WO2018097628A2 - 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법 - Google Patents

신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법 Download PDF

Info

Publication number
WO2018097628A2
WO2018097628A2 PCT/KR2017/013444 KR2017013444W WO2018097628A2 WO 2018097628 A2 WO2018097628 A2 WO 2018097628A2 KR 2017013444 W KR2017013444 W KR 2017013444W WO 2018097628 A2 WO2018097628 A2 WO 2018097628A2
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
neural stem
cells
neurons
mek
Prior art date
Application number
PCT/KR2017/013444
Other languages
English (en)
French (fr)
Other versions
WO2018097628A3 (ko
Inventor
최강열
김미연
한성호
Original Assignee
주식회사 샤인바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3041245A priority Critical patent/CA3041245C/en
Priority to CN202210691469.9A priority patent/CN115025225A/zh
Priority to MX2019006040A priority patent/MX2019006040A/es
Priority to KR1020187017867A priority patent/KR102114017B1/ko
Priority to EP20204059.8A priority patent/EP3800471A1/en
Priority to MYPI2019002759A priority patent/MY194462A/en
Priority to SG11201903725UA priority patent/SG11201903725UA/en
Priority to DK17874605.3T priority patent/DK3425390T3/da
Priority to NZ754020A priority patent/NZ754020A/en
Priority to EP17874605.3A priority patent/EP3425390B1/en
Priority to KR1020187001715A priority patent/KR101892457B1/ko
Priority to KR1020207013080A priority patent/KR20200056465A/ko
Priority to BR112019009711A priority patent/BR112019009711A2/pt
Priority to KR1020217023789A priority patent/KR102519796B1/ko
Priority to EA201990953A priority patent/EA038404B1/ru
Priority to JP2018554751A priority patent/JP6663509B2/ja
Priority to ES17874605T priority patent/ES2848720T3/es
Priority to CN201780003031.4A priority patent/CN109073634B/zh
Application filed by 주식회사 샤인바이오 filed Critical 주식회사 샤인바이오
Priority to AU2017363804A priority patent/AU2017363804B2/en
Priority to US15/897,138 priority patent/US10485802B2/en
Publication of WO2018097628A2 publication Critical patent/WO2018097628A2/ko
Publication of WO2018097628A3 publication Critical patent/WO2018097628A3/ko
Priority to IL266573A priority patent/IL266573B/en
Priority to ZA2019/03226A priority patent/ZA201903226B/en
Priority to PH12019501143A priority patent/PH12019501143A1/en
Priority to US16/545,438 priority patent/US11147816B2/en
Priority to US17/463,219 priority patent/US11701360B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0619—Neurons
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G01N33/4833—Physical analysis of biological material of solid biological material, e.g. tissue samples, cell cultures
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5026—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on cell morphology
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C12N2501/72—Transferases (EC 2.)
    • C12N2501/727—Kinases (EC 2.7.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/08—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from cells of the nervous system
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4709—Amyloid plaque core protein

Definitions

  • the present invention relates to a method of inducing neuronal regeneration comprising administering a MEK 1/2 inhibitor to a patient in need thereof, and a composition comprising a MEK 1/2 inhibitor for use in such a method.
  • MEK 1/2 inhibitors differentiate neuronal stem cells into neurons, protect neurons and neural stem cells from cytotoxicity by beta amyloid, or induce nerve regeneration by both.
  • the present invention also relates to methods of protecting neurons from loss or damage of neurons, comprising administering MEK 1/2 inhibitors, and compositions comprising MEK 1/2 inhibitors for use in such methods.
  • One aspect of the present invention relates to a composition for promoting differentiation of neural stem cells comprising the compound represented by the above [Formula 1].
  • the composition does not involve cancerous growth of neural stem cells.
  • composition for promoting differentiation of neural stem cells induces differentiation from neural stem cells to neurons even in the presence of beta amyloid.
  • Promoting differentiation of neurons by the composition for promoting differentiation of neural stem cells may be due to simultaneously inhibiting MEK1 and MEK2.
  • the composition may include certain MEK 1/2 inhibitors in place of the compound of Formula 1.
  • the composition induces differentiation of neural stem cells into neurons even in the presence of beta amyloid.
  • Another aspect of the present invention relates to a method for differentiating neural stem cells into neurons using the composition for promoting differentiation of the neural stem cells.
  • the differentiation method may be one day to 7 days until the differentiation is completed, after processing the composition for promoting differentiation of the neural stem cells to neural stem cells.
  • Another aspect of the present invention is to provide a method for promoting the differentiation of neural stem cells, in particular in the presence of beta amyloid to protect neural stem cells and nerve cells and to use to differentiate neural stem cells into neurons It relates to a compound.
  • Another aspect of the present invention is also directed to specific MEK 1/2 inhibitors for use in promoting the differentiation of neural stem cells, in particular for differentiating neural stem cells into neurons while protecting the neural stem cells and neurons even in the presence of beta amyloid. It is about.
  • Another aspect of the invention relates to a method of inducing neuronal regeneration comprising administering a specific MEK 1/2 inhibitor to a patient in need thereof.
  • MEK 1/2 inhibitors differentiate neural stem cells into neural cells, protect neural stem cells and neurons from cytotoxicity by beta amyloid, or induce nerve regeneration by both.
  • Most preferred MEK 1/2 inhibitors are compounds of Formula 1.
  • a further aspect of the invention relates to certain MEK 1/2 inhibitors, in particular compounds of Formula 1, for use in inducing neuronal regeneration.
  • a further aspect of the invention relates to compounds of formula 1 for use in the prevention or treatment of neurodegenerative diseases. It also relates to certain MEK 1/2 inhibitors for use in the prevention or treatment of neurodegenerative diseases.
  • Beta-amyloid especially oligomeric beta-amyloid
  • MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
  • rotenone and oxidopamine treating nerve cell damage causing substances such as oxidopamine) glutamate, lipopolysaccharide (LPS), and S100 calcium-binding protein B (S100B);
  • the term “differentiation” means that a cell develops into a specific cell, and specifically, a structure or function is specialized during division and proliferation of cells. Changes in form or function to accomplish a given task. "Differentiation" of neural stem cells is preceded by an asymmetric division in which the parent cell divides into two cells with different characteristics, some of which remain the same stem cells as the parent cell and some of which Differentiation "Differentiation of neural stem cells” includes “proliferation” in that neural stem cells are involved in this asymmetric division process.
  • the term "protection” is to take care of the external stimulus, such as danger or destruction, when given, to take good care of it, and to prevent the proliferation or differentiation of neuronal stem cells without killing nerve stem cells, particularly beta amyloid. It means maintaining the state so that the differentiated neurons can survive.
  • the term “protection” in the present invention encompasses lowering the A ⁇ (1-42) / A ⁇ (1-40) ratio in the brain to protect nerve stem cells and nerve cells from damage caused by beta amyloid ( Majid et al.
  • prevention means any action that inhibits or delays the onset of a neurodegenerative disease by the administration of the pharmaceutical composition according to the present invention
  • treatment means the treatment of a neurodegenerative disease by the administration of the pharmaceutical composition. Any action that improves or beneficially alters the symptoms of a suspicious and onset individual.
  • Japan Tabacco Inc. Applicant discloses the compound of Example 4-1 in WO2005 / 121142.
  • the compound of Formula 1 inhibits both MEK1 and MEK2, which are upstream molecules of ERK, in the mitogen-activated protein kinase / extracellular regulated kinase (MAPK) signaling pathway.
  • MEKINIST® is used as an anticancer agent for melanoma and non-small cell cancer.
  • the compound of Formula 1 may be used in the form of a free base, or a pharmaceutically acceptable salt or solvate.
  • Solvates can be, for example, hydrates or solvates such as dimethylsulfoxide, acetic acid, ethanol, nitromethane, chlorobenzene, 1-pentanol, isopropyl alcohol, ethylene glycol and 3-methyl-1-butanol.
  • the inventors have attempted to establish a composition that induces differentiation into neurons using neural stem cells of a mouse, wherein the compound of [Formula 1] is effectively separated from the brain of a mouse embryo or adult One neural stem cell was found to induce differentiation into neurons.
  • MEK 1/2 inhibitors that can be used in the present invention are substances that induce neural stem cells to differentiate into neurons and at the same time protect neural stem cells and neurons from toxic substances such as beta amyloid.
  • MEK 1/2 inhibitors that can be used in the present invention are as follows: Trametinib, Pimasertib (AS703026), AZD8330, Binimetinib (Binimetinib, MEK162, ARRY-162, ARRY- 438162), Refametinib (RDEA119, Bay 86-9766), PD318088, PD0325901, RO5126766.
  • an aspect of the present invention comprises the MEK 1/2 inhibitor, and for protecting neural stem cells and neurons from beta amyloid, in particular oligomeric form A ⁇ (1-42) while at the same time differentiation of nerve stem cells into neurons To a composition.
  • trametinib, pimasultip (AS703026), AZD8330, binimetinib, refametinib, PD318088, PD0325901, and RO5126766 induce differentiation of neuronal stem cells into neurons and neural stem cells It was confirmed that there is a protective effect of neurons.
  • the compound represented by [Formula 1] has never been used to induce differentiation of neural stem cells into neurons, and MEK1 inhibits activity against both MEK1 and MEK2 through ATP non-competitive binding.
  • / 2 inhibitor but only known as a treatment for melanoma and non-small cell cancer.
  • Another aspect of the present invention relates to a method for differentiating neural stem cells into neurons by using the compound represented by Formula 1 or another specific MEK 1/2 inhibitor.
  • the neural stem cells can be used separately from embryonic and adult brains of animals according to known methods, and can be used by purchasing a commercially available product or cultured according to a conventional culture method, which It is not specifically limited.
  • the neuronal stem cells were isolated from the frontal lobe of mouse embryos at 14.5 days and those isolated from the subventricular zone of 8-week-old mice.
  • the neural stem cells may be inoculated into the culture medium before differentiation and cultured at 37 ° C.
  • the medium for culturing the neural stem cells is not limited as long as it is a serum-free medium composition component to which growth factors are added.
  • the medium is, for example, 90-110 ⁇ M putrescine, 20-40 nM selenite, 10-30 in Dulbecco's Modified Eagle's Medium / Nutrient Mixture F12 (DMEM / F12) (1: 1).
  • the neural stem cells may be, for example, N2 medium (Dulbecco's modified Eagle's medium (DMEM) / F12 (1: 1), 100 ⁇ M putrescine, 30 nM selenite, 20 nM progesterone, 1.55 mg / ml glucose (d-(+)-glucose), 25 ⁇ g / ml insulin, 0.1 mg / ml apo-transferrin, 0.5 mM Glutamax, 100 IU / ml penicillin, Undifferentiated neural stem cells can be obtained by adding a growth factor to 100 [mu] g / ml streptomycin as a component.
  • DMEM Dulbecco's modified Eagle's medium
  • F12 1: 1
  • 100 ⁇ M putrescine 100 ⁇ M putrescine
  • 30 nM selenite 20 nM progesterone
  • Differentiating the cultured neural stem cells into neural cells refers to treating the neural stem cells with a composition for inducing differentiation comprising the compound represented by the above [Formula 1], and differentiating according to methods known to those skilled in the art. For example, it is possible to induce differentiation at 37 ° C by adding a composition for promoting differentiation of the neural stem cells of the present invention to the culture medium in which the neural stem cells are cultured.
  • the neural stem cells before the addition of the composition for promoting the differentiation of the neural stem cells comprising the compound represented by the formula [1] sufficiently secures the cell concentration, or changes the cells such as proliferation, differentiation or death of neural stem cells
  • the culture period of the neural stem cells is the cell concentration It is more preferable that the culture period of at least 1 day and up to 7 days in order to secure enough.
  • the compound represented by [Formula 1] is preferably treated to neural stem cells at a concentration of 1 nM to 20 ⁇ M, when the compound represented by the above [Formula 1] is less than 1 nM, the performance of differentiation induction of neural stem cells is reduced. Problem occurs, and if it exceeds 20 ⁇ M, a problem indicating cytotoxicity occurs.
  • neural stem cells are typically seeded such that each well of the plate is about 70-80% full. For example, 1 ⁇ 10 5 cells per well for 12-well plates and 5 ⁇ 10 5 cells per well for 6-well plates are seeded.
  • the compound represented by [Formula 1] is preferably treated at a concentration of 10 nM to 10 ⁇ M, more preferably 10 nM to 100 nM, if less than 10 nM concentration Since the differentiation rate of the neural stem cells is slowed and the differentiation induction period is long, there is an uneconomic problem, and when it exceeds 10 ⁇ M, the compound represented by the above [Formula 1] is added as an active ingredient in an excessive amount, so that when administered later in vivo Simultaneous inhibition of MEK1 and MEK2, which affect multiple signaling pathways in cells, increases, leading to unwanted reactions that can affect normal cells.
  • Trametinib (10 nM), Trametinib (100 nM), Memantine (5 ⁇ M), Memantine (10 ⁇ M), and AS703026 (10 ⁇ M) were each prepared in the undifferentiated mouse adult neural stem cells obtained in step 1A of Example 2. This is the result when processed at the concentration of.
  • FIG. 8B shows relative mRNA expression of Tuj1 and TH in mouse embryonic neural stem cells which inhibited expression of either MEK1 or MEK2, or both MEK1 and MEK2 using shMEK1 and shMEK2 as part of the results of Experimental Example 5-1 The amount was confirmed, and the result of confirming the expression of each protein through western blotting.
  • FIG. 10 shows the results of Experimental Example 6, FIGS. 10A and 10B show 0.1 ⁇ M, 1.0 ⁇ M, 10 ⁇ M of the MEK 1/2 inhibitors trametinib, AZD8330, PD184352, repametinib, PD318088, binimetinib, and AS703026.
  • Figure 10c is PD0325901, RO5126766 , BI847325, and U0126 were treated with adult neural stem cells, and then observed in the morphology of the cells under a phase contrast microscope (FIG. 10C).
  • FIG. 11 shows the results of Experiment 7, wherein MEK 1/2 inhibitors, trametinib (0.1 ⁇ M), AS703026 (10 ⁇ M), AZD8330 (1 ⁇ M), PD318088, were treated with or without beta amyloid in mouse adult neural stem cells.
  • (1 ⁇ M) vinimetinib (10 ⁇ M), repametinib (1 ⁇ M), PD0325901 (10 ⁇ M), RO5126766 (10 ⁇ M), and cobimetinib (10 known as selective inhibitors for MEK2 over MEK2) It is the result of observing the morphology of a cell by phase contrast microscope after administering [mu] M). Lines marked with “-” are not treated with beta amyloid, while lines marked with “A ⁇ 1-42 ” are treated with 10 ⁇ M of beta amyloid.
  • FIG. 14 shows the results of microscopic observation of the sections of the hippocampus (subiculum of hippocampus) of 5XFAD mice to which tramethinib was administered as a result of Experimental Example 8 by staining NeuN by immunohistochemical staining method.
  • Figure 16 shows the results of Experiments 9-2 and 9-3, Nissl, NeuN, Dcx and BrdU stained in the section of the dentate gyrus of the hippocampus of 5XFAD mice administered trametinib observed under a microscope Photographs (FIG. 16A) showing one result and the number of cells stained with BrdU are counted (FIG. 16B).
  • parts indicated by arrows ( ⁇ ) indicate cells stained with Dcx
  • heads ( ⁇ ) of arrows indicate cells stained with BrdU.
  • FIG. 18 is a photograph showing the results of experimental example 11 in which the sections of the cerebellum of 5XFAD mice to which trametinib was administered were stained with Tuj1 and calbindin to observe Purkinje neurons of the cerebellum under a microscope. Photographs of two slides (Tuj1 staining) or three (calbindin staining) for each treatment group were attached.
  • the inventors of the present invention when the compound of the present invention [Formula 1] to the neural stem cells, the expression of the neuronal marker Tuj1 is increased, dopamine neuronal marker TH, GABAergic (GABAergic) neuronal marker Gad1, exercise ( motor) It was confirmed that the expression of the neuronal marker Isl1 and the cholinergic (Cholinergic) neuronal marker ChAT were all increased (Experimental Example 4). This can be induced by differentiation of neural stem cells into various types of neurons such as dopamine neurons, GABAergic neurons, cholinergic neurons, and motor neurons by the compounds of [Formula 1]. It means that there is.
  • the compound of Formula 1 of the present invention can be used for the treatment of various neurodegenerative diseases causing loss or damage of various neurons.
  • Parkinson's disease is primarily associated with the loss of dopamine neurons and is associated with atrophic lateral sclerosis (Lou Gehrig's disease, ALS), progressive bulbar palsy (PBP), and progressive muscular atrophy (PMA).
  • Motor neuron disease such as primary lateral sclerosis (PLS), pseudobulbar palsy and hereditary spastic paraplegia (HSP), is associated with motor neuron.
  • Loss including Alzheimer's disease, vascular dementia, and senile dementia, is primarily associated with the loss of cholinergic neurons.
  • Huntington's disease is also mainly associated with the loss of GABA-medium-sized spiny neurons in the striatum of the basal ganglia.
  • the compound of [Formula 1] can be used as a therapeutic agent for Alzheimer's disease because it protects the neural stem cells from beta amyloid, which is a major pathological feature of Alzheimer's disease, and differentiates them into neurons.
  • the present inventors confirmed that the compound of [Formula 1] increases the number of neurons in the layer 5 of the hippocampus and cerebral cortex of Alzheimer's mouse (5xFAD) with human dementia gene (Experimental Example 8).
  • 5xFAD mice have mutations in amyloid precursor protein (APP) and presenilin (PSEN1) genes that are known to cause human familial Alzheimer's disease, and have high amyloid deposits in the hippocampus and cortical layer 5 Of neurons are lost.
  • the compound of [Formula 1] of the present invention increased the number of neurons, which means that the compound of [Formula 1] differentiates neural stem cells into neurons in vivo to increase the number of neurons and / or beta. To protect neurons from amyloid.
  • the compound of [Formula 1] increased the number of neurons in various parts of the 5xFAD mouse cerebral cortex, especially in the motor cortex, somatosensory cortex cortex compared to the control (Experimental Example 8, Figure 12, 13).
  • the compound of Formula 1 can be used for the treatment of diseases caused by neuronal loss of the part, for example motor neuron disease such as amyotrophic lateral sclerosis.
  • the compound of [Formula 1] in the cerebellum of the cerebellum (cerebellum) of the 5xFAD mouse increased the arborization of the axon of Purkinje neuron (Purkinje neuron) or preserved the axon structure (Experimental Example 11) , FIG. 18). This means that the compound of Formula 1 can be used for the treatment of cerebellar ataxia caused by the loss or damage of Purkinje cells of the cerebellum.
  • the compound of Formula 1 has an effect of inducing neuronal neurogenesis, protecting neurons, or both, thereby inducing neural regeneration or neuro-regeneration.
  • the compound of [Formula 1] increases Tuj1 expression, a marker of neurons during neuronal neoplasia in the cerebral somatosensory cortex of Alzheimer's disease model mouse (5xFAD), and hippocampus teeth.
  • SGZ subgranular zone
  • type 2 or type 3 cell-like cells characteristic during neuronal neurogenesis (as a result of Nissl and NeuN staining in Figure 16)
  • immature to express DCX Neurons and BrdU staining increased the number of dividing cells (FIG. 16). This supports that trametinib induced neuronal neurogenesis in the cerebral cortex and hippocampus teeth of mice.
  • the compound of [Formula 1] reduced the number of apoptosis cells that can be confirmed by the TUNEL assay in 5xFAD mice (Experimental Example 10, Figure 17), increase axon branching or axon structure of cerebellar Purkinje cells
  • the effect of preservation (experimental example 11, FIG. 18) and the ratio of A ⁇ (1-42) / A ⁇ (1-40) of brain tissue (experimental example 13, FIG. 20) was shown. This indicates that the compound of [Formula 1] may contribute to nerve regeneration by protecting nerve cells in an environment where loss or damage of nerve cells occurs and improving the state or activity of nerve cells.
  • neurodegenerative disease refers to a degenerative disorder of mental and physical function caused by the progressive structural and functional loss of neurons (neurons), specifically, dementia, Alzheimer's disease, vascular dementia, Geriatric dementia, frontal temporal lobe dementia, Lewy body dementia, Parkinson's disease, multiple system atrophy, corticobasal degeneration, progressive nucleus palsy, Huntington's disease, amyotrophic lateral sclerosis (ALS), primary lateral sclerosis, spinal muscular atrophy Disease, progressive bulbar palsy (PBP), progressive muscular atrophy (PMA), pseudobulbar palsy, hereditary spastic paraplegia (HSP), cerebellar ataxia, Creutzfeldt Diseases selected from Jakob disease, multiple sclerosis, Guillain-Barré syndrome and the like.
  • neurons specifically, dementia, Alzheimer's disease, vascular dementia, Geriatric dementia, frontal temporal lobe dementia, Lewy body dementia, Parkinson's disease, multiple system atrophy, corticobasal degeneration, progressive
  • the term 'comprising as an active ingredient' herein means containing an amount sufficient to inhibit the neurodegenerative diseases of the present invention.
  • the prophylactic or therapeutic compositions of the present invention can be prepared in parenteral dosage forms such as formulations common in the art such as oral administration or injection.
  • compositions according to the invention may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of a medicament, each according to a conventional method of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols Oral dosage forms, external preparations, suppositories, patches, and sterile injectable solutions.
  • Carriers, excipients and diluents that may be included in the compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, croscarmellose sodium, hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, sodium lauryl sulfate , Colloidal silicon dioxide, croscarmellose sodium and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, shoe, etc. in the pharmaceutical composition of the present invention. Prepared by mixing sucrose or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, patches and the like.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol gelatin and the like can be used.
  • compositions of the present invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the composition of the present invention may be administered at 0.0001 to 10 g / kg, preferably at 0.001 to 8 mg / kg. Administration may be administered once a day or may be divided several times.
  • the compound represented by [Formula 1] is 0.1mg to 10mg, 0.1mg to 5mg, 0.1mg to 2mg, 0.1mg to 1mg, 0.1mg to 0.5mg, 0.25mg to 2mg, 0.25mg to 1 day It may be administered in the range of 1 mg, 0.25 mg to 0.5 mg, 0.5 mg to 2 mg, 0.5 mg to 1 mg.
  • the compound of Formula 1 may be administered at a dose of 0.1 mg, 0.125 mg, 0.25 mg, 0.5 mg, 0.75 mg, 1 mg, 1.5 mg, 2 mg per day.
  • the present invention relates to a method for screening a substance capable of protecting neurons while simultaneously inducing neural stem cells into neurons in an environment simulating neurodegenerative diseases including Alzheimer's disease.
  • the screening method of the present invention is beta amyloid, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), rotenone, oxidopamine, glutamate, LPS (lipopolysaccharide) ), Using neuron damage causing substances such as S100 calcium-binding protein B (S100B) and mouse-derived neural stem cells, comprising the following steps.
  • the neural stem cells are preferably used that derived from the mouse.
  • Using neural stem cells of an animal such as a mouse is easier to cultivate cells and has ethical advantages than using human neural stem cells.
  • the neural stem cells need to be frequently replaced with a medium, and an expensive growth factor is required.
  • the neural stem cells of the mouse can be used to avoid these disadvantages.
  • human neural stem cells take more than 7 days to expand and differentiate cells, while mouse neural stem cells take 3 to 4 days to amplify cells and have a short differentiation period. Do.
  • the neural stem cells can be isolated and cultured from the adult brain of the mouse.
  • Mouse adult neural stem cells can be used isolated from the subventricular zone of 8 to 12 week old mice, for example 8 week old mice.
  • neural stem cells of the mouse are often cultured by separating from the frontal lobe of the mouse embryo (embryo) 12 to 16 days after fertilization.
  • Mouse embryonic neural stem cells are expected to be more tolerant to toxic environments because they have stronger stem cell abilities compared to neural stem cells derived from mouse adults.
  • the present inventors treated beta amyloid with mouse embryonic neural stem cells, all of the cells were killed and differentiation into neurons could not be observed regardless of the treatment of the test substance (see Comparative Example 1 and FIG. 3).
  • neural stem cells isolated from mouse adult brains were found to be more resistant to beta amyloid cells, making them suitable for screening of neural stem cell differentiation-inducing substances in an Alzheimer's disease-like environment. Therefore, the neural stem cells of an adult mouse are used in the method of this invention.
  • Neural stem cells isolated from adult mice can be seeded in culture medium prior to differentiation and cultured at 37 ° C.
  • a medium for culturing the neural stem cells it is preferable to use a serum-free medium composition containing a growth factor.
  • an IPM medium containing a growth factor is used.
  • N2 medium can be used when cultured and cultured after separation into single cells after neurospheres are formed.
  • the IPM medium may contain 1-4% B27 supplement, 0.5-2% Glutamax, 100 IU / ml penicillin, 100 ⁇ g / ml streptomycin in Neurobasal medium, and N2 medium may contain Dulbecco's.
  • DMEM / F12 Modified Eagle's Medium / Nutrient Mixture F12 (1: 1) 2.0 mg / ml glucose (d-(+)-glucose), 20-30 ⁇ g / ml insulin, 0.05-0.2 mg / ml apo-transferrin, 0.3-0.6 mMGlutamax, 50-150 IU / Ml penicillin and 50-150 ⁇ g / ml streptomycin added at least one component selected from the group consisting of 10-30 ng / ml bFGF, 10-30 ng / ml EGF and mixtures thereof It may be added to any one or more growth factors selected from the group consisting of.
  • the growth factor plays a role of maintaining neural stem cells in undifferentiated state.
  • the growth factor is included in the culture medium and cultured neural stem cells to treat test material in the state of differentiation inhibiting the effect of inducing differentiation of neural stem cells by test material. You can judge accurately.
  • beta amyloid can be commercially available, and can be obtained, for example, from Gibco (Waltham, Mass.). It is especially preferable to use the thing derived from a human.
  • Beta-amyloid is the most common form of A ⁇ (1-40) consisting of 40 amino acids and A ⁇ (1-42) consisting of 42 amino acids, of which A ⁇ (1-42) is more aggregated than A ⁇ (1-40) It is thought to be more associated with the disease state of Alzheimer's disease due to its stronger tendency to form, particularly toxic trimers or tetramers (Dahlgren, et al. (2002) Oligomeric and Fibrillar Species of Amyloid- ⁇ ) Peptides Differentially Affect Neuronal Viability.J. Biol.
  • a ⁇ (1-42) is dissolved in hexafluoroisopropanol (HFIP), dried under vacuum, and the dried peptide is resuspended in DMSO to 5 mM. Add DMEM / F12 (without phenol red) to bring the peptide to a concentration of 100 ⁇ M and incubate at 4 ° C. for 24 hours.
  • HFIP hexafluoroisopropanol
  • MPTP is a prodrug for the neurotoxin MPP + (1-methyl-4-phenylpyridinium), and MPP + permanently induces symptoms of Parkinson's disease by destroying dopaminergic neurons in the black matter of the brain. MPTP is used to induce symptoms of Parkinson's disease in Parkinson's disease animal models.
  • Rotenone is a substance that induces the degeneration of cerebral melanoma dopamine neurons by inhibiting the activity of mitochondrial complex I in cells, and is known to cause pathological characteristics of Parkinson's disease.
  • Oxidopamine is also called 6-hydroxydopamine (6-OHDA) or 2,4,5-trihydroxyphenethylamine, which selectively destroys dopamine and noradrenaline neurons in the brain. It is a neurotoxic compound used by researchers. Oxidopamine is thought to enter neurons via dopamine and noradrenaline reuptake transporters. Oxidopamine is also used in conjunction with selective noradrenaline reuptake inhibitors (eg desipramine) to selectively damage dopaminergic neurons.
  • 6-OHDA 6-hydroxydopamine
  • 2,4,5-trihydroxyphenethylamine 2,4,5-trihydroxyphenethylamine
  • S100B is a calcium binding protein that is secreted and expressed by astrocytes. S100B has neurotrophic activity in neuronal cell development and maintenance and affects the cognitive function of normal brain. However, abnormal elevations of S100B levels are harmful to neurons because they activate glial cells and cause neuroinflammatory responses.
  • test substance After treatment with nerve cell damage causing substances, the test substance is treated with neural stem cells and further cultured with a growth factor treated daily. 12 hours after treatment and as early as 48-72 hours later, morphology analysis can be used to determine whether the test substance is inducing neural stem cell differentiation.
  • Step 1 Mouse Embryonic Neural Stem Cell Culture
  • Step 1A Culture of Mouse Embryonic Neural Stem Cells in Undifferentiated State
  • Neural stem cells were isolated from the brain of mouse embryos at 14.5 days, and 10 ng / ml basic fibroblast growth factor (bFGF) (Peprotech, Princeton, NJ, cat #. 100-) in N2 culture medium. 18B) and 20 ng / ml human epidermal growth factor (EGF) (Peprotech, cat # .AF-100-15) to suspension for 4 days in a 25 cm 2 flask (Nunc, Pittsburgh, PA). Cultured in a) state. After 2 days, the formation of neurospheres was observed.
  • bFGF basic fibroblast growth factor
  • EGF human epidermal growth factor
  • the formed neuro sphere of the single cells counted 4 ⁇ 5X10 5 cells is 200 ⁇ 300 ⁇ l of the number of cells was separated into (single cell) Prepared to be included in the culture (N2 culture medium containing 10 ng / ml bFGF and 20 ng / ml EGF). The coating solution was suctioned just before seeding the cells and evenly spread before the plate dries. Allow the cells to adhere to the plate for about 1 minute, then observe the cell attachment to some extent, then add 1.5 ml of culture medium (N2 culture medium containing 10 ng / ml bFGF and 20 ng / ml EGF). And incubated in a 37 °C incubator.
  • the components of the N2 culture medium are as follows.
  • Dulbecco's modified Eagle's medium (DMEM) / F12 (1: 1) (Gibco, cat #. 11320033), 100 ⁇ M putrescine (Sigma, cat #. 51799), 30 nM selenite (Sigma, cat # .S5261), 20 nM progesterone (Sigma, cat # .P0130), 1.55 mg / ml glucose (d-(+)-glucose) (Sigma, cat # .G8270), 25 ⁇ g / ml insulin ( insulin) (Gibco, cat #.
  • Step 1B Culture of Neural Stem Cells Without Inhibiting Differentiation
  • mouse embryonic neural stem cells When isolated and sprayed into single cells, mouse embryonic neural stem cells were cultured in the same manner as in 1A, except that bFGF and EGF were not treated.
  • UD undifferentiated: undifferentiated
  • D Differentiated (differentiated)
  • Neural stem cells Undifferentiated neural stem cells of the UD group has a wide cell body, it is difficult to identify the shape of the neurites, and the cells continue to divide, so the total number of cells is larger than that of the D group.
  • Differentiated cells of group D have a small and round cell body, and the neurites are elongated and elongated, clearly distinguishing their shape from UD group cells.
  • bFGF basic fibroblast growth factor
  • EGF epidermal growth factor
  • the formed neurospheres are treated with 0.025% Trypsin-EDTA, separated into single cells, and the number of cells is counted so that 4-5X10 5 cells are included in 200-300 ⁇ l culture medium.
  • Cells were prepared.
  • N2 medium including 20 ng / ml bFGF and 20 ng / ml EGF
  • the coating solution was suctioned just before seeding the cells and evenly spread before the plate dries. Allow the cells to adhere to the plate for about 1 minute, then observe the cell attachment to some extent, then add 1.5 ml of culture medium (N2 culture medium containing 20 ng / ml bFGF and 20 ng / ml EGF). And incubated in a 37 ° C. incubator for 24 hours.
  • Step 1B Culture of Neural Stem Cells Without Inhibiting Differentiation
  • Beta amyloid was purchased from human A ⁇ (1-42) of Gibco (Waltham, MA) and used for the beta amyloid oligomer formation.
  • DMSO Sigma, cat # .D2650
  • DMEM / F12 without phenol red
  • trametinib was added to 10 nM and 100 nM, memantine (Sigma, cat # .M9292) to 5 ⁇ M and 10 ⁇ M, and AS703026 (pimasertib) to 10 ⁇ M, respectively. EGF and bFGF, beta amyloid and test materials were incubated for 4 days with daily treatment.
  • memantine which is currently used as a symptom relieving Alzheimer's disease
  • differentiation from neural stem cells to neural cells could not be confirmed, but rather neural stem cells were observed to die.
  • Memantine is an NMDA receptor antagonist that is involved in glutamate signaling and helps normal neuronal signaling in Alzheimer's patients, and this function cannot be expected to treat Alzheimer's disease by repairing damaged neurons.
  • the results of this experiment which indicate that memantine does not induce differentiation of neural stem cells but rather kill cells, confirm that memantine cannot be a fundamental treatment for dementia.
  • Step 1 Mouse Embryonic Neural Stem Cell Culture
  • beta amyloid was treated to mouse embryonic neural stem cells cultured in Step 1 above.
  • Step 3 Administer Test Substance
  • beta amyloid treatment 100 nM of trametinib, 10 ⁇ M of memantine and 10 ⁇ M of AS703026 (pimasertib) were added. EGF and bFGF, beta amyloid and test materials were incubated for 4 days with daily treatment.
  • FIG. 3 On the 4th day of culture, the shape of the cells was observed under a phase contrast microscope, and the results are shown in FIG. 3.
  • the upper part is a group not treated with beta amyloid in mouse embryonic neural stem cells
  • the lower part is a group treated with beta amyloid at a concentration of 10 ⁇ M.
  • UD Undifferentiated
  • D Differentiated
  • a ⁇ treatment group all the cells were killed regardless of the treatment of the test substance, and thus the effect of the test substance could not be confirmed.
  • Tuj1 Neuron-specific class III beta-tubulin
  • DAPI binds to the DNA of the cell and binds the nucleus to blue fluorescence. It is a dye labeled with.
  • Embryonic nerve stem cells cultured by the method of Experimental Example 1 was sprayed on a 24-well plate containing a coverslip and treated with trametinib and AS703026 by concentration for 4 days. The medium was removed and washed with PBS. After fixing for 10 minutes at room temperature with 10% formaldehyde (Sigma, cat #. HT501128) and washed again with PBS. Permeabilization at room temperature for 15 minutes with 0.2% Triton X-100 (Sigma, cat # .93443) and 10% BSA (Sigma, cat # .A2153) + 1% normal goat serum (Vector lab, Burlingame) after PBS washing , CA, cat # .S1000) was incubated at room temperature for 1 hour.
  • Tuj1 antibody Cell signaling, Danvers, MA, cat # 4466
  • 1% BSA + 1% normal goat serum 1% normal goat serum at a ratio of 1: 200 and incubated overnight at 4 ° C.
  • the solution was removed and washed with PBS after incubating the solution containing the secondary antibody (rhodamine attached antibody) in a ratio of 1: 200 in 1% BSA + 1% normal goat serum for 1 hour at room temperature, and washed with 5 ⁇ g
  • Incubated with / ml DAPI Sigma, cat # .D9542
  • the group treated with trametinib was found to actively increase the differentiation into neurons from the group treated with very low 10 nM concentration.
  • the cell morphology was also found to increase the number of neural clumps in the neural outgrowth in the group treated with trametinib 10 nM.
  • RNA concentration was measured to calculate 2 ⁇ g of RNA in each group, and the experiment was performed using a reverse transcription kit (Invitrogen, cat # .28025013). After adding 3 sterile water, 1 pM oligo dT, 1 mM dNTP and incubated at 65 ° C for 5 minutes, 5X First-strand buffer, 10mM DTT, M-MLV reverse transcriptase was added, and then 1 hour at 42 ° C and 72 ° C. CDNA made after 15 minutes incubation at 4 ° C. for 30 minutes was stored at ⁇ 20 ° C.
  • a reverse transcription kit Invitrogen, cat # .28025013
  • results are shown in FIG. 5A and 5B are mean values of relative mRNA expression levels of each group obtained by performing three times of qRT-PCR analysis.
  • the relative mRNA expression level is divided by the amount of expression of the mRNA corresponding to each differentiation marker by the amount of GAPDH expression, which is generally not significantly different in order to normalize the total amount of RNA in each group.
  • the neural stem cells were changed to N2 culture medium containing no EGF and bFGF, and further cultured for 4 days, RNA and protein were extracted, quantitative RT-PCR (qRT-PCR) and Western blotting was performed to confirm the effect of the activation of MEK1 and MEK2 on neural stem cell differentiation ability, as shown in FIG. 8C.
  • Results of FIG. 8C show that differentiation is inhibited when MEK1 and MEK2 are activated in an environment in which differentiation is induced, in contrast to FIG. 8B.
  • results of FIG. 8C show that differentiation is inhibited when MEK1 and MEK2 are activated in an environment in which differentiation is induced, in contrast to FIG. 8B.
  • Tuj1 and TH When confirmed by qRT-PCR and western blotting, it was confirmed that the expression of the mRNA and protein of the neuronal marker Tuj1 and the dopamine neuronal marker TH was inhibited, especially when both MEK1 and MEK2 were activated. It was confirmed that the expression of Tuj1 and TH is significantly reduced as compared to when one is activated.
  • mice mouse adult neural stem cells cultured as well in the plate (seeding) as in step 1A, and after incubation for 24 hours, to the cells 1 ⁇ g / ml of shRNA-MEK1 (CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT) or shRNA-MEK2 (CCGGCCTCTCTCGAGATCTCTCTCGAGATC ) Was transfected with Lipofectamin (Invitrogen) to prepare neural stem cells with suppressed expression of MEK1 or MEK2, or both.
  • shRNA-MEK1 CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT
  • shRNA-MEK2 CCGGCCTCTCTCGAGATCTCTCTCTCGAGATC
  • Lipofectamin Invitrogen
  • the neural stem cells thus prepared were changed to N2 culture medium again after 4 hours, or to medium in which 10 ⁇ M of beta amyloid (A ⁇ ) was treated in N2 medium, and cultured for 2 more days, followed by a microscope. The shape of the cells was observed, qRT-PCR was performed by RNA extraction by the method of Experimental Example 4, and the differentiation capacity into neurons was analyzed.
  • a ⁇ beta amyloid
  • differentiation was better induced in the case of neural stem cells which inhibited the expression of both MEK1 and MEK2 by simultaneously treating shMEK1 and shMEK2 than when either shMEK1 and shMEK2 were treated.
  • beta amyloid was treated, cells were killed in the group not inhibited by MEK1 and MEK2, but when either or both of MEK1 and MEK2 were inhibited, cell death did not occur and differentiation was induced.
  • AZD8330, Refametinib, PD318088, Binimetinib, and AS703026 confirmed that each compound induces differentiation only at the concentration at which differentiation is initiated.
  • AZD8330, Refametinib, and PD318088 showed differentiation morphology from 1.0 ⁇ M to Binimetinib and AS703026 from 10 ⁇ M.
  • Tuj1 a differentiation marker
  • PD184352 showed only a slight differentiation induction effect at 0.1 ⁇ M, and both cells died at 1.0 ⁇ M and 10 ⁇ M.
  • MEK 1/2 inhibitors PD0325901 (Selleckchem, cat # .S1036), RO5126766 (Selleckchem, cat # .S7170), BI847325 (Selleckchem, cat # .S7843) and U0126 (AGScientific, San Diego, CA, cat # .U-102) was administered to mouse adult neural stem cells cultured as in step 1A of Experimental Example 2 at various concentrations to observe whether there is an effect of inducing differentiation of neural stem cells. On the second day of the culture after the test material treatment, the shape of the cells was observed under a phase contrast microscope, and the results are shown in FIG. 10C. As shown in FIG.
  • Step 1A Adult neural stem cells cultured as in Experimental Example 2, Step 1A were treated with beta amyloid 10 ⁇ M as in Step 2 of Experimental Example 2 to induce a cytotoxic environment, and AS703026 (10 ⁇ M), AZD8330, a MEK1 / 2 inhibitor. (1 ⁇ M), PD318088 (1 ⁇ M), Binimetinib (10 ⁇ M), Refametinib (1 ⁇ M), PD0325901 (10 ⁇ M), and RO5126766 (10 ⁇ M), respectively, were treated at the concentrations that best induced differentiation in Experiment 6. Incubated.
  • a trametinib 0.1 ⁇ M treatment group and a cobimetinib 10 ⁇ M treatment group known as a selective inhibitor for MEK1 over MEK2, were added, as well as a group in which each compound was incubated without beta amyloid treatment. .
  • the shape of the cells was observed under a phase contrast microscope, and the results are shown in FIG. 11.
  • Half of the brain tissue (hemisphere) extracted from three mice per group were stored in a deep freezer immediately after extraction for western blotting and ELISA experiments. Brains from the other hemisphere of the other brain and from three mice per other group were placed in 10% formalin solution for one day at 4 ° C and 70%, 80%, 95% 100 Dehydration was performed for 1 hour in% alcohol order, soaked in xylene three times for 1 hour for clearing, and then soaked twice for 1 hour in paraffin in solution. After that, it was fixed well in the frame and made into sections with a thickness of 5 ⁇ m and stored at room temperature in the form of a slide.
  • FIG. 13 shows the results of analyzing coronal sections of the motor cortex of the mouse cerebral cortex.
  • the group administered only vehicle to 5XFAD mice showed damage of neurons of layer 5 of the motor cortex, but the number of neurons in the group of 5XFAD mice treated with trametinib. It was once again confirmed that it was significantly increased.
  • FIG. 13B shows the number of cells stained with NeuN in the motor cortex layer 5, as a percentage of cells per unit area.
  • FIG. Six parts of cotton per mouse were analyzed in three mice per group to count the total number of 18 cells and the ratio of NeuN stained cells in tramethinib-treated mice compared to vehicle-only groups. It was shown.
  • trametinib has an effect of increasing the number of neurons in the cerebral cortex layer 5 and the hippocampus in 5XFAD mice.
  • Fluorescent staining was performed by incubating Tuj1 antibody at 4 ° C for one day on brain tissue slides of 5XFAD mice of Experimental Example 1 and incubating Fluorescein isothiocyanate (FITC) -secondary antibody (Invitrogen, cat # .a21121) for 1 hour at room temperature. Stained with.
  • the fluorescence micrographs of the somatosensory cortex of the cerebral cortex are shown in FIG. 15.
  • the part indicated by the arrow ( ⁇ ) indicates the cells stained with Tuj1
  • the head indicated by the arrow ( ⁇ ) indicates the plaque due to beta amyloid aggregation.
  • Nissl staining is a staining method for staining the Nissl body of neurons and confirming the distribution of neurons and the state of neurons in the brain.
  • the tissue on the slide of the mouse brain of Experimental Example 8 was rehydrated by soaking for 5 minutes in the order of xylene, alcohol 100%, 90%, 80%, 70%, 50%, water, and then 0.1% cresyl violet The solution was immersed in (Sigma, cat # .C5042) at room temperature for 15 minutes and dehydrated again with alcohol 80%, 90%, 100%, xylene. After covering well with a cover slip, neurons in the brain were observed.
  • FIG. 16A The result is shown to FIG. 16A.
  • SGZ subgranular zone
  • ⁇ immature neurons stained by DCX staining (indicated by arrows ( ⁇ ) in the photo of the column labeled “Dcx” in FIG. 16) were identified, and in the dentate gyrus of the hippocampus of mice treated with trametinib It was confirmed that nerve regeneration is occurring.
  • FIG. 16A The result is shown in the photograph of the column shown by "BrdU" of FIG. 16A.
  • the cells marked with arrowheads ( ⁇ ) in the photograph are cells stained with BrdU.
  • the number of BrdU-stained cells in the dentate gyrus of trametinib-treated 5XFAD mice was increased compared to the vehicle-administered group.
  • Figure 16B shows the result of counting the number of BrdU stained cells, which also shows an increase in the number of BrdU stained cells in the trametinib administered group.
  • Figure 16b is a graph showing the average value of the number of cells of a total of nine sides by counting the three parts per side in three mice per group.

Abstract

본 발명은 신경재생이 필요한 환자에게 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경재생을 유도하는 방법에 관한 것이다. 특히 본 발명의 방법에서 MEK 1/2 억제제는 신경줄기세포를 신경세포로 분화시키거나 베타아밀로이드에 의한 세포독성으로부터 신경세포 및 신경줄기세포를 보호하거나, 둘 다에 의해 신경재생을 유도한다. 또한 본 발명은 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 방법에 관한 것이다. 추가적으로, 본 발명은 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성질환의 예방 또는 치료가 필요한 환자에게 상기 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성 질환의 예방 또는 치료 방법에 관한 것이다.

Description

신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
본 발명은 신경재생이 필요한 환자에게 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경재생을 유도하는 방법, 및 그러한 방법에 사용하기 위한 MEK 1/2 억제제를 포함하는 조성물에 관한 것이다. 본 발명에서 MEK 1/2 억제제는 신경줄기세포를 신경세포로 분화시키거나 베타아밀로이드에 의한 세포독성으로부터 신경세포 및 신경줄기세포를 보호하거나, 둘 다에 의해 신경재생을 유도한다. 또한 본 발명은 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 방법, 및 그러한 방법에 사용하기 위한 MEK 1/2 억제제를 포함하는 조성물에 관한 것이다. 추가적으로, 본 발명은 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성질환의 예방 또는 치료가 필요한 환자에게 상기 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성 질환의 예방 또는 치료 방법, 및 그러한 방법에 사용하기 위한 MEK 1/2 억제제를 포함하는 조성물에 관한 것이다.
알츠하이머병이나 파킨슨병과 같은 신경퇴행성 질환들은 주로 노인층이 많이 걸리는데, 사회의 노령화에 따라 그 환자수도 기하급수적으로 늘어나고 있다. 또한, 젊은 층에서도 조기 발현형 신경퇴행성 질환이 드물지 않게 보고되고 있다. 이에 병의 진행을 중단시키거나, 손상된 뇌조직을 회복시키기 위한 여러 치료법의 개발에 많은 관심이 집중되고 있다.
아직까지 이러한 신경퇴행성 질환에 대한 확실한 원인들은 규명되지 못했으나, 현재까지 밝혀진 바에 따르면 뇌의 특정 부분(Hippocampus; 해마 혹은 Substantia nigra; 흑질 등)에 존재하는 신경세포들이 파괴되어 발생되는 것으로, 부족해진 신경세포들 간의 네트워크가 망가지게 되어 신경퇴행성 질환의 다양한 증상들이 야기된다고 알려져 있다.
이를 치료하기 위해 다양한 분야에서 연구가 이루어지고 있는데, 현재까지는 증상완화와 연관되어 있는 약물들(Memantine: NMDA receptor antagonist, L-DOPA: dopamine mimic drug 등)이 대부분이고, 이외의 약물치료 역시 단기적인 효과에 그치거나 지속적인 투여에 의한 부작용이 발견되어 치료에 적용하기가 어렵고, 일시적으로 증상을 완화시키는 것 이상의 치료효과를 기대하기 어렵다는 등의 문제점이 있다. 따라서, 신경퇴행성 질환의 원인을 치료할 수 있는 치료법이 절대적으로 필요한 실정이다.
성인의 뇌에는 신경계 세포들로 분화될 수 있는 능력을 가진 신경줄기세포(neural stem cell: NSC)와 신경전구세포(neural progenitor cells: NPC)가 존재한다. 특히 측뇌실(lateral ventricle)의 뇌실하 영역(subventricular zone)과 해마(hippocampus)의 치아이랑(dentate gyrus) 부분에 신경줄기세포가 존재하며, 이 부분에서의 신경줄기세포의 분화 및 증식을 통해 일생에 걸쳐 신경세포신생(neurogenesis)이 이루어진다고 알려져 있다(Zhao et al. (2008) Mechanisms and functional implications of adult neurogenesis. Cell 132:645-660).
신경퇴행성 질환에서는 뇌 신경세포의 손상과 사멸이 일어나므로, NSC와 NPC를 자극하여 손상, 사멸된 신경세포가 정상 기능을 하는 신경세포로 교체되게 하는 것이 신경퇴행성 질환 치료의 근본적 치료법이 될 수 있다. 이러한 접근법에는 환자의 생체에서 NSC와 NPC를 분리하고 이를 시험관내에서 자극하여 신경세포로 분화시켜 환자에게로 이식하는 방식이 포함된다(줄기세포 치료제). 그러나 NSC와 NPC를 생체에서 얻고 환자에 이식하는 것에는 어려움이 따르고, 뇌에 이식된 NSC나 NPC가 뇌에서 빠른 시간 내에 기능을 상실하므로 빈번하게 이식을 수행해야 한다. 그 대안으로서, 신경줄기세포를 환자에게 이식하는 대신 환자에게 약물을 투여하여 환자의 뇌 속에 존재하는 NSC 또는 NPC를 자극하여 분화를 유도함으로써 신경세포를 재생시키는 방법이 최근 제안되었다(Davies et al. (2015) Stemistry: The Control of Stem Cells in Situ Using Chemistry. J. Med. Chem. 58:2863-2894).
베타아밀로이드(Aβ)는 36-43개의 아미노산으로 이루어진 펩타이드로서, 아밀로이드 전구단백질(amyloid precursor protein, APP)이라는 제1형 내재성 막단백질이 베타 세크레타제와 감마 세크레타제에 의해 분해되어 유도된다. Aβ는 뇌에서 가용성 Aβ 올리고머로 응집된 후 프로토피브릴(protofibril)을 거쳐 불용성 Aβ 피브릴을 형성하여 뇌 내에 아밀로이드 플라크로서 축적된다. 뇌 내 베타아밀로이드의 침착은 시냅스 손상, 신경세포 손상, 및 뇌 위축과 관련이 되어 있고, 결과적으로 알츠하이머병의 전형적 증상인 기억력과 인지기능 손상이 야기된다. Aβ의 여러 형태 중 가용성인 Aβ 올리고머, 특히 트라이머(trimer)나 테트라머(tetramer)가 신경 기능장애와 시냅스 손상과 가장 관련이 큰 독성 Aβ 종으로 인식되고 있다(Murakami (2014) Conformation-specific antibodies to target amyloid β oligomers and their application to immunotherapy for Alzheimer’s disease. Biosci. Biotechnol. Biochem. 78(8):1293-1305; Jana et al. (2016) Membrane-bound tetramer and trimer Aβ oligomeric species correlate with toxicity towards cultured neurons. J Neurochem. 136(3):594-608).
따라서, 베타아밀로이드, 특히 올리고머 형태의 Aβ로부터 신경세포를 보호하는 것이 알츠하이머 병 치료의 잠재적 표적으로 인식되고 있다. 그러나 알츠하이머병 환자는 이미 신경세포가 상당수 손상되어 있는 상태이므로, 신경세포의 보호뿐 만 아니라 내인성 신경줄기세포의 분화를 통해 신경세포를 재생시키는 것이 병의 근본적 치료에 필요하다.
MEK(mitogen-activated protein kinase kinase; MAP2K 또는 MAPKK라고도 불림)는 Ras-Raf-MEK-ERK의 순서로 이어지는 MAP 키나아제(Mitogen Activated Protein Kinase; MAPK) 신호전달 경로(이하 ‘MAPK/ERK 경로’라 함)의 일원이다. 성장 인자, 호르몬, 사이토카인 등 여러 가지 신호전달 물질이 세포막의 수용기에 결합하여 수용체 티로신 키나아제(Receptor Tyrosine Kinase)를 활성화시키면, Ras GTPase 단백질이 활성화되고, 그 결과 세포질 내의 Raf가 세포막으로 모집된다. 활성화된 Raf는 순차적으로 MEK, ERK를 인산화시키고 활성화시키며, 활성화된 ERK는 핵 내로 이동하여 다양한 전사요소들을 활성화시킨다. 이 전사요소들은 다양한 유전자의 촉진자(promoter)에 결합하여 세포 증식, 분화 및 생존을 통제한다. 이 MAPK/ERK 신호전달 경로가 종양세포에서 항진되어 있기 때문에, 구성원인 키나아제들은 암을 비롯한 다른 증식성 질환에서 질환 진행을 억제하는 중요한 목표로 여겨져 왔다.
MEK에는 MEK1부터 MEK7에 이르는 7개의 단백질이 알려져 있는데, 그 중 MEK1과 MEK2가 Ras-Raf-MEK-ERK 경로의 신호전달에 관련되어 있다. MEK1과 MEK2는 서로 다른 유전자에 의해 암호화되어 있지만, C-말단의 촉매 키나아제 영역과 대부분의 N-말단 조절 구역에서 높은 유사성(80%)을 공유하고 있다. MEK1과 MEK2의 발암 형태는 사람의 암에서 찾을 수 없지만, MEK의 지속적인 활성화가 세포를 변이시키는 것이 알려져 있고, 다른 종양유전자에 의해 활성화될 수 있다. 따라서 MEK1, 2의 억제 역시 항암제 개발의 타겟으로 연구되어 왔다. 그러나, MEK1, 2를 비롯한 MAPK/ERK 경로가 성체의 신경줄기세포의 증식 및 분화에서 어떤 역할을 하는지는 명확하지가 않다.
또한 MAPK/ERK 경로가 알츠하이머 환자의 뇌에서 발견되는 베타아밀로이드 또는 타우 단백질과 관계가 있다는 연구 결과들이 있으나, 알츠하이머병의 치료를 위해 이 신호전달 경로를 활성화시켜야 하는지 억제시켜야 하는지, 또는 이 신호전달경로의 조절이 알츠하이머병의 치료와 연결될 수 있는지 여부가 명확하지 않다.
매우 초기의 알츠하이머 환자의 뇌에서 MAPK/ERK 경로의 단백질들의 발현이 증가되어 있고(Arendt et al. (1995) Increased expression and subcellular translocation of the mitogen activated protein kinase kinase and mitogen-activated protein kinase in Alzheimer's disease. Neuroscience 68(1);5-18; Gartner et al. (1999) Elevated expression of p21ras is an early event in Alzheimer's disease and precedes neurofibrillary degeneration. Neuroscience 91(1):1-5), 이 경로의 ERK1/2와 MEK1/2가 알츠하이머 뇌의 타우 단백질의 과인산화(hyperphosphorylation)와 관계가 있으며(Pei et al. (2002) Up-regulation of mitogen-activated protein kinases ERK1/2 and MEK1/2 is associated with the progression of neurofibrillary degeneration in Alzheimer's disease. Brain Res Mol Brain Res. 109(1-2):45-55), 아밀로이드 전구체 단백질(Amyloid Precursor Protein: APP)을 발현하는 B103 세포(쥐의 신경모세포종 세포)에서 Ras 발현의 증가와 ERK1/2 활성화가 관찰되었다는 보고가 있다(Chaput et al. (2012) SILAC-based proteomic analysis to investigate the impact of amyloid precursor protein expression in neuronal-like B103 cells. Electrophoresis 33(24):3728-3737).
한편 다른 연구 결과에서는 ERK1/2가 활성화되면 Aβ에 의해 유도되는 세포 사멸이 억제되고 Aβ의 축적이 감소된다고 보고되었다(Guerra et al. (2004) Plasma membrane oestrogen receptor mediates neuroprotection against b-amyloid toxicity through activation of Raf-1/MEK/ERK cascade in septal-derived cholinergic SN56 cells. J. Neurochem. 91:99-109; Watson et al. (2005) Macrophage Inflammatory Protein 2 Inhibits β-Amyloid Peptide (1-42)-Mediated Hippocampal Neuronal Apoptosis through Activation of Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase Signaling Pathways. Molecular Pharmacology 67(3):757-765; Mills et al. (1997) Regulation of amyloid precursor protein catabolism involves the mitogen-activated protein kinase signal transduction pathway. J. Neurosci. 17:9415-9422). 또한, ERK1/2는 APP로부터 Aβ를 생성시키는 역할을 하는 감마-세크레타제(λ-secretase) 활성을 감소시키고, 산화 스트레스 환경에서 BACE1(β-secretase 1)의 발현과 활성을 감소시킨다고 보고되기도 하였다(Tamagno et al. (2009) JNK and ERK1/2 pathways have a dual opposite effect on the expression of BACE1. Neurobiology of Aging 30:1563-1573).
따라서 알츠하이머병을 비롯한 신경퇴행성 질환의 치료에 있어서 MAPK/ERK 경로의 조절 및 MEK의 억제가 어떠한 역할을 하는지에 대해서는 서로 상반된 견해들이 존재하며 명확히 밝혀져 있지 않다.
본 발명자들은 MEK1과 MEK2를 모두 억제하는 화합물을 이용하여, 신경줄기세포를 신경세포로 분화시키고, 베타아밀로이드로부터 신경줄기세포와 신경세포를 보호함으로써, 신경재생을 유도하는 방법을 제공하고자 한다. 또한, 본 발명자들은 MEK1과 MEK2를 모두 억제하는 화합물을 이용하여, 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 방법을 제공하고, 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성질환의 예방 또는 치료 방법을 제공하고자 한다.
본 발명자들은 MEK1과 MEK2를 모두 억제하는 화합물(이하 'MEK 1/2 억제제'라 함), 특히 하기 [화학식 1]로 표시되는 화합물이 신경줄기세포를 신경세포로 분화시키는 데 효과적이고, 특히 베타아밀로이드로부터 신경줄기세포와 신경세포를 보호하면서 동시에 신경줄기세포를 신경세포로 분화 유도한다는 것을 발견하였다.
[화학식 1]
Figure PCTKR2017013444-appb-I000001
본 발명의 한 측면은 상기 [화학식 1]로 표시되는 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물에 관한 것이다. 상기 조성물은 신경줄기세포의 암세포적 성장을 수반하지 않는다.
상기 신경줄기세포의 분화 촉진용 조성물은 베타아밀로이드 존재하에서도 신경줄기세포로부터 신경세포로의 분화를 유도한다.
상기 신경줄기세포의 분화 촉진용 조성물에 의한 신경세포 분화 촉진은 MEK1과 MEK2를 동시에 억제하는 것으로 인한 것일 수 있다.
상기 조성물은 [화학식 1] 화합물 대신 특정의 MEK 1/2 억제제를 포함할 수 있다. 이 조성물은 베타아밀로이드의 존재 하에서도 신경줄기세포의 신경세포로의 분화를 유도한다.
본 발명의 다른 측면은 상기 신경줄기세포의 분화 촉진용 조성물을 이용하여 신경줄기세포를 신경세포로 분화시키는 방법에 관한 것이다.
상기 분화 방법은 신경줄기세포에 상기 신경줄기세포의 분화 촉진용 조성물을 처리한 후, 분화완료까지 1 일 내지 7 일 간 소모되는 것일 수 있다.
또한 본 발명의 다른 측면은 신경줄기세포의 분화를 촉진시키는 데 사용하기 위한, 특히 베타아밀로이드의 존재 하에서 신경줄기세포와 신경세포를 보호하고 신경줄기세포를 신경세포로 분화시키는 데 사용하기 위한 [화학식 1]의 화합물에 관한 것이다. 또한 본 발명의 다른 측면은 신경줄기세포의 분화를 촉진시키는 데 사용하기 위한, 특히 베타아밀로이드의 존재 하에서도 신경줄기세포와 신경세포를 보호하면서 신경줄기세포를 신경세포로 분화시키기 위한 특정의 MEK 1/2 억제제에 관한 것이다.
본 발명의 다른 측면은 시험관내에서 신경줄기세포의 신경세포로의 분화를 촉진시키기 위한 키트에 관한 것으로서, 상기 키트는 상기 신경줄기세포의 분화 촉진용 조성물, 배지, 플레이트, 코팅 용액, 또는 성장인자와 같은 세포 배양에 필요한 첨가제 등을 포함할 수 있다.
본 발명의 또 다른 측면은 신경재생이 필요한 환자에게 특정의 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경재생을 유도하는 방법에 관한 것이다. 본 발명에 있어서 MEK 1/2 억제제는 신경줄기세포를 신경세포로 분화시키거나, 베타아밀로이드에 의한 세포 독성으로부터 신경줄기세포 및 신경세포를 보호하거나, 둘 다에 의해 신경재생을 유도한다. 가장 바람직한 MEK 1/2 억제제는 [화학식 1]의 화합물이다. 본 발명의 추가적 측면은 신경재생을 유도하는 데 사용하기 위한 특정의 MEK 1/2 억제제, 특히 [화학식 1] 화합물에 관한 것이다.
본 발명의 또 다른 측면은 특정의 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 방법에 관한 것이다. 이 방법에서 가장 바람직한 MEK 1/2 억제제는 [화학식 1]의 화합물이다. 본 발명의 추가적 측면은 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 데 사용하기 위한 특정의 MEK 1/2 억제제, 특히 [화학식 1] 화합물에 관한 것이다.
본 발명의 다른 측면은 [화학식 1]로 표시되는 화합물을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학 조성물, 또는 [화학식 1]의 화합물을 이용하여 신경퇴행성 질환을 예방 또는 치료하는 방법에 관한 것이다.
상기 신경퇴행성 질환은 신경세포의 기능 감소 또는 소실에 의해 운동조절능력, 인지기능, 지각기능, 감각기능 및 자율신경의 기능 이상이 일어나는 질환을 말하는 것으로서, 예를 들면 치매, 알츠하이머병, 혈관성치매, 노인성치매, 전두측두엽치매, 루이소체치매, 파킨슨병, 다계통위축증, 피질기저핵변성(corticobasal degeneration), 진행성핵상마비, 헌팅턴병, 근위축성 측삭 경화증(루게릭병, ALS), 원발성측삭경화증, 척수근육위축병, 진행성 연수마비(progressive bulbar palsy; PBP), 진행성 근위축증(progressive muscular atrophy; PMA), 가성연수마비(pseudobulbar palsy), 유전성 강직성 하반신마비(hereditary spastic paraplegia; HSP), 소뇌성 운동실조증, 크로이츠펠트-야콥병, 다발성경화증, 길랑-바레 증후군 등일 수 있다.
상기 약학 조성물 또는 방법은 [화학식 1] 화합물 대신 다른 특정의 MEK 1/2 억제제를 포함하거나 사용할 수 있다.
본 발명의 추가적 측면은 신경퇴행성 질환의 예방 또는 치료에 사용하기 위한 [화학식 1] 화합물에 관한 것이다. 또한, 신경퇴행성 질환의 예방 또는 치료에 사용하기 위한 특정의 MEK 1/2 억제제에 관한 것이다.
본 발명의 추가적 측면은, 알츠하이머병을 비롯한 신경퇴행성 질환을 모사한 환경에서 신경줄기세포를 신경세포로 분화 유도하면서 동시에 신경줄기세포 또는 신경세포를 보호할 수 있는 물질을 스크리닝하는 방법에 관한 것이다. 본 발명에 따른 스크리닝 방법은 다음과 같은 단계를 포함한다.
1) 성체 마우스 유래의 신경줄기세포에 베타아밀로이드(특히 올리고머 형태의 베타아밀로이드), MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), 로테논(Rotenone), 옥시도파민(oxidopamine) 글루타메이트(glutamate), LPS (lipopolysaccharide), S100B (S100 calcium-binding protein B)와 같은 신경세포 손상 유발 물질을 처리하는 단계;
2) 시험 물질을 상기 신경세포 손상 유발 물질이 처리된 신경줄기세포에 투여하는 단계; 및
3) 세포의 형태소(morphology) 분석을 통해 신경줄기세포의 분화 및 세포 사멸 여부를 확인하는 단계.
이하에서, 본 발명의 여러 측면 및 다양한 구현예에 대해 더욱 구체적으로 살펴보도록 한다.
본 발명에서 “신경줄기세포”는 미분화된 상태로 계속 증식하는 자가갱신(self-renew) 능력을 갖고, 한 개의 줄기세포로부터 다양한 신경세포(neuron) 및 교세포(glia)로 분화하는 분화의 다능성(multipotency)을 갖는 세포를 의미하고, 동물로부터 유래된 것이다. 이때, 동물이란 인간 및 영장류뿐 만 아니라, 소, 돼지, 양, 말, 개, 쥐, 랫트 및 고양이 등의 동물을 포함하며, 바람직하게는 인간이다. 경우에 따라 “신경줄기세포”는 “신경전구세포”(neural progenitor cell)를 포괄하는 의미로도 사용된다.
본 발명에서 용어 “분화(differentiation)”란 세포가 특정 세포로 발달하는 것을 의미하며, 구체적으로 세포가 분열 증식하여 성장하는 동안에 구조나 기능이 특화되는 현상으로, 생물의 세포, 조직 등이 각각에게 주어진 일을 수행하기 위하여 형태나 기능이 변해가는 것을 말한다. 신경줄기세포의 “분화”에는 모세포가 서로 다른 성격을 갖는 두 개의 세포로 분열하는 비대칭 분열(asymmetric division)이 선행하게 되는데, 분열된 세포 중 일부는 모세포와 동일한 줄기세포로 남아 있고 일부는 특정 세포로 분화가 된다. 신경줄기세포의 분화에 이러한 비대칭 분열 과정이 수반된다는 점에서 “신경줄기세포의 분화”는 “증식”의 의미를 포함한다.
본 발명에서 용어 “증식(proliferation)”이란 세포가 분열 증식하는 현상을 의미하는 것으로, 구체적으로 세포가 분열되어 동질의 것이 불어나는 현상 즉 동일한 형태의 세포가 재생산되어 그 수가 늘어나는 경우를 일컫는다.
본 발명에서 용어 “보호(protection)”란 위험이나 파괴 등 곤란한 외부 자극이 주어졌을 때 이로부터 잘 보살펴 지키는 것으로, 신경세포 손상 유발 물질, 특히 베타아밀로이드에 대하여 신경줄기세포가 사멸하지 않고 증식이나 분화할 수 있도록 상태를 유지시키며 분화된 신경세포가 살아 남을 수 있도록 지키는 것을 의미한다. 특히 알츠하이머병과 관련하여 본 발명에서 용어 “보호”는 뇌에서의 Aβ(1-42)/Aβ(1-40) 비율을 낮추어 베타아밀로이드로 인한 손상으로부터 신경줄기세포 및 신경세포를 보호하는 것을 포함한다(Majid et al. (2015) Pharmacologic treatment with histone deacetylase 6 inhibitor (ACY-738) recovers Alzheimer's disease phenotype in amyloid precursor protein/presenilin 1 (APP/PS1) mice. Alzheimers Dement. 170-181; Borchelt et al. (1996) Familial Alzheimer's disease-linked Presenilin 1 variants elevate Aβ1-42/1-40 ratio in vitro and in vivo. Neuron. 17:1005-1013).
본 발명에서, 용어 "예방"이란 본 발명에 따른 약학 조성물의 투여에 의해 신경퇴행성 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미하고, "치료"란 상기 약학 조성물의 투여에 의해 신경퇴행성 질환의 의심 및 발병 개체의 증상이 호전되거나 이롭게 변경하는 모든 행위를 의미한다.
본 발명의 일 측면은 하기 [화학식 1]로 표시되는 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2017013444-appb-I000002
상기 [화학식 1]로 표시되는 화합물의 일반명은 트라메티닙(Trametinib)이며 화학명은 N-(3-{3-사이클로프로필-5-[(2-플루오로-4-아이오도페닐)아미노]-6,8-디메틸-2,4,7-트리옥소-3,4,6,7-테트라하이드로피리도[4,3-d]피리미딘-1(2H)-일}페닐)아세트아미드(N-(3-{3-Cyclopropyl-5-[(2-fluoro-4-iodophenyl)amino]-6,8-dimethyl-2,4,7-trioxo-3,4,6,7-tetrahydropyrido[4,3-d]pyrimidin-1(2H)-yl}phenyl)acetamide)이다. Japan Tabacco Inc.가 출원인인 WO2005/121142에 실시예 4-1의 화합물로 개시되어 있다. [화학식 1]의 화합물은 MAPK/ERK(mitogen-activated protein kinase/extracellular regulated kinase) 신호전달경로 중 ERK의 상위 단계(upstream) 분자인 MEK1과 MEK2를 모두 억제한다. 상품명 MEKINIST®로 흑색종 및 비소세포암에 항암제로 사용되고 있다. 본 발명에서 [화학식 1]의 화합물은 유리 염기, 또는 제약학적으로 허용가능한 염 또는 용매화물의 형태로 사용될 수 있다. 용매화물은 예를 들어 수화물, 또는 디메틸술폭시드, 아세트산, 에탄올, 니트로메탄, 클로로벤젠, 1-펜탄올, 이소프로필 알콜, 에틸렌 글리콜 및 3-메틸-1-부탄올 등의 용매화물일 수 있다.
특히 본 발명의 일 측면은 베타아밀로이드로부터 신경줄기세포와 신경세포를 보호하면서 동시에 신경줄기세포를 신경세포로 분화시키는, 상기 [화학식 1]의 화합물을 포함하는 조성물에 관한 것이다. 베타아밀로이드는 뇌에서 아밀로이드 플라크로서 축적되고 시냅스 손상, 신경세포 손상, 및 뇌 위축과 관련이 되어 있으며, 결과적으로 알츠하이머병의 전형적 증상인 기억력과 인지기능 손상을 야기하는 것으로 인식되고 있다. 따라서, 베타아밀로이드로부터 신경줄기세포 또는 신경세포를 보호하면서 내인성 신경줄기세포의 분화를 통해 신경세포를 재생시키는 것이 알츠하이머병의 근본적 치료법이 될 수 있다.
베타아밀로이드 중 42개의 아미노산으로 이루어진 Aβ(1-42)가 Aβ(1-40)보다 응집체를 형성하는 경향이 더 강하며 특히 독성이 강한 트라이머나 테트라머를 형성하는 경향이 강하여 알츠하이머병의 질병 상태와 연관성이 더 크다고 여겨지고 있다. 따라서 Aβ(1-42), 특히 Aβ(1-42)의 올리고머 형태의 존재 하에서 신경줄기세포를 보호하면서 신경줄기세포를 분화시키는 조성물이 바람직하다.
본 발명의 구체적인 실시예에서 발명자들은 마우스의 신경줄기세포를 이용하여, 이를 신경세포로 분화를 유도하는 조성물을 확립하고자 한 바, 상기 [화학식 1]의 화합물이 매우 효과적으로 마우스 배아 또는 성체의 뇌에서 분리한 신경줄기세포를 신경세포로 분화하도록 유도한다는 것을 확인하였다.
신경줄기세포는 다양한 신경세포(neuron)로 분화하거나 희소돌기아교세포(oligodendrocyte), 성상세포(astrocyte), 소교세포(microglia) 등의 교세포(glial cell)로 분화할 수 있는 능력을 갖고 있다. 본 발명의 [화학식 1]의 화합물은 신경줄기세포를 주로 신경세포로 분화시키고 교세포로의 분화를 제한시킨다. 따라서, [화학식 1]의 화합물은 신경세포의 신생을 효과적으로 유도함으로써 신경세포 손실이 일어난 신경퇴행성질환 환자의 뇌에서 손실된 신경세포가 신생 신경세포로 대체되게 할 수 있어서, 신경재생(neural regeneration 또는 neuro-regeneration)을 촉진하는 의약으로서 사용될 수 있다.
또한 본 발명의 구체적인 실시예에서 본 발명자들은 베타아밀로이드 올리고머를 처리하여 알츠하이머병의 뇌내 환경을 모사한 시험관내(in vitro) 실험을 통해 [화학식 1]의 화합물이 신경줄기세포 또는 신경세포의 사멸에 대하여 보호효과가 있으며, 신경줄기세포를 신경세포로 분화되도록 유도하고 있음을 확인하였다(도 2).
추가적으로, 본 발명의 일 측면은 MEK1과 MEK2를 모두 억제하는 특정 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물에 관한 것이다. 본 발명에서 MEK1과 MEK2를 모두 억제하는 화합물을 “MEK 1/2 억제제”라고도 부른다. 본 발명에서 “MEK 1/2 억제제”는 바람직하게는 nM 수준의 IC50를 나타내고, MEK1에 대한 IC50와 MEK2에 대한 IC50의 차이가 바람직하게는 10배 이하, 더욱 바람직하게는 5배 이하인 물질이다. MEK1과 2에 대한 IC50는 예를 들면 문헌[Yamaguchi et al. International Journal of Oncology 2011;39:23-31]에 기재된 방법으로 측정할 수 있다. 본 발명에서 사용할 수 있는 MEK 1/2 억제제는 신경줄기세포를 신경세포로 분화되도록 유도하면서 동시에 베타아밀로이드와 같은 독성물질로부터 신경줄기세포와 신경세포를 보호하는 물질이다. 예를 들면 본 발명에서 사용될 수 있는 MEK 1/2 억제제는 다음과 같다: 트라메티닙(Trametinib), 피마설팁(Pimasertib, AS703026), AZD8330, 비니메티닙(Binimetinib, MEK162, ARRY-162, ARRY-438162), 레파메티닙(Refametinib, RDEA119, Bay 86-9766), PD318088, PD0325901, RO5126766.
본 발명에서 바람직한 MEK 1/2 억제제의 화학구조와 MEK1, MEK2에 대한 IC50 값 및 그 측정법이 기재되어 있는 문헌은 하기 [표 1]과 같다.
명칭 화학구조 MEK1, MEK2에 대한 IC50(IC50값의 측정방법에 대한 참고문헌)
트라메티닙
Figure PCTKR2017013444-appb-I000003
 0.92 ~ 3.4 nM(International Journal of Oncology 2011;39:23-31)
피마설팁(AS703026)
Figure PCTKR2017013444-appb-I000004
 ≤1 μM(US 2009/0093462, Table I, Example 115)
AZD8330
Figure PCTKR2017013444-appb-I000005
 7 nM (AACR Annual Meeting, 2009, Abst 3696)
비니메티닙(ARRY-162, ARRY-438162)
Figure PCTKR2017013444-appb-I000006
 12 nM(American College of Rheumatology, 2006 Annual Scientific Meeting, Abst 794)
레파메티닙(RDEA119, Bay 86-9766)
Figure PCTKR2017013444-appb-I000007
 MEK1: 19 nM, MEK2: 47 nM(Cancer Res. 2009;69(17):6839-47)
PD318088
Figure PCTKR2017013444-appb-I000008
 1.4 nM(WO 02/06213, Example 40)
PD0325901
Figure PCTKR2017013444-appb-I000009
 3.6 ~24 nM(Oncotarget 2012;3:1533-1545)
RO5126766(CH5126766)
Figure PCTKR2017013444-appb-I000010
 160 nM(Cancer Res. 2013;73(13): 4050-4060)
또한, 본 발명의 일 측면은 상기 MEK 1/2 억제제를 포함하며, 베타아밀로이드, 특히 올리고머 형태의 Aβ(1-42)로부터 신경줄기세포와 신경세포를 보호하면서 동시에 신경줄기세포를 신경세포로 분화시키기 위한 조성물에 관한 것이다.
MEK1과 MEK2를 모두 억제하는 MEK 1/2 억제제가 아닌, MEK1 또는 MEK2 중에서 어느 하나의 선택적인 억제제의 경우에는 신경세포로의 분화를 유도하는 효과가 약하므로 바람직하지 않다. 예를 들어, 코비메티닙(cobimetinib)은 MEK2에 비해 MEK1에 대해 100배 이상의 선택성을 나타내는 MEK1의 선택적 억제제인데(MEK1 IC50 = 0.95 nM, MEK2 IC50 = 199 nM; Molecules 2017;22:1551), MEK 1/2 억제제와는 달리 베타아밀로이드 처리 여부에 관계 없이 10 μM의 높은 농도에서도 마우스 성체 신경줄기세포의 분화를 유도하지 못함을 확인하였다(실험예 7).
또한, MEK1과 MEK2를 모두 억제하는 것이 신경줄기세포의 신경세포로의 분화 유도 및 신경줄기세포와 신경세포의 보호에 관여함은 shRNA(short hairpin RNA)를 이용한 MEK1 및 MEK2의 발현 억제 실험 및 constitutively active MEK1 (CAMEK1), constitutively active MEK2 (CAMEK2) 플라스미드를 이용한 MEK1 및 MEK2의 발현 활성화 실험에서도 확인된다(실험예 5).
그러나, MEK 1/2 억제제라고 하여 모두 동일한 효과를 보이는 것은 아니다. 예를 들어, MEK 1/2 억제제인 U0126, PD184352 및 BI847325는 실험한 모든 농도에서 신경줄기세포를 신경세포로 분화 유도하는 효과가 미약하거나 세포독성을 유발하여 본 발명의 신경줄기세포 분화 유도용 조성물로 사용하기에 부적합하였다(도 10a 및 10c). 따라서, MEK 1/2 억제 활성이 있는 화합물이 갖는 다른 고유의 특성에 의해 신경줄기세포의 신경세포로의 분화 유도효과 또는 신경줄기세포 및 신경세포의 보호 효과가 달라질 수 있으며, 본 발명에서는 MEK 1/2 억제제 중 트라메티닙 (Trametinib), 피마설팁(AS703026), AZD8330, 비니메티닙(Binimetinib), 레파메티닙(Refametinib), PD318088, PD0325901, RO5126766가 신경줄기세포의 신경세포로의 분화 유도효과 및 신경줄기세포/신경세포의 보호 효과가 있음을 확인하였다.
특히, [화학식 1]의 화합물(트라메티닙)은 본 발명에서 사용 가능한 MEK 1/2 억제제들 중에서도 현저히 우수한 분화능 및 베타아밀로이드로부터의 보호 효과를 나타냈다. 예를 들어, [화학식 1]의 화합물은 AS703026에 비해 100 배 이상 더 낮은 농도에서 현저히 우수한 분화능 및 베타아밀로이드로부터의 보호 효과를 나타냈다. 이러한 본 발명의 [화학식 1]의 화합물의 효과는 이 화합물의 MEK 1/2 억제 활성으로부터 예측되는 것보다 현저히 더 우수한 것이다.
본 발명에서 [화학식 1]로 표시되는 화합물은 신경줄기세포를 신경세포로 분화를 유도하는 용도로 전혀 사용된 적이 없는 물질로, ATP non-competitive binding을 통하여 MEK1과 MEK2 모두에 대한 활성을 저해하는 MEK1/2 억제제이면서 흑색종 및 비소세포암 치료제로 알려져 있을 뿐이었다.
본 발명의 다른 측면은 [화학식 1]로 표시되는 화합물 또는 다른 특정 MEK 1/2 억제제를 이용하여 신경줄기세포를 신경세포로 분화시키는 방법에 관한 것이다.
본 발명의 방법에서, 신경줄기세포는 공지된 방법에 따라 동물의 배아 및 성체의 뇌로부터 분리하여 사용할 수 있고, 시판되는 제품을 구입하여 사용하거나, 통상적인 배양방법에 따라 배양하여 사용할 수 있으며, 이는 특별히 한정되지 않는다. 본 발명의 실시예에서는 상기 신경줄기세포로 마우스 배아 14.5 일의 전두엽에서 분리한 것 및 8 주령 마우스의 부뇌실 구역에서 분리한 것을 사용하였다.
상기 신경줄기세포를 분화하기 이전에 배양 배지에 접종하고, 37°C에서 배양할 수 있다. 상기 신경줄기세포를 배양하기 위한 배지로는 성장인자를 추가한 무혈청 배지 조성 성분이면 제한되지 않는다. 상기 배지는 예를 들어, Dulbecco's Modified Eagle's Medium/Nutrient Mixture F12(DMEM/F12)(1:1)에 90-110 μM 푸트레신(putrescine), 20-40 nM 셀레나이트(selenite), 10-30 nM 프로게스테론(progesterone), 1.0-2.0 ㎎/㎖ 글루코오스(d-(+)-glucose), 20-30 ㎍/㎖ 인슐린(insulin), 0.05-0.2 mg/㎖ 아포-트랜스페린(apo-transferrin), 0.3-0.6 mM Glutamax, 50-150 IU/㎖ 페니실린(penicillin) 및 50-150 ㎍/㎖ 스트렙토마이신(streptomycin)로 이루어진 군으로부터 선택된 어느 하나 이상의 성분을 추가하고, 10-30 ng/㎖ bFGF, 10-30 ng/㎖ EGF 및 이들의 혼합물로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 추가한 것일 수 있다.
상기 신경줄기세포를 예를 들어, N2 배지[Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1), 100 μM 푸트레신(putrescine), 30 nM 셀레나이트(selenite), 20 nM 프로게스테론(progesterone), 1.55 ㎎/㎖ 글루코오스(d-(+)-glucose), 25 μg/㎖ 인슐린(insulin), 0.1 mg/㎖ 아포-트랜스페린(apo-transferrin), 0.5 mM Glutamax, 100 IU/㎖ 페니실린(penicillin), 100 ㎍/㎖ 스트렙토마이신(streptomycin)를 조성 성분으로 포함]에 성장인자를 추가하여 배양함으로써, 미분화된 신경줄기세포를 얻을 수 있다.
상기 배양된 신경줄기세포를 신경세포로 분화하는 것은, 상기 [화학식 1]로 표시되는 화합물을 포함하는 분화 유도용 조성물을 상기 신경줄기세포에 처리하고, 당업자에게 공지된 방법에 따라 분화시키는 것을 말한다. 예를 들면 신경줄기세포가 배양된 배지에 본 발명의 신경줄기세포의 분화 촉진용 조성물을 첨가하여 37°C에서 분화를 유도할 수 있다.
상기 신경줄기세포는 상기의 다양한 배양조건(배지의 성분, 상기 성분들의 함량, 배양 기간 등)에서 분화과정을 거쳐 신경세포로 분화되는데, 상기 배양 조건은 특별히 이에 제한되는 것은 아니나, 바람직하게는 35 내지 40°C에서 신경줄기세포로부터 신경세포로 분화를 유도할 수 있다. 만약 상기 배양 조건이 35°C 미만이거나 40°C를 초과하게 되면 신경줄기세포가 신경세포로 분화되기 이전에 사멸하는 문제가 발생한다.
또한, 상기 신경줄기세포는 상기 [화학식 1]로 표시되는 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물을 첨가하기 이전에 세포농도를 충분히 확보하거나, 신경줄기세포의 증식, 분화 또는 사멸 등의 세포 변화를 관찰하기 위하여 7 일 이하의 배양기간 내에, 상기 [화학식 1]로 표시되는 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물을 상술한 방법으로 처리하는 것이 바람직한데, 상기 신경줄기세포의 배양기간은 세포농도를 충분히 확보하기 위하여 최소 1 일 최대 7 일 이하의 배양기간인 것이 더욱 바람직하다.
또한, 상기 [화학식 1]로 표시되는 화합물은 1 nM 내지 20 μM 농도로 신경줄기세포에 처리하는 것이 바람직한데, 상기 [화학식 1]로 표시되는 화합물이 1 nM 미만이면 신경줄기세포의 분화유도 성능이 저하되는 문제가 발생하고, 20 μM 초과하면 세포 독성을 나타내는 문제가 발생한다. 화합물을 처리할 때 신경줄기세포는 통상 플레이트의 각 웰(well)이 약 70 내지 80%가 차도록 살포(seeding) 한다. 예를 들어 12-웰 플레이트의 경우는 웰 당 1x105개, 6-웰 플레이트의 경우는 웰 당 5x105개의 세포를 살포(seeding)한다.
더욱 바람직하게는 하기 실시예에서 후술하겠지만, 상기 [화학식 1]로 표시되는 화합물은 10 nM 내지 10 μM, 더욱 바람직하게는 10 nM 내지 100 nM의 농도로 처리하는 것이 바람직한데, 10 nM 농도 미만이면 신경줄기세포의 분화속도가 느려져 분화 유도 기간이 길어지므로 비경제적인 문제가 있고, 10 μM을 초과하게 되면 유효성분인 상기 [화학식 1]로 표시되는 화합물이 과량으로 첨가되기 때문에, 추후 생체 내에 투여될 시 세포 내 여러 신호전달경로에 영향을 미치는 MEK1과 MEK2 동시 억제 효과가 커지게 되어 원하지 않는 반응이 유도되어 일반 세포에도 영향을 미치는 문제가 발생할 수 있다.
상기 신경줄기세포 배양액에 MEK 1/2 억제제인 상기 [화학식 1]로 표시되는 화합물을 포함하는 신경줄기세포의 분화 촉진용 조성물을 첨가한 후, 분화완료까지 1 일 내지 7 일 간 소모되는 것을 특징으로 하는데, 바람직하게는 약 3 내지 5 일이 소요된다.
본 발명에 따른 신경줄기세포의 분화 촉진용 조성물은 신경퇴행성 질환을 앓고 있는 환자에게 적용될 경우, 환자 뇌에 존재하는 신경줄기세포가 신경세포로 분화되도록 유도하는 결과 신생된 신경세포가 손상 또는 손실된 신경세포를 대체하게 하여, 즉 신경세포신생(neurogenesis)에 의해 신경재생(neural regeneration 또는 neuro-regeneration)을 유도함으로써, 신경퇴행성 질환 등을 치료할 수 있는 예방 또는 치료용 조성물로 활용이 가능하다. 본 발명에서 “신경세포신생”(neurogenesis)은 신경줄기세포로부터 신경세포(neuron)가 생성되는 것을 말하고, 신경재생(neural regeneration 또는 neuro-regeneration)은 신경세포 사멸로 퇴행한 신경계 조직이 신경세포신생이 되면서 조직적으로, 기능적으로 재생되는 것을 말한다. 또한 본 발명에 따른 조성물은 베타아밀로이드 올리고머로부터 신경줄기세포 또는 신경세포를 보호하여 치료 또는 예방 효과를 나타낼 수 있다.
또한 신경퇴행성 질환과 관련된 신약개발에 있어 약물효과 검정 또는 각종 연구를 위한 재료로 폭 넓게 이용될 수 있다.
도 1은 실험예 1의 형태소 분석 결과로서, 마우스 배아 신경줄기세포에 트라메티닙과 피마설팁(AS703026)을 각각 다양한 농도로 처리하였을 때 신경줄기세포가 신경세포로 분화되는 것을 위상차 현미경으로 관찰한 결과이다. UD(Undifferentiated)와 D(Differentiated)는 시험 물질을 처리하지 않은 것으로서, 각각 실험예 1의 단계 1A에서 배양된 미분화된 마우스 배아 신경줄기세포와 단계 1B에서 배양된 분화된 신경줄기세포의 사진이다.
도 2는 실험예 2의 형태소 분석 결과로, 하단은 마우스 성체 신경줄기세포에 올리고머 형태의 베타아밀로이드(Aβ1-42)10 μM 처리한 군의 결과이고, 상단은 베타아밀로이드를 처리하지 않은 군의 결과이다. UD(Undifferentiated)와 D(Differentiated)는 시험 물질을 처리하지 않은 것으로서, 각각 실험예 2의 단계 1A에서 얻은 미분화된 마우스 성체 신경줄기세포와 단계 1B에서 얻은 분화된 성체 신경줄기세포의 사진이다. Trametinib(10 nM), Trametinib(100 nM), Memantine(5 μM), Memantine(10 μM), AS703026(10 μM) 은 실험예 2의 단계 1A에서 얻은 미분화된 마우스 성체 신경줄기세포에 각각의 물질을 각각의 농도로 처리하였을 때의 결과이다.
도 3은 비교예 1에 따라 14.5 일된 마우스 배아 신경줄기세포에 올리고머 형태의 베타아밀로이드 (Aβ) 10 μM을 처리한 군(하단)과 처리하지 않은 군(상단)의 세포 형태소의 비교 결과이다. UD(Undifferentiated)와 D(Differentiated)는 각각 시험물질을 처리하지 않은 상태의 비교예 1의 단계 1에서 얻은 미분화 또는 분화된 배아 신경줄기세포이다. Trametinib(100 nM), Memantine(10 μM), AS703026(10 μM)은 비교예 1의 단계 1에서 얻은 미분화된 마우스 배아 신경줄기세포에 각각의 물질을 각각의 농도로 처리하였을 때의 결과이다.
도 4는 실험예 3의 형광현미경 사진 결과이다. 첫번째 줄의 UD와 D는 각각 시험물질을 처리하지 않은 상태의 미분화 또는 분화된 배아 신경줄기세포이고, 두번째와 세번째 줄은 Trametinib과 AS703026을 각 농도로 처리하였을 때의 세포 사진이다. 파란색으로 염색된 점은 DAPI에 의해 염색된 신경계 세포의 핵을 나타내고, 적색의 길고 가늘게 뻗은 가지를 갖는 것은 로다민 부착 Tuj1에 의해 적색 형광을 띄는 신경세포이다.
도 5는 실험예 4-1의 결과로서, 다양한 농도의 트라메티닙과 AS703026을 마우스 배아 신경줄기세포에 처리하였을 때 신경세포 특이적 마커인 Tuj1(도 5a)과 도파민 신경세포 마커인 TH(도 5b)의 상대적 mRNA 발현량을 나타낸 것이다.
도 6은 실험예 4-2의 결과의 일부로서, 다양한 농도의 트라메티닙을 마우스 배아 신경줄기세포에 처리하였을 때 도파민 신경세포 마커인 TH(도 6a), 콜린성 신경세포 마커인 ChAT(도 6b), 운동신경세포 마커인 Isl1(도 6c), GABA성 신경세포 마커인 Gad1(도 6d)의 상대적 mRNA 발현량을 나타낸 것이다.
도 7은 실험예 4-2의 결과의 일부로서, 트라메티닙(Tra) 10 nM과 AS703026(AS) 10 μM을 마우스 성체 신경줄기세포에 처리하였을 때, 신경세포 마커인 Tuj1(도 7a), 콜린성 신경세포 마커인 ChAT(도 7b), 및 도파민 신경세포 마커인 TH(도 7c)의 상대적 mRNA 발현량을 나타낸 것이다.
도 8a는 실험예 5-1의 결과로서, MEK1, 또는 MEK1과 MEK2 둘 다의 발현이 억제된 마우스 배아 신경줄기세포의 신경세포로의 분화능을 분석하기 위해, RT-PCR을 통해 도파민 신경세포 마커(TH)의 발현유무를 확인한 결과이다.
도 8b는 실험예 5-1의 결과의 일부로서, shMEK1과 shMEK2를 이용하여 MEK1과 MEK2 중 어느 하나, 또는 MEK1과 MEK2 둘 다의 발현을 억제시킨 마우스 배아 신경줄기세포에서 Tuj1 및 TH의 상대적 mRNA 발현량을 확인하고, western blotting을 통해 각 단백질의 발현 유무를 확인한 결과이다.
도 8c는 실험예 5-2의 결과의 일부로서, CAMEK1, CAMEK2를 이용하여 MEK1과 MEK2 중 어느 하나, 또는 MEK1과 MEK2 둘 다의 발현을 활성화시킨 마우스 배아 신경줄기세포에서 Tuj1 및 TH의 상대적 mRNA 발현량을 확인하고, western blotting을 통해 각 단백질의 발현 유무를 확인한 결과이다.
도 9는 실험예 5-3의 결과로서, shMEK1과 shMEK2를 이용하여 MEK1과 MEK2 중 어느 하나, 또는 MEK1과 MEK2 둘 다의 발현을 억제시킨 마우스 성체 신경줄기세포에 베타아밀로이드(Aβ)를 처리하거나 처리하지 않았을 때 위상차 현미경에 의해 세포 형태를 관찰한 결과(도 9a) 및 신경세포 마커인 Tuj1의 상대적 mRNA 발현량을 분석한 결과(도 9b)이다.
도 10은 실험예 6의 결과로서, 도 10a 및 10b는 MEK 1/2 억제제인 트라메티닙, AZD8330, PD184352, 레파메티닙, PD318088, 비니메티닙, 및 AS703026를 0.1 μM, 1.0 μM, 10 μM의 농도로 마우스 배아 신경줄기세포에 처리한 후 위상차 현미경으로 세포의 형태를 관찰한 결과(도 10a)와 이 때 Tuj1의 상대적 mRNA 발현량을 분석한 결과(도 10b)이고, 도 10c는 PD0325901, RO5126766, BI847325 및 U0126을 마우스 성체 신경줄기세포에 처리한 후 위상차 현미경으로 세포의 형태를 관찰한 결과(도 10c)이다.
도 11은 실험예 7의 결과로서, 마우스 성체 신경줄기세포에 베타아밀로이드를 처리하거나 처리하지 않고서 MEK 1/2 억제제인 트라메티닙(0.1 μM), AS703026(10 μM), AZD8330(1 μM), PD318088 (1 μM), 비니메티닙(10 μM), 레파메티닙(1 μM), PD0325901(10 μM), RO5126766(10 μM), 및 MEK2에 비해 MEK1에 대해 선택적인 억제제로 알려진 코비메티닙(10 μM)을 투여한 후, 위상차 현미경으로 세포의 형태를 관찰한 결과이다. “-“로 표시한 행은 베타아밀로이드를 처리하지 않은 것이고, “Aβ1-42”로 표시한 행은 베타아밀로이드를 10 μM 처리한 것이다.
도 12는 실험예 8의 결과의 일부로서, 트라메티닙을 투여한 5XFAD 마우스의 대뇌 체성감각피질(somatosensory cortex) 부분의 절편에 대하여 면역조직화학염색방법으로 NeuN을 염색하여 현미경으로 관찰한 결과를 나타내는 사진(도 12a)과, 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시한 것이다(도 12b).
도 13은 실험예 8의 결과의 일부로서, 트라메티닙을 투여한 5XFAD 마우스의 대뇌 운동피질 부분의 절편에 대하여 면역조직화학염색방법으로 NeuN을 염색하여 현미경으로 관찰한 결과를 나타내는 사진(도 13a)과, 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시한 것이다(도 13b).
도 14는 실험예 8의 결과의 일부로서, 트라메티닙을 투여한 5XFAD 마우스의 해마이행부(hippocampus의 subiculum) 부분의 절편에 대하여 면역조직화학염색방법으로 NeuN을 염색하여 현미경으로 관찰한 결과를 나타내는 사진(도 14a)과 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시한 것이다(도 14b).
도 15는 실험예 9-1의 결과로서, 트라메티닙을 투여한 5XFAD 마우스의 대뇌 체성감각피질 부분 절편에 대하여 면역조직화학염색 방법으로 Tuj1을 염색하여 현미경으로 관찰한 결과를 나타내는 사진이다. 사진에서 화살표(→)로 표시한 부분은 Tuj1이 염색된 세포를 나타내고, 화살표의 머리(▼)로 표시한 것은 베타아밀로이드 응집으로 인한 플라크를 나타낸다.
도 16은 실험예 9-2 및 9-3의 결과로서, 트라메티닙을 투여한 5XFAD 마우스의 해마의 치아이랑(Dentate gyrus) 부분의 절편에서 Nissl, NeuN, Dcx 및 BrdU를 염색하여 현미경으로 관찰한 결과를 나타내는 사진(도 16a) 및 BrdU가 염색된 세포의 수를 계수한 결과이다(도 16b). 도 16a의 사진에서 화살표(→)로 표시한 부분은 Dcx가 염색된 세포를 나타내고, 화살표의 머리(▼)로 표시한 것은 BrdU가 염색된 세포를 나타낸다.
도 17은 실험예 10의 결과로서, 트라메티닙을 투여한 5XFAD 마우스의 해마이행부(hippocampus의 subiculum)와 대뇌체성감각피질 부분 절편에 대하여 세포사멸(apoptosis)을 확인할 수 있는 TUNEL(Terminal deoxynucleotidyl transferase dUTP nick end labeling) 염색을 수행한 후 현미경으로 관찰한 결과를 나타내는 사진이다. 해마이행부에서 세포사멸이 일어나 녹색 형광을 띄는 세포를 화살표(→)로 표시하였다.
도 18은 실험예 11의 결과로서, 트라메티닙을 투여한 5XFAD 마우스의 소뇌 부분의 절편을 Tuj1 및 calbindin으로 염색하여 소뇌의 푸르킨예 세포(Purkinje neuron)를 현미경으로 관찰한 결과를 나타내는 사진이다. 각 처리군별로 2개(Tuj1 염색) 또는 3개(calbindin 염색)의 슬라이드에 대한 사진을 첨부하였다.
도 19는 실험예 12의 결과로서, 트라메티닙을 투여한 5XFAD 마우스 뇌의 반구(hemisphere)를 이용하여 western blotting을 통해 pERK 단백질의 발현 유무를 확인하고(도 19a) 이를 정량화한 결과(도 19b)이다.
도 20은 실험예 13의 결과로서, 트라메티닙을 투여한 5XFAD 마우스 뇌의 반구(hemisphere)를 이용하여 ELISA(enzyme-linked immunosorbent assay) 방법을 통해 Aβ40과 Aβ42의 양을 측정하고, Aβ40과 Aβ42의 비율을 측정한 결과이다.
상기 각 도면의 그래프에서 별표(*)는 통계적으로 t-test 결과 각각 다음을 의미한다: *: P < 0.05, **: P < 0.01, ***: P < 0.005.
본 발명자들은 본 발명의 [화학식 1]의 화합물을 신경줄기세포에 처리할 경우 신경세포 마커인 Tuj1의 발현이 증가하고, 도파민 신경세포 마커인 TH, GABA성(GABAergic) 신경세포 마커인 Gad1, 운동(motor) 신경세포 마커인 Isl1, 및 콜린성(Cholinergic) 신경세포 마커인 ChAT의 발현이 모두 증가함을 확인하였다(실험예 4). 이는 [화학식 1]의 화합물에 의해 신경줄기세포가 도파민 신경세포, GABA성(GABAergic) 신경세포, 콜린성(Cholinergic) 신경세포, 운동(motor) 신경세포와 같은 다양한 종류의 신경세포로 분화가 유도될 수 있음을 의미한다. 따라서, 본 발명의 [화학식 1]의 화합물은 다양한 신경세포의 손실 또는 손상이 원인이 되는 다양한 신경퇴행성 질환의 치료에 사용될 수 있다. 예를 들어, 파킨슨병은 주로 도파민 신경세포의 손실과 관계가 있고, 근위축성 측삭 경화증(루게릭병, ALS), 진행성 연수마비(progressive bulbar palsy; PBP), 진행성 근 위축증(progressive muscular atrophy; PMA), 원발성 측삭 경화증(primary lateral sclerosis; PLS), 가성연수마비(pseudobulbar palsy) 유전성 강직성 하반신마비(hereditary spastic paraplegia; HSP) 등의 운동신경세포병(motor neuron disease)은 운동신경세포(motor neuron)의 손실과 관계가 있으며, 알츠하이머병, 혈관성치매, 노인성치매를 비롯한 치매는 주로 콜린성 신경세포의 손실과 관련이 있다. 또한 헌팅턴병은 주로 대뇌기저핵(basal ganglia)의 선조체(striatum)에서의 GABA성 중간크기 가시뉴런(Medium spiny neurons)의 손실과 관련이 있다.
특히 [화학식 1]의 화합물은 알츠하이머병의 주요 병리적 특징인 베타아밀로이드로부터 신경줄기세포를 보호하면서 이를 신경세포로 분화될 수 있도록 하기 때문에, 알츠하이머병 치료제로서 매우 유용하게 이용될 수 있다.
또한 본 발명자들은 [화학식 1]의 화합물이 사람의 치매 유전자를 가진 알츠하이머 마우스(5xFAD)의 해마이행부(subiculum)와 대뇌피질의 layer 5 부분에서 신경세포의 수를 증가시킴을 확인하였다(실험예 8). 5xFAD 마우스는 사람의 가족성 알츠하이머병을 초래하는 것으로 알려진 APP(amyloid precursor protein)와 프레세닐린(PSEN1) 유전자 돌연변이를 갖는 마우스로서, 해마이행부와 대뇌피질의 layer 5에 아밀로이드의 침착이 높고 그 부위의 신경세포가 손실되어 있는 마우스이다. 이 마우스 모델에서 본 발명의 [화학식 1]의 화합물이 신경세포의 수를 증가시켰다는 것은 [화학식 1]의 화합물이 생체내에서 신경줄기세포를 신경세포로 분화시켜서 신경세포의 수를 증가시키고/거나 베타아밀로이드로부터 신경세포를 보호함을 확인하는 것이다.
또한 [화학식 1]의 화합물은 5xFAD 마우스 대뇌피질의 다양한 부위, 특히 운동(motor cortex), 체성감각(somatosensory cortex) 피질 부분에서 대조군에 비하여 신경세포의 수를 증가시켰다(실험예 8, 도 12, 13). 이는 [화학식 1]의 화합물이 상기 부분의 신경세포 손실에 의해 발생하는 질병, 예를 들어 근위축성 측삭 경화증 등의 운동신경세포병의 치료에 사용될 수 있음을 의미한다
또한, 상기 5xFAD 마우스의 소뇌(cerebellum)에서 [화학식 1]의 화합물은 대조군과 대비하여 푸르킨예 세포(Purkinje neuron)의 액손의 분지형성(arborization)을 증가시키거나 액손 구조를 보전시켰다(실험예 11, 도 18). 이는 [화학식 1]의 화합물이 소뇌의 푸르킨예 세포의 손실 또는 손상이 원인이 되어 발생하는 소뇌성 운동실조증(cerebellar ataxia)의 치료에 사용될 수 있음을 의미한다.
[화학식 1]의 화합물은 신경세포를 신생시키거나(neurogenesis) 신경세포를 보호하거나, 둘 다의 효과를 나타내며, 이를 통해 신경재생(neural regeneration 또는 neuro-regeneration)을 유도하는 효과를 갖는다. 실험예 9의 결과에서 보는 바와 같이, [화학식 1]의 화합물은 알츠하이머병 모델 마우스(5xFAD)의 대뇌 체성감각피질 부분에서 신경세포신생 과정 중에 있는 신경세포의 마커인 Tuj1 발현을 증가시키고, 해마 치아이랑(dentate gyrus)의 subgranular zone(SGZ)에서 신경세포신생 과정 도중에 특징적으로 나타나는 type 2 또는 type 3 세포 모양의 세포를 증가시켰으며(도 16의 Nissl 및 NeuN 염색의 결과), DCX를 발현하는 미성숙 신경세포와 BrdU 염색이 되는 분열 중인 세포의 수를 증가시켰다(도 16). 이는 트라메티닙이 마우스의 대뇌피질 및 해마 치아이랑 부분에서 신경세포신생을 유도한 것임을 뒷받침한다.
또한, [화학식 1]의 화합물은 5xFAD 마우스에서 TUNEL assay로 확인할 수 있는 사멸하고 있는 세포의 수를 줄이고(실험예 10, 도 17), 소뇌 푸르킨예(Purkinje) 세포의 액손 분지형성 증가 또는 액손 구조 보전(실험예 11, 도 18), 및 뇌 조직의 Aβ(1-42)/Aβ(1-40)의 비율 감소(실험예 13, 도 20) 효과를 나타냈다. 이는 [화학식 1]의 화합물이 신경세포의 손실 또는 손상이 일어나는 환경에서 신경세포를 보호하고 신경세포의 상태 또는 활성을 향상시켜 신경재생에 이바지할 수 있음을 나타낸다.
따라서, 본 발명의 또 다른 측면은 [화학식 1]의 화합물을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학 조성물, 또는 [화학식 1]의 화합물을 이용하여 신경퇴행성 질환을 예방 또는 치료하는 방법, 또는 신경퇴행성 질환의 예방 또는 치료에 사용하기 위한 [화학식 1]의 화합물에 관한 것이다. 본 발명에서 [화학식 1]의 화합물 대신 신경줄기세포를 신경세포로 분화되도록 유도하면서 동시에 베타아밀로이드와 같은 독성물질로부터 신경줄기세포와 신경세포를 보호하는 다른 MEK 1/2 억제제를 사용할 수 있는데, [화학식 1]의 화합물을 사용하는 것이 특히 바람직하다.
앞서 언급된 바와 같이, 신경퇴행성 질환은 신경세포(뉴런)의 점진적인 구조적, 기능적인 손실로 인해 발생하는 정신적, 신체적 기능의 퇴화 질환을 의미하는 것으로, 구체적으로는, 치매, 알츠하이머병, 혈관성치매, 노인성치매, 전두측두엽치매, 루이소체치매, 파킨슨병, 다계통위축증, 피질기저핵변성(corticobasal degeneration), 진행성 핵상마비, 헌팅턴병, 근위축성 측삭 경화증(루게릭병, ALS), 원발성측삭경화증, 척수근육위축병, 진행성 연수마비(progressive bulbar palsy; PBP), 진행성 근위축증(progressive muscular atrophy; PMA), 가성연수마비(pseudobulbar palsy), 유전성 강직성 하반신마비(hereditary spastic paraplegia; HSP), 소뇌성 운동실조증, 크로이츠펠트-야콥병, 다발성경화증, 길랑-바레 증후군 등으로부터 선택된 질환 등을 포함한다.
특히 본 발명에 따른 [화학식 1]로 표시되는 화합물은 기존 항암효과를 보이는 농도보다 낮은 농도에서도 현저한 분화 유도 효과 및 신경세포 보호 효과를 보이기 때문에, 항암제로서의 용량보다 낮은 용량에서 보다 안전하게 투여될 수 있다. [화학식 1] 화합물을 항암제로 사용하는 경우의 권장용량은 2mg 1일 1회 경구 투여이고, 부작용으로 용량의 감량이 필요한 경우 1.5mg 1일 1회, 1mg 1일 1회까지 감량한다. 본 발명에서 [화학식 1]의 화합물을 5xFAD 마우스에서 실험한 경우 0.1 mg/kg/일의 낮은 용량에서도 신경줄기세포의 분화 효과를 나타낸 것을 확인할 수 있었다. 이 용량은 60 kg 사람에 해당하는 용량으로 변환시 0.48 mg/일에 해당한다(Journal of Basic and Clinical Pharmacy 2016;7(2):27-31).
한편, 본 명세서에서 용어 '유효성분으로 포함하는'이란 본 발명의 신경퇴행성 질환을 억제하는 데 충분한 양을 포함하는 것을 의미한다.
본 발명의 예방 또는 치료용 조성물은 당업계에 일반적인 제형 예컨대 경구투여제 혹은 주사제 등의 비경구 투여 형태로 제조될 수 있다.
본 발명에 따른 약학 조성물은 약제의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있으며, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제, 패치제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명의 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 크로스카멜로오스나트륨, 하이드록시프로필메틸셀룰로오스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 소듐 라우릴 설페이트, 콜로이드성 이산화규소, 크로스카멜로오스나트륨 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘(calcium carbonate), 슈크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제, 패치제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세롤젤라틴 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 전신 투여 또는 국소 투여가 가능 하다.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 예를 들어, 본 발명의 조성물은 1일 0.0001 내지 10 g/kg으로, 바람직하게는 0.001 내지 8 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 바람직하게는, 상기 [화학식 1]로 표시되는 화합물은 1일 0.1mg 내지 10mg, 0.1mg 내지 5mg, 0.1mg 내지 2mg, 0.1mg 내지 1mg, 0.1mg 내지 0.5mg, 0.25mg 내지 2mg, 0.25mg 내지 1mg, 0.25mg 내지 0.5mg, 0.5mg 내지 2mg, 0.5mg 내지 1mg의 범위 내에서 투여할 수 있다. 예를 들어, [화학식 1]의 화합물은 1일 0.1mg, 0.125mg, 0.25mg, 0.5mg, 0.75mg, 1 mg, 1.5mg, 2mg의 용량으로 투여할 수 있다.
본 발명의 다른 측면에서, 본 발명은 알츠하이머병을 비롯한 신경퇴행성 질환을 모사한 환경에서 신경줄기세포를 신경세포로 분화 유도하면서 동시에 신경세포를 보호할 수 있는 물질을 스크리닝하는 방법에 관한 것이다. 본 발명의 스크리닝 방법은 베타아밀로이드, MPTP(1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), 로테논(Rotenone), 옥시도파민(oxidopamine), 글루타메이트(glutamate), LPS (lipopolysaccharide), S100B(S100 calcium-binding protein B)와 같은 신경세포 손상 유발 물질과 마우스 유래 신경줄기세포를 이용하는 것으로서, 다음과 같은 단계를 포함한다.
1) 성체 마우스 유래의 신경줄기세포에 베타아밀로이드(특히 올리고머 형태의 베타아밀로이드), MPTP(1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), 로테논, 옥시도파민, 글루타메이트, LPS (lipopolysaccharide), S100B(S100 calcium-binding protein B)와 같은 신경세포 손상 유발 물질을 처리하는 단계;
2) 시험 물질을 상기 신경세포 손상 유발 물질이 처리된 신경줄기세포에 투여하는 단계; 및
3) 세포의 형태소(morphology) 분석을 통해 신경줄기세포의 분화 및 세포 사멸 여부를 확인하는 단계.
상기 스크리닝 방법에서 신경줄기세포는 마우스로부터 유래된 것을 사용하는 것이 바람직하다. 마우스와 같은 동물의 신경줄기세포를 사용하면 인간의 신경줄기세포를 사용하는 것에 비하여 세포 배양이 용이하고, 윤리적인 면에서도 이점이 있다. 또한 인간 신경줄기세포의 경우 마우스와는 달리 배지를 자주 교체해 줘야 하고 고가의 성장 인자가 필요하나, 마우스의 신경줄기세포를 사용하면 이러한 단점을 피할 수 있다. 더욱이 인간 신경줄기세포는 세포의 증폭(expansion)과 분화에 각각 7 일 이상의 시간이 소요되는 반면 마우스의 신경줄기세포는 세포의 증폭에 3 내지 4 일 정도가 소요되며 분화기간도 짧아서 신속하게 스크리닝하는 것이 가능하다.
상기 신경줄기세포는 마우스의 성체의 뇌로부터 분리하여 배양하여 사용할 수 있다. 마우스 성체 신경줄기세포는 8 주령 내지 12 주령, 예를 들어 8 주령 마우스의 부뇌실 구역에서 분리한 것을 사용할 수 있다. 통상적으로 마우스의 신경줄기세포는 수정 후 12 내지 16 일된 마우스 배아(embryo)의 전두엽에서 분리하여 배양하는 경우가 많다. 마우스 배아 신경줄기세포는 마우스 성체 유래의 신경줄기세포에 비하여 줄기세포능(stemness)이 더 강하여 독성 환경에 더 잘 견딜 것으로 예상된다. 그러나 본 발명자들이 마우스 배아 신경줄기세포에 베타아밀로이드를 처리하였을 때 시험물질의 처리와 관계 없이 세포가 모두 사멸하여 신경세포로의 분화를 관찰할 수가 없었다(비교예 1 및 도 3 참조). 이와는 달리, 마우스 성체의 뇌에서 분리한 신경줄기세포는 베타아밀로이드에 세포가 견디는 능력이 더 강하여, 알츠하이머병 모사 환경에서의 신경줄기세포 분화 유도 물질 스크리닝에 적합하다는 것을 발견하였다. 따라서, 본 발명의 방법에서는 성체 마우스의 신경줄기세포를 사용한다.
마우스 성체에서 분리한 신경줄기세포를 분화되기 이전에 배양 배지에 접종하고, 37°C에서 배양할 수 있다. 상기 신경줄기세포를 배양하기 위한 배지로는 성장인자를 포함하는 무혈청 배지 조성 성분을 사용하는 것이 좋은데, 바람직하게는 처음에 성체 마우스에서 신경줄기세포를 분리할 때에는 성장인자를 포함하는 IPM 배지를 이용하여 배양하고 뉴로스피어가 형성된 이후 단일세포로 분리하여 배양할 때에는 N2 배지를 사용할 수 있다. 또한, 상기 IPM 배지는 Neurobasal medium에 1-4 % B27 supplement, 0.5-2 % Glutamax, 100 IU/㎖ 페니실린(penicillin), 100 ㎍/㎖ 스트렙토마이신(streptomycin)을 함유할 수 있으며, N2 배지는 Dulbecco's Modified Eagle's Medium/Nutrient Mixture F12(DMEM/F12)(1:1)에 90-110 μM 푸트레신(putrescine), 20-40 nM 셀레나이트(selenite), 10-30 nM 프로게스테론(progesterone), 1.0-2.0 ㎎/㎖ 글루코오스(d-(+)-glucose), 20-30 ㎍/㎖ 인슐린(insulin), 0.05-0.2 mg/㎖ 아포-트랜스페린(apo-transferrin), 0.3-0.6 mMGlutamax, 50-150 IU/㎖ 페니실린(penicillin) 및 50-150 ㎍/㎖ 스트렙토마이신(streptomycin)로 이루어진 군으로부터 선택된 어느 하나 이상의 성분을 추가하고, 10-30 ng/㎖ bFGF, 10-30 ng/㎖ EGF 및 이들의 혼합물로 이루어진 군으로부터 선택된 어느 하나 이상의 성장인자를 추가한 것일 수 있다. 성장인자는 신경줄기세포를 미분화된 상태로 유지하는 역할을 하는데, 배지에 성장인자를 포함시켜서 신경줄기세포를 배양하여 분화가 억제된 상태에서 시험물질을 처리해야 시험물질에 의한 신경줄기세포의 분화 유도 효과를 정확히 판단할 수 있다.
본 발명의 스크리닝 방법에서 베타아밀로이드는 시판되는 것을 사용할 수 있고, 예를 들면 Gibco (Waltham, MA)사에서 입수할 수 있다. 특히 인간 유래의 것을 사용하는 것이 바람직하다. 베타아밀로이드는 40개의 아미노산으로 이루어진 Aβ(1-40)과 42개의 아미노산으로 이루어진 Aβ(1-42)가 가장 흔한 형태인데, 이 중 Aβ(1-42)가 Aβ(1-40)보다 응집체를 형성하는 경향이 더 강하며 특히 독성이 강한 트라이머나 테트라머를 형성하는 경향이 강하여 알츠하이머병의 질병 상태와 연관성이 더 크다고 여겨지고 있다(Dahlgren, et al. (2002) Oligomeric and Fibrillar Species of Amyloid-β Peptides Differentially Affect Neuronal Viability. J. Biol. Chem. 277(35):32046-32053; K. Murakami (2014) Conformation-specific antibodies to target amyloid β oligomers and their application to immunotherapy for Alzheimer’s disease. Biosci. Biotechnol. Biochem. 78(8):1293-1305). 따라서 본 발명의 스크리닝 방법에서는 Aβ(1-42), 특히 Aβ(1-42)의 올리고머 형태를 사용하는 것이 바람직하다.
본 발명의 스크리닝 방법에서 올리고머 형태의 Aβ는 24개 미만, 바람직하게는 12개 이하의 Aβ 단량체의 응집체, 더욱 바람직하게는 Aβ의 테트라머(tetramer)와 트라이머(trimer)로 주로 이루어진 혼합물로서, Aβ의 프로토피브릴이나 피브릴을 거의 포함하지 않는 것이다. 본 발명에서 Aβ(1-42)의 올리고머 형태는 문헌[Dahlgren, et al. (2002) Oligomeric and Fibrillar Species of Amyloid-β Peptides Differentially Affect Neuronal Viability. J. Biol. Chem. 277(35):32046-32053]에 개시된 방법을 사용하여 제조할 수 있다. 구체적으로, Aβ(1-42)를 헥사플루오로이소프로파놀(HFIP)에 녹인 후 진공 하에서 건조시키고, 건조된 펩티드를 5 mM이 되도록 DMSO에 재현탁 시킨다. DMEM/F12(without phenol red)를 첨가하여 펩티드가 100 μM의 농도로 되도록 한 후, 4 ℃에서 24 시간 배양한다.
본 발명의 스크리닝 방법에서 MPTP는 신경독소인 MPP+ (1-methyl-4-phenylpyridinium)에 대한 프로드럭으로서, MPP+은 뇌의 흑질에서 도파민성 뉴런을 파괴함으로써 파킨슨병의 증상을 영구적으로 유발시킨다. MPTP는 파킨슨병 동물 모델에서 파킨슨병의 증상을 유발하기 위하여 사용된다.
로테논(Rotenone)은 세포 내 미토콘드리아 complex I 의 활성을 저해함으로써, 뇌 흑질 도파민 신경세포의 퇴행을 유발하는 물질로, 파킨슨병의 병리학적 특징을 유발하는 것으로 알려져 있다.
옥시도파민(oxidopamine)은 6-히드록시도파민(6-OHDA) 또는 2,4,5-트리히드록시페네틸아민(trihydroxyphenethylamine)으로도 불리며, 뇌에서 도파민성 및 노르아드레날린성 뉴런을 선택적으로 파괴시키기 위하여 연구자들이 사용하는 신경독성 화합물이다. 옥시도파민은 도파민 및 노르아드레날린 재흡수 수송체(reuptake transporter)를 통해 뉴런에 들어간다고 생각된다. 옥시도파민은 도파민성 뉴런을 선택적으로 손상시키기 위하여 선택적 노르아드레날린 재흡수 억제제(예를 들어 데시프라민)과 함께 사용되기도 한다.
글루타메이트는 중추신경계에서 주요 흥분성 신경전달물질로 작용하는데, 고농도로 존재할 때 신경세포에 손상을 입혀 세포 사멸을 일으키는 것으로 알려져 있다. 글루타메이트의 신경흥분독성(excitotoxicity)은 허혈이나 외상성 뇌 손상과 같은 급성 CNS 손상뿐만 아니라, ALS, 다발성 경화증, 파킨슨병 등의 만성 신경퇴행성 질환과도 관련되어 있다.
LPS (lipopolysaccharide)는 그람음성세균의 세포 표면을 구성하는 물질로서, 예를 들어 살모넬라 티피무리움(Salmonella typhimurium)(Sigma, St. Louis, MO)에서 분리한 것을 사용할 수 있다. LPS는 동물에서 강한 면역 반응을 일으키고, 신경계에서 소교세포(microglia)를 활성화시켜 염증 반응을 유발한다. 비정상적으로 과다 활성화된 소교세포에 의한 염증 매개물의 분비는 면역계의 항상성을 교란시켜서 다발성 경화증, 알츠하이머병, 파킨슨병 등과 같은 중추신경계 자가면역질환 관련 퇴행성 질환을 유발하고 진전시킨다.
S100B는 성상세포(astrocyte)에 의해 분비되고 발현되는 칼슘 결합 단백질이다. S100B는 신경세포 발달과 유지에 있어서 신경영양성 활성(neurotrophic activity)을 갖고, 정상 뇌의 인지 기능에 영향을 미친다. 그러나, S100B 수준의 비정상적 상승은 교세포를 활성화시키고 신경염증 반응을 일으키므로 신경세포에 유해하다.
본 발명의 스크리닝 방법에서 베타아밀로이드와 같은 신경세포 손상 유발 물질은 시험 물질 처리 전에 신경줄기세포에 처리한다. 종래 신경세포에 시험물질 처리하고 일정 시간이 지난 후에 베타아밀로이드를 처리하여 시험물질의 신경세포 보호 효과를 관찰하는 방식으로 행해진 실험예가 있으나(예: 대한신경과학회지 21(2):174~182, 2003), 이러한 방식으로는 베타아밀로이드가 이미 뇌 내에 존재하고 있는 상태에서 약물을 투여 받게 되는 알츠하이머병 치료 상황을 모사할 수 없다. 본 발명에서와 같이 신경줄기세포에 베타아밀로이드를 먼저 처리한 후 시험물질을 처리하여야 질환 치료를 시도하는 시점에서의 알츠하이머병 환자의 뇌내 환경에 가깝게 모사할 수 있다.
신경세포 손상 유발 물질의 처리 후 시험물질을 신경줄기세포에 처리하고, 성장인자를 매일 처리해 주면서 추가로 배양한다. 시험물질 처리 후 빠르면 12시간, 늦어도 48~72시간 뒤에 시험물질이 신경줄기세포 분화 유도 효과를 보이는지 여부를 형태소(morphology) 분석으로 확인할 수 있다.
형태소 분석은 위상차 현미경으로 세포의 형태를 관찰하여 판단한다. 도 2 상단의 UD(미분화)와 D(분화)로 표시한 사진으로부터 알 수 있는 바와 같이, 신경줄기세포가 분화된 경우(D)에는 분화되지 않은 경우(UD)와 뚜렷이 구별된다. 분화되지 않은 경우(UD)에는 세포 몸체(cell body)가 넓고, 액손이나 덴드라이트와 같은 신경돌기(neurite)의 모양을 확인하기 어려우며, 세포가 계속 분열하고 있어 전체적인 세포의 수가 많다. 반면 분화된 경우(D)에는 세포의 몸체가 작고 동그랗게 변한 대신 신경돌기가 가늘고 길게 뻗어 나와 있다.
본 발명의 스크리닝 방법에서 사용하는 신경줄기세포는 통상의 세포주나 암세포주에 비하여 비교적 연약한 세포이므로, 시험 물질의 독성에 민감하게 반응한다. 시험물질이 세포 독성을 나타내는 경우, 현미경으로 사멸된 세포를 관찰할 수 있어, 분화 유도 효과 관찰 시 시험물질의 독성 여부도 한번에 판별할 수 있다.
본 발명의 스크리닝 방법에 따르면 알츠하이머병과 같은 신경퇴행성 질환 환자의 뇌 내 환경을 모사한 상태에서 신경줄기세포의 분화 유도 효과를 갖는 물질을 스크리닝할 수 있어서 신경퇴행성 질환의 근본적 치료제 후보 물질의 스크리닝 방법으로서 적합하다. 또한 별도의 시험분석이 필요 없이 세포 모양의 관찰만으로 신경줄기세포의 분화 여부를 판별할 수 있어서 편리하다. 또한 일반적으로 성장인자가 포함되지 않은 배지로 배양하여 자연적인 분화를 유도하는 경우 신경줄기세포의 분화는 최소 48시간 이후가 되어야 세포의 형태가 변하는 것을 관찰할 수 있으나, 매우 분화 효능이 좋은 물질의 경우 성장인자가 포함된 배지에 배양을 하는 상태임에도 불구하고 시험 물질 처리 후 빠르면 12시간, 늦어도 48~72시간 뒤에는 분화효과를 보이는지 여부를 확인할 수 있어 신속하며, 시험 물질의 독성 여부도 분화 유도 효과 여부와 동시에 관찰할 수 있어서 효율적이다.
또한, 본 발명은 상기와 같은 스크리닝 방법을 수행할 수 있는 키트에 관한 것이다. 본 발명의 스크리닝용 키트는 마우스 성체 유래의 신경줄기세포, 베타아밀로이드, MPTP, 로테논, 옥시도파민, 글루타메이트, LPS, 또는 S100B과 같은 신경세포 손상 유발 물질, 성장인자, 배지, 기타 세포 배양용 첨가물, 세포 배양용 플레이트(코팅된 것이거나 별도의 코팅 용액 포함)을 포함할 수 있다.
이하에서 실시예 등을 통해 본 발명을 더욱 상세히 설명하고자 하며, 다만 이하에 실시예 등에 의해 본 발명의 범위와 내용이 축소되거나 제한되어 해석될 수 없다. 또한, 이하의 실시예를 포함한 본 발명의 개시 내용에 기초하면, 구체적 실험 결과가 제시되지 않은 실시태양도 통상의 기술자가 용이하게 실시할 수 있으며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속하는 것도 당연하다.
실험예 1: 마우스 배아 신경줄기세포에서 [화학식 1] 화합물의 신경줄기세포 분화능 확인
단계 1: 마우스 배아 신경줄기세포 배양
단계 1A: 미분화 상태로의 마우스 배아 신경줄기세포 배양
마우스 배아 14.5 일의 뇌에서 신경줄기세포를 분리하고, N2 배양 배지(medium)에 10 ng/㎖ 염기성 섬유아세포 성장인자(human basic fibroblast growth factor, bFGF)(Peprotech, Princeton, NJ, cat#. 100-18B)와 20 ng/㎖ 인간 표피 성장인자(human epidermal growth factor, EGF)(Peprotech, cat#. AF-100-15)를 처리하여 25 ㎠ 플라스크(Nunc, Pittsburgh, PA)에서 4 일간 현탁액(suspension) 상태로 배양하였다. 2 일 이후부터 뉴로스피어(neurosphere)가 형성되는 것을 관찰할 수 있었다.
단일세포(single cell) 분리를 위하여 하루 전, 15 ㎍/㎖ 폴리-L-오르니틴(poly-L-ornithine)(Sigma, St. Louis, MO, cat#.P2533) 용액을 6-웰 플레이트에 처리하여 37℃에서 하루 동안(overnight) 코팅하였다(incubation). 실험 당일, 폴리-L-오르니틴 용액을 제거하고, PBS로 3번 플레이트를 씻었다(washing). 이어서 10 ㎍/㎖ 파이브로넥틴(fibronectin)(Gibco, Waltham, MA, cat#. 33016015) 용액을 넣고 다시 37℃에서 2시간 동안 코팅했다(incubation). 플레이트 준비가 완료 되면, 형성된 뉴로스피어에 TryPLE (Gibco, Cat#. 12604013)를 처리하여 단일세포(single cell)로 분리한 후, 세포의 수를 세어 4~5X105 개의 세포가 200~300 μl의 배양액(10 ng/㎖ bFGF 및 20 ng/㎖ EGF를 포함하는 N2 배양배지)에 포함되도록 준비하였다. 세포를 살포(seeding)하기 직전에 코팅 용액을 석션(suction)하고 플레이트가 마르기 전에 골고루 잘 살포하였다(seeding). 약 1분간 세포들이 플레이트에 부착될 수 있도록 두었다가 세포가 어느 정도 부착이 된 것을 관찰한 후 1.5 ml의 배양배지(10 ng/㎖ bFGF 및 20 ng/㎖ EGF를 포함하는 N2 배양배지)를 더 추가하여 주고, 37℃ 인큐베이터에서 배양하였다.
이때, 상기 N2 배양 배지의 성분은 다음과 같다.
Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1)(Gibco, cat#. 11320033), 100 μM 푸트레신(putrescine)(Sigma, cat#. 51799), 30 nM 셀레나이트(selenite)(Sigma, cat#. S5261), 20 nM 프로게스테론(progesterone)(Sigma, cat#.P0130), 1.55 ㎎/㎖ 글루코오스(d-(+)-glucose)(Sigma, cat#.G8270), 25 ㎍/㎖ 인슐린(insulin)(Gibco, cat#. 12585014), 0.1 mg/㎖ 아포-트랜스페린(apo-transferrin)(Sigma, cat#.T1147), 0.5 mM Glutamax(Gibco, cat#. A1286001), 100 IU/㎖ 페니실린(penicillin)(Gibco, cat#. 15140122), 100 ㎍/㎖ 스트렙토마이신(streptomycin)(Gibco, cat#. 15140122)
단계 1B: 분화를 억제하지 않은 상태의 신경줄기세포의 배양
단일세포로 분리하여 살포할 때, bFGF와 EGF를 처리하지 않은 것을 제외하고 상기 1A에서와 동일하게 마우스 배아 신경줄기세포를 배양하였다.
단계 2: 시험 물질의 처리
단계 1A에서 배양된 마우스 배아 신경줄기세포에 다양한 농도의 [화학식 1]의 화합물(이하, '트라메티닙'이라고도 한다)(Medchem express, Monmouth Junction, NJ, cat#. HY-10999A) 및 AS703026(피마설팁)(Selleckchem, Houston, TX, cat#.S1475)을 매일 처리해 주면서 4 일 동안 배양하였다.
단계 3: 형태소 분석
배양 4 일째에 위상차 현미경으로 세포의 모양을 관찰하였고, 그 결과를 도 1에 나타냈다.
도 1에서 UD(undifferentiated: 미분화)는 시험물질을 처리하지 않은 단계 1A에서 얻은 미분화된 마우스 배아 신경줄기세포이고, D(Differentiated: 분화됨)는 시험물질을 처리하지 않은 단계 1B에서 얻은 분화된 마우스 배아 신경줄기세포이다. UD 군의 미분화 신경줄기세포는 세포 몸체(cell body)가 넓고, 신경돌기(neurite)의 모양을 확인하기 어려우며, 세포가 계속 분열하고 있어 전체적인 세포의 수가 D 군에 비하여 많다. D 군의 분화된 세포는 세포 몸체가 작고 동그랗게 변한 대신 신경돌기가 가늘고 길게 뻗어 나와 UD 군 세포와 모양이 확연히 구별된다.
도 1에 나타난 바와 같이, [화학식 1]의 화합물(Trametinib)은 10 nM, 25 nM, 및 100 nM(0.1 μM)의 낮은 농도에서 신경줄기세포로부터 신경세포로의 분화를 잘 유도하였다. AS703026을 처리한 군은 트라메티닙을 처리한 군보다 100배 이상 높은 농도인 1.0 μM에서 신경세포 분화가 관찰되기 시작하였다.
상기 결과를 종합하면 [화학식 1]의 화합물(트라메티닙)이 신경줄기세포로부터 신경세포로의 분화를 유도하며, 특히 매우 낮은 농도(10 nM 이상)에서도 이러한 효과가 현저함을 알 수 있고, 이는 [화학식 1]의 화합물이 신경줄기세포를 신경세포로 분화되도록 유도하는 조성물 및 분화 방법에 이용되고, 신경퇴행성 질환의 치료에 이용될 수 있음을 시사한다.
실험예 2: 마우스 성체 신경줄기세포에서 [화학식 1]의 화합물의 신경줄기세포 분화능 확인(신경줄기세포를 신경세포로 분화 유도하면서 동시에 신경세포를 보호할 수 있는 물질을 스크리닝하는 방법)
단계 1: 마우스 성체 신경줄기세포의 배양
단계 1A: 미분화 상태로의 마우스 성체 신경줄기세포의 배양
8 주령 마우스 뇌의 부뇌실 부분에서 신경줄기세포를 분리하여 IPM 배양배지에 20 ng/㎖ 인간염기성 섬유아세포 성장인자(human basic fibroblast growth factor, bFGF)와 20 ng/㎖ 인간 표피 성장인자(human epidermal growth factor, EGF)를 처리하고 24-웰 플레이트에서 7 일간 현탁액(suspension)상태로 배양하였다. 4 일 이후부터 뉴로스피어(neurosphere)가 형성되는 것을 관찰할 수 있었다.
단일세포(single cell)로 분리하기 이틀 전, 10 ㎍/㎖ 폴리-L-오르니틴(poly-L-ornithine) 용액을 6-웰 플레이트에 처리하여 상온에서 하루 동안(overnight) 코팅하였다(incubation). 다음날, 폴리-L-오르니틴 용액을 제거하고, 3차 멸균수로 3번 플레이트를 씻어 주었다(washing). 이어서 0.5 mg/㎖ 라미닌(laminin)(Roche, Upper Bavaria, Germany, cat#.11243217001) 용액을 넣고 다시 37℃에서 하룻밤(overnight) 동안 코팅해 주었다(incubation). 플레이트 준비가 완료 되면, 형성된 뉴로스피어에 0.025 % Trypsin-EDTA 를 처리하여 단일세포(single cell)로 분리한 후, 세포의 수를 세어 4~5X105 개의 세포가 200~300 μl의 배양액에 포함되도록 세포를 준비하였다. 이때 배양액으로는 N2 배지(20 ng/㎖ bFGF 및 20 ng/㎖ EGF를 포함)를 사용하였다. 세포를 살포(seeding)하기 직전에 코팅 용액을 석션하고 플레이트가 마르기 전에 골고루 잘 살포하였다. 약 1분간 세포들이 플레이트에 부착될 수 있도록 두었다가 세포가 어느 정도 부착이 된 것을 관찰한 후 1.5 ml의 배양배지(20 ng/㎖ bFGF 및 20 ng/㎖ EGF를 포함하는 N2 배양배지)를 더 추가하고, 37℃ 인큐베이터에서 24시간 배양하였다.
이때 상기 IPM 배양 배지와 N2 배양 배지의 성분은 다음과 같다.
IPM 배양 배지: Neurobasal medium(Gibco, cat#.21103049), B27 supplement(Gibco, cat#.A3582801), Glutamax, 100 IU/㎖ 페니실린(penicillin), 100 ㎍/㎖ 스트렙토마이신(streptomycin)
N2 배양 배지: Dulbecco's modified Eagle's medium (DMEM)/F12 (1:1), 100 μM 푸트레신(putrescine), 30 nM 셀레나이트(selenite), 20 nM 프로게스테론(progesterone), 1.55 ㎎/㎖ 글루코오스(d-(+)―glucose), 25 ㎍/㎖ 인슐린(insulin), 0.1 mg/㎖ 아포-트랜스페린(apo-transferrin), 0.5 mM Glutamax, 100 IU/㎖ 페니실린(penicillin), 100 ㎍/㎖ 스트렙토마이신(streptomycin).
단계 1B: 분화를 억제하지 않은 상태의 신경줄기세포의 배양
단일세포로 분리하여 살포할 때, bFGF와 EGF를 처리하지 않은 것을 제외하고 상기 1A에서와 동일하게 마우스 성체 신경줄기세포를 배양하였다.
단계 2: 베타아밀로이드 처리
단계 1에서 배양한 신경줄기세포의 배지를 갈아 주고, 각 웰에 베타아밀로이드(Aβ)(Gibco, cat#.03112) 10 μM을 처리하였다. 비교군으로 사용하기 위하여 베타아밀로이드를 처리하지 않은 웰을 남겨 두었다.
베타아밀로이드(Aβ)는 Gibco(Waltham, MA)의 인간 Aβ(1-42)를 구입하여 사용하였고, 베타아밀로이드 올리고머 형성을 위하여 다음과 같은 과정을 거쳤다. 먼저 베타아밀로이드가 1 mg/ml이 되도록 100% HFIP(1,1,1,3,3,3-hexafluoro-2-propanol)(Sigma, cat#.105228)에 녹인 후 상온에서 1시간 동안 볼텍싱(vortexing)해 주었다. 이 후 speed Vac 기계를 이용하여 10분간 건조시키고, 5 mM이 되도록 DMSO(Sigma, cat#.D2650)를 넣고 상온에서 10분간 약하게 볼텍싱해 주었다. DMEM/F12(without phenol red)(Gibco, cat#. 21041025)를 더 첨가하여 100 μM이 되도록 하였다. 4℃에서 24시간 배양해 준 후 세포에 처리하였다.
단계 3: 시험 물질 투여
베타아밀로이드 처리 직후 트라메티닙(trametinib)은 10 nM, 100nM을, 메만틴(memantine)(Sigma, cat#. M9292)은 5 μM, 10 μM을, AS703026(pimasertib)은 10 μM을 각각 첨가하였다. EGF와 bFGF, 베타아밀로이드 및 시험물질을 매일 처리해 주면서 4 일간 배양하였다.
단계 4: 형태소 분석
배양 4 일째에 위상차 현미경으로 세포의 모양을 관찰하고, 그 결과를 도 2에 나타냈다.
도 2에서 상단은 마우스 성체 신경줄기세포에 베타아밀로이드 처리하지 않은 군이고, 하단은 베타아밀로이드를 10 μM 농도로 처리한 군이다. UD(Undifferentiated)는 시험물질을 처리하지 않은 단계 1A에서 얻은 미분화된 성체 신경줄기세포이고, D(Differentiated)는 시험물질을 처리하지 않은 단계 1B에서 얻은 분화된 성체 신경줄기세포이다. 상단의 Aβ 미처리 군 중 UD 군의 세포는 세포 몸체(cell body)가 넓고, 신경돌기(neurite)의 모양을 확인하기 어려우며, 세포가 계속 분열하고 있어 전체적인 세포의 수가 D 군에 비하여 많다. D 군의 세포는 세포 몸체가 작고 동그랗게 변한 대신 신경돌기가 가늘고 길게 뻗어 나와 UD 군 세포와 모양이 확연히 구별된다.
트라메티닙을 처리한 군은 베타아밀로이드 처리 유무와 관계없이 10 nM 및 100 nM의 낮은 농도에서 신경줄기세포로부터 신경세포로의 분화를 잘 유도하였다. AS703026을 처리한 군은 트라메티닙을 처리한 군보다 훨씬 높은 농도인 10 μM에서 베타아밀로이드 처리 유무와 관계 없이 신경세포로의 분화 유도 효과를 보였다. 또한, 두 물질 모두 분화 유도 효과를 보인 농도에서 세포 독성을 나타내지 않아 알츠하이머병 치료제의 후보 물질로서 적합함을 확인하였다.
아울러, 현재 알츠하이머병 증상완화제로 사용되고 있는 메만틴(memantine)을 처리한 그룹에서는, 신경줄기세포로부터 신경세포로의 분화를 확인할 수 없었으며, 오히려 신경줄기세포가 사멸되는 것이 관찰되었다. 메만틴은 NMDA 수용체 길항제로서 글루타메이트 신호전달에 관여하여 알츠하이머 환자에서 정상적인 신경 신호전달이 이루어지도록 돕는 역할을 하는데, 이러한 기능에 의해서는 손상된 신경세포의 회복에 의한 알츠하이머병의 근본적인 치료를 기대할 수 없다. 메만틴이 신경줄기세포의 분화를 유도하지 못하고 오히려 세포를 사멸시킨다는 위 실험 결과는 메만틴이 치매의 근본적 치료제가 될 수 없다는 사실을 확인해 주는 것이다.
비교예 1: 마우스 배아 신경줄기세포에 베타아밀로이드 처리하였을 때의 효과
단계 1: 마우스 배아 신경줄기세포 배양
실험예 1, 단계 1A 및 1B에서와 같은 방법으로 배양하였다.
단계 2: 아밀로이드 베타 처리
실험예 2, 단계 2에서와 동일한 방법으로 위 단계 1에서 배양된 마우스 배아 신경줄기세포에 베타아밀로이드를 처리하였다.
단계 3: 시험 물질 투여
베타아밀로이드 처리 직후 트라메티닙(trametinib) 100 nM, 메만틴(memantine) 10 μM, AS703026(pimasertib) 10 μM 을 첨가하였다. EGF와 bFGF, 베타아밀로이드 및 시험물질을 매일 처리해 주면서 4 일간 배양하였다.
단계 4: 형태소 분석
배양 4 일째에 위상차 현미경으로 세포의 모양을 관찰하고, 그 결과를 도 3에 나타냈다. 도 3에서 상단은 마우스 배아 신경줄기세포에 베타아밀로이드를 처리하지 않은 군이고, 하단은 베타아밀로이드를 10 μM 농도로 처리한 군이다. UD(Undifferentiated)는 미분화된 배아 신경줄기세포이고(시험물질 미처리), D(Differentiated)는 분화된 배아 신경줄기세포이다(시험물질 미처리). Aβ 처리 군에서 시험물질 처리 여부와 관계 없이 세포가 모두 사멸하여 시험물질의 효과를 확인할 수가 없었다.
실험예 3: 면역세포화학염색분석(Immunocytochemistry)
실험예 1에서 신경줄기세포가 신경세포로 분화가 유도되었는지를 확인하고자, Tuj1 및 DAPI(4',6-diamidino-2-phenylindole) 마커를 이용한 면역세포화학염색분석을 수행하였다. Tuj1(Neuron-specific class III beta-tubulin)은 신경세포 특이적인 마커 단백질로서 본 실험에서 로다민(Rhodamine)을 부착하여 적색형광이 나타나도록 표지하였고, DAPI는 세포의 DNA에 결합하여 핵을 청색형광으로 표지하는 염료이다.
실험예 1의 방법으로 배양한 배아신경줄기세포를 coverslip이 담겨진 24-웰 플레이트에 살포하고 트라메티닙과 AS703026을 농도별로 4 일 동안 처리하였다. 배지를 제거하고 PBS로 세척하였다. 10% 포름알데하이드(Sigma, cat#.HT501128)로 상온에서 10 분간 고정한 뒤 다시 PBS로 세척하였다. 0.2% Triton X-100(Sigma, cat#.93443)으로 상온에서 15 분간 투과화(permeabilization)시키고 PBS 세척 후 10% BSA(Sigma, cat#.A2153)+1% normal goat serum(Vector lab, Burlingame, CA, cat#.S1000)으로 상온에서 1시간 인큐베이션 시켰다. 1% BSA+1% normal goat serum에 1:200의 비율로 Tuj1 항체(Cell signaling, Danvers, MA, cat#4466)가 있는 용액을 넣고 4℃에서 하룻밤(overnight) 인큐베이션 시켰다. 이후 용액을 제거하고 PBS 세척 후 1% BSA+1% normal goat serum에 1:200의 비율로 2차 항체(로다민 부착항체)가 있는 용액을 상온에서 1시간 인큐베이션한 후 PBS로 세척하고 5 μg/ml 의 DAPI(Sigma, cat#.D9542)로 5분간 인큐베이션한 후 PBS로 세척하고 슬라이드 글라스에 mounting 하여 형광현미경으로 관찰하였다.
그 결과를 도 4에 나타냈다. 도 4에서 보는 바와 같이, AS703026으로 처리한 그룹은 1.0 μM 농도 처리한 그룹에서 적색으로 표지된 가늘고 길게 뻗은 신경세포의 신경돌기(neurite)가 보이기 시작하여 이 농도에서 신경세포로 분화가 시작되고 있음을 알 수 있으나, 분화가 매우 미미한 정도에 그치고 있었다. 또한 그 이하의 농도로 처리한 그룹(0.1 μM)에서는 분화가 전혀 이루어지지 않음을 알 수 있다.
한편 트라메티닙으로 처리한 그룹은 매우 낮은 10 nM 농도로 처리한 그룹에서부터 신경세포로의 분화가 활발하게 증가하고 있음을 확인하였다. 세포의 형태 역시 트라메티닙 10 nM을 처리한 그룹에서 신경돌기(neurite)가 뻗어 나가는 신경세포 군집들이 증가하고 있음을 확인할 수 있었다.
실험예 4: 상대적인 mRNA 발현 분석
실험예 4-1: 마우스 배아 신경줄기세포에서 [화학식 1]의 화합물의 Tuj1 및 TH 발현 분석
실험예 1에서 분화 유도된 세포의 종류를 확인하고자, quantitative RT-PCR(qRT-PCR) 분석을 통해 신경세포 특이적 마커인 Tuj1과 도파민 신경세포 마커인 TH(Tyrosine hydroxylase)의 mRNA 발현을 확인하였다.
단계 1: RNA 분리
실험예 1에서 형태소 분석을 마친 후, 각 처리군의 배지를 모두 제거하고 TRIzol®(Invitrogen, Waltham, MA)　을 플레이트에 넣은 뒤 5분간 상온에서 인큐베이션 하여 세포가 잘 깨질 수 있도록 하였다. TRIzol®과 함께 세포를 모아 튜브로 옮기고 클로로포름(Sigma, cat#.366919)을 넣어 준 뒤 잘 섞어주고 원심분리하여 상층액의 맑은 부분만 새 튜브로 옮겼다. 이소프로판올(Ducsan, GyunggiDo, Korea, cat#.67-63-0)을 처리하여 RNA가 잘 분리되도록 섞어 주고 다시 원심분리한 후 상층액을 제거하고 펠렛만 남겼다. 75% 에탄올(Ducsan, cat#,64-17-15)을 처리하고 다시 원심분리하여 상층액을 제거하였다. 3차 멸균수로 펠렛을 잘 녹여 mRNA를 얻고, 55℃에서 10분간 인큐베이션한 후 -80℃에 RNA를 보관하였다.
단계 2: Reverse transcription
RNA의 농도를 측정하여 실험 각 그룹의 RNA가 2 μg이 되도록 계산하고, Reverse transcription kit(Invitrogen, cat#.28025013)를 이용하여 실험하였다. 3차 멸균수, 1 pM oligo dT, 1 mM dNTP 를 넣고 65℃에서 5분간 인큐베이션한 후, 5X First-strand buffer, 10mM DTT, M-MLV reverse transcriptase 를 더 첨가하여 42℃에서 1시간, 72℃에서 15분, 4℃에서 30분 인큐베이션한 후 만들어진 cDNA를 -20℃에 보관하였다.
단계 3: qRT-PCR
위 단계에서 만들어진 cDNA 1μl, 프라이머 1 pM, 3차 증류수, Rotor-Gene SYBR® Green (Qiagen, Venlo, Netherlands, cat#.204074)을 넣고 잘 섞어 준 뒤 Rotor-Gene Q (Qiagen) 기계를 이용하여 PCR을 하였다. 사용된 프라이머(Bioneer, Daejeon, Korea)는 하기 [표 2]와 같다.
Gene Forward Primer Reverse Primer
GAPDH 5'- CGTGCCGCCTGGAGAAACC-3' 5'- TGGAAGAGTGGGAGTTGCTGTTG-3'
Tuj1 5'- GGTCTGGCGCCTTTGGA-3' 5'- CACCACTCTGACCAAAGATAAAGTTG-3'
TH 5'-AGGTATACGCCACGCTGAAG-3' 5'-CTCGGGTGAGTGCATAGGTG-3'
그 결과를 도 5에 나타내었다. 도 5a, 5b는 qRT-PCR 분석을 3회 수행하여 얻은 각 그룹의 상대적인 mRNA 발현 수치에 대한 평균값이다. 여기서 상대적인 mRNA 발현 수치란, 각 그룹의 전체 RNA의 양을 보정(normalization)하기 위하여 일반적으로 발현양이 크게 차이 나지 않는 GAPDH의 발현양으로 각 분화 마커에 해당하는 mRNA 발현양을 나눠주고, 이 후 다시 각 그룹의 대조군(미분화 신경줄기세포)의 수치에 대하여 시험 물질 처리군의 수치를 비교한 것을 의미한다.
도 5에서 보는 바와 같이, 트라메티닙 처리군은 10 nM, 25 nM 및 100 nM의 농도에서 신경세포 분화인자인 Tuj1과 도파민 신경세포의 마커인 TH의 발현이 높게 나타났다. 이러한 결과는, 트라메티닙이 신경줄기세포로부터 신경세포로의 분화를 매우 효율적으로 유도하고, 특히 도파민 신경세포로의 분화를 잘 유도한다는 것을 나타낸다. 또한 트라메티닙은 1 nM의 매우 낮은 농도에서도 분화 유도 효과를 나타냈다. 이는 본 발명에 따른 신경줄기세포를 신경세포로 분화되도록 유도하는 조성물 및 분화 방법을 통해 신경퇴행성 질환에 이용될 수 있음을 시사한다.
AS703026은 10 μM(10000 nM)에서 트라메티닙 25 nM 처리군과 동등한 정도의 효과를 나타내어, 트라메티닙이 AS703026보다 400 배 이상 더 낮은 농도에서 신경줄기세포를 신경세포로 분화를 유도함을 확인하였다.
실험예 4-2: 마우스 배아 및 성체 신경줄기세포에서 [화학식 1] 화합물의 TH, ChAT, Isl1, 및 Gad1 mRNA 발현 분석
[화학식 1] 화합물이 도파민 신경세포 이외에 다른 종류의 신경세포로도 분화를 유도하는지 확인하고자, qRT-PCR분석을 통해 콜린성 신경세포 마커인 ChAT(choline acetyltransferase), 운동신경세포 마커인 Isl1(Islet1), GABA성 신경세포 마커인 Gad1(glutamate decarboxylase 1)의 mRNA 발현을 확인하였다.
실험예 1의 방법으로 세포를 배양하였으며, 트라메티닙을 1 nM, 10 nM, 25 nM 내지 100 nM로 2일간 처리한 후 RNA를 분리하여 신경세포 분화 마커를 확인하였다. mRNA의 발현은 상기 설명한 실험예 4-1과 동일한 방법으로 확인하였으며, 사용한 프라이머는 아래 [표 3]과 같다.
그 결과를 도 6에 나타냈다.
Gene Forward Primer Reverse Primer
GAPDH 5'- CGTGCCGCCTGGAGAAACC-3' 5'- TGGAAGAGTGGGAGTTGCTGTTG-3'
Tuj1 5'- GGTCTGGCGCCTTTGGA-3' 5'- CACCACTCTGACCAAAGATAAAGTTG-3'
TH 5'-AGGTATACGCCACGCTGAAG-3' 5'-CTCGGGTGAGTGCATAGGTG-3'
ChAT 5'-CCTGCCAGTCAACTCTAGCC-3' 5'-TACAGAGAGGCTGCCCTGAG-3'
Gad1 5'-TCATGTTATGGAAATCTTGCTTCAG-3' 5'-CGAGTCACAGAGATTGGTCATATACTACT-3'
Isl1 5'-CGGAGAGACATGATGGTGGT-3' 5'-GGCTGATCTATGTCGCTTTGC-3'
도 6에서 보는 바와 같이, 트라메티닙의 처리 농도가 높아질수록 시험한 모든 종류의 신경세포 마커, 즉 도파민 신경세포 마커인 TH, 콜린성 신경세포 마커인 ChAT, 운동신경세포 마커인 Isl1, GABA성 신경세포 마커인 Gad1의 발현이 증가되는 것을 확인하였다. 이는 트라메티닙이 다양한 종류의 신경세포 손실이 원인이 되는 신경퇴행성 질환의 치료에 사용될 수 있음을 의미한다.
마우스 성체 신경줄기세포에서도 동일한 효과가 나타나는지 확인하기 위하여, 실험예 2의 단계 1A와 같이 배양한 마우스 성체 신경줄기세포에 10 nM 농도의 트라메티닙과 10 μM 농도의 AS703026을 2일 동안 각각 처리한 후, 신경세포 마커인 Tuj1과 도파민 신경세포 마커인 TH, 콜린성 신경세포 마커인 ChAT mRNA 발현을 qRT-PCR로 분석하였다.
결과를 도 7에 나타냈다. 성체신경줄기세포에서도 배아신경줄기세포와 마찬가지로 트라메티닙이 Tuj1과 TH, ChAT 모두의 발현을 증가시켰다. 특히 트라메티닙은 AS703026보다도 1000배 낮은 농도에서도 신경세포로의 분화 유도 효과가 훨씬 높은 것을 확인하였다.
실험예 5: 신경줄기세포에서 MEK1, MEK2 발현 조절에 의한 분화능 확인
실험예 5-1: 마우스 배아 신경줄기세포에서 MEK1, MEK2 발현 억제
MEK1, MEK2의 발현 정도에 따른 신경줄기세포의 신경세포로의 분화능을 확인하였다. 이때 MEK1, MEK2의 발현이 조절된 세포는 아래와 같이 제조한 것을 이용하였다.
먼저 MEK1, MEK2의 발현이 억제된 신경줄기세포를 제조하기 위해, MEK1, MEK2의 발현을 억제하는 shRNA를 이용하였다. 구체적으로 실험예 1, 단계 1A에서와 같이 배양된 마우스 배아 신경줄기세포를 플레이트에 잘 살포(seeding)하고 24시간 동안 배양 후, 상기 세포에 1 μg/ml의 shRNA-MEK1 (CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT) 또는 shRNA-MEK2 (CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG)를 리포펙타민(Invitrogen, cat#.18324010)을 사용하여 트랜스펙션(transfection)하여, MEK1 또는 MEK2, 또는 이들 모두의 발현이 억제된 신경줄기세포를 제조하였다.
이와 같이 만들어진 신경줄기세포를 4시간 이후 다시 N2 배양 배지로 배지를 바꾸어 주고 4 일 동안 더 배양 한 후, RNA를 실험예 4-1의 방법으로 추출한 뒤 Reverse transcription PCR (RT-PCR)을 수행하여 신경세포로의 분화능을 분석하였다. 구체적으로, cDNA로 reverse transcription 해 주고, EX-Taq DNA polymerase (SG Bio, Kyunggi Do, Korea)와 프라이머를 넣어 준 뒤, T100™ Thermal Cycler (Bio-rad, Hercules, CA) 기계를 이용하여 PCR 하였다. 95℃에서 5분 인큐베이션한 후, 95℃에서 30초, 55~62℃에서 30초, 72℃에서 30초를 1 사이클로 총 25~35 사이클이 되도록 PCR 하였다. PCR 결과는 2 % 아가로스 겔을 이용하여 전기영동한 후 image analyzer인 LAS-3000 (Fujifilm, Tokyo, Japan) 기계로 결과를 확인하였다.
본 실험예 및 하기 실험예 5-2와 5-3에서 RT-PCR 및 qRT-PCR에 사용된 프라이머는 아래 [표 4]와 같다.
Gene Forward Primer Reverse Primer
GAPDH 5'- CGTGCCGCCTGGAGAAACC-3' 5'- TGGAAGAGTGGGAGTTGCTGTTG-3'
Tuj1 5'- GGTCTGGCGCCTTTGGA-3' 5'- CACCACTCTGACCAAAGATAAAGTTG-3'
TH 5'-AGGTATACGCCACGCTGAAG-3' 5'-CTCGGGTGAGTGCATAGGTG-3'
MEK1 5'-CGGCGGTTAACGGGACCA-34' 5'-GGATTGCGGGTTTGATCTCCA-3'
MEK2 5'-CCTGGATGAGCAGCAAAGGA-3' 5'-CAGTGAGCCACCATCCATGT-3'
그 결과를 도 8a에 나타냈다. 도 8a에서 보는 바와 같이, shMEK1과 shMEK2로 동시에 처리하여 MEK1과 MEK2 발현을 모두 억제한 신경줄기세포(shMEK1+, shMEK2+)의 경우, MEK2 발현만을 억제한 신경줄기세포(shMEK1-, shMEK2+)에 비하여 도파민 신경세포 마커(TH)의 발현이 크게 증가하는 것을 확인하였다.
MEK1과 MEK2 각각의 발현 저해 및 MEK1과 MEK2의 동시 발현 저해 효과를 다시 한번 더 확인해 보기 위하여 qRT-PCR 및 western blotting의 방법으로 신경줄기세포의 신경세포로의 분화능을 확인하였다. 상기 설명된 방법으로 MEK1, MKE2가 각각 발현이 억제된 신경줄기세포와 MEK1과 MEK2가 동시에 발현이 억제된 신경줄기세포를 제조한 후, 신경줄기세포를 4시간 이후 다시 N2 배양 배지로 배지를 바꾸어 주고 4 일 동안 더 배양하고, 실험예 4-1의 방법으로 qRT-PCR을 수행하였다. 그 결과를 도 8b의 그래프에 나타냈다. 도 8b의 그래프에서 보는 것처럼 MEK1, MEK2의 발현을 각각 저해하였을 때보다 MEK1과 MEK2의 발현을 모두 저해하였을 때, 신경세포의 마커인 Tuj1 및 TH의 발현이 현저히 증가되어 있음을 확인할 수 있었다.
mRNA 뿐 아니라 단백질 수준에서도 MEK1과 MEK2의 발현 저해에 따른 신경세포 분화 효과를 보이는지를 확인하기 위하여 western blotting 을 수행하였다.
각 세포에 대하여 다음과 같이 Western blotting을 수행하였다. 상기 설명된 MEK1, MEK2의 발현이 억제된 신경줄기세포를 4 일간 배양한 후, 배지를 모두 제거하고, 얼음 위에서 RIPA 버퍼 (0.05 M Tris HCl pH7.4(Sigma, cat#.T3253), 0.1 5M NaCl(Ducsan, cat#. 7647-14-5), 0.25% deoxycholic acid(Sigma, cat#.D6750), 1% NP-40(USB, Waltham, MA, cat#.19628), 1 mM EDTA(Sigma, cat#.EDS), 1 mM PMSF(Acros organics, Geel, Belgium, cat#. 215740050), 1 mM sodium orthovanadate(Bio labs, Ipswich, MA, cat#. P0758L), 1 mM sodium fluoride(Sigma, cat#.S7920), protease inhibitors(Sigma, cat#.P83430))를 플레이트에 넣은 뒤 scrapper로 세포를 모았다. 10분간 얼음에서 인큐베이션한 뒤 13000rpm, 4℃로 원심분리하여 상층액을 모았다. 단백질의 농도를 측정한 후 sample 버퍼(0.25 M Tris-HCl pH6.8, 0.05% SDS(Amersco, Solon, OH, cat#. 227), 50% glycerol(Ducsan, cat#. 56-81-5), 0.25 M DTT(Invitrogen, cat#.R0861), 0.5 mg/ml BPB(Bio-rad, Hercules, CA, cat#.161-0404)를 첨가하고 100℃에서 10분 끓인 후 -20℃에 보관하였다.
8~12% SDS-PAGE gel을 만들고 10~20 μg 단백질 샘플을 로딩하여 분리한 후 nitrocellulose membrane 에 옮기고 5% skim milk로 상온에서 1시간동안 blocking 하였다. 0.1% Tween 20(Sigma, cat#.P1379)을 포함하는 tris buffered saline(TBS)에 Tuj1, TH(Cell signaling, cat#. 2792), MEK1/2(Santa cruz, Dallas, TX, cat#. sc-292838), ERK(Snata cruz, cat#. sc-135900) 항체를 각각 준비하여 상온에서 2시간 혹은 4℃에서 하룻밤(overnight) 인큐베이션한 후 Horseradish peroxidase가 붙어 있는 2차 항체를 상온에서 1시간 인큐베이션하였다. 이 후 감광장비로 단백질의 발현을 확인하여 그 결과를 도 8b 하단의 사진에 나타내었다. 도 8b에 나타난 바와 같이, shMEK1과 shMEK2로 동시에 처리하여 MEK1과 MEK2의 발현을 모두 억제한 신경줄기세포의 경우(shMEK1+, shMEK2+), 신경세포 마커인 Tuj1과 도파민 신경세포의 마커(TH)의 발현이 mRNA와 단백질 수준에서 모두 크게 증가하는 것을 확인하였다.
한편 MEK1과 MEK2 중 어느 하나의 발현만을 억제한 신경줄기세포의 경우에는 MEK1과 MEK2를 모두 억제한 신경줄기세포보다 Tuj1이나 TH의 발현량이 낮음을 확인할 수 있었다.
실험예 5-2: 마우스 배아 신경줄기세포에서 CAMEK1, CAMEK2 발현 유도
MEK1, MEK2의 활성화에 따른 신경줄기세포의 신경세포로의 분화능을 확인하고자 MEK1과 MEK2가 항상 활성화가 되도록 돌연변이를 갖는 constitutively active MEK1(CAMEK1), constitutively active MEK2(CAMEK2) 플라스미드를 이용하여 실험하였다. 구체적으로 실험예 1, 단계 1A에서와 같이 배양된 마우스 배아 신경줄기세포를 플레이트에 잘 살포(seeding)하고 24시간 동안 배양 후, 상기 세포에 1 μg/ml 의 CAMEK1, CAMEK2를 리포펙타민을 사용하여 트랜스펙션 하여, CAMEK1와 CAMEK2 중 어느 하나, 또는 CAMEK1과 CAMEK2가 모두 발현된 신경줄기세포를 제조하였다. 이와 같이 만들어진 신경줄기세포를 4시간 이후 다시 EGF와 bFGF가 포함되지 않은 N2 배양 배지로 배지를 바꾸어 주고 4 일 동안 더 배양한 후, RNA 및 단백질을 추출하고, quantitative RT-PCR(qRT-PCR) 및 western blotting을 수행하여, MEK1, MEK2의 활성화가 신경줄기세포에서 신경세포로의 분화능에 미치는 영향을 확인하여 도 8c에 나타냈다.
도 8c의 결과는 도 8b와는 반대로 분화가 유도되는 환경에서 MEK1과 MEK2가 활성화가 되면 분화가 억제된다는 것을 보여준다. qRT-PCR 및 western blotting을 통해 확인해 보았을 때, 신경세포 마커인 Tuj1과 도파민 신경세포 마커인 TH의 mRNA 및 단백질의 발현이 모두 억제되는 것을 확인하였고, 특히 MEK1과 MEK2가 모두 활성화된 경우에는 둘 중 어느 하나가 활성화된 경우에 비하여 Tuj1과 TH의 발현이 현저히 감소하는 것을 확인하였다.
실험예 5-3: 마우스 성체 신경줄기세포에서 MEK1, MEK2 발현 억제
성체 줄기세포에서도 MEK1과 MEK2의 억제가 신경줄기세포의 분화를 유도하는지, 베타아밀로이드가 있는 상황에서도 동일한 효과가 있는지를 확인하기 위하여 다음과 같이 실험을 진행하였다.
실험예 2, 단계 1A에서와 같이 배양된 마우스 성체 신경줄기세포를 플레이트에 잘 살포(seeding)하고 24시간 동안 배양 후, 상기 세포에 1 μg/ml의 shRNA-MEK1 (CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT) 또는 shRNA-MEK2 (CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG)를 리포펙타민(Lipofectamin, Invitrogen)을 사용하여 트랜스펙션(transfection)하여, MEK1 또는 MEK2, 또는 이들 모두의 발현이 억제된 신경줄기세포를 제조하였다.
이와 같이 만들어진 신경줄기세포를 4시간 이후 다시 N2 배양 배지로 배지를 바꾸어 주거나, N2 배지에 10 μM 의 베타아밀로이드(Aβ) 10 μM이 처리된 배지로 바꾸어 주고, 2 일 동안 더 배양 한 후, 현미경으로 세포의 모양을 관찰하고, 실험예 4의 방법으로 RNA 추출하여 qRT-PCR를 수행하였고, 신경세포로의 분화능을 분석하였다.
그 결과를 도 9에 나타냈다.
도 9a에서 보는 바와 같이 shMEK1과 shMEK2 중 어느 하나를 처리한 경우 보다 shMEK1, shMEK2를 동시에 처리하여 MEK1과 MEK2 둘 다의 발현을 억제한 신경줄기세포의 경우 분화가 더 잘 유도된 것을 확인할 수 있었다. 베타아밀로이드가 처리된 경우 MEK1과 MEK2가 저해되지 않은 군에서는 세포가 사멸하였으나, MEK1과 MEK2 중 어느 하나, 또는 둘 다가 저해 된 경우에는 세포의 사멸이 일어나지 않고 분화가 유도되는 것을 확인하였다.
또한, 도 9b에서 보는 바와 같이 shMEK1과 shMEK2로 동시에 처리하여 MEK1, MEK2 발현을 모두 억제한 신경줄기세포의 경우(shMEK1+shMEK2), 신경세포 마커(Tuj1)의 발현이 크게 증가하는 것을 확인하였다. 한편 MEK1과 MEK2 중 어느 하나의 발현만을 억제한 신경줄기세포의 경우(shMEK1과 shMEK2)에는, MEK1과 MEK2 발현을 모두 억제한 경우보다 신경세포 마커(Tuj1)의 발현이 낮아 신경세포로의 분화 효과가 낮은 것을 확인할 수 있었다. 베타아밀로이드를 처리한 환경에서는 MEK1 또는 MEK2 어느 하나의 발현만을 억제한 경우에도 어느 정도 보호효과 및 분화 효과가 있었으나, MEK1과 MEK2를 모두 저해한 그룹의 경우에 세포 보호와 분화가 현저히 더 잘 유도되었다.
이를 통해 성체신경줄기세포에서 MEK1과 MEK2의 저해는 신경줄기세포의 분화를 유도할 뿐만 아니라 베타아밀로이드에 대한 보호효과도 가지고 있음을 알 수 있다.
실험예 6: 다른 MEK 1/2 억제제의 신경줄기세포 분화 유도 효과
트라메티닙 이외에 다른 MEK 1/2 억제제들도 신경줄기세포의 분화 유도 및 보호 효과가 있는지 확인하기 위하여 마우스 배아신경줄기세포에 각 화합물들을 처리하였다. 구체적으로 실험예 1의 단계 1A에서와 같이 배양된 마우스 배아신경줄기세포에 MEK 1/2 억제제로 알려진 AZD8330(Selleckchem, cat#.S2134), PD184352(Selleckchem, cat#.S1020), Refametinib(Sellechchem, cat#.S1089), PD318088(Selleckchem, cat#.S1568)., Binimetinib(Selleckchem, cat#.S7007), 및 AS703026을 0.1 μM, 1.0 μM, 10 μM로 각각 처리하고 배양하였다. 비교를 위하여 트라메티닙도 같은 농도로 처리하였다. 배양 2 일 째에 위상차 현미경으로 세포의 모양을 관찰하고, 그 결과를 도 10a에 나타냈다. 도 10b는 각 그룹의 세포에 대하여 Tuj1 mRNA 발현을 분석한 결과이다.
도 10a 및 10b에서 보는 바와 같이, AZD8330, Refametinib, PD318088, Binimetinib, 및 AS703026 는 각 화합물들이 분화 유도를 시작하는 농도만 다를 뿐 분화를 유도하고 있음을 확인하였다. AZD8330, Refametinib, 및 PD318088 은 1.0 μM에서부터 Binimetinib 및 AS703026은 10 μM에서부터 분화 형태를 나타내고 있었다. 분화 마커인 Tuj1의 발현을 RT-PCR로 확인하여 보았을 때에도 같은 농도에서 분화를 유도하고 있음을 확인하였다. 트라메티닙은 0.1 μM의 낮은 농도에서도 다른 물질들보다 현저히 우수한 신경줄기세포 분화 효과를 나타냈다. 그러나 PD184352는 0.1 μM에서 미약한 분화 유도 효과를 보였을 뿐, 1.0 μM 및 10 μM에서는 세포가 모두 사멸하였다.
추가로 다른 MEK 1/2 억제제인 PD0325901(Selleckchem, cat#.S1036), RO5126766(Selleckchem, cat#.S7170), BI847325(Selleckchem, cat#.S7843) 및 U0126(A.G.Scientific, San Diego, CA, cat#.U-102)을 실험예 2의 단계 1A에서와 같이 배양한 마우스 성체 신경줄기세포에 다양한 농도로 투여하여 신경줄기세포의 분화 유도 효과가 있는지 관찰하였다. 시험물질 처리 후 배양 2일 째에 위상차 현미경으로 세포의 모양을 관찰하고, 그 결과를 도 10c에 나타냈다. 도 10c에서 보는 바와 같이, PD0325901은 0.1 μM에서부터, RO5126766은 1.0 μM에서부터 분화 유도 효과를 나타냈다. 특히 PD0325901은 0.1 μM에서 10 μM에 이르기까지 넓은 농도 범위에 걸쳐 분화를 유도시켜서 우수한 효과를 나타내는 것을 확인하였다. 반면, BI847325는 0.1 μM에서 미약한 분화 유도 효과를 보였을 뿐, 1.0 μM 및 10 μM로 처리시에는 세포가 모두 사멸하였다. BI847325를 더 낮은 농도로 처리하여 보았을 때에도(1.0 nM 및 10 nM) 세포 증식이 약간 억제된 것으로 보이고 분화 유도 효과는 나타나지 않았다. U0126은 0.1 μM 및 1 μM에서 세포 증식이 억제된 것으로 보이고 10 μM에서는 세포 독성이 나타났다. U0126은 2.5 μM에서도 뚜렷한 분화 유도 효과를 보이지 않아 처리한 모든 농도에서 신경줄기세포의 분화 유도 효과를 확인할 수 없었다.
이 실험 결과는 기존에 MEK 1/2 억제제로 알려진 물질들이 모두 신경줄기세포의 분화를 효과적으로 유도하는 것이 아님을 보여준다. 실험예 5의 결과에 따르면 MEK 1과 MEK 2의 억제가 신경줄기세포의 분화 유도에 관여하는 것은 분명하나, 각 MEK 1/2 억제제들이 갖는 고유한 다른 특성들이 신경줄기세포의 분화 유도 능력에 영향을 미쳐서 실험예 6과 같은 결과가 얻어진 것으로 생각된다.
실험예 7: 세포 독성인자 존재 하에서 다른 MEK 1/2 억제제의 신경 세포 분화능
실험예 2, 단계 1A에서와 같이 배양한 성체 신경줄기세포에 실험예 2의 단계 2에서와 같이 베타아밀로이드 10 μM을 처리하여 세포독성 환경을 유발하고, MEK1/2 억제제인 AS703026(10 μM), AZD8330(1 μM), PD318088(1 μM), Binimetinib(10 μM), Refametinib(1 μM), PD0325901(10 μM), RO5126766(10 μM)을 각각 실험예 6에서 가장 분화를 잘 유도한 농도로 처리하여 배양하였다. 비교를 위하여 트라메티닙 0.1 μM 처리군과 MEK2에 비해 MEK1에 대해 선택적인 저해제로 알려진 코비메티닙(cobimetinib) 10 μM 처리군을 추가하고, 베타아밀로이드 처리를 하지 않고 각 화합물을 배양한 군도 추가하였다. 배양 2 일째에 위상차 현미경으로 세포의 모양을 관찰하고, 그 결과를 도 11에 나타냈다.
도 11에서 “-“로 표시한 행은 마우스 성체 신경줄기세포에 베타아밀로이드 처리하지 않은 군이고, “Aβ1-42”로 표시한 행은 베타아밀로이드를 10 μM 농도로 처리한 군이다. 베타아밀로이드 10 μM을 처리하여 세포 독성이 유발된 환경에서 AS703026, AZD8330, PD318088, Binimetinib, Refametinib, PD0325901, 및 RO5126766은 성체신경줄기세포에 각각 가장 분화를 잘 유도하는 농도로 처리하였을 때 세포를 보호하고 분화를 잘 유도하고 있음을 확인하였다. 대조적으로 MEK2에 비해 MEK1에 대해 선택적인 저해제로 알려진 코비메티닙(cobimetinib)은 10 μM의 높은 농도로 처리시에서도 베타아밀로이드 처리와 무관하게 성체 신경줄기세포의 분화를 유도하지 못하였다.
실험예 8: 알츠하이머 병 모델 마우스에서 신경세포 수의 증가 효과 확인
앞선 실험 결과들을 통해 MEK1, MEK2를 동시에 억제하는 물질들 중 특정 물질이 신경줄기세포로부터 신경세포로의 분화를 유도하고, 베타아밀로이드로부터 신경줄기세포를 보호하는 효과가 있고, 특히 트라메티닙이 현저히 우수한 효과를 나타냄을 확인하였다. 이러한 효과를 신경퇴행성 질환 모델 마우스에서도 확인하고자 신경퇴행성 질환 중 가장 흔한 질환인 알츠하이머병의 증상, 특히 체성감각피질의 layer 5와 해마이행부(subiculum)에서의 신경세포의 퇴행 및 사멸을 나타내는 동물모델(Oakley et al. (2006) Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation. J Neurosci. 26(40):10129-10140)인 5XFAD 마우스를 이용하여 트라메티닙의 신경재생 및 치료 효능을 확인하였다.
알츠하이머병 모델 마우스인 5XFAD (B6SJL-Tg (APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax) 가 12 개월령이 되었을 때, 트라메티닙을 0.1 mg/kg, 1.0 mg/kg의 용량으로 매일 28 일간 경구투여하고, 대조군에게는 비히클(4% DMSO+Corn oil)을 동일한 방법으로 투여하였다(군당 7 마리). 추후 BrdU 염색 실험을 수행하기 위하여 위 투여기간의 마지막 5일간은 추가로 50mg/kg의 BrdU(Sigma, cat#.B5002)를 매일 투여하였다. 이 후 마우스를 마취한 후 PBS를 이용하여 perfusion 방법으로 희생하고 뇌를 적출하였다. 군당 3 마리의 마우스에서 적출한 뇌 중 반의 뇌 조직(hemisphere)은 western blotting과 ELISA 실험을 위하여 적출하자 마자 곧바로 초저온냉동고(Deep freezer)에 보관하였다. 나머지 반대쪽 뇌의 반구(hemisphere)와 또 다른 나머지 군당 3마리 마우스에서 적출한 뇌는 10% formalin solution에 담아 4℃에서 하루 동안 두었다가 파라핀이 뇌 조직으로 잘 침투되도록 70%, 80%, 95% 100% 알코올의 순서로 각각 1시간씩 두어 탈수화를 해 주고 clearing을 위해 자일렌에 1시간씩 3번 담가 주었다가 용액상태의 파라핀에 1시간씩 2번 담가 주었다. 이 후 틀에 잘 고정하고 5 μm 두께로 절편을 만들어 슬라이드 형태로 상온 보관하였다. 면역조직화학염색 실험을 위하여 슬라이드 위 조직을 자일렌, 알코올 100%, 90%, 80%, 70%, 50%, 물의 순으로 5분씩 담가 주어 재수화하였다. Sodium citrate(10 mM, pH 6)(Sigma, S4641) 버퍼에 담근 후 120℃에서 15분간 Antigen retrieval 과정을 거친 후 10% BSA(Bovine serum albumin)으로 blocking 한 후 신경세포 마커인 NeuN의 항체(Cell signaling, cat#.24307)로 4℃에서 하루 동안 인큐베이션시켰다. 다음 날 anti-rabbit 항체(Vector lab, cat#.PI-1000)를 상온에서 1 시간 인큐베이션 시킨 후 DAB 염색법으로 염색하여 뇌에서 신경세포의 분포를 분석하였다.
5XFAD 마우스의 경우 대뇌 피질의 layer 5와 해마(hippocampus)의 해마이행부(subiculum) 부분에서 신경세포 손상이 많이 일어나고 있음이 이미 알려져 있으므로 가장 먼저 이 부분들을 확인해 보았다.
도 12는 마우스 대뇌 피질 중 체성감각피질(somatosensory cortex) 부분의 시상면(sagittal) 절편을 분석한 결과이다. 도 12a에서 보는 바와 같이 5XFAD 마우스에 비히클(4% DMSO + corn oil)만을 투여한 대조군(왼쪽 첫번째 사진)은 이미 대뇌피질 layer 5의 신경세포들이 많이 손상되어 NeuN이 염색되는 신경세포의 수가 줄어 있는데, 트라메티닙을 0.1 mg/kg, 1.0 mg/kg으로 투여한 5XFAD 마우스는 NeuN이 염색되는 신경세포의 수가 현저히 증가되어 있음을 확인하였다. 도 12b는 체성감각피질 layer 5 부분의 단위 면적당 NeuN이 염색된 세포의 수(%)인데, 그룹 당 3 마리의 마우스에서 마리 당 3 부분의 면을 분석하여 총 9 면의 세포의 수를 계수하고, 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시한 것이다.
도 13은 마우스 대뇌 피질 중 운동피질(motor cortex) 부분의 관상면(coronal) 절편을 분석한 결과이다. 도 13a에서 보는 바와 같이 체성감각피질에서의 결과와 마찬가지로 5XFAD 마우스에 비히클만 투여한 그룹은 운동피질의 layer 5의 신경세포의 손상을 보이고 있으나 트라메티닙을 투여한 5XFAD 마우스 그룹에서는 신경세포의 수가 현저히 증가되어 있음을 다시 한번 더 확인하였다. 도 13b는 운동피질 layer 5 부분의 NeuN이 염색된 세포의 수를 계수하여 단위 면적 당 세포의 수 비율로 나타낸 것이다. 그룹 당 3 마리의 마우스에서 마리 당 6 부분의 면을 분석하여 총 18 면의 세포의 수를 계수하고, 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시하였다.
도 14는 마우스 해마이행부(hippocampus의 subiculum) 부분의 시상면(sagittal)을 분석한 결과이다. 도 14a에서 보는 바와 같이 대뇌 피질의 결과와 마찬가지로 5XFAD 마우스에 비히클만 투여한 그룹은 해마이행부 부분에서 신경세포 마커인 NeuN이 염색된 신경세포의 수가 현저히 적은 것을 확인할 수 있었다. 트라메티닙을 투여한 5XFAD 마우스 그룹에서는 NeuN이 염색된 신경세포의 수가 비히클을 처리한 그룹에 비하여 현저히 증가되어 있음을 다시 한번 더 확인하였다. 도 14b는 도 14a에서 점선으로 표시된 해마이행부(hippocampus의 subiculum)의 NeuN 염색된 세포의 수를 계수하여 단위 면적 당 세포의 수 비율로 나타낸 것이다. 그룹 당 3 마리의 마우스에서 마리 당 3 부분의 면을 분석하여 총 9 면의 세포의 수를 계수하고, 비히클만을 투여한 그룹 대비 트라메티닙을 투여한 마우스에서의 NeuN 염색 세포 수의 비율을 계산하여 표시하였다. 위 실험들을 통하여 트라메티닙이 5XFAD 마우스에서 대뇌 피질 layer 5 부분과 해마 이행부의 신경세포 수를 증가시키는 효과가 있음을 확인할 수 있었다.
실험예 9: 알츠하이머 병 모델 마우스에서 신경세포 신생 효과 확인
실험예 8에서 트라메티닙을 투여한 5XFAD 마우스의 대뇌 피질 및 해마이행부에서의 신경세포 수의 증가가 트라메티닙에 의한 신경세포 신생 유도 효과를 통해 나타난 것인지를 확인하기 위하여 신경줄기세포에서 신경세포로 분화하는 과정 중 나타나는 다양한 세포들의 마커를 이용하여 면역조직화학염색 방법으로 확인해 보았다.
DCX (doublecortin)는 신경전구세포에서 발현되는 단백질로, 이동하는 신경세포(migrating neurons)나 분화하고 있는 신경세포에서 주로 발현되므로 신경세포신생(neurogenesis) 과정 중에 있는 미성숙 신경세포임을 나타내고, Tuj1(neuron-specific class IIIβ tubulin)은 한창 분열중인 신경전구세포 또는 새로 생성된 미성숙 후분열기 신경세포에서 발현되는 단백질로서 신경세포신생 과정에 있는 신경세포임을 나타낸다. 따라서 DCX나 Tuj1의 존재를 면역조직화학염색 방법으로 확인함으로써 신경줄기세포에서 신경세포로의 분화를 통해 신경세포신생이 일어난 것인지를 확인할 수 있다. BrdU(5-Bromodeoxycytidine)는 염기서열 중 하나인 티미딘(thymidine)의 유사체인데, 분열하는 세포에서 DNA가 합성될 때 티미딘 대신 끼어들어간다. 따라서 BrdU에 대한 면역조직화학염색 방법으로 신경세포신생으로 인하여 분열하는 세포를 확인할 수 있다.
실험예 9-1: 대뇌 체성감각피질 부분의 Tuj1 발현 확인
실험예 8의 5XFAD 마우스의 뇌 조직 슬라이드에 Tuj1 항체를 4°C에서 하루 동안 인큐베이션 시키고 다음 날 Fluorescein isothiocyanate(FITC)-2차 항체(Invitrogen, cat#.a21121)를 상온에서 1 시간 인큐베이션 시켜 형광염색법으로 염색하였다. 대뇌피질 중 체성감각피질 부분의 형광현미경 사진 결과를 도 15에 나타냈다. 도 15에서 화살표(→)로 표시한 부분은 Tuj1이 염색된 세포를 나타내고, 화살표의 머리(▼)로 표시한 것은 베타아밀로이드 응집으로 인한 플라크를 나타낸다. 비히클 처리군과 트라메티닙 처리군 모두에서 베타아밀로이드 플라크가 존재하고 있었으나, 특히 트라메티닙 0.1 mg/kg을 투여한 군에서 비히클 그룹과 대비하여 유사한 정도의 베타아밀로이드 플라크의 존재에도 불구하고 Tuj1이 염색된 세포의 수가 현저히 증가되어 있음을 확인하였다.
실험예 9-2: 해마의 치아이랑(dentate gyrus) 부분의 Nissl, NeuN, 및 DCX 발현 확인
마우스 치아이랑(dentate gyrus)의 subgranular zone (SGZ)에서 신경세포신생 과정이 활성화 되면 신경줄기세포가 비대칭 분열이 일어나게 되고 그 결과로 Type 2 형태의 세포가 가장 초기에 생성된다. Type 2 형태의 세포는 작은 세포체(soma)와 비정형의 세포핵을 가지고 있고, 짧고 수평방향으로 세포가 자리잡고 있으며, nestin이나 Dcx를 발현하고 있다. Type 3 형태의 세포는 Type 2 형태의 세포가 조금 더 분화한 형태의 세포를 말하는데 신경모세포(neuroblast)라고도 한다. Type 3 세포는 신경아교세포계보(glial cell lineage)가 아니라 신경세포계보(neuronal cell lineage)로 분화되는 분화 초기의 세포이다. Type 3 세포는 마우스 치아이랑의 subgranular zone에서 granular layer 쪽으로 약간 이동된 위치에 존재하며, 세포의 모양은 Type 2 세포와 달리 수평 방향에서 수직 방향의 모양으로 바뀌어 있는 형태이다. 마우스 치아이랑의 subgranular zone에 Type 2와 Type 3 세포가 존재하는 것은 신경세포신생이 이루어지고 있음을 의미한다.
Nissl 염색은 신경세포의 Nissl body를 염색하는 것으로 뇌에서 신경세포의 분포 및 신경세포의 상태를 확인할 수 있는 염색방법이다. Nissl 염색을 위하여 실험예 8의 마우스 뇌의 슬라이드 위 조직을 자일렌, 알코올 100%, 90%, 80%, 70%, 50%, 물의 순으로 5분씩 담가 주어 재수화한 후, 0.1% cresyl violet (Sigma, cat#.C5042)용액에 상온에서 15분간 담그고 다시 알코올 80%, 90%, 100%, 자일렌으로 탈수화했다. cover slip으로 잘 덮은 후 뇌 내 신경세포를 관찰하였다.
NeuN 염색은 실험예 8에서와 동일한 방법으로 수행하고, DCX 염색 역시 동일한 방법으로 수행하되 NeuN 항체 대신 DCX 항체(Santa cruz, cat#.sc271390)를 사용하여 실험하였다.
그 결과를 도 16a에 나타냈다. Nissl 염색과 NeuN 염색의 결과, 트라메티닙을 투여한 5XFAD 마우스의 경우 치아이랑(dentate gyrus)의 subgranular zone(SGZ) 부분과 subgranular zone보다 약간 더 granular zone에 가까운 부분에서 신경세포신생 과정 도중에 특징적으로 나타나는 Type 2 또는 Type 3 세포의 모양을 갖는 세포들이 많이 증가되어 있는 것으로 나타났다. 또한 DCX 염색에 의해서도 염색되는 미성숙 신경세포들(도 16의 “Dcx”로 표시한 열의 사진에서 화살표(→)로 표시함)이 확인되어, 트라메티닙이 투여된 마우스의 해마의 치아이랑 부분에서 신경재생이 일어나고 있음을 확인하였다.
실험예 9-3: 해마의 치아이랑(dentate gyrus) 부분의 BrdU 염색
신경세포의 신생이 일어나기 위하여서는 신경줄기세포의 비대칭 분열(asymmetric division)이 먼저 일어나야 하는데, 이를 확인하기 위하여 다음과 같이 실험을 수행하였다.
실험예 8에서 희생하기 전 5일부터 50 mg/kg의 BrdU를 5일간 매일 투여 받은 5XFAD 마우스의 뇌 조직 슬라이드를 재수화하고, 1.5M HCl(염산)에 담그고 37℃ 에서 30분간 인큐베이션 해 주었다. 이후 0.5% BSA(Bovine serum albumin), 0.3% TritonX-100, 10% Normal goat serum이 포함된 용액에서 blocking을 해 주고 BrdU 항체(Cell signaling, cat#.5292)를 4℃에서 하루 동안 인큐베이션 시켰다. 다음날 Fluorescein isothiocyanate(FITC)-2차 항체를 상온에서 1 시간 인큐베이션 시켜 형광염색법으로 염색하였다. 해마의 치아이랑 부분의 염색된 조직을 형광현미경으로 확인하였다.
그 결과를 도 16a의 “BrdU”로 표시한 열의 사진에 나타냈다. 사진에서 화살표 머리(▼)로 표시한 세포들이 BrdU가 염색된 세포이다. 트라메티닙을 투여한 5XFAD 마우스의 치아이랑에서 BrdU가 염색되는 세포의 수가 비히클 투여 그룹에 비하여 증가되어 있었다. 도 16b는 BrdU가 염색된 세포의 수를 계수한 결과로서, 역시 트라메티닙 투여군에서 BrdU 염색된 세포의 수 증가를 보여준다. 도 16b는 그룹 당 3 마리의 마우스에서 마리 당 3 부분의 면을 분석하여 총 9 면의 세포의 수를 계수하여 그 평균값을 그래프로 나타낸 것이다.
위 실험예들의 결과를 바탕으로 트라메티닙이 알츠하이머병 모델 마우스에서 신경줄기세포의 분화를 유도하여 신경세포의 신생을 유도함을 알 수 있다. 이러한 결과는 트라메티닙이 알츠하이머병의 근본적 치료제로서 유용하게 사용될 수 있을 뿐만 아니라, 대뇌피질의 신경세포 손상 또는 소실, 특히 운동피질의 손상 또는 소실이 원인이 되는 질환의 치료 또는 예방에 유효할 것임을 시사한다.
실험예 10: 알츠하이머 병 모델 마우스에서 신경세포 보호 효과 확인
5XFAD 마우스의 대뇌 피질 및 해마이행부에서 트라메티닙이 신경세포의 보호 효과를 가지는 것인지를 확인하기 위하여 세포사멸(apoptosis)을 확인할 수 있는 면역조직화학염색 방법인 TUNEL (Terminal deoxynucleotidyl transferase dUTP nick end labeling) assay를 수행하였다. TUNEL assay는 세포사멸이 일어날 때, 부서지고 있는 DNA의 3'-hydroxyl 말단을 염색하는 염색법으로, 조직 내 사멸하고 있는 세포를 눈으로 확인할 수 있다.
실험예 8의 5XFAD 마우스의 시상면(sagittal) 뇌 조직 슬라이드를 재수화 해 주고 TUNEL assay kit (Promega, Wisconsin, USA, cat#.G3250)를 이용하여 염색하였다. 구체적으로, 뇌 조직 슬라이드를 20 μg/ml proteinase K 용액으로 10분간 permeabilization 한 후, Equilibration 버퍼로 10분간 인큐베이션 하고 TdT 용액으로 37℃에서 1시간 인큐베이션 함으로써 염색하였다. 이 후 5XFAD 마우스에서 세포 사멸이 현저하게 나타난다고 알려진 체성감각피질(somatosensory cortex) 부분과 해마이행부(subiculum)를 현미경으로 관찰하였다. 이 때, 일반 성체 마우스 뇌 조직 슬라이드를 이용하여 TUNEL assay 실험이 잘 수행되었는지 확인하였다.
도 17은 그 결과를 나타낸다. TUNEL assay 결과, 일반 성체 마우스 뇌의 경우는 세포사멸이 일어나지 않아 녹색 형광 표시가 나타나지 않았으나(도 17에서 “Normal mouse”로 표시한 사진) 5XFAD 마우스 뇌의 경우 체성감각피질 부분(도 17에서 “cortex”로 표시한 행의 사진)과 해마이행부(도 17에서 “subiculum”으로 표시한 행의 사진)에서 녹색 형광으로 염색된 세포가 많은 것을 확인할 수 있었다. 도 17에서 해마이행부의 경우 염색된 세포는 화살표(→)로 표시하였고 체성감각피질의 경우 염색된 세포가 많아 별도로 화살표로 표시하지 않았다. 트라메티닙을 투여한 5XFAD 마우스는 체성감각피질 부분과 해마이행부에서 TUNEL 염색이 되는 세포의 수가 비히클 투여 그룹 보다 현저히 감소되어 있음을 확인할 수 있었다.
위 실험예들의 결과를 바탕으로 트라메티닙이 알츠하이머 병 모델 마우스에서 신경세포의 사멸에 대하여 보호하는 효과를 가지고 있음을 알 수 있다.
실험예 11: 알츠하이머 병 모델 마우스에서 소뇌 푸르킨예 세포(Purkinje cell) 보호 효과 확인
실험예 8의 5XFAD 마우스의 뇌 조직 슬라이드에 Tuj1 항체 및 calbindin 항체(Cell signaling, cat#.13176)를 4°C에서 하루 동안 인큐베이션 시키고 다음 날 Fluorescein isothiocyanate (FITC)-2차 항체 또는 Rhodamine-2차 항체를 상온에서 1시간 인큐베이션시켜 형광염색법으로 염색하였다. 소뇌 푸르킨예 세포층(Purkinje cell layer) 부분을 형광현미경으로 관찰한 결과의 사진을 도 18에 나타냈다. 각 처리군별로 2개(Tuj1 염색) 또는 3개(calbindin 염색)의 슬라이드에 대한 사진을 첨부하였다.
도 18에서 보는 바와 같이, 비히클 처리군의 푸르킨예 세포는 뻗어나가는 액손의 형태가 가늘고 중간이 끊어지는 양상을 띄고 있는데 반하여, 트라메티닙 투여군, 특히 트라메티닙 0.1 mg/kg 처리군은 비히클 처리군에 비하여 푸르킨예 세포 액손의 분지형성(arborization)이 증가되어 있거나 액손 구조가 보전되어 있었다.
소뇌(cerebellum)는 주로 감각 인지의 통합과 운동근육의 조정, 제어에 중요한 역할을 담당하는 기관으로 알려져 있다. 소뇌에 존재하는 세포들 중 가장 눈에 띄는 세포인 푸르킨예 세포(Purkinje cell)는 뇌에서 크기가 가장 큰 세포 중의 하나이며, 푸르킨예 세포에서 뻗어 나가는 액손에서 형성된 분지가(arborization) 서로 시냅스를 형성하고, 소뇌의 깊은 핵까지 뻗어 나가 운동근육을 조정, 제어하는 역할을 담당한다. 본 실험예의 결과는 트라메티닙이 소뇌에서 푸르킨예 세포를 보호하고 액손의 분지형성을 증가시켜, 소뇌의 푸르킨예 세포의 손실 또는 손상이 원인이 되어 발생하는 소뇌성 운동실조증(cerebellar ataxia) 등의 치료에 사용될 수 있음을 보여준다.
실험예 12: 알츠하이머 병 모델 마우스에서 트라메티닙의 MEK 활성 저해 효과 확인
신경퇴행성 질환 치료용 약물은 중추신경계에 작용하는 약물이므로 혈액뇌장벽(blood brain barrier)을 통과하여 뇌에서 작용할 수 있는지 여부가 문제가 된다. MEK 1/2 억제제 중 AS703026과 같은 물질은 마우스의 BBB를 효과적으로 통과하여 마우스 뇌에서 MEK를 억제하는 결과 phosphorylated ERK(pERK: ERK의 활성화된 형태)의 발현을 감소시키는 것으로 알려져 있다(Shaw et al. (2012) Evaluation of brain pharmacokinetics as a potential differentiation factor for the MEK inhibitors, MSC2015103 and pimasertib. Abstract LB-456, American Association for Cancer Research Annual Meeting, Chicago, IL). 본 실험예에서는 MEK1/2 억제제인 트라메티닙이 5XFAD 마우스에 경구 투여하였을 때, 뇌로 전달되어 위 실험예들과 같은 효과를 나타낸 것인지를 확인하기 위하여 뇌 조직에서의 pERK 발현 수준을 측정하였다.
실험예 8에서 초저온냉동고(Deep freezer)에 보관 중이던 군당 3 마리 5XFAD 마우스 뇌의 반구(hemisphere)를 액체 질소에 넣고, 액체 질소가 담긴 막자사발에서 곱게 갈았다. 갈은 분말을 6 등분 하여 각각 새 튜브에 옮겨 다시 초저온냉동고에 보관하였다. 그 중 한 튜브를 꺼내 실험예 5-2의 방법으로 western blotting을 수행하였다. RIPA 버퍼를 넣고 파이펫팅으로 분말을 잘 현탁하고 10분간 얼음에서 인큐베이션한 뒤 13000rpm, 4℃에서 원심분리하여 상층액을 모았다. 단백질의 농도를 측정한 후 sample 버퍼(0.2 5M Tris-HCl pH6.8, 0.05% SDS, 50% glycerol, 0.25 M DTT, 0.5 mg/ml BPB)를 첨가하고 100℃에서 10분 끓인 후 -20℃에 보관하였다. 10% SDS-PAGE gel을 만들고 10 μg 단백질 샘플을 로딩하여 분리한 후 nitrocellulose membrane에 옮기고 5% skim milk로 상온에서 1시간동안 blocking 하였다. 0.1% Tween 20을 포함하는 tris buffered saline (TBS)에 pERK (Cell signaling, cat#.4370)와 ERK 항체를 각각 준비하여 상온에서 1시간 인큐베이션 한 후 Horseradish peroxidase가 붙어 있는 2차 항체를 상온에서 1시간 인큐베이션 하였다. 이 후 감광장비로 단백질의 발현을 확인하였다(도 19a). pERK의 발현양 변화를 정량하기 위하여 농도계측(Densitometry)을 하여 pERK 및 ERK의 발현농도를 측정하고, pERK의 발현양을 ERK 발현양으로 정규화(Normalize) 한 후 비히클 그룹 대비 트라메티닙 처리 그룹에서의 정규화 된 pERK 발현양을 도 19b에 표시하였다.
도 19에서 나타난 바와 같이 비히클 그룹과 비교하여 트라메티닙을 0.1 mg/kg, 1.0 mg/kg으로 투여한 마우스의 뇌에서 pERK 단백질의 양이 현저히 감소되어 있음을 확인하였다.
이 결과는 트라메티닙을 경구 투여하였을 때 트라메티닙이 뇌로 이동하여 MEK의 활성을 억제한 결과 pERK의 양이 감소되었음을 나타내고, 이에 따라 신경세포의 신생 및 신경세포 보호 효과가 나타난 것일 수 있음을 시사하는 것이다.
실험예 13: 알츠하이머 병 모델 마우스에서 베타아밀로이드(Aβ)의 축적 감소 확인
알츠하이머 병의 가장 큰 병리학적 특징은 베타아밀로이드의 축적이므로, 트라메티닙이 베타아밀로이드 축적을 감소시키는 효과가 있는지 확인하고자 하였다. 실험예 12로부터 얻어진 5XFAD 마우스 뇌의 반구(hemisphere)의 잘 갈은 분말을 이용하여 Aβ(1-40)과 Aβ(1-42)의 양을 ELISA(Enzyme-linked immunosorbent assay) 방법으로 확인하였다. 다음과 같이 ELISA kit (Invitrogen, MA, cat#.KHB3442)를 이용하여 실험을 수행하였다. 먼저 5 M guanidine-HCl 용액을 넣고 파이펫팅으로 마우스 뇌의 분말을 잘 현탁하고, 16000xg, 4℃로 원심분리하여 상층액을 모았다. 단백질의 농도를 측정한 후 30~50 μg의 단백질이 100 μl 가 되도록 dilution 버퍼를 넣어 준비하였다. Aβ(1-40) 혹은 Aβ(1-42) 항체를 96-웰 플레이트에 각각 100 μl씩 넣고 상온에서 2시간 인큐베이션 한 후 용액을 제거하고 4번 세척용 버퍼로 세척하였다. HRP가 붙은 2차 항체를 각각 100 μl씩 넣고 상온에서 30분간 인큐베이션 하였다. 다시 용액을 제거하고 세척용 버퍼로 4번 세척하였다. 이 후 준비해 두었던 단백질을 100 μl씩 각 웰에 넣고 어두운 곳에서 30분간 인큐베이션 한 후 stop 용액을 100 μl 더 첨가하여 반응을 멈추었다. 이 후 감광기계를 이용하여 450 nm 에서 감광반응을 측정하였다. 흡광도 수치를 기준 농도 대비 환산하여 측정된 각 단백질의 농도를 계산하였다. 단백질 총량(30~50 μg) 대비 Aβ(1-40), Aβ(1-42) 의 양을 계산하고, 다시 Aβ(1-40) 대비 Aβ(1-42)의 양을 계산하였다. 그룹 당 3 마리에서의 수치의 평균값을 구해 도 20에 나타냈다. 도 20에서 보는 바와 같이 트라메티닙을 처리한 그룹에서 비히클 처리 그룹 보다 Aβ(1-42)/Aβ(1-40)의 양이 줄어드는 것을 확인하였다.
이는 트라메티닙이 알츠하이머병 동물 모델에서 베타아밀로이드의 양, 특히 독성이 강한 올리고머나 응집체를 형성하는 경향이 강한 Aβ(1-42)의 양을 줄여 신경세포를 보호할 수 있음을 나타낸다.

Claims (20)

  1. 신경재생이 필요한 환자에게 MEK (mitogen-activated protein kinase kinase) 1 및 MEK 2를 모두 억제하는 화합물(MEK 1/2 억제제)을 투여하는 것을 포함하는 신경재생을 유도하는 방법으로서, 상기 MEK 1/2 억제제는 트라메티닙(trametinib), 피마설팁(pimasertib; AS703026), 비니메티닙(binimetinib), 레파메티닙(refametinib),
    Figure PCTKR2017013444-appb-I000011
    (AZD8330),
    Figure PCTKR2017013444-appb-I000012
    (PD318088),
    Figure PCTKR2017013444-appb-I000013
    (PD0325901), 및
    Figure PCTKR2017013444-appb-I000014
    (RO5126766)
    로 이루어진 군에서 선택되는 하나 이상의 화합물인 방법.
  2. 제1항에 있어서, MEK 1/2 억제제가 신경줄기세포를 신경세포로 분화시키거나, 베타아밀로이드에 의한 세포 독성으로부터 신경줄기세포 및 신경세포를 보호하거나, 둘 다에 의해 신경재생을 유도하는 것인 방법.
  3. 제1항에 있어서, MEK 1/2 억제제가 트라메티닙인 방법.
  4. MEK (mitogen-activated protein kinase kinase) 1 및 MEK 2를 모두 억제하는 화합물(MEK 1/2 억제제)을 투여하는 것을 포함하는, 신경세포의 손실 또는 손상으로부터 신경세포를 보호하는 방법으로서, 상기 MEK 1/2 억제제는 트라메티닙(trametinib), 피마설팁(pimasertib; AS703026), 비니메티닙(binimetinib), 레파메티닙(refametinib),
    Figure PCTKR2017013444-appb-I000015
    (AZD8330),
    Figure PCTKR2017013444-appb-I000016
    (PD318088),
    Figure PCTKR2017013444-appb-I000017
    (PD0325901), 및
    Figure PCTKR2017013444-appb-I000018
    (RO5126766)
    로 이루어진 군에서 선택되는 하나 이상의 화합물인 방법.
  5. 제4항에 있어서, MEK 1/2 억제제가 트라메티닙인 방법.
  6. 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성질환의 예방 또는 치료가 필요한 환자에게 트라메티닙(trametinib), 피마설팁(pimasertib; AS703026), 비니메티닙(binimetinib), 레파메티닙(refametinib),
    Figure PCTKR2017013444-appb-I000019
    (AZD8330),
    Figure PCTKR2017013444-appb-I000020
    (PD318088),
    Figure PCTKR2017013444-appb-I000021
    (PD0325901), 및
    Figure PCTKR2017013444-appb-I000022
    (RO5126766)
    로 이루어진 군에서 선택된 하나 이상의 MEK 1/2 억제제를 투여하는 것을 포함하는, 신경세포의 손실 또는 손상에 의해 발생하는 신경퇴행성 질환의 예방 또는 치료 방법.
  7. 제6항에 있어서, 신경퇴행성 질환이 치매, 알츠하이머병, 혈관성치매, 노인성치매, 전두측두엽치매, 루이소체치매, 파킨슨병, 다계통위축증, 피질기저핵변성(corticobasal degeneration), 진행성핵상마비, 헌팅턴병, 근위축성 측삭 경화증(루게릭병, ALS), 원발성측삭경화증, 척수근육위축병, 진행성 연수마비(progressive bulbar palsy; PBP), 진행성 근위축증(progressive muscular atrophy; PMA), 가성연수마비(pseudobulbar palsy), 유전성 강직성 하반신마비(hereditary spastic paraplegia; HSP), 소뇌성 운동실조증, 크로이츠펠트-야콥병, 다발성경화증, 및 길랑-바레 증후군으로 이루어진 군에서 선택된 것인 방법.
  8. 제6항에 있어서, MEK 1/2 억제제가 트라메티닙인 방법.
  9. 제8항에 있어서, 신경퇴행성 질환이 알츠하이머병인 방법.
  10. 제8항에 있어서, 신경퇴행성 질환이 혈관성치매인 방법.
  11. 제8항에 있어서, 신경퇴행성 질환이 근위축성 측삭 경화증(루게릭병, ALS)인 방법.
  12. 제8항에 있어서, 신경퇴행성 질환이 헌팅턴병인 방법.
  13. 제8항에 있어서, 트라메티닙이 1일 0.1 mg 내지 2 mg의 용량으로 투여되는 것인 방법.
  14. 제13항에 있어서, 트라메티닙이 1일 0.1 내지 1 mg의 용량으로 투여되는 것인 방법.
  15. 제14항에 있어서, 트라메티닙이 1일 0.1 내지 0.5 mg의 용량으로 투여되는 것인 방법.
  16. 1) 성체 마우스 유래의 신경줄기세포에 베타아밀로이드, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), 로테논(Rotenone), 옥시도파민(oxidopamine), 글루타메이트, LPS (lipopolysaccharide), 및 S100B (S100 calcium-binding protein B)로 이루어진 군에서 선택된 하나 이상의 신경세포 손상 유발 물질을 처리하는 단계;
    2) 상기 신경세포 손상 유발 물질이 처리된 신경줄기세포에 시험 물질을 투여하는 단계; 및
    3) 세포의 형태소(morphology) 분석을 통해 신경줄기세포의 분화 및 세포 사멸 여부를 확인하는 단계;
    를 포함하는, 신경퇴행성 질환 치료제 후보 물질의 스크리닝 방법.
  17. 제16항에 있어서, 신경세포 손상 유발 물질이 베타아밀로이드인 방법.
  18. 제17항에 있어서, 베타아밀로이드가 올리고머 형태의 베타아밀로이드인 방법.
  19. 제18항에 있어서, 올리고머 형태의 베타아밀로이드가 베타아밀로이드의 트라이머(trimer)와 테트라머(tetramer)를 포함하는 것인 방법.
  20. 제19항에 있어서, 베타아밀로이드가 42개의 아미노산으로 이루어진 Aβ(1-42)인 방법.
PCT/KR2017/013444 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법 WO2018097628A2 (ko)

Priority Applications (25)

Application Number Priority Date Filing Date Title
AU2017363804A AU2017363804B2 (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
MX2019006040A MX2019006040A (es) 2016-11-25 2017-11-23 Composicion para promover la diferenciacion y proteccion de celulas madre neurales y metodo para inducir la regeneracion neural usando las mismas.
KR1020187017867A KR102114017B1 (ko) 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
EP20204059.8A EP3800471A1 (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
MYPI2019002759A MY194462A (en) 2016-11-25 2017-11-23 Composition for Promoting Differentiation of and Protecting Neural Stem Cells and Method for Inducing Neural Regeneration using same
SG11201903725UA SG11201903725UA (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
DK17874605.3T DK3425390T3 (da) 2016-11-25 2017-11-23 Sammensætning til fremme af differentiering og beskyttelse af neurale stamceller og fremgangsmåde til induktion af neural regenerering ved anvendelse heraf
NZ754020A NZ754020A (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
EP17874605.3A EP3425390B1 (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
KR1020187001715A KR101892457B1 (ko) 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
KR1020207013080A KR20200056465A (ko) 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
BR112019009711A BR112019009711A2 (pt) 2016-11-25 2017-11-23 método de indução de neuro-regeneração, método de proteção de neurônios contra perda ou dano neuronal, método de prevenção ou tratamento de doença neurodegenerativa devido à perda ou dano neuronal, e método de triagem de candidatos de fármaco para o tratamento de doenças neurodegenerativas
KR1020217023789A KR102519796B1 (ko) 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
CA3041245A CA3041245C (en) 2016-11-25 2017-11-23 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
JP2018554751A JP6663509B2 (ja) 2016-11-25 2017-11-23 神経幹細胞の分化促進用及び保護用の組成物、並びにそれを利用して神経再生を誘導する方法
ES17874605T ES2848720T3 (es) 2016-11-25 2017-11-23 Composición para promover la diferenciación y la protección de células madre neurales y método para inducir la regeneración neural utilizando la misma
CN201780003031.4A CN109073634B (zh) 2016-11-25 2017-11-23 用于诱导神经干细胞的分化和保护的组合物及使用该组合物诱导神经再生的方法
EA201990953A EA038404B1 (ru) 2017-03-22 2017-11-23 Применение траметиниба для лечения нейродегенеративного заболевания, вызванного утратой или повреждением нейронов
CN202210691469.9A CN115025225A (zh) 2016-11-25 2017-11-23 用于诱导神经干细胞的分化和保护的组合物及使用该组合物诱导神经再生的方法
US15/897,138 US10485802B2 (en) 2016-11-25 2018-02-14 Composition for inducing differentiation and protection of neural stem cells and method for inducing neuro-regeneration using the same composition
IL266573A IL266573B (en) 2016-11-25 2019-05-12 A preparation for promoting the differentiation and protection of neural stem cells and a method for inducing neural regeneration using it
ZA2019/03226A ZA201903226B (en) 2016-11-25 2019-05-22 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
PH12019501143A PH12019501143A1 (en) 2016-11-25 2019-05-22 Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
US16/545,438 US11147816B2 (en) 2016-11-25 2019-08-20 Composition for inducing differentiation and protection of neural stem cells and method for inducing neuro-regeneration using the same composition
US17/463,219 US11701360B2 (en) 2016-11-25 2021-08-31 Composition for inducing differentiation and protection of neural stem cells and method for inducing neuro-regeneration using the same composition

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2016-0158739 2016-11-25
KR20160158739 2016-11-25
KR20170036268 2017-03-22
KR10-2017-0036268 2017-03-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/897,138 Continuation US10485802B2 (en) 2016-11-25 2018-02-14 Composition for inducing differentiation and protection of neural stem cells and method for inducing neuro-regeneration using the same composition

Publications (2)

Publication Number Publication Date
WO2018097628A2 true WO2018097628A2 (ko) 2018-05-31
WO2018097628A3 WO2018097628A3 (ko) 2018-08-09

Family

ID=62196019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/013444 WO2018097628A2 (ko) 2016-11-25 2017-11-23 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법

Country Status (20)

Country Link
US (3) US10485802B2 (ko)
EP (2) EP3800471A1 (ko)
JP (2) JP6663509B2 (ko)
KR (4) KR101892457B1 (ko)
CN (2) CN115025225A (ko)
AU (1) AU2017363804B2 (ko)
BR (1) BR112019009711A2 (ko)
CA (1) CA3041245C (ko)
CL (1) CL2019001415A1 (ko)
DK (1) DK3425390T3 (ko)
ES (1) ES2848720T3 (ko)
HU (1) HUE052854T2 (ko)
IL (1) IL266573B (ko)
MX (1) MX2019006040A (ko)
MY (1) MY194462A (ko)
NZ (1) NZ754020A (ko)
PH (1) PH12019501143A1 (ko)
SG (2) SG10202105383QA (ko)
WO (1) WO2018097628A2 (ko)
ZA (1) ZA201903226B (ko)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3800471A1 (en) 2016-11-25 2021-04-07 Genuv Inc. Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
EP3962514A4 (en) * 2019-05-02 2023-04-19 Board of Regents, The University of Texas System METHODS AND COMPOSITIONS INVOLVING TERT ACTIVATION THERAPIES
KR20220024161A (ko) * 2019-05-22 2022-03-03 주식회사 지뉴브 트라메티닙 및 마커를 이용한 신경퇴행성 질환의 치료를 위한 투여 방법 및 투약 용법
CN111143763B (zh) * 2019-12-13 2021-09-17 广东电网有限责任公司 电力设备状态的评估方法、装置及其存储介质
KR20230004597A (ko) * 2020-04-14 2023-01-06 주식회사 지뉴브 신경퇴행성질환 치료제에 대한 반응을 평가하기 위한 방법 및 조성물
WO2022045723A1 (ko) * 2020-08-24 2022-03-03 차의과학대학교 산학협력단 신경줄기세포의 도파민 신경세포로의 분화 촉진용 조성물
CN112695019B (zh) * 2021-03-23 2021-06-25 翌圣生物科技（上海）有限公司 逆转录酶突变体及其应用
CN115322966B (zh) * 2022-08-19 2024-04-16 山东大学 叶酸钙纳米颗粒的批量制备方法及诱导神经干细胞分化为胆碱能神经元的方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005121142A1 (en) 2004-06-11 2005-12-22 Japan Tobacco Inc. 5-amino-2,4,7-trioxo-3,4,7,8-tetrahydro-2h-pyrido’2,3-d! pyrimidine derivatives and related compounds for the treatment of cancer

Family Cites Families (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6310060B1 (en) * 1998-06-24 2001-10-30 Warner-Lambert Company 2-(4-bromo or 4-iodo phenylamino) benzoic acid derivatives and their use as MEK inhibitors
CZ2003680A3 (cs) * 2000-08-11 2003-11-12 Cephalon, Inc. Způsob modulace kinasových proteinů s vícenásobnou vazbou a vyhledávání sloučenin modulujících kinasové proteiny s vícenásobnou vazbou
MXPA04010255A (es) * 2002-04-19 2008-03-04 Univ Toronto Metodos inmunologicos y composiciones para el tratamiento de la enfermedad de alzheimier.
AU2003252559A1 (en) 2002-08-17 2004-03-03 Hae-Young Suh A method for transdifferentiating mesenchymal stem cells into neuronal cells
CN101076543A (zh) * 2004-10-13 2007-11-21 阿布林克斯公司 用于治疗和诊断变性神经疾病如阿尔茨海默症的单结构域骆驼抗淀粉样蛋白β的抗体以及包含它的多肽
KR101318012B1 (ko) 2004-10-20 2013-10-14 메르크 세로노 에스.에이. 3-아릴아미노 피리딘 유도체
WO2006061717A2 (en) * 2004-12-09 2006-06-15 Neuro Therapeutics Ab Materials and methods related to dickkopfs (dkk) and neurogenesis
JP4792290B2 (ja) * 2005-12-27 2011-10-12 財団法人 東京都医学総合研究所 神経幹細胞の製造方法
FR2905009A1 (fr) * 2006-08-18 2008-02-22 Servier Lab Methode de criblage de composes aux proprietes anti-amyloide
KR101082484B1 (ko) * 2007-11-06 2011-11-11 한국과학기술원 퇴행성 신경질환 치료제의 스크리닝 방법
KR20100088342A (ko) * 2009-01-30 2010-08-09 연세대학교 산학협력단 신경줄기세포의 분화 촉진용 조성물
WO2010137547A1 (ja) * 2009-05-25 2010-12-02 国立大学法人東京工業大学 中枢神経細胞の増殖及び分化に係る中核因子を含む医薬組成物
EP2435585A4 (en) * 2009-05-28 2013-02-20 Univ Central Florida Res Found METHOD FOR SCREENING MEDICAMENTS FOR INVERSION OF NEUROTOXICITY OF BETA AMYLOID
WO2011062013A1 (ja) * 2009-11-18 2011-05-26 国立大学法人徳島大学 神経幹細胞及び／又は神経系前駆細胞への選択的分化誘導剤
KR101211610B1 (ko) 2010-05-10 2012-12-12 주식회사 스템폰즈 Ｂｍｉ１, ＭＥＫ 억제제와 ＧＳＫ 억제제를 이용하여 체세포로부터 배아줄기세포 유사세포로의 역분화를 유도하는 조성물 및 이를 이용한 배아줄기세포 유사세포의 제조방법
KR102029391B1 (ko) * 2011-12-13 2019-11-08 유니사 벤쳐스 피티와이 엘티디 다능성 줄기세포의 제조방법
ES2415581B2 (es) 2011-12-20 2014-02-19 Universidad Nacional De Educación A Distancia Compuestos potenciadores del aprendizaje.
US9452215B2 (en) * 2012-02-22 2016-09-27 The Regents Of The University Of Colorado Bourvadin derivatives and therapeutic uses thereof
CN102604894B (zh) * 2012-02-29 2014-07-30 中国科学院广州生物医药与健康研究院 用于制备神经干细胞的培养基及其用途
HUE028850T2 (en) 2012-05-30 2017-01-30 Merck Patent Gmbh N-((S) -2,3-Dihydroxypropyl) -3- (2-fluoro-4-iodo-phenylamino) -isonicotinamide solid forms
US10017734B2 (en) 2013-08-06 2018-07-10 Takeda Pharmaceutical Company Limited Method for producing dopaminergic neurons
US9532987B2 (en) * 2013-09-05 2017-01-03 Genentech, Inc. Use of a combination of a MEK inhibitor and an ERK inhibitor for treatment of hyperproliferative diseases
US9943549B2 (en) * 2015-03-17 2018-04-17 Food Industry Research And Development Institute Isolation of human neural stem cells from amniotic fluid of patients with neural tube defects
KR20160138756A (ko) 2015-05-26 2016-12-06 연세대학교 산학협력단 신경줄기세포로부터 도파민 신경세포로의 분화 유도용 조성물 및 이를 이용하여 신경줄기세포로부터 도파민 신경세포로 분화시키는 방법
US10179132B2 (en) 2015-05-26 2019-01-15 Industry-Academic Cooperation Foundation, Yonsei University Composition for inducing differentiation of multipotent neural stem cells into dopaminergic neurons and method for inducing differentiation of multipotent neural stem cells into dopaminergic neurons by using the same
WO2017117386A1 (en) 2015-12-30 2017-07-06 Icahn School Of Medicine At Mount Sinai Methods of treating cancer using network brakes
WO2017161188A1 (en) 2016-03-16 2017-09-21 The Regents Of The University Of California Detection and treatment of anti-pd-1 therapy resistant metastatic melanomas
CN109715802A (zh) 2016-03-18 2019-05-03 卡里斯科学公司 寡核苷酸探针及其用途
EP3240538B1 (en) 2016-03-25 2021-09-29 AB Science Use of masitinib for treatment of an amyotrophic lateral sclerosis patient subpopulation
CN105816461B (zh) 2016-04-06 2018-10-30 福州大学 曲美替尼在制备治疗帕金森症药物上的应用
CN105796544A (zh) * 2016-04-06 2016-07-27 福州大学 Mapk信号通路抑制剂在制备治疗帕金森药物上的应用
JP2019521116A (ja) 2016-06-07 2019-07-25 センター フォー セルラー アンド モレキュラー プラットフォームズ 神経炎症及び神経変性を管理するための方法及び組成物
EP3800471A1 (en) 2016-11-25 2021-04-07 Genuv Inc. Composition for promoting differentiation of and protecting neural stem cells and method for inducing neural regeneration using same
WO2018225062A1 (en) 2017-06-04 2018-12-13 Rappaport Family Institute For Research In The Medical Sciences Method of predicting personalized response to cancer therapy and kit therefor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005121142A1 (en) 2004-06-11 2005-12-22 Japan Tobacco Inc. 5-amino-2,4,7-trioxo-3,4,7,8-tetrahydro-2h-pyrido’2,3-d! pyrimidine derivatives and related compounds for the treatment of cancer

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
ARENDT ET AL.: "Increased Expression and Subcellular Translocation of the Mitogen-Activated Protein Kinase Kinase and Mitogen-Activated Protein Kinase in Alzheimer's Disease", NEUROSCIENCE, vol. 68, no. 1, 1995, pages 5 - 18, XP022251246, DOI: doi:10.1016/0306-4522(95)00146-A
BORCHELT ET AL.: "Familial Alzheimer's Disease-Linked Presenilin 1 Variants Elevate Aβΐ-42/1-40 Ratio In Vitro and In Vivo", NEURON, vol. 17, 1996, pages 1005 - 1013
CHAPUT ET AL.: "SILAC-based Proteomic Analysis to Investigate the Impact of Amyloid Precursor Protein Expression in Neuronal-Like B103 Cells", ELECTROPHORESIS, vol. 33, no. 24, 2012, pages 3728 - 3737
DAHLGREN ET AL.: "Oligomeric and Fibrillar Species of Amyloid-p Peptides Differentially Affect Neuronal Viability", J. BIOL. CHEM., vol. 277, no. 35, 2002, pages 32046 - 32053, XP002403799, DOI: doi:10.1074/jbc.M201750200
DAVIES ET AL.: "Stemistry: The Control of Stem Cells in Situ Using Chemistry", J. MED. CHEM., vol. 58, 2015, pages 2863 - 2894
GARTNER ET AL.: "Elevated Expression of p21ras is an Early Event in Alzheimer's Disease and Precedes Neurofibrillary Degeneration", NEUROSCIENCE, vol. 91, no. 1, 1999, pages 1 - 5
GUERRA ET AL.: "Plasma Membrane Oestrogen Receptor Mediates Neuroprotection Against β-Amyloid Toxicity Through Activation of Raf-1/MEK/ERK Cascade in Septal-Derived Cholinergic SN56 Cells", J. NEUROCHEM., vol. 91, 2004, pages 99 - 109
J. KOREAN NEUROL. ASSOC., vol. 21, no. 2, 2003, pages 174 - 182
JANA ET AL.: "Membrane-bound tetramer and trimer Ap oligomeric species correlate with toxicity towards cultured neurons", J NEUROCHEM., vol. 136, no. 3, 2016, pages 594 - 608
JOURNAL OF BASIC AND CLINICAL PHARMACY, vol. 7, no. 2, 2016, pages 27 - 31
K. MURAKAMI: "Conformation-Specific Antibodies to Target Amyloid-p Oligomers and Their Application to Immunotherapy for Alzheimer's Disease", BIOSCI. BIOTECHNOL. BIOCHEM., vol. 78, no. 8, 2014, pages 1293 - 1305
MAJID ET AL.: "Pharmacologic Treatment with Histone Deacetylase 6 Inhibitor (ACY-738) Recovers Alzheimer's Disease Phenotype in Amyloid Precursor Protein/Presenilin 1 (APP/PS1) Mice", ALZHEIMERS DEMENT., 2015, pages 170 - 181
MILLS ET AL.: "Regulation of Amyloid Precursor Protein Catabolism Involves the Mitogen-Activated Protein Kinase Signal Transduction Pathway", J. NEUROSCI., vol. 17, 1997, pages 9415 - 9422
MOLECULES, vol. 22, 2017, pages 1551
MURAKAMI: "Conformation-specific antibodies to target amyloid β oligomers and their application to immunotherapy for Alzheimer's disease", BIOSCI. BIOTECHNOL. BIOCHEM., vol. 78, no. 8, 2014, pages 1293 - 1305
OAKLEY ET AL.: "Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation", J NEUROSCI, vol. 26, no. 40, 2006, pages 10129 - 10140, XP002688009, DOI: doi:10.1523/​JNEUROSCI.1202-06.2006
PEI ET AL.: "Up-Regulation of Mitogen-Activated Protein Kinases ERK1/2 and MEK1/2 is Associated with the Progression of Neurofibrillary Degeneration in Alzheimer's Disease", BRAIN RES MOL BRAIN RES., vol. 109, no. 1-2, 2002, pages 45 - 55
TAMAGNO ET AL.: "JNK and ERK1/2 Pathways Have a Dual Opposite Effect on the Expression of BACE1", NEUROBIOLOGY OF AGING, vol. 30, 2009, pages 1563 - 1573, XP026521809, DOI: doi:10.1016/j.neurobiolaging.2007.12.015
WATSON ET AL.: "Macrophage Inflammatory Protein 2 Inhibits p-Amyloid Peptide (1-42)-Mediated Hippocampal Neuronal Apoptosis through Activation of Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase Signaling Pathways", MOLECULAR PHARMACOLOGY, vol. 67, no. 3, 2005, pages 757 - 765
YAMAGUCHI ET AL., INTERNATIONAL JOURNAL OF ONCOLOGY, vol. 39, 2011, pages 23 - 31
ZHAO ET AL.: "Mechanisms and Functional Implications of Adult Neurogenesis", CELL, vol. 132, 2008, pages 645 - 660

Also Published As

Publication number Publication date
KR102519796B1 (ko) 2023-04-11
MX2019006040A (es) 2019-08-21
US20180169102A1 (en) 2018-06-21
CA3041245A1 (en) 2018-05-31
US11147816B2 (en) 2021-10-19
US10485802B2 (en) 2019-11-26
AU2017363804B2 (en) 2021-12-23
CN109073634B (zh) 2022-07-08
HUE052854T2 (hu) 2021-05-28
BR112019009711A2 (pt) 2019-08-13
NZ754020A (en) 2022-11-25
EP3800471A1 (en) 2021-04-07
MY194462A (en) 2022-11-30
KR20180116235A (ko) 2018-10-24
PH12019501143A1 (en) 2019-12-16
JP2019513806A (ja) 2019-05-30
WO2018097628A3 (ko) 2018-08-09
DK3425390T3 (da) 2021-02-15
IL266573B (en) 2022-03-01
IL266573A (en) 2019-07-31
AU2017363804A1 (en) 2019-06-20
KR20200056465A (ko) 2020-05-22
CL2019001415A1 (es) 2019-10-04
EP3425390A4 (en) 2019-12-25
ES2848720T3 (es) 2021-08-11
KR102114017B1 (ko) 2020-05-22
ZA201903226B (en) 2023-12-20
JP2020074796A (ja) 2020-05-21
EP3425390A2 (en) 2019-01-09
KR20210095748A (ko) 2021-08-02
US20210401844A1 (en) 2021-12-30
CA3041245C (en) 2022-12-06
SG10202105383QA (en) 2021-07-29
EP3425390B1 (en) 2020-12-23
US20200046706A1 (en) 2020-02-13
JP6663509B2 (ja) 2020-03-11
KR101892457B1 (ko) 2018-08-31
CN115025225A (zh) 2022-09-09
CN109073634A (zh) 2018-12-21
SG11201903725UA (en) 2019-05-30
US11701360B2 (en) 2023-07-18

Similar Documents

Publication Publication Date Title
WO2018097628A2 (ko) 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
WO2018101708A1 (ko) 미토콘드리아를 포함하는 약학 조성물
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2017078499A2 (ko) 단백질 타이로신 탈인산화효소 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 조성물
WO2016209057A2 (ko) 신경전구세포의 분비단백체를 유효성분으로 포함하는 허혈성 질환 또는 신경염증 질환 치료용 조성물
WO2022250477A1 (ko) Hla 동형접합 유도만능줄기세포 유래 신경전구세포를 포함하는 뇌졸중 예방 및 치료용 조성물
WO2022039421A1 (ko) 아베마시클립을 유효성분으로 포함하는 퇴행성 뇌질환의 예방 또는 치료용 약학적 조성물
WO2020197332A1 (ko) 봉독 추출물을 유효성분으로 함유하는 신경염증 질환 예방 또는 치료용 조성물
WO2019245347A2 (ko) 신경퇴행성 질환 예방 또는 치료용 조성물
WO2016068616A1 (ko) C3 또는 c1r 보체를 분비하는 태반 유래 세포 및 이를 포함하는 조성물
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2023090971A1 (ko) 직접교차분화 유도용 조성물 및 이로 처리된 줄기세포
WO2020122392A1 (ko) 조타로리무스를 유효성분으로 함유하는 세포노화 관련 질환 예방 또는 치료용 조성물
WO2017160128A1 (ko) Bkca 채널 활성화용 조성물
WO2023244051A1 (ko) 넉줄고사리 추출물을 유효성분으로 포함하는 퇴행성 신경질환 예방 또는 치료용 조성물
WO2017014545A1 (ko) 멜라닌 응집 호르몬을 유효성분으로 포함하는 파킨슨병 치료 및 레보도파 부작용 억제용 약학 조성물
WO2021096270A1 (ko) Ampk 억제기능과 아연항상성 조절기능에 기반한 다발성 경화증 치료용 약학적 조성물
WO2023224431A1 (ko) 삼차원 시상하부 오가노이드로부터 유래된 신경줄기세포를 포함하는 노인성 질환 예방 및 치료용 약학 조성물 및 그의 용도
WO2019209065A1 (ko) 이브루티닙을 유효성분으로 포함하는 퇴행성 뇌질환의 예방 또는 치료용 약학적 조성물
WO2020017725A1 (ko) 보체 성분 8 감마 단백질 또는 이의 단편을 포함하는 신경염증성 질환 치료용 조성물
EA038404B1 (ru) Применение траметиниба для лечения нейродегенеративного заболевания, вызванного утратой или повреждением нейронов
WO2011129516A1 (ko) 데커시놀 유도체, 그 제조방법 및 이를 포함하는 약학적 조성물
WO2019013607A1 (ko) Oct4 저해용 조성물 및 이의 용도

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 1020187001715

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2017874605

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2018554751

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017874605

Country of ref document: EP

Effective date: 20181005

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17874605

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3041245

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019009711

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017363804

Country of ref document: AU

Date of ref document: 20171123

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112019009711

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190513