WO2019245347A2 - 신경퇴행성 질환 예방 또는 치료용 조성물 - Google Patents

신경퇴행성 질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2019245347A2
WO2019245347A2 PCT/KR2019/007556 KR2019007556W WO2019245347A2 WO 2019245347 A2 WO2019245347 A2 WO 2019245347A2 KR 2019007556 W KR2019007556 W KR 2019007556W WO 2019245347 A2 WO2019245347 A2 WO 2019245347A2
Authority
WO
WIPO (PCT)
Prior art keywords
neurodegenerative diseases
acceptable salt
acid
pde
disease
Prior art date
Application number
PCT/KR2019/007556
Other languages
English (en)
French (fr)
Other versions
WO2019245347A3 (ko
Inventor
고재영
김하나
김태윤
이희경
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Priority to EP19823531.9A priority Critical patent/EP3838272A4/en
Priority to US17/254,323 priority patent/US20210220340A1/en
Priority claimed from KR1020190074410A external-priority patent/KR20190143833A/ko
Publication of WO2019245347A2 publication Critical patent/WO2019245347A2/ko
Publication of WO2019245347A3 publication Critical patent/WO2019245347A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Definitions

  • the present invention relates to a composition for preventing or treating neurodegenerative diseases, and more particularly, the present invention relates to a phosphodiesterase which can be usefully used for preventing or treating neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease ( It relates to a neurodegenerative disease containing a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient and a composition for preventing or treating cell damage by amyloid beta.
  • PDE phosphodiesterase
  • Neurodegenerative diseases are associated with symptoms when neurons degenerate, lose function or die. Since these are mainly progressive, the consequences of neurodegenerative diseases are very devastating. Patients with neurodegenerative diseases suffer from extreme degeneration in cognitive or motor skills. Therefore, patients have no quality of life or expectation of life at all.
  • Alzheimer's mechanisms are based on amyloid theory, which is based on the study of the APP, BACE, and Presenilin genes, on the interaction and regulation of other factors in the cell, on the generation, degradation and signaling of factors. Research has been mainstream. Because of this, even if a single compound was prepared through synthesis, the target material was focused on 'BACE1', 'inhibition of amyloid beta fibril formation'.
  • ALS Amyotrophic lateral sclerosis
  • sALS Sporadic ALS
  • fALS familial ALS
  • SOD-1 proteins mutant SOD-1 proteins
  • Neurodegenerative diseases such as Alzheimer's and Lou Gehrig's
  • the lysosomes are organelles that lead to circulation and degradation in relation to autophagy and endocytosis. to be.
  • Such degradation of lysosomes is common in neurodegenerative diseases such as Alzheimer's dementia, Parkinson's, Huntington's and Lou Gehrig's.
  • the function of the lysosome is reduced, condensation and accumulation of the mutant protein occurs, it has been confirmed that causing problems in maintaining homeostasis of organelles.
  • acetylcholinesterase inhibitors or memantine As an agent capable of treating neurodegenerative diseases, acetylcholinesterase inhibitors or memantine, N-methyl-D-aspartate channel blockers are known, and various drugs such as secretase inhibitors are known. While this has been attempted, it has not been studied whether the function or child action of lysosomes in the neurodegenerative diseases may be an alternative to the treatment of new neurodegenerative diseases, and the effective treatments have not yet been developed.
  • the present inventors made diligent efforts to discover novel compounds having a prophylactic or therapeutic effect against neurodegenerative diseases among conventional safe treatments in which clinical trials have been completed. As a result, we attempted to evaluate the mechanisms and the effective effects of PDE inhibitors on the organelles of neurodegenerative diseases. We used these to evaluate the pharmacological mechanisms of various PDE inhibitors in neurodegenerative disease cell / animal models including Alzheimer's dementia. The present invention was completed by confirming the effect.
  • a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases, including aslexoxox (AMX) or a pharmacologically acceptable salt thereof as an active ingredient.
  • AMX aslexoxox
  • Another object of the present invention is Piceathanol, Ataluren, Masitinib, JTC-801, Obatoclax mesylate, Dovitinib, CYC116, Resveratrol, Fifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukas Zafirlukast, Hexachloropene, Febuxostat, and Sulfadiazine are one or more compounds selected from the group consisting of Silver Sulfadiazine or a pharmacologically acceptable salt thereof as an active ingredient. It provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases.
  • Still another object of the present invention is to provide a food composition for preventing or improving neurodegenerative diseases, including a phosphodiesterase (PDE) inhibitor or a food acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • Still another object of the present invention is to provide a food composition for preventing or improving neurodegenerative diseases, including as an active ingredient Amlexanox or a food acceptable salt thereof.
  • Still another object of the present invention is Piceathanol, Atalene, Masitinib, JTC-801, Obatoclax mesylate, Dovitinib, CYC116 , Resveratrol, Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zaphyl Lufir (Zafirlukast), Hexachloropene, Febuxostat, and Sulfadiazine includes at least one compound selected from the group consisting of (Silver Sulfadiazine) or a food acceptable salt thereof as an active ingredient It is to provide a food composition for the prevention or improvement of neurodegenerative diseases.
  • Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating cell damage, including as an active ingredient Amlexanox or a pharmacologically acceptable salt thereof.
  • Still another object of the present invention is to provide a prophylactic or therapeutic use of a neurodegenerative disease comprising a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • Still another object of the present invention is to provide a prophylactic or therapeutic use of a neurodegenerative disease, including as an active ingredient Amlexanox or a pharmacologically acceptable salt thereof.
  • Still another object of the present invention is Piceathanol, Atalene, Masitinib, JTC-801, Obatoclax mesylate, Dovitinib, CYC116 , Resveratrol, Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zaphyl Lufir (Zafirlukast), Hexachloropene, Febuxostat, and Sulfadiazine includes one or more compounds selected from the group consisting of (Silver Sulfadiazine) or a pharmacologically acceptable salt thereof as an active ingredient It is to provide a prophylactic or therapeutic use of neurodegenerative diseases.
  • PDE phosphodiesterase
  • Still another object of the present invention is Piceathanol, Atalene, Masitinib, JTC-801, Obatoclax mesylate, Dovitinib, CYC116 , Resveratrol, Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zaphyl
  • Zafirlukast Hexachloropene
  • Febuxostat and Sulfadiazine
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases, including a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising amlexanox or a pharmacologically acceptable salt thereof as an active ingredient.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Hexachloropene, Febuxostat, and sulfadiazine are neurodegenerative diseases including one or more compounds selected from the group consisting of (Silver Sulfadiazine) or a pharmacologically acceptable salt thereof as an active ingredient. It provides a pharmaceutical composition for the prophylaxis or treatment of.
  • the present invention provides a food composition for preventing or ameliorating neurodegenerative diseases, including a phosphodiesterase (PDE) inhibitor or a food acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a food composition for preventing or ameliorating neurodegenerative diseases comprising Amlexoxox or a food acceptable salt thereof as an active ingredient.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Hexachloropene, Febuxostat, and Sulfadiazine are neurodegenerative diseases including one or more compounds selected from the group consisting of (Silver Sulfadiazine) or a food acceptable salt thereof as an active ingredient. It provides a food composition for the prevention or improvement of.
  • the present invention provides a pharmaceutical composition for preventing or treating cell damage, including as an active ingredient Amlexanox or a pharmacologically acceptable salt thereof.
  • the present invention provides a prophylactic or therapeutic use of neurodegenerative diseases comprising a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a prophylactic or therapeutic use of a neurodegenerative disease comprising an amlexanox or a pharmacologically acceptable salt thereof as an active ingredient.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Hexachloropene, Febuxostat, and sulfadiazine are neurodegenerative diseases including one or more compounds selected from the group consisting of (Silver Sulfadiazine) or a pharmacologically acceptable salt thereof as an active ingredient. To provide a prophylactic or therapeutic use.
  • the present invention provides a method for preventing or treating neurodegenerative diseases by administering to a subject a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof.
  • PDE phosphodiesterase
  • the present invention provides a method for preventing or treating a neurodegenerative disease by administering Amlexanox or a pharmacologically acceptable salt thereof to a subject.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Febuxostat, and Sulfadiazine (Silver Sulfadiazine) are administered to the subject by administering to the subject a neurodegenerative disease by administering at least one compound or a pharmacologically acceptable salt thereof.
  • a method of preventing or treating are administered to the subject by administering to the subject a neurodegenerative disease by administering at least one compound or
  • the PDE is PDE1A, PDE1B, PDE1C, PDE2A, PDE3a, PDE3B, PDE4A, PDE4B, PDE5A, PDE6A, PDE6B, PDE6C, PDE6D, PDE7A, PDE7B, PDE8A, PDEA, PDE8B, 10, It may be one or more selected from the group consisting of PDE11A, but is not limited thereto.
  • the amlexanox or a pharmacologically acceptable salt thereof may be to prevent or reduce toxic protein aggregation by amyloid beta accumulation, but is not limited thereto.
  • the Amlexanox or a pharmacologically acceptable salt thereof may be one that prevents or reduces apoptosis due to oxidative stress, but is not limited thereto.
  • the pharmacologically acceptable salt is an organic acid selected from oxalic acid, maleic acid, fumaric acid, malic acid, tartaric acid, citric acid and benzoic acid, or is formed by an inorganic acid selected from hydrochloric acid, sulfuric acid, phosphoric acid and hydrobromic acid. It may be in the form of acid addition salts, but is not limited thereto.
  • the neurodegenerative disease is Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, Lou Gehrig's disease (ALS), post-traumatic stress disorder (trauma), multiple sclerosis (MS), cerebral ischemia
  • AD Alzheimer's disease
  • PD Parkinson's disease
  • ALS Lou Gehrig's disease
  • trauma post-traumatic stress disorder
  • MS multiple sclerosis
  • cerebral ischemia The disease may be selected from the group consisting of atrophic lateral sclerosis, but is not limited thereto.
  • the neurodegenerative disease may be Alzheimer's disease.
  • the cell damage may be that the lysosomal pH is increased by amyloid beta, the activity of the lysosomal protein is reduced or the concentration of zinc in the cell is reduced, but is not limited thereto. .
  • the cell may be any one or more selected from the group consisting of perivascular cells, neurons and astrocytes, but is not limited thereto.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases using PDE inhibitors whose safety has been verified through clinical trials.
  • the present invention also provides a pharmaceutical composition for preventing or treating cell damage by amyloid beta using a PDE inhibitor.
  • composition of the present invention can be usefully used to safely or effectively improve or treat neurodegenerative diseases and cell damages caused by amyloid beta without concern for side effects.
  • FIG. 1 shows the mRNA expression of PDE isomers (1-11) in each of neurons, astrocytes, pericytes, and 661W photoreceptor cells (661W) by RT-PCR. to be.
  • Figure 2 shows the results of confirming the mRNA expression of PDE isomers (1-11) in each of CHO7W ⁇ E9 cells, SH-SY5Y / swe cells, ARPE-19 cells by RT-PCR.
  • Figure 3 is treated with amyloid beta attached to a fluorescent staining sample (FITC) attached to the pericyte of the mouse, the fluorescence intensity of amyloid beta attached to the FITC attached to the confocal microscopy and cells over time It is a graph measured by.
  • FITC fluorescent staining sample
  • Figure 4 shows the results of analyzing the amyloid beta accumulation by organelles after treatment with amyloid beta attached to the fluorescent staining sample (FITC) to the pericyte of the mouse (pericyte), by confocal microscopy.
  • FITC fluorescent staining sample
  • Figure 5 is cultured pericyte of the mouse (pericyte) after treatment for 1 hour according to CTL (control), amyloid beta (A ⁇ ), cilostazol (amyloid beta + cilostazol; + cilo), confocal It is a photograph analyzed with a microscope.
  • FIG. 6 is cultured pericyte of mice and treated for 24 hours according to CTL (control), amyloid beta (A ⁇ ), cilostazol (amyloid beta + cilostazol; + cilo), Western blotting This is the result of analysis.
  • FIG. 7 is cultured pericyte of mice to treat CTL (control), cilostazol (amyloid beta + cilostazol; + cilo), cAMP (amyloid beta + cAMP) for 1 hour, Fluozin- 3 (Zinc staining in cytoplasm) and lysotracker (Zinc staining in acidic organelles) are photographs.
  • FIG. 8A is a visualization of intracellular pH by staining astrocytes of mice with Lysosensor Green DND-189.
  • the visualized cells were treated with amyloid beta (A ⁇ ) or amyloid beta and cilostazol (A ⁇ + cilo), It is a photograph showing the pH change during 0 ⁇ 1 hour in each group.
  • 8B is a visualization of intracellular pH by staining astrocytes of mice with Acridine Orange Dye.
  • the visualized cells were treated with nothing (CTL; control), or were treated with batillomycin A1 (BA), or bar
  • CTL nothing
  • BA batillomycin A1
  • the pH change in each group is a photograph.
  • 10 is a graph showing luminescence raw values according to cAMP concentrations in PDE and cAMP.
  • FIG. 11 is a graph showing luminescence raw values according to PDE3 concentration and relative activity (% activity) according to PDE3 concentration.
  • FIG. 12 is a graph showing the luminescence raw value according to the cilostazol (positive control) concentration for PDE3 and the relative activity (% activity) according to the PDE3 inhibitor cilostazol concentration.
  • FIG. 13 is a graph showing z'scores for 800 libraries of FDA-approved drugs for PDE3.
  • 15 is a graph of relative activity (% activity) analysis according to the concentration of the first selected compound (Z001 ⁇ Z011) for PDE3.
  • FIG. 16 is a graph showing the relative activity (% activity) according to the concentration of the finally selected amlexanox (AMX) for various PDE isomers.
  • 17 and 18 show the amyloid beta expression and G93A SOD-1 and P301L tau by treating the periphery cells and astrocytes, which have accumulated amyloid beta, with the final selected Amlexanox (AMX) cells.
  • the picture was analyzed by Western blotting.
  • FIG. 20 is a photograph taken by confocal microscopy of untreated (CTL) and treated group (PDEi) without treatment of finally selected amlexanox (AMX) in perivascular cells of mice.
  • CTL untreated
  • PDEi treated group
  • AMX amlexanox
  • Figure 21 shows the degree of hydrolysis of cathepsin B (top) or cathepsin L (bottom) after treatment of vATPase inhibitor Bafilomycin A1 to mouse astrocytes. It is a photograph taken with a confocal microscope over time.
  • Fig. 22 shows the astrocytes of mice treated with Bafilomycin A1, which was finally administered amlexanox (AMX) (Z007), followed by cathepsin B (top) or The degree of hydrolysis of cathepsin L (bottom) is measured by confocal microscopy over time.
  • AMX amlexanox
  • Figure 23 shows Alzheimer's animal model 5X FAD (Swedish mutation (KM670 / 671NL: increased production of A ⁇ ), Florida mutation (I716V: increased production of A ⁇ 42), London mutation (V717I: increased production of A ⁇ 42), human presenilin 1 (M146L and L286V: Increased production of A ⁇ 42))
  • FIGS. 24 and 25 are graphs of pharmacological effects of Amlexanox (AMX) on amyloid beta (A ⁇ 1-42) and PS1 overexpression on the reduction of cognitive memory through water maze evaluation consisting of a hidden platform test and prove test. (Upper: 1 mg / kg, lower: 2.5 mg / kg).
  • FIG. 26 shows experimental results of Lou Gehrig's disease animal model (G93A SOD-1 mouse) divided into two groups (AMX administration group and control group (Veh)).
  • FIG. 27 is a graph showing apoptosis by inducing intracellular oxidative damage with H 2 O 2, causing cell death, and treating ALEXANOX (AMX) to quantify cell death using LDH.
  • Figure 28 shows the results confirming the inhibitory effect of GFP-mHttQ aggregation of Amlexoxox (AMX).
  • FIG. 31 is a graph showing the relative activity (% activity) according to the concentration of Piaceanol for various PDE isomers.
  • FIG. 32 is a graph showing the relative activity (% activity) according to the concentration of Ataluren for various PDE isomers.
  • FIG. 33 is a graph showing the relative activity (% activity) according to the concentration of masititin for various PDE isomers.
  • 35 is a graph showing the relative activity (% activity) according to the concentration of Obatoclax mesylate for various PDE isomers.
  • 36 is a graph showing the relative activity (% activity) according to the concentration of Dovitinib for various PDE isomers.
  • 40 is a graph showing the relative activity (% activity) according to the concentration of RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol) for various PDE isomers.
  • FIG. 41 is a graph showing the relative activity (% activity) according to the concentration of Axitinib for various PDE isomers.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising amlexanox (AMX) or a pharmacologically acceptable salt thereof as an active ingredient.
  • AMX amlexanox
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Hexachloropene, Febuxostat, and Sulfadiazine are neurodegenerative diseases comprising at least one compound selected from the group consisting of (Silver Sulfadiazine) or a pharmacologically acceptable salt thereof as an active ingredient. It provides a pharmaceutical composition for the prophylaxis or treatment of.
  • amyloid plaques and tau protein expression in neurons, astrocytes and perivascular cells due to the accumulation of amyloid beta in various cells of mice, and alleviate or restore the decrease of intracellular organelle activity.
  • amlexanox which was used as a PDE inhibitor, can effectively treat neurodegenerative diseases such as Alzheimer's and Lou Gehrig caused by the accumulation of amyloid beta.
  • PDE inhibitor phosphodiesterase (PDE) inhibitor
  • Amlexanox Piaceanol, Ataluren
  • Masitibini Masitinib
  • JTC-801 Obatoclax mesylate
  • Dovitinib CYC116
  • Resveratrol Fifithrin
  • RITA 5,5 '-(2,5- furandiyl) bis-2-thiophenemethanol
  • Axitinib Imatinib mesylate
  • Zafirlukast Hexachloropene
  • Febuxostat or sulfadiazine Silver (Silver Sulfadiazine)
  • silver Silver
  • neurodegenerative disease means that changes triggered by the accumulation of amyloid beta are passed through several cells or signaling systems, resulting in abnormal aggregation of amyloid beta and abnormal tau protein. Induces changes in the production of toxic proteins, which implies motor dysregulation, cognitive function, perceptual function, sensory function, and autonomic nervous system dysfunction due to reduced or lost neuronal function, which is equivalent to 'degenerative brain disease' .
  • the neurodegenerative diseases can be classified as clinical features. The main symptoms include those with progressive cognitive impairment, such as Alzheimer's disease, dementia (frontal dementia, Louis dementia, etc.), and corticobasal degeneration. Multiple system atrophy, Huntington's disease, and progressive supranuclear palsy. Neurodegenerative diseases that show muscle weakness and muscular dystrophy include Lou Gehrig's disease, Primary lateral sclerosis, and Spinal muscular atrophy.
  • amyloid plaque may be an insoluble fibrous protein aggregate comprising amyloid beta.
  • the amyloid plaques may be present in cells, on the cell surface, and / or in spaces between cells. For example, it may be present in the space between cells of the neural tissue.
  • neural tissue includes central nervous system tissue, such as the brain.
  • Brain tissue may include cerebral, cerebellar and hippocampal tissue.
  • Cerebral tissue includes the cerebral cortex.
  • Neural tissues include nerve cells as well as nerve tissue itself, and nerve cells are one of the components that make up nerve tissue.
  • Such neurons include neuronal cells and / or astrocytes.
  • Cultivation of neural tissue includes culturing neural cells such as neuronal cells and / or astrocytes in vitro.
  • treatment means any action that ameliorates or beneficially alters the associated symptoms by administration of a composition according to the present invention.
  • Those skilled in the art will be able to determine the extent to which the composition of the present invention is accurate, improved, improved and treated, with reference to the data presented by the Korean Medical Association and the like. .
  • prevention means any action that inhibits or delays the onset of a related disease by administration of a composition according to the present application.
  • neuropsychological examinations can be used to diagnose pre-dementia patients with mild cognitive impairment. On average, 12% of patients with mild cognitive impairment develop Alzheimer's disease for a year. If left untreated, 80% of the disease progresses to Alzheimer's disease after about 6 years, and thus the composition of the present disclosure can alleviate or reduce the toxicity caused by toxic proteins such as amyloid plaques containing amyloid beta and abnormal tau proteins. Dosing may have the effect of preventing or slowing the progression of neurodegenerative diseases.
  • the composition of the present invention prevents or reduces aggregation of toxic proteins due to amyloid beta accumulation and memory in drug administration and behavioral evaluation experiments in animal model 5X FAD mice that induce Alzheimer's dementia.
  • Mutant protein of SOD-1 expression of glycine substituted with alanine at codon 93
  • a gene associated with ALS in humans with Lou Gehrig's disease animal model was confirmed (Example 13).
  • apoptosis was significantly reduced in vitro for astrocytes that caused oxidative cell damage (Example 14).
  • Amalexanox is 2-amino-7-isopropyl-5-oxo-5H- [1] benzopyrano [2,3-b] pyridine-3-carboxylic acid, and the molecular formula is C 16 H 14 N 2 O 4. And a molecular weight is 298.30. Amlexanox is odorless and has an off-white, white crystalline powder.
  • the structural formula is as follows.
  • Amlexanox is a safe compound because it is used as an antiallergic drug that has been clinically proven to be effective against atopic diseases, especially allergic asthma and rhinitis.
  • PDE inhibitors of the present invention may be those listed in Table 1, but are not limited thereto:
  • the term "comprising an active ingredient” is meant to include an amount sufficient to achieve the efficacy or activity of a PDE inhibitor or Amlexoxox.
  • the PDE inhibitor or Amlexoxox in the composition of the present invention is for example at least 0.001 mg / kg, preferably at least 0.1 mg / kg, more preferably at least 1 mg / kg, even more preferably 10 mg / kg. Since the PDE inhibitor or Amlexoxox has almost no adverse effects on the human body even when excessively administered, the upper limit of the amount of the PDE inhibitor or Amlexoxox contained in the composition of the present invention can be selected and performed by those skilled in the art within an appropriate range.
  • the PDE inhibitor or Amlexanox used as an active ingredient in the composition of the present invention is interpreted to include not only the compound itself, but also a pharmacological or food acceptable salt, hydrate, solvate or prodrug thereof.
  • the composition of the present invention is a pharmaceutical composition.
  • the term "pharmacologically acceptable salt” means a formulation of a compound that does not cause serious irritation to the organism to which the compound is administered and does not impair the biological activity and properties of the compound.
  • pharmacologically acceptable acids include, for example, organic acids such as oxalic acid, maleic acid, fumaric acid, malic acid, tartaric acid, citric acid, benzoic acid, and hydrochloric acid, sulfuric acid, phosphoric acid, hydrobromic acid and the like. The same inorganic acid is included.
  • the compound of the present invention is reacted with a base, and salts such as alkali metal salts such as ammonium salts, sodium or potassium salts, and alkaline earth metal salts such as calcium or magnesium salts, dicyclohexylamine and N-methyl-D-glucamine And salts of organic bases such as tris (hydroxymethyl) methylamine, and amino acid salts such as arginine and lysine, but are not limited thereto.
  • salts such as alkali metal salts such as ammonium salts, sodium or potassium salts, and alkaline earth metal salts such as calcium or magnesium salts, dicyclohexylamine and N-methyl-D-glucamine
  • salts of organic bases such as tris (hydroxymethyl) methylamine, and amino acid salts such as arginine and lysine, but are not limited thereto.
  • hydrate refers to a hydrate of said PDE inhibitor or Amlexanox with the desired pharmacological effect.
  • pharmaceutically acceptable solvate denotes a solvate of a compound of said PDE inhibitor or Amlexanox that has the desired pharmacological effect.
  • the hydrates and solvates may also be prepared using the acids described above.
  • prodrug refers to a derivative of said PDE inhibitor or Amlexanox that must undergo bioconversion before exerting the pharmacological effect of said PDE inhibitor or Amlexanox.
  • prodrugs are prepared for prolongation of the duration of action and reduction of side effects in order to improve chemical safety, patient acceptability, bioavailability, organ selectivity or convenience of preparation.
  • Preparation of the prodrug of the present invention is carried out according to conventional methods in the art (eg Burger's Medicinal Chemistry and Drug Chemistry, 5th ed., 1: 172-178 and 949-982 (1995)) using the Amlexoxox. It can be manufactured easily.
  • Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mann
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by nasal administration, eye drop administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration and the like.
  • Suitable dosages of the pharmaceutical compositions of the present invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to response of the patient, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.001-100 mg / kg.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulations here may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.
  • compositions of the present invention may be prepared in the form of topical skin preparations, aerosols, sprays, eye drops, oral preparations and injections.
  • the pharmaceutical composition of the present invention can be used for human or animal use.
  • the present invention also provides a food composition for the prevention or improvement of neurodegenerative diseases comprising a phosphodiesterase (PDE) inhibitor or a food acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a food composition for preventing or improving neurodegenerative diseases, including as an active ingredient Amlexanox or a food acceptable salt thereof.
  • the present invention is Piaceanol (Piceathanol), Atalene (Ataluren), Masitibini (Masitinib), JTC-801, Obatoclax mesylate (Obatoclax mesylate), Dobitinib (Dovitinib), CYC116, Resveratrol (Resveratrol), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Exitinib, Imatinib mesylate, Zafirlucast Nerve comprising at least one compound selected from the group consisting of Zafirlukast, Hexachloropene, Febuxostat, and Silver Sulfadiazine, or a food acceptable salt thereof as an active ingredient
  • a food composition for preventing or improving degenerative diseases.
  • the food composition according to the present invention can be used as a functional food or added to various foods.
  • Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, confectionery, diet bars, dairy products, meat, chocolates, pizzas, breads, ramen noodles, other noodles, gums, ice creams, vitamin complexes, health Supplements;
  • the food composition of the present invention may include, as an active ingredient, PDE inhibitors or Amlexoxox as well as ingredients commonly added in the manufacture of foods, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. It includes.
  • examples of the above carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And sugars such as conventional sugars such as polysaccharides such as dextrin, cyclodextrin and the like and xylitol, sorbitol, erythritol.
  • natural flavoring agents [tautin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.
  • stevia extract for example, rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents sacharin, aspartame, etc.
  • citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, and various plant extracts may be further included in addition to Amlexanox.
  • the present invention provides a dietary supplement as a food composition comprising a PDE inhibitor or Amlexanox or a food acceptable salt thereof as an active ingredient.
  • Health functional foods are foods made by adding Amlexanox to food materials such as beverages, teas, spices, gums, confectionery, encapsulated, powdered, suspensions, etc. Meaning, unlike the general medicine has the advantage that there is no side effect that can occur when taking a long-term use of the drug as a food raw material.
  • the health functional food of the present invention thus obtained is very useful because it can be consumed on a daily basis.
  • the amount of PDE inhibitor or Amlexoxox added in such a dietary supplement cannot be defined uniformly depending on the type of dietary supplement, but it may be added within a range that does not impair the original taste of the diet. It is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight.
  • a health functional food in the form of pills, granules, tablets or capsules it is usually added in the range of 0.1 to 100% by weight, preferably 0.5 to 80% by weight.
  • the dietary supplement of the present invention may be in the form of pills, tablets, capsules or beverages.
  • the term “food acceptable salt” means a formulation of a compound that does not cause serious irritation to the organism to which the compound is administered and does not impair the biological activity and properties of the compound.
  • the food salt is a compound of the present invention, such as hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid and other inorganic acids, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid and the like, sulfonic acid, tartaric acid, formic acid, citric acid, acetic acid, trichloro It can be obtained by reaction with organic carboxylic acids such as roacetic acid, trifluoroacetic acid, capric acid, isobutanoic acid, malonic acid, succinic acid, phthalic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid and the like.
  • the compound of the present invention is reacted with a base, and salts such as alkali metal salts such as ammonium salts, sodium or potassium salts, and alkaline earth metal salts such as calcium or magnesium salts, dicyclohexylamine and N-methyl-D-glucamine And salts of organic bases such as tris (hydroxymethyl) methylamine, and amino acid salts such as arginine and lysine, but are not limited thereto.
  • salts such as alkali metal salts such as ammonium salts, sodium or potassium salts, and alkaline earth metal salts such as calcium or magnesium salts, dicyclohexylamine and N-methyl-D-glucamine
  • salts of organic bases such as tris (hydroxymethyl) methylamine, and amino acid salts such as arginine and lysine, but are not limited thereto.
  • the food composition of the present invention can be used as human food or animal feed or feed additives.
  • the present invention provides a pharmaceutical composition for preventing or treating cell damage, comprising as active ingredient Amlexanox or a pharmacologically acceptable salt thereof.
  • the inventors of the present invention have a long-term dose of protective activity against cellular damage caused by toxic proteins such as amyloid plaques and tau proteins in neurons, astrocytes and perivascular cells, which are caused by the accumulation of amyloid beta in various cells of mice.
  • toxic proteins such as amyloid plaques and tau proteins in neurons, astrocytes and perivascular cells, which are caused by the accumulation of amyloid beta in various cells of mice.
  • the newly discovered amlexanox as a PDE inhibitor caused changes in pH of lysosomes, decreased activity of lysosomal proteins, or cells caused by accumulation of amyloid beta. It was confirmed that the damage of cells such as decrease in the concentration of zinc can be effectively treated.
  • the prophylactic or therapeutic activity of the term "cell damage caused by amyloid beta” refers to the alteration triggered by amyloid beta through various cells or signaling systems, leading to the formation of abnormal aggregation of amyloid beta and abnormal changes of tau protein.
  • cell damage in the body is induced. Specifically, lysosomal pH is increased, lysosomal protein activity is decreased, zinc concentration in cells is reduced, or apoptosis is induced. It may be.
  • Cell damage caused by amyloid beta may be caused by neurodegenerative disease, degenerative brain disease, spinal cord injury, or peripheral nerve injury, but is not limited thereto.
  • the neurodegenerative diseases may be classified as clinical features, and the main symptoms include those with progressive cognitive impairment, such as Alzheimer's disease, dementia (frontal dementia, and Louis dementia), and corticobasal degeneration. Other disorders that indicate progressive ataxia include Parkinson's disease, multiple system atrophy, Huntington's disease, and progressive supranuclear palsy. Neurodegenerative diseases that show muscle weakness and muscular dystrophy include Lou Gehrig's disease, Primary lateral sclerosis, and Spinal muscular atrophy.
  • treatment means any action that ameliorates or beneficially alters the associated symptoms by administration of a composition according to the present invention.
  • Those skilled in the art to which the present application belongs, will be able to determine the extent to which the composition of the present invention is correct, improved, improved and treated by referring to the data presented by the Korean Medical Association and the like. .
  • prevention means any action that inhibits or delays the onset of a related disease by administration of a composition according to the present application.
  • neuropsychological examinations can be used to diagnose pre-dementia patients with mild cognitive impairment. On average, 12% of patients with mild cognitive impairment develop Alzheimer's disease for a year. If left untreated, 80% of the disease progresses to Alzheimer's disease after about 6 years, and thus the composition of the present invention which can alleviate or reduce the toxicity by toxic proteins such as amyloid plaque containing amyloid beta and abnormal tau protein. Dosing may have the effect of preventing or slowing the progression of neurodegenerative diseases.
  • amlexanox AMX
  • bafilomycin A1 the lysosomal pH environment is restored to its original state within 60 minutes ( Acidification), and the concentration of zinc in the cells was confirmed to recover and increase to the normal level (Example 10).
  • the composition of the present invention by using the LDH method to confirm the protective effect against damage to astrocytes subjected to oxidative stress (glutamate or hydrogen peroxide treatment) caused by toxic proteins due to amyloid beta accumulation
  • oxidative stress glutamate or hydrogen peroxide treatment
  • the survival rate in the cell group treated with the composition of the present invention was significantly higher (40%) (Example 14), and it was confirmed that there was little morphological change due to cell damage.
  • the pharmaceutical composition for preventing or treating cell damage by amyloid beta having Amlexanox according to the present invention as an active ingredient may be used as a medicament effective in treating or preventing cell damage.
  • Amlexanox is a compound that is secured because it is used as an antiallergic drug that has been clinically proven to be effective in atopic diseases, especially allergic asthma and rhinitis.
  • the present invention provides a prophylactic or therapeutic use of neurodegenerative diseases comprising a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof as an active ingredient.
  • PDE phosphodiesterase
  • the present invention provides a prophylactic or therapeutic use of a neurodegenerative disease comprising an amlexanox or a pharmacologically acceptable salt thereof as an active ingredient.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Hexachloropene, Febuxostat, and sulfadiazine are neurodegenerative diseases including one or more compounds selected from the group consisting of (Silver Sulfadiazine) or a pharmacologically acceptable salt thereof as an active ingredient. To provide a prophylactic or therapeutic use.
  • the present invention provides a method for preventing or treating neurodegenerative diseases by administering to a subject a phosphodiesterase (PDE) inhibitor or a pharmacologically acceptable salt thereof.
  • PDE phosphodiesterase
  • the present invention provides a method for preventing or treating a neurodegenerative disease by administering Amlexanox or a pharmacologically acceptable salt thereof to a subject.
  • the present invention relates to spiceatanol (Piceathanol), atalene (Ataluren), masitatinib (Masitinib), JTC-801, obatoclax mesylate (Obatoclax mesylate), dovitinib (CuiC116), CYC116, resveratrol ), Pifithrin, RITA (5,5 '-(2,5-furandiyl) bis-2-thiophenemethanol), Axitinib, Imatinib mesylate, Zafirlukast ), Hexachloropene, Febuxostat, and Sulfadiazine (Silver Sulfadiazine) are administered to the subject by administering to the subject a neurodegenerative disease by administering at least one compound or a pharmacologically acceptable salt thereof.
  • a method of preventing or treating are administered to the subject by administering to the subject a neurodegenerative disease by administering at least one compound or
  • the term "administration" means introducing a pharmaceutical composition of the present invention to a patient in any suitable manner, and the route of administration of the composition of the present invention may be various oral or parenteral routes as long as it can reach the desired tissue. It can be administered through.
  • the term "individual” refers to a subject to which a PDE inhibitor of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same may be administered, but is not limited thereto.
  • the subject of the present invention may preferably be a mammal including a human, and may be, for example, a mammal such as a human, a mouse, a rat, a monkey, a cat, a dog, a cow, a pig, etc., but is not limited thereto. .
  • Reagents and protein staining samples used in the present invention were purchased or prepared as follows. Amlexanox, Bafilomycin A1, Hydrogen peroxide were purchased from Sigma, Beta amyloid (6E10) was purchased from Bioolegend, and green. Fluorescent protein (GFP) was purchased from Santa Cruze. GM130 antibody was also purchased from Epitomics, EEA1 antibody was purchased from Cell Signaling, and LAMP1 antibody was purchased from Novus Biological.
  • FluoZin-3 a sample for staining intracellular zinc activity, was purchased from Molecular Probe, Zinpyr-1 was purchased from Mellitech, and Lysosensor green DND-189 was purchased from Molecular Probe. .
  • beta-amyloid 1-42 a sample used for amyloid beta accumulation in cells, was purchased from American Peptide company.
  • HTS high-throughput screening
  • neocortices are first isolated from mouse embryos (3 days old), and then the collected cortical tissue is divided into single cells. Then, the single cells were dispensed, and the cultured astrocytes were cultured at 37 ° C. in a humidified incubator using a culture medium of DMEM + 7% FBS + 7% HS + 100 U / ml penicillin + 100 ⁇ g / ml glutamine. Stored at 5% carbon dioxide conditions. Cells grown over 80-90% after DIV 10-14 were used, and cells were washed and used twice with warm MEM before the experiment. New cells were incubated each time without subculture.
  • Neocortices of mice were isolated at 3-4 weeks, and the separated tissues were divided into single cells using collagenase. Since percoll (Percoll) to separate the vascular cell layer to branch the cells.
  • the culture medium of DMEM + 20% FBS + 100 U / ml penicillin + 100 ⁇ g / ml glutamine was stored at 37 ° C. and 5% carbon dioxide in a humidified incubator for about 2 weeks. After incubation, passage passage was used to the cells corresponding to passage 4 or more. The cells were washed twice with warm MEM and used before the experiment.
  • ARPE-19 human retinal pigment epithelial cell
  • Cells were purchased from the cell line bank (ATCC CRL-2302, the American Type Culture Collection, Manassas, VA, USA). The cultured cells were stored at 37 ° C. and 5% carbon dioxide in a humidified incubator using a culture medium of DMEM + 5% FBS + 5% HS + 100 U / ml penicillin + 200 uM glutamine. Whenever necessary for the experiment, trypsinization was performed using confluent culture.
  • the Chinese hamster ovary 7W ⁇ E9 (CHO7W ⁇ E9) cell line was used by Dr. David E. Kang (USF Health Byrd Alzheimer's Institute, Tampa, FL, USA).
  • the cultured cells were stored at 37 ° C. and 5% carbon dioxide in a humidified incubator using RPMI1640 + 10% FBS + 5% HS + 100 U / ml penicillin culture medium. Whenever necessary for the experiment, trypsinization was performed using confluent culture.
  • SH-SY5Y cells were incubated with Dulbecco's modified Eagles medium (DMEM) (Gibco) medium containing 10% (v / v) fetal bovine serum (FBS), 100 U / ml penicillin / streptomycin. It was stored at 37 °C, 5% carbon dioxide conditions. Whenever necessary for the experiment, trypsinization was performed using confluent culture.
  • DMEM Dulbecco's modified Eagles medium
  • FBS fetal bovine serum
  • Livecell confocal microscopy was used to treat fluorescent dyes from Lysosensor (intracellular pH measurement; green) and Lysotracker (cell organelle staining; red) for 30 minutes. After changing to a medium containing a livecell imaging solution (media change), the structure of the organelles, pH changes, etc. were observed in real time using a live cell confocal microscope.
  • Peripheral vessels cultured in the above culture conditions were fixed with 4% paraformaldehyde (paraformaldehyde) for 30 minutes, washed three times or more with PBS, and then blocked with blocking solution (1% BSA + 0.1% Triton X-100) for 30 minutes ( blocking and reacted with the primary antibody overnight.
  • Primary antibodies used include Golgi markers (GM130), endosomal markers (EEA1) and lysosomal markers (LAMP1). After washing the primary antibody three times or more with PBS, and reacted with a secondary antibody (secondary antibody, Alexa Fluor-conjugated secondary antibodies) for 1 hour, samples were prepared on a glass plate.
  • Each cell was cultured under the above culture conditions, and the cell culture was recovered, and then a particle fraction was prepared in 50 mM Tris buffer.
  • the protein obtained from the cell culture was developed on an SDS polyacrylamide gel, transferred to an Immobilon-P membrane (Millipore, USA), and then antibodies (antibodies). And reacted for one day. The next day, wash the western blotting, react with peroxidase-linked secondary antibody for 1 hour at room temperature and then use 4-chloro-1-naphthol. The band was stained.
  • RT- Reverse transcription Reverse transcription-polymerase chain reaction
  • Primer base sequences of PDE isomers used for PCR are as follows.
  • hPDE3a-F GACCACAAACGAGGGCCAAGAGG
  • hPDE4a-F CAG GCG CTT CGA GGC AGA GAA TG
  • hPDE5a-R CAGAGGCAGAGATTTTCCTGGTTGGTG
  • Cathepsin B and cathepsin L enzyme stained samples were treated in a cell culture, allowed to react for 30 minutes, and the change in the activity of lysosomes in the cells was confirmed by confocal microscopy.
  • the central nervous system consists of various cells, including neurons and astrocytes. In addition to neurons and astrocytes, there are perivascular cells that control the microcirculation of neurons in the neurodegenerative diseases, and thus, the mRNA expression of PDE isomers was analyzed for various cells.
  • FIG. 1 shows the mRNA expression of PDE isomers (1-11) in each of neurons, astrocytes, pericytes, and 661W photoreceptor cells (661W) by RT-PCR. to be.
  • Figure 2 shows the results of confirming the mRNA expression of PDE isomers (1-11) in each of CHO7W ⁇ E9 cells, SH-SY5Y / swe cells, ARPE-19 cells by RT-PCR.
  • PDE isomers (1-11) are expressed in the various cells, in particular in neurons PDE1A, 1B, 1C, 2A, 3A, 3B, 4A, 4B, 5A , 6B, 7A, 7B, 8A, 10A mRNA was expressed, Astrocytes were similar to neurons, but it was confirmed that the mRNA of 1 to 3 PDE isomers were expressed more than neurons. Perivascular cells are similar in appearance to neurons, but the mRNA expression of PDE isomers of 1 and 2 is less, and the mRNA expression of PDE isomers of 3 is higher.
  • Figure 3 is treated with amyloid beta attached to a fluorescent staining sample (FITC) attached to the pericyte of the mouse, the fluorescence intensity of amyloid beta attached to the FITC attached to the confocal microscopy and cells over time It is a graph measured by.
  • FITC fluorescent staining sample
  • the amyloid beta is attached to the fluorescein stained sample, and the amyloid beta is introduced into the perivascular cells over time and aggregated into toxic proteins. It was.
  • beta amyloid When beta amyloid was administered to perivascular cells, we tried to identify the location of organelles in which amyloid beta accumulates. To this end, it was confirmed by confocal microscopy using an antibody against GM130 (Golgi marker), EEA1 (endosome marker), LAMP1 (lysosomal marker).
  • GM130 Golgi marker
  • EEA1 endosome marker
  • LAMP1 lysosomal marker
  • amyloid beta 4 is a result of analyzing amyloid beta accumulation by organelles by confocal microscopy after treating amyloid beta having a fluorescent staining sample (FITC) attached to pericyte of a mouse, and thus, perivascular cells.
  • FITC fluorescent staining sample
  • PDE3 showing a particularly high expression in perivascular cells was first selected as a target material.
  • Cilostazol known as a specific inhibitor of PDE3, was treated to observe the effect on amyloid beta accumulation.
  • Figure 5 is cultured pericyte of the mouse (pericyte) after treatment for 1 hour according to CTL (control), amyloid beta (A ⁇ ), cilostazol (amyloid beta + cilostazol; + cilo), confocal It is a photograph analyzed with a microscope. The graph on the right side of FIG. 5 shows CTL (control), amyloid beta (A ⁇ ), and cilostazol (amyloid beta + cilostazol; + cilo) on perivascular cells for 1 hour and observed thereafter. It is a graph measured by.
  • FIG. 6 is cultured pericyte of mice and treated for 24 hours according to CTL (control), amyloid beta (A ⁇ ), cilostazol (amyloid beta + cilostazol; + cilo), Western blotting This is the result of analysis.
  • the graph on the right is a graph showing the measured oligomer / actin expression and monomer / actin expression in each group.
  • FIG. 7 is cultured pericyte of mice to treat CTL (control), cilostazol (amyloid beta + cilostazol; + cilo), cAMP (amyloid beta + cAMP) for 1 hour, Fluozin- 3 (Zinc staining in cytoplasm) and lysotracker (Zinc staining in acidic organelles) are photographs.
  • FIG. 8A is a visualization of intracellular pH by staining astrocytes of mice with Lysosensor Green DND-189.
  • the visualized cells were treated with amyloid beta (A ⁇ ) or amyloid beta and cilostazol (A ⁇ + cilo), It is a photograph showing the pH change during 0 ⁇ 1 hour in each group.
  • 8B is a visualization of intracellular pH by staining astrocytes of mice with Acridine Orange Dye.
  • the visualized cells were treated with nothing (CTL; control), or were treated with batillomycin A1 (BA), or bar
  • CTL nothing
  • BA batillomycin A1
  • the pH change in each group is a photograph.
  • Figure 8 shows the measurement of lysosomal pH change in cells treated with PDE inhibitors, which is a test of whether the effect of the PDE inhibitor is actually associated with the lysosomal pH change, in the case of the group accumulates amyloid beta It was confirmed that the pH of the bosome was alkalized. On the other hand, in cells directly administered with PDE3 inhibitor cilostazol or cAMP, the pH was acidified and its function was normalized.
  • FIG. 9 illustrates an experimental method and apparatus for HTS
  • FIG. 10 is a graph showing luminescence raw values according to cAMP concentrations in PDE and cAMP
  • FIG. 11 is a result of PDE3 concentration dependency test, and shows luminescence according to PDE3 concentration.
  • Graph showing raw value and relative activity (% activity) according to PDE3 concentration.
  • FIG. 12 is a graph showing the luminescence raw value according to the cilostazol (positive control) concentration for PDE3 and the relative activity (% activity) according to the PDE3 inhibitor cilostazol concentration.
  • FIG. 13 is a graph showing z'scores of 800 libraries of FDA-approved drugs for PDE3
  • FIG. 14 is a graph of relative activity (% activity) analysis according to concentrations of PDE isomers.
  • PDE3 in screening a substance for treating neurodegenerative diseases such as Alzheimer's and Lou Gehrig, was selected as a target among PDE isomers, and an optimized concentration to be used in the experiment was selected as shown in FIG. 9. A drug screening system was established.
  • Candidates for increasing cAMP activity were selected from the library for 800 FDA-approved drugs using the High Throughput Screening (HTS) method.
  • HTS High Throughput Screening
  • the compounds contained in 800 libraries of FDA-approved drugs are diluted at a concentration of 1/4 from 100 ⁇ M each, and the PDE reactant is mixed there for 1 hour. The reaction was incubated. The stop solution was mixed with AMP detection reagent and dispensed in a well stage for 20 ul, reacted for 10 minutes, and luminescence was measured immediately (performed as recommended by the PDELight HTS cAMP phosphodiesterase Kit).
  • Z007 is 7 to 40 times more than other drugs
  • Example 8 For the eleven compounds selected through Example 8, the HTS of Example 7 was performed once again, targeting all PDE isomers, and amlexanox (AMX) (Z007) showing excellent reduction efficacy in all PDE isomers. ) was the final choice.
  • FIG. 16 is a graph showing the relative activity (% activity) according to the concentration of the finally selected Amlexanox (AMX) for various PDE isomers
  • FIGS. 17 and 18 show perivascular cells accumulated with amyloid beta and The astrocytes were treated with a final selected Amlexanox (AMX) to the cells to analyze the amyloid beta expression and the expression of G93A SOD-1, P301L tau by Western blotting.
  • amyloid beta was injected into and accumulated in perivascular and astrocytes, and it was confirmed that amyloid beta protein aggregation was inhibited by AMX treatment.
  • AMX amyloid beta protein aggregation
  • G93A SOD-1 toxic protein accumulation was confirmed that the AMX is also reduced.
  • Example 10 phosphorus In vitro , Intracellular zinc concentration, Lysosome For function Of amlexanox (AMX) Impact Analysis
  • the left picture of Figure 19 is treated with a vATPase inhibitor bafilomycin A1 (bafilomycin A1) on the perivascular cells of the mouse, and measured with a confocal microscope over time using a lysosensor (top) And, after treatment with the final selected Amlexanox (AMX) in the perivascular cells of the mice treated with bafilomycin A1 (bafilomycin A1), measured by confocal microscopy over time using a lysosensor (lysosensor) It can be represented by a picture (bottom).
  • bafilomycin A1 vATPase inhibitor
  • AMX Amlexanox
  • the perivascular cells of the mouse was treated with bafilomycin A1 (bafilomycin A1) as a result of increasing the lysosomal pH, it was confirmed that the change to alkaline. That is, while the bacillomycin A1 exacerbates the pH environment of the intracellular lysosomes (alkaline), the selected lexanox, which was finally selected through the HTS system of the present invention, is alkaline around the blood vessels changed by the bacillomycin A1 (bafilomycin A1). It was confirmed that the lysosomal pH environment of the cells was restored to the original state (acidification) within 60 minutes.
  • bafilomycin A1 bafilomycin A1
  • FIG. 20 is a photograph taken by confocal microscopy of untreated (CTL) and treated group (PDEi) without treatment of finally selected amlexanox (AMX) in perivascular cells of mice.
  • CTL untreated
  • PDEi treated group
  • AMX amlexanox
  • Figure 21 shows the degree of hydrolysis of cathepsin B (top) or cathepsin L (bottom) after treatment of vATPase inhibitor Bafilomycin A1 to mouse astrocytes. It is a photograph taken with a confocal microscope over time.
  • Fig. 22 shows the astrocytes of mice treated with Bafilomycin A1, which was finally administered amlexanox (AMX) (Z007), followed by cathepsin B (top) or The degree of hydrolysis of cathepsin L (bottom) was measured by confocal microscopy over time.
  • Bafilomycin A1 degrades lysosomal protein activity and function of astrocytes due to Bafilomycin A1.
  • Amlexanox (AMX) was treated here, it was confirmed that the lysosomal protein activity and function of astrocytes were restored to normal levels by inhibiting the effect of bacillomycin A1.
  • Amlexanox (AMX) (Z007) was tested using 5X FAD mice, one of the Alzheimer's dementia animal models, to determine whether they were effective in animal models. At this time, 5X FAD mice, one of Alzheimer's dementia animal models, were used for domestic presale.
  • Drug administration and behavioral evaluation was carried out on the schedule as shown in FIG. 23. Specifically, amlexanox (AMX) (Z007) was dissolved in DMSO and administered to 3 months old 5X FAD female mice once daily at a dose of 1 mg / kg. Intraperitoneal administration for 3 months. Immediately after the end of the administration, the Morris water maze test, a behavioral test to evaluate memory and learning ability, was conducted.
  • AMX amlexanox
  • the tank used for the underwater maze test was a cylindrical tank 90 cm in diameter and 60 cm in height, filled with 23 ⁇ 2 ° C. water diluted with powdered milk during the test period.
  • the tank was equipped with a transparent platform 1 cm below the surface of the water and four covers on the outside of the tank.
  • the motion trajectories of the mice were analyzed using a video tracking system (Smart3.0, Panlab, USA).
  • mice were placed into the tank towards the side not seeing the platform at the randomly selected four start points.
  • Each trial records the escape latency after the mouse is placed in the tank, and when the mouse finds the platform, the mouse stays on the platform for 10 seconds before being transferred to the home cage. If the mouse could not find a platform within 60 seconds, the escape latency was recorded as 60 seconds.
  • Each trial was run four times a day for five days.
  • Probe test was conducted on the last 5 days of the test. After removing the platform, the mouse was allowed to swim in the tank for 60 seconds, recording the first time it entered the position where the platform was and how many times it passed.
  • Figure 23 shows Alzheimer's animal model 5X FAD (Swedish mutation (KM670 / 671NL: increased production of A ⁇ ), Florida mutation (I716V: increased production of A ⁇ 42), London mutation (V717I: increased production of A ⁇ 42), human presenilin 1 (M146L and L286V: Increased production of A ⁇ 42))
  • 24 and 25 are graphs of pharmacological effects of Amlexanox (AMX) on amyloid beta (A ⁇ 1-42) and PS1 overexpression on the reduction of cognitive memory through water maze evaluation consisting of a hidden platform test and prove test.
  • Figure 24 (upper: 1 mg / kg, lower: 2.5 mg / kg) shows the animal model movement route to find the target in each test group (Veh group (control), AMX administration group).
  • Example 13 Lou Gehrig's disease In animal models Amlexanox Prevention or treatment effect analysis
  • G93A SOD-1 mice expressing a mutant protein of SOD-1, a gene related to human ALS (expressing an amino acid in which glycine is substituted with alanine in codon 93), were used as an animal model of Lou Gehrig's disease.
  • the G93A SOD-1 mice were purchased from Jackson Labs (USA).
  • At least one hind leg drag 1 point
  • mice were euthanized when they scored zero (Weydt et al. 2003). Survival was measured through behavioral experiments after intraperitoneal administration of vehicle or Amlexanox (AMX) to 2.5 mg / kg once daily for 5 days in each of the neurodegenerative diseases of Lou Gehrig's disease.
  • AMX Amlexanox
  • FIG. 26 shows the experimental results of Lou Gehrig's disease animal model (G93A SOD-1 mouse) divided into two groups (AMX-administered group and control group (Veh)), from 10 weeks to G93A SOD-1 mouse until neurological score is 0. Survival was compared by intraperitoneal administration of vehicle, vehicle and Amlexanox once daily at 2.5 mg / kg 5 days a week. It was confirmed that the survival rate of the AMX-administered group (130.2 ⁇ 2.0 days) was significantly increased than the control (veh) (121.3 ⁇ 3.6 days). In other words, when Amlexanox (AMX) was administered to an animal model of Lou Gehrig's disease, it was confirmed that the onset time and survival rate of Lou Gehrig's disease can be obtained. Lexanox (AMX) has been shown to be effective in preventing the deterioration of motor symptoms that persist in the course of neurodegenerative diseases such as Lou Gehrig's disease or Alzheimer's disease.
  • H2O2 was injected into astrocytes to induce apoptosis due to intracellular oxidative damage.
  • cell culture models similar to those of animal models of neurodegenerative diseases such as Alzheimer's or Lou Gehrig were prepared.
  • AMX Amlexanox
  • a H2O2 control group treated with nothing and a test group to which Amlexanox (AMX) was administered were prepared, and the LDH method was performed 24 hours later. Cell death was measured quantitatively.
  • FIG. 27 is a graph showing apoptosis by inducing intracellular oxidative damage with H 2 O 2, causing cell death, and treating ALEXANOX (AMX) to quantify cell death using LDH. According to this, it was confirmed that apoptosis was significantly reduced by 40% in the test group treated with Amlexanox (AMX), and the control group was found to significantly increase apoptosis by 60%.
  • AMX ALEXANOX
  • the pharmacological reaction by AMX was confirmed by GFP antibody by injecting GFP attached mHttQ protein into cells. It was confirmed by expression of GFP that mHttQ aggregated and accumulated in cells.
  • the results of FIG. 29 showed that the Veh group containing nothing showed survival of about 150 days, while AMX increased the survival rate in a concentration-dependent manner.
  • HTS was used for drug efficacy screening for PDE inhibition. Screening was performed using FDA-approved drug librar and selleckchem library based on cAMP based on existing PDE inhibitors. The experiment was conducted in the same manner as when screening the FDA approved drug library. Based on cilostazol, known as PDE3 inhibitor, drugs with high inhibitory activity were selected. This is to screen for drugs that increase the activity of cAMP among the screening drugs.
  • Each well of the screening library drugs in each 96-well plate was diluted from 100 uM to 1/4, and the PDE reactants were mixed and stored to treat the drug and PDE for 1 hour. The stop drug was mixed with the AMP detection reagent and dispensed in 20ul portions, and the luminescence was measured immediately after the reaction for 10 minutes.
  • PDE inhibitors especially Amlexanox (AMX) is a cell in which oxidative damage caused by the accumulation of amyloid beta due to neurodegenerative diseases such as Alzheimer's and Lou Gehrig's disease (astrocytic cells, neurons, perivascular cells), It plays a very important role in apoptosis, and it can be clearly seen that it has a pharmacological effect of repairing or preventing cell damage.
  • AMD Amlexanox
  • composition of the present invention can be usefully used to safely or effectively ameliorate or treat neurodegenerative diseases and cell damages caused by amyloid beta without side effects, and thus have industrial applicability.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 임상 실험을 통해 안전성이 검증된 암렉사녹스(amlexanox)를 이용한 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물에 관한 것이다. 또한, 본 발명은 암렉사녹스(amlexanox)를 포함하는 포스포디에스터라제(phosphodiesterase, PDE) 억제제를 이용한 아밀로이드 베타에 의한 세포손상 예방 또는 치료용 약학적 조성물에 관한 것이다. 본 발명의 조성물은 아밀로이드 베타에 기인한 신경퇴행성 질환 및 세포손상을 부작용에 대한 우려 없이 안전하고 효과적으로 개선 또는 치료하는데 유용하게 사용될 수 있다.

Description

신경퇴행성 질환 예방 또는 치료용 조성물
본 발명은 신경퇴행성 질환 예방 또는 치료용 조성물에 관한 것으로서, 보다 상세하게는 본 발명은 알츠하이머 질환, 파킨슨 질환, 루게릭 병과 같은 신경퇴행성 질환 예방 또는 치료에 유용하게 이용될 수 있는 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 함유하는 신경퇴행성 질환 및 아밀로이드 베타에 의한 세포손상 예방 또는 치료용 조성물에 관한 것이다.
본 출원은 2018년 06월 21일에 출원된 한국특허출원 제10-2018-0071564호 및 2019년 6월 21일에 출원된 한국 특허출원 제10-2019-0074410호에 기초한 우선권을 주장하며, 해당 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
신경퇴행성 질환은 신경세포가 퇴화하고, 기능을 잃거나, 사멸하는 경우의 증상들과 관련된다. 이들은 주로 진행성이기 때문에, 신경퇴행성 질환의 결과는 대단히 파괴적이다. 신경퇴행성 질환을 가진 환자들은 인지(cognitive) 또는 운동(motor) 능력에 있어서의 극심한 퇴화를 겪는다. 따라서, 환자들은 삶의 질이나 삶에 대한 기대감을 전혀 갖지 못하고 있는 실정이다.
알츠하이머의 매커니즘에 대한 연구는 대부분 아밀로이드 이론에 근거하였으며, 이를 기반으로 APP, BACE, Presenilin 유전자에 대한 연구, 세포 내 다른 요인과의 상호작용 및 조절에 대한 연구, 인자들의 생성, 분해 및 신호전달에 대한 연구가 주를 이루어 왔다. 이로 인해, 합성을 통해 단일 화합물을 제조하더라도, 표적물질은 'BACE1', 'amyloid beta fibril 형성 억제'에 초점이 맞춰져 있었다.
그러나, 최근 Alzhemed(amyloid beta aggregation inhibitor)와 Flurizan(γ-secretase inhibitor) 등의 화합물이 초기 알츠하이머 치매 환자에 대해서 실질적으로 효과가 없음이 입증되었고, 개발 중인 ACC001(amyloid vaccine)는 면역반응에 의한 부작용이 발견되어 상용화되지 못하고 있는 실정이다.
한편, 신경퇴행성 질환 중에서도 루게릭 병으로 널리 알려진 근위축성 측색 경화증(Amyotrophic lateral sclerosis, ALS)는 중추신경계의 운동신경세포가 퇴행적으로 사멸하게 되는 것으로, 환자의 몸에 마비가 오고, 마지막에는 호흡곤란 증상이 발생하여 2-5년 내에 사망하게 되는 질병이다. 산발성 ALS(sporadic ALS, sALS)가 전체 ALS 중 90-95%를 차지하고 가족성(familial ALS, fALS)은 5-10% 이며, 가족성 중 약 20% 가 돌연변이 SOD-1 단백질에 의해 발병하는 것으로 밝혀져 있다. ALS의 명확한 병리학적인 기전은 밝혀져 있지 않지만, 유전적 요인 또는 산화성 손상, 비정상적인 단백질의 축적, 흥분독성, 미토콘드리아 손상, 염증 등의 복합적인 요인에 의해 유발된다고 보고된 바 있다. 현재까지 루게릭 병의 치료제로 개발된 약물은 임상실험 중인 라일루졸(riluzole)이 유일하다. 하지만 이마저도 루게릭 병의 진행을 늦추는 것일 뿐, 근본적인 해결책이 되지는 못하고 있다. 따라서 기존에 사용해오던 약물로는 한계가 있다.
상기 알츠하이머와 루게릭과 같은 신경퇴행성 질환은 라이소좀의 기능저하가 가장 큰 병리현상으로 작용하고, 상기 라이소좀은 자식작용(Autophagy)과 내포작용(endocytosis)와 관련하여 순환과 분해를 주도하는 세포소기관이다. 이러한 라이소좀의 기능저하는 알츠하이머 치매, 파킨슨, 헌팅턴, 루게릭 등 신경퇴행성 질환에 공통적으로 나타난다. 구체적으로 라이소좀의 기능이 저하될 경우, 돌연변이 단백질의 응축 및 축적이 발생하고, 세포소기관의 항상성 유지에 문제를 유발하는 것으로 확인된 바 있다. 그러나, 아직까지 신경퇴행성 질환을 치료할 수 있는 약제로는 아세틸콜린스테라제 억제제 혹은 메만틴, N-메틸-D-아스파테이트 채널 차단제가 공지되어 있고, 시크리테이즈(secretase) 억제제 등 다양한 약물들의 개발이 시도되고 있을 뿐, 상기 신경퇴행성 질환에서 라이소좀의 기능 혹은 자식작용이 새로운 신경퇴행성 질환 치료의 대안이 될 수 있는지에 대해서는 연구된 바 없고, 그 효과적인 치료법 역시 아직까지 개발되지 않은 상태이다.
상기한 배경기술로서 설명된 사항들은 본 발명의 배경에 대한 이해 증진을 위한 것일 뿐, 이 기술 분야에서 통상의 지식을 가진 자에게 이미 알려진 종래기술에 해당함을 인정하는 것으로 받아들여져서는 안 될 것이다.
본 발명자들은 임상실험이 완료된 종래의 안전한 치료제 중에서 신경퇴행성 질환에 대하여 예방 또는 치료 효과를 갖는 신규 화합물을 발굴하고자 예의 노력을 하였다. 그 결과, 신경퇴행성 질환에서 PDE 억제제의 세포소기관과의 연관성과 관련된 기전이나, 유효효과에 대하여 평가하고자 하였고, 이를 이용하여 알츠하이머 치매를 포함한 신경퇴행성 질환 세포/동물 모델에서 다양한 PDE 억제제의 약리기전 및 효과를 확인함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 다른 목적은 암렉사녹스(amlexanox, AMX) 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 다른 목적은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환 예방 또는 개선용 식품 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 세포손상 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 1이상의 화합물또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
따라서, 본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 암렉사녹스(amlexanox) 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명은 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환 예방 또는 개선용 식품 조성물을 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 세포손상 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명의 일실시예에서, 상기 PDE는 PDE1A, PDE1B, PDE1C, PDE2A, PDE3a, PDE3B, PDE4A, PDE4B, PDE5A, PDE6A, PDE6B, PDE6C, PDE6D, PDE7A, PDE7B, PDE8A, PDE8B, PDE9A, PDE10A, 및 PDE11A로 이루어진 군으로부터 하나 이상 선택된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염은 아밀로이드 베타 축적에 의한 독성단백질 응집을 예방 또는 저감시키는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염은 산화적 스트레스에 의한 세포사멸을 예방 또는 저감하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 약리학적으로 허용 가능한 염은 옥살산, 말레산, 푸마르산, 말산, 타르타르산, 시트르산 및 벤조산 중에서 선택된 유기산이거나, 또는 염산, 황산, 인산 및 브롬화수소산 중에서 선택된 무기산에 의해 형성되는 산부가염의 형태일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 신경퇴행성 질환은 알츠하이머 질환(AD), 파킨슨 질환(PD), 헌팅턴 병, 루게릭 병(ALS), 외상 후 스트레스 장애(trauma), 다발성 경화증(MS), 대뇌 허혈질환 및 근위축성측색경화증으로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 실시예에서, 상기 신경퇴행성 질환은 알츠하이머 질환일 수 있다.
본 발명의 또 다른 실시예에서, 상기 세포손상은 아밀로이드 베타에 의해 라이소좀 pH가 증가되고, 라이소좀 단백질의 활성이 감소되거나 또는 세포 내 아연의 농도가 감소되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 실시예에서, 상기 세포는 혈관주위세포, 신경세포 및 성상세포로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
i. 본 발명은 임상 실험을 통해 안전성이 검증된 PDE 억제제를 이용한 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
ii. 또한, 본 발명은 PDE 억제제를 이용한 아밀로이드 베타에 의한 세포손상 예방 또는 치료용 약학적 조성물을 제공한다.
iii. 본 발명의 조성물은 아밀로이드 베타에 기인한 신경퇴행성 질환 및 세포손상을 부작용에 대한 우려 없이 안전하고 효과적으로 개선 또는 치료하는데 유용하게 사용될 수 있다.
도 1은 신경세포(neuron), 성상세포(astrocyte), 혈관주위세포(pericyte), 661W 광수용체 세포(661W) 각각에서 PDE 이성질체(1~11)의 mRNA 발현여부를 RT-PCR을 통해 확인한 결과이다.
도 2는 CHO7W△E9 세포, SH-SY5Y/swe 세포, ARPE-19 세포 각각에서 PDE 이성질체(1~11)의 mRNA 발현여부를 RT-PCR을 통해 확인한 결과이다.
도 3은 마우스의 혈관주위세포(pericyte)에 형광 염색 시료(FITC)가 부착된 아밀로이드 베타를 처리한 후, 시간에 따라 공촛점 현미경 촬영한 사진과 세포에서의 FITC가 부착된 아밀로이드 베타의 형광세기를 측정하여 나타낸 그래프이다.
도 4는 마우스의 혈관주위세포(pericyte)에 형광 염색 시료(FITC)가 부착된 아밀로이드 베타를 처리한 후, 세포소기관 별 아밀로이드 베타 축적을 공촛점 현미경으로 분석한 결과이다.
도 5는 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 아밀로이드 베타(Aβ), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo)에 따라 1시간 동안 처리한 후, 공촛점 현미경으로 분석한 사진이다.
도 6은 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 아밀로이드 베타(Aβ), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo)에 따라 24시간 동안 처리하고, 웨스턴블롯팅으로 분석한 결과이다.
도 7은 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo), cAMP(아밀로이드 베타+cAMP)를 1시간 동안 처리하고, Fluozin-3(세포질에서의 아연 염색), lysotracker(산성 세포소기관에서 아연 염색)로 염색한 결과 사진이다.
도 8a는 마우스의 성상교세포를 Lysosensor Green DND-189로 염색하여 세포 내 pH를 시각화한 것으로, 상기 시각화된 세포에 아밀로이드 베타(Aβ) 또는 아밀로이드 베타와 실로스타졸을 처리(Aβ+cilo)하고, 각 군에서 0 ~ 1 시간동안의 pH 변화를 나타낸 사진이다.
도 8b는 마우스의 성상교세포를 Acridine Orange Dye로 염색하여 세포 내 pH를 시각화한 것으로, 상기 시각화된 세포에 아무것도 처리하지 않거나(CTL;대조군), 바필로마이신 A1(BA)을 투여하거나, 또는 바필로마이신과 실로스타졸을 투여 (+cilo)하거나, 바필로마이신과 cAMP(+cAMP)를 투여한 후, 각 군에서 pH 변화를 나타낸 사진이다.
도 9는 HTS를 위한 실험방법 및 장치를 도시한 것이다.
도 10은 PDE와 cAMP에서, cAMP 농도에 따른 luminescence raw value를 나타낸 그래프이다.
도 11은 PDE3 농도 의존성 테스트 결과로, PDE3 농도에 따른 luminescence raw value를 나타낸 그래프와 PDE3 농도에 따른 상대적 활성(% activity)을 나타낸 그래프이다.
도 12는 PDE3에 대한 실로스타졸(양성 대조군) 농도에 따른 luminescence raw value를 나타낸 그래프와 PDE3억제제 실로스타졸 농도에 따른 상대적 활성(% activity)을 나타낸 그래프이다.
도 13은 PDE3에 대한 FDA 승인약물 800 개 라이브러리(library)에 대한 z'score를 나타낸 그래프이다.
도 14는 PDE 이성질체의 농도에 따른 상대적 활성(% activity) 분석 그래프이다.
도 15는 PDE3에 대한 1차 선정된 화합물(Z001~Z011)의 농도에 따른 상대적 활성(% activity) 분석 그래프이다.
도 16은 다양한 PDE 이성질체에 대하여, 최종 선정된 암렉사녹스(amlexanox, AMX)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 17 및 도 18은 아밀로이드 베타가 축적된 혈관주위세포 및 성상교세포에, 최종 선정된 암렉사녹스(amlexanox, AMX)를 세포에 처리하여 아밀로이드 베타 발현 양상과 G93A SOD-1, P301L tau의 발현을 웨스턴 블롯팅으로 분석한 사진이다.
도 19는 마우스의 혈관주위세포에 vATPase 억제제인 바필로마이신 A1(bafilomycin A1)을 처리하고, 라이소센서(lysosensor)를 이용해 시간에 따라 공초점 현미경으로 측정한 사진(좌측)과, 이를 정량화한 데이터(우측)이다.
도 20은 마우스의 혈관주위세포에 최종 선정된 암렉사녹스(amlexanox, AMX)를 처리하지 않은 것(CTL)과, 처리한 군(PDEi)을 공초점 현미경으로 측정한 사진으로, 아연의 농도를 측정하기 위해 아연 이온을 검지하는 형광시약(Zinpyr-1)을 처리하여 형광 정도를 측정하였다.
도 21는 마우스의 성상교세포에 vATPase 억제제인 바필로마이신 A1(Bafilomycin A1)을 처리한 다음, 카텝신 B(cathepsin B)(상단) 또는 카텝신 L(cathepsin L)(하단)의 가수분해정도를 시간에 따라 공초점 현미경으로 측정한 사진이다.
도 22는 바필로마이신 A1(Bafilomycin A1)로 처리된 마우스의 성상교세포에, 최종 선정된 암렉사녹스(amlexanox, AMX)(Z007)를 투여한 다음, 카텝신 B(cathepsin B)(상단) 또는 카텝신 L(cathepsin L)(하단)의 가수분해정도를 시간에 따라 공초점 현미경으로 측정한 사진이다.
도 23은 알츠하이머 동물모델 5X FAD((Swedish mutation(KM670/671NL: Aβ 생산 증가), Florida mutation(I716V: Aβ42의 생산 증가), London mutation(V717I: Aβ42의 생산 증가), human presenilin 1(M146L and L286V: Aβ42의 생산 증가)) 마우스)에 암렉사녹스(AMX)의 약리효능을 평가하기 위한 실험일정을 나타내는 도이다.
도 24 및 도 25는 아밀로이드 베타(Aβ1-42)와 PS1 과발현으로 인지기억능 감소에 대한 암렉사녹스(AMX)의 약리효과를 hidden platform test와 prove test로 구성된 water maze 평가를 통해 분석한 그래프이다(상: 1 mg/kg, 하: 2.5 mg/kg).
도 26은 루게릭 병 동물모델(G93A SOD-1 마우스)을 두 그룹(AMX 투여군과 대조군(Veh))으로 나누어 실험한 결과이다.
도 27은 성상교세포에 H2O2로 세포 내 산화적 손상을 유발하여 세포사멸을 일으키고, 여기에 암렉사녹스(AMX)를 처리하여 LDH 방법을 이용해 세포사멸을 정량화하여 나타낸 그래프이다.
도 28은 암렉사녹스(AMX)의 GFP-mHttQ 응집 억제 효과를 확인한 결과이다.
도 29는 암렉사녹스(AMX)의 G93A-SOD 마우스 모델의 생존율 개선 효과를 확인한 결과이다.
도 30은 암렉사녹스(AMX)의 G93A-SOD 마우스 모델에서 질병 진행 지연과 관련하여 운동능력 실조 완화 효과를 확인한 결과이다.
도 31은 다양한 PDE 이성질체에 대하여, 피세아탄올(Piceathanol)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 32은 다양한 PDE 이성질체에 대하여, 아탈루렌(Ataluren)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 33은 다양한 PDE 이성질체에 대하여, 마시티닙(Masitinib)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 34은 다양한 PDE 이성질체에 대하여, JTC-801의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 35은 다양한 PDE 이성질체에 대하여, 오바토클락스 메실레이트(Obatoclax mesylate)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 36은 다양한 PDE 이성질체에 대하여, 도비티닙(Dovitinib)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 37은 다양한 PDE 이성질체에 대하여, CYC116의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 38은 다양한 PDE 이성질체에 대하여, 레스베라트롤(Resveratrol)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 39은 다양한 PDE 이성질체에 대하여, 피피트린(Pifithrin)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 40은 다양한 PDE 이성질체에 대하여, RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
도 41은 다양한 PDE 이성질체에 대하여, 엑시티닙(Axitinib)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 암렉사녹스(amlexanox, AMX) 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 1 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명자들은 마우스의 다양한 세포에서 아밀로이드 베타의 축적으로 인해 나타나는 신경세포, 성상세포 및 혈관주위세포에서의 아밀로이드 플라크, tau 단백질 발현을 억제하고, 세포 내 소기관의 활성 감소를 완화 또는 회복시키는 신규 물질을 발굴하고자 노력한 결과, PDE 억제제로 사용되던 암렉사녹스(amlexanox)가 아밀로이드 베타의 축적에 의해 발생되는 알츠하이머, 루게릭 등의 신경퇴행성 질환을 효과적으로 치료할 수 있음을 확인하였다.
본 명세서에서, 용어 “포스포디에스터라제(phosphodiesterase, PDE) 억제제”(이하, PDE 억제제)는 예를 들어, 암렉사녹스, 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 또는 설파다이아진은(Silver Sulfadiazine)일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 용어 "신경퇴행성 질환(neurodegenerative disease)"의 예방 또는 치료 활성은 아밀로이드 베타의 축적에 의해 촉발된 변화가 여러 세포나 신호 전달 체계를 거쳐, 아밀로이드 베타의 비정상적 응집 형성과 tau 단백질의 비정상적인 변화를 유도하여 독성 단백질을 생성하여, 신경세포의 기능 감소 또는 소실에 의해 운동조절능력, 인지기능, 지각기능, 감각기능 및 자율신경의 기능 이상을 의미하며, '퇴행성 뇌질환'과 동일한 의미이다. 상기 신경퇴행성 질환은 임상적 특징으로 분류할 수 있다. 주요 증상으로 진행성 인지기능 장애를 나타내는 질환에는, 알츠하이머병, 치매(전두측두치매, 루이치매, 등), 피질기저퇴행증(corticobasal degeneration) 등이 있고, 진행성 운동실조를 나타내는 질환에는 파킨슨병, 다계통위축증(multiple system atrophy), 헌팅턴병, 진행성핵상마비(progressive supranuclear palsy) 등이 있다. 근력저하 및 근위축 증상을 나타내는 신경퇴행성 질환으로는 루게릭 병, 원발성측삭경화증, 척수근위축병 등이 있다.
본 명세서에서 "아밀로이드 플라크"는 아밀로이드 베타를 포함하는 불용성 섬유성 단백질 응집체일 수 있다. 상기 아밀로이드 플라크는 세포 내, 세포 표면에, 및/또는 세포 사이의 공간에 존재하는 것일 수 있다. 예를 들면, 신경조직의 세포 사이의 공간에 존재하는 것일 수 있다.
본 명세서에서 "신경조직"은 뇌와 같은, 중추신경계 조직을 포함한다. 뇌 조직은 대뇌, 소뇌 및 해마 조직을 포함할 수 있다. 대뇌 조직은 대뇌 피질을 포함한다. 신경조직은 신경조직 자체뿐만 아니라 신경세포를 포함하며, 신경세포란 신경조직을 이루는 성분 중 하나이다. 이러한 신경세포는 뉴런세포 및/또는 성상교세포를 포함한다. 신경조직의 배양은 인 비트로에서 뉴런세포 및/또는 성상교세포와 같은 신경 세포를 배양하는 것을 포함한다.
본 명세서에서 "치료"란 본 발명에 따른 조성물의 투여로 관련 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술 분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 본원의 조성물이 효과가 있는 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 명세서에서 "예방"은 본원에 따른 조성물의 투여로 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 예를 들어 신경 심리검사를 통하여 경도인지장애(mild cognitive impairment)를 가진 치매 전 단계 환자의 진단이 가능한데, 1년 동안 경도인지장애를 가진 환자의 평균 12%가 알츠하이머 병으로 발전하며, 경도인지장애를 그대로 방치할 경우, 약 6년 경과 시 80%가 알츠하이머 병으로 진전하기 때문에, 아밀로이드 베타를 포함하는 아밀로이드 플라크, 비정상적인 tau 단백질 등의 독성단백질에 의한 독성을 완화 또는 감소시킬 수 있는 본원의 조성물을 투여하면 신경퇴행성 질환의 진행을 막거나 진행을 늦추는 효과를 볼 수 있을 것이다.
본 발명의 실시예에 따르면, 본 발명의 조성물은 아밀로이드 베타 축적에 의한 독성단백질의 응집을 예방하거나 저감시키고, 알츠하이머 치매를 유발시킨 동물모델 5X FAD 마우스를 대상으로 한 약물투여 및 행동평가 실험에서 기억과 학습 능력을 예방하거나 회복시키는 효능을 나타내었고(실시예 12), 루게릭 병 동물모델인 사람의 ALS와 관련된 유전자인 SOD-1(codon 93번째에서 글라이신이 알라닌으로 치환된 아미노산 발현)의 돌연변이 단백질이 발현되는 G93A SOD-1 마우스를 대상으로 한 약물투여 및 생존률 평가 실험에서, 루게릭 병의 발병시점과 생존률의 연장효능을 확인하였다(실시예 13). 또한, 산화적 세포 손상을 유발시킨 성상교세포를 대상으로 한 인 비트로(in vitro)에서 세포사멸을 현저히 감소시켰다(실시예 14).
상기 암렉사녹스의 화학식은 2-amino-7-isopropyl-5-oxo-5H-[1]benzopyrano[2,3-b] pyridine-3-carboxylic acid이고, 분자식은 C 16H 14N 2O 4이며, 분자량은 298.30이다. 암렉사녹스는 냄새가 없고 황백색의 흰색 결정성 분말을 가지며, 구조식은 다음과 같다.
[구조식 1]
Figure PCTKR2019007556-appb-img-000001
암렉사녹스는 아토피성 질환 특히, 알레르기성 천식 및 비염에 임상적으로 효과가 규명된 항알레르기성 약물로 사용되고 있으므로, 안전성이 확보된 화합물이다.
상기 암렉사녹스와 유사한 구조식을 갖는 다양한 화합물이 존재하나, 그 중에서도 상대적으로 7 내지 40 배 이상의 현저히 낮은 농도를 사용함에도 동등하거나 더 우수한 효과를 나타내면서, 모든 PDE 이성질체에서 탁월한 감소 효능을 보이는 것은 암렉사녹스(amlexanox, AMX)(Z007)인 것을 확인하였다(실시예 8, 9).
본 발명의 PDE 억제제는 하기 표 1에 기재된 것일 수 있으나, 이에 제한되는 것은 아니다:
Figure PCTKR2019007556-appb-img-000002
Figure PCTKR2019007556-appb-img-000003
Figure PCTKR2019007556-appb-img-000004
본 명세서에서 용어 "유효성분으로 포함하는"이란 PDE 억제제 또는 암렉사녹스의 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미한다. 본 발명의 조성물 내에서 PDE 억제제 또는 암렉사녹스는 예를 들어, 0.001 mg/kg 이상, 바람직하게는 0.1 mg/kg 이상, 보다 바람직하게는 1 mg/kg 이상, 보다 더 바람직하게는 10 mg/kg 이상 포함된다.PDE 억제제 또는 암렉사녹스는 과량 투여하여도 인체에 부작용이 거의 없으므로 본 발명의 조성물 내에 포함되는 PDE 억제제 또는 암렉사녹스의 양적 상한은 당업자가 적절한 범위 내에서 선택하여 실시할 수 있다.
본 발명의 조성물에서 유효 성분으로 이용되는 상기 PDE 억제제 또는 암렉사녹스는 그 화합물 자체뿐만 아니라, 그의 약리학적 또는 식품학적으로 허용 가능한 염, 수화물, 용매화물 또는 프로드러그를 포함하는 의미로 해석된다.
본 발명의 바람직한 구현 예에 따르면, 본 발명의 조성물은 약학적 조성물인 것이다.
본 명세서에서 용어, "약리학적으로 허용 가능한 염"은, 화합물이 투여되는 유기체에 심각한 자극을 유발하지 않고 화합물의 생물학적 활성과 물성들을 손상시키지 않는, 화합물의 제형을 의미한다.
상기 약리학적으로 허용 가능한 염 중에서, 약리학적으로 허용가능한 산으로는, 예를 들어, 옥살산, 말레산, 푸마르산, 말산, 타르타르산, 시트르산, 벤조산과 같은 유기산, 및 염산, 황산, 인산, 브롬화수소산과 같은 무기산이 포함된다.
또한, 본 발명의 화합물을 염기와 반응시켜, 암모니움염, 나트륨 또는 칼륨염 등의 알칼리 금속염, 칼슘 또는 마그네슘염 등의 알칼리 토금속염 등의 염, 디시클로헥실아민, N-메틸-D-글루카민, 트리스(히드록시메틸) 메틸아민 등의 유기염기들의 염, 및 아르기닌, 리신 등의 아미노산 염을 형성함으로써 얻어질 수도 있으며, 이에 제한되지 않는다.
용어, "약리학적으로 허용 가능한 수화물"은 소망하는 약리학적 효과를 갖는 상기 PDE 억제제 또는 암렉사녹스의 수화물을 나타낸다. 용어, "약리학적으로 허용 가능한 용매화물"은 소망하는 약리학적 효과를 갖는 상기 PDE 억제제 또는 암렉사녹스의 화합물의 용매화물을 나타낸다. 상기 수화물 및 용매화물도 상기한 산을 이용하여 제조될 수 있다.
용어, "약리학적으로 허용 가능한 프로드러그"는 상기 PDE 억제제 또는 암렉사녹스의 약리학적 효과를 발휘하기 이전에 생물전환을 하여야 하는 상기 PDE 억제제 또는 암렉사녹스의 유도체를 나타낸다. 이러한 프로드러그는 화학적 안전성, 환자 수용성, 생물학적 이용성, 기관 선택성 또는 조제의 편의를 개선하기 위하여, 작용 기간의 장기화 및 부작용의 감소를 위하여 제조된다. 본 발명의 프로드러그의 제조는 상기 암렉사녹스를 이용하여 당업계의 통상적인 방법(예: Burger's Medicinal Chemistry and Drug Chemistry, 5th ed., 1:172-178 and 949-982(1995))에 따라 용이하게 제조될 수 있다.
본 발명의 약학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences(19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 비강 투여, 점안 투여, 정맥 내 주입, 피하 주입, 근육 주입, 복강주입, 경피 투여 등으로 투여할 수 있다. 본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현 예에 따르면, 본 발명의 약학적 조성물의 1일 투여량은 0.001-100 ㎎/㎏이다.
본 발명의 약학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질 중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약학적 조성물은 피부 외용제, 에어로졸, 스프레이, 점안제, 경구제 및 주사제 형태의 제형으로 제조될 수 있다. 본 발명의 약학적 조성물은 인간용 또는 동물용으로 사용될 수 있다.
또한, 본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명에 따른 식품 조성물은 기능성 식품으로 이용하거나, 각종 식품에 첨가할 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는 예를 들어, 음료류, 알코올 음료류, 과자류, 다이어트바, 유제품, 육류, 초코렛, 피자, 빵류, 라면, 기타 면류, 껌류, 아이스크림류, 비타민 복합제, 건강보조식품류 등이 있다.
본 발명의 식품 조성물은 유효성분으로서 PDE 억제제 또는 암렉사녹스 뿐만 아니라, 식품 제조 시에 통상적으로 첨가되는 성분을 포함할 수 있으며, 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스, 올리고당 등; 및 폴리사카라이드, 예를 들어 덱스트린, 사이클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제 [타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등]) 및 합성 향미제(사카린, 아스파르탐 등)를 사용할 수 있다. 예컨대, 본 발명의 식품 조성물이 드링크제와 음료류로 제조되는 경우에는 암렉사녹스 이외에 구연산, 액상과당, 설탕, 포도당, 초산, 사과산, 과즙, 및 각종 식물 추출액 등을 추가로 포함시킬 수 있다.
본 발명은 PDE 억제제 또는 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 식품 조성물로서 건강기능식품을 제공한다. 건강기능식품이란, 암렉사녹스을 음료, 차류, 향신료, 껌, 과자류 등의 식품소재에 첨가하거나, 캡슐화, 분말화, 현탁액 등으로 제조한 식품으로, 이를 섭취할 경우 건강상 특정한 효과를 가져오는 것을 의미하나, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있다. 이와 같이하여 얻어지는 본 발명의 건강기능식품은, 일상적으로 섭취하는 것이 가능하기 때문에 매우 유용하다. 이와 같은 건강기능식품에 있어서의 PDE 억제제 또는 암렉사녹스의 첨가량은, 대상인 건강기능식품의 종류에 따라 달라 일률적으로 규정할 수 없지만, 식품 본래의 맛을 손상시키지 않는 범위에서 첨가하면 되며, 대상 식품에 대하여 통상 0.01 내지 50 중량%, 바람직하기로는 0.1 내지 20 중량%의 범위이다. 또한, 환제, 과립제, 정제 또는 캡슐제 형태의 건강기능식품의 경우에는 통상 0.1 내지 100 중량%, 바람직하게는 0.5 내지 80 중량%의 범위에서 첨가하면 된다. 한 구체 예에서, 본 발명의 건강기능식품은 환제, 정제, 캡슐제 또는 음료의 형태일 수 있다.
본 명세서에서 용어, "식품학적으로 허용 가능한 염"은, 화합물이 투여되는 유기체에 심각한 자극을 유발하지 않고 화합물의 생물학적 활성과 물성들을 손상시키지 않는, 화합물의 제형을 의미한다. 상기 식품학적 염은, 본 발명의 화합물을, 염산, 브롬산, 황산, 질산, 인산 등의 무기산, 메탄술폰산, 에탄술폰산, p-톨루엔술폰산 등의 술폰산, 타타르산, 포름산, 시트르산, 아세트산, 트리클로로아세트산, 트리플루오로아세트산, 카프릭산, 이소부탄산, 말론산, 숙신산, 프탈산, 글루콘산, 벤조산, 락트산, 푸마르산, 말레인산, 살리실산 등과 같은 유기 카본산과 반응시켜 얻어질 수 있다. 또한, 본 발명의 화합물을 염기와 반응시켜, 암모니움염, 나트륨 또는 칼륨염 등의 알칼리 금속염, 칼슘 또는 마그네슘염 등의 알칼리토금속염 등의 염, 디시클로헥실아민, N-메틸-D-글루카민, 트리스(히드록시메틸)메틸아민 등의 유기염기들의 염, 및 아르기닌, 리신 등의 아미노산 염을 형성함으로써 얻어질 수도 있으며, 이에 제한되지 않는다.
본 발명의 식품 조성물은 인간용 식품 또는 동물용 사료나 사료첨가제 등으로 사용될 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 세포손상 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명자들은 마우스의 다양한 세포에서 아밀로이드 베타의 축적으로 인해 나타나는 신경세포, 성상세포 및 혈관주위세포에서의 아밀로이드 플라크, tau 단백질과 같은 독성단백질에 의한, 세포손상에 대하여 보호활성을 가지면서 장기간 복용하더라도 독성이나 부작용이 낮은 신규 물질을 발굴하고자 노력한 결과, PDE 억제제로 새롭게 발굴한 암렉사녹스(amlexanox)가 아밀로이드 베타의 축적에 의해 발생되는 세포 내 라이소좀의 pH 변화, 라이소좀 단백질의 활성 저하 또는 세포 내 아연 농도 감소 등 세포의 손상을 효과적으로 치료할 수 있음을 확인하였다.
본 명세서에서, 용어 "아밀로이드 베타에 의한 세포손상"의 예방 또는 치료 활성은 아밀로이드 베타에 의해 촉발된 변화가 여러 세포나 신호 전달 체계를 거쳐, 아밀로이드 베타의 비정상적 응집 형성과 tau 단백질의 비정상적인 변화를 유도하여 독성 단백질을 생성됨에 따라, 체내 세포 손상이 유발되는 것을 의미하며, 구체적으로는 라이소좀 pH가 증가되고, 라이소좀 단백질의 활성이 감소되며, 세포 내 아연의 농도가 감소되거나, 세포사멸이 유발되는 것일 수 있다. 아밀로이드 베타에 의한 세포손상은 신경퇴행성 질환, 퇴행성 뇌질환, 척수손상, 또는 말초신경 손상에 의해 유발될 수 있으나, 이에 한정되는 것은 아니다. 상기 신경퇴행성 질환은 임상적 특징으로 분류할 수 있는데, 주요 증상으로 진행성 인지기능 장애를 나타내는 질환에는, 알츠하이머병, 치매(전두측두치매, 루이치매), 피질기저퇴행증(corticobasal degeneration) 등이 있고, 진행성 운동실조를 나타내는 질환에는 파킨슨병, 다계통위축증(multiple system atrophy), 헌팅턴병, 진행성핵상마비(progressive supranuclear palsy) 등이 있다. 근력저하 및 근위축 증상을 나타내는 신경퇴행성 질환으로는 루게릭 병, 원발성측삭경화증, 척수근위축병 등이 있다.
본 명세서에서 "치료"란 본 발명에 따른 조성물의 투여로 관련 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술 분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 본원의 조성물이 효과가 있는 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 명세서에서 "예방"은 본원에 따른 조성물의 투여로 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 예를 들어 신경 심리검사를 통하여 경도인지장애(mild cognitive impairment)를 가진 치매 전 단계 환자의 진단이 가능한데, 1년 동안 경도인지장애를 가진 환자의 평균 12%가 알츠하이머 병으로 발전하며, 경도인지장애를 그대로 방치할 경우, 약 6년 경과시 80%가 알츠하이머 병으로 진전하기 때문에, 아밀로이드 베타를 포함하는 아밀로이드 플라크, 비정상적인 tau 단백질 등의 독성단백질에 의한 독성을 완화 또는 감소시킬 수 있는 본원의 조성물을 투여하면 신경퇴행성 질환의 진행을 막거나 진행을 늦추는 효과를 볼 수 있을 것이다.
본 발명의 실시예에 따르면, 혈관주위세포에 아밀로이드 베타를 주입하여 축적하게 한 후, AMX를 처리하면 아밀로이드 베타, tau 단백질 응집이 억제되는 것을 확인하였다. 또한 아밀로이드 베타 축적 이외에 Tau, G93A SOD-1의 독성단백질 축적도 AMX가 감소시키고 있음을 확인하였다(실시예 9).
또한, 바필로마이신 A1(bafilomycin A1)을 투여하여 세포 내 라이소좀 pH를 알칼리화한 신경세포에 암렉사녹스(amlexanox, AMX)를 투여할 경우, 라이소좀 pH 환경을 60분 내에 원래상태로 회복(산성화)시켰으며, 세포 내 아연의 농도가 정상수준으로 회복 및 증가시킴을 확인하였다(실시예 10).
또한, 바필로마이신 A1에 의해 라이소좀 단백질 활성이 저해된 성상교세포에, 암렉사녹스를 처리할 경우, 성상교세포 라이소좀 활성이 60분 내에 원래상태로 회복되는 것을 확인할 수 있었다(실시예 11).
또한, 본 발명의 실시예에 따르면, 본 발명의 조성물은 아밀로이드 베타 축적에 의한 독성단백질로 유발되는 산화적 스트레스(글루타메이트 또는 과산화수소 처리)를 받은 성상교세포의 손상에 대한 보호효과를 LDH 방법을 이용해 확인하였다, 그 결과 본원발명의 조성물을 처리한 세포군에서의 생존율이 현저히 높게(40%) 나타났고(실시예 14), 세포 손상으로 인한 형태학적 변화는 거의 없는 것으로 확인되었다.
상기 본 발명에 따른 암렉사녹스를 유효성분으로 하는 아밀로이드 베타에 의한 세포손상 예방 또는 치료용 약학 조성물은 세포 손상에 대한 치료 또는 예방에 효과가 있는 의약품으로 활용될 수 있다.
상기 암렉사녹스는 아토피성 질환 특히, 알레르기성 천식 및 비염에 임상적으로 효과가 규명된 항 알레르기성 약물로 사용되고 있으므로, 안전성이 확보된 화합물이다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도를 제공한다.
본 발명은 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명은 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명은 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법을 제공한다.
본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
본 명세서에 있어서, "개체(individual)"란 본 발명의 PDE 억제제, 또는 그의 약학적으로 허용가능한 염, 또는 그를 포함하는 약학적 조성물이 투여될 수 있는 대상을 말하며, 그 대상에는 제한이 없다. 본 발명의 개체는 바람직하게는 인간을 포함하는 포유동물일 수 있으며, 예를 들어, 인간, 마우스, 랫, 원숭이, 고양이, 개, 소, 돼지 등의 포유동물일 수 있으나, 이에 제한되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
<실험방법 및 재료>
본 발명에서 사용한 시약 및 단백질 염색 시료는 다음과 같이 구입하거나 준비하여 사용하였다. 암렉사녹스(Amlexanox), 바필로마이신 A1(Bafilomycin A1), 과산화수소(Hydrogen peroxide)는 시그마(Sigma)로부터 구입하였고, 베타 아밀로이드(Beta amyloid)(6E10)는 바이오레전드(Biolegend)로부터 구입하였으며, 녹색형광 단백질(GFP)은 산타 크루즈(Santa Cruze)로부터 구입하였다. 또한 GM130 항체는 에피도믹스(Epitomics)로부터 구입하였고, EEA1 항체는 셀 시그널(Cell Signaling)로부터 구입하였으며, LAMP1 항체는 노버스 바이올로지칼(Novus Biological)로부터 구입하였다.
세포 내 아연 활성을 염색하기 위한 시료인, FluoZin-3은 Molecular Probe로부터 구입하였고, Zinpyr-1는 Mellitech로부터 구입하였으며, 라이소센서 그린 DND-189(Lysosensor green DND-189)은 Molecular Probe로부터 구입하였다.
또한, 세포 내 아밀로이드 베타 축적에 사용한 시료인, 베타-아밀로이드 1-42(Beta-amyloid 1-42)는 아메리칸 펩타이드사(American Peptide company)로부터 구입하였다.
1. 약물 스크리닝(Drug screening)
약효 스크리닝을 위해, 고속 다중 스크리닝법(High-Throughput screening, HTS)을 사용하였다. 구체적으로 cAMP를 기반으로 하여 기존 PDE 억제제와 FDA-approved drug library와 selleckchem library 검색을 통해 유효 물질을 확보하였다.
2. 세포배양
1) 대뇌 피질 성상교세포의 배양
성상교세포의 배양을 위해, 우선 마우스 태아(3일령)로부터 대뇌피질(neocortices)을 분리한 다음, 채취된 대뇌피질 조직을 단일 세포로 나눈다. 다음 상기 단일세포를 분주하고, 배양한 성상교세포를 DMEM + 7% FBS + 7% HS + 100 U/㎖ 페니실린 + 100 ㎍/㎖ 글루타민의 배양 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. DIV 10-14 이후에 80-90% 이상 자란 세포를 사용하였고, 실험 전에 세포들을 따뜻한 MEM으로 두 번 세정하고 사용하였다. 계대 배양하지 않고 매번 새로운 세포를 배양해서 사용하였다.
2) 혈관주위세포 배양
3-4주째 마우스의 대뇌피질(neocortices)을 분리하고, 분리된 조직을 콜라게네이즈(collagenase)를 이용해 단일세포로 나누었다. 이후 퍼콜(Percoll)을 이용해 혈관세포층을 분리하여 세포를 분지하였다. 약 2주간 DMEM + 20% FBS + 100 U/㎖ 페니실린 + 100 ㎍/㎖ 글루타민의 배양 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. 배양한 후, 계대 배양하여 passage 4 이상 해당하는 세포를 실험에 사용하였다. 실험 전에 세포들을 따뜻한 MEM으로 2회 세정하고 사용하였다.
3) 661W 광수용체 세포(661W)
오클라오마 대학(by The university of Oklahoma department)에서 제공받은 세포를 플레이트에 Fibronectin(피브로넥틴) 또는 PLL(poly-L-Lysine) 코팅하여 배양하였다. 배양한 세포는 DMEM + 10% FBS + 100 U/㎖ 페니실린의 배양 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. 실험에 필요할때마다 트립신처리(trypsinization)하여 계대 배양(confluent culture)하여 사용하였다.
4) ARPE-19(인간 망막색소상피세포)
세포주 은행에서 세포를 구입하여 사용하였다(ATCC CRL-2302, the American Type Culture Collection, Manassas, VA, USA). 배양한 세포는 DMEM + 5% FBS + 5% HS + 100 U/㎖ 페니실린 + 200 uM 글루타민의 배양 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. 실험에 필요할 때마다 트립신처리(trypsinization)하여 계대 배양(confluent culture)하여 사용하였다.
5) CHO7W△E9 세포
The Chinese hamster ovary 7W△E9(CHO7W△E9) cell line은 David E. Kang 박사에게 제공받아 사용하였다(USF Health Byrd Alzheimer's Institute, Tampa, FL, USA). 배양한 세포는 RPMI1640 + 10% FBS + 5% HS + 100 U/㎖ 페니실린의 배양 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. 실험에 필요할 때마다 트립신처리(trypsinization)하여 계대 배양(confluent culture)하여 사용하였다.
6) SH-SY5Y 세포
SH-SY5Y 세포는 10%(v/v) fetal bovine serum(FBS), 100 U/㎖ 페니실린/스트렙토마이신이 포함된 Dulbecco's modified Eagles medium(DMEM)(Gibco) 배지를 이용하여 습식배양기(humidified incubator)에서 37 ℃, 5% 이산화탄소 조건으로 보관하였다. 실험에 필요할 때마다 트립신처리(trypsinization)하여 계대 배양(confluent culture)하여 사용하였다.
3. 공촛점 현미경 분석
생세포 공촛점 현미경(Livecell confocal microscopy)을 이용하여 라이소센서(Lysosensor)(세포 내 pH 측정;녹색)와 라이소트래커(Lysotracker)(세포 소기관 염색;적색)의 형광염료를 30분간 처리하고, 생세포 이미징 용액(Livecell imaging solution)이 함유된 배지로 교환(media change)해 준 다음, 생세포 공촛점 현미경을 이용해 실시간으로 세포소기관의 구조, pH 변화 등을 관찰하였다.
4. 면역염색법
상기 배양조건으로 배양한 혈관주위세포를 4% 파라포름알데히드(paraformaldehyde)로 30분간 고정시킨 다음 PBS로 3회 이상 세척 후 블로킹 솔루션(1% BSA + 0.1% Triton X-100)으로 30분간 블로킹(blocking)시키고, 1차 항체(primary antibody)와 하루 밤 동안 반응시켰다. 사용한 1차 항체로는 골지 마커(GM130), 엔도좀 마커(EEA1) 그리고 라이소좀 마커(LAMP1)가 있다. 1차 항체 염색 후 PBS로 3회 이상 세척한 후, 2차 항체(secondary antibody, Alexa Fluor-conjugated secondary antibodies)와 1시간 동안 반응시키고, 유리판에 표본 제작하였다.
5. 웨스턴 블롯팅(Western blotting) 분석법
상기 배양조건으로 각각의 세포를 배양하고, 세포 배양물을 회수한 후, 이로부터 입자 분획물(particulate fraction)을 50 mM Tris 완충액(buffer)에 제조하였다. 상기 세포 배양물로부터 수득된 단백질을 SDS 폴리아크릴아마이드 겔(polyacrylamide gel)에 전개시킨 후, 이모빌론 P 멤브레인(Immobilon-P membrane)(Millipore, USA)에 전달(transfer)한 뒤, 항체(antibodies)와 하루 동안 반응시켰다. 다음날 웨스턴 블롯팅을 세척하고, 퍼옥시다아제가 결합된 이차항체(peroxidase-linked secondary antibody)과 함께 상온에서 1시간동안 반응시킨 후 4-클로로-1-나프톨(4-chloro-1-naphthol)을 이용하여 밴드를 염색하였다.
6. 역전사 중합효소 연쇄반응(reverse transcription-polymerase chain reaction; RT- PCR )
TRIsure(BIOLINE, BIO-38032) 용액을 이용해 세포로부터 RNA를 분리한 후 이소프로판올(isopropanol)과 에탄올(ethanol)을 이용해 RNA를 정제하였다. Quantitect Reverse Transcription Kit(Qiagen, Cat No./ID: 205311)를 이용하여 역전사 중합(Reverse transcription) 반응을 통해 RNA에서 cDNA를 합성하였다. 이 cDNA를 이용하여 중합효소 연쇄반응(Polymerase Chain Reaction, PCR Master Mix(Thermo Scientific,#K0171))을 통해 세포 내 PDE mRNA의 발현양을 확인하였다.
PCR에 사용한 PDE 이성질체들의 primer 염기서열은 아래와 같다.
PDE1A-F_ GAAGCAGCTGGAGAAAGGTGATGTC
PDE1A-R_ CCTTTCCACAAAAATCCCAGCCTGG
PDE1B-F_ GCGCTACATGGTGAAGCAGTTGGAG
PDE1B-R_ CCACGAAGATCCCAGCCTGCAC
PDE1C-F CGGCTGCCATCCATGACTATGAAC
PDE1C-R GTTCGAAACTCCCTCCAGTCATCC
PDE2A-F GGT CAT ACC CCT GCT GGA CAA GG
PDE2A-R CAGTTGCAGGATCTTTCGGTCATGG
PDE3a F_ACTTTCATGCTTTGGAGATCGGATA
PDE3a R_AGGAATCGGCTGTGTTGTGAGA
PDE3B-F CTCTGGGACTGGGACTTGAAGCAG
PDE3B-R CTTTGGCCTACAGGAACCTGAGAAAG
PDE4A-F GCTTGGAGGCAGAAAATGGGCC
PDE4A-R CGGAGACTGGCCAGCACCTG
PDE4B-F_ GTGGAAAATGGCCCTTCTCCAGGTC
PDE4B-R_ GGCAAAAGGAGTGACAATCAGGTCATC
PDE5A-F_ CGCCTCTTTGATGTTGCTGAAGGTTC
PDE5A-R_ CCTGATTTCTTGTTGATGGCCTGAGC
PDE6A-F_ GATGTGTGGCCAGTTCTGATGGGC
PDE6A-R_ CATCCAGAGGCTCTTTCTGGAATTC
PDE6B-F_GATAAACGTGCAGGATGTGGCAGAG
PDE6B-R_CACAGTTGTGGAGGTAGCTTAGGTG
PDE6C-F_CCGGAGAAGCCAGATCCTTATGTGG
PDE6C-R_CCTGCCATCTGGAGTCTTTGGTCC
PDE6D-F GATGAACCTTCGGGATGCCGAAACAG
PDE6D-R GCCAGGTGTTTGTGGAGTTAGGGATC
PDE7A-F CAGCTCTCGCAGAGACGTGGAG
PDE7A-R CCAGCATACACTTGGCTTGTCCATTG
PDE7B-F GTTGTGTCACCTCTTCAACTCCCATGG
PDE7B-R GCATGATGTCCAGAGGTGTGAGG
PDE8A-F GTCACCAAGGAGGTGCAGACTGTC
PDE8A-R GAGTTACAAGCCCTGAGTTTCAGCTG
PDE8B-F CAGTGTTTACAGCGTTAGACCACTGTC
PDE8B-R CGAATGAGGCTCTGTCTGAGAGTTGTC
PDE9A-F_GACACCTCGACGTGATGTCCCC
PDE9A-R_CATCTGTGTCACACAGAAGCAGTGC
PDE10A-F_ GGGATTGCTGGTCAAGTGGCAAGAAC
PDE10A-R_ GCTTCTCCATGGTAACCCTGTAGATGC
PDE11A-F_ GCTGGAGGTGGTCAATGACCTC
PDE11A-R_CTGTCGAAGCAACCAGCTCAGCG
GAPDH-F GTCGTGGAGTCTACTGGTGTCTTCAC
GAPDH-R GTTGTCATATTTCTCGTGGTTCACACCC
hPDE1a-F GCTTGTTCTAGCTGCTGAAACTGACTG
hPDE1a-R CTGCTTCCAGCACAGATGCCGC
hPDE1b-F GAGCTTGGACTGGGAGCCCAAAG
hPDE1b-R GCTGACTTCAGCTCCAGGGGTG
hPDE1c-F GACAGCCCAAACTATCTCAGCTTCAC
hPDE1c-R GATCTACCACTGAAGCTTCCCCTCTC
hPDE3a-F GACCACAAACGAGGGCCAAGAGG
hPDE3a-R CACTGAGCGAAGTGACGGGATTCAC
hPDE3b-F CTGCAGCCAGTTACTATGGCAGTTGC
hPDE3b-R GGC TTG GAT CAG TCA GAA GAT CTG AC
hPDE4a-F CAG GCG CTT CGA GGC AGA GAA TG
hPDE4a-R CCT CGC TGG TGA CCG ATG AGT TC
hPDE4b-F GCC TTT GAC AAC GCT TCC AAG CAT TGC
hPDE4b-R GCT CGC TTG GAA GAG AAG AGT TTC TCG
hPDE5a-F CCAGCAGCAGAAGCAGCAGCAG
hPDE5a-R CAGAGGCAGAGATTTTCCTGGTTGGTG
hPDE7a-F GGAAGTGTGTTACCAGCTGCCGG
hPDE7a-R GGCTCCTTACACGTACATCTCCTAGC
hPDE7b-F CACCGCTCAGAGATTTCACGGCATTC
hPDE7b-R CTTGGTGCCAATCTCCCCTGAGTATG
hPDE10a-F GAGTGCTTCCTGAGCCCCAGTTTG
hPDE10a-R GCTGGTTGTCTCCTCCTGTGTCC
hGAPDH-F GGCACCGTCAAGGCTGAGAACG
hGAPDH-R GCAGAGGGGGCAGAGATGATGAC
7. 라이소좀 활성 분석
카텝신 B(cathepsin B)와 카텝신 L(cathepsin L) 효소 염색 시료를 세포 배양체에 처리하여, 30분간 반응시키고, 공촛점 현미경을 이용해 세포 내 라이소좀의 활성 변화를 확인하였다.
9. 통계학적 분석
평균±표준오차(SEM) 통계적 유의를 나타내는 데이터 값은 Scheffe 테스트로 편차 분석을 통해 측정하였다. 통계적 유의로서 P<0.05의 값을 기준치로 삼았다.
실험 및 실험결과
< 실시예 1> 세포별 PDE 이성질체( PDE isoform ) mRNA 발현 양상
중추신경계는 신경세포와 성상교세포를 포함한 다양한 세포들로 이루어져 있다. 신경세포와 성상교세포 이외에 신경퇴행성 질환과 관련하여 최근 주목을 받고 있는 세포 중에는 신경계 미세순환을 조절하는 혈관주위세포 등이 존재하므로, 이들 다양한 세포에 대하여 PDE 이성질체의 mRNA 발현 여부를 분석하고자 하였다.
도 1은 신경세포(neuron), 성상세포(astrocyte), 혈관주위세포(pericyte), 661W 광수용체 세포(661W) 각각에서 PDE 이성질체(1~11)의 mRNA 발현여부를 RT-PCR을 통해 확인한 결과이다. 도 2는 CHO7W△E9 세포, SH-SY5Y/swe 세포, ARPE-19 세포 각각에서 PDE 이성질체(1~11)의 mRNA 발현여부를 RT-PCR을 통해 확인한 결과이다.
도 1 및 2에 나타난 바와 같이, 상기 다양한 세포들에 PDE 이성질체(1~11)가 발현되고 있음을 확인하였고, 특히 신경세포에서는 PDE1A, 1B, 1C, 2A, 3A, 3B, 4A, 4B, 5A, 6B, 7A, 7B, 8A, 10A의 mRNA가 발현하고 있었으며, 성상세포는 신경세포와 유사하나, 신경세포보다 1~3의 PDE 이성질체의 mRNA가 추가로 발현됨을 확인하였다. 혈관주위세포에서는 신경세포와 양상이 유사하나, 1, 2의 PDE 이성질체의mRNA 발현이 더 적고 3의 PDE 이성질체의 mRNA 경우에는 발현이 더 많은 것을 확인할 수 있다.
< 실시예 2.> 혈관주위세포(pericyte)에서 아밀로이드 베타 응집 분석
도 3은 마우스의 혈관주위세포(pericyte)에 형광 염색 시료(FITC)가 부착된 아밀로이드 베타를 처리한 후, 시간에 따라 공촛점 현미경 촬영한 사진과 세포에서의 FITC가 부착된 아밀로이드 베타의 형광세기를 측정하여 나타낸 그래프이다.
도 3에 나타난 바와 같이 마우스의 혈관주위세포를 분리, 배양한 후 형광 염색 시료가 부착된 아밀로이드 베타를 처리할 경우, 시간에 따라 아밀로이드 베타가 혈관주위세포 내로 유입되고, 독성단백질로 응집되는 것을 확인하였다.
< 실시예 3> 혈관주위세포에서 아밀로이드 베타 응집 양상 분석
혈관주위세포에 베타 아밀로이드를 투여할 때, 아밀로이드 베타가 축적되는 세포소기관 위치를 확인하고자 하였다. 이를 위해 GM130(골지 표지인자), EEA1(엔도좀 표지인자), LAMP1(라이소좀 표지인자)에 대한 항체를 사용하여 공촛점 현미경으로 확인하였다.
도 4는 마우스의 혈관주위세포(pericyte)에 형광 염색 시료(FITC)가 부착된 아밀로이드 베타를 처리한 후, 세포소기관 별 아밀로이드 베타 축적을 공촛점 현미경으로 분석한 결과로, 이에 따르면, 혈관주위세포에서, 아밀로이드 베타 응집체는 엔도좀과 라이소좀에 집중되고 있음을 확인하였으며, 시간이 경과할수록 점차 양이 증가하고 있음을 확인하였다.
< 실시예 4.> 아밀로이드 응집과 PDE의 관련성
실시예 1에서의 결과를 통해, 혈관주위세포에서 특이적으로 높은 발현을 보이는 PDE3를 우선 표적물질로 선정하였다. PDE3의 특이적 억제제로 알려져 있는 실로스타졸을 처리하여, 아밀로이드 베타 축적에 어떠한 영향을 미치는지를 관찰하고자 하였다.
도 5는 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 아밀로이드 베타(Aβ), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo)에 따라 1시간 동안 처리한 후, 공촛점 현미경으로 분석한 사진이다. 도 5의 우측에 있는 그래프는 혈관주위세포에 CTL(대조군), 아밀로이드 베타(Aβ), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo)를 1 시간동안 처리하여 관찰한 후, 이의 형광세기를 측정하여 나타낸 그래프이다.
도 6은 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 아밀로이드 베타(Aβ), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo)에 따라 24시간 동안 처리하고, 웨스턴블롯팅으로 분석한 결과이다. 우측의 그래프는 각 군에서 올리고머/actin 발현량, monomer/actin 발현량을 측정하여 나타낸 그래프이다.
도 5 및 6에 나타난 바와 같이, 응집된 아밀로이드 베타의 양을 실로스타졸이 현저히 감소시키는 것을 확인하였다. 이는 아밀로이드 베타 응집에 PDE가 영향을 준다는 사실을 입증한 것이라 할 수 있다.
< 실시예 5.> PDE 억제제에 의한 아연 농도 변화
도 7은 마우스의 혈관주위세포(pericyte)를 배양하여 CTL(대조군), 실로스타졸(아밀로이드 베타+실로스타졸; +cilo), cAMP(아밀로이드 베타+cAMP)를 1시간 동안 처리하고, Fluozin-3(세포질에서의 아연 염색), lysotracker(산성 세포소기관에서 아연 염색)로 염색한 결과 사진이다.
도 7에 나타난 바와 같이, PDE3 억제제를 투여하거나, cAMP의 농도를 증가시킬 경우, 세포 내 아연의 농도가 변화하는 것을 확인할 수 있다. PDE 억제제 또는 직접적인 cAMP를 처리한 세포에서 세포 내 아연 농도가 증가하는 것을 아연 염색 시료를 통해 관찰할 수 있었고 그 아연의 농도는 라이소좀 내에 증가하는 것을 발견하였다. 뇌에는 이미 시냅스 아연을 포함해서 많은 양의 아연을 가지고 있는데 세포 외 아연을 세포 안 특히 라이소좀으로 이동시켜주는 약물들이 아밀로이드의 축적을 감소시키며 라이소좀의 pH 까지 변화시키는 것으로 보아 아연이 라이소좀 기능에 중요한 역할을 할 가능성이 있다고 여겨진다.
< 실시예 6> 라이소좀의 pH 변화
도 8a는 마우스의 성상교세포를 Lysosensor Green DND-189로 염색하여 세포 내 pH를 시각화한 것으로, 상기 시각화된 세포에 아밀로이드 베타(Aβ) 또는 아밀로이드 베타와 실로스타졸을 처리(Aβ+cilo)하고, 각 군에서 0 ~ 1 시간동안의 pH 변화를 나타낸 사진이다.
도 8b는 마우스의 성상교세포를 Acridine Orange Dye로 염색하여 세포 내 pH를 시각화한 것으로, 상기 시각화된 세포에 아무것도 처리하지 않거나(CTL;대조군), 바필로마이신 A1(BA)을 투여하거나, 또는 바필로마이신과 실로스타졸을 투여 (+cilo)하거나, 바필로마이신과 cAMP(+cAMP)를 투여한 후, 각 군에서 pH 변화를 나타낸 사진이다.
도 8은 PDE 억제제가 처리된 세포에서의 라이소좀 pH 변화를 측정하여 나타낸 것으로, 이는 PDE 억제제의 효과가 실제로 라이소좀 pH 변화와 관련되어 있는지 실험한 것으로써, 아밀로이드 베타가 축적된 군의 경우 라이소좀의 pH가 알칼리화 되는 것을 확인하였다. 한편 PDE3 억제제인 실로스타졸이나 cAMP가 직접 투여된 세포에서는 pH가 산성화되고 그 기능 역시 정상화되는 것을 확인하였다.
또한, 바필로마이신 A(Bafilomycin A)와 같이 vATPase를 완전히 억제시키는 화합물이 투여된 경우에는, 세포의 라이소좀 pH를 변화시킨 조건에서도 동일한 결과를 나타냄을 확인하였다. 즉 변형 presenilin1의 경우처럼 vATPase 기능이 저하된 경우에도 cAMP의 효과가 나타날 가능성이 있음을 시사하는 것이라 여겨진다.
< 실시예 7.> 스크리닝 시스템 구축 및 1차 선별
현재 임상에 쓰이고 있는 FDA 승인약물 및 selleckchem에 대한 라이브러리(library)를 확보하여, 이를 스크리닝에 사용(도 13)하였다. 상기 라이브러리에서도 국내 반입이 가능한 화합물만을 선별하여 실험을 수행하였다.
도 9는 HTS를 위한 실험방법 및 장치를 도시한 것이고, 도 10은 PDE와 cAMP에서, cAMP 농도에 따른 luminescence raw value를 나타낸 그래프이고, 도 11은 PDE3 농도 의존성 테스트 결과로, PDE3 농도에 따른 luminescence raw value를 나타낸 그래프와 PDE3 농도에 따른 상대적 활성(% activity)을 나타낸 그래프이다.
도 12는 PDE3에 대한 실로스타졸(양성 대조군) 농도에 따른 luminescence raw value를 나타낸 그래프와 PDE3억제제 실로스타졸 농도에 따른 상대적 활성(% activity)을 나타낸 그래프이다.
도 13은 PDE3에 대한 FDA 승인약물 800 개 라이브러리(library)의 z'score를 나타낸 그래프이고, 도 14는 PDE 이성질체의 농도에 따른 상대적 활성(% activity) 분석 그래프이다.
상기 도 9 내지 14를 통해, 스크리닝 전에, 각 PDE 이성질체에 대한 EC 50을 확인하고(도 14), 해당 PDE 이성질체에 특이적 억제제로 알려진 약물의 억제 농도를 확보하여 스크리닝 시, 비교를 위한 기준 약물로 사용하고자 하였다.
또한, 이를 통해 본 발명에서는 알츠하이머, 루게릭 등의 신경퇴행성 질환을 치료하기 위한 물질을 스크리닝 하는데 있어서, PDE 이성질체 중에서 PDE3을 타겟대상으로 선정하였으며, 실험에 사용할 최적화된 농도를 선택하여, 도 9와 같이 약물 스크리닝 시스템을 구축하였다.
< 실시예 8.> 2차 선정
HTS 스크리닝 방법을 이용한 cAMP 활성물질 스크리닝
고속 대량 스크리닝(HTS, High Throughput Screening)방법을 이용하여 FDA 승인약물 800 개에 대한 라이브러리(library)로부터 cAMP 활성을 증가시키는 후보물질을 선별하였다. 96-웰 플레이트의 한 웰 당 FDA 승인약물 800 개 라이브러리(library)에 포함되어 있는 화합물을 각각 100 μM 농도부터 1/4씩 희석하여 분주하고 거기에 PDE 반응제를 혼합하여 1시간동안 약물과 PDE 반응을 항온 처리하였다. 중지 용액을 AMP 검출 시약과 혼합하여 20 ul씩 웰 단 분주하고 10분간 반응시킨 후 곧바로 발광을 측정하였다(PDELight HTS cAMP phosphodiesterase Kit의 권고대로 시행함).
실시예 7에서 구축된 약물 스크리닝 시스템을 통해, PDE3에 대해 800 개의 약물을 스크리닝한 결과, 1차로 21개의 화합물을 선정하였다. 상기 21 개의 약물들의 억제농도인 IC 50을 확인한 결과, 2차로 11개의 화합물을 선정하였다.
도 15는 PDE3에 대한 2차 선정된 화합물(Z001~Z011)의 농도에 따른 상대적 활성(% activity) 분석 그래프로, 이에 따르면 본 발명의 Z007(AMX)는 다른 약물들에 비해 7 내지 40 배 이상의 현저히 낮은 농도에서 동등하거나 더 우수한 효과를 나타내는 것으로, 종래 약물에 비해 현저한 PDE3에 특이적 억제효과를 가지고 있음을 알 수 있다.
< 실시예 9.> 인 비트로(in vitro)에서 , 여러가지 독성 단백질 축적에 대한 암렉사녹스(amlexanox, AMX)의 영향 분석
실시예 8을 통해 선정된 11개의 화합물들에 대하여, 모든 PDE 이성질체를 타겟으로 한번 더 실시예 7의 HTS를 수행하였고, 모든 PDE 이성질체에서 탁월한 감소 효능을 보이는 암렉사녹스(amlexanox, AMX)(Z007)를 최종 선택하였다.
도 16은 다양한 PDE 이성질체에 대하여, 최종 선정된 암렉사녹스(amlexanox, AMX)의 농도에 따른 상대적 활성(% activity)를 나타낸 그래프이고, 도 17 및 도 18은 아밀로이드 베타가 축적된 혈관주위세포 및 성상교세포에, 최종 선정된 암렉사녹스(amlexanox, AMX)를 세포에 처리하여 아밀로이드 베타 발현 양상과 G93A SOD-1, P301L tau의 발현을 웨스턴 블롯팅으로 분석한 사진이다.
도 16 내지 도 18에 나타난 바와 같이, 혈관주위세포 및 성상교세포에 아밀로이드 베타를 주입하여 축적하게 한 후, AMX를 처리하면 아밀로이드 베타 단백질 응집이 억제되는 것을 확인하였다. 또한 아밀로이드 베타 축적 이외에 Tau, G93A SOD-1의 독성단백질 축적도 AMX가 감소시키고 있음을 확인하였다.
< 실시예 10> 인 비트로(in vitro)에서 , 세포 내 아연 농도 및 라이소좀 기능에 대한 암렉사녹스(amlexanox, AMX)의 영향 분석
마우스의 혈관주위세포에서, pH에 따라 라이소좀을 염색하는 염료(pH-sensitive lysosomal dye)인 라이소센서(lysosensor)를 이용해 세포 내 라이소좀 pH 변화를 공촛점 현미경으로 시각화할 수 있는 시스템을 확립하였고(실시예 6 참조), 이를 통해 암렉사녹스(AMX)가 세포 내 라이소좀의 pH 변화에 관여하는지를 관찰하고자 하였다.
도 19는 마우스의 혈관주위세포에 vATPase 억제제인 바필로마이신 A1(bafilomycin A1)을 처리하고, 라이소센서(lysosensor)를 이용해 시간에 따라 공초점 현미경으로 측정한 사진(좌측)과, 이를 정량화한 데이터(우측)이다.
이때, 도 19의 좌측 사진은 마우스의 혈관주위세포에 vATPase 억제제인 바필로마이신 A1(bafilomycin A1)을 처리하고, 라이소센서(lysosensor)를 이용해 시간에 따라 공초점 현미경으로 측정한 사진(상단)과, 상기 바필로마이신 A1(bafilomycin A1)이 처리된 마우스의 혈관주위세포에 최종 선정된 암렉사녹스(AMX)를 처리하고, 라이소센서(lysosensor)를 이용해 시간에 따라 공초점 현미경으로 측정한 사진(하단)으로 나타낼 수 있다.
도 19에 나타난 바와 같이, 마우스의 혈관주위세포는 바필로마이신 A1(bafilomycin A1)을 처리한 결과 라이소좀 pH가 증가되어, 알칼리성으로 변화되는 것을 확인하였다. 즉 바필로마이신 A1은 세포 내 라이소좀의 pH 환경을 더욱 악화(알칼리성)시키는데 반해, 본 발명의 HTS 시스템을 통해 최종 선정된 암렉사녹스는 바필로마이신 A1(bafilomycin A1)에 의해 알칼리성으로 변화된 혈관주위세포의 라이소좀 pH 환경을 60분 내에 원래상태로 회복(산성화)시키는 것을 확인할 수 있었다.
도 20은 마우스의 혈관주위세포에 최종 선정된 암렉사녹스(amlexanox, AMX)를 처리하지 않은 것(CTL)과, 처리한 군(PDEi)을 공초점 현미경으로 측정한 사진으로, 아연의 농도를 측정하기 위해 아연 이온을 검지하는 형광시약(Zinpyr-1)을 처리하여 형광 정도를 측정하였다.
도 20에 나타난 바와 같이 혈관주위세포에 암렉사녹스(amlexanox, AMX)를 투여할 경우, 세포 내 아연의 농도가 정상수준으로 회복 및 증가되고 있음을 확인하였다.
< 실시예 11> 라이소좀 기능 활성 검증 연구
성상교세포에 형광이 달린 라이소좀 단백질을 염색한 후, 라이소좀 단백질인 카텝신 B(cathepsin B)와 카텝신 L(cathepsin L)의 가수분해 정도를 분석하고자 하였다.
도 21는 마우스의 성상교세포에 vATPase 억제제인 바필로마이신 A1(Bafilomycin A1)을 처리한 다음, 카텝신 B(cathepsin B)(상단) 또는 카텝신 L(cathepsin L)(하단)의 가수분해정도를 시간에 따라 공초점 현미경으로 측정한 사진이다.
도 21에 나타난 바와 같이, 마우스의 성상교세포는 바필로마이신 A1가 처리됨에 따라, 라이소좀의 단백질인 카텝신 L과 카텝신 B가 감소되는 것을 확인하였으며, 이를 통해 바필로마이신 A1은 성상교세포에서의 라이소좀 기능을 현저히 저하시킴을 알 수 있다. 다시 말해 BA는 상기 두가지 라이소좀 단백질 모두의 활성을 감소시킴을 확인하였다.
도 22는 바필로마이신 A1(Bafilomycin A1)로 처리된 마우스의 성상교세포에, 최종 선정된 암렉사녹스(amlexanox, AMX)(Z007)를 투여한 다음, 카텝신 B(cathepsin B)(상단) 또는 카텝신 L(cathepsin L)(하단)의 가수분해정도를 시간에 따라 공초점 현미경으로 측정한 사진으로, 이에 따르면 바필로마이신 A1(Bafilomycin A1)으로 인해 성상교세포의 라이소좀 단백질 활성 및 기능이 저하되었고, 여기에 암렉사녹스(AMX)가 처리되면 바필로마이신 A1의 영향을 억제하여 성상교세포의 라이소좀 단백질 활성 및 기능이 정상수준으로 회복되는 것을 확인하였다.
즉, 암렉사녹스가 처리되면, 성상교세포의 카텝신 B(cathepsin B) 또는 카텝신 L(cathepsin L)의 성상교세포 라이소좀 활성이 60분 내에 원래상태로 회복되는 것을 확인할 수 있었다.
< 실시예 12> 알츠하이머 동물모델에서의 암렉사녹스 예방 또는 치료효과 분석
암렉사녹스(amlexanox, AMX)(Z007)가 동물모델에서도 효과가 있는지 확인하기 위해 알츠하이머 치매 동물모델 중 하나인 5X FAD 마우스를 이용하여 실험하였다. 이때 알츠하이머 치매 동물모델 중 하나인 5X FAD 마우스는 국내 분양 받아 사용하였다.
약물 투여 및 행동평가는 도 23과 같은 일정으로 실시하였고, 구체적으로 암렉사녹스(amlexanox, AMX)(Z007)를 DMSO에 녹여서 1 ㎎/㎏의 용량으로 1일 1회씩 3개월령 5X FAD 암컷 마우스에 3개월 동안 복강 투여하였다. 투여를 종료한 직후, 기억과 학습능력을 평가할 수 있는 행동실험인 모리스 수중미로 실험(Morris water maze test)를 실시하였다.
모리스 수중 미로 테스트는 Behav. Brain Res.(155, 185-196)에 기재된 바에 의하여 수행되었다(참조 : Behav. Brain Res., 155, 185-196). 수중 미로 테스트에 사용된 수조는 지름이 90 cm이고 높이가 60 cm인 원통형 수조이며, 시험 기간 동안 분유를 희석한 23 ± 2 ℃의 물을 채워 사용하였다. 수조 안에는 수면에서 1 cm 아래에 투명한 플랫폼을 장치하였으며, 수조 바깥쪽에 네 개의 표지를 장치하였다. 마우스의 운동궤적은 비디오 트래킹 시스템(Smart3.0, Panlab, USA)을 통하여 분석하였다.
시험(trial) 기간 동안 마우스는 네군데의 시작점을 무작위로 선택한 지점에서 플랫폼을 보지 못하는 쪽을 향하여 수조안으로 넣어졌다. 각 시험(trial)에서는 마우스가 수조로 넣어진 후 플랫폼을 찾는 시간(escape latency)을 기록하게 되며, 마우스가 플랫폼을 찾으면 10 초간 플랫폼 위에서 머무르게 한 후 케이지(home cage)로 옮겼다. 마우스가 60초 내로 플랫폼을 찾지 못할 경우 플랫폼을 찾는 시간(escape latency)은 60 초로 기록하였다. 각 시험(trial)은 5일 동안, 하루 네번씩 실행되었다.
시험 마지막 5일째에 확인 평가(probe test)를 진행하였다. 플랫폼을 제거한 후, 60초간 마우스로 하여금 수조 안을 수영하게 하면서 플랫폼이 있던 위치에 처음 들어가는 시간과, 몇 번 지나는지 기록하는 방법으로 수행되었다.
도 23은 알츠하이머 동물모델 5X FAD((Swedish mutation(KM670/671NL: Aβ 생산 증가), Florida mutation(I716V: Aβ42의 생산 증가), London mutation(V717I: Aβ42의 생산 증가), human presenilin 1(M146L and L286V: Aβ42의 생산 증가)) 마우스)에 암렉사녹스(AMX)의 약리효능을 평가하기 위한 실험일정을 나타내는 도이다. 도 24 및 도 25는 아밀로이드 베타(Aβ1-42)와 PS1 과발현으로 인지기억능 감소에 대한 암렉사녹스(AMX)의 약리효과를 hidden platform test와 prove test로 구성된 water maze 평가를 통해 분석한 그래프이다. 도 24(상: 1 mg/kg, 하: 2.5 mg/kg)는 각 시험군(Veh 군(대조군), AMX 투여군)에서의 타겟을 찾는 동물모델 이동경로를 나타낸 것이다.
도 24 및 도 25(상: 1 mg/kg, 하: 2.5 mg/kg)에 나타난 바와 같이, AMX 투여군(amx)의 동물모델이 Veh(vehicle) 군(대조군)의 동물모델에 비해, 타겟 지점을 찾는 시간이 점차 빨라질 뿐만 아니라 지나는 횟수도 많아지는 것을 확인할 수 있다. 이를 통해 암렉사녹스(AMX)를 투여한 알츠하이머 동물모델은 기억과 학습 능력이 증진됨을 알 수 있다.
< 실시예 13.> 루게릭 병 동물모델에서의 암렉사녹스 예방 또는 치료효과 분석
사람의 ALS와 관련된 유전자인 SOD-1(codon 93번째에서 글라이신이 알라닌으로 치환된 아미노산 발현)의 돌연변이 단백질이 발현되는 G93A SOD-1 마우스를 루게릭 병 동물모델로 사용하였다. 상기 G93A SOD-1 마우스는 잭슨랩(USA)으로부터 구입하였다.
루게릭 병 동물모델은 척수의 운동신경세포사가 일어나 한쪽 또는 양쪽에서 사지 마비가 발생한다. 임상 점수 시스템은 다음의 신경학적 점수 체계를 사용하여 구별하였다.
운동 장애의 징후가 없는 정상 : 4점
꼬리에 매달린 경우 뒷발 떨림이 있음 : 3점
걸음걸이 이상 : 2점
적어도 하나의 뒷다리 끌기 : 1점
30초 이내에 자신을 바로 잡을 수 없음 : 0점
마우스는 0점일 때 안락사 하였다(Weydt et al. 2003). 상기 신경퇴행성 질환 중 하나인 루게릭 병 동물모델에 vehicle 또는 암렉사녹스(AMX)를 2.5 mg/kg를 각각 주 5일 매일 한번씩 복강 투여한 후 행동실험을 통해 생존율을 측정하였다.
AMX 투여군과 대조군(Veh)에 따라 증상이 나타나기 전부터 시작하여 죽을 때까지 1주일에 1-2회 행동실험을 실시하였다. 4 rpm부터 40 rpm으로 점차 속도를 증사시키는 방법과 15 rpm의 일정한 속도로 5-10분간 운동을 시키는 방법을 채택하였다. rod에서 떨어지기까지 걸리는 시간을 기록하여 AMX 투여군과 대조군에서 차이가 있는지 분석하였다.
도 26은 루게릭 병 동물모델(G93A SOD-1 마우스)을 두 그룹(AMX 투여군과 대조군(Veh))으로 나누어 실험한 결과로, G93A SOD-1 마우스에 10주부터 신경학적 점수가 0점일 때까지, vehicle과 암렉사녹스를 각각 2.5 mg/kg 주 5일 매일 한번씩 복강 투여한 후, 생존율을 비교 분석하였다. AMX 투여군(130.2±2.0일)의 생존율이 대조군(veh)(121.3±3.6일)보다 유의하게 증가하였음을 확인하였다. 즉, 암렉사녹스(AMX)를 루게릭 병 동물모델에 투여한 경우, 루게릭 병의 발병시점과 생존률의 연장효과를 얻을 수 있음을 확인하였으며, 이와 같은 결과를 볼 때 본 발명자들에 의해서 새롭게 제시된 암렉사녹스(AMX)는 루게릭병 또는 알츠하이머와 같은 신경퇴행성 질환의 진행과정에서 지속적으로 나타나는 운동증상 악화를 예방하는 효과가 있음이 알 수 있다.
< 실시예 14.> 세포사멸에 대한 AMX의 세포보호 효과 분석
아밀로이드 베타에 의한 독성단백질의 축적으로 발생하는 세포손상에 있어서, 성상교세포에 대한 암렉사녹스(AMX)의 세포보호 효과를 확인하고자 하였다. 즉, 아밀로이드 베타에 의해 독성단백질의 축적이 유발되고, 이로 인해 세포에 산화적 손상을 유발하여 세포사멸이 발생하게 되므로, 이에 대한 AMX 약리효과를 확인하고자 하는 것이다.
구체적으로 성상교세포에 H2O2를 주입하여 세포 내 산화적 손상에 의한 세포사멸을 유도하여, 알츠하이머 혹은 루게릭과 같이 신경퇴행성 질환 동물모델과 유사한 세포배양모델을 제작하였다. 이렇게 제작된 세포 모델에 암렉사녹스(AMX)의 세포 보호 효과를 확인하기 위하여 아무것도 처리하지 않은 H2O2 대조군과 여기에 암렉사녹스(AMX)를 투여한 시험군을 제조하고, 24 시간 뒤 LDH 방법을 이용해 세포사멸을 정량적으로 측정하였다.
도 27은 성상교세포에 H2O2로 세포 내 산화적 손상을 유발하여 세포사멸을 일으키고, 여기에 암렉사녹스(AMX)를 처리하여 LDH 방법을 이용해 세포사멸을 정량화하여 나타낸 그래프이다. 이에 따르면 암렉사녹스(AMX)를 처리한 시험군에서는 40%까지 세포사멸이 현저히 감소하였음을 확인하였고, 대조군은 60%까지 세포사멸이 현저히 증가되었음을 확인하였다.
<실시예 15.> AMX의 GFP-mHttQ 응집 정리 효과
GFP가 붙어 있는 mHttQ 단백질을 세포 내에 주입하여 AMX에 의한 약리반응을 GFP antibody를 통해 확인하였다. mHttQ가 세포 내에 응집되어 축적되어 있는 것을 GFP의 발현으로 확인하였다.
그 결과, 도 28에 나타난 바와 같이 감소된 GFP 발현을 통하여 AMX가 응집 단백질의 억제 효과를 보임을 재확인하였다.
<실시예 16.> AMX, G93A-SOD 마우스 모델의 생존율 개선
AMX 농도별로 G93A-SOD 마우스에 매일 복강주사하여 생존율의 변화를 확인하였다.
도 26의 결과와 동일하게 도 29에 나타난 결과, 아무것도 넣지 않은 Veh군의 경우 150일 정도의 생존을 보이는 반면, AMX는 농도의존적으로 생존율이 증가하는 것을 확인하였다.
<실시예 17.> AMX의 G93A-SOD 마우스 모델에서 질병 진행을 지연 효과
실시예 15의 생존율 개선 효과와 함께 AMX에 의한 농도별 운동능력 실조 변화를 확인하였다.
도 26의 결과와 동일하게 도 30에 나타난 결과, 아무것도 주입하지 않은 대조군의 경우, 운동능력의 실조가 빨리 그리고 급격하게 진행되는 것에 비해 AMX를 농도별로 주입한 군의 경우 운동능력 실조의 시기가 더 늦게 시작되었고 진행 속도 또한 완화되는 것을 확인하였다.
< 실시예 18.> PDE 억제제 스크리닝
PDE 억제에 관한 약물효능 스크리닝을 위해 HTS를 사용하였다. cAMP를 기반으로 기존 PDE 억제제를 기준 삼아 FDA 승인 약물 librar와 selleckchem library를 사용하여 스크리닝하였다. FDA 승인 약물 library를 스크리닝할 때와 동일하게 실험을 진행하였다. PDE3 억제제로 알려진 cilostazol을 기준삼아 그와 대비하여 억제활성이 높은 약물들을 선별하였다. 이는 스크리닝하는 약물들 중 cAMP의 활성을 증가시키는 약물들을 선별하고자 함이다. 96웰 플레이트 각 웰 당 스크리닝 library 약물들을 각각 100 uM부터 1/4씩 희석하여 분주하고 PDE 반응제를 혼합하여 1시간 동안 약물과 PDE가 반응할 수 있게 처리하여 보관하였다. 중지용약을 AMP 검출시약과 혼합하여 20ul씩 분주하고 10분간 반응 후 바로 발광을 측정하였고, 사용키트의 권고대로 실험을 시행하였다.
처음 선정은 PDE3를 타겟으로 시작하고 후보약물이 선별된 후 전체 PDE isoform을 모두 실험하였다. 전체 PDE isoform에서 모두 좋은 억제 효능을 보인 11개의 약물이 선별되어 도 31 내지 도 41에 도시하였다(11개의 약물 : 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 설파다이아진은(Silver Sulfadiazine), 명세서 내 표 1에 기재).
도 31에 도시된 바와 같이, Piceatanol의 경우, PDE 억제값이 가장 좋은 약물로 그래프에 기재한 것처럼 각 isoform의 억제값이 최소 0.3nM에서 최대 5.5로 현저히 낮았다. 나머지 약물들의 전체 PDE isoform의 억제값도 우수함을 확인하였다.
즉, PDE 억제제, 특히 암렉사녹스(AMX)는 알츠하이머, 루게릭 병 등의 신경퇴행성 질환에 따른 아밀로이드 베타의 축적에 의한 산화적 손상이 발생한 세포(성상세포, 신경세포, 혈관주위세포)에서의, 세포사멸에 매우 중요한 역할을 수행하며, 세포손상을 회복시키거나 예방하는 약리효과를 가지고 있음을 명확히 확인할 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 조성물은 아밀로이드 베타에 기인한 신경퇴행성 질환 및 세포손상을 부작용에 대한 우려 없이 안전하고 효과적으로 개선 또는 치료하는데 유용하게 사용될 수 있어, 산업상 이용가능성이 있다.

Claims (22)

  1. 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  2. 암렉사녹스(amlexanox, AMX) 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  3. 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서,
    상기 포스포디에스터라제(phosphodiesterase, PDE)는 PDE1A, PDE1B, PDE1C, PDE2A, PDE3a, PDE3B, PDE4A, PDE4B, PDE5A, PDE6A, PDE6B, PDE6C, PDE6D, PDE7A, PDE7B, PDE8A, PDE8B, PDE9A, PDE10A, 및 PDE11A로 이루어진 군으로부터 하나 이상 선택된 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  5. 제2항에 있어서,
    상기 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염은 아밀로이드 베타 축적에 의한 독성단백질 응집을 예방 또는 저감시키는 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  6. 제2항에 있어서,
    상기 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염은 산화적 스트레스에 의한 세포사멸을 예방 또는 저감하는 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  7. 제2항에 있어서,
    상기 약리학적으로 허용 가능한 염은 옥살산, 말레산, 푸마르산, 말산, 타르타르산, 시트르산 및 벤조산 중에서 선택된 유기산이거나, 또는 염산, 황산, 인산 및 브롬화수소산 중에서 선택된 무기산에 의해 형성되는 산부가염의 형태인 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  8. 제1항 내지 제3항 중 어느 한 항에 있어서,
    상기 신경퇴행성 질환은 알츠하이머 질환(AD), 파킨슨 질환(PD), 헌팅턴 병, 루게릭 병(ALS), 외상 후 스트레스 장애(trauma), 다발성 경화증(MS), 대뇌 허혈질환 및 근위축성측색경화증으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  9. 제8항에 있어서,
    상기 신경퇴행성 질환은 알츠하이머 질환인 것을 특징으로 하는, 신경퇴행성 질환의 예방 또는 치료용 약학적 조성물.
  10. 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물.
  11. 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성의 질환 예방 또는 개선용 식품 조성물.
  12. 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 개선용 식품 조성물.
  13. 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 세포손상 예방 또는 치료용 약학적 조성물.
  14. 제13항에 있어서,
    상기 세포손상은 아밀로이드 베타에 의해 라이소좀 pH가 증가되고, 라이소좀 단백질의 활성이 감소되거나 또는 세포 내 아연의 농도가 감소되는 것을 특징으로 하는, 세포손상 예방 또는 치료용 약학적 조성물.
  15. 제13항에 있어서,
    상기 세포는 혈관주위세포, 신경세포 및 성상세포로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 세포손상 예방 또는 치료용 약학적 조성물.
  16. 암렉사녹스 또는 이의 식품학적으로 허용되는 염을 유효성분으로 포함하는 세포손상 예방 또는 개선용 식품 조성물.
  17. 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도.
  18. 암렉사녹스 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도.
  19. 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 유효성분으로 포함하는 신경퇴행성 질환의 예방 또는 치료 용도.
  20. 포스포디에스터라제(phosphodiesterase, PDE) 억제제 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법.
  21. 암렉사녹스 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법.
  22. 피세아탄올(Piceathanol), 아탈루렌(Ataluren), 마시티닙(Masitinib), JTC-801, 오바토클락스 메실레이트(Obatoclax mesylate), 도비티닙(Dovitinib), CYC116, 레스베라트롤(Resveratrol), 피피트린(Pifithrin), RITA(5,5'-(2,5-furandiyl)bis-2-thiophenemethanol), 엑시티닙(Axitinib), 이마티닙 메실레이트(Imatinib mesylate), 자피를루카스트(Zafirlukast), 헥사클로로펜(Hexachloropene), 페북소스타트(Febuxostat), 및 설파다이아진은(Silver Sulfadiazine)으로 이루어진 군으로부터 선택된 하나 이상의 화합물 또는 이의 약리학적으로 허용 가능한 염을 개체에 투여함으로써 신경퇴행성 질환을 예방 또는 치료하는 방법.
PCT/KR2019/007556 2018-06-21 2019-06-21 신경퇴행성 질환 예방 또는 치료용 조성물 WO2019245347A2 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP19823531.9A EP3838272A4 (en) 2018-06-21 2019-06-21 COMPOSITION FOR THE PREVENTION OR TREATMENT OF NEURODEGENERATIVE DISEASE
US17/254,323 US20210220340A1 (en) 2018-06-21 2019-06-21 Composition for prevention or treatment of neurodegenerative disease

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0071564 2018-06-21
KR20180071564 2018-06-21
KR10-2019-0074410 2019-06-21
KR1020190074410A KR20190143833A (ko) 2018-06-21 2019-06-21 신경퇴행성 질환 예방 또는 치료용 조성물

Publications (2)

Publication Number Publication Date
WO2019245347A2 true WO2019245347A2 (ko) 2019-12-26
WO2019245347A3 WO2019245347A3 (ko) 2020-02-20

Family

ID=68982649

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/007556 WO2019245347A2 (ko) 2018-06-21 2019-06-21 신경퇴행성 질환 예방 또는 치료용 조성물

Country Status (1)

Country Link
WO (1) WO2019245347A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111714517A (zh) * 2020-04-14 2020-09-29 南开大学 一种溶酶体作为制备药物领域的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180071564A (ko) 2016-12-20 2018-06-28 주식회사 실리콘웍스 정류 회로
KR20190074410A (ko) 2017-12-20 2019-06-28 주식회사 포스코 주조롤 장치

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008130619A2 (en) * 2007-04-20 2008-10-30 Trustees Of Boston College A composition comprising an inhibitor of pde4 and/or pde7

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180071564A (ko) 2016-12-20 2018-06-28 주식회사 실리콘웍스 정류 회로
KR20190074410A (ko) 2017-12-20 2019-06-28 주식회사 포스코 주조롤 장치

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"Burger's Medicinal Chemistry and Drug Chemistry", vol. 1, 1995, pages: 172 - 178,949-982

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111714517A (zh) * 2020-04-14 2020-09-29 南开大学 一种溶酶体作为制备药物领域的应用

Also Published As

Publication number Publication date
WO2019245347A3 (ko) 2020-02-20

Similar Documents

Publication Publication Date Title
WO2018034522A1 (ko) 코어와 그의 표면에 결합된 시알산, 시알릴락토스 또는 이들의 유도체를 포함하는 결합체 및 그의 용도
WO2017030292A1 (ko) P62 zz 도메인에 결합하는 리간드 또는 아르기닌화된 bip에 의해 매개되는 오토파지 활성을 통한 신경변성 질환 예방 및 치료
WO2018097628A2 (ko) 신경줄기세포의 분화 촉진 및 보호용 조성물 및 이를 이용하여 신경재생을 유도하는 방법
WO2022035115A1 (ko) 오리나무 추출물 또는 이로부터 분리된 화합물을 함유하는 골격근 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2020106119A1 (en) Pharmaceutical composition comprising histone deacetylase 6 inhibitors
WO2019245347A2 (ko) 신경퇴행성 질환 예방 또는 치료용 조성물
WO2016080796A2 (ko) 세스퀴테르펜 화합물을 포함하는, stat3 매개 질환의 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2017188690A1 (ko) 페닐아세트알데히드를 포함하는, 유방암 줄기세포 성장 억제용 조성물
WO2012093787A2 (ko) 플로로글루시놀, 플로로탄닌 또는 갈조류 추출물을 포함하는 가바 ａ형-벤조다이아제핀 수용체 활성용 조성물 및 불안 완화, 경련 개선, 진정 작용, 및 수면 유도 및 개선용 조성물
WO2020055129A1 (ko) 베르베논 유도체를 포함하는 암 치료 또는 예방용 조성물
WO2015102390A1 (ko) 신규한 아미드 유도체 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 포함하는 통증의 예방 또는 치료용 약학적 조성물
WO2021206455A1 (ko) 멜리사엽 분획 추출물 및 이를 포함하는 신규한 약학적 조성물
WO2019147089A1 (ko) 칼슘 채널 억제제 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2018221922A1 (ko) 황련 추출물을 함유하는 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2020197332A1 (ko) 봉독 추출물을 유효성분으로 함유하는 신경염증 질환 예방 또는 치료용 조성물
WO2018217009A1 (ko) 신선초 추출물 또는 이로부터 분리된 화합물을 함유하는 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2016032127A2 (ko) Tlr4에 lps와의 경쟁적 결합을 통한 항산화 및 항염증 활성을 갖는 신규 화합물 및 이의 의학적 용도
WO2024181780A1 (ko) 다이페닐 에터 유도체를 유효성분으로 포함하는, 말초신경병증의 예방 또는 치료용 조성물
WO2023244051A1 (ko) 넉줄고사리 추출물을 유효성분으로 포함하는 퇴행성 신경질환 예방 또는 치료용 조성물
WO2019139365A1 (ko) 신규한 페닐설포닐 옥사졸 유도체 및 이의 용도
WO2024080768A1 (ko) 이소퀴놀린 유도체를 유효성분으로 포함하는 말초신경병증의 예방 또는 치료용 조성물
WO2019172566A1 (ko) 이오논을 유효성분으로 함유하는 항스트레스제, 항우울제 또는 항불안제 조성물
WO2014051398A1 (ko) 아세카이니드 또는 이의 유도체를 포함하는 근력약화 관련 질환의 예방 또는 치료용 약학적 조성물
WO2022131759A1 (ko) 프테로신 화합물 및 이의 유도체를 유효성분으로 포함하는 pka 관련 질환 예방 또는 치료용 약학적 조성물
WO2018164442A1 (ko) 피라졸 유도체를 유효성분으로 함유하는 소양증의 예방 또는 치료용 약학적 조성물 및 이를 검출하기 위한 스크리닝 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19823531

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019823531

Country of ref document: EP

Effective date: 20210121