
  • CD9 and CD44 CD9 and CD44
  • CD13, CD90 MSC markers
  • Expression of SSEA4, TRA-1-60, TRA-1-81 decreases in the presence of FGF4.
  • FIG. 29 shows hPDCs cultured in induction medium containing FGF4 in a High-Density (HD) culture system. Time-lapse digital images of the microscope were used to image hPDC in normal culture conditions and HD culture systems.
  • HD High-Density
  • FIG. 30 shows that cell-cell contact induces high levels of neurons in high-density culture systems.
  • A Shows the shape of hPDC in the HD culture system for the indicated time.
  • B, C Immunofluorescence staining with antibodies to Nestin, Ki-67, and Tuj1 of hPDCs under normal conditions or HD culture system in induction medium containing FGF4 for 12 hours, 1 day and 3 days The results shown. Cell density shown: 1,000 cells / cm 2 (1 ⁇ ) and 10,000 cells / cm 2 (10 ⁇ ). Scale bar is 100um.
  • D to E mRNA levels of Nestin, Musashi, and Tuj1 were analyzed.
  • FIG. 31 shows that cell-cell contact induces high levels of neurons through increased DLL 1 expression in NPCs.
  • A shows the levels of Delta-like 1 and notch receptor related gene expression of hPDCs cultured in HD culture or normal conditions.
  • B shows DLL-1 and HES1 gene levels in HD culture system.
  • C, E mRNA levels of DLL-1, Nestin, and Tuj1 in the presence of DAPT.
  • D, F mRNA levels of Nestin and Tuj1 in hPDCs overexpressed DLL-1 with DLL-FLAG and DLL-Fc.
  • GH is a diagram showing the effect of FGF4 on hPDC-, human bone marrow-, and fat MSC (positive control: human fetal NPC).
  • DCX DCX
  • E Sox-2
  • B neural progenitor marker
  • Nestin neural progenitor marker
  • C migration marker
  • A marker of pluripotent stem cells, at the site of transplantation and migration
  • TH a nerve marker
  • FIG. 34 shows functional recovery and PET image analysis measured by motor behavior task in 6-OHDA rats implanted with hPDCs.
  • A Behavioral experiment using 90 minutes of rotation experiment: Amphetamine (5 mg / kg, ip) -induced rotation score.
  • B Cycling asymmetry score in Cylinder Task.
  • CD Motor learning experiments using Rotarod experiments at 3 and 6 weeks after transplantation are shown. For short-term motor memory experiments, three trials performed in the first session were analyzed. For long-term motor memory experiments, the time spent on the rod was analyzed for three consecutive days 21-24 and 42 days after transplantation.
  • E BP increased after infusion of placental cells with PET images. Coronal and transaxial 18 F FP-CIT PET image slices of dopaminergic injury model (control), placental cell-induced neural progenitor cells (hPDC-NPC) and normal controls (not transplanted).
  • CM conditioned medium
  • the cells were about 80% density.
  • PDC was treated with 2 mM CM-DiI (1,1'-dioctadecyl 3,3,3 ', 3'-tetramethy lindocarbocyanine pechlorate), a lipophilic membrane-bound fluorescent dye at 37 ° C. for 30 minutes. Incubation with (Molecular Probes, Eugene, OR) (FIG. 15).
  • Placental derived cells were counted in a 100 mm dish at 4 ⁇ 10 5 cells / mm 3 in Alpha-MEM containing 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, 25 ng / mL FGF4, and 1 ⁇ g / mL heparin. Incubated for 3 days. Cells are then washed with serum-free (ITS or Alpha-MEM) medium containing 1% penicillin / streptomycin, followed by serum-free (ITS or Alpha-MEM) medium. 10 ml were placed in placental cells. After 2 days, the supernatant was collected using a 0.22um filter (conditioned medium). The obtained conditioned medium (CM) was used after storage at 4 °C.
  • FBS fetal bovine serum
  • ITS or Alpha-MEM serum-free
  • ITS or Alpha-MEM serum-free
  • Trypsin treatment was performed for protein fragmentation and protein fragmentation was performed to make peptides.
  • Protein pellets were dissolved in 1 ml / 50 mM ammonium bicarbonate and reduced to a final concentration of 5 mM.
  • the protein was treated with 14 mM concentration of iodine acetamide, then excess iodine acetamide was removed by DTT treatment and the final concentration of protein was 7 mM.
  • Reduced and alkylated proteins were removed by treating trypsin at 37 ° C. for one day. Finally 2% formic acid was added and the trypsinized peptide was dried.
  • Trypsin-treated peptides were desalted using a Sep-Pak C18 cartridge and subjected to mass spectrometer (MS) analysis. The cartridge was washed with 100% acetonitrile and calibrated with 0.1% formic acid. Trypsin-treated peptides were dissolved in 0.5% formic acid, placed in a cartridge, washed with 0.1% formic acid and 5% MEOH, and then treated with 70% acetonitrile. The two chemicals were extracted, and the peptides were dried and stored at -80 ° C.
  • MS mass spectrometer
  • the immune-related protein C3, C1r , EEF1A1, LGALS3BP (Galectin-3-binding protein), and FLJ53478 were measured only in placental-derived cells of the present invention, while aging-related protein EPPK1 was about 7 times higher in placental-derived cells than NPCs. .
  • PDCs placental derived cells
  • the expression levels of anti-angiogenic factors (including factors promoting the neovascular stabilization) in PDC were compared with hBM-MSC (membrane-derived mesenchymal stem cells) and hAdipo-MSC (adipocyte-derived mesenchymal stem cells). It was. No difference was found for PEDF and ANG-1 expression (FIG. 15B), but TGF- ⁇ expression was much stronger in PDC compared to hBM-MSC and hAdipo-MSC (FIG. 16B).
  • BV2 mouse microglial lines were maintained in DMEM supplemented with 10% fetal bovine serum (Gibco), 2 mM glutamine, and penicillin-streptomycin (Gibco) at 37 ° C. under 5% CO 2 .
  • fetal bovine serum Gibco
  • penicillin-streptomycin Gibco
  • BV2 cells were cultured in a transwell system.
  • hpMSC 2 ⁇ 10 5 cells / well
  • BV2 cells (2 ⁇ 10 5 cells / well) were plated in a 6-well dish and allowed to attach overnight. The plates were incubated for 25 -35 A ⁇ -treated 24 hours and was treated with BV2 cells with 50 ⁇ m amyloid peptide for 24 hours. NO 2 ⁇ in the culture supernatant was measured to assess NO production in BV2 cells after A ⁇ 25 -35 treatment. 50 ⁇ l of sample aliquots were mixed with 50 ⁇ l of grease reagent (Promega, Madison, Wis., USA) in 96-well plates and incubated at 25 ° C. for 10 minutes. Absorbance at 550 nM was measured with a microplate reader.
  • PDCs were cultured in 24-well plates in 1 ml DMEM medium (2 ⁇ 10 5 cells / ml), TNF- ⁇ (10 ng / ml; R & D systems) and IFN- ⁇ (100 ng / ml; Peprotech ) For 6 hours. Cells were harvested after 24 hours and supernatants analyzed using enzyme-linked immunoassay (ELISA) against TGF- ⁇ (R & D systems).
  • ELISA enzyme-linked immunoassay
  • BV2 cells immortalized rat microglial cells
  • a ⁇ 25 - after stimulation with peptide 35 were incubated with PDC ball.
  • activated glial cells are microscopic, while showing a united densely cell mass (clump), PDC and the ball fine cultured astrocytes were no cell mass (Fig. 2A).
  • PDC is A ⁇ 25 in fine glial-35 It also affected mediated NO production.
  • Exogenous IFN- ⁇ and TNF- ⁇ co-administration stimulated PDC in vitro. Quantitative real-time PCR confirmed a significant increase in TGF- ⁇ after IFN- ⁇ and TNF- ⁇ co-administration (p ⁇ 0.001; FIG. 13A). MMP-9 and IDE mRNA levels were significantly higher in PDCs cultured with pro-inflammatory cytokines than those cultured without said cytokines (p ⁇ 0.0009 and p ⁇ 0.05, respectively; FIG. 13A).
  • TGF- ⁇ levels were measured for cell lysates (236.70 pg / ml) of PDCs cultured with pro-inflammatory cytokines and cell lysates (126.73 pg / ml) for PDCs cultured without cytokines and supernatant (155.14 pg / ml) and Significantly higher than the supernatant (117.63 pg / ml) (p ⁇ 0.03 and p ⁇ 0.000006, respectively; FIG. 13B) and the level of MMP-9 was a cell lysate (452.09 pg / ml) of cells incubated with cytokines.
  • APPswe Tg2576 mice were obtained from Taconic Laboratory (Germantown, NY, USA). 12 weeks after transplantation, adult female APPswe mice (15-16 months of age; 20 g; 8 injected with PDC and 6 injected with PBS) were used for behavioral experiments and pathological analysis.
  • adult male APPswe mice (12-13 months of age; 20 g; 8 injected with PDC and 6 injected with PBS) were used for further pathological analysis one week after transplantation. Wild-type littermate mice (normal group, n 10) were compared with APPswe group.
  • mice 3 ⁇ Tg-AD mice (6-7 months old; three female mice at each time point) purchased from the Jackson Laboratory (Bar Harbor, ME, USA) were used. All experimental animals were raised under specific sterile conditions and treated under animal protocols approved by the CHA University's Animal Experimental Ethics Committee (IACUC).
  • IACUC Animal Experimental Ethics Committee
  • Placental derived cells isolated in Example 1.1 were cultured in dishes coated with 15 g / ml polyornithine (Sigma) and 4 ⁇ g / ml fibronectin (Sigma) at a density of 1 ⁇ 10 4 cells / cm 2 .
  • Complete medium containing 25 ng / ml FGF4 and 1 ⁇ g / ml heparin was then added and the cells were incubated for 6 days at 37 ° C. under 3% CO 2 .
  • 200 ⁇ l of cell suspension (about 2 ⁇ 10 6 cells) was injected into the tail blood vessel (PDC-injection group).
  • PDC-injection group In the control group, 200 ⁇ l of PBS was injected into the tail blood vessel (PBS-injection group).
  • WMT A tank containing a platform (10 cm in diameter) (1.1 m in diameter) was used in this experiment and 36 trials were made in 5 consecutive days.
  • the trial block, 1, 2, 3, and 4 contained 8 trials, and the fifth block contained 4 trials.
  • Mobility test performed on a 40 cm square. The two zones were separated by open fields: the surrounding zone and the central zone. The mouse was placed in the center of the open field and allowed to move freely for 60 minutes and tracked with an automatic tracking system.
  • Open Field Experiments This was performed on a 40 cm square black background with an inner circular platform of 10 cm diameter and illuminated by lamps. The mouse was placed in an open field arena and allowed to move freely for 60 minutes and tracked using a video recording system.
  • the maze contained four arms (45 cm (length) x 10 cm (width)) forming a cross: two arms were open arms and two arms (same size) were roof and walls. Will be closed.
  • the labyrinth was set up in a laboratory over 50 cm floor. In each trial, the mouse was placed on a central platform facing the open arms and allowed to move freely for 5 minutes. The total number of moves, the time spent in each room, and the potential for entering the bright room were recorded.
  • Video monitoring WNT, motor performance experiments, open field experiments and expensive cross-labyrinth experiments were evaluated and recorded using a charge-coupled device (CCD) camera connected to the video monitor. Experiments were performed using a video-tracking system (Ethovision, Noldus, Wageningen, NL).
  • CCD charge-coupled device
  • Brain sections per mouse isolated at 300 ⁇ m intervals, were used for quantitation. Brain sections were incubated in 0.5% Thioflavin S (Sigma) dissolved in 50% ethanol, washed twice with 50% ethanol, once with water and encapsulated with a mounting medium. The right hemisphere was stored at -80 ° C for RNA analysis.
  • Immunofluorescence Analysis For morphological analysis of activated microglial cells, an A ⁇ plaque-free brain region was selected, in which extensive infiltration of microglial cells around the A ⁇ plaques prevented the assessment of the morphology of a single microglial cell. Because.
  • immunofluorescence staining for microglia (Iba-1) and CD68 (ED1) sections were isolated from Iba-1 (1: 500; Wako, Osaka, Japan) and ED1 (1: 500; Serotec, Washington, DC, USA). Incubate overnight with antibody against and incubate with Alexa Fluor 488-, or 594-conjugated secondary antibody for 1 hour at room temperature.
  • Dual immunofluorescence staining of microglial cells, CD68 and astrocytes was performed using antibodies of the human nucleus (HuNu) (1: 100; Millipore, Billerica, Mass., USA). Normal goat serum (isotype control), or PBS (0.1 M, pH 7.4) was substituted for the primary antibody as a negative control.
  • Human nucleus (HuNu) staining was performed by the HRP-DAB method. Images were obtained using a microscope equipped with a confocal microscope (Zeiss, Oberkochen, Germany) and Adobe Photoshop CS5 software was used for quantitative analysis. A ⁇ plaques were sorted by size and counted.
  • Mouse lymphocytes were isolated from the spleen. A suspension of single cells in the spleen was obtained and Ficoll-Conray density gradient centrifugation was performed to remove dead cells and red blood cells. Mouse lymphocytes were stained in FACS buffer at 4 ° C. for 30 minutes with FITC-labeled anti-CD4 and PE-labeled anti-CD25. Relative immunofluorescence of the cells was analyzed using a FACSCalibur TM flow cytometer (BD).
  • BD FACSCalibur TM flow cytometer
  • the latent period of the normal control in tryblock 3 was significantly faster than the PBS- and PDC-injected groups (p ⁇ 0.0001 and p ⁇ 0.0002, respectively; FIG. 3B).
  • 9A shows resting microglia that are ED1 negative
  • FIG. 9B shows that ED1-positive microglia in the PDC-scan group are scattered around the A ⁇ plaque. No brain region was found without A ⁇ plaques (FIG. 10). Subsequently, similar sized, A ⁇ plaques and peripheral sites of microglia were selected for more precise analysis. Most of the Iba-1-positive microglia of the PDC-injection group were ED-1 positive, whereas a very small number of Iba-1-positive microglia in the PBS-injection group costained with ED1 (FIG. 9B).
  • the ED1 expression ratio for Iba-1 expression was significantly higher in the PDC-injected group than in the PBS-injected group, both at 1 week and 2 weeks after injection (p ⁇ 0.02 and p, respectively). ⁇ 0.05; Fig 9C). This finding suggests that the implanted PDC regulates phagocytic activity of microglia.
  • HuNu immunostaining was further performed to confirm the locus of the implanted PDC. Human cells were not found in the brain of PDC-injected mice 1 week after transplantation, but HuNu-positive cells were confirmed in the spleen at least 1 week after injection (FIG. 11).
  • the levels of mRNA encoding proinflammatory cytokines, IL-1 and TNF- ⁇ were lower than in the PDC-injected group than the normal control one week after injection (p ⁇ 0.01 and p ⁇ 0.06, respectively). However, the levels of mRNA encoding the anti-inflammatory cytokine, IL-10, were higher in the PDC-injected group than in the normal control group (p ⁇ 0.04). TGF- ⁇ mRNA levels were not significantly different between the two groups (p ⁇ 0.08; FIG. 12A).
  • IL-10 and TGF- ⁇ mRNA levels were significantly higher in the PDC-injected group than in the normal control group (p ⁇ 0.0003 and p ⁇ 0.01, respectively), but IL-1 and TNF- ⁇ . There was no significant difference in the expression of mRNA (FIG. 12B).
  • a ⁇ degrading enzymes including insulin-degrading enzyme (IDE) and MMP-9, were higher in the PDC-injected group compared to the normal control group one week after injection (p ⁇ 0.005 and p, respectively). ⁇ 0.06; Figure 12C).
  • each tissue (deciduas basalis) was carefully dissected and washed with PBS.
  • the recovered piece of tissue was cut into small pieces and digested with 0.5% collagenase IV (Sigma, St. Louis MO, USA) at 37 ° C. for 30 minutes in a shaker incubator.
  • Recovered cells were 10% fetal bovine serum (Gibco, Grand Island. NY, USA) in T 25 flasks (2 ⁇ 10 5 cells / mm 3, Nunc), 100 ⁇ g / ml penicillin and streptomycin (Gibco), respectively.
  • the cells were cultured in 25 ng / ml FGF4 (R & D system, Minneapolis, MN, USA), and alpha MEM supplemented with 1 ⁇ g / ml heparin (Sigma). All cultures were maintained in incubator at 37 ° C. with 5% CO 2 conditions and the culture medium was changed daily. In each experiment, the cells were about 80% dense, and cells greater than 5 (P5) were not used in the experiment.
  • PDC was treated with 2 mM CM-DiI (1,1'-dioctadecyl 3,3,3 ', 3'-tetramethy lindocarbocyanine pechlorate), a lipophilic membrane-bound fluorescent dye at 37 ° C. for 30 minutes. Incubation with Molecular Probes, Eugene, OR) (FIG. 15).
  • PDC was seeded at 2 ⁇ 10 5 cells / ml, incubated overnight at 1 ml volume, and then 10 ng / ml TNF- ⁇ , a pro-inflammatory cytokine; R & D systems) and IFN- ⁇ 100 ng / ml; Peprotech, Rocky Hill, NJ, USA) for 6 hours. Concentration and time were selected after titration (data not shown). Supernatants were collected and analyzed using ELISA.
  • TGF- ⁇ 1 Human TGF- ⁇ 1 Obtained from GenBank Using mRNA nucleic acid sequence (GI: 260655621) and design strategy of siRNA, two pairs of 21-bp reverse repeat sequences targeting TGF- ⁇ 1 mRNA were synthesized using Bioneer (Seoul, Korea). Forward of TGF- ⁇ 1 encoded sequence: 5′-CAGAGUACACACAGCAUAU-3 ′ (1243-1261) (SEQ ID NO: 31); The reverse, 5′-AUAUGCUGUGUGUACUCUG-3 ′ (1261-1243) (SEQ ID NO: 32) was targeted by siRNA. siRNA (final concentration 100 pmol) was infected with cells using Lipofectamine2000 (Invitrogen, Gaithersburg, MD) according to the manufacturer's instructions. The effect of TGF- ⁇ 1 gene silencing was assessed by quantitative real-time RCR and western blotting.
  • HUVEC Human umbilical vein endothelial cells
  • PDC (2 ⁇ 10 5 cells / well) was seeded inside a Transwell (BD) 6-well having a membrane pore size of 0.4 ⁇ m, HUVEC (2 ⁇ 10 5 cells / well) plated on a 6-well dish, It was allowed to attach overnight.
  • PDCs were treated or untreated with pro-inflammatory cytokines or siRNAs. siRNA treatment was performed prior to stimulation with pro-inflammatory cytokines. Plates were incubated 24 hours prior to the proliferation assay.
  • HUVECs were seeded in 6-well plates (2 ⁇ 10 5 cells / well) containing growth medium. After 16 hours of starvation phase (1% FCS), cells were stimulated with VEGF165 (20 ng / ml; R & D) and incubated with BrdU (5'-bromodeoxyuridine) solution for 24 hours at a final concentration of 0.01 mM. It was. Cell proliferation was assessed by BrdU-based proliferation measurement. BrdU included was stained with specific anti-BrdU (Abcam, Cambridge, Mass.) Fluorescent antibodies. Absorbance was confirmed with a microplate reader variable VersaMax (Molecular Devices, Sunnyvale, Calif., USA).
  • cytokine expression in OIR-induced retinas was analyzed. Multiple inflammatory cytokines, in particular TNF- ⁇ and IFN- ⁇ , were upregulated (FIG. 17). Based on these results, the effects of IFN- ⁇ and TNF- ⁇ on PDC were tested in vitro. MRNA and protein were extracted from PDC at 0 and 24 hours after IFN- ⁇ and TNF- ⁇ treatment. RT-PCR analysis showed that IFN- [gamma] and TNF- [alpha] exposed PDCs showed no significant difference in mRNA levels of PEDF and ANG-1 expression was slightly reduced (Figure 18A).
  • TGF- ⁇ expression in PDC was significantly upregulated (p ⁇ 0.001; FIG. 18A).
  • increased secretion of TGF- ⁇ protein was confirmed by ELISA (271.82 ⁇ 6.35 pg / ml vs. 70.45 ⁇ 2.36 pg / ml, p ⁇ 0.001; Figure 18B).
  • HUVECs were co-cultured with normal or IFN- ⁇ and TNF- ⁇ treated PDCs.
  • IFN- [gamma] and TNF- [alpha] treatment were performed on PDC one day before coculture.
  • Inhibitory effect on proliferation was determined by BrdU-based proliferation assay, and the results demonstrated PDC-mediated inhibition of HUVEC proliferation.
  • FIG. 19 compared to the culture of HUVEC alone, a slight inhibitory effect on proliferation was observed in HUVEC co-cultured with normal PDC.
  • IFN- ⁇ and TNF- ⁇ treated PDCs showed a greater inhibitory effect on the proliferation of HUVECs compared to normal PDCs (FIG. 19A). This suggests that PDCs exposed to retinopathy-like conditions inhibit HUVEC proliferation more effectively than PDCs under normal conditions.
  • TGF- ⁇ expression was silenced by siRNA transfection.
  • the transfection effect of TGF- ⁇ siRNA in PDC culture was confirmed by quantitative real-time PCR, which showed that TGF- ⁇ siRNA reduced 80-90% of TGF- ⁇ expression compared to control PDC (FIG. 20), The expression of PEDF and Ang-1 showed no change (FIG. 21).
  • TGF- ⁇ siRNA transfection interfered with the inhibitory effect of PDC on HUVEC proliferation.
  • OIR Oxygen-Induced Retinopathy
  • P17 retinas were harvested for imaging of vasculature, sites of injected or endogenous cells, and features. Quantification of vascular obliteration and preretinal neovascular tufts was performed at P17. Immunohistologic analysis for staining blood vessels was performed as previously described. In summary, the retina is fixed in 4% paraformaldehyde (PFA) for 1 hour and blocked in 10% normal goat serum (NGS) for 1 hour, followed by fluorescent labeling. Incubated overnight with conjugated Griffonia simplicifolia lectin (GS-lectin) (Vector. Lab., Oratories Inc, CA).
  • PFA paraformaldehyde
  • NGS-lectin conjugated Griffonia simplicifolia lectin
  • the retina was counterstained with DAPI to visualize cell nuclei.
  • the retina was placed flat with a radial-relaxing incision to obtain a whole-mount preparation. In some cases, only blocking without vascular staining was performed to prevent fluorescence interference for tracking the injected cells. Images were obtained using a microscope connected to a Windows PC for quantitative analysis using a digital camera system (Nikon, Tokyo, Japan) and Adobe Photoshop CS5 software.
  • Real-time PCR was performed in the LightCycler (Roche) SYBR-Green reaction kit (Roche, Lewes, UK) according to the manufacturer's instructions, relative to the housekeeping gene and the genes of VEGF, TGF- ⁇ PEDF, and Ang-1 Expression was determined. Primer sequences are shown in Table 3. Analysis of relative gene expression data was calculated by CT (comparative threshold cycle method). Target gene expression values were normalized against the expression levels of housekeeping genes. Control expression values in the data set were standardized and relative expression levels of other samples were calculated.
  • the dissected retina, snap frozen was homogenized on ice in RIPA buffer containing Proteinase Inhibition Cocktail (Sigma-Aldrich). Since the total retinal total protein of three young mice was collected for one sample, a total of three samples were obtained from 9 litters per group. Samples were centrifuged at 4 ° C. at 8,000 g for 10 minutes. TGF- ⁇ 1 in retinal samples and culture supernatants was analyzed using Human TGF- ⁇ 1 Quantikine kits (R & D) according to manufacturer's instructions. The concentration of TGF- ⁇ 1 was calculated by comparison with a standard sample. The TGF- ⁇ 1 mean of each group is shown in three experiments.
  • SAS Statistical Analysis System
  • SAS SAS Korea, Inc., Seoul, Korea
  • version Enterprise 4.0 was used as the primary university main computer. Data is presented as mean ⁇ SEM and all statistics were calculated using an independent tee test. Real time PCR data were analyzed using raw data. The p value was considered to be less than 0.05.
  • cytokine expression in the retina of OIR model mice was analyzed after treatment of PDC.
  • PDC was injected intraperitoneally in each mouse of P12 and retinal tissues were analyzed at P17.
  • Anti-neovascular factor expression in the retina was then assessed by real time PCR. Similar to in vitro data, TGF- ⁇ expression was significantly increased in the retina of PDC-treated mice (FIG. 22A). PEDF expression in the PDC-treated group was not different from the control group, and Ang-1 expression was not detected in the retinal tissues.
  • TGF- ⁇ levels reached 65.23 ⁇ 11.16 pg / ml in the PDC-treated group, whereas TGF- ⁇ mean levels in the control group were 27.73 ⁇ 3.57 pg / ml (p ⁇ 0.01; FIG. 22B).
  • TGF- ⁇ mRNA and protein levels indicates that TGF- ⁇ is secreted by PDC in vivo retinopathy conditions.
  • FIG. 23A administration of PDC significantly altered the extent of pathological angiogenesis induced by OIR compared to control.
  • Quantitative analysis confirmed that the inhibition of neovascularization sites in the retina was 4.73% or more in the PDC-treated group compared to the control group.
  • the retinal vasculature of the PDC-treated group shows general morphology and branching in the periphery and periphery, except for sparse avascular sites around the central retina (FIG. 23C).
  • the vascular obliteration portion is grayed out ( Figure 23C).
  • the retinas of PDC treated mice show about 10.93% of non-vascular portions as compared to the retinas of PBS treated mice (p ⁇ 0.001; FIG. 23D).
  • TGF- ⁇ siRNA treated PDCs failed to inhibit neovascular bundle formation compared to non-silent PDCs (p ⁇ 0.001; FIG. 23B); However, even though the difference in normal vascularization fraction between untreated PDC and TGF- ⁇ siRNA treated PDC was not significant (p> 0.27; FIG. 23D), the normal vascularization portion was TGF- ⁇ siRNA compared to the control. There was a slight increase in the treatment group (p ⁇ 0.06; FIG. 23D). These results indicate that PDC treatment effectively inhibits retinal neovascularization through TGF- ⁇ expression, whereas the effect on vascular occlusion is irrelevant to TGF- ⁇ .
  • Example 4 Nerve from Placental Cells Progenitor cells Identify the effects of functional impairment improvement on induction and his Parkinson's induction model
  • the recovered cells were subjected to Alpha-MEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) and penicillin / streptomycin (Gibco), 25 ng / mL FGF4 (R & D Systems), and 1 ⁇ g / mL heparin (Sigma). , New York, USA) was incubated in a T25 flask (2 X 10 5 cells / mm 3 , Nunc). On day 3, human amniotic stem cells (trypinized) were trypsinized and counted using a hemacytometer.
  • Alpha-MEM medium Gibco
  • FBS fetal bovine serum
  • Gibco penicillin / streptomycin
  • 25 ng / mL FGF4 R & D Systems
  • 1 ⁇ g / mL heparin Sigma
  • hBM-MSCs human Bone marrow mesenchymal stem cells
  • hAD-MSCs Human Adipose mesenchymal stem cells
  • Human derived neural precursor cells were plated at a density of 30,000 cells / cm 2 in a culture dish pre-coated with 15 ⁇ g / ml polyornithine and 4 ⁇ g / m fibronectin.
  • Cells were 1 ug / ml tocopherol and 1 ug tocopherol acetic acid and 20 ng / ml human epidermal growth factor (EGF), 20 ng / ml human fibroblast growth factor (FGF-2; formerly primary fibroblast growth factor) and 2% B- Cultured in DMEM / F12 (Gibco) supplemented with 27 minus-AO supplement. Cultures at 37 ° C., 5% CO 2 , 92% N 2 and 3% O 2 Placed in a humid environment.
  • Flow cytometry analysis For phenotypic analysis, cells were stained with appropriate concentrations of the following antibodies at 4 ° C. in FACS buffer for 20 minutes: FITC-labeled anti-SSEA4, TRA-1-81, CD90, CD34 and PE-labeled anti- TRA-1-60, CD9, CD44, CD13 (BD Pharmingen). After washing the cells, they were analyzed by FACS Calibur (Becton Dickinson) using Cell Quest software.
  • Immunoblotting Assay Cells were washed with cold PBS and lysed with lysis buffer containing Protease Inhibition Cocktail (Pierce). Total cell lysates were normalized by Bradford reagent (Bio-Rad), 30-50 ⁇ g of lysate was applied to 8-12% SDS-PAGE and transferred to PVDF membrane (Milipore). The membranes were blocked in TBS-T (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.05% Tween-20) containing 5% skim milk (Becton Dickinson) and examined with each antibody. Immune responses were performed using the ECL Western Blotting system (Milipore, Amersham).
  • hPDCs were incubated in alpha-MEM supplemented with 10% FBS (Gibco), 100 ⁇ g / mL penicillin and streptomycin (Gibco), 25 ng / mL FGF4 (R & D Systems), and 1 ⁇ g / mL Heparin (Sigma), respectively.
  • FBS FBS
  • penicillin and streptomycin Gibco
  • 25 ng / mL FGF4 R & D Systems
  • Heparin Heparin
  • Cells begin at approximately 1/3 of the total plate space at the center of the plate, at a density of 10,000 cells / cm 2 in a dish coated with 15 ug / mL polyornithine (Sigma) and 4 ⁇ g / mL fibronectin (Sigma) The cells were plated by spotting, followed by incubation in 37 ° C., 5% CO 2 environment for 6 days in complete medium containing 25 ng / mL FGF4 and 1 ⁇ g / mL heparin.
  • Adipogenic differentiation Seeding cells in a 6-well culture dish at a density of 1.5 X 10 4 cells / cm 2 and high glucose DMEM supplemented with 10% FBS (Gibco) until 100% density is reached. Incubated in Gibco). Followinged by lipocytic induction medium (1 mM dexamethasone (Sigma), 0.5 mM 3-isobutyl-1-methyl-xanthine (Sigma), 10 ng / mL recombinant human insulin (Sigma), 100 mM indomethacin (Sigma) , 3 cycles of induction for 7 consecutive days each using high-glucose DMEM supplemented with 10% FBS and adipocyte maintenance medium (high-glucose DMEM supplemented with 10 ng / mL recombinant human insulin and 10% FCS) / Maintenance was performed. After differentiation, cells were fixed with 10% formalin and stained with 2% (wt / vol) Oil Red O formulation (Sigma) for 5 minutes at room
  • Osteogenic differentiation cells are 3 X 10 3 cells / cm 2 Seed to density, incubated in high glucose DMEM (Gibco) supplemented with 10% FBS (Gibco) until reaching 70-80% density, followed by osteogenic induction medium (100 nM dexamethasone twice per week for 2.5 weeks). Sigma), 10 mM ⁇ -glycerophosphate (Sigma), 0.2 mM ascorbate (Sigma), and IMDM basal medium (GIBCO) supplemented with 10% FBS Osteogenic differentiation was 10% for 15 minutes at room temperature. Cells were fixed with formalin and detected using staining with von Kossa staining, which demonstrates the deposition of the hydroxyapatite matrix.
  • Chondrogenic differentiation To induce chondrogenic differentiation, the first cells (3 x 10 3 cells / cm 2 ) are seated, transferred to 15-mL polypropylene tubes, and pellet micromass at the bottom of each tube. In order to form (pelleted micromass), centrifugation was performed at 1000 rpm for 5 minutes, and finally cartilage medium (0.1 M dexamethasone, 50 g / mL AsA, 100 g / mL sodium pyruvate, 40 g / mL proline, 10 ng / mL).
  • cartilage medium 0.1 M dexamethasone, 50 g / mL AsA, 100 g / mL sodium pyruvate, 40 g / mL proline, 10 ng / mL).
  • TGF-1 (Peprotech), 6.25 g / mL insulin, 6.25 g / mL transferrin, 6.25 ng / mL selenic acid, 1.25 mg / mL BSA, and 5.35 mg / mL linoleic acid (all except TGF-1) from Sigma ) Supplemented with high-glucose DMEM).
  • Medium was changed twice a week and cartilage formation was analyzed weekly. 2-4 weeks after incubation, cells were washed twice with PBS, fixed in 4% PFA and stained with Alcian Blue.
  • hPDC was added to alpha-MEM medium containing 10% FBS pretreated or not pretreated with 5 ⁇ M ERK inhibitory U0126 or 10 ⁇ M JNK inhibitory SP600125 (Calbiochem) in dimethyl sulfoxide (DMSO). After incubation for 1 hour, the cells were stimulated with 25ng / mL FGF4 for 3 days.
  • ASCs were not pretreated or pretreated with 50 ⁇ M Notch Inhibited DAPT (N- [N- (3,5-difluorophenacetyl) -1-alanyl] -S-phenylglycine t-butyl ester, Sigma). Cultured in alpha-MEM medium containing 10% FBS for 1 hour and stimulated with 25 ng / mL FGF4 for 3 days.
  • Cells are incubated with Alexa Fluor 488 or 594-conjugated antibody (Molecular Probes) for 1 hour at room temperature and 4 ', 6-diamino-2-phenylindole (DAPI, 2 mg / mL in PBS) to identify cell nuclei. Stained with. A cover-slip was enclosed on a glass slide. Cells were articleed using a fluorescence microscope or confocal fluorescence microscope (LSM 510 confocal microscope, Zeiss).
  • Alexa Fluor 488 or 594-conjugated antibody Molecular Probes
  • DAPI 6-diamino-2-phenylindole
  • mice Female adult Sprague-Dawley rats (220-250 g) were housed at room temperature (22-23 ° C.) standard 12 hour light / dark cycle (7 am), providing unrestricted access to food and water. It was. The experimental procedure was performed according to the animal care guidelines of the experimental animal control committee.
  • the Vectastain Elite ABC Kit (Vector Laboratories., Burlingame, CA, USA) was used as the secondary antibody. Tissues were visualized with a fluorescence microscope or confocal fluorescence microscope (LSM 510 confocal microscope, Zeiss).
  • the free-flowing 40- ⁇ m fragments obtained as above were stained overnight at 4 ° C. with the following primary antibodies: SOX2 (1: 200; Chemicon), Nestin (1: 200; Chemicon) and DCX ( 1: 200; Cell-Signaling Technology).
  • Tissues were washed three times with PBS and incubated for 2 hours with secondary fluorescent-conjugated goat anti-mouse or anti-rabbit antibody (DAKO, Denmark, Cy3, FITC, both diluted 1: 1,000) and finally Washed and sealed into Vectorshield. All tissue samples were additionally counterstained with DAPI. Tissues were visualized with a fluorescence microscope or confocal fluorescence microscope (LSM 510 confocal microscope, Zeiss).
  • Rotational Experiment After intraperitoneal injection of 5 mg / kg amphetamine (Sigma), rotational behavior was measured for 90 minutes using an automatic rotameter system (Med Associates Inc.). The number of ipsilateral turns was calculated 7 days before cell transplantation and 3, 7 and 9 weeks after transplantation.
  • Cylinder experiment Spontaneous movement was determined by placing the animal in a transparent cylinder (height, 40 cm; diameter, 20 cm). Voluntary activities were recorded for 5 minutes in video. A total of six patterns of movement (left forelimb contact, right forelimb contact, first left contact of both forelimbs, first right contact of both forelimbs, both forelimb contact, and body only) were evaluated by observation of the spontaneous movement of the let. The number of forelimb steps was measured.
  • Rotarod Experiment Accelerated Rotarod experiments were performed using the ACCELER Rotarod Wheel of the Lett. After adapting to a fixed speed (4 rpm) for 3 minutes, the rotational speed of the rod was placed on a horizontal plastic rod that increased linearly from 50 rpm to an initial speed of 4 rpm for 5 minutes. The amount of time each rat was able to balance the walking on the rod was measured. Load rotation time was calculated 21, 22, 23, and 42 days after cell transplantation.
  • the rats were sacrificed by cervical dislocation 6 weeks after implantation or salt infusion, and the striatum (ST) and subtantia nigra (SN) were rapidly dissected. Samples were placed in 400 ⁇ l of ice-cold lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholic acid, 0.1% SDS and 0.02% sodium azide). Sonicate. Protein concentration of the lysate was determined using Bradford reagent.
  • samples (10-20 ⁇ g protein) were loaded onto 12% sodium dodecyl sulfate-polyacrylamide electrophoresis gel. After separation, proteins were blotted onto nitro cellulose membranes and stirred at room temperature in Tri-buffered saline (TBS) containing 0.1% Tween-20, 5% skim milk and 0.2% BSA for 1 hour. After stirring, the membranes were incubated with the primary antibody (rabbit monoclonal anti-TH; Biotechnologies Santa Cruz, CA. USA; 1: 1000) for 1 hour at room temperature in TBS containing 0.1% Tween-20.
  • TBS Tri-buffered saline
  • the primary antibody was detected using horseradish peroxidase (HRP) -bound secondary antibody (anti-rabbit; 1: 1000), and the bound secondary antibody was enhanced chemiluminescence (Amersham Biosciences, Visualized by Buckingghamshire, UK).
  • HRP horseradish peroxidase
  • mice 6 x 6 week old 6 BALB / c-nu Sic male mice (Central Lab. Animal Inc, Korea) were implanted with 5 x 10 5 cells in 10 ⁇ l culture medium into both right and left testes using a 21-gauge needle. It was. At 8, 12 or 48 weeks after transplantation, mice were sacrificed and testes were fixed in 10% formalin. For all tissue analysis, they were placed in paraffin blocks, the blocks were cut to 10-15 ⁇ m and the resulting slides were stained with hematoxylin and eosin.
  • Karyotyping was performed using the Cytogenomic Services Facility of Samkwang Medical Laboratories. For the analysis of karyotypes, cell division was blocked at mid-term using 0.05 ⁇ g / mL colcemid for 1-2 hours. Chromosomes were visualized by G-band staining, more than 100 medium cells were analyzed, and at least three were karyotyped.
  • Statistical analyzes were performed using a Statistical Analysis System (SAS; SAS Korea, Inc. Seoul, Korea), version Enterprise 4.0. The number of TH + cells was analyzed using T-test or two-way analysis and subsequent LSD-post assay. For behavioral assays, the mean values of rotational experiments, rotarod, and cylinder tests were used as dependent variables, and "treatment" (control, hPDCs, hPDCs-NPC, and hES-NPC transplant groups) were independent variables. (independent variable). Mixed model analysis of the variance procedure (SAS, PROC MIXED) is used to take into account the random effects of the let.
  • SAS Statistical Analysis System
  • PROC MIXED Mixed model analysis of the variance procedure
  • HPDCs isolated from placental amnion were characterized using several in vitro assays.
  • Karyotyping of isolated cells confirmed retention of human fetal origin (FIG. 25A), and a very flat, asymmetrical spindle-shaped form strongly reminiscent of mesenchymal cells (FIG. 25B).
  • the growth curve of hPDC demonstrated that the amount of cells accumulated in vitro increases rapidly and constantly with increasing cell passage, indicating active proliferation of cells.
  • the doubling time of hPDCs is 31 hours and the population doubling level (PDL) lasts up to 32 days (FIG. 25C, D).
  • Flow cytometry is positive for hPDCs on MSC-related surface markers CD44 (94.3 ⁇ 3.7%), CD13 (84.1 ⁇ 7.1%) and CD90 (84.0 ⁇ 7.5%), negative for hematopoietic stem cell marker CD34 Indicates.
  • hPDC protein levels of OCT4, NANOG, and KLF4 were not detected in freshly isolated hPDCs (FIG. 25H), whereas four genes in hPDCs, KLF4, OCT-3 / 4, NANOG and Expression of mRNA for SOX2 was detected (FIG. 25G, H).
  • H9 cells showed alkaline phosphatase activity, but not hPDC (FIG. 25I).
  • hPDC showed the ability to differentiate into mesenchymal-line cells such as adipocytes, osteoblasts and chondrocytes (FIG. 26A).
  • FGF4 growth factors including bFGF, EGF, and FGF4 were examined to investigate their neural induction potential.
  • FGF4 influenced the fate of proliferation of hPDC. Accordingly, three days of treatment with different doses of FGF4 (10 ng / mL, 25 ng / mL, and 50 ng / mL) were investigated to affect Nestin expression, a typical marker of NPC of hPDC.
  • the highest mRNA expression level of Nestin was obtained at 25 ng / mL FGF4 (FIG. 27A).
  • the expression of Nestin protein measured by immunoblotting was similarly increased (FIG. 27B).
  • FGF4 25 ng / mL
  • the number of Nestin-expressing cells was significantly different (total cells counted in 7 sets of independent cultures, p ⁇ 0.0001 ) (FIG. 27C , D).
  • Expression of SSEA-4, TRA-1-60, and TRA-1-81 was also lower in FGF4 treated cultures than in FGF4 untreated control cultures (FIG. 28), while CD9, CD90, CD13 , And CD44 were maintained in FGF4 treated cultures.
  • Intracellular signaling activity such as mitogen-activated protein kinase (MAPK; including ERK and JNK), which can subsequently activate neuronal differentiation of hPDC.
  • MAPK mitogen-activated protein kinase
  • FGF4-treated or untreated cells changes in protein levels of signal molecules in the form of activation (phosphorylation) over 72 hours were measured.
  • pERK phosphorylated ERK
  • An immediate increase in pERK (phosphorylated ERK) levels was observed at 12 hours, and the level of pERK gradually increased during 24 hours after FGF4 treatment.
  • FGF4 / ERK signaling or FGF4 / JNK signaling 5 mM U0216, an ERK signaling inhibitor, or 20 mM, a JNK signaling inhibitor, 1 hour before FGF4 administration to hPDC SP600125 was administered and ERK phosphorylation and JNK phosphorylation were analyzed at 72 hour time points.
  • Inhibition of FGF4-MAPK signaling by specific inhibitors U0126 (ERK signaling) and SP600125 (JNK signaling) resulted in a decrease in Nestin protein levels (FIG. 27F, G).
  • Ki-67 + proliferating cells Ki-67 + proliferating cell ratio
  • FGF4 induced ERK signaling is specific for signal induction, but does not affect Ki67 + proliferating cells, whereas FGF4-JNK signal transduction affects the expression of Ki-67 as well as Nestin.
  • hPDCs cultured in medium containing FGF4 were spotted on the plates to form morphologically spherical aggregates, termed "High-Density (HD) culture systems".
  • HD High-Density
  • hPDCs cultured in HD showed Nestin + cells at a slightly higher rate than cells in normal culture, and no HD showed 5 ⁇ density.
  • a sharp increase in the number of Nestin + and TUJ1 + cells was observed.
  • hPDCs cultured by the 10 x density HD method demonstrated the highest levels of Nestin + cells.
  • hPDCs cultured by the 10 ⁇ density HD method showed the highest expression of TUJ-1 after 3 days of neural induction.
  • HD conditions resulted in a slight increase in Nestin mRNA levels on day 3 and a strong increase in Nestin on day 6 compared to expression levels under normal culture conditions, while Musashi mRNA and TUJ1 mRNA under HD conditions compared to normal growth conditions.
  • the increase in the level of was not significant (FIG. 30D).
  • Musashi1 protein levels increased at HD culture conditions of 5x to 10x (P ⁇ 0.0001 from 5x to 10x in HD culture conditions) (FIG. 30F, H ).
  • PCNA protein levels slightly decreased under HD culture conditions (FIG. 30F, J).
  • mRNA expression of some Notch receptors and ligands was measured in hPDC and hPDC-NPC using RT-PCR. Initially, mRNA levels were compared between hPDCs cultured under normal culture conditions and hPDC-NPC induced under HD culture conditions. In all culture conditions, the same medium containing FGF4 was used for 3 days. RT-PCR analysis showed that hPDC expresses all human Notch receptors Notch1, Notch2, Notch3, Notch 4, Notch ligand expresses DLL1, DLL3 and JAG2, but not DLL4, JAG1 (Fig. 31 A). ).
  • DLL-1 ligand is much more potent in HD cultured hPDC-NPC than normal cultured cells, whereas the expression of JAG2 ligand and Notch receptor does not change between the two cultures, indicating that DLL1 is the optimal neuron / neuron Indicates an important factor for induction.
  • DLL1 neurotransmission regulates transcription factors it regulates the development of neural lineage and generates hepatocytes, including progenitors including HES1, HES5, MASH1, NEUROD, and NGN2. Gene expression patterns were evaluated. Semi-quantitative RT-PCR showed that the expression levels of MASH1 and NEUROD were increased in HD culture than in normal culture. Expression of HES1 was detected in both normal and HD cultures. In HD culture methods, expression of HES1 decreases with increasing cell density, while the level of DLL1 increases with increasing cell density.
  • HES1 is a negative bHLH transcription factor that inhibits neurogenesis, and that DLL-1 is essential for neuronal or neuronal development through cell-cell interactions, it would be desirable to improve cell-cell interactions to increase neuronal / neuronal induction. The likelihood is very high ( Figure 31B).
  • neuron / neuron induction during the culture of hPDCs was performed using the effect of the Notch inhibitor DAPT ( N- [ N- (3,5-difluorophenacetyl) -1-alanyl] -S -phenylglycine t-butyl ester). Under conditions (HD with FGF4) it was examined whether binding of DLL1 blocks Notch (FIG. 31C). To analyze the effect of DAPT inhibitors on neuronal maintenance, gene expression of DLL, Nestin, TUJ was measured in DAPT treated cells and DMSO treated cells.
  • BM-MSCs adult human bone marrow MSCs
  • AD-MSCs adipose tissue-derived MSCs
  • Neural induction of fetal NPCs was hardly affected by FGF4 (FIG. 31G, H).
  • HN-immunoreactive cells were observed around the vertical needle tract 1 week after implantation (FIG. 33A). One week after transplantation, almost all of the HN + cells co-expressed SOX2 (FIG. 33B). At about 1 and 6 weeks after transplantation Nestin + cells were co-labeled with HN + cells (FIG. 33C). One week after transplantation no other germline markers were detected, such as BRA (mesoderm), Desmin (mesoderm), and c-KIT (endoderm). Six weeks after transplantation, cells positive for the migration marker DCX were distributed in the striatum.
  • BRA meoderm
  • Desmin mesoderm
  • c-KIT endoderm
  • the hPDC-NPC group was significantly different from the control group ( P ⁇ 0.03 and P ⁇ 0.003 , respectively), and the ipsilateral convolutional behavior, compared to the gastric control group, showed that the hPDC and hPDC-NPC groups At 20% and 30% respectively.
  • amphetamine-induced ipsilateral rotation continued to decrease from 3 to 9 weeks.
  • Rats implanted with hPDC-NPC demonstrated a markedly increased use of damaged forelimbs compared to the control group ( P ⁇ 0.05).
  • the motor memory was analyzed using the Rotarod experiment. The lactency falling from the accelerated load was measured. This experiment was divided into short-term and long-term memory experiments. To measure short-term memory, three trials of the first day were analyzed and the slope difference between trials was analyzed. Letts implanted with hPDC-NPC showed a gradual increase in latent phase and spent significantly more time on the load during three trials (p ⁇ 0001, FIG. 34C).
  • a PET analysis was performed 9 weeks after cell transplantation to quantify DAT-ligand binding to left and right striatum at specific binding sites and cerebellar binding to cerebellum at nonspecific binding sites.
  • the control group was 18 F FP-CIT PET of the dopaminergic impairment model.
  • the BP of the dopamine injury model was 0.06 at 6-OHDA injection site (right striatum) and 2.70 at normal site (left striatum).
  • ASI was 1.91 (FIG. 34E. Left).
  • hPDC-NPC cell transplantation increased uptake of radionuclide was detected at the striatum.
  • BP was 1.75 at placental derived cell input site (right striatum), 2.75 at normal site and ASI was 0.44 (FIG. 34E. Middle).
  • ASI was 0.44
  • BP in striatum was 2.89 (left striatum) and 2.95 (right striatum) and ASI was 0.02 (FIG. 34E. Right).
  • the mean number of striatum sites was significantly higher.
  • Molecular imaging with 18 F FP-CIT PET showed reduced radioactivity in striatal lesions at the site of 6-OHDA.
  • BP significantly increased and ASI significantly decreased, indicating a recovery of FP-CIT in the DAT terminal.
  • TH protein levels were measured to assess in vivo survival of dopaminergic neurons in striatum and SN.
  • TH protein was detected in intact striatum and intact SN and not in lesioned striatum or diseased SN in hPDC-injection group or gastric-contrast group.
  • TH protein was observed weekly in the diseased striatum and SN in the hPDC-NPC injection group (FIG. 34F).
  • hPDC-NPCs form teratomas
  • SCID mice To test whether hPDC-NPCs form teratomas, hPDC-NPCs were implanted in SCID mice. No teratoma formation was observed at 6 and 32 weeks (FIGS. 35A, and B).
  • Example 5 Verification of the efficacy of aging inhibition of human placental derived cells
  • hPDCs human placenta derived cells
  • LL-24 As senescence of LL-24 was observed by coculture with cell lines derived from aged human lung (generation 17-23) and placental cells isolated from human placental amnion, The effect of the cells of the present invention was confirmed. Specifically, 17, 20, and 23 generations of LL-24 in a transwell chamber through which secreted substances of hPDCs (5th generation or less) can pass (hPDCs are isolated) in culture conditions for LL-24. After co-culture, cultured LL-24 was collected to analyze molecular biological markers of cell proliferation and cell aging.
  • co-cultured LL-24 inhibited generation of cell growth markers 1) PCNA, Cyclin D1, and 2) anti-aging marker Sirt1, 4) generation of free radicals, which is a major factor of aging, compared to control.
  • the Western blot showed that p16 protein, an increase in Sirt1 and PCNA, and aging markers It was confirmed that the decrease in co-culture (Fig. 38). However, such differences were shown to decrease as the generation progressed, indicating that the inhibitory effect of aging by hPDCs varies with age and generation of target cells.
  • HNPCs cultured up to 18 generations were co-cultured for 4 and 6 days in a chamber through which substances secreted from hPDCs could pass under culture conditions of hNPCs, followed by aging-related markers, cell proliferation markers, and aging-promoting activity of hNPCs. Regulatory factors of reactive oxygen, epigenetic markers related to the maintenance of the properties of hNPCs, and the expression of Wnt signaling, a key mechanism, were investigated.
  • Placenta derived from the present invention through various behavioral experiments and molecular biological and biochemical analysis of tissues after at least one administration of human placenta-derived cells, studying the processes and mechanisms of natural aging in naturally aged mice (> 18 months of age). The aging regulation and anti-aging mechanisms of cells were studied.
  • mice C57BL / 6 mice aged 18-20 months were injected with 10,000 human placental derived cells (hPDCs) or control groups at 6 weeks intervals in the same volume of physiological saline through the blood vessels in the tail, and their survival and changes in cognitive function were notified.
  • hPDCs human placental derived cells
  • hippocampus a brain region that plays an important role in regulating cognitive function of the brain in aged mice administered hPDCs three times
  • the placenta-derived cells were administered Similar to the results of cognitive improvement in rats, expression of aging-related markers such as p16, HMGA2, and p57 was inhibited in 23-month-old aging rats (multi-cell group) with three cells compared to controls of the same age group. Confirmed. However, there was no difference in the single cell group of 18 months old cells compared to the control group. The expression of p16 and p57 was increased in all aged rats compared to the 3 month old young group.
  • the astrocytes which regulate immune function and neuronal activity in the brain, increase with aging progression.
  • hPDCs were decreased once compared with controls of the same age, but 23-month-old aging In rats, the effect was shown to be small.
  • the expression of energy metabolism and oxidative stress markers, UCP2 and SOD2, in the tissues showed a decrease, although not significant (FIG. 40).
  • hPDCs The effects of hPDCs on the differentiation of oligodentrocytes that regulate aging and neurotransmitter function of neurons were then investigated.
  • Myelin a protein secreted by oligodendrocytes and its cells, has been reported to surround neuronal axons and regulate neurotransmitter function, and destruction of oligodendrocytes and myelin is closely associated with age-related neurological diseases.
  • NG2 progenitor cells
  • MBP mature oligodendrocytes
  • the cells stained by MBP showed structural and expression differences in senescent rats to which placental cells were administered.
  • differences in oligodendrocytes distribution and function were associated with improved cognitive function and increased neuronal activity by placental cells. It seemed to be the cause.
  • This list of genes corresponds to genes that showed a significant 1.5-fold difference in expression in senescent mice compared to young mice.
  • This list of genes corresponds to genes that showed significantly more than 1.5-fold differences in expression in senescent mice administered cells compared to controls.
  • fatty metabolites and metabolic mechanisms such as sphingolipid are secreted by oligodendrocytes and are involved in the synthesis of myelin, which regulates nerve signal transduction by surrounding nerve cells' axons.
  • oligodendrocytes are involved in the synthesis of myelin, which regulates nerve signal transduction by surrounding nerve cells' axons.
  • beta-alanine and glutathione-related metabolites which act as a potent sensitizer for the activation of reactive oxygen species, were significantly different in aged mice treated with three cells compared to the aging control group of the same age.
  • one or more administrations of hPDCs in sensitized rats resulted in improved cognitive and motor function in senescent rats, expression of various genes, metabolic mechanisms, and metabolite distribution in senescent and neurological diseases. Influence was found to have the effect of inhibiting and preventing aging and neurological diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Reproductive Health (AREA)
  • Organic Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gynecology & Obstetrics (AREA)
  • Genetics & Genomics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pregnancy & Childbirth (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)

Abstract

본 발명은 C3 또는 C1r 보체 단백질을 분비하는 태반 유래 세포, 이를 포함하는 약학적 조성물, 및 이를 이용하는 질환 치료방법에 대한 것이다. 본 발명에 따른 태반 유래 세포는 알츠하이머병, 파킨슨병, HIV 치매, 간질과 같은 신경질환, 또는 암, 망막증과 같은 혈관신생 관련 질환에 효과적으로 이용될 수 있어, 산업적 활용도가 높다.

Description

C3 또는 C1R 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물
C3 또는 C1r 보체를 분비하는 태반 유래 세포, 이를 포함하는 약학적 조성물 및 이를 이용하는 질환 치료방법에 관한 것이다.
최근 평균수명이 증가하고 사회의 고령화가 진행되면서 노화에 대한 관심 및 노화와 관련된 질병 특히, 뇌졸증, 치매, 알츠하이머병,　파킨슨병 등의 뇌신경질환과 같은 뇌신경 세포 손상과 관련된 퇴행성　신경질환　등에 대한 관심이 증대되고 있다. 상기 뇌신경계 질환들은 특정 뇌세포의 사멸 또는 퇴화가 일시적 또는 오랜 기간에 걸쳐 진행하는 것이 특징이다. 한번 죽은 뇌세포는 재생이 되지 않기 때문에 결국 치명적인 뇌기능의 손실로 이어진다. 특히, 대표적인 뇌신경계 질환인 알츠하이머병은 80세 이상 노인의 50% 정도가 고통을 받고 있는 병으로, 암, 심장질환 및 뇌졸증에 이어 노인 사망의 네 번째 원인이 되고 있다. 그러나 알츠하이머병의 치료는 주로 환자의 증상을 가볍게 하고, 병의 진행속도를 지연시키는데 주안을 두는 간접적인 치료가 유일한 치료법이 되어 왔다.
한편 혈관신생(angiogenesis)은 조직이나 장기에 신규의 혈관을 제공하는 생물학적 과정이다. 정상적인 혈관 신생은 신생혈관 생성조절인자에 의해 엄격하게 조절되나, 혈관신생이 자율적으로 조절되지 못하고 병적으로 성장할 경우 질환이 나타난다. 병적인 상태에서 나타나는 혈관신생과 관련이 있는 질환을 크게 분류해 보면 관절염과 같은 염증성 질환, 당뇨병성　망막증과 같은 안과 질환, 건선과 같은 피부과 질환 및 암으로 나눌 수 있다. 혈관신생과 관련된 질환은 혈관신생을 억제하는 것이 근원적인 치료법일 수 있으나, 현재 개발된 많은 혈관신생 억제제는 체내에서 독성을 갖는다는 문제점이 있다.
이에 따라 현재 뇌신경계질환 또는 혈관신생관련 질환의 치료를 위한 새로운 방법으로 줄기세포를 이용하여 치료하려는 연구가 활발히 진행되고 있다. 그 중에서도 중간엽 줄기세포(mesenchymal stem cells)는 자가 증식할 수 있고, 조건에 따라 여러 조직으로 분화될 수 있어 다양한 치료학적 효능을 가지므로, 상기 질환들의 치료제로서 우수한 후보물질이다. 그러나 중간엽 줄기세포는 성인 인간 골수에서 그 양이 매우 적을 뿐만 아니라 나이가 듦에 따라서 그 수도 급속도로 줄어드는 양상이 나타난다. 그러므로 중간엽 줄기세포는 미래의 세포치료제로서는 부족하기 때문에 그 대안이 필요한 실정이다.
한편, 태반은 최근까지 출산 후 폐기되는 일시적인 기관으로 인식되어 왔으나, 최근 들어 태반의 부위별로 중간엽 세포, 탈락막(decidua) 세포, 양막(amnion), 상피 세포(endothelial cells) 등의 다양한 세포들이 존재하는 것이 밝혀지고 있다. 태반 유래 세포는 윤리적인 문제를 해결할 수 있으며, 다량의 세포를 얻을 수 있다는 장점이 있다. 아울러 질병 치료에 좋은 특성을 나타내는 태반유래 세포를 확보할 수 있다면 기존 단점을 해결할 수 있는 좋은 세포치료제로 사용될 수 있을 것이다.
이러한 배경 하에 본 발명자들은 태반에서 유래된 신규 세포를 분리ㆍ배양하고, 보체를 발현하는 특성 및 이 신규 세포가 뇌신경계 질환 및 혈관신생질환의 치료 효과, 그리고 항노화 효과가 있음을 확인하여 본 발명을 완성하였다.
일 목적은 태반 유래 세포를 제공하는 것이다.
다른 목적은 태반 유래 세포를 포함하는 신경 질환 또는 혈관 신생 관련 질환의 치료 또는 예방용 약학적 조성물을 제공하는 것이다.
또 다른 목적은 태반 유래 세포를 포함하는 노화 감소용 조성물을 제공하는 것이다.
또 다른 목적은 태반 유래 세포를 포함하는 조성물을 개체에 투여하여 신경 질환, 혈관 신생 관련 질환 또는 개체의 노화와 연관된 증상을 치료하는 방법을 제공하는 것이다.
일 양태는 C3 또는 C1r 보체 단백질을 분비하는 태반 유래 세포를 제공한다.
본 명세서에서 용어 "태반(placenta)"은 임신한 포유류 동물의 자궁에 생기는 기관으로, 모체의 자궁점막에서 유래한 탈락막과 수정란에서 유래한 융모막, 양막 등으로 이루어져 있으며, 모체와 태아 사이의 물질 교환이 일어나는 장소를 의미한다.
용어, "태반 유래 세포"는 태반으로부터 분리되고, 뼈, 연골, 지방, 근육세포를 포함한 여러 가지 중배엽성 세포 또는 신경세포와 같은 외배엽성 세포를 포함한 다양한 조직 세포로 분화하는 능력을 가진 세포를 의미한다.
본 발명의 세포가 유래된 태반은 양막, 융모막, 탈락막 및 탯줄 또는 이들의 조합을 포함할 수 있다. 예를 들면 상기 태반 유래 세포는 태반의 양막으로부터 유래된 것일 수 있다. 또한 구체적으로 태반 유래 세포는 태반의 융모판막으로부터 유래한 것일 수 있다. 이 경우 단일한 배아밖중배엽(extra-embryonic mesoderm)으로부터 유래되기 때문에 세포치료제의 원료로써 그 가치를 더욱 가질 수 있다.
본 발명에 따른 태반 유래 세포는 C3 또는 C1r 보체 단백질을 분비하는 특징을 갖는다.
용어 "보체(complement)"는 항원항체복합체와 비특이적으로 결합하고 감염, 염증반응, 면역반응 등에 동원되어 여러 생물학적 활성을 발현하는 체액(주로 혈청)의 단백질 성분을 의미한다. 상기 보체는 C1에서 C9까지 9가지 성분(보체성분)을 함유하며, C1의 경우 보체성분의 분해산물에 따라 C1q, C1r, C1r의 복합체로 구분될 수 있다. 면역 반응을 일으키기 위한 보체계의 활성화는 고전경로 (Claasical pathway of complement system), 대체경로 (Alternative pathway of complement system), 렉틴경로 (Lectin pathway of complement system)의 세가지 경로로 구분된다. 세 경로는 그 반응이 시작되는 원인이 다르지만 모두 9가지 보체 구성 성분 중 하나인 C3 활성화로 이어지게 되고, 이로 인해 이로 인해 병원체 표면에 C3b를 축적되며 식세포 작용을 일으켜 타겟 병원체를 파괴하게 된다. 상기 C3의 결핍은 세균감염에 취약하다고 보고되고 있고, C3의 비정상적인 감소나 증가는 퇴행성 신경질환인 알츠하이머병이나 파킨슨병뿐이니라 다양한 면역결핍 질환에도 관여하는 것으로 보고된다.
상기 태반 유래 세포는 추가적으로 EPPK1, PTX3, EEF1A1, LGALS3BP (Galectin-3-binding protein), FLJ53478, PXDN 및 TGFβ로 이루어진 군으로부터 선택되는 하나 이상의 단백질을 분비할 수 있다. 상기 태반 유래 세포는 예를 들면 EPPK1, PTX3, EEF1A1, LGALS3BP, FLJ53478, PXDN 및 TGF를 분비할 수 있다.
본 발명의 일 실시예에서 본 발명에 따른 태반 유래 세포로부터 C3, C1r, PTx3, EEF1A1, LGALS3BP, 및 FLJ53478이 분비되는 것을 확인하였다. 반면 신경전구세포의 경우, C3, C1r, PTx3, EEF1A1, LGALS3BP, 및 FLJ53478 모두 측정이 되지 않았다. 상기 C3, C1r, PTx3, EEF1A1, LGALS3BP, 및 FLJ53478는 면역 관련된 단백질이다. 한편 노화 관련 단백질인 EPPK1의 경우 신경전구세포에서도 분비되는 것을 확인하였으나, 태반 유래 세포에서의 측정 양이 신경전구세포보다 약 7배 정도 높았다.
본 발명의 태반 유래 세포는 상기 C3 또는 C1r 보체 단백질을 0.1 내지 1000 pg/ml/1×106cell 의 양으로 발현하는 것일 수 있다. 예를 들면 상기 태반 유래 세포는 C3 또는 C1r 보체 단백질을 1 내지 1000 pg/ml/1×106cell, 또는 10 내지 1000 pg/ml/1×106cell의 양으로 발현하는 것일 수 있다.
또한 상기 태반 유래 세포는 EPPK1을 신경전구세포보다 7배 이상 더 발현 (발현량 기준)하는 것일 수 있다 .
또한 상기 태반 유래 세포는 CD9+, CD13+, CD90+ 및 CD200+ 의 표현형을 가질 수 있다. 또한, 상기 태반 유래 세포는 SSEA4-, TRA-1-60-, TRA-1-81- 및 CD34- 일 수 있다. 본 명세서에서 용어 "+의 표현형"은 그 표지가 기준이 되는 다른 세포와 비교하였을 때 더 많은 양, 또는 더 높은 농도로 존재하는 것을 의미한다. 즉, 세포는 어느 표지가 세포 내부 또는 표면에 존재하기 때문에 그 표지를 이용하여 그 세포를 하나 이상의 다른 세포 유형과 구별할 수 있으면 그 표지에 대하여 +의 표현형이 된다. 또한 세포가 배경값보다 더 큰 값으로 신호, 예를 들면 세포 측정 장치의 신호를 낼 수 있는 만큼의 양으로 그 표지를 가지고 있다는 것을 의미한다. 용어 "-의 표현형"은 특정 세포 표면 표지에 특이적인 항체를 사용하여도 배경값에 비교하여 그 표지를 검출할 수 없음을 의미한다.
다른 양태는 상기 태반 유래 세포를 포함하는 약학적 조성물을 제공한다.
상기 약학적 조성물에 포함되는 태반 유래 세포는 상기한 바와 같다.
일 구체예는 상기 태반 유래 세포를 포함하는 신경질환 치료 또는 예방용 약학적 조성물을 제공한다.
상기 신경질환은 예를 들면, 알츠하이머병, 파킨슨병, HIV 치매, 간질, 정신분열증, 우울증, 조울증, 신경 발생장애, 자폐증, 뇌졸중, 루게릭, 헌팅턴병, 다발성경화증, 뇌손상, 뇌성 마비 또는 척수 손상일 수 있다. 바람직하게는 상기 신경질환이 알츠하이머병일 수 있다.
본 발명의 일 실시예에서, 본 발명에 따른 태반 유래 세포를 알츠하이머병 유도 마우스 모델에 투여한 결과, 알츠하이머병 치료를 효과적으로 입증하였다.
다른 구체예는 상기 태반 유래 세포를 포함하는 혈관신생 관련 질환 예방 또는 치료용 약학적 조성물을 제공한다.
상기 혈관 신생 관련 질환은 예를 들면 암, 당뇨병성　망막증, 미숙아　망막증, 각막 이식 거부, 신생혈관 녹내장, 홍색증, 증식성　망막증, 건선, 혈우병성 관절, 아테롬성 동맥경화 플라크 내에서의 모세혈관 증식, 켈로이드, 상처 과립화, 혈관 접착, 류마티스 관절염, 골관절염, 자가면역 질환, 크론씨병, 재발협착증, 아테롬성 동맥경화, 장관 접착, 캣 스크래치 질환, 궤양, 간경병증, 사구체신염, 당뇨병성 신장병증, 악성 신경화증, 혈전성 미소혈관증, 기관 이식 거부, 신사구체병증 또는 당뇨병 일 수 있다. 바람직하게는 상기 혈관신생 관련 질환은 당뇨병성 망막증, 미숙아　망막증, 또는 증식성　망막증과 같은 망막증 관련 질병일 수 있다.
본 발명의 일 실시예에서 본 발명에 따른 태반 유래 세포를 OIR 모델 마우스의 망막에서 투여한 결과, 대조군에 비해 신생혈관다발형성을 억제하고 증식적 망막증에서의 정상적인 혈관화 부분을 증가시키는 것을 확인하였다.
다른 구체예는 상기 태반 유래 세포를 포함하는 노화 감소용 조성물을 제공한다.
상기 조성물에 있어서, 노화를 감소시키는 것은 세포 또는 개체의 노화를 지연 또는 방지하거나, 노화된 세포 (senescent cell)를 그보다 젊은 세포 (young cell)로 전환시키는 것을 포함한다.
본 명세서에 있어서, "세포의 노화 (senescence of a cell)"는 표준 세포 (reference cell)에 비하여 세포의 증식능의 감소, 리포푸신 축적, β-갈락토시다제 활성 증가, 미토콘드리아 활성 산소 종 증가, 미토콘드리아 막 전위 감소, 및 세포의 G0 및/또는 G1기의 기간의 감소 중 하나 이상을 포함하거나, 그를 야기하는 과정을 나타낸다. "젊은 세포 (young cell)"란 표준 세포 (reference cell)에 비하여 세포의 증식능의 증가, 리포푸신 축적 감소, β-갈락토시다제 활성 감소, 미토콘드리아 활성 산소 종 감소, 미토콘드리아 막 전위 증가, 및 세포의 G0 및/또는 G1기의 기간의 증가 중 하나 이상을 포함하는 것을 나타낸다.
상기 조성물에 있어서, 세포의 노화를 감소시키는 것은 세포의 증식능을 증가시키는 것, 리포푸신 축적을 감소시키는 것, β-갈락토시다제 활성을 감소시키는것, 미토콘드리아 활성 산소 종을 감소시키는 것, 미토콘드리아 막 전위를 높이는 것, 및 세포의 G0 및/또는 G1기의 기간을 감소시키는 것 중 하나 이상을 포함하는 것일 수 있다. 상기 세포는 미오블라스트(myoblast)를 포함한 근육세포, 섬유아세포(fibroblast), 조기노화세포 (cell from a subject suffering Hutchinson-Gilford progeria syndrome), 또는 신경세포일 수 있다.
다른 구체예에서 상기 태반 유래 세포를 포함하는 개체 또는 세포의 노화와 연관된 증상을 치료하기 위한 조성물을 제공한다. 상기 세포 노화와 연관된 증상은 피부주름, 상처 재생 저하, 근감소증, 조기노화증 (Hutchinson-Gilford progeria syndrome), 또는 그 조합인 것일 수 있다. 상기 세포 노화와 연관된 증상은 리포푸신의 축적과 연관된 증상인 것일 수 있다. 상기 리포푸신의 축적과 연관된 증상은 신경 세로이드 리포푸신증 (neuronal ceroid lipofuscinoses: NCL), 나이 관련 황반변성 (Age-related macular degeneration), 신경근섬유의 엉킴 (neurofibrillary tangles), 심장의 갈색위축 (Brown atrophy of the heart), 알츠하이머병(Alzheimer's disease), 파킨슨병 (Parkinson's disease), 루게릭 병 (amyotrophic lateral sclerosis: ALS), 말단 비대증 (acromegaly), 탈신경 위축증 (denervation atrophy), 지질 축적 근질환 (lipid myopathy), 만성 폐쇄성 폐 질환 (chronic obstructive pulmonary disease: COPD)인 것일 수 있다.
상기 태반 유래 세포를 포함하는 약학적 조성물은 태반 유래 세포 이외에 태반 유래 세포의 배양물에서 수득한 배지를 포함할 수 있다. 상기 배지는 태반 유래 세포를 FGF4, 및 heparin을 포함한 Alpha-MEM에서 배양한 후, 무-혈청 배지에서 배양하여 수득한 것일 수 있다. 본 발명의 태반 유래 세포는 C3를 분비하므로, 상기 배지에는 C3가 포함되어 있다. 따라서 신경질환 치료, 신생혈관 관련 질환 치료, 노화 감소 또는 노화 관련 증상 치료에 더욱 우수한 효과를 갖는다. 또한 상기 배지에는 C3 뿐만 아니라, 면역 관련 단백질인 C1r, EEF1A1, LGALS3BP, FLJ53478 및 노화관련 단백질인 EPPK1을 포함할 수 있다.
상기의 태반 유래 세포를 포함하는 약학적 조성물은 유효성분인 태반 유래 세포 이외에 약학적으로 허용되는 첨가제를 추가로 포함할 수 있으며, 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위 투여형의 제제로 제형화시킬 수 있다. 이러한 목적에 적합한 제형으로는 비경구투여 제제로서 주사제 또는 국소 투여용 제제 등이 포함된다. 예를 들면, 필요에 따라서 물 혹은 그 이외의 약제학적으로 허용할 수 있는 용매를 사용한 무균성 용액 또는 현탁액제의 주사제의 형태로 비경구적으로 사용할 수 있다. 예를 들면, 약제학적으로 허용되는 담체 혹은 매체, 예를 들어 멸균수, 생리식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 부형체, 비히클, 방부제, 결합제 등과 적당히 조합하여, 일반적으로 인정되는 단위 용량 형태로 혼화하는 것에 의해 제제화할 수 있다.
또한, 본 발명의 조성물은 생착(engraftment)을 촉진하는 화합물(예를 들어 항-T세포 수용체 항체, 면역 억제제 등), 알부민, 덱스트란 40, 젤라틴, 하이드록시에틸 전분 등의 안정제를 하나 이상 포함할 수 있다
상기 제제는 통상의 방법에 따라 경구 또는 비경구적으로 투여될 수 있으며, 구체적으로는 비경구적으로 투여될 수 있다. 상기 비경구 투여는 국부적 또는 전신적 투여를 포함한다. 상기 국부적 투여는, 직접적으로 병변 또는 그 주변에 투여하는 것, 예를 들면 병변인 뇌 또는 척수, 그 주변 또는 그 반대쪽 부위에 직접 투여하는 것일 수 있다. 상기 전신적 투여는 척수액, 정맥 또는 동맥에 투여하는 것을 포함한다. 상기 척수액은 뇌척수액을 포함한다. 상기 동맥은 병변에 혈액을 공급하는 부위일 수 있다.
상기 조성물의 1일 투여량은 체중에 따라 1x104 내지 1x107 cells/kg, 예를 들면 5x105 내지 5x106 cells/kg 일 수 있다. 투여 횟수는 1회 또는 수회로 나누어 투여할 수 있다. 상기 조성물의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여 경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자를 고려하여 증감이 가능하다.
본 발명의 조성물의 투여 형태는 조성물의 투여 형태는 단독으로 또는 다른 약학적 활성 화합물과 결합뿐만 아니라 적당한 집합으로 사용될 수 있다. 또한 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 약학적 제형으로 제조될 수 있다. 제형의 제조에 있어서, 활성 성분을 담체와 함께 혼합 또는 희석하거나, 용기 형태의 담체 내에 봉입시키는 것이 바람직하다.
다른 양태는 상기 약학적 조성물을 포함하는 신경 질환, 혈관 신생 관련 질환, 노화 관련 증상 치료용 키트를 제공한다. 상기 키트는 태반 유래 세포의 배양을 위하여 필요한 성분들을 추가로 더 포함할 수 있다. 상기 태반 유래 세포, 약학적 조성물 및 상기 신경 질환, 혈관 신생 관련 질환, 노화 관련 증상에 대해서는 전술한 바와 같다.
다른 양태는 상기 태반 유래 세포를 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 신경 질환, 혈관 신생 관련 질환, 노화 관련 증상을 치료하는 방법을 제공한다.
상기 치료방법에서 개체에 투여되는 태반 유래 세포 및 약학적 조성물을 각각 상기한 바와 같다. 상기 방법에 있어서, 태반 유래 세포는 환자 본인으로부터 채취된 것뿐 아니라 타인 또는 다른 의료용 동물 유래의 세포를 이용하는 것도 가능하다. 세포는 냉동 보존한 것이어도 된다.
상기 방법은 태반 유래 세포를 폴리오르니틴 및 피브로넥틴으로 코팅된 디쉬에 배양하는 단계; 및 상기 배양된 세포를 FGF4 및 헤파린을 포함하는 배지에, 1% 내지 7%의 CO2 조건에서 인큐베이션하는 단계를 더 포함할 수 있다. 또한, 상기 CO2 조건에서 2% 내지 5% 일 수 있으며, 3% 일 수 있다.
상기 투여는 국소 또는 전신 투여일 수 있다. 예를 들면, 경구, 직장, 정맥, 비강, 복강, 피하 또는 국소 투여일 수 있으며, 국소 투여는 예를 들면 병변에 직접, 또는 병변 주위에 투여 일 수 있다. 상기 투여는 상기 질환을 예방 또는 치료하기 위한 유효량을 투여하는 것일 수 있다. 이러한 유효한 양은 선택되는 질환의 조건에 따라 당업자가 용이하게 선택할 수 있다. 또한, 본 발명의 약학적 조성물은 유효성분을 표적 세포로 전달할 수 있는 임의의 장치를 이용해 투여될 수 있다.
본 발명의 치료방법은 반드시 사람에게만 한정되지 않는다. 용어, "개체"는 원숭이, 소, 말, 양, 돼지, 닭, 칠면조, 메추라기, 고양이, 개, 마우스, 쥐, 토끼 또는 기니아 피그, 인간을 포함한 포유류를 포함하나 이에 한정되지 아니하는 동물을 의미하고, 일 실시예에서는 포유류일 수 있다. 통상, 사람 이외의 포유동물에 있어서도 태반 유래 세포를 이용하여, 본 발명의 방법을 실시하는 것이 가능하다.
또 다른 양태는 태반 유래 세포로부터 유도된 신경 전구 세포를 제공한다.
상기 태반 유래 세포는 태아 또는 모체에서 유래한 것(즉 태아 아니면 모체의 유전형을 띨 수 있음)이다. 태반 세포군 또는 태반 세포를 함유하는 세포군은 오로지 태아 유래 또는 오로지 모체 유래인 태반 유래 세포를 포함할 수 있고, 또 태아와 모체 유래가 섞인 혼합 태반 세포군을 포함할 수도 있다. 상기 태반 유래 세포와 상기 태반 유래 세포를 함유하는 세포군은 아래에 기술하는 형태학적 표지와 배양 특성에 따라 동정되고 선택될 수 있다.
본 발명의 태반 유래 세포는 태반의 양막, 융모막, 탈락막 및 탯줄 또는 이들의 조합으로부터 유래된 것일 수 있다. 예를 들면 상기 세포는 태반의 양막으로부터 유래된 것일 수 있다.
용어 "신경 전구 세포(neuronal progenitor cell 또는 neuronal precursor cell)"는 여러 형태의 신경 세포로 분화할 수 있는 세포를 의미한다. 상기 신경 전구 세포는 신경 줄기 세포(neural stem cell 또는 Neural progenitor cell 또는 Neural precursor cell)와 혼용되어 사용될 수 있다. 또한, 상기 신경 전구 세포는 신경 줄기 세포로부터 유래된 세포를 의미할 수 있다. 상기 신경 전구 세포는 CD9+, CD13+, 및 CD 90+이다. 또한, 상기 신경전구 세포는 SSEA-4-, TRA-1-60-, TRA-1-81-, SSEA-1-, CD34- 및 CD44+일 수 있다. 상기 신경 전구 세포는 태반 유래 세포를 FGF4 존재하에 고밀도 배양으로 유도한 것일 수 있다.
상기 신경전구세포는 태반 유래 세포로부터 분화된 것일 수 있다. 이 경우, 상기 태반 유래 세포는 상기한 바와 같다.
상기 태반 유래 세포로부터 유도된 신경전구세포는 태반으로부터 유래한 세포를 고밀도 세포 배양방법에 의해 유도된 것일 수 있다. 상기 고밀도 세포배양방법은 세포를 15 ug/mL 폴리오르니틴(Sigma) 및 4 ㎍/mL 피브로넥틴(Sigma)로 코팅된 디쉬에 10,000 cells/cm2 밀도로, 플레이트의 중앙에, 총 플레이트 공간의 약 1/3으로 시작하는 세포 스포팅(spotting)으로 도말하고, 뒤이어 세포를 25ng/mL FGF4 및 1 ㎍/mL 헤파린을 포함하는 완전 배지에서 배양하는 방법일 수 있다. 상기 태반 유래 세포는 태반을 분쇄하여, 2 mg/ml의 트립신(Sigma), 20 ug/ml DNase I(Sigma), 1.2 U/ml Dispase(Gibco) 및 1 mg/ml 콜라게나제 IV(Sigma)를 포함하는 용액으로 분해한 후, 회수한 세포를 10% 소태아혈청(FBS, Gibco) 및 페니실린/스트렙토마이신(Gibco), 25ng/mL FGF4(R&D Systems), 및 1 ㎍/mL 헤파린(Sigma)을 포함하는 Alpha-MEM 배지(Gibco, New York, USA)에서 배양한 것일 수 있다.
또 다른 양태는 상기 신경전구세포를 포함하는 신경질환 치료 또는 예방용 약학적 조성물을 제공하는 것이다.
상기 신경 질환은 알츠하이머병, 파킨슨병, HIV 치매, 간질, 정신분열증, 우울증, 조울증, 신경 발생장애, 자폐증, 뇌졸중, 루게릭, 헌팅턴병, 다발성경화증, 뇌손상, 뇌성 마비 또는 척수 손상일 수 있다. 바람직하게는 상기 신경 질환은 알츠하이머병일 수 있다. 일 실시예에서 본 발명에 따른 태반 유래 세포로부터 유도된 신경전구세포를 파킨슨 병 모델 마우스에 투여한 결과 개선 효과를 보였다.
일 양태에 따른 태반 유래 세포는 신경질환, 혈관신생 관련 질환의 치료 효과 및 노화를 감소시킬 수 있는 효과가 있으며, 이에 따라 신경질환, 혈관신생 관련 질환, 또는 노화 관련 증상의 치료를 위한 신약개발의 소재로도 사용할 수 있을 뿐만 아니라, 신경질환 및 혈관신생 관련 질환, 또는 노화 관련 증상의 치료 치료와 관련된 기초 연구 분야에서도 널리 사용될 수 있다.
도 1은 태반 유래 세포를 나타낸 도면이다. (A) 패시지 4에서 수득한 본 발명의 태반 유래 세포의 형태(morphology), (B) 태반 유래 세포의 면역표현형 표면 프로파일의 FACS 분석 결과.
도 2는 Aβ25 -35로 자극된 미세교세포에서 태반 유래 세포(PDC)의 효과를 나타낸다. (A) Aβ25 -35 활성화된 미세교세포는 강하게 뭉쳐진 세포 덩어리를 나타내는 반면, PDC와 공배양시에는 거대한 덩어리를 나타내지 않았다. (B) 전염증 사이토카인인, 종양괴사인자 (Tumor Necrosis factor; TNF-α 및 인터류킨1(Interleukin 1;IL-1)가 PDC와 공배양한 미세교세포에서 유의적으로 감소하였다. Scale bar, 100 ㎛. 각각의 비교에서 **, P < 0.01. 데이터는 평균 ±S.E.M. 값으로 나타냈다.
도 3은 마우스 수중 미로 실험에서의 공간기억능력에 대한 PDC의 효과를 나타낸다. (A)는 출발점이 다른 군 간의 탈출 잠재기가 차이가 없음을 보여준다. (B) 3 시도 블록 이후 PDC-주사군이 PBS-주사군보다 평균 탈출 잠재기가 유의적으로 감소함을 나타낸다. (C) 5 시도 블록에서의 수영경로를 나타낸다. (D) 시도 실험에서, PBS-주사군보다 PDC-주사군의 표적 지역에서 보내는 시간이 유의적으로 증가하였음을 나타낸다. 각각의 비교에서 **, P < 0.01; *, P < 0.05; #, P < 0.06. 데이터는 평균 ± S.E.M. 값으로 나타낸다.
도 4는 WMT에서의 수영활동에의 PDC의 투여가 미치는 영향을 나타낸다. (A)는 총 수영 거리, (B)는 수영속도를 나타낸다. *P < 0.05. #p < 0.08. 데이터는 평균 ± S.E.M. 값으로 나타낸다
도 5는 불안-유사 행동 및 로코모터 활성을 나타낸다. (A) 고가식 십자 미로실험 (B) 명/암 왕래 실험 (C) 오픈 필드 실험 (D) 로코모터 실험 결과.
도 6은 뇌의 Aβ 플라크 분포에 대한 PDC 투여의 효과를 나타낸다. (A) 뇌의 해마 및 피질 부위의 조직. 마우스 뇌의 피질 및 해마의 동결 절편(저배율(x40, B 및 C), 고배율(x100, D, E, F 및 G))이 티오플라빈 S(초록색)으로 염색되었다. (H) PDC 또는 PBS가 주입된 APPswe (Tg2576) 마우스에서의 Aβ에 대한 정량 분석 결과이다. Scale bar, 100 ㎛. 각각의 비교에서 **, P < 0.01; *, P < 0.05. 데이터는 평균 ± S.E.M. 값으로 나타낸다.
도 7은 WMT에서의 탈출 잠재기와 아밀로이드 플라크의 수간의 상관관계를 나타낸다.
도 8은 미세교세포의 조절에 대한 PDC 투여의 효과를 나타낸다. (A) 미세교세포를 표지하기 위하여 일차 항체(Iba-1)를 이용하여 면역형광염색을 하였다. PDC 또는 PBS가 주입된 APPswe 마우스에서의 뇌 피질 부위의 미세교세포의 패턴을 나타낸다. (B) 이식 후 1주 및 12주에서의 mm2 당 미세교세포의 평균 개수에 대한 정량적 영상 분석결과이다. (C) 이식 후 1주 및 12주에서의 Iba-1 양성 세포 비율을 나타낸다. Scale bar, 20 ㎛. 각각의 비교에서 *, P < 0.05. 데이터는 평균 ± S.E.M. 값으로 나타낸다.
도 9는 미세교세포의 식균작용에 대한 PDC 투여의 효과를 나타낸다. Iba-1 양성 미세교세포(초록색) 내의 ED-1(CD68)의 면역반응성의 발현(빨간색). 상주 미세교세포에는 ED-1이 발현되지 않았으나(A) 반면, Aβ 플라크 주변의 활성화된 미세교세포의 세포 기질에서는 ED-1이 발현되었다(B). (C) 이식 후 1주 및 12주에서의 Iba-1 양성 미세교세포 내의 ED1 발현 비율에 대한 정량적 영상 분석 결과이다. Scale bar, 10 ㎛. 각각의 비교에서 *, P < 0.05. 데이터는 평균 ± S.E.M. 값으로 나타낸다.
도 10은 미세교세포의 ED-1 면역반응성을 나타낸다. 상주 미세교세포에는 ED-1의 활성이 검출되지 않았다 (A 및 C). Aβ 플라크에 아주 근접한 활성화된 미세교세포(Iba-1)에서는 ED-1 면역반응성을 나타낸다 (B 및 D). Scale bar, 20 ㎛.
도 11은 뇌와 비장에의 PDC 검출의 타임 코스(time course)를 나타낸다. (A) 주사 후 1일 및 1주 후 뇌 조직에서 HuNu가 검출되지 않은 반면, 비장의 경우 1일 및 1주 후에서는 검출되었으며, 12 주에서는 검출되지 않았다. (B) 주사 후 1일 및 1주 후에 비장에서의 HuNu 양성 세포가 DAB 염색으로 재확인되었다. Scale bar 20 ㎛(A); 100 ㎛(B).
도 12는 염증성 사이토카인 및 단백질 가수분해 효소 분비에 대한 PDC 투여의 효과를 나타낸다. PBS 또는 PBS가 주입된 APPswe 마우스에서의 염증성 사이토카인 및 단백질 가수분해 효소의 mRNA 발현 수준을 정량한 결과이다. (A)는 주입 후 1주 뒤의 IL-1, TNF-α 형질전환성장인자(TGF-β), 및 인터류킨 10(IL-10)의 mRNA 발현정도, (B)는 주입 후 12 주 뒤의 IL-1, TNF, TNF-α, TGF-β 및 IL-10의 mRNA 발현정도, (C)는 주입 후 1 주 후에 매트릭스 메탈로펩티다제 9 (MMP9) 및 인슐린-분해 효소 (IDE)의 mRNA 발현 정도를 나타낸다. 각각의 비교에서 **, P < 0.01; *, P < 0.05; #, P < 0.06; ##, P < 0.08. 데이터는 평균 ± S.E.M. 값으로 나타낸다
도 13은 염증 자극에 대한 PDC의 인 비트로 반응을 나타낸다. (A) TNF-α 및 인터페론 감마(IFN-γ)로 자극된 경우와 비자극된 PDC의 TGF-β, MMP9, 및 IDE의 mRNA 발현의 비교이다. (B) ELISA를 이용한 TNF-α 및 IFN-γ로 자극된 경우와 비 자극된 PDC의 TGF-β 및 MMP9의 단백질 발현의 비교이다. 각각의 비교에서 ***, P<0.001; **, P<0.01; *, P<0.05. 데이터는 평균 ± S.E.M. 값으로 나타낸다
도 14는 알츠하이머 마우스에서 조절 T 세포(regulatory T cell; Treg)의 조절에 대한 PDC 투여의 효과를 나타낸다. 비장 단핵 세포(spleen mononuclear cell, SMNC) 내의 조절 T 세포(Treg)의 분포이다. (A) 염 또는 PDC 주사된 알츠하이머 마우스에서, 주사 후 1일 및 1주일 후의 Treg CD4+ CD25high 세포를 나타낸다. (B) 염이 주사된 마우스와 비교한 각 시점에서의 Treg(%)의 빈도를 나타낸다. 각각의 비교에서 ***, P < 0.001; **, P < 0.01; ##, P < 0.08. 데이터는 평균 ± S.E.M. 값으로 나타낸다
도 15에서 (A)는 패시지 6에서 수득한 PDC의 형태(좌측 패널), 및 DiI 염색된 PDC(우측 패널)를 나타낸다. (B)는 human Bone marrow-MSC (hBM-MSC), hPDC 및 human Adipocyte-MSC (hAdipo-MSC)에서의 Angiopoietin-1 (Ang-1) 및 Pigment epithelium -derived factor (PEDF)의 비교를 나타낸다.
도 16은 PDC의 특징을 나타낸다. (A) PDC의 면역표현형 프로파일의 FACS 분석 결과를 나타낸 도면이다. PDC는 SSEA4, TRA-1-81, TRA-1-60(ES 마커) 및 CD34(조혈세포 및 내피세포 마커)에 음성적이고, CD9(비영양막 마커) 및 CD13, CD90(MSC 마커)에 양성적이다. (B) PDC, hBM-MSC 및 hAdipo-MSC에서의 TGF-β 발현의 비교이다.
도 17은 OIR 유도된 마우스의 망막에서의 염증 사이토카인의 프로파일을 나타낸다. 정상군에 비교하여 OIR군의 망막에서 염증 사이토카인이 증가하였다. IFN-γ 및 TNF-α 수준이 유의적으로 증가하였다. 각각의 비교에서 ***, p<0.001; *, p<0.05. 데이터는 평균 ±S.E.M.으로 나타낸다.
도 18은 인 비트로 병리적 조건에서의 PDC의 반응을 나타낸다. (A) IFN-γ 및 TNF-α로의 자극 후 항-신생혈관 인자의 인 비트로 mRNA 발현을 실시간 PCR로 결정하였다. (B) 자극 후 TGF-β 수준이 유의적으로 증가 한 반면, 다른 인자들은 변화가 없었다. PDC의 배양 상청액 내의 TGF-β 단백질 수준을 ELISA로 결정하였다. 자극된 PDC의 배양 상청액 내의 TGF-β 수준이 정상 세포와 비교하여 현저하게 증가하였다. 각각의 비교에서 ***, p<0.001. 데이터는 대조군 세포(-)내의 mRNA의 수준(=1.0)으로 정규화하였으며 평균 ± S.E.M.으로 나타낸다.
도 19는 HUVEC (Human Umbililcal Vein Endothelial Cells) 증식에 대한 PDC의 억제 효과를 나타내는 도면이다. (A) PDC와 공배양된 HUVEC는 HUVEC가 단독배양된 경우와 비교하여 감소된 증식을 나타냈다. IFN-γ 및 TNF-α로 선처리된 PDC는 일반 PDC에 비하여 HUVEC에 대한 더 강한 억제 효과를 나타냈다. (B) TGF-β siRNA의 형질감염은 IFN-γ 및 TNF-α 처리된 PDC의 억제효과를 방해하였으나, 처리되지 않은 일반 PDC의 억제 효과는 TGF-β siRNA의 형질감염에 의해 영향을 받지 않았다. 각각의 비교에서 ***, p<0.001; *, p<0.05. 데이터는 평균 ±S.E.M.으로 나타낸다.
도 20은 PDCs에서의 TGF-β 특이적 siRNA의 효과를 나타낸다. RNA를 TGF-β siRNA 형질감염된 PDC 또는 정상 PDC에서 추출하였으며, TGF-β의 mRNA 발현을 분석하였다. TGF-β 발현 수준은 TGF-β siRNA 형질감염된 PDC에서 유의적으로 감소하였다. 각각의 비교에서 ***, p<0.001. 데이터는 평균 ± S.E.M.으로 나타낸다.
도 21은 TGF-β siRNA 형질감염 후 PEDF 및 Ang-1의 발현을 나타낸다. PEDF및 Ang-1의 발현수준은 TGF-β siRNA 형질 감염 후 변화하지 않았다.
도 22는 인 비보 항-신생혈관 인자 발현에 대한 PDC의 영향을 나타낸 도면이다. (A) 표시된 항-신행혈관 인자의 망막 mRNA 발현 수준을 정량적 실시간 PCR로 결정하였다. PDC가 처리된 마우스에서 TGF-β 망막에서 유의적으로 증가하였다. (B) 마우스 망막에서의 TGF-β의 단백질 수준을 ELISA로 결정하였다. PDC 처리된 마우스의 망막에서의 TGF-β 수준은 PBS 처리된 마우스에 비하여 유의적으로 증가하였다. 각각의 비교에서 ***, p<0.001; **, p<0.01. 데이터는 대조군 마우스(PBS-처리된) 내의 mRNA 수준(=1.0)으로 정규화하였으며 평균 ± S.E.M.으로 나타낸다.
도 23은 망막 혈관신생에 대한 PDC의 효과를 나타낸다. P17에서의 대표적인 망막 평면 봉입(flat mount)를 제조하였다. 망막 신생혈관 다발 형성 부위(배율×200, A) 및 혈관 폐색(vaso-obliteration) 부위(배율×40, C)를 컴퓨터-지원형 영상분석으로 결정하였다. 정량된 부위는 회색으로 나타내었다(삽화). 분석된 데이터는 망막에서 혈관 폐색 부위(B) 및 신생혈관 다발 형성 부위(D)의 비율을 나타낸다. 혈관 폐색 및 신생혈관 다말 형상은 대조군에 비하여 PDC 처리군에서 감소하였다. TGF-β siRNA 처리된 PDC는 비 형질감염된 PDC에 비하여 신생혈관형성을 감소시키지 못하였으나, 혈관 폐색의 경우 TGF-β siRNA 처리된 PDC로 처리된 마우스의 망막에서 대조군에 비해 조금 감소되었다. 각각의 비교에서 ***, p < 0.001; **, p < 0.01; *, p < 0.05; #, p < 0.06. 데이터는 평균 ±S.E.M.으로 나타낸다.
도 24는 인 비보 망막에서의 PDC의 추적을 나타낸다. 이동한 PDC를 주입후 5일 뒤에 망막에서 검출하였다. 좌측 패널은 DIC(회색) 및 DiI 표지된 PDC의 병합된 영상을 나타낸다. 중간 패널은 DAPI(파란색) 및 DiI 표지된 PDC(red)의 병합된 영상을 나타낸다. 우측 패널은 GS-랙틴염색된 혈관(초록색) 및 DiI 표지된 PDC(빨간색)의 병합된 영상을 나타낸다. Scale bar = 20 ㎛.
도 25는 패시지 1에서의 인간 태반 유래 세포(human placenta derived cell, hPDC)의 특징을 나타낸 도면이다. (A)는 hPDC의 핵형분석을 (B)는 hPDC의 형태(morphology)를, (C)는 hPDC의 성장곡선을, (D)는 hPDCs 집단 배가수(Population of doubling level, PDL)를, (E)는 hPDC의 면역표현형 표면 프로파일에 대한 FACS를 각각 나타낸다. hPDC는 CD34(조혈모세포 및 내피 세포 마커)에 음성이고, SSEA4, TRA-1-60, TRA-1-81(ES 마커), CD9 및 CD44, CD13, CD90(MSC 마커)에 양성이다. (F-H) OCT4, NANOG, KLF4 및 SOX2와 같은 줄기세포 마커의 mRNA 수준과 단백질 수준을 역전사-PCR, 면역형광 염색, 면역블롯팅으로 분석한 결과이다. (I)는 알칼리성 인산가수분해효소(Alkaline phosphatase, AP) 어세이 결과이다. Scale bar = 100um.
도 26은 hPDC의 분화 잠재력을 나타내는 도면이다. (A) hPDC의 분화 잠재력을 나타낸다. 지방세포성(osteogenic) 분화에 Oli Red O 염색, 골원성(osteogenic) 분화에 Von Kossa 염색, 연골성(chondrogenic) 분화에 Alcian blue가 사용되었다. scale bar = 5 mm. (B) hPDC를 표시된 성장인자(10 ng/ml bFGF, 10 ng/ml EGF, 25 ng/ml FGF4))로 3일간 처리하였다. 25 ng/mL FGF4 조건에서의 Nestin 및 Musashi의 mRNA 발현을 역전사-PCR을 이용하여 검출하였다.
도 27은 FGF4가 직접적으로 hPDC를 신경 전구세포로 유도하는 것을 나타낸다. 인지된 농도의 FGF4를 3일 동안 hPDC에 처리하였다. Nestin의 mRNA를(A) RT-PCR를 통해 분석되고, Nestin의 단백질 수준은(B) 면역블롯분석 및(C) 면역형광염색으로 분석하였다. Nestin mRNA의 발현 및 단백질 수준은 25 ng/mL FGF 4에서 유의적으로 증가하였다. Scale bar = 100 um. 각각의 비교에서 ***, P < 0.0001. 데이터는 평균 ± S.E.M로 나타낸다. (E) FGF4-매개 ERK1/2 및 JNK의 발현과 활성은 hPDC에의 FGF4처리 후 짧은 기간 동안 적합한 항체를 이용한 면역블롯을 통하여 분석하였다. (F 내지 I) hPDC를 U0126 및 SP600125와 함께 FGF4 존재 조건에서 3일간 배양되었다. 그 다음 세포를 항체에 대한 면역블롯 및 면역형광염색으로 분석하였다. Nestin 단백질은 U0126 및 SP600125 내에서 감소하였다. Ki-67의 비율이 JNK 억제에서 감소하였다. 스케일바는 100 um. 각각의 비교에서 ***, P < 0.0001. 데이터는 평균 ±S.E.M.로 나타낸다.
도 28은 FGF4(-) 또는 FGF4(25ng)에서의 hPDC의 면역표현형 표면 프로파일에 대한 FACS 분석 결과이다. hPDC는 CD34(조혈 세포 및 내피 세포 마커)에 대하여 음성적이고, CD9 및 CD44, CD13, CD90(MSC 마커)에 양성이다. SSEA4, TRA-1-60, TRA-1-81(ES 마커)의 발현은 FGF4의 존재하에서 감소한다.
도 29는 High-Density(HD) 배양 시스템에서 FGF4를 포함하는 유도 배지에서 배양된 hPDC를 나타낸다. 현미경을 이용한 타임 랩스(time-lapse) 디지털 영상으로 정상 배양 조건 및 HD 배양 시스템에서의 hPDC를 영상화 하였다.
도 30은 세포-세포 접촉이 고-밀도 배양 시스템 내의 신경 세포를 높은 수준으로 유도하는 것을 보여준다. (A) 표시된 시간 동안의 HD 배양 시스템 내의 hPDC의 형태를 나타낸다. (B, C) 12시간, 1일 및 3일 동안, FGF4를 포함하는 유도배지에서의 HD 배양 시스템 또는 정상 조건에서의 hPDC의 Nestin, Ki-67, 및 Tuj1에 대한 항체를 이용한 면역형광 염색을 나타낸 결과이다. 표시된 세포 밀도: 1,000cells/cm2(1x) 및 10,000 cells/ cm2(10x). 스케일 바는 100um. (D 내지 E) Nestin, Musashi, 및 Tuj1의 mRNA 수준을 분석한 결과이다. (F, G) Nestin,(F, H) Musashi, 및(F, I) Tuj1의 발현은 HD 배양 및 정상 조건의 높은 밀도에서 증가하였다. PCNA의 발현은 HD 배양하에서 미세하게 감소하였다(F, J). 각각의 비교에서 ***, P < 0.0001. 데이터는 평균 ±S.E.M.로 나타낸다.
도 31은 세포-세포 접촉은 NPC에서 DLL 1발현 증가를 통해 신경 세포를 높은 수준으로 유도하는 것을 나타낸다. (A)는 HD 배양 또는 정상 조건에서 배양된 hPDC의 델타-유사 1(Delta-like 1) 및 노치(notch) 수용기 관련 유전자 발현의 수준을 나타낸다. (B)는 HD 배양 시스템에서의 DLL-1 및 HES1 유전자 수준을 나타낸다. (C, E) DAPT 존재하에서 DLL-1, Nestin, 및 Tuj1의 mRNA 수준을 나타낸다. (D, F) DLL-FLAG 및 DLL-Fc으로 DLL-1 과발현된 hPDC에서의 Nestin 및 Tuj1의 mRNA 수준을 나타낸다. (G-H) hPDC-, 인간 골수-, 및 지방 MSC(양성 대조군: 인간 태아 NPC)에서의 FGF4의 효과를 나타낸 도면이다. 다른 성체 줄기세포와 비교하여 hPDC 내에 Nestin 양성 세포가 높은 비율로 존재한다. (I) DLL-1의 mRNA는 HD 배양 시스템 하의 hPDC에서만 발현하였다. Scale bar = 100um. 각각의 비교에서 ***, P < 0.0001. 데이터는 평균 ± S.E.M.으로 나타낸다.
도 32는 3일간 FGF4(-) 또는 FGF4(+)조건 하에서 및 2D 구(sphere) 배양 시스템에서 hPDC를 배양한 결과이다. 면역형광 염색으로, 세포에서 Nestin, Tuj1 및 다른 계통 분화(linege differention) 단백질 Brachyury, Desmin, GATA4를 검출하였다. scale bar = 100 um.
도 33은 파킨슨 렛트 모델 내의 이식된 세포의 특징을 나타낸 도면이다. 이식 부위 및 이동 부위에서의(A) 전분화능(pluripotent) 줄기세포의 마커인, Sox-2,(B) 신경 전구세포 마커인, Nestin,(C) 이동(migration) 마커인, DCX,(E) 신경 마커인, TH.
도 34는 hPDC가 이식된 6-OHDA 렛트에서의 운동 행동 실험(motor behavior task)에 의해 측정된 기능적 회복 및 PET 영상 분석을 나타낸 도면이다. (A) 90분 동안의 회전 실험을 이용한 행동 실험: 암페타민(5mg/kg, i.p.)-유도 회전 점수(score)를 나타낸다. (B) Cylinder Task에서의 사이클링 비대칭 점수를 나타낸다. (C-D) 이식 후 3주 및 6주에서의 로타로드 실험을 이용한 운동 학습 실험을 나타낸다. 단기 운동 기억 실험을 위해서, 제1회(session)에서 수행된 3번의 시도가 분석되었다. 장기 운동 기억 실험을 위해서, 이식 후 21-24일 및 42일 뒤의 연속하는 3일 동안 로드 위에서 소요하는 시간이 분석되었다. (E) PET 영상으로 태반 유래 세포의 투여(infusion)후, BP가 증가하였다. 도파민적 손상 모델(위대조군), 태반 유래 세포-유도 신경전구세포(hPDC-NPC) 및 정상대조군(이식되지 않음)의 관상 및 횡측상(transaxial) 18F FP-CIT PET 영상 슬라이스.
도 35는 테라토마 형성의 분석결과이다. (A-B) 안정성 검사, 10 ㎕ 내의 5×105 cells hPDC-NPC가 BALB/c-nu Sic 수컷 마우스에 주사되었다(Central Lab. Animal Inc, Korea). 세포주입 후 6 주 및 36주에 결과를 측정하였으며, 테라토마는 형성되지 않았다.
도 36은 태반 유래 세포 및 태반 유래 신경전구세포의 CM(conditioned medium)의 단백질 발현의 상대적 비교 결과를 보여준다. 도면에서 Inf. (infinite)는 MSC에서만 단백질이 발현되는 것을 나타낸다.
도 37은 hPDCs와 공배양 후 LL-24에서의 노화 마커인 베타 갈락토시데이즈 감소 (20과 23 세대)와 세포 수 증가 (17과 20 세대)를 보여준다.
도 38은 hPDCs와의 공배양 후 LL-24에서의 노화 마커 발현의 변화 및 단백질 변화를 나타낸다.
도 39는 hPDCs와 공배양 후 hNPCs에서의 항산화 및 후생학적 마커의 발현 증가 결과를 보여준다.
도 40은 hPDC가 투여된 노화 쥐의 생존율 증가 결과를 보여준다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 태반 유래 세포 배양 및 특성 분석
1.1. 태반 유래 세포 분리 및 배양
내과, 산과 또는 외과 합병증의 증상을 보이지 않는 정상 인간 태반(=37 주 임신)을 제왕절개술 후 수득하였다. 태반을 조심스럽게 절개하고 PBS로 수차례 세척한 다음, 기계적으로 분쇄하고, 37℃에서 30분간 0.5% 콜라게나제 IV(Sigma, St. Louis MO, USA)로 분해(digest)하였다. 회수된 세포를 10% 소태아혈청(Gibco, Grand Island. NY, USA) 및 각각 100㎍/ml의 페니실린 및 스트렙토마이신, 25ng/ml의 FGF4(R&D system, Minneapolis, MN, USA), 및 1㎍/ml 헤파린(Sigma)을 보충한 알파-MEM을 포함하는 T25 플라스크(Nunc, Rochester, NY, USA)에 배양하였다. 세포를 밀도 1×104 cells/cm2에서 폴리오르니틴(Sigma) 및 4㎍/ml 피브로넥틴(Sigma)으로 코팅된 디쉬에서 배양하였다. 25ng/ml FGF4 및 1㎍/ml 헤파린을 포함하는 완전 배지를 추가하고, 세포를 3% CO2의 조건에서 37℃에서 6일간 인큐베이션하였다.
각각의 실험에서, 세포는 약 80 % 밀도였다. 주사된 세포의 추적을 위하여, PDC를 30분간 37℃에서 친유성 막-결합 형광염료인 2 mM의 CM-DiI(1,1'-dioctadecyl 3,3,3',3'-tetramethy lindocarbocyanine pechlorate)(Molecular Probes, Eugene, OR)와 함께 인큐베이션하였다(도 15).
1.2. 태반 유래 세포의 발현 단백질 분석
태반 유래 세포를 100mm 디쉬에서 4 ×105 cells/mm3로 계수하여 10% 소태아혈청 (FBS), 1% 페니실린/스트렙토마이신, 25ng/mL FGF4, 및 1μg/mL 헤파린을 포함한 Alpha-MEM에서 3일간 배양하였다. 그 다음 세포를 1% 페니실린/스트렙토마이신이 포함된 무-혈청(serum-free)(ITS 또는 Alpha-MEM) 배지로 세척한 후, 무-혈청(serum-free) (ITS 또는 Alpha-MEM) 배지 10ml을 태반 세포에 넣어주었다. 2일 후 상등액을 0.22um 필터를 이용하여 걸러내어 모았다 (conditioned medium). 얻어진 conditioned medium (CM)은 4℃에 보관 후 사용하였다.
보체 단백질 측정을 위해 트립신 처리를 하여 단백질 단편화 (fragmentation) 작업을 수행하여 펩타이드로 만들었고, 단백질 펠릿 (pellet)을 1ml/50mM농도의 중탄산암모늄에 녹여 최종 농도 5mM까지 줄였다. 알킬화를 위해 단백질에 14mM 농도의 요오드아세트아미드를 처리한 다음, 과량의 요오드아세트아미드는 DTT 처리로 제거하고 단백질의 최종농도는 7mM이 되게 하였다. 환원되고 알킬화된 단백질은 트립신을 37℃에서 하루 동안 처리하여 제거하였다. 마지막으로 2% 포름산을 첨가하고 트립신 처리된 펩타이드는 건조시켰다. 트립신 처리된 펩타이드는 Sep-Pak C18 카트리지를 이용하여 탈염처리 한 후 MS (mass spectrometer) 분석을 실시하였다. 카트리지는 100% 아세토니트릴로 세척했고 0.1% 포름산으로 균형 (calibration)을 맞췄다. 0.5% 포름산에 트립신 처리된 펩타이드를 녹여 카트리지에 넣고 다시 0.1% 포름산과 5% MEOH으로 세척 후 70% 아세토니트릴을 처리하여 두 화학물질을 추출하였으며, 펩타이드는 건조시켜서 -80℃에 저장하였다.
모든 측정은 V-mode에서 실시되었으며 분석은 positive mode Nano ESI에서 실시하였다. 400 mol/㎕농도의 피브리노젠 용액으로 칼리브레이션 작업을 하였으며 LCMS 데이터는 DDA 모드에서 수집하였다. LC-MS/MS 데이터는 Protein Lynx Global Server (PLGS)을 이용하여 처리하였다. 이온 탐지, 군집화, 평균화 (normalization) 작업도 PLGS를 사용하여 실시하였다. 처리가 끝난 데이터는 PLGS, MASCOT DAEMON 프로그램을 사용하여 IPI 인간 데이터베이스에 있는 데이터와 맵핑(mapping) 작업을 하였다. 맵핑 작업을 위한 검색 설정은 프로그램에 의해 정해지며 분석에 사용된 펩타이드는 최대 한 개의 서열 불일치와 시스테인이 카바미도메틸레이션된 트립신이 처리된 조각으로 한정하였다.
발현된 단백질 확인 결과, 도 36에서 볼 수 있는 바와 같이 본 발명에 따른 태반 유래 세포와 태반 유래-NPC(신경전구세포)에서 나온 CM의 단백질 발현을 상대적으로 비교해보면, 면역 관련 단백질인 C3,C1r, EEF1A1, LGALS3BP (Galectin-3-binding protein), 및 FLJ53478이 본 발명의 태반 유래 세포에서만 측정이 되었다 한편 노화 관련 단백질인 EPPK1은 NPC에 비해 태반 유래 세포에서 약 7배 정도 더 많은 양이 측정되었다.
1.3. 태반 유래 세포의 면역 표현형 특성
표현형 분석을 위하여, 적합한 농도의 하기의 항체와 4℃에서 20분간 FACS 버퍼 내에서 염색하였다: FITC-표지된 항- SSEA4, TRA-1-81, CD34 및 PE-표지된 항- TRA-1-60, CD90, CD9, CD13(BD Pharmingen, San Diego, CA, USA); PE-표지된 CD200(R&D system). 세포의 세척 후, Cell Quest 소프트웨어를 이용하여 FACS Caliber(BD, San Jose, CA, USA)로 분석하였다.
도 1은 패시지(passage) 4에서 회수된 태반 유래 세포(PDC)의 형태(morphology)를 보여준다. PDC의 면역표현형 표면 프로파일의 유동 계수 분석은 CD34(조혈세포 및 내피세포의 마커), SSEA4, TRA-1-60, 및 TRA-1-81(배아줄기세포 마커)에 대하여 음성이고, CD9(비영양막(non-trophoblast) 마커), 및 CD13 및 CD90에 양성임을 나타냈다. 이러한 발현 프로파일을 통해 본 발명의 태반 유래 세포가 다분화능(multipotent)의 특성을 갖는 것을 확인할 수 있었다. 더욱이, PDC는 세포 표면 항원 CD200에 대하여 양성적이었다(도 1B). 최근 인식된 막관통 글리코프로테인(transmembrane glycoprotein)인 CD200은 면역조절, 그의 수용체 CD200R을 통한 내성(tolerance)에 중요한 역할을 수행하는 것이 알려졌다.
한편 PDC에서의 항-신생혈관 인자(신생혈관 안정화를 촉진하는 인자를 포함)의 발현 수준을 hBM-MSC (골수 유래 중간엽 줄기세포) 및 hAdipo-MSC (지방세포 유래 중간엽 줄기세포)과 비교하였다. PEDF 및 ANG-1 발현에 대해서는 차이점이 발견되지 않았지만(도 15B), TGF-β 발현은 hBM-MSC 및 hAdipo-MSC에 비하여 PDC에서 훨씬 강력하였다(도 16B).
실시예 2. 알츠하이머병에 대한 본 발명의 태반 유래 세포의 효과
2.1. 인 비트로에서의 PDC의 영향 확인
<실험방법>
(1) 미세교세포에 대한 아밀로이드 펩티드의 처리
인큐베이터 내에서, BV2 마우스 미세교세포주를 37℃에서 5%의 CO2 하에서, 10% 소태아혈청(Gibco), 2 mM 글루타민, 및 페니실린-스트렙토마이신(Gibco)로 보충된 DMEM에서 유지시켰다. 합성 Aβ25 -35(Sigma)를 1 mM의 농도의 멸균된 증류수에서 용해하고, 응집(aggregation)을 위하여 72시간 동안 37℃에서 인큐베이션하였다. BV2 세포에의 Aβ25 -35 처리를 3중으로 수행하였다. 이 목적을 위하여, BV2 세포를 트렌스웰(transwell) 시스템에서 배양하였다. hpMSC(2X105 cells/well)를 트렌스웰 내에 시딩(seeding) 하고, BV2 세포(2X105 cells/well)가 6-웰 디쉬에 도말(plate)하였으며, 밤새 부착되도록 하였다. 플레이트를 Aβ25 -35 처리 전 24시간 동안 인큐베이션하였고, BV2 세포를 24시간 동안 50㎛ 아밀로이드 펩티드로 처리하였다. Aβ25 -35 처리 후 BV2 세포에서의 NO 생산을 평가하기 위하여 배양 상청액 내의 NO2-를 측정하였다. 50㎕의 샘플 부분 표본을 50㎕의 그리스 시약(Promega, Madison, WI, USA)과 96-웰 플레이트에서 혼합하고 10분간 25 ℃에서 인큐베이션하였다. 550 nM에서의 흡광도를 마이크로플레이트 리더로 측정하였다.
(2) IFN-γ 및 TNF-α 자극 후 태반 유래 세포의 mRNA 및 사이토카인 수준 분석
PDC의 인비트로 자극: PDC를 1ml DMEM 배지(2 X 105 cells/ml) 내의 24-웰 플레이트에서 배양하였고, TNF-α (10ng/ml; R&D systems) 및 IFN-γ (100ng/ml; Peprotech)로 6시간 동안 자극하였다. 세포를 24시간 후 회수하고, TGF-β (R&D systems)에 대한 효소-연결 면역 분석법(ELISA)을 이용하여 상청액을 분석하였다.
사이토카인의 측정: TGF-β 및 MMP-9(R&D systems)에 대한 샌드위치 ELISA를 제조사의 지시에 따라, PDC 또는 배양 상청액 내의 사이토카인의 농도를 자극 후 24시간 뒤에 측정하였다. 사이토카인 농도를 공지된 표준과의 비교에 의해 계산하였다. 모든 측정은 3회씩 수행되었고 결과는 평균 ± S.E.M으로 나타냈다.
<결과>
(1) Aβ25-35에 의해 유도된 미세교세포에 대한 PDC의 억제 활성
PDC에서 발현되는 CD200가 아밀로이드-활성화된 미세교세포에서 면역조절효과를 갖는지를 조사하기 위하여, 불사화된(immortalized) 쥐의 미세교세포주인 BV2 세포를 50μM의 총장 Aβ25 -35 펩티드의 신경독 도메인(neurotoxic domain), Aβ25 - 35 펩티드로 자극한 뒤, PDC와 공배양하였다. 24시간 동안 Aβ25 -35로 자극한 후, 활성화된 미세교세포는 밀집하게 뭉친 세포 덩어리(clump)를 보이는 반면, PDC와 공배양한 미세교세포는 세포덩어리를 보이지 않았다(도 2A). 또한, PDC는 미세교세포에서의 Aβ25 - 35 매개 NO 생산에도 영향을 미쳤다. 정상 미세교세포는 매우 적은 양의 아질산염(2.7±0.1 μM)을 생산하였다. 24시간 동안 Aβ25 -35로 자극한 후, NO 생산은 유의적으로 증가(21.4±1.2 μM; p<0.001)한 반면, AMCS와의 공배양에서는 아질산성 질소축적(nitrite accumulation)이 유의적으로 감소하였다(13.4±2.2μM)(도 2B). 다음, PDC의 활성화된 미세교세포에서의 TNF-α 및 IL-1의 mRNA 활성에 대한 영향을 확인해 본 결과 도 2c에서 나타난 바와 같이, LPS(100 ng/ml)는 미세교세포에서의 TNF-α 및 IL-1의 뚜렷한 상향조절을 일으켰다. 비히클-처리된 미세교세포와 비교하였을 때, PDC와의 공배양물은 LPS-유도된 TNF-α 및 IL-1β 과생산을 유의적으로 억제하였다.
(2) 전염증 사이토카인, IFN-γ 및 TNF-α 자극 후, PDC는 TGF-β 및 MMP-9의 발현 수준 검증
외인성(exogenous) IFN-γ 및 TNF-α 병용 투여(co-administration)는 인 비트로에서 PDC를 자극하였다. 정량적 실시간 PCR을 통해 IFN-γ 및 TNF-α 병용 투여 후 TGF-β 유의적인 증가를 확인하였다(p < 0.001; 도 13A). MMP-9 및 IDE mRNA 수준은 전염증 사이토카인과 함께 배양된 PDC에서가 상기 사이토카인 없이 배양된 것에 비하여 유의적으로 높았다(각각, p < 0.0009 및 p < 0.05; 도 13A). TGF-β 수준은 전염증 사이토카인과 함께 배양된 PDC의 세포 용해물(236.70 pg/ml) 및 상청액(155.14 pg/ml)이 사이토카인 없이 배양된 PDC의 세포 용해물(126.73 pg/ml) 및 상청액(117.63 pg/ml) 보다 유의적으로 높았으며(각각, p < 0.03 및 p < 0.000006; 도 13B), MMP-9의 수준은 사이토카인과 함께 배양된 세포의 세포 용해물(452.09 pg/ml) 및 상청액(261.06 pg/ml)이 사이토카인 없이 배양된 세포의 세포 용해물(235.59 pg/ml) 및 상청액(95.51 pg/ml) 보다 유의적으로 높았다(각각, p < 0.002 및 p < 0.04). 이러한 발견은 본 발명의 태반 유래 세포가 알츠하이머병(AD) 뇌에서 면역 조절 역할을 수행한다는 인 비보 모델에서와 동일한 결과이다.
2.2. 인 비보에서의 PDC의 영향 확인
<실험방법>
(1) 실험동물의 특성 및 처리
PDC(aminotic membrane-derived MSC)의 이식 효과를 평가하기 위하여, 알츠하이머병(Alzheimer's desease, AD)에 대한 형질전환 마우스 모델을 사용하였다. APPswe(Tg2576) 마우스를 Taconic Laboratory(Germantown, NY, USA)로부터 수득하였다. 이식 12 주 후, 성체 암컷 APPswe 마우스(15-16 월령; 20 g; 8마리는 PDC를 주입하고, 6마리는 PBS를 주입)를 행동 실험 및 병리학적 분석을 위하여 사용하였다. 또한 성체 수컷 APPswe 마우스(12-13 월령; 20 g; 8마리는 PDC를 주입하고, 6마리는 PBS를 주입)을 이식 1주 후에 추가적인 병리학적 분석을 위하여 이용하였다. 야생형 한배새끼(littermate) 마우스(정상군, n = 10)을 APPswe 군과 비교하였다. AD 병리에 대한 PDC의 면역 조절을 평가하기 위하여, Jackson Laboratory(Bar Harbor, ME, USA)로부터 구매한 3xTg-AD 마우스(6-7 월령; 각 시점의 3마리의 암컷 마우스)를 사용하였다. 모든 실험 동물을 특정 무균상태에서 사육하고 CHA대학교의 동물실험윤리위원회(IACUC)에 승인된 동물 프로토콜 하에서 다루었다.
(2) 인간 태반 세포의 제조 및 주입
상기 실시예 1.1에서 단리된 태반 유래 세포를 밀도 1×104 cells/cm2에서 15 g/ml 폴리오르니틴(Sigma) 및 4 ㎍/ml 피브로넥틴(Sigma)으로 코팅된 디쉬에서 배양하였다. 25 ng/ml FGF4 및 1 ㎍/ml 헤파린을 포함하는 완전배지를 그 뒤 추가하고, 세포를 3% CO2의 조건에서 37 ℃에서 6일간 인큐베이션하였다. 정맥 주사를 위하여 200 ㎕의 세포 현탁액(약 2×106 cells)을 꼬리 혈관에 주입하였다(PDC-주사군). 대조군에서는 200 ㎕의 PBS를 꼬리 혈관에 주입하였다(PBS-주사군).
(3) 동물실험모델의 행동 평가 및 기록
고가식 십자미로 실험(elevated plus-maze), 명/암 왕래 실험(light/dark transition test) 및 운동능력(locomotor) 및 오픈 필드 실험과 같은 탐구-기반 과제(Exploration-based task)를, 일부 변형을 가하여(하기 참고), 기본적 운동능력 및 불안-유사 행동(anxiety-like behaviors)을 평가하기 위해 이용하였다. 최종적으로, 인지적 변화(cognitive change)를 수중미로실험(water maze test, WMT)을 이용하여 측정하였다. 모든 행동 실험은 PDC 이식 후 6 주 후에 수행하였다.
WMT: 플랫폼(직경이 10 cm)을 포함하는 탱크(직경이 1.1 m)를 이 실험에서 사용하였고, 연속된 5일 동안에 36 차례 시도하였다. 시도 블록, 1, 2, 3, 4가 8차례의 시도를 포함하고, 5번째의 블록이 4차례의 시도를 포함하였다. 6일째에, 단일 시도 검사(probe trial)을 시도 블록에 포함하였다. 7일째에, 모든 마우스에게 6개 단서의(six cued) 학습 실험(learning test)을 수행시켰고, 이는 각각의 마우스에 대하여 감각운동 지수(sensorimotor index)로 제공되었다.
운동능력 실험: 40 cm 정사각형에서 수행하였다. 두 구역을 오픈 필드에 의해서 구분하였다: 주변구역 및 중앙구역. 마우스는 오픈 필드의 중앙에 위치시키고 60분간 자유롭게 움직이도록 하였으며 자동 추적 시스템으로 추적하였다.
오픈 필드 실험: 10 cm 직경의 내부 원형의 플랫폼을 갖는 검정색 바탕으로 된 40 cm의 정사각형에서 수행하였으며, 램프로 조명하였다. 마우스를 오픈 필드 경기장(arena)에 위치시키고 60 분간 자유롭게 움직이게 하였으며, 비디오 레코딩 시스템을 이용하여 추적하였다.
명/암 왕래 실험: 우리(21 X 42 X 25 cm)를 문을 포함하는 파티션을 이용하여 동일한 크기로 분리하였다. 방 하나는 백색 다이오드(390 lux)에 의해 밝게 비춘 반면 나머지 방은 어둡게 하였다(2 lux). 마우스을 5분 동안 두 방간을 자유롭게 움직이게 하였다. 총 이동 횟수, 각 방에서 보낸 시간, 밝은 방으로 들어가는 잠재기(lactency)를 기록하였다.
고가식 십자 미로실험: 미로는 십자를 형성하는 4개의 팔(arm)(45 cm(길이)x10 cm(너비))을 포함했다: 두 팔은 열린 팔이고 두 팔(동일한 크기)는 지붕 및 벽으로 닫힌 것이다. 미로를 50 cm이 넘는 바닥의 검사실에 설치하였다. 각각의 시도에서, 마우스를 열린 팔과 마주하는 중앙 플랫폼에 위치시키고 5분간 자유롭게 움직이게 하였다. 총 이동 횟수, 각 방에서 보내는 시간, 밝은 방으로 들어가기 위한 잠재기를 기록했다.
비디오 모니터링: WNT, 운동능력 실험, 오픈 필드 실험 및 고가식 십자 미로 실험을 평가하고, 비디오 모니터와 컴퓨터로 연결된 전하결합소자(charge-coupled device, CCD) 카메라를 이용하여 기록하였다. 실험은 비디오-추적 시스템(Ethovision, Noldus, Wageningen, NL)을 이용하여 수행하였다.
(4) 세포 이식된 마우스로부터의 조직의 분리 및 처리와 이의 면역조직학적 분석
조직의 준비 및 티오플라빈(thioflavin) S 염색: 마우스를 이식 후 1주 뒤(PBS-주사군 n = 7; PDC-주사군, n = 7) 및 12주 뒤(PBS-주사군 n = 7; PDC-주사군, n = 8)에 희생시켰다. 마우스를 마취한 직후 PBS를 심장에 관류 후, 뇌를 분리하여, 분석을 위하여 좌우 반구로 나누었다. 좌측 반구를 4 %의 포르말린으로 고정시켰으며, 30% 수크로스에서 인큐베이션 후, 저온유지 장치(cryostat)(Leica, Germany)에서 동결하고 절단하였다. 20 ㎛ 간격의 일련의 관상 절편(coronal section)을 대표적으로 문측 전교련(rostral anterior commisure)으로부터 미측 해마(caudal hippocampus)까지 수거하였다. 300 ㎛ 간격으로 각각 분리한, 마우스 당 6개의 뇌 절편이 정량을 위하여 사용하였다. 뇌 절편을 50 %의 에탄올에 용해된 0.5 %의 티오플라빈 S(Sigma)에서 인큐베이션시켰으며, 50 %의 에탄올로 2회, 물로 1회 세척하였고, 봉입제(mounting medium)으로 봉입하였다. 우측 반구는 RNA 분석을 위하여 -80℃에서 보관하였다.
면역형광 분석: 활성화된 미세교세포의 형태학적 분석을 위하여, Aβ 플라크-부재 뇌 부위를 선택하였으며, 이는 Aβ 플라크 주변의 미세교세포의 광범위한 침윤(massive infiltration)이 단일 미세교세포의 형태의 평가를 불가능하게 하기 때문이다. 미세교세포(Iba-1) 및 CD68(ED1)에 대한 면역형광염색을 위해 절편을 Iba-1(1:500; Wako, Osaka, Japan) 및 ED1(1:500; Serotec, Washington, DC, USA)에 대한 항체와 함께 밤새 인큐베이션하고, Alexa Fluor 488-, 또는 594- 접합된 이차항체와 함께 실온에서 1시간 동안 인큐베이션하였다. 미세교세포, CD68 및 성상세포(astrocyte)의 이중 면역형광 염색은 인간 핵(HuNu)(1:100; Millipore, Billerica, MA, USA)의 항체를 이용하였다. 정상 염소 혈청(isotype control), 또는 PBS(0.1 M, pH 7.4)를 음성대조군으로 일차 항체를 대신하였다. 인간 핵(HuNu) 염색을 HRP-DAB 방법으로 수행하였다. 공초점 현미경(Zeiss, Oberkochen, Germany)을 갖춘 현미경을 이용하여 영상을 수득하였고, 정량 분석을 위하여 Adobe Photoshop CS5 소프트웨어를 이용하였다. Aβ 플라크를 크기별로 분류하고 계수하였다. 대형(직경> 100 ㎛), 중형(직경 50-100 ㎛) 및 소형(직경 < 50 ㎛) 플라크를 검출하고, 공초점 현미경을 이용하여 피질 및 해마를 계수하였다.
(5) 동물모델 우측 반구로부터 RNA의 분리 및 정량적 실시간 PCR
TRIzol 제제(Invitrogen, Carlsbad, CA, USA)를 이용하여, 총 RNA를 세포(PDC 및 BV2 세포)와 우측 반구로부터 추출하였다. SuperScriptTMIII(Invitrogen)를 이용하여 1㎍의 정제된 총 RNA를 cDNA로 변경하였고, 모든 cDNA 샘플을 -80 ℃에서 보관하였다. LightCycler(Roche, Indianapolis, IN, USA)에서, SYBR-Green 반응 키트(Roche)를 이용하여 실시간 PCR를 수행하였으며, 하우스키핑 유전자(GAPDH)와 TGF-β IL-10, TNF-α, IFN-γ, IL-1, IDE, 및 MMP9의 유전자의 상태적 발현을 결정하였다. 실시간 PCR에서 이용된 프라이머는 표 1에 나타낸다. 표적 유전자 발현 값은 GAPDH에 대응하여 정규화하였다. 대조군의 발현값을 데이터 세트에 표준으로 부여하고 모든 다른 샘플의 상대적 발현 수준을 계산하였다.
표 1 실시간 PCR에 사용된 프라이머 서열
Gene name Accession No. 5'-forward primer sequence-3' 3'-Reverse primer sequence-5'
mIL-1 NM_008361.3 CCCAAGCAATACCCAAAGAA(서열번호 1) GCTTGTGCTCTGCTTGTGAG(서열번호 2)
mTNF-α NM_013693.2 GCTCCAGTGAATTCGGAAAG(서열번호 3) GATTATGGCTCAGGGTCCAA(서열번호 4)
mIL-10 NM_010548.2 CAGGGATCTTAGCTAACGGAAA(서열번호 5) GCTCAGTGAATAAATAGAATGGGAAC(서열번호 6)
mTGF-β NM_011577.1 CAAGGGCTACCATGCCAAC(서열번호 7) AGGGCCAGGACCTTGCTG(서열번호 8)
mMMP-9 NM_013599.2 TGCCGTCGAAGGGATACC(서열번호 9) GACCCGAAGCGGACATTGT(서열번호 10)
mIDE NM_031156.2 GAAGACAAACGGGAATACCGTG(서열번호 11) CCGCTGAGGACTTGTCTGTG(서열번호 12)
mGAPDH NM_008084.2 GTGAGGGAGATGCTCAGTGTT(서열번호 13) GGCTGGCATTGCTCT(서열번호 14)
hTGF-β NM_000660.4 AAATTGAGGGCTTTCGCCTTAGCG(서열번호 15) TCTTCTCCGTGGAGCTGAAGCAAT(서열번호 16)
hMMP-9 NM_004994.2 TTGACAGCGACAAGAAGTGG(서열번호 17) GCCATTCACGTCGTCCTTAT(서열번호 18)
hIDE NM_004969.3 CTCGGAACCTTGCTTCAACAC(서열번호 19) GGCCCGCTGAAGACGATA(서열번호 20)
hGAPDH NM_002046.3 AGGGCTGCTTTTAACTCTGGT(서열번호 21) CCCCACTTGATTTTGGAGGGA(서열번호 22)
(6) 마우스모델 림프구의 면역표현형 검사
마우스 림프구를 비장에서 분리하였다. 비장의 단일세포의 현탁액을 수득하고, 죽은 세포 및 적혈구를 제거하기 위하여 Ficoll-Conray 밀도 구배 원심법을 수행하였다. 마우스 림프구를 FACS 버퍼에서, FITC-표지된 항-CD4 및 PE-표지된 항- CD25과 함께 30분 동안 4℃에서 염색하였다. 세포의 상대적 면역형광을 FACSCaliburTM 유세포 분석기(flow cytometer)(BD)를 이용하여 분석하였다.
(7) 통계적 분석
통계적 분석은 Statistical Analysis System(SAS; SAS Korea, Inc., Seoul, Korea), 버전 Enterprise 4.0을 이용한 차대학교의 메인프레임 컴퓨터에서 수행하였다. 기초 운동기능 분석, 영상 강도(image intensity) 데이터, 실시간 PCR 데이터는 T-test 또는 이원분산 분석(two-way variance analysis)을 이용하여 분석하였고, 그 뒤 LSD(Fisher's least significant difference) 사후 검증(post-hoc test)을 수행하였다. 모든 측정은 마우스의 랜덤 영향을 고려하여 믹스 모델(mixed model) 분석(SAS, PROC MIXED)을 사용하여 분석하였다. WMT와 플라크 개수 사이의 상관을 피어슨 상관 분석(Pearson correlation coefficient)을 사용하여 분석을 하였다. 데이터는 평균 ± SEM으로 나타내고 p 값< 0.05을 유의적이라고 보았다.
<결과>
(1) PDC의 이식에 의한 기억 기능 개선 효과 검증
수중 미로 실험(water maze test, WMT)에서 각각의 출발점(동쪽 E, 북쪽 N, 북서쪽 NW 및 남동쪽 SE: 도 3A)으로부터 숨겨진 플랫폼으로 도달하기까지 필요한 평균 탈출 잠재기(escape latency)를 측정하였다. 서로 다른 출발점의 군간에는 통계학적으로 유의적인 상호 영향은 없었다(F6,66 = 0.50 : F6는 집단간 자유도, 출발점 (n:7)-1=값(6), F66은 전체 자유도, 전체 샘플 수, p = 0.80). 그러나, 시도 블록과 실험군 간에는 유의적인 상호 영향이 있었다(F8,88 = 2.73, F8는 집단간 자유도, 출발점 (n:7)-1=값(6), F88은 전체 자유도, 전체 샘플 수. p = 0.009; 도 3B). 시도 블록 1에서는, 정상 대조군이 PBS- 및 PDC-주사군보다 더 빨리 숨겨진 플랫폼을 찾는 경향이 있는 반면(p = 0.06; 도 3B), 시도 블록 2에서는, 3개 군의 평균 탈출 잠재기에는 유의적인 차이가 없었다(도 3B). 시도블록 3에서의 정상 대조군의 잠재기는 PBS-주사 및 PDC-주사군보다 유의적으로 빨랐다(각각, p < 0.0001 및 p < 0.0002; 도 3B).
흥미롭게도, 시도블록 3부터 시도블록 5까지, PDC-주사군이 평균 탈출 잠재기에 유의적인 변화를 나타내며, 이는 손상된 기억 기능이 태반 유래 세포 주입에 의해 변화하였음을 의미한다. 더욱이, 시도 블록 4 및 5에서 PDC-주사군과 정상대조군 간에 통계학적으로 유의적인 차이가 없는 반면, PDC-주사군과 PBS-주사군간에는 유의적인 차이가 존재하였다(시도 블록 4에서 p < 0.06 및 시도 블록 5에서 p < 0.002; 도 3B). 시도 블록 4 및 5에서, 정상 대조군의 결과도 PBS-주입군의 결과와 유의적으로 달랐다(각각, p < 0.002 및 p < 0.0003; 도 3B). 시도 블록 5에서의 각 실험군의 대표적인 수영 경로에서, PDC-주사군이 PBS-주사군에 비하여 공간 학습 습득(spatial learning acquisition)이 증가하는 것을 나타냈다(도 3C).
이어서, 5일째, 마지막 훈련 시도 후 24시간 뒤, 검사 실험(probe test)을 수행하였다. 시도 검사는 플랫폼을 재거하고, 각각의 마우스가 종전 플랫폼으로 채워졌던 구역에서 보내는 60초 이상의 시간의 길이를 기록하였다. 결과는 정상 대조군은 2.41 ± 0.35 초, PBS-주사군은 0.92 ± 0.31 초이고, PDC-주사군은 2.61±0.75 초이다(F2,21 = 4.32, p = 0.03; 도 3D). 구역에서 보낸 시간은 정상 대조군(p < 0.008) 및 PDC-주사군(p < 0.02)에 비하여 PBS-주사군에서 현저하게 짧았다. 총 수영거리에 대해서는, 시도 블록과 실험군간에 유의적인 상호영향이 존재하였다(F8,88 = 2.68, p < 0.01; 도 4A). 1 내지 4 시도 블록 동안에는 정상대조군과 PDC-주사군 간에는 수영속도(velocity)에 대한 차이가 존재하지 않았으나(시도블록 및 실험군간의 상호영향; F8,88 = 2.40, p < 0.02), 정상대조군과 PBS-주사군간에는 유의적인 차이가 있었다(p < 0.05; 도 4B).
운동능력실험, 고가식 십자미로 실험, 명/암 왕래실험 또는 오픈 필드 실험에서는, 야생형 마우스(정상대조군), PBS 가 주사된 APPswe 마우스(PBS-주사군) 또는 PDC가 주사된 APPswe 마우스(PDC-주사군)간에 유의적인 차이가 없었다(도 5).
(2) PDC 처리에 의한 APPswe 마우스 뇌 내에서의 Aβ 플라크 개선 효과 확인
12 주간 PDC를 처리한 마우스로부터 제거된 뇌조직의 모든 6개의 절편을 크레실 바이오렛(cresyl violet)(도 6 A) 및 티오플라빈 S(thioflavin S)(도 6 B 내지 도 6 G)로 염색하였다. 피질 및 해마, 두 뇌 부위의 Aβ 플라크의 수는 PBS-주사군(19.84 ± 3.45) 보다 PDC-주사군(8.72 ± 1.22)에서 훨씬 적었다(도 6H; p < 0.02). 플라크를 개별 Aβ 플라크의 크기에 기초하여 하위 범주에 따라 분석하였다. 결과는 소형(지름이 < 50 ㎛), 중형(지름이 50-100 ㎛) 플라크의 수는 PBS-주사군에 비하여 PDC-주사군에서 유의적으로 적은 반면(도 6 H; 각각 p < 0.01 및 p < 0.03), 대형 플라크(지름이 > 100 ㎛)의 수는 그룹간에 차이가 없었음을(도 6 H; p < 0.1)를 나타냈다. 이것은 PDC 주사 후 1 주 뒤의 경우에는 그렇지 않았다(데이터 미기재).
또한 PDC-주사군은 WMT에서의 평균 탈출 잠재기와 아밀로이드 플라크간의 양의 상관관계(positive correlation)(rho = 0.85, p < 0.06)를 나타내는 경향을 보인 반면, PBS-주사군에서는 그러한 상관관계가 나타나지 않았다(p = 0.83; 도 7).
(3) PDC 이식에 의한 미세교세포의 리크루팅 조절 검증, 및 PDC 이식에 의한 대체-활성화된, 식균 미세교세포의 비율 증가 경향 검증
PDC-주사군에서 감소하는 Aβ 플라크의 메커니즘을 조사하기 위하여, 상재(resident) 미세 교세포의 수를 계수하였다. 주사 후 1 주 뒤에, PBS-주사군에 비하여(58.36 cells/mm2, p < 0.02;도 8A, B), PDC-주사군에서(67.58 cells/mm2) Iba-1-양성 미세교세포의 수가 유의적으로 증가한 반면, 주사 후 12 주 후에는, 각 군간의 Iba-1-양성 미세교세포 수는 차이가 없었다(p = 0.95; 도 8A, B). 추가의 정량 영상 분석은, 주입 후 1주 뒤에, PBS-주사군보다 PDC-주사군에서의 Iba-1-양성 미세교세포의 밀도가 더 높지만(p < 0.04; 도 8C), 주사 후 12 주 뒤에는 더 낮다는 것이 나타났다(p < 0.05; 도 8C). 이것은 주입된 PDC가, AD 마우스 모델로의 이식 후의 초기급성 단계(initial acute stage)에서 미세 교세포를 리크루팅(Recruitment) 하는 것이 가능하지만, 전-염증(proinflammatory)환경에도 불구하고, 낮은 수의 상재 미세 교세포를 유지한다는 것을 암시한다. 이는 MSC의 면역억제역할을 뒷받침한다.
ED1 또한 양성인, Iba-1-양성군의 활성화된 미세 교세포의 밀도를 분석하였다. 도 9A는 ED1 음성인 휴지(resting) 미세 교세포를 나타내고, 도 9B는 PDC-주사군 내의 ED1-양성 미세 교세포가 Aβ 플라크 주변에 산재하는 것을 나타낸다. Aβ 플라크가 존재하지 않는 뇌 영역은 발견되지 않았다(도 10). 뒤이어, 유사한 크기의, Aβ 플라크와 미세교세포의 주변 부위를 더 정밀한 분석을 위하여 선택하였다. PDC-주사군의 Iba-1-양성 미세 교세포의 대부분은 ED-1 양성인 반면, PBS-주사군내의 Iba-1-양성 미세교세포의 아주 적은 수가 ED1과 공염색됨을 나타내다(도 9B). 이 결과와 일치하게, Iba-1 발현에 대한 ED1 발현 비율은 주사 후 1주 뒤 및 2 주 뒤 모두에서, PDC-주사군에서가 PBS-주사군보다 유의적으로 높았다(각각 p < 0.02 및 p < 0.05; 도 9C). 이러한 발견은 이식된 PDC가 미세 교세포의 식균 활성을 조절한다는 것을 암시한다.
최종적으로, 이식된 PDC의 좌위를 확인하기 위하여 HuNu 면역염색이 더 수행하였다. 이식 후 1주일 뒤에 PDC-주사 마우스의 뇌에는 인간 세포가 발견되지 않았으나, 적어도 주사 후 1주 뒤까지 HuNu-양성세포가 비장에서는 확인되었다(도 11).
(4) PDC에 의한 IL-1, TNF -α IL-10, 및 TGF -β 발현 조절, 및 Aβ 분해 효소 분비 검증
전염증 사이토카인, IL-1 및 TNF-α를 코딩하는 mRNA의 수준은 주사 후 1 주 뒤에, PDC-주사군에서가 정상 대조군보다 더 낮았다(각각, p < 0.01 및 p < 0.06). 그러나 항-염증 사이토카인, IL-10을 코딩하는 mRNA의 수준은 정상 대조군에 비하여 PDC-주사군에서 더 높았다(p < 0.04). TGF-β mRNA 수준은 두 군간에 유의적인 차이가 없었다(p < 0.08; 도 12A).
주사 후 12 주까지, IL-10 및 TGF-β mRNA 수준은, PDC-주사군이 정상대조군에 비하여 유의적으로 높았으나(각각, p < 0.0003 및 p < 0.01), IL-1 및 TNF-α mRNA의 발현에는 유의적인 차이가 없었다(도 12B).
인슐린-분해 효소(insulin-degrading enzyme, IDE) 및 MMP-9를 포함하는, Aβ 분해 효소의 수준은 주입 후 1주 뒤에, PDC-주사군에서 정상대조군에 비해 높았다(각각, p < 0.005 및 p < 0.06; 도 12C).
(5) PDC에 의한 면역 조절 기능(immune regulatory function) 검증
PDC가 면역 반응에서의 내성을 조절하는 능력이 있는, CD4+CD25high T 세포인, 조절 T 세포의 유도를 촉진하는지 여부를 확인하였다. AD 마우스로의 PDC의 주입후 1일째 및 7일째에, 각 시점에서의 비장세포로부터 CD4+CD25high 세포의 유세포계수 분석을 수행하였다(도 14A). PDC가 주입된 AD 마우스로부터 분리된 림프구 내의 CD4+CD25high T세포의 비율이 PBS가 주입된 AD마우스에 비하여 현저하게 증가(3배 보다 높게) 증가하였다(도 14B).
실시예 3. 망막증에 대한 PDC의 효과 확인
3.1. 인 비트로의 병리적 조건(pathologic condition)에서의 PDC의 반응
<실험 방법>
(1) 태반 유래 세포의 배양 및 처리
차종합병원으로부터 인간 태반을 받자마자, 각각의 조직(기저탈락막(deciduas basalis))을 조심스럽게 절개하고 PBS로 세척하였다. 회수한 조직의 조각을 작은 조각으로 절단하고, 교반기 인큐베이터(shaker incubator) 내에서 30 분간 37 ℃에서 0.5 %의 콜라게나제 IV(Sigma, St. Louis MO, USA)로 분해(digest)시켰다. 회수된 세포는 T 25 플라스크(2 X 105 cells/mm3, Nunc)내의, 10 % 우태아혈청(Gibco, Grand Island. NY, USA), 각각 100 ㎍/ml의 페니실린 및 스트렙토마이신(Gibco), 25 ng/ml FGF4(R&D system, Minneapolis, MN, USA), 및 1 ㎍/ml 헤파린(Sigma)으로 보충된 알파 MEM에서 배양하였다. 모든 배양물은 5 % CO2조건으로 37 ℃에서 인큐베이터 내에 유지시켰으며, 배양 배지를 매일 갈아주었다. 각각의 실험에서, 세포는 약 80 % 밀도이며, 페시지 5(P5) 초과의 세포는 실험에서 사용하기 않았다. 주사된 세포의 추적을 위하여, PDC는 30 분간 37℃에서 친유성 막-결합 형광염료인 2mM의 CM-DiI(1,1'-dioctadecyl 3,3,3',3'-tetramethy lindocarbocyanine pechlorate)(Molecular Probes, Eugene, OR)와 함께 인큐베이션하였다 (도 15).
(2) PDC의 면역표현형 분석
유세포계수 분석을 P5의 PDC에 수행하엿다. 2 X 105 세포를 30분간 SSEA4, TRA-1-60, TRA-1-81, CD34, CD13, 및 CD90, CD9(BD, Becton Dickinson, San Jose, CA) 항체와 접합한 FITC(fuorescein isothiocyanate) 또는 PE(phycoerythrin)과 함께 인큐베이션시켰다. FACS Calibur Flow Cytometer(BD, Hialeah, FL)에서 항체당 만 번의 반응이 일어났다. 뒤이어 결과는 CellQuest Pro 소프트웨어를 이용하여 분석하였다.
(3) PDC의 인비트로 자극 및 분석
PDC를 2 X 105 cells/ml로 시딩하고, 1ml 부피로 밤새 배양한 뒤, 전-염증 사이토카인인 TNF-α 10 ng/ml; R&D systems) 및 IFN-γ 100 ng/ml; Peprotech, Rocky Hill, NJ, USA)로 6시간 동안 자극시켰다. 농도와 시간은 적정 후 선택하였다(데이터 미기재). 상청액을 수집하고 ELISA를 이용하여 분석하였다.
(4) siRNA-표적(targeting) TGF-β1의 처리
GenBank로부터 수득한 인간의 TGF-β1 mRNA 핵산서열(GI:260655621)의 사용 및 siRNA의 설계 전략으로, TGF-β1 mRNA를 타겟으로 하는 두 쌍의 21-bp의 역 반복 서열을 Bioneer(Seoul, Korea)를 이용하여 합성하였다. TGF-β1이 코딩된 서열의 정방향: 5`-CAGAGUACACACAGCAUAU-3`(1243-1261)(서열번호 31); 역방향, 5`-AUAUGCUGUGUGUACUCUG-3`(1261-1243)(서열번호 32)을 siRNA가 표적화하였다. siRNA(최종 농도가 100 pmol)가 Lipofectamine2000(Invitrogen, Gaithersburg, MD)를 이용하여 제조사의 지시에 따라 세포로 감염시켰다. TGF-β1 유전자 침묵(gene silencing)의 효과는 정량적 실시간 RCR 및 웨스턴 블롯팅에 의하여 평가하였다.
(5) PDC와 인간제대혈관내피세포와의 공배양
인간제대혈관내피세포(Human umbilical vein endothelial cell. HUVEC)를 차의과학대학교의 Dr. Hyung-Min Chung(Seoul, Korea)로부터 제공받았다. 세포는 플레이트의 EGM-MV Bullet Kit(5% FBS 및 12 ㎍/ml BBE, 1 ㎍/ml 히드로코르티손(hydrocortisone), 및 1 ㎕/ml GA-1000를 포함하는 EBM 배지; Clonetics, San Diego, CA)에서 성장시켰다. 70 % 컨플루언시(confluency)의 HUVEC(패시지 6)가 대부분의 실험에서 사용되었다.
PDC(2 X 105 cells/well)를 0.4 ㎛의 막 기공 크기를 갖는 Transwell(BD) 6-웰 내부에 시딩하고, HUVEC(2 X 105 cells/well)가 6-웰 디쉬에 도말하고, 밤새 부착되도록 하였다. 각 실험을 위하여, PDC를 전-염증 사이토카인 또는 siRNA로 처리 또는 미처리하였다. siRNA 처리는 전-염증 사이토카인으로의 자극 전에 수행하였다. 플레이트는 증식도 측정(proliferation assay)의 24시간 전 동안 인큐베이션하였다.
(6) HUVEC 증식의 억제
HUVEC를 성장 배지를 포함하는 6-웰 플레이트(2 X 105 cells/well)에 시딩하였다. 16시간의 기아기(starvation phase)(1% FCS) 후, 세포를 VEGF165(20 ng/ml; R&D)로 자극하고 BrdU(5'-bromodeoxyuridine)용액과 함께 0.01 mM의 최종농도로 24시간 동안 인큐베이션하였다. 세포증식은 BrdU-기반 증식도 측정으로 평가하였다. 포함된 BrdU는 특이적 항-BrdU(Abcam, Cambridge, MA) 형광 항체로 염색하였다. 흡광도는 마이크로플레이트 리더 가변 VersaMax(Molecular Devices, Sunnyvale, CA, USA)로 확인하였다.
<결과>
(1) PDC의 특징의 확인
PDC의 면역표현형 표면 프로파일에 대한 유세포계수 분석은 PDC가 SSEA4, TRA-1-60, TRA-1-81(배아줄기세포 마커), 및 CD34(조혈 및 내피세포 마커)에 대하여 음성이고, CD13, CD90(MSC 마커), 및 CD9(비-영양막(non-trophoblast) 마커)에 대해서는 양성임을 나타냈다(도 16A).
PDC에서의 항-신생혈관 인자(anti-neovascular factor)(신생혈관 안정화(neovessel stabilization) 촉진하는 인자를 포함)의 발현 수준을 hBM-MSC 및 hAdipo-MSC과 비교하였다. PEDF 및 ANG-1 발현에 대해서는 차이점이 발견되지 않았지만(도 15B), TGF-β 발현은 hBM-MSC 및 hAdipo-MSC에 비하여 PDC에서 훨씬 강력하였다(도 16B).
(2) 인 비트로의 병리적 조건(pathologic condition)에서의 PDC의 반응
전-염증 사이토카인이 존재하는 병리적 조건하에서 PDC가 그의 항-신생혈관 특성을 유지하는지 여부를 조사하기 위하여, OIR-유도된 망막내의 사이토카인 발현을 분석하였다. 다중 염증 사이토카인, 특히 TNF-α 및 IFN-γ가 상향조절(upregulated)되었다(도 17). 이 결과를 바탕으로, IFN-γ 및 TNF-α의 PDC에의 효과를 인 비트로에서 실험하였다. IFN-γ 및 TNF-α 처리 후 0시간 및 24시간 후에 PDC로부터 mRNA 및 단백질을 추출하였다. RT-PCR 분석은 IFN-γ 및 TNF-α 노출된 PDC가 PEDF의 mRNA 수준에 대해서는 유의적인 차이를 나타내지 않았으며, ANG-1 발현은 조금 감소하였음을 나타내었다(도 18A). 반대로, PDC에서의 TGF-β 발현은 유의적으로 상향조절되었다(p < 0.001; 도 18A). 이와 일치하게, TGF-β 단백질의 증가된 분비가 ELISA를 통하여 확인되었다(271.82 ± 6.35 pg/ml 대 70.45 ± 2.36 pg/ml, p < 0.001; 도 18B). 이러한 데이터는 PDC가 TGF-β의 분비 향상을 통하여 환경적 변화에 반응함을 암시한다.
(3) HUVEC 증식에 대한 PDC의 억제 효과의 확인
PDC에 의한 TGF-β의 유도가 혈관신생의 억제에 중요하게 작용하는지 여부에 대하여 조사하기 위하여, HUVEC를 정상 또는 IFN-γ 및 TNF-α가 처리된 PDC와 공배양하였다. 공배양 1일 전에 PDC에 대한 IFN-γ 및 TNF-α 처리(PDC 자극)를 수행하였다. 증식에 대한 억제영향은 BrdU-기반 증식 분석에 의하여 측정하였고, 결과는 HUVEC 증식에 대한 PDC-매개 억제를 증명하였다. 도 19에서 나타난 바와 같이, HUVEC 단독 배양에 비하여, 정상 PDC와 공배양된 HUVEC에서 증식에 대한 미세한 억제효과를 관찰할 수 있었다. 더욱 중요하게, IFN-γ 및 TNF-α 처리된 PDC가 정상 PDC에 비하여 HUVEC의 증식에 더욱 큰 억제 효과를 나타냈다(도 19A). 이것은 망막증-유사 조건에 노출된 PDC가 일반적인 조건하의 PDC보다 더 효과적으로 HUVEC의 증식을 억제한다는 것을 암시한다.
뒤이어, PDC의 억제효과의 메커니즘을 실험하였다. TGF-β 역할을 평가하기 위하여, TGF-β 발현을 siRNA 형질감염(transfection)에 의해서 침묵화(silence)시켰다. PDC 배양물에서의 TGF-β siRNA의 형질감염효과는 정량적 실시간 PCR를 통하여 확인하였으며, 이것은 대조군 PDC와 비교하여 TGF-β siRNA가 TGF-β 발현의 80~90 %를 감소시키고(도 20), PEDF 및 Ang-1의 발현은 변화하지 않음(도 21)을 나타냈다. 도 19B에서 나타난 바와 같이, TGF-β siRNA 형질감염은 PDC의 HUVEC증식에 대한 억제효과를 방해하였다. 중요하게 TGF-β siRNA가 형질 감염된 정상 PDC는 비-형질전환된 정상 PDC에 비하여 억제 능력에 유의적인 차이를 나타내지 않았다(p = 0.77). 대조적으로, IFN-γ 및 TNF-α 처리된, TGF-β 수준이 감소된 PDC의 HUVEC 증식에의 억제효과는 유의적으로 제거되었다(p = 0.007).
종합하여 보면, 이러한 결과는 PDC가 망막증 조건하에서 HUVEC 증식에 억제적인 역할을 수행하며, 이는 TGF-β 발현의 상향-조절을 통할 수 있음을 나타낸다.
3.2. 인 비보 망막증에서의 PDC에 의한 효과 분석
<실험 방법>
(1) 산소-유도된 망막증(oxygen-induced retinopathy, OIR) 모델의 유도
OIR(산소-유도된 망막증)을 C57BL/6J 마우스에서 유도하였다. P7의 새끼 및 그들의 모체를 실내 공기에서 75 % 산소로 이동시켜 5일을 유지한 후 실내 공기로 다시 돌아오게 하였다. 체중은 P12 및 P17에서 기록하였다(표 2).
표 2
Day after birth Body weights
PBS treated mice PDCs treated mice
P12 4.23±0.15 4.54±0.19
P17 4.85±0.17 4.56±0.08
(2) PDC의 복강내 이식
P12에서 실내 공기로 돌아온 직후, 체중으로 짝지어진 새끼에게 50 ㎕ 의 PBS로 희석된 1 X 106 세포(hMSC군, n=8)또는 50 ㎕의 PBS(비교군(con group), n=8)를 임의로 복강내(intraperitoneal, i.p)이식하였다. 이식은 복부의 사분면에서의 오른쪽 하부에, 역류를 통한 손실을 방지하게 위하여 조심스럽게 처리하였다. 수여 마우스의 망막을 P17에서 실험하였다.
(3) 맥관구조(vasculature)의 면역조직화학 및 가시화
맥관 구조, 주사되거나 내생의 세포의 부위, 및 특징의 영상화를 위하여 P17의 망막을 수확하였다. 혈관 폐색(vascular obliteration) 및 전망막 신생혈관 다발(preretinal neovascular tuft)의 정량을 P17에서 수행하였다. 혈관을 염색하기 위한 면역조직학적 분석이 종래에 기술된 바와 같이 수행되었다. 요약하면, 망막을 4 %의 파라포름알데히드(paraformaldehyde, PFA)내에 1시간 동안 고정시키고, 1시간동안 10 %의 정상염소혈청(normal goat serum, NGS)에서 블로킹(blocking) 시킨 후, 형광 표지와 접합된 Griffonia simplicifolia lectin(GS-lectin)(Vector. Lab., oratories Inc, CA)와 함께 밤새 인큐베이션시켰다.
세척 후, 세포 핵을 가시화 하기 위하여 망막을 DAPI로 대비염색시켰다. 전체 봉입 시료(whole-mount preparation)를 얻기 위하여 망막을 방사-이완(radial-relaxing) 절개로 평평하게 놓았다. 일부의 경우, 주사된 세포의 추적을 위하여, 형광 간섭(fluorescence interference)을 방지하기 위하여, 혈관 염색 없이 블로킹만을 수행하였다. 영상을 디지털 카메라 시스템(Nikon, Tokyo, Japan)을 갖추고 Adobe Photoshop CS5소프트웨어를 이용한 정량적 분석을 위하여 윈도우 PC로 연결된 현미경을 이용하여 얻었다.
(4) 동물모델의 망막으로부터 RNA의 분리 및 역전사효소-PCR의 수행
RNA를 세포 및 망막 조직으로부터 TRIzol 제제(Invitrogen)를 제조사의 지시에 따라 이용하여 분리하였다. 망막 RNA를 9 한배 새끼(litter)의 하나의 눈의 망막으로부터 추출하였다. 샘플의 총 정제된 RNA로부터 100 ng를 SuperScriptTM III(Invitrogen)를 이용하여 cDNA로 변환하고, 모든 cDNA 샘플을 -80 ℃에서 보관하였다. 페시지 5의 인간 골수 MSC(hBM-MSC)의 RNA 및 인간 지방질 MSC(hAdipo-MSC)의 RNA를 Porf. Hyung-Min Chung(CHA University, Korea)부터 얻었다. 역전사효소-PCR은 AccuPower PCR PreMix(Bioneer)의 20 ㎕ 반응 용량(reaction volume)으로 수행되었다
(5) 정량적 실시간 PCR
실시간 PCR은 LightCycler(Roche) 내에서 SYBR-Green 반응 키트(Roche, Lewes, UK)를 제조사의 지시에 따라 수행하였으며, 하우스키핑 유전자와, VEGF, TGF-β PEDF, 및 Ang-1의 유전자의 상대적 발현을 결정하였다. 프라이머 서열은 표 3에서 나타낸다. 상대적 유전자 발현 데이터의 분석은 CT(comparative threshold cycle method)로 계산하였다. 표적 유전자 발현값은 하우스키핑 유전자의 발현 수준과 대비하여 정규화하였다. 데이터 세트 내의 대조군 발현 값을 표준으로 정하고 다른 샘플의 상대적인 발현 수준을 계산하였다.
표 3 실시간 RT-PCR에서 사용된 프라이머 서열
Gene name Accession No. 5'-forward primer sequence-3' 3'-Reverse primer sequence-5'
mTGF-β NM_011577.1 CAAGGGCTACCATGCCAAC(서열번호 7) AGGGCCAGGACCTTGCTG(서열번호 8)
mPEDF NM_011340.3 GCCCAGATGAAAGGGAAGATT(서열번호 23) TGAGGGCACTGGGCATT(서열번호 24)
mAng-1 NM_009640.3 CCTCTGGTGAATATTGGCTTGGGA(서열번호 25) AGCATGTACTGCCTCTGACTGGTT(서열번호 26)
mGAPDH NM_008084.2 GTGAGGGAGATGCTCAGTGTT(서열번호 13) GGCTGGCATTGCTCT(서열번호 14)
hTGF-β NM_000660.4 AAATTGAGGGCTTTCGCCTTAGCG(서열번호 15) TCTTCTCCGTGGAGCTGAAGCAAT(서열번호 16)
hPEDF NM_002615.5 TATCACCTTAACCAGCCTTTCATC(서열번호 27) GGGTCCAGAATCTTGCCAATG(서열번호 28)
hAng-1 NM_001146.3 CCGTGAATCTGGAGCCGTTTG(서열번호 29) AAGCCCGACAGTCAGTGGAG(서열번호 30)
hGAPDH NM_002046.3 AGGGCTGCTTTTAACTCTGGT(서열번호 21) CCCCACTTGATTTTGGAGGGA(서열번호 22)
(6) 동물모델로부터 절개된 망막 단백질에 대한 ELISA 수행
절개한 망막, 냉각된 스냅(snap frozen)이 프로티나제 억제 칵테일(Sigma-Aldrich)를 포함하는 RIPA 버퍼 내에서 얼음에서 균질화시켰다. 1개의 샘플을 위하여 3마리의 새끼 마우스의 망막 총 단백질이 수집되었기 때문에, 각 군당 9 한배새끼로부터 총 3개의 샘플을 얻었다. 샘플은 10분간 8,000 g으로 4 ℃에서 원심분리하였다. 망막 샘플 및 배양 상청액에서 나타난 TGF-β1을 Human TGF-β1 Quantikine kits(R&D)를 이용하여 제조사의 지시에 따라 분석하였다. TGF-β1의 농도는 표준 샘플과의 비교로 계산하였다. 각 군의 TGF-β1 평균을 3개의 실험으로 나타내었다.
(7) 통계적 분석
통계적 분석은 차 대학 메인프레임 컴퓨터로 the Statistical Analysis System(SAS; SAS Korea, Inc., Seoul, Korea), 버전 Enterprise 4.0을 사용하였다. 데이터는 평균 ± SEM 으로 나타내었고, 모든 통계는 독립 티 검정을 사용하여 계산하였다. 실시간 PCR 데이터는 로우데이터를 사용하여 분석하였다. p 값은 0.05이하를 유의적인 것으로 고려하였다.
<결과>
(1) 인 비보 망막증 조건하에서의 PDC에 의한 사이토카인의 조절의 확인
인 비보에서 PDC의 가능한 영향을 평가하기 위하여, PDC의 처리 후, OIR 모델 마우스의 망막에서의 사이토카인 발현을 분석하였다. PDC를 P12의 각 마우스의 복강 내로 주사하였고, P17에서 망막 조직을 분석하였다. 망막에서의 항-신생혈관 인자 발현이 그 뒤 실시간 PCR에 의해 평가되었다. 인 비트로 데이터와 동일하게, PDC-처리된 마우스의 망막에서, TGF-β 발현이 유의적으로 증가하였다(도 22A). PDC-처리군에서의 PEDF 발현은 대조군과 차이가 없었으며, 망막조직에서 Ang-1 발현은 검출되지 않았다. ELISA 를 이용한 망막 조직 용해물 내의 TGF-β 발현의 정량적 분석은, PDC-처리군에서 TGF-β 수준이 65.23 ± 11.16 pg/ml에 도달한 반면, 대조군에서의 TGF-β 평균 수준은 27.73 ± 3.57 pg/ml임을 나타냈다(p < 0.01; 도 22B). 따라서, TGF-β mRNA 및 단백질 수준의 분석은TGF-β 인 비보의 망막증 조건에서 PDC에 의해 분비된다는 것을 나타낸다.
(2) 망막 혈관신생에 대한 PDC의 영향
뒤이어, 병리적 혈관형성(pathologic angiogenesis)을 감소시키는 PDC의 잠재력을 인 비보에서 실험하였다. 도 23A에서 나타난 바와 같이, PDC의 투여는 대조군에 비하여 OIR 에 의해 유도된 병리적 혈관신생의 정도를 현저히 변화시켰다. 대조군 마우스의 중앙 및 중간주변부(midperipheral) 망막에 풍부한 신생 혈관 다발(neovascular tuft)이 PDC-처리군에서는 미비하게 나타났다(도 23A, 왼쪽 및 중간 패널). 신생혈관다발 부위는 회색으로 나타난다(도 23A, 삽화). 정량적 분석은 대조군에 비하여 PDC-처리군에서 망막내에 신생혈관다발 부위의 억제가 4.73% 이상임을 확인하였다.
일관되게, PDC-처리군의 망막 맥관 구조는 중앙 망막 주변의 희박한 무혈관(sparse avascular) 부위를 제외한, 중간주변부 및 주변부에서 일반적인 형태(morphology) 및 분지(branching)를 나타낸다(도 23C). 혈관 폐색(vascular obliteration) 부분은 회색으로 나타난다(도 23C 삽화). PDC 처리된 마우스의 망막은 PBS 처리된 마우스의 망막에 비하여, 약 10.93 %의 비혈관 부분을 나타낸다(p < 0.001; 도 23D). 이 결과는 PDCs가 신행혈관다발형성을 억제하고 증식적 망막증에서의 정상적인 혈관화 부분(normal vascularized area)을 증가시킨다는 것을 나타낸다.
인 비보에서 TGF-β siRNA의 PDC의 이로운 효과를 무력화시키는 능력을 또한 실험하였다. 이를 위해, 기능적 분석을 TGF-β siRNA로 처리된 PDC사용으로 수행하였다(도 23A, C, 우측 패널). 예상한 바와 같이, TGF-β siRNA 처리된 PDC는 비-침묵화 PDC와 비교하여 신형혈관다발 형성을 억제하는데에 실패하였다(p < 0.001; 도 23B); 그러나, 비처리된 PDC와 TGF-β siRNA 처리된 PDC간의 정상적인 혈관화 부분의 차이가 유의적이지 않음에도 불구하고(p > 0.27; 도 23D), 정상적인 혈관화 부분은 대조군에 비하여 TGF-β siRNA 처리군에서 미비하게 증가하였다(p < 0.06; 도 23D). 이러한 결과는 PDC 처리가 TGF-β 발현을 통하여 망막 신생혈관화를 효과적으로 억제하는 반면, 혈관 폐색에 대한 효과는 TGF-β 무관함을 나타낸다.
(3) 망막 신생혈관화에 대한 가능한 PDC-매개 억제효과
망막 신생혈관화에 대한 가능한 PDC-매개 억제효과를 조사하기 위하여, 복강내 투여된 PDC를 CM-DiI로 표지하고 추적하였다(도 15A). 순환 PDC의 망막 혈관 누출 가능성의 배제를 위하여, PDC가 정맥으로 투여되지 않음이 매우 중요하다. 주사 후 5일 뒤에, 이동한 PDC가 망막에서 검출되었다(도 24, 좌 및 중간 패널). PDC는 망막 신생혈관화 부위에 위치하고, 혈관 그물(vascular network)에 흡수되지 않았으며(도 24, 우측 패널), 이는 PDC가 내피세포 또는 주위세포(pericyte)로 분화되지 않음을 나타낸다. 이러한 결과는 PDC가 사이토카인 분비를 통하여 비정상적 혈관신생을 조절하는 근거리 분비(paracrine) 메카니즘을 뒷받침한다.
실시예 4. 태반 유래 세포로부터 신경 전구세포 유도 및 그의 파킨슨 유도 모델에 대한 기능 손상 개선 효과 확인
<실험 방법>
(1) 인간만삭태반으로부터 hPDC의 분리 및 처리
내과, 산과 또는 외과적 합병증이 없는 정상의, 인간만삭태반(human term placenta)(임신 주수 = 37)를 제왕절개술로 수득하여, 각 태반을 조심스럽게 절개하였다. 회수된 조직의 조각을 PBS로 수회 세척한 뒤, 기계적으로 분쇄한 뒤, 30분간 37 ℃에서, 2 mg/ml의 트립신(Sigma), 20 ug/ml DNase I(Sigma), 1.2 U/ml Dispase(Gibco) 및 1 mg/ml 콜라게나제 IV(Sigma)를 포함하는 Hank's Balanced Salt solution(HBSS, Gibco)로 분해(digest)하였다. 회수한 세포를 10% 소태아혈청(FBS, Gibco) 및 페니실린/스트렙토마이신(Gibco), 25ng/mL FGF4(R&D Systems), 및 1 ㎍/mL 헤파린(Sigma)을 포함하는 Alpha-MEM 배지(Gibco, New York, USA)를 포함하는 T25 플라스크(2 X 105 cells/mm3, Nunc) 내에서 배양하였다. 3일째에, hPDC(human amniotic stem cell)을 트립신화시키고(trypsinized) 혈구 계수기(hemacytometer)를 이용하여 계수하였다.
(2) 인간 ESC, 인간 BM-MSC, 인간 AD-MSC, 인간 태아 NPC의 배양
인간 골수 중간엽 줄기세포(human Bone marrow mesenchymal stem cells, hBM-MSCs, Lonza)를 10 % FBS 및 페니실린/스트렙토마이신 및 100 mM L-글루타민로 보충한 Alpha-MEM 배지에서 37 ℃에서 5 %의 CO2환경에서 배양하였다. 인간 지방 중간엽 줄기세포(Human Adipose mesenchymal stem cells, hAD-MSCs)는 10% FBS 및 페니실린/스트렙토마이신이 보충된 Alpha-MEM 배지에서 37 ℃에서 5% CO2 환경에서 배양하였다. 컨플루언스(confluence)가 80 %에 도달하면, 세포를 트립신화시키고 새로운 배양 디쉬로 옮겼다.
인간 유래 신경 전구세포(neural precursor cell)를 15 ㎍/ml 폴리오르니틴(polyornithine) 및 4 ㎍/m 피프로넥틴이 미리-코팅된 배양 디쉬에 30,000 cells/cm2의 밀도로 도말하였다. 세포는 1ug/ml 토코페롤 및 1ug 토코페롤 아세트산 및 20 ng/ml의 인간 상피 성장 인자(EGF), 20 ng/ml 인간 섬유아세포 성장인자(FGF-2; 종전 기본 섬유아세포 성장인자) 및 2 % B-27 마이너스-AO 보충물로 보충된 DMEM/F12(Gibco)에서 배양하였다. 배양물은 37 ℃에서, 5% CO2, 92% N2 및 3% O2 조건의 다습환경에 위치시켰다.
(3) 유세포 계수 분석, 정량적 PCR 및 면역블롯팅 분석
유세포 계수 분석(Flow cytometry analysis): 표현형 분석을 위하여, 세포를 FACS 버퍼내에서 20분간 4 ℃에서 적적한 농도의 하기 항체와 함께 염색하였다: FITC-표지된 항- SSEA4, TRA-1-81, CD90, CD34 및 PE-표지된 항- TRA-1-60, CD9, CD44, CD13(BD Pharmingen). 세포의 세척 후, Cell Quest 소프트웨어를 이용한 FACS Calibur(Becton Dickinson)으로 분석하였다.
정량적 역전사 PCR: TRIzol(Invitrogen)를 이용하여 총 RNA를 세포로부터 분리시켰다. 1 ㎍ 의 총 RNA로부터 Superscript II 역전사효소, Oligo-d(T) 12-18 프라이머, DTT, 및 dNTPs를 제조사의 프로토콜에 따라 이용하여, cDNA를 합성하였다. RT-PCR를 Pre-Mix 키트(Bioneer)를 이용하여 수행하였다. 사용된 프라이머는 표 1에 나타냈다. PCR 생산물을 RedGel(Biotium,Inc) 를 이용한 2 %의 아가로스겔 전기영동하였고, UV- 트랜스일루미네이터(transilluminator)로 가시화하였다.
면역블롯팅 분석: 세포를 저온의 PBS로 세척하고, 프로테아제 억제 칵테일(Pierce)을 포함하는 용해 버퍼로 용해시켰다. 총 세포 용해물이 Bradford 시약(Bio-Rad)에 의해 정규화하고, 30~50 ㎍의 용해물을 8 ~ 12 % SDS-PAGE에 적용하고 PVDF 막(Milipore)로 이동시켰다. 막은 5% 탈지유(Becton Dickinson)를 포함하는 TBS-T(50mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.05% Tween-20)내에 블록킹(block)하였고, 각 항체로 조사하였다. 면역반응은 ECL Western Blotting system(Milipore, Amersham)를 이용하여 수행하였다.
(4) hPDC의 NPC에 대한 배양 시스템
hPDC를 10% FBS(Gibco), 각각 100 ㎍/mL의 페니실린 및 스트렙토마이신(Gibco), 25ng/mL FGF4(R&D Systems), 및 1 ㎍/mL 헤파린(Sigma)이 보충된 알파-MEM에 배양하였다. 신경 유도를 위하여, 고밀도 세포 배양방법(high cell density culture method)가 세포간의 상호작용을 증가시키기 위하여 사용되었다. 세포는 15 ug/mL 폴리오르니틴(Sigma) 및 4 ㎍/mL 피브로넥틴(Sigma)로 코팅된 디쉬에 10,000 cells/cm2 밀도로, 플레이트의 중앙에, 총 플레이드 공간의 약 1/3으로 시작하는 세포 스포팅(spotting)으로, 도말하였고, 뒤이어 세포를 25ng/mL FGF4 및 1 ㎍/mL 헤파린을 포함하는 완전 배지에서 6일간 37 ℃, 5 % CO2환경에서 인큐베이션하였다.
(5) 인간 PDC의 분화 잠재력의 분석
지방세포성 분화(Adipogenic differentiation): 세포를 6-웰 배양 디쉬에 of 1.5 X 104 cells/ cm2의 밀도로 시딩하고 100 % 밀집도에 도달하기 까지 10 % FBS(Gibco)가 보충된 고 글루코스 DMEM(Gibco)에 배양하였다. 뒤이어 세포에 대하여 지방세포성 유도 배지(1 mM 덱사메타손(Sigma), 0.5 mM 3-이소부틸-1-메틸-잔틴(Sigma), 10 ng/mL 재조합 인간 인슐린(Sigma), 100mM 인도메타신(Sigma), 10% FBS로 보충된 고-글루코스 DMEM) 및 지방세포 유지 배지(10 ng/mL 재조합 인간 인슐린 및 10% FCS가 보충된 고-글루코스 DMEM)를 이용하여 각각 7일간 연속적으로 3 사이클의 유도/유지를 수행하였다. 분화 후, 세포를 10 % 포르말린으로 고정하고, 세포질 내의 유적(oil droplet)의 생산을 확인하기 위하여, 실온에서 5분간 2%(wt/vol) Oil Red O 제제(Sigma)로 염색하였다.
골원성 분화(Osteogenic differentiation): 세포를 3 X 103 cells/cm2 밀도로 시딩하고, 10% FBS(Gibco)가 보충된 고 글루코스 DMEM(Gibco)에 70-80 % 밀집도에 도달할 때 까지 배양되며, 뒤이어 2.5 주 동안 주 당 2회씩 골원성 유도 배지(100nM 덱사메타손(Sigma), 10mM β-글리세로포스파트(Sigma), 0.2mM 아스코르브산염(Sigma), 및 10% FBS을 보충한 IMDM 기본 배지(GIBCO)를 공급하였다. 골원성 분화는 실온에서 15분동안 10 % 포르말린으로 세포를 고정하고, 하이드록시에퍼타이트 메트릭스(hydroxyapatite matrix)의 축적(deposition)을 증명하는 von Kossa 염색으로 염색하는 것을 이용하여 검출하였다.
연골성 분화(Chondrogenic differentiation): 연골성 분화를 유도하기 위하여, 처음 세포(3 x 103 cells/cm2)를 시팅하고, 15-mL 폴리프로필렌 튜브에 이동시키고, 각 튜브의 바닥에 펠렛 마이크로매스(pelleted micromass)를 형성하기 위해, 5분간 1000 rpm에서 원심분리하였으며, 최종적으로 연골성 배지(0.1 M 덱사메타손, 50g/mL AsA, 100g/mL 소듐 피루빈산염, 40g/mL 프롤린, 10 ng/mL TGF-1(Peprotech), 6.25 g/mL 인슐린, 6.25 g/mL 트랜스페린, 6.25 ng/mL 아셀렌산, 1.25 mg/mL BSA, 및 5.35mg/mL 리놀레산 (TGF-1을 제외한 나머지 모두 Sigma 사 제품)이 보충된 고-글루코스 DMEM)을 처리하였다. 배지는 주 2회 교체하였으며, 연골형성을 매주 분석하였다. 배양 후 2-4 주 후, 세포를 PBS로 2회 세척하고, 4% PFA에 고정하고 Alcian Blue로 염색하였다.
(6) FGF4의 후속반응의 억제
FGF4 후속 반응(downstream) 억제를 위하여, hPDC를 디메틸 설폭사이드(DMSO) 중 5 μM ERK 억제 U0126 또는 10 μM JNK 억제 SP600125(Calbiochem)로 선처리하거나 선처리하지 않은 10% FBS를 포함하는 알파-MEM 배지에 1시간 동안 배양한 뒤, 25ng/mL FGF4으로 3일 동안 자극하였다. Notch 신호의 억제를 분석하기 위하여, ASC가 50 μM Notch 억제 DAPT(N-[N-(3,5-difluorophenacetyl)-1-alanyl]-S-phenylglycine t-butyl ester, Sigma)로 선처리하거나 선처리 하지 않은 10% FBS를 포함하는 알파-MEM 배지 내에 1시간 동안 배양하고, 25 ng/mL FGF4로 3일간 자극하였다.
(7) 세포의 면역세포화학적 분석
세포를 처음 실온에서 15분간 4 %의 PFA로 고정하고, 20분 동안 0.1% Triton X-100로 투과성화(permeabilize)하였으며, 그 뒤 10 % 정상 염소 혈청(normal goat serum, NGS)으로 블로킹(blocking)하였다. 하기의 일차 항체를 사용하였다: 항-뉴론 classIII β-튜블린(Tuj1), -Nestin(Covance), -Ki-67(Novocastra), -SOX2, -NANOG, KLF4, Brachyury/Bry(모두 Abcam), OCT3/4, GATA4(모두 Santa Cruz). 세포를 Alexa Fluor 488 또는 594-접합된 항체(Molecular Probes)와 함께 1시간동안 실온에서 인큐베이션 시키고, 세포 핵을 확인하기 위하여 4', 6-diamino-2-phenylindole(DAPI, PBS 내 2mg/mL)로 염색시켰다. 커버-슬립(cover-slip)를 유리 슬라이드 위에 봉입하였다. 세포를 형광 현미경 또는 공초점 형광 현미경(LSM 510 confocal microscope, Zeiss)을 이용하여 기사화하였다.
(8) 동물 실험
실험동물 모델의 준비 및 처리
암컷 성체 Sprague-Dawley 렛트(220-250 g)를 실온(22-23 ℃) 표준 12시간 명/암 사이클(오전 7시에 밝힘)로 사육하였으며, 음식과 물에 대한 비제한적인 접근이 가능하도록 하였다. 실험 절차는 실험동물관리위원회의 동물관리 가이드라인에 따라서 수행하였다.
6-히드록시도파민 병변 및 이식
렛트를 rumpun(1.5 mg/kg)을 포함하는 케타민(4.5 mg/kg, i.p.)을 이용하여 마취시켰다. 렛트의 우측 내측전뇌속(medial forebrain bundle, MFB)에 9 ㎍ 6-OHDA 및 0.2 mg/mL L-아스코르브산을 양쪽 정위 주사(bilateral stereotaxic injection)로 26-게이지 Hamilton 주사기를 이용하여 투여하였다: 문측-후측(anterior-posterior, AP) -4.4, 내측-외측(medial-lateral, ML) -1.2, 등측-배측(dorsal-ventral, DV) -7.8, -2.3 에서 tooth bar set 및 AP -4.0, ML -0.8, DV -8.0, 3.4에서 tooth bar set; 모든 브레그마(bregma)에서 밀리미터 적응(adjustment)으로 나타낸다(Paxinos et al., 1997, Espino et al., 1995, Kim et al., 1998). 삽입한 바늘을 5분 뒤에 각 부위에서 철수시켰다. 6-OHDA 주사후 4 주 뒤에, 렛트의 암페타민-유도된 회전 비대칭(rotational asymmetry)을 실험하였다. 회전 수치는 자동화된 로터미터(rotameter) 장치(Med Associates Inc., St. Albans, VT, USA)를 이용하여 90 분간 모니터하였다.
세포 이식을 위하여, 병변의 동측으로 6 회전/분의 렛트를 하기의 4개 중 하나로 배속시켰다: 위대조군(n=11), hPDCs(n=9), hPDCs-NPC(n=8), 및 hES-NPC(n=4).주사일에, 세포를 트립신화하고, PBS로 세척한 후 계수하였고, 3 ㎕의 세포 상청액(PBS 내의 1.5 x 105 cells/㎕)를 22-게이지 바늘로, KDS310 나노 펌프(KD Scientific Inc., Holliston, MA, USA)를 이용하여 동측 선조체(ipsilateral striatum)에 5분 이상 주입하였다. 케타민(4.5 mg/kg) 및 rompun(1.5 mg/kg)으로 유도한 마취 하에서, 세포 또는 염을 두 부위(브레크마 및 경막(dura)에 대하여 AP, ML 및 DV로(1) 0.07, -0.30, -0.55;(2) -0.10, -0.40, -0.50)에 위치시켰다. 10분 후 각 부위에서 바늘을 제거하였다. 위대조군을 포함하는 모든 동물에게 면역억제제인 염으로 희석된 사이클로스포린 A(10mg/kg, Chongkundang Pharmaceutical Corp.)를 이식한 다음날부터 시작하여 이식 후 2주까지 복강내(i.p.)로 투여하였다. 투여량은 실험에 끝날 때까지 5 mg/kg 감소시켰다.
동물모델 뇌 조직의 처리, 면역조직화학 및 면역형광
동물을 세포 이식 또는 염의 주사 후 1, 6 또는 12 주에 펜토바르비탈(pentobarbital)(3 mL/kg)에 의한 마취로 안락사시킨 뒤, 0.05 M 인산염 버퍼 중 4% PFA를 경심관류(transcardially)로 관류시켰다. 뇌를 제거하구, 후-고정하며, 동결보존(cryoprotect)하였다. 면역조직화학을 종래 기술된 바에 따라, 뇌 전체를 포함하는 자유-유동적 동결절편기-절편(free-floating cryomicrotome-cut section)(40 ㎛ 두께)에서 수행하였다. 0.05M PBS 내에서 3 % H2O2 에서 인큐베이션 후, 0.1 M PBS내의 0.3 % Triton X-100 및 3 % BSA에 인큐베이션하고, 절편은 도파민작동성 뉴런(1:200 TH from Abcam)을 인식하기 위한 일차 항체와 함께 4 ℃에서 밤새 염색하였다. The Vectastain Elite ABC 키트(Vector Laboratories., Burlingame, CA, USA)를 이차 항체로 사용하였다. 조직은 형광 현미경 또는 공초점 형광 현미경(LSM 510 confocal microscope, Zeiss)으로 가시화하였다.
대안적으로, 상기와 같이 수득한 자유-유동적 40-㎛ 절편을 하기의 일차 항체와 함께 4 ℃에서 밤새 염색하였다: SOX2(1:200; Chemicon), Nestin(1:200; Chemicon) 및 DCX(1:200; Cell-Signaling Technology). 조직을 PBS로 3 회 세척하고, 2시간 동안 이차 형광-접합 염소 항-마우스 또는 항-토끼 항체(DAKO, Denmark, Cy3, FITC, both diluted 1:1,000)과 2시간 동안 인큐베이션시켰으며, 최종적으로 세척하고 Vectorshield 내로 봉입하였다. 모든 조직 샘플은 추가적으로 DAPI로 대비 염색하였다. 조직은 형광 현미경 또는 공초점 형광 현미경(LSM 510 confocal microscope, Zeiss)으로 가시화하였다.
행동 분석
6-OHDA 파킨슨모델에서 대조군(n=11), hES-NPC(n=4), hPDC(n=9) 및 hPDCs-NPC(n=8)의 4개의 군에 대하여 하기의 행동 실험을 수행하였다.
회전 실험: 5 mg/kg 암페타민(Sigma) 의 복강내 주사 후에, 회전 행동을 자동 로타미터 시스템(rotameter system)(Med Associates Inc.)을 이용하여 90분간 측정하였다. 동측(ipsilateral) 회전의 수를 세포 이식 전 7일 전에 및 이식 후 3, 7 및 9주 후에 계산하였다.
실린더 실험: 자발적 움직임(spontaneous movement)은 동물을 투명한 실린더(높이, 40 cm; 직경, 20 cm)에 위치시키는 것으로 측정하였다. 자발적활동을 5분간 비디오로 기록하였다. 총 6개 패턴의 움직임(왼쪽 앞다리 접촉, 오른쪽 앞다리 접촉, 양 앞다리의 최초 왼쪽 접촉, 양 앞다리의 최초 오른쪽 접촉, 양 앞다리 접촉, 몸만을 일으킴)을 렛트의 자발적 움직임의 관찰로 평가하였다. 앞다리 스텝의 수를 측정하였다.
로타로드 실험: 가속 로타로드 실험을 렛트의 ACCELER 로타로드 쳇바퀴를 이용하여 수행하였다. 3분간 고정된 속도(4 rpm)에 적응 후, 로드의 회전 속도가 5분간 4 rpm의 최초 속도에서 50 rpm으로 선형 증가하는 수평의 플라스틱 로드에 위치시켰다. 각 쥐가 로드 위에서 걷기 균형을 유시할 수 있는 시간을 측정하였다. 로드 회전 시간을 세포 이식 후 21, 22, 23, 및 42 일에 계산하였다.
(9) 동물 모델의 선조체에 대한 웨스턴 블롯
단백질 추출물을 수득하기 위하여, 렛트를 이식 또는 염 주입 후 6주째에 경추 파열법(cervical dislocation)으로 희생시키고, 빠르게 선조체(striatum, ST) 및 흑질(subtantia nigra, SN)를 절개하였다. 샘플을 400 ㎕의 빙온의 용해 버퍼(50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% Triton X-100, 0.5% 소듐 데옥시콜산, 0.1% SDS 및 0.02% 소듐 아지드)내에서 방사선처리(sonicate) 하였다. 용해물의 단백질 농도를 Bradford 시약을 이용하여 결정하였다.
웨스턴 블롯 분석을 위하여, 샘플(10-20 ㎍ 단백질)을 12 % 도데실황산나트륨(sodium dodecyl sulfate)-폴리아크릴아미드(polyacrylamide) 전기영동 겔에 로딩시켰다. 분리 후, 단백질을 나이트로 셀룰로스 막에 블롯팅하고 1시간동안 0.1% Tween-20, 5% 탈지유 및 0.2% BSA를 포함하는 TBS(Tris-buffered saline) 내에서 실온에서 교반하였다. 교반 후, 막을 0.1% Tween-20를 포함하는 TBS 내에서 일차 항체(토끼 모노클로날 항 -TH; Biotechnologies Santa Cruz, CA. USA; 1:1000)와 함께 1시간 동안 실온에서 인큐베이션 하였다. 홀스래디쉬 페록시다아제(horseradish peroxidase, HRP)-결합된 이차 항체(항-토끼; 1:1000)를 이용하여 일차 항체를 검출하였고, 결합된 이차 항체는 강화된 화학 발광((Amersham Biosciences, Buckingghamshire, UK)에 의해 가시화되었다.
(10) 테라토마 형성 분석 및 핵형 분석을 통한 안전성 실험
테라토마 형성 어세이: 6 주령의 6 BALB/c-nu Sic 수컷 마우스(Central Lab. Animal Inc, Korea)에 21-게이지 바늘을 이용하여 좌우 양쪽 고환에 10 ㎕ 배양 배지 내의 5 X 105 cell를 이식하였다. 이식 후 8, 12 또는 48 주에, 마우스를 희생하고 고환을 10 % 포르말린에 고정하였다. 모든 조직 분석을 위하여 파라핀 블록 내에 넣고, 블록을 10-15 ㎛로 절단하였고, 결과 슬라이드를 헤마톡시린 및 에오신으로 염색하였다.
핵형 분석: 핵형분석(Karyotyping)을 Cytogenomic Services Facility of Samkwang Medical Laboratories를 이용하여 수행하였다. 핵형의 분석을 위하여, 1-2 시간동안 0.05 ㎍/mL 콜세미드(colcemid)를 이용하여 세포분열을 중기에서 블로킹하였다. 염색체를 G-band염색으로 가시화하고, 100개 이상의 중기 세포를 분석하였으며, 최소한 3개를 핵형 분석하였다.
(11) 통계적 분석
통계적 분석을 차대학 메인프레임 컴퓨터에서 Statistical Analysis System(SAS; SAS Korea, Inc. Seoul, Korea), 버전 Enterprise 4.0.를 이용하여 수행하였다. TH+ 세포의 수를 T-검정 또는 이원분산분석과 차후 LSD-사후 검정을 이용하여 분석하였다. 행동 어세이를 위해서, 회전 실험, 로타로드 및 실린더 검사의 평균값을 종속 변인(dependent variable)으로 이용하고, "처리"(위대조군, hPDCs, hPDCs-NPC, 및 hES-NPC이식군)를 독립변인(independent variable)으로 이용하였다. 분산과정(variance procedure)(SAS, PROC MIXED)의 혼합 모델 분석을 렛트의 임의 요인(random effect)를 고려하기 위하여 사용한다.
<결과>
(1) 인간 만삭 태반의 hPDC의 특징 분석
태반 양막으로부터 분리한 hPDC를 몇몇의 인비트로 어세이를 이용하여 특정하였다. 분리된 세포의 핵형분석으로 인간 태아 기원 (도 25A), 및 중간엽 세포를 강하게 연상시키는 매우 납작하고 비대칭 방추-모양의(asymmetrical spindle-shaped) 형태의 보유를 확인하였다 (도 25B). hPDC의 성장곡선은 인 비트로에서 축적된 세포의 양이 세포 패시지가 증가함에 따라 급격하고 일정하게 증가한다는 것을 증명하였고, 이는 세포의 활발한 증식을 나타낸다. hPDC의 배가시간은 31시간이고, 집단 배가수(population doubling level, PDL)은 32일까지 지속된다(도 25C, D). 세포계수(Flow cytometry)는 hPDC가 MSC-관련 표면 마커 CD44(94.3 ± 3.7 %), CD13(84.1±7.1%) 및 CD90(84.0±7.5%)에 양성적이고, 조혈줄기세포 마커인 CD34에 음성적임을 나타낸다.
일부 줄기세포 표면 마커가 신선하게 분리된 hPDC에서 나타난다(도 25E). 세포는 SSEA-4(97.0±1.4 %) 및 TRA-1-60(56.9±19.3%), 및 TRA-1-81(50.5±17.7 %)을 포함하는 배아 줄기세포(Embryonic stem cell, ESC)의 다른 표면 마커를 발현하였고, SSEA-1를 발현하지 않았다. CD9(99.8±0.1%)의 검출은 세포가 영양막(trophoblast)으로부터 유래하지 않았음을 확인하였다(도 25E). 인간 ESC 및 ASC 둘다, OCT-3/4, NANOG, KLF4, 및 SOX2을 포함하는, 다분화(pluripotent) 줄기세포의 특징인 유전자의 mRNA를 발현하였다(도 25G). 그러나, hPDC의 면역조직화학 프로파일은 이 세포가 SOX2에만 양성 반응성이고, OCT 4, NANOG, 및 KLF4 단백질은 전혀 없다는 것을 나타냈다(도 25F).
또한, 면역 블롯팅을 이용하여, 신선하게 분리된 hPDC에서 OCT4, NANOG, 및 KLF4의 단백질 수준이 검출되지 않은 반면(도 25H), hPDCs에서 4개의 유전자, KLF4, OCT-3/4, NANOG 및 SOX2에 대한 mRNA의 발현은 검출되었다(도 25G, H). H9 세포는 알카리성 인산가수분해효소 활성을 나타내었지만, hPDC는 아니었다 (도 25I). 추가적 특징으로 hPDC는 지방세포(adipocyte), 조골세포(osteoblast) 및 연골세포(chondrocyte)와 같은 중간엽-계통 세포로 분화할 수 있는 능력을 나타내었다(도 26A).
(2) FGF4에 처리에 따라 증가되는 hPDC의 Nestin 양성 세포
신경 유도 잠재력을 조사하기 위하여 bFGF, EGF, 및 FGF4를 포함하는 일부 성장인자를 실험하였다. NPC의 마커인 Nestin 및 Musashi1의 발현 수준이 다른 두 조건(10 ng/mL EGF 또는 10 ng/mL bFGF로 처리)에 비하여 25 ng/mL FGF4로 처리하였을 때 훨씬 높았다(도 26B). 뒤이어, FGF4가 hPDC의 증식으로의 운명에 영향을 미치는지 여부에 대해서 조사하였다. 이에 따라, 각기 다른 용량의 FGF4(10 ng/mL, 25 ng/mL, 및 50 ng/mL)의 3 일간의 처리가 hPDC의 NPC의 전형적 마커인, Nestin 발현에 영향을 미치는지를 조사하였다.
25ng/mL FGF4에서 Nestin의 가장 높은 mRNA 발현 수준을 얻었다(도 27A). 면역블롯팅으로 측정한 Nestin 단백질의 발현도 유사하게 증가하였다(도 27B). 분화 3일째에, FGF4(25ng/mL)가 배지에 존재하는지 여부에 따라, Nestin-발현 세포의 수가 유의적으로 상이하였다 (독립적 배양의 7 세트에서 계수된 총 세포, p < 0.0001)(도 27C, D). SSEA-4, TRA-1-60, 및 TRA-1-81의 발현 또한, FGF4가 처리되지 않은 대조군 배양물에서보다 FGF4가 처리된 배양물에서 더 낮은 반면(도 28), CD9, CD90, CD13, 및 CD44는 FGF4 처리 배양물에 유지되었다.
(3) hPDC의 FGF4 후속적 신호 전달의 확인
FGF4의 후속적으로 hPDC의 신경 분화를 활성화할 수 있는, 미토젠-활성화된 단백질 카이나제(MAPK; ERK 및 JNK을 포함)와 같은 세포내 신호활성을 조사하였다. FGF4-처리 또는 미처리된 세포에서, 72시간 동안의 활성화(인산화)형태의 신호분자의 단백질 수준 변화를 측정하였다. pERK(인산화된 ERK) 수준의 즉각적 증가가 12 시간에서 관찰되었고, FGF4의 처리 후 24시간 동안 pERK의 수준이 점진적으로 증가하였다.
또한, 또 다른 FGF4의 주요한 후속 신호 물질인 pJNK의 수준이 FGF4 처리의 12시간 동안 급격하게 증가하였다. 흥미롭게도, FGF4-처리세포에서 12시간의 시점에서, pERK1/2 및 pJNK가 가장 높은 수준이었고, 12시간에 Nestin 발현의 현저한 증가가 검출되었다(도 27E). FGF4에 의한 Nestin 발현의 유도가 FGF4/ERK 신호 전달(signaling) 또는 FGF4/JNK 신호 전달에 따르는 것인지 분석하기 위하여, hPDC에 FGF4 투여 1시간 전에 ERK 신호 전달 억제제인 5mM U0216 또는JNK 신호전달 억제제인 20mM SP600125를 투여하였고, ERK인 산화 및 JNK 인산화를 72시간 시점에서 분석하였다. 특이적 억제제인 U0126(ERK 신호전달) 및 SP600125(JNK 신호전달)에 의한 FGF4-MAPK 신호전달의 억제는 Nestin 단백질 수준의 감소를 야기하였다(도 27F, G). 그룹간에 유의적인 차이가 존재하였다(ERK 억제 실험에서 F(3,23)=11.56, P < 0.0001, ERK 및 JNK 억제 실험에서 F(3,23) = 137.22, P < 0.0001). 5mM U0216의 존재하에 47.61 ± 3.46의 총 세포가 Nestin+ 이고, 20mM SP600125 존재하에서 48.47 ± 3.07의 총 세포가 Nestin+ 인 반면(DMSO 내 보다, 각각, P < 0.004 및 P < 0.006), DMSO 내에서는 68.19 ± 4.2이었다.
대조적으로 Ki-67+ 증식 세포(Ki-67+ proliferating cell)의 비율은 5 mM U0216 존재하에서 낮은 반면(총 DAPI+ 세포에서 % Ki-67+cells: 5 mM U0216 에서 64.46 ± 2.14, 및 DMSO 내에서 67.3 ± 2.39; P < 0.0001, n = 6), 20 mM SP600125의 존재하에서 보다 유의적으로 감소하였다(총 DAPI+ 세포에서 % Ki-67+cells: 20 mM SP600125내에서 37.53 ± 1.89 in 20 mM SP600125(P < 0.0001 DMSO처리군과 비교하여, n=6))(도 27 G, H). 이러한 데이터는 FGF4로 유도된 ERK 신호전달이 신호 유도에 특이적이지만, Ki67+ 증식 세포에는 영향을 주지 않는 반면, FGF4-JNK 신호 전달은 Nestin 뿐만 아니라 Ki-67의 발현에 영향을 미치는 것으로 보인다.
(4) DLL1 발현 증가로 인한, 높은 수준의 NPC로 유도된 세포-세포 접촉
신경세포의 수율 및 순도를 증가시키는 방법을 조사하기 위하여, 신경/뉴런 유도에의 일부 세포-대-세포 접촉(contact)수준의 효과가, 세포-세포 접촉을 향상시키는 상이한 세포 밀도 조건에서 실험되었다. 이에 따라, FGF4를 포함하는 배지에서 배양된 hPDC를 "High-Density(HD) 배양 시스템"으로 명명되는, 형태적으로 구형 응집체를 형성하기 위하여, 플레이트에 스포팅(spotting)하였다. 일반적으로, 세포의 형태적 변화는 세포 이동, 분화 및 다세포 조직의 발달에서 특정 구조의 형성을 동반한다.
HD 배양 시스템 내(10×세포밀도) 또는 정상 배양 조건(10×세포밀도) 의 FGF4-처리 hPDC를, hPDC 세포의 분화과정에서의 형태의 변화를 시각화할 수 있는, 위상차 현미경(phase contrast microscopy)을 이용하여, 24시간 동안 타임 랩스(time-lapse) 디지털 이미지로 영상화 하였다(도 29, 도 30A). 또한 25ng FGF4를 포함하는 배지에서 정상 및 HD 배양 간의 Nestin/Ki-67 및 Nestin/TUJ1의 3일간의 발현 수준을 비교하였다. 일반적으로 Nestin-면역반응성 세포는 분화기 중에 점진적으로 증가한다(도 30B, C). 도 30B에서 나타난 바와 같이, 12시간에서, Nestin+ 세포가 10x 밀도로 HD로 배양된 hPDC에서 관찰되었으며; 이것은 상이한 조건의 군 간에 가장 높은 비율이었다.
첫날에, HD로 배양된 1×밀도의 hPDC가 정상 배양의 세포보다 미세하게 높은 비율로 Nestin+ 세포를 나타내었으며, 어떠한 HD도 5 x 밀도를 나타내지 않았다. 반면, 10 x 세포밀도에서, Nestin+ 및 TUJ1+ 세포 수의 급격한 증가가 관찰되었다. 신경 유도 3일 후, 10 x 밀도의 HD 방법으로 배양된 hPDC은 Nestin+ 세포의 가장 높은 수준을 증명하였다. 더욱이, 10 x 밀도의 HD 방법으로 배양된 hPDC는 신경 유도 3일 후, TUJ-1 가장 높은 발현을 나타냈다.
증식에 관하여, 10×밀도에서 배양된 세포는 HD 또는 정상 배양 하의 1×밀도로 배양된 세포에 비하여, Ki-67의 증가된 발현을 증명하였다. 첫날에 비하여 3일째에 모든 군에서 급격한 증가를 관찰할 수 있었다. 그러나, HD 방법의 10×밀도의 세포 성장은 감소하였다(도 30B). 도 30C에서 나타난 바와 같이, 단백질 면역블롯팅은 사용되는 배양 방법에 무관하게, 세포 밀도가 증가함에 따라, Nestin 및 TUJ-1의 상대적 발현도 꾸준히 증가하는 것을 입증한다. 동일한 세포 밀도(1×밀도)에서, Nestin mRNA, Musashi mRNA, 및 TUJ1 mRNA의 수준은 정상 및 HD 분화 조건하에서 일반적으로 증가하였다. HD 조건은, 정상 배양조건하의 발현 수준에 비하여, 3일째에 Nestin mRNA 약간의 수준 증가를 유도하고, 6일째에는 Nestin을 강력하게 증가시키는 반면, 정상 성장 조건에 비하여 HD 조건 하에서 Musashi mRNA 및 TUJ1 mRNA의 수준의 증가가 현저하지 않았다(도 30D). 더욱이, Nestin, Muhashi, 및 TUJ1단백질 수준은 세포 밀도에 비례하여 3일째에 모든 배양 조건하에서 현저하게 증가하였다(도 30E, F(1,12 ) = 68.84, P < 0.0001, n=3).
놀랍게도, Nestin 단백질의 수준은, HD 조건하에서 3개의 상이한 세포 농도에서 정상 조건에 비하여 높았으며(정상 조건하에 비하여, 1x에서, P = 0.0001, 5x에서 p = 0.002, 및 10x에서 P = 0.0004) HD 배양 조건에서 10x세포 밀도에서 최대치에 도달한다(도 30F, G). 3개의 상이한 세포 농도에서, TUJ1 단백질 수준의 동일한 패턴이 관찰되었고(정상 조건하에 비하여, 1x에서, P = 0.0007, 5x에서, p = 0.004, 및 10x 에서 P = 0.01), HD 배양 조건에서 10x 세포 밀도에서 최대치에 도달하였다(도 3F, I). Musashi1 단백질 수준은 세포 밀도 비례적으로 증가하였으며(F(1,12)=16.15, P < 0.001, n=3), 즉, Musashi1의 단백질 수준이 1x 내지 10x 정상 배양 조건에서 증가(정상 조건에서 1x 부터 5x 까지 P<0.0001 및 5x 부터 10x 까지 P<0.0001)하고, 5x 내지 10x의 HD 배양 조건에서 Musashi1 의 단백질 수준이 증가하였다(HD 배양 조건에서 5x 부터 10x까지 P < 0.0001)(도 30F, H). 이에 비해, PCNA 단백질 수준은 HD 배양조건하에서 조금 감소하였다(도 30F, J).
(5) 세포-세포 상호작용의 신경 유도 메커니즘의 확인
세포-세포 상호작용의 신경 유도 메커니즘을 더 조사하기 위하여, 일부 Notch 수용기 및 리간드(ligand)의 mRNA 발현을 RT-PCR을 이용하여 hPDC 및 hPDC-NPC에서 측정하였다. 처음에, mRNA 수준을 정상 배양 조건에서 배양된 hPDC와 HD 배양조건에서 유도된 hPDC-NPC 간에 비교하였다. 모든 배양조건에서, FGF4를 포함하는 동일 배지가 3일 동안 사용되었다. RT-PCR 분석은 hPDC가 모든 인간 Notch 수용체인 Notch1, Notch2, Notch3, Notch 4는 모두 발현 하며, Notch 리간드는 DLL1, DLL3및 JAG2를 발현하며, DLL4, JAG1는 발현하지 않는다는 것을 나타냈다(도 31 A). 특히, DLL-1 리간드의 발현 수준은 정상적으로 배양된 세포에 비하여 HD 배양된 hPDC-NPC에서 훨씬 강력한 반면, JAG2 리간드 및 Notch 수용기의 발현은 두 배양간에 변화가 없으며, 이는 DLL1가 최적의 신경/뉴론 유도에 중요한 인자임을 나타낸다.
DLL1 신경 전달이 어떻게 전사인자를 조절하는지를 검사하기 위하여, 신경계통(neural lineage)의 발달을 조절하고, HES1, HES5, MASH1, NEUROD, 및 NGN2를 포함하는 간세포(progenitor)를 발생시키는, bHLH 단백질의 유전자 발현 패턴을 평가하였다. 반-정량적(Semi-quantitative) RT-PCR은 MASH1 및 NEUROD의 발현 수준이 정상 배양보다 HD 배양에서 증가한다는 것을 나타냈다. HES1의 발현은 정상 및 HD 배양물 모두에서 검출되었다. HD 배양 방법에서, HES1의 발현은 세포 밀도가 증가함에 따라 감소하는 반면, DLL1의 수준은 세포 밀도가 증가함에 따라 증가한다. HES1이 신경발생을 억제하는 음성 bHLH 전사 인자이고, DLL-1가 세포-세포 상호작용을 통해 신경 또는 뉴런 발생에 필수적임을 고려해볼 때, 세포-세포 상호작용의 개선이 신경/뉴런 유도를 증가시길 가능성이 매우 높다(도 31B).
이를 더 확인하기 위하여, Notch 억제제 DAPT(N-[N-(3,5-difluorophenacetyl)-1-alanyl]-S-phenylglycine t-butyl ester)의 효과를 이용하여, hPDC의 배양 동안 신경/뉴런 유도 조건(FGF4를 포함하는 HD)하에서 DLL1의 결합이 Notch를 블록하는지 여부를 조사하였다(도 31C). 신경 유지에 대한 DAPT 억제제의 효과를 분석하기 위하여, DLL, Nestin, TUJ의 유전자 발현이 DAPT 처리된 세포 및 DMSO 처리된 세포에서 측정되었다.
DAPT 처리된 세포에서 DMSO 처리된 세포에 비하여 DLL1, Nestin, 및 TUJ1가 유의적으로 낮은 수준으로 발현하였다(각각 P=0.009, P=0.003, 및 P=0.02, 각각 n=3). DLL1 신호전달의 상승-조절을 DLL1-FLAG 및 DLL1-Fc를 이용하여 더 측정되었다. hPDC 배양에서 FGF4를 수반한 DLL1-FLAG 및 DLL1-Fc의 처리 3일 후, 재조합 DLL1 단백질은 DLL1(DLL1-Flag에서 P=0.0005 및 DLL1-Fc에서 P=0.0002 for DLL1-Fc, 각각 n=3), Nestin(DLL1-Fc 에서 P=0.01, 각각 n=3), 및 TUJ1(DLL1-Flag 에서 P=0.05 및 DLL1-Fc에서 P=0.03, 각각 n=3) 유전자의 mRNA 수준을 상승-조절하였다. 이러한 결과는 세포-세포간 상호작용을 통한 DLL1의 수준이 hPDC의 신경/뉴런 분화를 유도하는 중요한 인자임을 나타낸다(도 31D).
FGF4 노출이 다른 계통 세포를 증가시키는지 여부를 시험하기 위하여, 면역조직화학적 어세이를 수행하였다. Brachyury 및 Desmin, 중배엽 마커는 발현하지 않았고, 내배엽 마커인 GATA4는 FGF4 노출여부와 관계 없이 발현하였다(도 32).
(6) 골수, 및 지방조직으로부터 유도된 MSC 및 태반 유래 세포의 신경 유도 잠재력의 비교
이 발명을 통한 신규한 신경 유도 방법이 다른 종류의 성체 MSC에 적용가능한지를 더 조사하기 위하여, 성체 인간 골수 MSC(BM-MSCs) 및 지방조직 유래 MSC(AD-MSC)를 3일 동안 정상 조건 또는 HD 조건하에서 25 ng/mL FGF4의 존재 또는 부존재하에서 최초 배양되었다. FGF4를 수반한 정상 또는 HD 배양은 Nestin+ 세포를 현저하게 유도(FGF4 부재한 배양 조건과 비교하여 모든 조건 하에서 Ps < 0.0001, 각 실험에서 n = 7)함에도 불구하고, FGF4 포함 FGF4 배지에서의 다른 성체 MSC 에 비하여 hPDC에서 Nestin+ 세포 비율이 가장 높았으며(F(3,84)=602.5, P < 0.0001, n=7), 이는 양성 대조군으로 사용한 태아-NPC와 비교할 만하였다. 정상 방법으로 배양된 hPDC와 HD 방법으로 배양된 hPDC 간에 Nestin+수가 가장 큰 차이를 나타냈으며, 이는 hPDC로부터 유래되 세포가 FGF4 신경 유도에 매우 민감함을 나타낸다(P < 0.0001, n=7). 태아 NPC의 신경 유도는 FGF4에 거의 영향을 받지 않았다(도 31G, H). 시험된 세포의 반-정량적 RT-PCR 분석은 두 성체 MSC 내에서 DLL1가 mRNA로 거의 또는 전혀 존재하지 않았음을 증명한다; 그러나 hPDC 내의 DLL1 수준은 "HD" 배양 조건 하에서만 증가하였고, 태아 NPC는 강력한 DLL1 발현을 나타냈다(도 32I).
(7) 선조체 이식 부위(striatum graft site)의 이식된 hPDC-NPC의 특정
인간-특이적 인간 핵(HN) 마커로의 직접적 면역조직화학 염색을 이용하여 뇌 절편에서 이식 부위를 쉽게 인식하였다. HN-면역반응적 세포는 이식 후 1주일 후에 수직의 바늘 경로(vertical needle tract) 주변에 관찰되었다(도 33A). 이식 후 1 주일 후에서, HN+세포의 거의 대부분이 SOX2를 동시발현하였다(도 33B). 이식 후 약 1 및 6주에서 Nestin+ 세포는 HN+ 세포와 공동-표지(co-labeled) 되었다(도 33C). 이식후 1 주 후 다른 배엽 마커, 예를 들면 BRA(중배엽), Desmin(중배엽), 및 c-KIT(내배엽)은 검출되지 않았다. 이식 후 6주 뒤에, 이동 마커인 DCX에 양성인 세포들은 선조체에 분포되었다. 일부 DCX+ 세포는 HN로 공염색되었다(도 33D). 일부 TH+ 세포 역시 HN 와 공발현되었으며, 이는 이식된 hPDC-NPC가 선조체 부위에서, 신경 및 특히 TH+ 뉴런으로 분화함을 나타낸다. 더욱이, 일부 세포는 AADC에 양성이었다(도 33E, F).
(8) hPDC-NPC 이식에 따른 기능 손상 개선 효과 확인
실험적으로 유도된 파킨슨 증상을 나타내는 hPDC, hPDC-NPC(HD 조건군), H9-NPC, 및 위대조군의 4 군의 렛트가 행동 어세이에 사용하였다. 운동 손상(motor impairment)의 정도 또는 이식 전 및 이식 후 3, 6, 및 9주 후의 4군의 동물에서의 개선 정도를 평가하기 위하여 암페타민-유도 회전 행동이 측정되었다(도 34A). 그룹간 및 시간간의 현저한 상호영향이 관찰되었다(F9, 117 = 1.30, P < 0.04). 이식 후 6 및 9주에서, hPDC-NPC군은 위대조군과 유의적으로 상이하였으며(각각 P < 0.03 및 P < 0.003) 동측 회선 행동이, 위 대고군과 비교하여 볼때, hPDC 및 hPDC-NPC군에서 각각 20 % 및 30 % 감소하였다. hPDC-NPC가 이식된 렛트에서, 암페타민-유도 동측 회전은 3주부터 9주까지 계속적으로 감소하였다.
H9-NPC군에서는, 비 대칭적 행동이 6주에서는 약 20 % 낮았지만, 9주에서 약 10 %였다. MFB 의 일방적 병변(unilateral lesion)은 비-손상된 발의 사용이 우선적이다. 비대칭적 행동을 확인하기 위해 사용되는 또 다른 실험인, 실린더 실험이, 투명한 실린더에서의 손상된 앞다리의 사용을 평가하기 위하여 수행되었다(도 34B). 손상된 앞다리 터치 수의 유의적인 효과가 관찰되었다(F3, 32 = 2.52, P < 0.05).
hPDC-NPC가 이식된 렛트에서는 위대조군에 비하여 손상된 앞발다리의 현저히 증가된 이용을 증명하였다(P < 0.05). 최종적으로, 로타로드 실험을 이용하여 운동 기억을 분석하였다. 가속화된 로드에서 떨어지는 잠재기(lactency)를 측정하였다. 이 실험은 단기기억 및 장기기억 실험으로 분리하여 진행하였다. 단기기억을 측정하기 위하여, 첫날의 3회의 시도가 분석되고, 시도간의 차 경사(slope difference)가 분석되었다. hPDC-NPC가 이식된 렛트는 잠재기의 점진적 증가를 보였고, 3회의 시도 동안에 로드 위에서 유의적으로 많은 시간을 보냈다(p < 0001, 도 34C).
장기 기억 시험에서, 이식 후 21일 및 42일 후부터 시작하는 3일간의 연속일 동안 동물을 동일한 실험을 수행하였다. 기간내의 차 경사(slope difference)가 동물이 어떻게 실험을 수행하는지를 기억하는 시간을 나타낸다. hPDC-NPC 군 및 hESC-NPC군의 잠재기는 위대조군 및 hPDC군에 비하여, 3일간의 연속일 전반에 걸쳐, 더 길었다(Ps < 0.001). 42일째에, HD 조건하에서 배양된 hPDC-NPC가 이식된 군이 다른 군에 비하여 나은 로타로드 수행을 나타낸 반면, 로드 위에서 보내는 시간은 미비하게 감소하였다(Ps < 0.0001, 도 34D).
평형상태에서(equilibrium state)에서, 특이적 결합 위치에서의 좌우 선조체로의 DAT-리간드 결합 및 비특이적 결합 위치에서의 소뇌로의 DAT-리간드 결합을 정량하기 위하여 세포 이식후 9주후PET 분석을 수행하였다. 위대조군은 도파민적 손상 모델(dopaminergic impairment model)의 18F FP-CIT PET였다. 도파민적 손상모델의 BP는 6-OHDA 투입 부위(우측 선조체)에서0.06이고, 정상 부위(좌측 선조체)에서 2.70였다. ASI는 1.91였다(도 34E. 좌측). hPDC-NPC 세포 이식 후, 증가된 방사성 핵종(radionuclide)의 흡수(uptake)가 선조체 부위에서 검출되었다.
태반 유래 세포 투입 부위(우측 선조체)에서 BP는 1.75이고, 정상 부위에서 2.75였으며, ASI는 0.44였다(도 34E. 중간). 정상 대조군에서, 선조체내의 BP는 2.89(좌측 선조체) 및 2.95(우측 선조체) 이고 ASI는 0.02였다(도 34E. 우측). hPDC의 이식 후, 가시적 평가에 따르면, 선조체 부위의 평균수가 유의적으로 높았다. 18F FP-CIT PET를 이용한 분자 이미징은 6-OHDA가 투입된 부위에서 선조체 병변(striatal lesion)에서 감소된 방사능을 나타냈다. 그러나, 세포 이식 후, BP가 유의적으로 증가하였고, ASI는 유의적으로 감소하였으며, 이는 DAT 터미널 내의 FP-CIT의 회복을 나타낸다. 최종적으로, 세포 이식후, 선조체 및 SN에서의 도파민성 뉴런의 인 비보 생존을 평가하기 위하여 TH 단백질 수준을 측정하였다. 이식 후 6 주 뒤에, TH 단백질은 손상되지 않은 선조체 및 손상되지 않은 SN에서 검출되었으며, hPDC -주사군 또는 위-대고군에서의 병변화된 선조체 또는 병변화된SN에서는 검출되지 않았다. 놀랍게도, TH 단백질은 hPDC-NPC 주사군에서는 병변화된 선조체 및 SN에서 매주 관찰되었다(도 34F).
hPDC-NPC가 테라토마를 형성하는지 여부를 검사하기 위하여, hPDC-NPC가 SCID 마우스에 이식되었다. 6주 및 32 주에서 테라토마 형성은 관찰되지 않았다(도 35A, 및 B).
실시예 5. 인간 태반 유래 세포의 노화 억제의 효능 검증
5.1. In vitro 연구
인간 유래 노화된 세포들 (senescent cells)과 인간 태반 유래 세포 (human placenta derived cells: hPDCs)와의 공배양을 통해 hPDCs의 항노화 효과를 검증하였다.
(1) 노화된 사람의 폐에서 유래한 세포주와 태반 유래 세포와의 공배양
세대주의 진행에 따른 노화된 사람의 폐에서 유래한 세포주 (LL-24: 17-23 세대)와 인간 태반 양막에서 분리한 태반 유래 세포와의 공배양을 통해 LL-24의 노화 (senescence)에 대한 본 발명의 세포의 영향을 확인하였다. 구체적으로 17, 20, 23 세대의 LL-24를 LL-24를 위한 배양액 조건에서 hPDCs (5세대 이하)의 분비된 물질들이 통과할 수 있는 (hPDCs는 격리됨) 챔버 (transwell chamber)에서 4일간 공동 배양을 한 후, 배양된 LL-24를 수집하여 세포 증식 및 세포 노화의 분자생물학적 마커를 분석하였다.
그 결과, hPDCs와 공동 배양된 계대별 (p17, p20, 그리고 p23) 섬유아세포가 공동 배양하지 않은 섬유아세포에 비해 1) 노화 마커인 베타 갈락토시데이즈 (SA-b-galctosidase assay)의 감소, 2) 세포 수의 증가를 확인하였다 (도 37).
또한, 공동 배양된 LL-24에서 대조군에 비해 세대별 세포 증식 마커인 1) PCNA, Cyclin D1과 2) 항노화 마커인 Sirt1의 발현의 증가, 4) 노화의 주된 요인인 활성 산소의 발생을 억제하는 항산화 효소인 SOD2 발현양의 대폭 증가, 5) 여러 타깃 유전자의 후생학적 발현 조절자인 Tet1의 발현의 증가를 확인하였으며, 6) 웨스턴 블롯을 통해 Sirt1, PCNA등의 증가와 노화 마커인 p16 단백질이 공배양시 감소함을 확인하였다 (도 38). 하지만 그러한 차이들은 세대가 진행됨에 따라 감소됨이 보여줘, hPDCs에 의한 노화 억제 효과가 타깃 세포의 연령 및 세대에 따라 변함을 알 수 있었다.
(2) 인간 유래 신경전구세포 (human neural precursor cells: hNPCs ) 와의 공배양
18세대까지 배양된 hNPCs를 hNPCs의 배양 조건에서 hPDCs에서 분비된 물질이 통과될 수 있는 챔버에서 4일과 6일 동안 공배양을 한 후, hNPCs의 노화 관련 마커, 세포증식 마커, 노화를 촉진시키는 활성 산소 (reactive oxygen)의 조절 인자들, hNPCs의 특성 유지에 관련하는 후생학적 마커 (epigenetic markers)와 주요 기작인 Wnt 신호물질의 발현을 조사하였다.
그 결과, hNPCs의 경우 세포 계대 배양 기간이 길고 (~14일), 증식 속도가 느린 관계로 4일과 6일 동안의 hPDCs와의 공배양이 세포의 증식과 세포 증식 마커 등의 변화를 유발하지 못하는 것으로 확인되었다. 또한 p16과 같은 노화 마커의 발현에 차이가 나지는 않았지만, 강력한 노화 유발 요인인 활성 산소 생성을 억제하는 효소들, catalase, SOD2, GPx1,의 발현이 6일 동안 공배양 시 증가하였으며, 특히 SOD2의 경우 4일 동안 공배양에도 다른 효소들에 비해 크게 증가하였음을 확인하였으며, hNPCs의 특성 유지 및 조절에 관여하는 후생학적 마커들인 DNMT3a, DNMT3b, TET1등이 공배양 시 소폭의 증가를 보여주고 있으며, hNPCs의 증식 및 분화에 관여하는 WNT신호의 억제 펩타이드인 SFRP1의 발현이 공배양시 증가함을 확인하였다 (도 39).
5.2. In vivo 연구
자연 노화된 쥐 (>18개월령)를 이용한 자연 노화의 과정과 기작을 연구하며 인간 태반 유래 세포의 최소 1차례 이상의 투여 후 다양한 행동 실험과 조직들의 분자 생물학적 그리고 생화학적 분석을 통해 본 발명의 태반 유래 세포의 노화 조절 작용과 항노화 기작을 연구하였다.
(1) 자연 노화된 쥐를 이용한 태반 유래 세포의 항노화 효능성 확인
18-20개월 된 C57BL/6쥐들에게 6주 간격으로 10,000개의 인간 태반 유래 세포 (hPDCs) 또는 대조군으로 같은 부피의 생리 식염수를 꼬리에 있는 혈관을 통해 주입한 후 생존율과 함께 인지 기능의 변화를 알 수 있는 행동 실험 등을 진행하였다.
그 결과, 동일 연령대 (18-20개월령)의 생리 식염수가 투여된 쥐에 비해 또는 인간 태반 유래 세포를 6주 간격으로 투여 한 쥐의 경우, 1) 투여 시점으로부터의 24-25개월령 사이의 생존율이 증가하였으며 (도 40), 2) 훈련 후 지정된 장소 (probe)를 찾아가는 능력으로 인지 기능을 확인하는 모리스 워터메이즈 실험 (Morris Water Maze)에서 3차례 투여 후 지정된 장소로 찾아가는데 걸리는 시간, 지정된 장소를 찾아가는 빈도, 그리고 지정된 장소가 위치한 구역에서 머무르는 시간 등의 향상으로 대조군에 비해 인지 기능이 향상되었음을 보여주었다 (데이터 미표시). 이와 함께 4) 한정된 공간에서 움직임을 보여주는 시간이 3차례 세포 투여 후 식염수가 투여된 대조군에 비해 향상되어 hPDCs에 의한 운동 기능의 향상을 확인하였다.
또한 hPDCs를 3차례 투여된 노화 쥐에서 뇌의 인지 기능 조절에 중요한 역할을 하는 뇌 부위인 해마체 (hippocampus)를 분석하여 본 발명의 세포에 의한 해마체의 노화 진행을 확인해 본 결과, 태반 유래 세포가 투여된 쥐에서 보여준 인지 기능의 향상 결과와 마찬가지로 p16, HMGA2, p57등의 노화 관련 마커들의 발현이 3차례 세포가 투여된 23개월령의 노화 쥐 (multi-cell group)에서 같은 연령대의 대조군에 비해 억제되었음을 확인하였다. 하지만 18개월 된 1차례 세포가 투여된 쥐 (single cell group)에서는 대조군에 비해 차이가 나지 않았다. 3개월 된 어린 쥐 (young group)에 비해 모든 노화된 쥐들에서 p16과 p57의 발현이 증가하였음을 확인하였다. 뇌에서의 면역 기능과 신경세포의 활동을 조절하는 성상세포 (astrocytes) 경우 노화 진행과 함께 증가하는데 18개월 된 노화 쥐에 hPDCs의 1차례로 같은 연령대의 대조군에 비해 감소됨을 확인하였으나, 23개월된 노화 쥐의 경우 그 효과가 작아지는 것을 보여주었다. 조직 내에서 에너지 대사와 산화 스트레스 마커인 UCP2와 SOD2의 발현은 유의적이지는 않지만 감소하는 경향을 보여주었다 (도 40).
또한 외부에서 투여된 태반 유래 세포에 의한 해마체의 치아 이랑 (dentate gyrus) 내의 자체 신경 줄기세포에 의한 신경세포의 분화에 대한 영향을 조사하였다. 면역 항체 염색 방법 (immunohistochemistry)을 통하여 3차례 hPDCs가 투여된 23개월 된 노화 쥐의 전 성숙 단계 (Tuj1)와 성숙 단계 (NeuN)에의 신경세포의 분포는 같은 연령대의 대조군에 비해 태반 유래 세포에 의한 큰 변화가 없음을 확인하였다.
이어서 신경 세포의 노화 및 신경 전달 기능을 조절하는 희소 돌기 세포 (oligodentrocytes)의 분화의 hPDCs에 영향을 조사하였다. oligodendrocytes와 그 세포에 의해 분비되는 단백질, myelin은 신경 세포의 축삭(axon)을 둘러싸 신경전달 기능을 조절하고 oligodendrocytes와 myelin의 파괴는 노화 관련 신경 질환과 밀접한 관계가 있다고 보고되었다. 면역 항체 염색 방법을 통하여 oligodendrocyte의 전구세포 (NG2)의 분포가 hPDCs를 3차례 투여된 23개월령의 노화 쥐에서 같은 연령대의 대조군에 비해 증가하였음을 보였으며, 그 차이는 성숙된 oligodendrocytes (MBP)에서 더 크게 나타났다. 특히 MBP에 의한 염색되는 세포들의 경우 태반 유래 세포가 투여된 노화 쥐에서 구조적으로 그리고 발현 양의 차이가 나타나, oligodendrocytes 분포 및 기능의 차이가 태반 유래 세포에 의한 인지 기능의 향상과 신경 활동의 증가의 원인이 될 수 있을 것으로 보였다.
(2) 태반 유래 세포 투여된 노화 쥐의 해마체의 전사체 분석 (RNA sequence analysis)
hPDCs가 투여된 23개월 된 노화 쥐의 해마체 (hippocampus)의 전사체 (transcripts)를 분리하여 태반 유래 세포에 의한 유전자의 발현 차이를 전사체 분석 기법 (RNA sequence analysis: Rseq analysis)을 통하여 분석하였다. 어린 쥐들에 비해 23개월 된 노화 쥐의 해마체는 다양한 면역 기능에 관련된 많은 유전자들의 발현이 유의적으로 1.5배 이상의 차이가 나는 것으로 보이며, 이는 노화에 따른 면역 기능의 변화와 일치함을 보여주었다 (표 4). 태반 유래 세포가 3차례 투여된 23개월령의 노화 쥐의 경우 같은 나이의 대조군에 비해, 신경 세포의 증식과 분화, 포도당 대사, 생합성 및 면역 기능의 조절과 관련된 많은 유전자들이 유의적으로 (p-value<0.05) 1.5배 이상의 차이 보여 주었다 (표 5). 표 4 및 표 5에서 제시된 유전자들은 우의적 차이에 있어서 가장 높은 순위에 있는 대표적 유전자들로, 보다 많은 유전자들의 발현이 태반 유래 세포 투여에 의해 영향을 받았음을 확인하였다.
표 4 3개월 어린 쥐와 23개월 노화된 쥐의 해마체에서의 전사체 비교
Term Count PValue Benjamini
GO:0006955~immune response 25 8.97E-10 1.14399E-06
GO:0006952~defense response 16 0.000215 0.128061949
mmu04060:Cytokine-cytokine receptor interaction 11 0.001047 0.093787922
GO:0050830~defense response to Gram-positive bacterium 4 0.002262 0.618256899
GO:0050766~positive regulation of phagocytosis 4 0.002262 0.618256899
GO:0050764~regulation of phagocytosis 4 0.002888 0.602504662
GO:0009991~response to extracellular stimulus 7 0.004447 0.679390626
GO:0006954~inflammatory response 9 0.004627 0.627056618
GO:0030888~regulation of B cell proliferation 4 0.005871 0.658148649
GO:0016064~immunoglobulin mediated immune response 5 0.006023 0.61844242
GO:0019724~B cell mediated immunity 5 0.006725 0.615829076
GO:0009595~detection of biotic stimulus 3 0.006814 0.582046828
GO:0045807~positive regulation of endocytosis 4 0.006965 0.55549258
GO:0009611~response to wounding 11 0.007065 0.529456684
GO:0002684~positive regulation of immune system process 8 0.010021 0.627882589
GO:0002449~lymphocyte mediated immunity 5 0.011562 0.65353014
GO:0002252~immune effector process 6 0.015431 0.73363622
GO:0009620~response to fungus 3 0.016101 0.725976354
GO:0002250~adaptive immune response 5 0.016205 0.70662904
- 위 유전자 목록은 어린 쥐에 비해 노화 쥐에서 유의적으로 1.5배 이상의 발현 차이를 보여주는 유전자에 해당함.
표 5 3차례 hPDCs가 투여된 23개월 노화된 쥐와 같은 연령의 대조군의 해마체에서의 전사체 비교
Term Count PValue Benjamini
GO:0045927~positive regulation of growth 4 0.003494621 0.944318731
GO:0008284~positive regulation of cell proliferation 7 0.004460707 0.84184154
GO:0035270~endocrine system development 4 0.007066515 0.857752987
GO:0009309~amine biosynthetic process 4 0.007340905 0.781210752
GO:0021532~neural tube patterning 3 0.007473213 0.709952571
GO:0045165~cell fate commitment 5 0.008424757 0.687550171
GO:0015758~glucose transport 3 0.010092495 0.697452119
GO:0021915~neural tube development 4 0.010433485 0.660949255
GO:0042401~biogenic amine biosynthetic process 3 0.010802181 0.630493477
GO:0021983~pituitary gland development 3 0.010802181 0.630493477
GO:0008645~hexose transport 3 0.011533309 0.615967271
GO:0015749~monosaccharide transport 3 0.012285632 0.604312019
mmu04080:Neuroactive ligand-receptor interaction 6 0.015403555 0.494916026
GO:0021536~diencephalon development 3 0.018124928 0.715641565
GO:0050863~regulation of T cell activation 4 0.021056125 0.74089527
GO:0042127~regulation of cell proliferation 8 0.026862326 0.799031687
GO:0030917~midbrain-hindbrain boundary development 2 0.026938855 0.777306661
GO:0009792~embryonic development ending in birth or egg hatching 7 0.028070034 0.769628766
GO:0042398~cellular amino acid derivative biosynthetic process 3 0.028087059 0.749063813
- 위 유전자 목록은 대조군에 비해 세포 투여된 노화 쥐에서 유의적으로 1.5배 이상의 발현 차이를 보여주는 유전자에 해당함
해마체 (hippocampus)에서 분리된 전사체 (transcript)의 분석을 통해 발현의 차이가 보이는 유전자의 관련 기작을 분석하였다. 3개월령의 어린 쥐에 비해 23개월의 노화 쥐들의 해마체애서 면역 관련 기작들과 알츠하이머병과 암종과 같은 질환 관련 기작들은 활성화 되었지만, 신경 시냅스와 촉상 발달, 세포에 신호 전달 체계와 관련된 기작들은 억제되었음을 확인하였다. 3차례 태반 유래 세포가 투여된 노화 쥐의 경우 같은 연령대의 노화된 쥐에 비해 칼슘과 세로토닌에 의한 신호 전달 기작과 신경 세포들 사이의 신호 전달과 관련된 기작들이 활성화되었으며, 리간드와 수용체의 상호 반응 (ligand-receptor interaction)과 관련된 기작들이 억제되었음을 확인하였다. 위의 결과들은 태반 유래 세포에 의한 해마체의 신경 신호 전달 체계의 강화를 통해 인지 기능과 운동 능력의 향상이 이루어졌을 가능성을 암시하며, 이는 태반 유래 세포에 의한 신경계 질환의 발생 억제의 가능성을 나타내는 것이다.
(3) 태반 유래 세포 투여가 투여된 노화 쥐의 혈장을 이용한 대사체 분석 (metabolomic analysis)
본 연구에서는 태반 유래 세포 투여로 인한 인지 기능의 향상과 신경 신호 전달계의 활성화를 발견하여, hPDCs 주입에 따른 대사체의 변화와 노화 및 항노화 기작의 변화와의 상호 작용을 조사하였다. 같은 연령대의 대조군에 비해, 3차례 hPDCs가 투여된 23개월 노화 쥐들은 리놀레산과 알파-리놀렌산 대사, 판토테네이트와 CoA합성, 스핑고리피드와 글리세로포스포리미드 대사, 그리고 아라키돈산 대사등 신경 세포의 기능과 퇴행성 뇌질환과 관련성이 보고된 대사체에서 유의적 차이를 보임. 특히 스핑고리피드 등의 지방 대사체와 대사기작은 희돌기교세포(oligodendrocyte)에 의해 분비되어 신경 세포의 촉상들 (axons)을 둘러싸 신경 신호 전달을 조절하는 myelin의 합성과 관련이 있어 대조군과 태반 유래 세포가 투여된 23개월 된 노화 쥐에서 발견된 대사체의 차이와 MBP에 의해 염색되는 세포의 구조와 MBP의 발현 차이의 상관 관계의 일부분을 설명할 수 있다. 이와 더불어 강력한 노화 유발인 활성산소종의 제거 작용을 하는 베타-알라닌과 글루타치온 대사 관련 대사체가 같은 연령대의 노화 대조군에 비해 3차례 세포가 투여된 노화 쥐에서 유의적으로 차이가 나타나는 것을 보여주었다. 전분 및 수크로스 대사, 아르기닌 및 프롤린 대사, 퓨린 대사와 같은 에너지 및 기초 대사, 단백질 및 유전체 합성, 및 활성질소 생성 조절에 관련된 대사체들도 유의적으로 차이를 나타냈다.
hPDCs가 3차례 투여 된 노화 쥐에서의 대사체 변화를 조사함고 동시에, 노화 돈 쥐에서의 태반 유래 세포 투여에 따른 단기적 영향을 조사하기 위해 태반 유래 세포가 1차례 투여된 18개월 된 노화 쥐의 혈장을 분리하여, 같은 연령대의 대조군 비교하였다. 23개월의 노화 쥐들과 유사하게 리놀레산과 알파-리놀렌산 대사, 판토테네이트와 CoA합성, 아라키돈산 대사등 신경 세포의 기능과 항산화 작용을 하는 베타-알라닌과 글루타치온 대사 관련 대사체에서 유의적 차이를 보였다. 23개월 된 노화 쥐와 달리, 아미노산 대사 관련 대사체와 부타노에이트와 스테로이드 호르몬 등 지방산 대사 관련 대사체에서 1차례 hPDCs가 투여된 쥐와 같은 연령의 대조군들 사이에 유의적 차이를 보였다. 이와 더불어, 유전체 안정성 유지에 도움을 주는 텔로미어의 길이에 영향을 주는 프로파노에이트와 생체내 독성을 유발할 수 있는 셀레노아미노산 대사, 그리고 인지 기능 저하와 노화를 유발하는 AGE (advanced glycation end products)로 불리는 단백질 변성을 막는 비타민 B6 대사 관련 대사체에서 유의적 차이를 보여, 이는 노화 억제 및 신경 질환 예방의 태반 유래 세포 투여를 통한 단기적 효과의 가능성을 제시하였다.
결론적으로, 상기 실험들을 통해 노화 쥐에 hPDCs의 한차례 이상의 투여는 노화 쥐의 인지와 운동 기능의 향상을 유발하고, 노화 및 신경 질환과 관련된 다양한 유전자의 발현과 대사 기작 및 그 기작의 대사체 분포에 영향을 주어 노화 및 신경계 질환의 억제 및 예방의 효과를 가지고 있음을 확인할 수 있었다.

Claims (13)

  1. C3 또는 C1r 보체 단백질을 분비하는 태반 유래 세포.
  2. 청구항 1에 있어서, 추가로 EPPK1, PTX3, EEF1A1, LGALS3BP, FLJ53478, PXDN 및 TGFβ로 이루어진 군으로부터 선택되는 하나 이상의 단백질을 분비하는 태반 유래 세포.
  3. 청구항 2에 있어서, 상기 세포는 CD 9+, CD13+, CD 90+ 및 CD200+ 인 것인 태반 유래 세포.
  4. 청구항 1에 있어서, 상기 C3 또는 C1r 보체 단백질이 0.1 내지 1000 pg/ml/1x106 cell로 발현되는 것인 태반 유래 세포.
  5. 청구항 1에 있어서, 상기 태반은 양막, 융모막, 탈락막 및 탯줄 또는 이들의 조합을 포함하는 것인 태반 유래 세포.
  6. 청구항 1 내지 4 중 어느 한 항에 따른 태반 유래 세포를 포함하는 신경질환 치료 또는 예방용 약학적 조성물.
  7. 청구항 6에 있어서, 상기 신경질환은 알츠하이머병, 파킨슨병, HIV 치매, 간질, 정신분열증, 우울증, 조울증, 신경 발생장애, 자폐증, 뇌졸중, 루게릭, 헌팅턴병, 다발성경화증, 뇌손상, 뇌성 마비 또는 척수 손상인 것인 약학적 조성물.
  8. 청구항 7에 있어서, 상기 신경질환은 알츠하이머병인 것인 약학적 조성물.
  9. 청구항 1 내지 4 중 어느 한 항에 따른 태반 유래 세포를 포함하는 혈관신생 관련 질환 치료 또는 예방용 약학적 조성물.
  10. 청구항 9에 있어서, 상기 혈관신생 관련 질환은 암, 당뇨병성　망막증, 미숙아　망막증, 각막 이식 거부, 신생혈관 녹내장, 홍색증, 증식성　망막증, 건선, 혈우병성 관절, 아테롬성 동맥경화 플라크 내에서의 모세혈관 증식, 켈로이드, 상처 과립화, 혈관 접착, 류마티스 관절염, 골관절염, 자가면역 질환, 크론씨병, 재발협착증, 아테롬성 동맥경화, 장관 접착, 캣 스크래치 질환, 궤양, 간경병증, 사구체신염, 당뇨병성 신장병증, 악성 신경화증, 혈전성 미소혈관증, 기관 이식 거부, 신사구체병증, 당뇨병 또는 관절염인 것인 조성물.
  11. 청구항 10에 있어서, 상기 혈관신생 관련 질환은 미숙아 망막증, 당뇨병성 망막증 또는 증식성 망막증인 것인 조성물.
  12. 청구항 1 내지 4 중 어느 한 항에 따른 태반 유래 세포를 포함하는 노화 감소용 약학적 조성물.
  13. 청구항 1 내지 4 중 어느 한 항에 따른 태반 유래 세포를 포함하는 노화 관련 증상 치료용 약학적 조성물.
PCT/KR2015/011493 2014-10-29 2015-10-29 C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물 WO2016068616A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/523,160 US20180280447A1 (en) 2014-10-29 2015-10-29 Placenta-derived cells excreting c3 or c1r complement and composition containing same
EP15855075.6A EP3214171A4 (en) 2014-10-29 2015-10-29 Placenta-derived cells excreting c3 or c1r complement and composition containing same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0148457 2014-10-29
KR20140148457 2014-10-29

Publications (1)

Publication Number Publication Date
WO2016068616A1 true WO2016068616A1 (ko) 2016-05-06

Family

ID=55857845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/011493 WO2016068616A1 (ko) 2014-10-29 2015-10-29 C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물

Country Status (4)

Country Link
US (1) US20180280447A1 (ko)
EP (1) EP3214171A4 (ko)
KR (1) KR101808762B1 (ko)
WO (1) WO2016068616A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018035454A1 (en) * 2016-08-19 2018-02-22 Memorial Sloan-Kettering Cancer Center Methods of differentiating stem cells into endoderm

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2022025109A1 (ko) * 2020-07-29 2022-02-03

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060234376A1 (en) * 2003-06-27 2006-10-19 Ethicon Incorporated Repair and regeneration of ocular tissue using postpartum-derived cells
US20120177616A1 (en) * 2010-12-22 2012-07-12 Plasalus LLC Methods for augmentation collection of placental hematopoietic stem cells and uses thereof
US20140234277A1 (en) * 2009-03-26 2014-08-21 Depuy Synthes Products Llc hUTC AS THERAPY FOR ALZHEIMER'S DISEASE

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101395266B (zh) * 2005-12-29 2018-06-15 人类起源公司 胎盘干细胞群
WO2008036374A2 (en) * 2006-09-21 2008-03-27 Medistem Laboratories, Inc. Allogeneic stem cell transplants in non-conditioned recipients
AU2007326171B2 (en) * 2006-11-30 2012-11-15 Medipost Co., Ltd. Use of a composition contaning human umbilical cord blood-derived mesenchymal stem cell for inducing differentiation and proliferation of neural precursor cells or neural stem cells to neural cells
BRPI0815946B8 (pt) * 2007-09-19 2021-05-25 Pluristem Ltd artigo de fabricação
EP2331109B1 (en) * 2008-08-22 2013-05-29 Anthrogenesis Corporation Methods and compositions for treatment of bone defects with placental cell populations
EP2367932B1 (en) * 2008-11-19 2019-06-12 Celularity, Inc. Amnion derived adherent cells
CN107699541A (zh) * 2010-04-07 2018-02-16 人类起源公司 使用胎盘干细胞的血管生成

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060234376A1 (en) * 2003-06-27 2006-10-19 Ethicon Incorporated Repair and regeneration of ocular tissue using postpartum-derived cells
US20140234277A1 (en) * 2009-03-26 2014-08-21 Depuy Synthes Products Llc hUTC AS THERAPY FOR ALZHEIMER'S DISEASE
US20120177616A1 (en) * 2010-12-22 2012-07-12 Plasalus LLC Methods for augmentation collection of placental hematopoietic stem cells and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRFVIARIO, FERRUCCIO ET AL.: "Interleukin-1-inducible Genes in Endothelial Cells", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, no. 31, 5 November 1992 (1992-11-05), pages 22190 - 22197, XP002259793 *
JOHNSON, EGIL ET AL.: "Human Umbilical Vein Endothelial Cells Synthesize Functional C3, C5, C6, C8 and C9 In Vitro", SCANDINAVIAN JOURNAL OF IMMUNOLOGY, vol. 33, no. 6, 30 June 1991 (1991-06-30), pages 667 - 671, XP055439058 *
See also references of EP3214171A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018035454A1 (en) * 2016-08-19 2018-02-22 Memorial Sloan-Kettering Cancer Center Methods of differentiating stem cells into endoderm

Also Published As

Publication number Publication date
US20180280447A1 (en) 2018-10-04
EP3214171A1 (en) 2017-09-06
KR20160052377A (ko) 2016-05-12
KR101808762B1 (ko) 2017-12-14
EP3214171A4 (en) 2018-07-11

Similar Documents

Publication Publication Date Title
WO2018101708A1 (ko) 미토콘드리아를 포함하는 약학 조성물
WO2016209057A2 (ko) 신경전구세포의 분비단백체를 유효성분으로 포함하는 허혈성 질환 또는 신경염증 질환 치료용 조성물
WO2018097628A2 (ko) 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
WO2011096728A2 (en) Method for proliferating stem cells by activating c-met/hgf signaling and notch signaling
WO2014181954A1 (ko) 줄기세포의 재생능 향상을 위한 배지 조성물 및 이를 이용한 줄기세포의 배양방법
Niknazar et al. Protective effect of [Pyr1]-apelin-13 on oxidative stress-induced apoptosis in hair cell-like cells derived from bone marrow mesenchymal stem cells
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
WO2019083281A2 (ko) 신규한 근골격계 줄기세포
WO2018048220A1 (ko) 염증 자극된 중간엽 줄기세포를 포함하는 면역질환 또는 염증 질환의 예방 또는 치료용 약학적 조성물
AU2020203955B2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2021034164A1 (ko) 유사교세포로 분화 유도된 후기 단계의 인간 중간엽 줄기세포를 유효성분으로 함유하는 알츠하이머 치료용 약학적 조성물
KR101555981B1 (ko) 태반 유래 중간엽 줄기 세포, 또는 태반 유래 줄기세포로부터 유도된 신경 전구세포, 이를 포함하는 약학적 조성물, 질환 치료용 키트, 및 이를 이용하는 질환 치료방법
WO2016068616A1 (ko) C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물
WO2021071289A2 (ko) 줄기세포능을 증대시키기 위한 조성물 및 이의 용도
WO2021033990A1 (ko) 유도만능줄기세포-유래 중간엽 줄기세포 전구세포로부터 유래된 엑소좀을 포함하는 비알콜성 지방간염의 예방 또는 치료용 조성물
WO2013119026A1 (ko) 줄기세포를 신경세포로 분화시키는 방법
WO2019050350A2 (ko) 줄기세포 유래 세르톨리유사세포, 그 제조방법, 및 그의 용도
WO2018026212A2 (ko) 섬유증 질환 모델의 제조방법 및 섬유증 질환 모델의 용도
WO2022250477A1 (ko) Hla 동형접합 유도만능줄기세포 유래 신경전구세포를 포함하는 뇌졸중 예방 및 치료용 조성물
WO2013162330A1 (ko) 키메라 중간엽 줄기세포군, 그의 제조방법 및 편도줄기세포를 이용하여 부갑상선 호르몬을 생산하는 방법
WO2019190246A1 (ko) 인간 제대로부터 줄기세포를 분리하는 방법
Villageois et al. Regulators of human adipose-derived stem cell self-renewal
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2023090971A1 (ko) 직접교차분화 유도용 조성물 및 이로 처리된 줄기세포
WO2019190175A2 (ko) 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15855075

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015855075

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15523160

Country of ref document: US