WO2019051084A1 - SHP2 INHIBITOR COMPOSITIONS AND METHODS OF TREATING CANCER - Google Patents

SHP2 INHIBITOR COMPOSITIONS AND METHODS OF TREATING CANCER Download PDF

Info

Publication number
WO2019051084A1
WO2019051084A1 PCT/US2018/049744 US2018049744W WO2019051084A1 WO 2019051084 A1 WO2019051084 A1 WO 2019051084A1 US 2018049744 W US2018049744 W US 2018049744W WO 2019051084 A1 WO2019051084 A1 WO 2019051084A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
formula
inhibitor
shp2
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/049744
Other languages
English (en)
French (fr)
Inventor
Robert J. NICHOLS
Mark A. Goldsmith
Christopher Schulze
Jacqueline Smith
David E. WILDES
Stephen Kelsey
Mallika Singh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Revolution Medicines Inc
Original Assignee
Revolution Medicines Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=63684567&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2019051084(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CN201880069854.1A priority Critical patent/CN111344017A/zh
Priority to MX2020002608A priority patent/MX2020002608A/es
Priority to KR1020207009441A priority patent/KR20200051684A/ko
Priority to SG11202001282UA priority patent/SG11202001282UA/en
Priority to AU2018328273A priority patent/AU2018328273A1/en
Priority to CA3074690A priority patent/CA3074690A1/en
Priority to JP2020513824A priority patent/JP7356414B2/ja
Priority to RU2020112303A priority patent/RU2805355C2/ru
Application filed by Revolution Medicines Inc filed Critical Revolution Medicines Inc
Priority to EP18778734.6A priority patent/EP3678703A1/en
Priority to BR112020004246-3A priority patent/BR112020004246A2/pt
Priority to MA49353A priority patent/MA49353B2/fr
Publication of WO2019051084A1 publication Critical patent/WO2019051084A1/en
Priority to IL272877A priority patent/IL272877A/en
Priority to US16/810,525 priority patent/US11596633B2/en
Anticipated expiration legal-status Critical
Priority to CONC2020/0002588A priority patent/CO2020002588A2/es
Priority to US18/166,150 priority patent/US20240058341A1/en
Priority to JP2023118814A priority patent/JP2023139151A/ja
Priority to US18/655,511 priority patent/US20250090532A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965Non-condensed pyrazines
    • A61K31/497Non-condensed pyrazines containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/28Compounds containing heavy metals
    • A61K31/282Platinum compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41841,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • A61K9/0056Mouth soluble or dispersible forms; Suckable, eatable, chewable coherent forms; Forms rapidly disintegrating in the mouth; Lozenges; Lollipops; Bite capsules; Baked products; Baits or other oral forms for animals

Definitions

  • the present disclosure relates to compositions and methods for the treatment of diseases or disorders (e.g., cancer) with inhibitors of the protein tyrosine phosphatase SHP2, alone and in combination with other therapeutic agents such as a RAS pathway inhibitor (e.g., a MEK inhibitor).
  • a RAS pathway inhibitor e.g., a MEK inhibitor
  • this invention is concerned with methods of treating diseases or disorders (such as cancer) in certain subsets of patients that are determined to be candidates for treatment with a SHP2 inhibitor.
  • RTKs receptor tyrosine kinases
  • RTKs are transmembrane proteins having an extracellular ligand binding domain, a transmembrane domain, and a tyrosine kinase domain.
  • Receptor tyrosine kinases are an important class of receptor that are involved in many fundamental cellular processes including cell proliferation, survival, metabolism, and migration, e.g. Schlessinger, Cell, 103 : 211-225 (2000).
  • Prominent families of this class include, for example, epidermal growth factor receptor (EGFR), platelet derived growth factor receptor (PDGFR), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFR), tyrosine kinase with immunoglobulin-like and epidermal growth factor homology domains (TIE-2), insulin growth factor— I (IGFI) receptor, macrophage colony stimulating factor (MCSF), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephrin (eph) receptors, hepatocyte growth factor receptors (HGFR) and the RET protooncogene.
  • EGFR epidermal growth factor receptor
  • PDGFR platelet derived growth factor receptor
  • erbB2 erbB2
  • VEGFR vascular endothelial growth factor receptor
  • TIE-2 vascular endothelial growth
  • the class of receptor tyrosine kinases is so named because when activated by dimerization, the intracellular domain of RTKs acquire tyrosine kinase activity that can, in turn, activate a variety signal transduction pathways.
  • FIG. 1 shows a cartoon schematic of a RTK pathway.
  • the RTK is dimerized upon ligand binding, which triggers auto-phosphorylation of the receptor and initiation of downstream signal transduction.
  • RTK phosphorylation recruits binding of the GRB2 adapter via its SH2 domain, and GRB2 then recruits (via its SH3 domain) downstream signaling molecules such as the adapter protein GAB 1 and the GEF protein SOS1 (McDonald et al., FEBS J. 2012 Jun 279(2): 2156-2173).
  • RAS oscillates between GDP-bound "off and GTP-bound "on” state, facilitated by interplay between a GEF protein (e.g., SOS1), which loads RAS with GTP, and a GAP protein (e.g., F1), which hydrolyzes GTP, thereby inactivating RAS.
  • GEF protein e.g., SOS1
  • GAP protein e.g., F1
  • SFIP2 protein tyrosine phosphatase-2
  • RAF serine/threonine kinase RAF
  • RAF phosphorylates MEK/2 which in turn phosphorylates and activates ERKl/2 leading to downstream signaling, e.g., via transcription, as well as feedback inhibition of the RTK, thereby turning off transduction of the signal.
  • RAF also activates MAP3 kinases that activate MKK4/7, MKKK3/6 and MEK5, which activates JNKl/2, p38 and ERK5, consecutively.
  • MAP3Ks are also activated by inflammatory cytokines, oxidative stress and UV radiation.
  • PI3K is activated by RTK autophosphorylation and results in the activation of Akt, which also induces mTOR within the mTORCl complex. Akt is also regulated by mTORC2 complex. PLOy activation leads to Ca +2 mobilization and to the activation of PKC. These events play an essential role in proliferation, differentiation, survival and cell migration.
  • RTKs and/or RAS pathway signaling molecules have been shown to result in uncontrolled cell growth.
  • the aberrant activity of such kinases has been linked to malignant tissue proliferation, survival, invasion and metastasis.
  • mutations affecting RTKs and/or RAS pathway components Ras (KRAS, RAS, FIRAS), B-Raf, F1, PI3K and AKT are common in promoting the malignancy of several types of cancers and from different tissue origins.
  • RTKs and downstream RAS pathway signal transducers represent attractive therapeutic targets.
  • therapeutic inhibition of the RAS pathway although often initially efficacious, can ultimately prove ineffective as it may lead to over-activation of RAS pathway signaling via a number of mechanisms including, e.g., reactivation of the pathway via relief of the negative feedback machineries that naturally operate in these pathways.
  • MEK inhibition results in increased ErbB signaling due to its relief of MEK / ERK-mediated feedback inhibition of RTK activation.
  • cells that were initially sensitive to such inhibitors may become resistant.
  • SHP2 is a non-receptor protein tyrosine phosphatase encoded by the PTPN11 gene that contributes to multiple cellular functions including proliferation, differentiation, cell cycle maintenance and migration. SHP2 is involved in signaling through the RAS-mitogen-activated protein kinase (MAPK), the JAK-STAT and/or the phosphoinositol 3- kinase-AKT pathways.
  • MAPK RAS-mitogen-activated protein kinase
  • JAK-STAT the JAK-STAT
  • phosphoinositol 3- kinase-AKT phosphoinositol 3- kinase-AKT pathways.
  • SHP2 has two N-terminal Src homology 2 domains (N-SH2 and C-SH2), a catalytic domain (PTP), and a C-terminal tail.
  • the two SH2 domains control the subcellular localization and functional regulation of SHP2.
  • the molecule exists in an inactive, self -inhibited conformation stabilized by a binding network involving residues from both the N-SH2 and PTP domains. Stimulation by, for example, cytokines or growth factors acting through RTKs leads to exposure of the catalytic site resulting in enzymatic activation of SHP2.
  • Mutations in the PTPN11 gene and subsequently in SHP2 have been identified in several human developmental diseases, such as Noonan Syndrome and Leopard Syndrome, as well as human cancers, such as juvenile myelomonocytic leukemias, neuroblastoma, melanoma, acute myeloid leukemia and cancers of the breast, lung and colon. Some of these mutations destabilize the auto-inhibited conformation of SHP2 and promote autoactivation or enhanced growth factor-driven activation of SHP2.
  • SHP2 therefore, represents a highly attractive target for the development of novel therapies for the treatment of various diseases including cancer. It has been disclosed previously that either the knockdown of SHP2 expression using RNAi technology or inhibition of SHP2 by an allosteric small molecule inhibitor interferes with signaling from various RTKs involved in driving cancer cell growth. However, this work also concluded that such approaches would be ineffective at blocking growth signaling in cells in which growth is driven by mutations in proteins that act downstream of RTKs, such as those containing activating mutations in Ras or Raf proteins (Chen, Ying-Nan P. 148 Nature Vol 535 7 July 2016 at pg. 151 ).
  • the present disclosure relates to treating or preventing a disease or disorder (e.g., cancer) with a SHP2 inhibitor alone or in combination with another suitable therapeutic agent.
  • a disease or disorder e.g., cancer
  • the present disclosure relates to the unexpected discovery that contrary to the teachings of the prior art, certain subsets of cancer cells carrying oncogenic RAS pathway mutations are sensitive to SHP2 inhibition and may be effectively treated with SHP2 inhibitors.
  • the present disclosure relates to the discovery that certain subsets of cancer cells carrying RAS mutations (e.g., KRAS G12C and/or certain other KRAS mutations) are sensitive to SHP2 inhibition.
  • certain subsets of cancer cells carrying NF 1 L0F mutations are sensitive to SHP2 inhibition.
  • the present disclosure provides a method for treating cells (e.g., cancer cells) containing RAS pathway mutations, which render the mutated protein dependent on upstream signaling through SHP2, with an inhibitor of SHP2.
  • cells e.g., cancer cells
  • SHP2 upstream signaling through SHP2
  • the present disclosure relates to the unexpected discovery that even though SHP2 activation naturally promotes MAPK signaling, which in turn may promote feedback inhibition of RTK and RAS pathway signaling, inhibition of SHP2 does not result in subsequent over-activation of RTK or RAS pathway signaling via relief of that feedback inhibition.
  • SHP2 is downstream from the RTKs in the RAS pathway, and SHP2 inhibition blocks transmission of signals from RTKs; thus, the expected outcome of SHP2 inhibition was hyperactivation of RTKs due to feedback disinhibition.
  • the present disclosure demonstrates that unlike MAPK inhibitors, which may induce resistance by relief of feedback inhibition, SHP2 inhibitors do not, and they are able to attenuate hyperactivation of RAS in response to MEK inhibitor treatment that may contribute to MEK inhibitor drug resistance.
  • the present disclosure relates to the discovery that SHP2 inhibition is an effective means for preventing and delaying the emergence of tumor resistance to various cancer therapies and for re-sensitizing a tumor that is resistant to a MAPK inhibitor to that inhibitor.
  • the discoveries disclosed herein provide a method for treating cells (e.g., cancer cells) with a SHP2 inhibitor, wherein the cells have been rendered dependent on SHP2 by means of a therapeutic intervention (e.g., administration of a MAPK inhibitor).
  • a therapeutic intervention rendering the cells dependent on SHP2 signaling results in overactivation of the RAS pathway via relief of a natural RAS pathway negative feedback mechanism.
  • the present disclosure relates to the surprising discovery that contrary to the teachings of the prior art, SHP2 phosphorylation at Y580 occurs after, and is dependent on prior phosphorylation at Y542, and allosteric inhibition of SHP2 activity occurs by stabilizing the closed state of the enzyme, thereby preventing the phosphorylation of Y580, but not Y542.
  • the present invention provides a method of determining whether a SHP2 inhibitor has engaged its target (i.e., SHP2), the method comprising determining whether Y542, but not Y580 on SHP2 is phosphorylated in response to growth factor stimulation.
  • the present invention relates to compositions and methods for treating or preventing diseases or disorders (e.g., cancer) with inhibitors of the protein tyrosine phosphatase SHP2.
  • the present invention also relates to methods of establishing appropriate treatment plans for subjects based upon the expression of one or more biomarker in a tissue sample from the subject, wherein the biomarker is indicative of SHP2 inhibitor sensitivity.
  • the present invention also relates to methods determining sensitivity to a SHP2 inhibitor based upon a phosphorylation status of SHP2.
  • the present disclosure provides a method of treating a subj ect having a disease or disorder comprising a cell containing a mutation encoding the KRAS G12C variant, comprising providing to the subject an inhibitor of SHP2.
  • the disease or condition is a tumor.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the method further comprises providing to the subject an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853 and GSKl 120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib or Ulixertinib.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from
  • the present disclosure provides a method of treating a subj ect having a disease or disorder comprising a cell with a mutation encoding an NF1 loss of function ( F1 L0F ) variant, comprising providing to the subject an inhibitor of SHP2.
  • the disease or condition is a tumor.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the method further comprises providing to the subject an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY- 424704/ARRY-704); R05126766; ARS-853 and GSKl 120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib or Ulixertinib.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound
  • the present disclosure provides a method of treating a subj ect having a disease or disorder associated with a RAS pathway mutation in a cell of the subject that renders the cell at least partially dependent on signaling flux through SHP2, comprising providing to the subject an inhibitor of SHP2.
  • the RAS pathway mutation is a mutation in a RAS, RAF, NFl, MEK, ERK, or SOS, including any specific isoforms or alleotypes thereof.
  • the RAS pathway mutation is a mutation in a RAS, RAF, NFl, or SOS, including any specific isoforms or alleotypes thereof.
  • the RAS pathway mutation is a RAS mutation selected from a KRAS mutation, an NRAS mutation, an URAS mutation, and a Class III BRAF mutation.
  • the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • the KRAS mutation is KRAS G12C .
  • the KRAS mutation is KRAS G12A .
  • the Class III BRAF mutation is selected from one or more of the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • the MEK mutation is a MEKl or MEK2 mutation.
  • the MEKl mutation is a RAF dependent MEKl mutation (i.e., a "Class I" MEKl mutation).
  • the MEKl mutation is a RAF regulated MEKl mutation (i.e., a "Class ⁇ " MEKl mutation).
  • the Class I MEKl mutation is selected from D67N; P124L; P124S; and L177V.
  • the Class II MEK mutation is selected from AE51-Q58; AF53-Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • the RAF mutation is a ARAF or CRAF mutation.
  • the NFl mutation is an NFl loss of function mutation.
  • the SOS mutation leads to altered function of SOS.
  • the disease or condition is a tumor.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer , JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the method further comprises providing to the subject an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY- 424704/ARRY-704); R05126766; ARS-853 and GSK1120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x
  • the present disclosure provides a method of treating a subj ect having a disease associated with an NF1 loss of function mutation, comprising providing to the subject an inhibitor of SHP2.
  • the disease or condition is a tumor.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer , JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the disease is a tumor comprising cells with an NF1 loss of function mutation.
  • the tumor is an NSCLC or melanoma tumor.
  • the disease is selected from neurofibromatosis type I, neurofibromatosis type II, schwannomatosis, and Watson syndrome.
  • the method further comprising providing to the subject an inhibitor of the RAS pathway.
  • the method further comprises providing to the subject an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853 and GSK1120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib or Ulixertinib.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from
  • the present disclosure provides a method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as a KRAS mutant; and (b) administering to the subject an inhibitor of SHP2 if the biological sample is classified as a KRAS G12C mutant, a KRAS G12D mutant, a KRAS G12S mutant, or a KRAS G12V mutant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof. In some embodiments, Compound C
  • the present disclosure provides a method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as an NF1 L0F mutant; and (b) administering to the subject an inhibitor of SHP2 if the biological sample is classified as an NF1 L0F mutant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the present disclosure provides a method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as an Class 3 BRAF mutant; and (b) administering to the subject an inhibitor of SHP2 if the biological sample is classified as an Class 3 BRAF mutant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the present disclosure provides a method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as an Class 1 MEK1 mutant; and (b) administering to the subject an inhibitor of SHP2 if the biological sample is classified as an Class 1 MEK1 mutant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the Class I MEK1 mutation is selected from D67N; P124L; P124S; and L177V.
  • the present disclosure provides a method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as an Class 2 MEK1 mutant; and (b) administering to the subject an inhibitor of SHP2 if the biological sample is classified as an Class 2 MEK1 mutant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the Class II MEK mutation is selected from AE51-Q58; AF53-Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • the present disclosure provides a method for treating or preventing drug resistance in a subject receiving administration of a RAS pathway inhibitor, comprising administering to the subject a SHP2 inhibitor.
  • the subject comprises a tumor containing cells with anNFl L0F mutation.
  • the subject comprises a tumor containing a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12A mutation, a KRAS G12S mutation, or a KRAS G12V mutation.
  • the RAS pathway inhibitor is a MEK inhibitor.
  • the MEK inhibitor is selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC- 0973/XL581); Binimetinib; Vemurafenib; Pimasertib; TAK733; R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766; AZD8330 (ARRY-424704/ARRY-704); and GSK1120212.
  • the RAS pathway inhibitor is an ERK inhibitor.
  • the ERK inhibitor is selected from any ERK inhibitor known in the art. In some embodiments, the ERK inhibitor is selected from LY3214996 and BVD523; In some embodiments, the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety;
  • the method further comprises providing to the subject an inhibitor of the RAS pathway.
  • the present disclosure provides a combination therapy comprising administering to a subject in need thereof a RAS pathway inhibitor and a SHP2 inhibitor.
  • the RAS pathway inhibitor is a MEK inhibitor.
  • the MEK inhibitor is selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581); Binimetinib;Vemurafenib; Pimasertib; TAK733; R04987655 (CH4987655); CI-1040; PD- 0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766; AZD8330 (ARRY-424704/ARRY-704); and GSK1120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib or Ulixertinib. In some embodiments, the RAS pathway inhibitor is the KRASG12C-specific inhibitor ARS-853.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597
  • the present disclosure provides a pharmaceutical composition comprising a RAS pathway inhibitor, a SHP2 inhibitor, and one or more pharmaceutically acceptable carrier, excipient, diluent, and/or surfactant.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597),
  • the RAS pathway inhibitor is selected from one or more of Trametinib (GSK1120212) Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSK1120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib or Ulixertinib.
  • the present disclosure provides a method of inhibiting the growth or proliferation of a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2, the method comprising contacting the cell with an inhibitor of SHP2.
  • the SHP2 inhibitor may be any SHP2 inhibitor known in the art or disclosed herein.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the RAS pathway mutation is selected from a KRAS mutation, an RAS mutation, an HRAS mutation, a SOS mutation, a Class 3 BRAF mutation, a MEK1 mutation, a MEK2 mutation, an ERK mutation and an NF1 mutation.
  • the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • the KRAS mutation is KRAS G12C .
  • the KRAS mutation is KRAS G12A .
  • the Class 3 BRAF mutation is selected from one or more of the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • the MEK1 mutation is selected from D67N; P124L; P124S; and L177V.
  • the MEK1 mutation is selected from AE51-Q58; AF53-Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • the method further comprises contacting the cell with an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the RAS pathway inhibitor is a SOS inhibitor.
  • the SOS inhibitor is administered to a cell comprising higher than normal SOS levels or SOS activity.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86- 9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853; LY3214996; BVD523; and GSKl 120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib. .
  • the present disclosure provides a method of inhibiting RAS- GTP accumulation in a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2, the method comprising contacting the cell with an inhibitor of SHP2.
  • the SHP2 inhibitor may be any SHP2 inhibitor known in the art or disclosed herein.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • the RAS pathway mutation is selected from a KRAS mutation, an RAS mutation, an URAS mutation, a SOS mutation, a Class 3 BRAF mutation, a MEK mutation, an ERK mutation, and an F 1 mutation. In some embodiments, the RAS pathway mutation is selected from a KRAS mutation, an NRAS mutation, an URAS mutation, a SOS mutation, a Class 3 BRAF mutation, and an NF1 mutation.
  • the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • the KRAS mutation is KRAS G12C .
  • the KRAS mutation is KRAS G12A .
  • the Class 3 BRAF mutation is selected from one or more of the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • the MEK mutation is a Class I MEK1 mutation selected from D67N; P124L; P124S; and L177V.
  • the MEK mutation is a Class II MEKl mutation selected from AE51-Q58; AF53-Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • the method further comprises contacting the cell with an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the RAS pathway inhibitor is a SOS inhibitor.
  • the SOS inhibitor is administered to a cell comprising higher than normal SOS levels or SOS activity.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86- 9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853; LY3214996; BVD523; and GSKl 120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the present disclosure provides a method of inhibiting the growth of a tumor cell, comprising contacting the tumor cell with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • Such contacting may be, for example, in vivo, in a subject ⁇ e.g., a mammal, preferably a human).
  • such a method may, e.g., in one non-limiting embodiment, comprise contacting the tumor cell with a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD- 0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212.
  • a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD62
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the tumor cell may be contacted with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety;
  • the tumor cell may be contacted with a combination therapy comprising Compound B and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC- 0973/XL581), Binimetinib, CI- 1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212.
  • a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC- 0973/XL581), Binimetinib, CI- 1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BA
  • the tumor cell may be contacted with a combination therapy comprising Compound B and Abemaciclib.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and Compound B. In some non -limiting embodiments, the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK 1120212) and Compound A. In some non- limiting embodiments, the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and SHP099. In some non-limiting embodiments, the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and NSC-87877.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK 1120212) and a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof.
  • GSK 1120212 Trametinib
  • the tumor cell may be a cell from a tumor selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and
  • the present disclosure provides a method of inhibiting the growth of a tumor cell, comprising contacting the tumor cell with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor, such as combination therapy comprising Trametinib (GSK1120212) and Compound B, wherein the tumor cell is from a NSCLC tumor; wherein the contacting preferably occurs in vivo in a subject (e.g., a mammal, preferably a human).
  • a subject e.g., a mammal, preferably a human.
  • the method is as above, but the tumor cell is from a colon cancer tumor rather than an NSCLC tumor.
  • the method is as above, but the tumor cell is esophageal cancer tumor.
  • the method is as above, but the tumor cell is a rectal cancer tumor. In some alternative embodiments, the method is as above, but the tumor cell is a JMML tumor. In some alternative embodiments, the method is as above, but the tumor cell is a breast cancer tumor. In some alternative embodiments, the method is as above, but the tumor cell is a melanoma tumor. In some alternative embodiments, the method is as above, but the tumor cell is a Scwannoma tumor. In some alternative embodiments, the method is as above, but the tumor cell is a pancreatic cancer tumor.
  • the contacting of the tumor cell with the combination therapy comprising the MEK inhibitor and the SHP2 inhibitor results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of the respective MEK and SHP2 inhibitors separately.
  • the present disclosure provides a method of treating a subj ect having a tumor, comprising providing to the subject an inhibitor of SHP2 and an inhibitor of the RAS pathway.
  • the disease or condition is a tumor.
  • the tumor is selected from an NSCLC, a colon cancer, an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • the disease is a tumor comprising cells with an NF1 loss of function mutation.
  • the tumor is an NSCLC or melanoma tumor.
  • the disease is selected from neurofibromatosis type I, neurofibromatosis type II, schwannomatosis, and Watson syndrome.
  • the method further comprising providing to the subject an inhibitor of the RAS pathway.
  • the inhibitor of the RAS pathway is a MAPK inhibitor.
  • the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86- 9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853 and GSK1120212.
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety;(viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x
  • the present disclosure provides a method of treating a subj ect having a tumor, comprising contacting the tumor with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • Such contacting may be, for example, in vivo, in a subject ⁇ e.g., a mammal, preferably a human).
  • the person of skill in the art will understand that the contacting may be via administration, e.g., to a subject (such as a mammal, preferably a human).
  • such a method may, e.g., comprise contacting the tumor cell with a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD- 0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSK1120212.
  • a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib
  • Such a method may, e.g., comprise contacting the tumor cell with a combination therapy comprising a SHP2 inhibitor and Abemaciclib.
  • the tumor cell may be contacted with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PC
  • the tumor cell may be contacted with a combination therapy comprising Compound B and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD- 0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212.
  • a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib
  • the tumor cell may be contacted with a combination therapy comprising a SHP2 inhibitor (e.g., Compound B) and Abemaciclib.
  • a SHP2 inhibitor e.g., Compound B
  • the tumor cell may be contacted with a combination therapy comprising Trametinib and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSKl 120212) and Compound B.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSKl 120212) and Compound A.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSKl 120212) and Compound C.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSKl 120212) and SHP099.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and NSC-87877.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X and a combination thereof.
  • GSK1120212 Trametinib
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK 1120212) and a SHP2 inhibitor compound of TN0155.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and a SHP2 inhibitor listed on Table 1.
  • the tumor cell may be contacted with a combination therapy comprising Trametinib (GSK1120212) and a SHP2 inhibitor listed on Table 2.
  • the tumor cell may be a cell from a tumor selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck cancer; skin cancer;
  • the present disclosure provides a method of treating a subject having a tumor, comprising contacting the tumor cell with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor, such as combination therapy comprising Trametinib (GSK1120212) and Compound B, wherein the tumor cell is from a NSCLC tumor; wherein the contacting preferably occurs in vivo in a subj ect (e.g., a mammal, preferably a human).
  • a subj ect e.g., a mammal, preferably a human
  • the present disclosure provides a method of treating a subject having a tumor, comprising contacting the tumor cell with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor, such as a combination therapy comprising Trametinib (GSK1120212) and Compound C or a combination therapy comprising Trametinib and a compound selected from the compounds listed on Table 1 and Table 2, wherein the tumor cell is from a NSCLC tumor; wherein the contacting preferably occurs in vivo in a subject (e.g., a mammal, preferably a human).
  • the method is as above, but the tumor cell is from a colon cancer tumor rather than an NSCLC tumor.
  • the method is as above, but the tumor cell is esophageal cancer tumor. In some alternative embodiments, the method is as above, but the tumor cell is a rectal cancer tumor. In some alternative embodiments, the method is as above, but the tumor cell is a JMML tumor. In some alternative embodiments, the method is as above, but the tumor cell is a breast cancer tumor. In some alternative embodiments, the method is as above, but the tumor cell is a melanoma tumor. In some alternative embodiments, the method is as above, but the tumor cell is a Scwannoma tumor. In some alternative embodiments, the method is as above, but the tumor cell is a pancreatic cancer tumor.
  • the method of treating a subj ect having a tumor comprising contacting of the tumor cell with the combination therapy comprising the MEK inhibitor and the SHP2 inhibitor results in synergistic inhibition of tumor growth.
  • “Synergistic inhibition of tumor growth” means inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of the respective inhibitors separately.
  • treatment of a subject having a tumor with a combination therapy comprising Trametinib (GSK1120212) and Compound B results in synergistic inhibition of tumor growth, i.e., inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of the respective Trametinib (GSK1120212) and Compound B inhibitors separately.
  • treatment of a subject having a tumor with a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI- 1040; PD- 0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212, results in synergistic inhibition of tumor growth.
  • a combination therapy comprising a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimet
  • treatment of a subject having a tumor with a combination therapy comprising (a) a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212; and (b) a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of
  • FIG. 1 shows a cartoon schematic depicting the receptor tyrosine kinase (RTK) signaling pathway.
  • FIG. 1A shows signaling from RTK ligand binding to activation of ERK and subsequent feedback inhibition of RTK activity.
  • FIG. IB shows SHP2 modulates RAS- GTP loading by an unknown mechanism, which we posit involves priming the GEF protein SOS1.
  • Figure 2 shows inhibitory potency (IC50 values) of SHP2 allosteric inhibitor Compound B (Compound B) on cell viability (as measured using CTG) in a panel of KRAS G12C mutant cell lines and H441 (KRAS G12V ) grown in 3D culture.
  • FIG. 3 shows Compound B (Compound B) (allosteric SHP2 inhibitor) and ARS- 853 (covalent KRAS G12C -selective inhibitor) caused concentration-dependent inhibition of cellular p-ERKl/2 levels in NSCLC KRAS G12C cell lines.
  • FIG. 3A shows inhibition of pERKl/2 levels in H358 cells.
  • FIG. 3B shows inhibition of pERKl/2 levels in H1792 cells.
  • FIG. 3C shows inhibition of pERKl/2 levels in CALU-1 cells.
  • FIG. 4 shows that the SHP2 allosteric inhibitor Compound A (Compound A) inhibits RAS activation and produces a concentration-dependent inhibition of cellular p- ERK1/2 levels and cell growth (3D culture) in H358 KRAS G12C cells in vitro.
  • FIG. 4A shows a western blot demonstrating that Compound A (Compound A) reduces RAS-GTP.
  • FIG. 4B shows Compound A (Compound A) inhibits p-ERKl/2 levels.
  • FIG. 4C shows Compound A (Compound A) inhibits H358 KRAS G12C cell growth.
  • FIG. 5 shows that the SHP2 allosteric inhibitor Compound A (Compound A) inhibits Ras activation and produces a concentration-dependent inhibition of cellular p-ERKl/2 levels and cell growth in HI 838 F1 L0F cells in vitro.
  • FIG. 5 A shows Compound A (Compound A) reduces RAS-GTP.
  • FIG. 5B shows Compound A (Compound A) inhibits p- ERK1/2.
  • FIG. 5C shows Compound A (Compound A) inhibits H1838 F1 L0F cell growth.
  • Figure 6 shows dose-dependent inhibition of tumor cell growth in the NSCLC H358 xenograft model in female CB.17 SCID mice following oral administration of Compound A (Compound A).
  • Figure 7 shows dose-dependent inhibition of tumor cell growth in the NSCLC H358 xenograft model in female athymic nude mice following oral administration of the SHP2 allosteric inhibitor Compound B (Compound B) (**p ⁇ 0.01 ANOVA with multiple comparisons)
  • Figure 8 shows dose-dependent inhibition of tumor cell growth in the pancreatic cancer MiaPaca-2 xenograft model in female athymic nude mice following oral administration of the SHP2 allosteric inhibitor Compound B (Compound B) (*p ⁇ 0.05, **p ⁇ 0.01 ANOVA with multiple comparisons).
  • Figure 9 shows that MEK inhibition by selumetinib caused feedback-driven p-RTK hyperactivation in MDA-MB-231 (KRAS G13D ) cell line whereas Compound A (Compound A) did not.
  • Figure 10 shows that MEK inhibition by trametinib in NCI-H1838 ( F1 L0F ) caused feedback-driven RAS-GTP accumulation and Compound A (Compound A) suppressed this effect.
  • FIG. 11 shows that the SHP2 allosteric inhibitor Compound B (Compound B) suppressed RAS-GTP accumulation resulting from MEK inhibition by trametinib in H358 (KRAS G12C ) and A549 (KRAS G12S ) cells.
  • FIG. 11A shows the effect on RAS-GTP accumulation of 6 hour and 24 hour MEK inhibition in H358 (KRAS G12C ) cells with and without SHP2 inhibition by Compound B.
  • FIG. 11B shows the effect on RAS-GTP accumulation of 6 hour and 24 hour MEK inhibition in H358 (KRAS G12C ) cells with and without the KRAS G12C -specific inhibitor ARS-853.
  • FIG. 11A shows the effect on RAS-GTP accumulation of 6 hour and 24 hour MEK inhibition in H358 (KRAS G12C ) cells with and without the KRAS G12C -specific inhibitor ARS-853.
  • FIG. 11C shows the effect on RAS-GTP accumulation of 6 hour and 24 hour MEK inhibition in A549 (KRAS G12S ) cells with and without SHP2 inhibition by Compound B.
  • FIG. 11D shows the effect on RAS-GTP accumulation of 6 hour and 24 hour MEK inhibition in A549 (KRAS G12S ) cells with and without the KRAS G12C -specific inhibitor ARS-853.
  • FIG. 12 shows phosphorylation of Tyr-542 and Tyr-580 measured in response to both EGF and PDGF in various cell lines.
  • FIG. 12A shows Tyr phosphorylation in mouse embryonic fibroblasts (MEFs).
  • FIG. 12B shows Tyr phosphorylation in H358 cells.
  • FIG. 12C shows Tyr phosphorylation in HEK 293 (C) cells.
  • “Cmp B” stands for Compound B.
  • FIG. 13 shows SHP2 inhibition suppresses growth and RAS/MAPK signaling in cancer cell lines with BRAF Class III mutations.
  • FIG. 13 A shows the effect of Compound B (Compound B) on proliferation of Class I (A375, BRAF V600E )) and Class II (NCI-H1755 BRAF G469A ) BRAF mutant cell lines in 3D culture.
  • FIG. 13B shows the effect of Compound B (Compound B) on RAS-GTP levels in Class I A375 and Class II NCI-H1755 cells grown in 2D culture.
  • FIG. 13C shows the effect of Compound B (Compound B) on p-ERK levels in Class I A375 and Class II NCI-H1755 cells grown in 2D culture.
  • FIG. 13 A shows the effect of Compound B (Compound B) on proliferation of Class I (A375, BRAF V600E )) and Class II (NCI-H1755 BRAF G469A ) BRAF mutant cell lines in 3D culture.
  • FIG. 13D shows the effect of Compound B (Compound B) on proliferation of two Class III BRAF mutant cell lines (Cal- 12T, BRAFG466V/+; NCI-H1666, BRAFG466V/+) cells in 3D culture.
  • FIG. 13E shows the effect of Compound B (Compound B) on RAS-GTP levels in Class III Cal-12T cells.
  • FIG. 13F shows the effect of Compound B (Compound B) on p-ERK levels in Class III Cal-12T and NCI-H1666 cells.
  • FIG. 14 shows that the effects of SHP2 inhibition on RAS activation proceed through SOS1.
  • FIG. 14A shows correlation analysis of the cellular effects of genetic knockdown of signaling molecules in the RTK / RAS pathway in Project DRIVE. Knockdown of PTPN11 (SHP2) is most closely correlated with SOS1 (correlation coefficient 0.51) and GRB2 (correlation coefficient 0.4) suggesting these are all members a core RAS-regulatory module.
  • FIG. 14B shows the effect of Compound B (Compound B) on cellular p-ERK in HEK293 expressing SOS-WT (wild type) or SOS-F, a SOS-1 mutant that targets SOS protein constitutively to the plasma membrane.
  • FIG. 14C shows expression of SOS-F in HEK293 cells leads to EGF -independent pERK signaling.
  • Figure 15 shows caspase 3/7 activity in NCI-H358 cells grown on ULA plates as spheroids. Culture spheroids were treated with Compound B (Compound B) or staurosporine, as a positive control, and assayed for caspase 3/7 activity after 22 h.
  • Compound B Compound B
  • staurosporine as a positive control
  • FIG. 16 shows synergistic tumor cell growth inhibition via the combined in vitro treatment of human non-small cell lung cancer cell lines CALU-1 and NCI-H358 with varying concentrations of Compound B (Compound B) in combination with trametinib.
  • FIG. 16A shows normalized percent inhibition relative to vehicle control in H358 NSCLC tumor cells grown in spheroids (3D culture), and treated for five days with increasing amounts of Compound B (Compound B) and Trametinib.
  • FIG. 16B shows a fit of the Loewe Model of Additivity to the normalized growth inhibition data in FIG. 16 A.
  • FIG. 16C shows normalized percent inhibition relative to vehicle control in CALU-1 NSCLC tumor cells grown in spheroids (3D culture), and treated for five days with increasing amounts of Compound B (Compound B) and Trametinib.
  • FIG. 16D shows a fit of the Loewe Model of Additivity to the normalized growth inhibition data in FIG. 16C. For each of FIGS 16B and 16D, numbers in the positive range (mapped in blue) are indicative of synergy.
  • Figure 18 shows the effect of Compound B (Compound B) alone and in combination with trametinib on body weight in NCI-H358 tumor bearing nude mice. Note that one animal in the Compound B (Compound B) 30mg/kg + trametinib group (dark green) lost >20% body weight on day 30 and was removed from the study.
  • FIG. 19 shows SHP2 inhibition suppresses growth and RAS/MAPK signaling in cancer cell lines driven by NF1 L0F mutation.
  • FIG. 19A and FIG. 19B show the effect of Compound B on proliferation ofNFl loss-of-function cells in 3D culture. One day after seeding cells were treated with Compound B and cell viability measured on Day 7 using CTG.
  • FIG. 19B lists the geometric mean IC50 values for proliferation inhibition by Compound B and NF1 mutational status in the cancer cell lines evaluated.
  • FIG. 19C and FIG. 19D show NCI-H1838 and MeWo NF1 LOF cells were grown in 2D culture and incubated with increasing concentrations of Compound B for one hour.
  • FIGS 20A and 20B show the effect of Compound B (Cmp B) on proliferation of NF1 loss-of-function cells in 3D culture. One day after seeding cells were treated with Compound B and cell viability measured on Day 7 using CTG.
  • FIG. 20B lists the geometric mean IC50 values for proliferation inhibition by Compound B and NF1 mutational status in the cancer cell lines evaluated.
  • FIGS 20C and 20D show NCI-H1838 and MeWo NF1 LOF cells were grown in 2D culture and incubated with increasing concentrations of Compound B for one hour.
  • FIG. 21 shows the efficacy of repeated daily dosing of SFIP2 inhibitor Compound C ("Cmp C") at 10 mg/kg PO with or without co-administration of a Ras pathway inhibitor in the H358 KRas G12C model of human non-small cell lung cancer.
  • FIG. 21 A shows the efficacy of Compound C and Trametinib (MEK inhibitor), alone or in combination, and FIG. 2 IB shows percent body weight changes in these mice;
  • FIG. 21C shows the efficacy of Compound C and Cobimetinib (MEK inhibitor) alone or in combination, and FIG. 2 ID shows percent body weight changes in these mice;
  • FIG. 21E the efficacy of Compound C and Ulixertinib (ERK1/2 inhibitor), alone or in combination, and
  • FIG. 2 IF shows percent body weight changes in these mice. Control is vehicle only for all groups.
  • FIG. 22 shows the efficacy of repeated daily dosing of SHP2 inhibitor Compound C ("Cmp C") at 30 mg/kg PO with or without co-administration of Abemaciclib (CDK inhibitor) at 50 mg/kg in the human pancreatic carcinoma MIA-Pa-Ca-2 xenograft model.
  • FIG. 22A shows the efficacy of Compound C and Abemaciclib, alone or in combination, and FIG.22B shows percent body weight changes in these mice.
  • administer refers to either directly administering a disclosed compound or pharmaceutically acceptable salt of the disclosed compound or a composition to a subject, or administering a prodrug derivative or analog of the compound or pharmaceutically acceptable salt of the compound or composition to the subject, which can form an equivalent amount of active compound within the subject's body.
  • carrier encompasses excipients, and diluents and means a material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a pharmaceutical agent from one organ, or portion of the body, to another organ, or portion of the body of a subject.
  • Compound A and “Cmp A” are used interchangeably herein to refer to a SHP2 inhibitor compound having the following structure:
  • Compound B and “Cmp B” are used interchangeably herein to refer to a SHP2 inhibitor compound having the following structure:
  • Compound C and “Cmp C” are used interchangeably herein to refer to an allosteric SHP2 inhibitor compound of similar structure to Compounds A and B.
  • Compound C is disclosed in PCT/US2017/041577 (WO 2018/013597), incorporated herein by reference in its entirety.
  • SHP099 refers to a SHP2 inhibitor having the following structure:
  • Class III BRAF mutation ; "Class 3 BRAF mutation”; “BRAF Class 3 mutation”; “BRAF Class III mutation”; “BRAF class 3 mutation” and “BRAF class 111 mutation” are used interchangeably herein to refer to a kinase-dead or lower activity BRAF mutation (as compared to wildtype BRAF) including, but not limited to any of the Class 3 BRAF mutations disclosed in Yao, Z. et al, Nature, 2017 Aug 10; 548(7666):234-238 or Nieto, P. et al, Nature. 2017 Aug 10; 548(7666):239-243, each of which are incorporated herein by reference in their entirety.
  • Class 3 BRAF mutations include, without limitation, the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • Class I MEKl mutation or “Class 1 MEKl mutation” are used herein to refer to a MEKl mutation that causes the MEKl kinase to be dependent on and hyperactivated by phosphorylation of S218 and S222 by RAF.
  • Class I MEKl mutations include, but are not limited to any of the Class I MEKl mutations disclosed in Gao Y., et al, Cancer Discov. 2018 May; 8(5):648-661, incorporated herein by reference in its entirety.
  • the term "Class I MEKl mutation” includes, without limitation, the following amino acid substitutions in human MEKl : D67N; P124L; P124S; and L177V.
  • Class II MEKl mutation and “Class 2 MEKl mutation” are used herein to refer to a MEKl mutation that causes the MEKl kinase to have some level of basal, RAF- independent activity, but to be further activated by RAF.
  • Class II MEKl mutations include, but are not limited to any of the Class II MEKl mutations disclosed in Gao Y., et al, Cancer Discov. 2018 May; 8(5):648-661, incorporated herein by reference in its entirety.
  • Class II MEKl mutation includes, without limitation, the following amino acid substitutions in human MEKl : ⁇ 51-Q58; AF53- Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • combination therapy refers to a method of treatment comprising administering to a subject at least two therapeutic agents, optionally as one or more pharmaceutical compositions.
  • a combination therapy may comprise administration of a single pharmaceutical composition comprising at least two therapeutic agents and one or more pharmaceutically acceptable carrier, excipient, diluent, and/or surfactant.
  • a combination therapy may comprise administration of two or more pharmaceutical compositions, each composition comprising one or more therapeutic agent and one or more pharmaceutically acceptable carrier, excipient, diluent, and/or surfactant.
  • at least one of the therapeutic agents is a SHP2 inhibitor.
  • the two agents may optionally be administered simultaneously (as a single or as separate compositions) or sequentially (as separate compositions).
  • the therapeutic agents may be administered in an effective amount.
  • the therapeutic agent may be administered in a therapeutically effective amount.
  • the effective amount of one or more of the therapeutic agents may be lower when used in a combination therapy than the therapeutic amount of the same therapeutic agent when it is used as a monotherapy, e.g., due an additive or synergistic effect of combining the two or more therapeutics.
  • a certain subtype e.g., an F1 L0F or KRAS G12C subtype
  • determining may comprise analysis of a subject's medical or other record, which record indicates that the subject comprises a tumor comprising a cell with a KRAS G12C mutation. In some embodiments, "determining" may comprise analysis of a subject's medical or other record, which record indicates that the subject comprises a tumor comprising a cell with an F1 L0F mutation. In some embodiments, "determining" may comprise analysis of a subj ec s medical or other record, which record indicates that the subj ect comprises a tumor comprising a cell with a KRAS G12D , KRAS G12S , or a KRAS G12V mutation.
  • "determining" may comprise experimentally testing a sample (e.g., a tissue sample comprising one or more cell such as a tumor cell) from a subject having, or suspected of having, a disease or disorder (e.g., a tumor) that is treatable with a SHP2 inhibitor to determine whether the sample comprises an indicator that the cell might be sensitive to SHP2 inhibition.
  • a sample e.g., a tissue sample comprising one or more cell such as a tumor cell
  • a disease or disorder e.g., a tumor
  • the indicator that the cell might be sensitive to SHP2 inhibition comprises the presence of a Fl L0F mutation, a RAS mutation, an RAS mutation, an HRAS mutation, a KRAS mutation, a KRAS mutation with a substitution at amino acid 12, a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, a KRAS G12Y mutation, a Class III BRAF mutation, or a combination of two or more such mutations.
  • Suitable methods for experimentally determining the presence of such mutations are disclosed herein and known in the art (e.g., Domagala et al, Pol J Pathol 2012; 3 : 145-164, incorporated herein by reference in its entirety).
  • disorder is used in this disclosure to mean, and is used interchangeably with, the terms disease, condition, or illness, unless otherwise indicated.
  • an "effective amount" when used in connection with a compound is an amount effective for treating or preventing a disease or disorder in a subject as described herein.
  • inhibitor means a compound that prevents a biomolecule, (e.g., a protein, nucleic acid) from completing or initiating a reaction.
  • An inhibitor can inhibit a reaction by competitive, uncompetitive, or non-competitive means.
  • Exemplary inhibitors include, but are not limited to, nucleic acids, DNA, RNA, shRNA, siRNA, proteins, protein mimetics, peptides, peptidomimetics, antibodies, small molecules, chemicals, analogs that mimic the binding site of an enzyme, receptor, or other protein, e.g., that is involved in signal transduction, therapeutic agents, pharmaceutical compositions, drugs, and combinations of these.
  • the inhibitor can be nucleic acid molecules including, but not limited to, siRNA that reduce the amount of functional protein in a cell. Accordingly, compounds said to be "capable of inhibiting" a particular protein, e.g., SHP2, comprise any such inhibitor.
  • a monotherapy refers to a method of treatment comprising administering to a subject a single therapeutic agent, optionally as a pharmaceutical composition.
  • a monotherapy may comprise administration of a pharmaceutical composition comprising a therapeutic agent and one or more pharmaceutically acceptable carrier, excipient, diluent, and/or surfactant.
  • the therapeutic agent may be administered in an effective amount.
  • the therapeutic agent may be administered in a therapeutically effective amount.
  • mutation indicates any modification of a nucleic acid and/or polypeptide which results in an altered nucleic acid or polypeptide.
  • the term “mutation” may include, for example, point mutations, deletions or insertions of single or multiple residues in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences, as well as amplifications and/or chromosomal breaks or translocations.
  • NFl loss of function and "NF1 L0F” are used interchangeably herein to refer to any mutation that renders the NFl enzyme catalytically inactive or that results in little or no production of NFl transcript or protein. More than 2600 different mutations in NFl are known to be inherited, and more than 80% of all constitutional NFl mutations are inactivating (i.e., NF1 L0F mutations)(Philpott et al., Human Genomics (2017) 11 : 13, incorporated herein by reference in its entirety).
  • a "patient” or “subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or rhesus.
  • preventing refers to keeping a disease or disorder from afflicting the subject. Preventing includes prophylactic treatment. For instance, preventing can include administering to the subject a compound disclosed herein before a subject is afflicted with a disease and the administration will keep the subject from being afflicted with the disease.
  • a therapeutic agent e.g., a SFIP2 inhibitor
  • administering includes administering such an agent.
  • RAS pathway and "RAS/MAPK pathway” are used interchangeably herein to refer to a signal transduction cascade downstream of various cell surface growth factor receptors in which activation of RAS (and its various isoforms and alleotypes) is a central event that drives a variety of cellular effector events that determine the proliferation, activation, differentiation, mobilization, and other functional properties of the cell.
  • SHP2 conveys positive signals from growth factor receptors to the RAS activation/deactivation cycle, which is modulated by guanine nucleotide exchange factors (GEFs, such as SOSl) that load GTP onto RAS to produce functionally active GTP-bound RAS as well as GTP-accelerating proteins (GAPs, such as NF1) that facilitate termination of the signals by conversion of GTP to GDP.
  • GTP-bound RAS produced by this cycle conveys essential positive signals to a series of serine/threonine kinases including RAF and MAP kinases, from which emanate additional signals to various cellular effector functions.
  • RAS pathway mutation and "RAS/MAPK pathway activating mutation” are used interchangeably herein to refer to a mutation in a gene encoding a protein directly involved in the signaling processes of the RAS/MAPK signaling pathway and/or regulating (either positively or negatively) this signaling pathway that renders the pathway active, wherein such mutation may increase, change or decrease the activity level of said protein.
  • proteins include but are not limited to Ras, Raf, F1, SOS, and specific isoforms or alleotypes thereof
  • RTK-driven tumor refers to a tumor comprising a cell with one or more oncogenic mutation of an RTK, or a protein that is part of the RTK signaling complex, that causes high levels RTK signaling. Some such cells may be considered “addicted” to the RTK, and inhibition of RTK signaling leads to simultaneous suppression of downstream pathways, often resulting in cell growth, arrest, and death.
  • RTK-driven tumors include, but are not limited to, non-small cell lung cancers (NSCLCs) with mutations in EGFR or ALK.
  • NSCLCs non-small cell lung cancers
  • SFIP2 means "Src Homolgy-2 phosphatase” and is also known as SH- PTP2, SH-PTP3, Syp, PTP1D, PTP2C, SAP-2 or PTPNl l .
  • SHP2 inhibitor and “inhibitor of SHP2” are used interchangeably.
  • SOS refers to SOS genes, which are known in the art to include RAS guanine nucleotide exchange factor proteins that are activated by receptor tyrosine kinases to promote GTP loading of RAS and signaling.
  • SOS includes all SOS homologs that promotes the exchange of Ras-bound GDP by GTP.
  • SOS refers specifically to "son of sevenless homolog 1" (“SOSl").
  • an F 1 L0F subtype, a KRAS G12C subtype, a KRAS G12S subtype, a KRAS G12D subtype, a KRAS G12V subtype means that the cell contains a gene mutation encoding a change in the protein of the type indicated.
  • a cell classified as an " F1 L0F subtype” contains a mutation that results in NF1 loss of function;
  • a cell classified as a "KRAS G12C subtype” contains at least one KRAS allele that encodes an amino acid substitution of cysteine for glycine at position 12 (G12C);
  • other cells of a particular subtype e.g., KRAS G12D , KRAS G12S and KRAS G12V subtypes
  • contain at least one allele with the indicated mutation e.g., a KRAS G12D mutation, a KRAS G12S mutation or a KRAS G12V mutation, respectively).
  • amino acid position substitutions referenced herein correspond to substitutions in the human version of the referenced protein, i.e., KRAS G12C refers to a G- C substitution in position 12 of human KRAS.
  • a “therapeutic agent” is any substance, e.g., a compound or composition, capable of treating a disease or disorder.
  • therapeutic agents that are useful in connection with the present disclosure include without limitation SHP2 inhibitors, ALK inhibitors, MEK inhibitors, RTK inhibitors (TKIs), and cancer chemotherapeutics. Many such inhibitors are known in the art and are disclosed herein.
  • terapéuticaally effective amount is the amount of the drug, e.g., a SHP2 inhibitor, needed to elicit the desired biological response following administration.
  • treatment refers to improving at least one symptom, pathology or marker of the subject's disease or disorder, either directly or by enhancing the effect of another treatment. Treating includes curing, improving, or at least partially ameliorating the disorder, and may include even minimal changes or improvements in one or more measurable markers of the disease or condition being treated.
  • Treatment does not necessarily indicate complete eradication or cure of the disease or condition, or associated symptoms thereof.
  • the subject receiving this treatment is any subject in need thereof. Exemplary markers of clinical improvement will be apparent to persons skilled in the art. Overview
  • the present disclosure relates to, inter alia, compositions, methods, and kits for treating or preventing a disease or disorder ⁇ e.g., cancer) with a SHP2 inhibitor alone or in combination with another suitable therapeutic agent.
  • SHP2 is an important signaling effector molecule for a variety of receptor tyrosine kinases (RTKs), including the receptors of platelet-derived growth factor (PDGFR), fibroblast growth factor (FGFR), and epidermal growth factor (EGFR).
  • RTKs receptor tyrosine kinases
  • PDGFR platelet-derived growth factor
  • FGFR fibroblast growth factor
  • EGFR epidermal growth factor
  • SFIP2 is also an important signaling molecule that regulates the activation of the mitogen activated protein (MAP) kinase pathway which can lead to cell transformation, a prerequisite for the development of cancer.
  • MAP mitogen activated protein
  • SFIP2 is involved in signaling through the Ras-mitogen-activated protein kinase, the JAK-STAT and/or the phosphoinositol 3- kinase- AKT pathways.
  • SHP2 mediates activation of Erkl and Erk2 (Erkl/2, Erk) MAP kinases by receptor tyrosine kinases such as ErbBl, ErbB2 and c-Met by modulating RAS activation.
  • SHP2 has two N-terminal Src homology 2 domains (N-SH2 and C-SH2), a catalytic domain (PTP), and a C-terminal tail.
  • the two SH2 domains control the subcellular localization and functional regulation of SFIP2.
  • the molecule exists in an inactive conformation, inhibiting its own activity via a binding network involving residues from both the N-SH2 and PTP domains.
  • SFIP2 associates with the RTK signaling apparatus, and this induces a conformational change that results in SFIP2 activation.
  • Activating mutations of SFIP2 have been associated with developmental pathologies such as Noonan syndrome and Leopard Syndrome and may also be found in multiple cancer types, including most RTK-driven tumors, leukemia, lung and breast cancer, gastric carcinoma, anaplastic large-cell lymphoma, glioblastoma and neuroblastoma. 1
  • SHP2 plays a role in transducing signals originating from immune checkpoint molecules, including but not limited to programmed cell death protein 1 (PD-1) and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). In this context, inhibition of SHP2
  • the present disclosure relates to the unexpected discovery that, contrary to the teachings of the prior art, certain subsets of cells carrying certain oncogenic Ras pathway mutations (e.g., KRAS G12C mutations) are sensitive to SHP2 inhibition and may be effectively treated with SHTP2 inhibitors (see, e.g., Example 1).
  • certain oncogenic Ras pathway mutations e.g., KRAS G12C mutations
  • SHTP2 inhibitors see, e.g., Example 1
  • the present disclosure demonstrates that certain subsets of cancer cells carrying particular KRAS mutations (e.g., KRAS G12C mutations) or NF1 L0F mutations are sensitive to SHP2 inhibition and that SHP2 inhibition is an effective means for preventing and delaying the emergence of tumor resistance to various therapeutic agents including cancer therapies (e.g., MAPK inhibitors) and an effective means for re-sensitizing a tumor that is resistant to a cancer therapy (e.g., a MAPK inhibitor) to that inhibitor, particularly in the context of Ras pathway mutations.
  • cancer therapies e.g., MAPK inhibitors
  • an effective means for re-sensitizing a tumor that is resistant to a cancer therapy e.g., a MAPK inhibitor
  • cancer cells carrying particular BRAF mutations e.g., Class 3 BRAF mutations
  • MEK mutations e.g., Class 1 MEKl mutations
  • SHP2 inhibition is an effective means for preventing and delaying the emergence of tumor resistance to various therapeutic agents including cancer therapies (e.g., MAPK inhibitors, MEK inhibitors, Erk inhibitors, etc.) and an effective means for re-sensitizing a tumor that is resistant to a cancer therapy (e.g., a MAPK inhibitor) to that inhibitor, particularly in the context of Ras pathway mutations.
  • cancer therapies e.g., MAPK inhibitors, MEK inhibitors, Erk inhibitors, etc.
  • an effective means for re-sensitizing a tumor that is resistant to a cancer therapy e.g., a MAPK inhibitor
  • KRAS G12C is not a constitutively and fully active protein but rather the nucleotide state of KRAS G12C is in a state of dynamic flux that can be modulated by upstream signaling factors (Patricelli et al., Cancer Discov. 2016 Mar;6(3):316-29, incorporated herein by reference in its entirety).
  • GAP GTPase activating protein
  • F1 L0F GTPase activating protein
  • compositions, methods, and kits for the identification, assessment and/or treatment of a disease or condition (e.g., a cancer or tumor such as, for example an oncogene-associated cancer or tumor) responsive to a treatment that includes a SHP2 inhibitor alone or in combination with another cancer therapeutic agent (e.g., an inhibitor of a MAP kinase pathway).
  • a disease or condition e.g., a cancer or tumor such as, for example an oncogene-associated cancer or tumor
  • a treatment that includes a SHP2 inhibitor alone or in combination with another cancer therapeutic agent e.g., an inhibitor of a MAP kinase pathway.
  • the present disclosure provides a method for patient stratification based upon the presence or absence of a RAS pathway mutation or based upon the particular subtype of such a mutation.
  • patient stratification means classifying one or more patient as having a disease or disorder (e.g., cancer) that is either likely or unlikely to be treatable with a SHP2 inhibitor.
  • patient stratification may comprise classifying a patient as having a tumor that is sensitive to treatment with a SHP2 inhibitor.
  • the patient stratification may be based on the presence or absence of a tumor comprising one or more cell containing a RAS pathway mutation that renders the mutated protein dependent on signaling flux through SHP2.
  • the term "at least partially dependent on signaling flux through SHP2" when used in relation to a mutation refers to a mutation that renders the function of the mutated protein susceptible to modulation by SHP2 and the effects of inhibitors thereof.
  • the RAS pathway mutation may occur in one or more protein selected from KRAS, RAS, HRAS, ARAF, BRAF, CRAF, SOS, MEK (e.g., MEK1), and NF1.
  • the RAS pathway mutation may occur in one or more protein selected from KRAS, NRAS, HRAS, BRAF, SOS, and NF1.
  • the mutation in KRAS, NRAS, HRAS, BRAF, SOS, MEK (e.g., MEK1) or NF l renders the mutated protein sensitive to upstream signaling inputs to maintain a highly active state.
  • the upstream signaling inputs may require SHP2.
  • the term "sensitive to upstream signaling inputs to maintain a highly active state” means that maintenance of the active state of a protein (e.g., GTP-RAS) requires upstream signaling inputs (e.g., signaling via SHP2), and modulation of these inputs (e.g., by SHP2 inhibition) results in a change of the active state of the protein (e.g., as shown herein, inhibition of SHP2 results in decreased RAS-GTP levels (FIGS 4-5); thus RAS is sensitive to upstream signaling inputs to maintain a highly active state.).
  • GTP-RAS protein
  • SHP2 inhibition results in a change of the active state of the protein
  • Such mutations may include, without limitation one or more of the following mutations: KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS G12S ; KRAS G12V ; an F1 L0F mutation; an NF1 L0F mutation; a Class 3 BRAF mutation; a Class 1 MEKl mutation; a Class 2 MEKl mutation, and mutations in SOS.
  • Such mutations may include, without limitation one or more of the following mutations: KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS G12S ; KRAS G12V ; an F1 L0F mutation; an F1 L0F mutation; a Class 3 BRAF mutation; and mutations in SOS.
  • the present invention provides a method for subject stratification comprising (a) determining whether a cell from the subject comprises a RAS pathway mutation selected from the group consisting of KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS Gi2S. KRAS Gi2v. an ⁇ p i LOF mutation; a Class 3 BRAF mutation; a Class 1 MEK 1 mutation; a Class 2 MEKl mutation; and a SOS mutation/amplification; (b) administering to the subject SHP2 inhibitor; (c) optionally, administering to the subject an additional therapeutic agent (e.g., an anti-cancer therapeutic agent).
  • a RAS pathway mutation selected from the group consisting of KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS Gi2S. KRAS Gi2v. an ⁇ p i LOF mutation; a Class 3 BRAF mutation; a Class 1 MEK 1 mutation; a Class 2 MEKl
  • the present invention provides a method for subject stratification comprising (a) determining whether a cell from the subject comprises a RAS pathway mutation selected from the group consisting of KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS Gi2S. KRAS Gi2v. an ⁇ p i LOF mutation; a Class 3 BRAF mutation; and a SOS mutation/amplification; (b) administering to the subject SHP2 inhibitor; (c) optionally, administering to the subject an additional therapeutic agent (e.g., an anti-cancer therapeutic agent).
  • a RAS pathway mutation selected from the group consisting of KRAS G12A ; KRAS G12C ; KRAS G12D ; KRAS Gi2S. KRAS Gi2v. an ⁇ p i LOF mutation; a Class 3 BRAF mutation; and a SOS mutation/amplification
  • administering to the subject SHP2 inhibitor comprising administering to the subject SHP2 inhibitor; (c
  • any disease or condition associated with a RAS pathway mutation may be identified, assessed, and/or treated according to the present disclosure.
  • the RAS pathway mutation renders the mutated protein dependent on signaling flux through SHP2.
  • diseases or conditions comprising RAS pathway mutations are known in the art.
  • the present disclosure provides methods for treating a disease or condition selected from, but not limited to, Noonan Syndrome (e.g., Noonan syndrome caused by a mechanism other than a SHP2 mutation), Leopard Syndrome (e.g., Leopard Syndrome caused by a mechanism other than a SHP2 mutation); tumors of hemopoietic and lymphoid system including myeloproliferative syndromes, myelodysplastic syndromes, and leukemia, e.g., acute myeloid leukemia, and juvenile myelomonocytic leukemias; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer, neuroblastoma, bladder cancer, prostate cancer; glioblastoma; urothelial carcinoma, uterine carcinoma, adenoid and ovarian sereous cystadenocarcinoma, paraganglioma, phaeochromocytoma, pancreatic cancer, adrenocortical carcinoma,
  • Noonan Syndrome
  • the methods for treating such diseases or disorders involve administering to a subject an effective amount of a SHP2 inhibitor or a composition (e.g., a pharmaceutical composition) comprising a SHP2 inhibitor.
  • a SHP2 inhibitor or a composition comprising a SHP2 inhibitor.
  • Any compound or substance capable of inhibiting SHP2 may be utilized in application with the present disclosure to inhibit SHP2.
  • Non-limiting examples of such SHP2 inhibitors are known in the art and are disclosed herein.
  • the compositions and methods described herein may utilize one or more SHP2 inhibitor selected from, but not limited to, any SHP2 inhibitor disclosed in Chen, Ying- Nan P et al, 148 Nature Vol 535 7 July 2016, incorporated herein by reference in its entirety, including SHP099, disclosed therein.
  • compositions and methods described herein may utilize one or more SHP2 inhibitor selected from, but not limited to any SHP2 inhibitor disclosed in PCT application PCT/US2017/041577 (WO2018013597), which is incorporated herein by reference in its entirety.
  • the compositions and methods described herein may utilize one or more SHP2 inhibitor selected from, but not limited to any SHP2 inhibitor disclosed in PCT applications PCT/IB2015/050343 (WO2015107493); PCT/IB2015/050344 (WO2015107494); PCT/IB2015/050345 (WO201507495); PCT/IB2016/053548 (WO2016/203404); PCT/IB2016/053549 (WO2016203405); PCT/IB2016/053550 (WO2016203406); PCT/US2010/045817 (WO2011022440); PCT/US2017/021784 (WO2017156397); and PCT/US2016/060787 (WO2017079723); and PCT/CN2017/08
  • compositions and methods described herein may utilize one or more SHP2 inhibitor selected from, but not limited to any SHP2 inhibitor disclosed in Chen L, et al, Mol Pharmacol. 2006 Aug; 70(2): 562-70, incorporated herein by reference in its entirety, including NSC-87877 disclosed therein.
  • the compositions and methods described herein may utilize TN0155, described under ClinicalTrials.gov Identifier: NCT03114319, available at world wide web address: clinicaltrials.gov/ct2/show/NCT03114319, incorporated herein by reference in its entirety.
  • compositions and methods described herein may utilize one or more SHP2 inhibitor selected from, but not limited to Compound A, disclosed herein; Compound B, disclosed herein; Compound C, disclosed herein; a SHP2 inhibitor compound of Formula I, Formula II, Formula III, Formula I- VI, Formula I-V2, Formula I-W, Formula I-X, Formula I- Y, Formula I-Z, Formula IV, Formula V, Formula VI, Formula IV-X, Formula IV- Y, Formula IV-Z, Formula VII, Formula VIII, Formula IX, and Formula X, disclosed herein; a compound from Table 1, disclosed herein; and a compound from Table 2, disclosed herein.
  • SHP2 inhibitor selected from, but not limited to Compound A, disclosed herein; Compound B, disclosed herein; Compound C, disclosed herein; a SHP2 inhibitor compound of Formula I, Formula II, Formula III, Formula I- VI, Formula I-V2, Formula I-W, Formula I-X, Formula I- Y, Formula I-Z, Formula IV, Formula V, Formula VI,
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 1 is -S- or a direct bond
  • Y 2 is -NR a - -(CR a 2)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-,-N(R a )C(S)N(R a )-, - C(0)0-
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alky
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C 4 -Cscycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 ,
  • R a is independently, at each occurrence, -H, -D, -OH, -C3-C 8 cycloalkyl, or -Ci- C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 - C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5
  • R 3 is independently -Ci-C 6 alkyl or a 3- to 12-membered monocyclic or polycyclic heterocycle, wherein each alkyl or heterocycle is optionally substituted with one or more -Ci- Cealkyl, -OH, or -NH 2 ; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, or -NH 2 ;
  • R 4 is independently -H, -D, or-Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, -NH 2 , halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C3-Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or poly cyclic 3- to 12- membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or poly cyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is -NR a - -(CR a 2)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, - C(0)0- -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0- -N(R a )C(S)-, -
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 -Cscycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -
  • R a is independently, at each occurrence, -H, -D, -OH, -C3-C 8 cycloalkyl, or -Ci- C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , - S(0) 2 NR 5 R 6 ,
  • R 3 is independently -Ci-C 6 alkyl or a 3- to 12-membered monocyclic or polycyclic heterocycle, wherein each alkyl or heterocycle is optionally substituted with one or more -Ci- Cealkyl, -OH, or -NH 2 ; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, or -NH 2 ;
  • R 4 is independently -H, -D, or-Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, -NH 2 , halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C3-Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or poly cyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or poly cyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is -NR a - -(CR a 2)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, - C(0)0- -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0- -N(R a )C(S)-, -
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 -Cscycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -
  • R a is independently, at each occurrence, -H, -D, -OH, -C3-C 8 cycloalkyl, or -Ci- C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , - S(0) 2 NR 5 R 6 ,
  • R 3 is independently -Ci-C 6 alkyl or a 3- to 12-membered monocyclic or polycyclic heterocycle, wherein each alkyl or heterocycle is optionally substituted with one or more -Ci- Cealkyl, -OH, or -NH 2 ; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, or -NH 2 ;
  • R 4 is independently -H, -D, or-Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, -NH 2 , halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C3-Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or poly cyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or poly cyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are 5- to 12-membered monocyclic or 5- to 12-membered polycyclic;
  • Y 2 is -NR a -, wherein the bond on the left side of Y 2 , as drawn, is bound to the pyrazine ring and the bond on the right side of the Y 2 moiety, as drawn, is bound to R 3 ;
  • R a and R 4 together with the atom or atoms to which they are attached, are combined to form a monocyclic or polycyclic C3-Ci2cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0)2- in the heterocycle;
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, -OR 6 , halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -C(0)R 5 ,-C0 2 R 5 , -C(0) R 5 R 6 , - R 5 C(0)R 6 , monocyclic or polycyclic heterocyclyl,
  • R 2 is independently - H 2 , -OR b , -CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl,
  • each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)NR 5 R 6 , -S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6
  • R b is independently, at each occurrence, -H, -D, -OH, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, -(CH 2 ) n -aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, heterocycle, heteroaryl, or -(CH 2 )n-aryl is optionally substituted with one or more -OH, halogen, -N0 2 , oxo, -CN,
  • R 3 is independently -H, -Ci-C 6 alkyl, a 3- to 12-membered monocyclic or polycyclic heterocycle, a 5- to 12-membered spiroheterocycle, C3-C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, spiroheterocycle, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, -NH 2 , -OR b , -NHR b , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, -NR 7 R 8 , -N0 2 , -CF3, or - CN; R and R are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, -OR b , or a monocyclic or poly cyclic 3- to 12-membered hetero
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • I-V2 and pharmaceutically acceptable salts, prodrugs, solvates, hydrates, tautomers, and isomers thereof, wherein:
  • A is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are 5- to 12-membered monocyclic or 5- to 12-membered polycyclic;
  • Y 2 is - R a - wherein the bond on the left side of Y 2 , as drawn, is bound to the pyrazine ring and the bond on the right side of the Y 2 moiety, as drawn, is bound to R 3 ;
  • R 3 is combined with R a to form a 3- to 12-membered polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-Cealkyl, halogen, -OH, -OR b , - H2, - HR b , heteroaryl, heterocyclyl,
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, -OR 6 , halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -NR 5 S(0)R 6 , -NR 5 S(0)R 6 , -C(0)R 5 ,-C0 2 R 5 , -
  • R 2 is independently - H 2 , -OR b , -CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl,
  • each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)NR 5 R 6 , -S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6
  • R b is independently, at each occurrence, -H, -D, -OH, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, -(CH 2 ) n -aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, heterocycle, heteroaryl, or -(CH 2 )n-aryl is optionally substituted with one or more -OH, halogen, -N0 2 , oxo, -CN,
  • R 4 is independently -H, -D, -Ci-C 6 alkyl, -Ci-C 6 haloalkyl, -Ci-C 6 hydroxyalkyl, -CF 2 OH, -CHFOH, -NH-NHR 5 , -NH-OR 5 , -0-NR 5 R 6 , -NHR 5 , -OR 5 , -NHC(0)R 5 , -NHC(0)NHR 5 , -NHS(0) 2 R 5 , -NHS(0) 2 NHR 5 , -S(0) 2 OH, -C(0)OR 5 , -NH(CH 2 ) n OH, -C(0)NH(CH 2 )nOH, -C(0)NH(CH 2 ) n R b , -C(0)R b , -NH 2 , -OH, -CN, -C(0)NR 5 R 6 , -S(0) 2 NR 5 R 6 , C3-C 8 cyclo
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or poly cyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, -CF3, or - CN;
  • R and R are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, -OR b , or a monocyclic or poly cyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2,
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, wherein cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are 5- to 12-membered monocyclic or 5- to 12-membered polycyclic;
  • Y 2 is -NR a - -(CR3 ⁇ 4)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, - C(0)0- -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0- -N(R a )C(S)-, -
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, -OR 6 , halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -NR 5 S(0)R 6 , -NR 5 S(0)R 6 , -C(0)R 5 ,-C0 2 R 5 , -
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, halogen, -C(0)OR b , -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5
  • R a is independently, at each occurrence, -H, -D, -OH, -C3-C 8 cycloalkyl, -Ci-C 6 alkyl, 3- to 12-membered heterocyclyl, or-(CH 2 ) n -aryl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , or wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -OH, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, -(CH 2 ) n -aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, heterocycle, heteroaryl, or -(CH 2 )n-aryl is optionally substituted with one or more -OH, halogen, -N0 2 , oxo, -CN,
  • R 3 is independently -H, -Ci-C 6 alkyl, a 3- to 12-membered monocyclic or polycyclic heterocycle, a 5- to 12-membered spiroheterocycle, C3-C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, spiroheterocycle, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, -NH 2 , -OR b , -NHR b , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 4 is independently -H, -D, -Ci-C6alkyl, -Ci-C 6 haloalkyl, -Ci-C 6 hydroxyalkyl -CF 2 OH, -CHFOH - H- HR 5 , -NH-OR 5 , -0- R 5 R 6 , - HR 5 , -OR 5 , - HC(0)R 5 , - HC(0)NHR 5 , - HS(0) 2 R 5 , - HS(0) 2 HR 5 , -S(0) 2 OH, -C(0)OR 5 , - H(CH 2 ) n OH, -C(0) H(CH 2 )nOH, -C(0) H(CH 2 ) n R b , -C(0)R b , - H 2 , -OH, -CN, -C(0) R 5 R 6 , -S(0) 2 R 5 R 6 , C 3 -C 8 cycloalkyl,
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C 3 -Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, a monocyclic or polycyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -N0 2 , -CF 3 , or - CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OR b , or a monocyclic or polycyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH 2 ,
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 1 is -S- or a direct bond
  • Y 2 is -NR a -, -(CR a 2)m- -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, - C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0-, -N(R a )C(S)-, - C(S)N(R a )-, or -OC(0)0-; wherein the bond on the left side of Y 2
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , - R 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6
  • R a is independently, at each occurrence, -H, -D, -OH, -C 3 -C 8 cycloalkyl, or -C i- C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 3 -C 8 cycloalkyl, -C 2 - C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0)R 5 R 6 , -S(0)R 5 , - R 5 S(0)R 6
  • R 3 is independently -H, -Ci-C 6 alkyl, or a 3- to 12-membered monocyclic or polycyclic heterocycle, wherein each alkyl or heterocycle is optionally substituted with one or more -Ci- Cealkyl, -OH, or - H 2 ; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, or - H 2 ;
  • R 4 is independently -H, -D, -Ci-Cealkyl, - H- HR 5 , - H-OR 5 , -0- R 5 R 6 , -NHR 5 , -OR 5 , - HC(0)R 5 , - HC(0) HR 5 , - HS(0) 2 R 5 , - HS(0) 2 HR 5 , -S(0) 2 OH, -C(0)OR 5 , -C(0) R 5 R 6 , -S(0) 2 R 5 R 6 , Cs-Cscycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, wherein each alkyl, cycloalkyl, or heterocyclyl is optionally substituted with one or more -OH, -NH 2 , halogen, or oxo; where
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C3-Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;_wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -N0 2 , or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or polycyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH 2 , -N0 2 , or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • One aspect of the disclosure relates to compounds of Formula I-Y: and pharmaceutically acceptable salts, prodrugs, solvates, hydrates, tautomers, or isomers thereof, wherein:
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 1 is -S- or a direct bond
  • Y 2 is -NR a -, -(CR a 2)m- -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, - C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0-, -N(R a )C(S)-, -, -
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , - R 5 S(0)R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optional
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 3 -C 8 cycloalkyl, -C2-C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , - R 5 R 6 , -SR 5 , - S(0) 2 R 5 R 6 ,
  • R 3 is independently -H, -C i-C 6 alkyl, a 3- to 12-membered monocyclic or polycyclic heterocycle, C 3 -C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -C i-Cealkyl, -OH, - H 2 , -OR b , - HR b , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, - H 2 , heteroaryl, heterocyclyl, -(CH 2 ) n H 2 , -COOR b , -CO HR b , -CO H(CH 2 ) n COOR b , - HCOOR b , -CF 3 , -CHF 2 , or -CH 2 F;
  • R 4 is independently -H, -D, -Ci-Cealkyl, - H- HR 5 , - H-OR 5 , -0- R 5 R 6 , -NHR 5 , -OR 5 , - HC(0)R 5 , - HC(0) HR 5 , - HS(0) 2 R 5 , - HS(0) 2 HR 5 , -S(0) 2 OH, -C(0)OR 5 , - H(CH 2 )nOH, -C(0) H(CH 2 )nOH, -C(0) H(CH 2 ) n R b , -C(0)R b , - H 2 , -OH, -CN, -C(0)NR 5 R 6 , -S(0) 2 NR 5 R 6 , C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O, or heteroaryl containing 1-5 hetero
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C 3 -Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or poly cyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or poly cyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is a 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is -NR a - -(CR a 2)m- -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0-, -N(R a )C(S)-, or -C(S)N(R a )-; wherein the bond on the left side of Y 2 , as drawn, is bound to the pyrazine ring and the bond on the right side of the Y 2 moiety, as
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or
  • R 2 is independently -OR b , - H2, -CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl,
  • R a is independently, at each occurrence -OH, -C3-C 8 cycloalkyl, or -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C3-C 8 cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, and O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , - S(0) 2 NR 5 R 6 ,
  • R 3 is independently -H, -Ci-C 6 alkyl, a 3- to 12-membered monocyclic or polycyclic heterocycle, C 3 -C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, -NH 2 , -OR b , -NHR b , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3- to 12-membered monocyclic or polycyclic heterocycle or a 5- to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with one or more -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n NH 2 , -COOR b , -CONHR b , -CONH(CH 2 ) n COOR b , - NHCOOR b , -CF 3 , -CHF 2 , or -CH 2 F;
  • R 4 is independently -Ci-Cealkyl, - H- HR 5 , - H-OR 5 , -0- R 5 R 6 , - HR 5 , -OR 5 , - HC(0)R 5 , - HC(0) HR 5 , - HS(0) 2 R
  • R a and R 4 together with the atom or atoms to which they are attached, are combined to form a monocyclic or polycyclic C3-Ci 2 cycloalkyl or a monocyclic or polycyclic 3- to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3- to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -N0 2 , or -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, or a monocyclic or polycyclic 3- to 12-membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H 2 , -N0 2 , or -CN;
  • n is independently, at each occurrence, 1, 2, 3, 4, 5 or 6;
  • n is independently, at each occurrence, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • One aspect of the invention relates to compounds of Formula IV:
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 1 is -S- or a direct bond
  • Y 2 is selected from the group consisting of: -NR a -, -(CR a 2 )m- -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R a )0-, -N(R a )C(S)-, -C(S)N(R a
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl, -C 2 -C 6 alkynyl, -Cs-Cscycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 ,
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , - NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 can combine with R a to form a 3 -to 12-membered monocyclic or poly cyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, or - H2;
  • R 4 is independently, at each occurrence, -H, -D, or -Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, - H2, halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or poly cyclic C3-Ci2cycloalkyl, or a monocyclic or poly cyclic 3 -to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3- C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and
  • n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is selected from the group consisting of: -NR a -, -(CR a 2 )m- -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl, -C 2 -C 6 alkynyl, -Cs-Cscycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted with
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 ,
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , - NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 can combine with R a to form a 3 -to 12-membered monocyclic or poly cyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, or - H2;
  • R 4 is independently, at each occurrence, -H, -D, or -Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, - H2, halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or poly cyclic C3-Ci2cycloalkyl, or a monocyclic or poly cyclic 3 -to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3- C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and
  • n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is selected from the group consisting of: -NR a -, -(CR a 2 )m- -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0- -C(0)N(R
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl, -C 2 -C 6 alkynyl, -Cs-Cscycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted with
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 ,
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , - NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 can combine with R a to form a 3 -to 12-membered monocyclic or poly cyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, or - H2;
  • R 4 is independently, at each occurrence, -H, -D, or -Ci-C 6 alkyl, wherein each alkyl is optionally substituted with one or more -OH, - H2, halogen, or oxo; or
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or poly cyclic C3-Ci2cycloalkyl, or a monocyclic or poly cyclic 3 -to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3- C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and
  • n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • One aspect of the invention relates to compounds of Formula IV- Y:
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 1 is -S- or a direct bond
  • Y 2 is selected from the group consisting of: -NR a -, -(CR3 ⁇ 4)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0-, -N(R a )C(S)-, -C(S)N(R a )-, and -OC(0)0-; wherein the bond on
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C 4 - Cscycloalkenyl, -C 2 -C 6 alkynyl, -Cs-Cscycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted with one
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 ,
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0)
  • R 3 is independently, at each occurrence, selected from the group consisting of -H, -Ci-C6alkyl, a 3 -to 12-membered monocyclic or poly cyclic heterocycle, C 3 -C8cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, - H 2 , -OR a , - HR a , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3 -to 12-membered monocyclic or poly cyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n H 2 , -COOR a , -CO HR b , -CO H(CH 2 )nCOOR a , - HCOOR 3 , -CF 3 , CHF 2 , or CH 2 F;
  • R 4 is independently, at each occurrence, -H, -D, -Ci-Cealkyl, - H- HR 5 , - H-OR 5 , -0- R 5 R 6 , - HR 5 , -OR 5 , - HC(0)R 5 , -NHC(0) HR 5 , - HS(0) 2 R 5 , - HS(0) 2 HR 5 , - S(0) 2 OH, -C(0)OR 5 , - H(CH 2 )nOH, -C(0) H(CH 2 ) n OH, -C(0) H(CH 2 ) n R b , -C(0)R b , H 2 , -OH, -CN, -C(0) R 5 R 6 , -S(0) 2 R 5 R 6 , C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, heteroaryl containing
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or poly cyclic C 3 -Ci 2 cycloalkyl, or a monocyclic or poly cyclic 3 -to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 - C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH 2 , -N0 2 , or -CN; m is independently 1, 2, 3, 4, 5 or 6; and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • One aspect of the invention relates to compounds of Formula IV-Z:
  • IV-Z or a pharmaceutically acceptable salt, prodrug, solvate, hydrate, tautomer, or isomer thereof, wherein:
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • Y 2 is selected from the group consisting of: -NR a -, -(CR3 ⁇ 4)m-, -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0- -N(R a )C(S)-, -C(S)N(R a )-, and -OC(0)0-; wherein the bond on
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , - R 5 S(0)R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optional
  • R 2 is independently -OR b , -CN, -Ci-Cealkyl, -C 2 -Cealkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -NH 2 , halogen, -C(0)OR a , -C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C8cycloalkyl, and -Ci-C6alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more - H 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0)R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5
  • R 3 is independently, at each occurrence, selected from the group consisting of -H, -Ci-C 6 alkyl, a 3-to 12-membered monocyclic or polycyclic heterocycle, C 3 -C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, - H 2 , -OR a , - HR a , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3-to 12-membered monocyclic or polycyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n H 2 , -COOR a , -CO HR b , -CO H(CH 2 )nCOOR a , - HCOOR 3 , -CF 3 , CHF 2 , or CH 2 F;
  • R 4 is independently, at each occurrence, -H, -D, -Ci-Cealkyl, - H- HR 5 , - H-OR 5 , -0- R 5 R 6 , - HR 5 , -OR 5 , - HC(0)R 5 , -NHC(0) HR 5 , - HS(0) 2 R 5 , - HS(0) 2 HR 5 , - S(0) 2 OH, -C(0)OR 5 , - H(CH 2 )nOH, -C(0) H(CH 2 ) n OH, -C(0) H(CH 2 ) n R b , -C(0)R b , H 2 , -OH, -CN, -C(0)NR 5 R 6 , -S(0) 2 NR 5 R 6 , C 3 -C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, heteroaryl
  • R a and R 4 together with the atom or atoms to which they are attached, can combine to form a monocyclic or polycyclic C 3 -Ci 2 cycloalkyl, or a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein the cycloalkyl or heterocycle is optionally substituted with oxo; wherein the heterocycle optionally comprises -S(0) 2 - in the heterocycle;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 - C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and
  • n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or
  • X 1 is N or C;
  • X 2 is N or CH;
  • B including the atoms at the points of attachment, is a monocyclic or polycyclic 5-to 12-membered heterocycle or a monocyclic or polycyclic 5-to 12-membered heteroaryl;
  • R 2 is independently H, -OR b , - R 5 R 6 ,-CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -NH 2 , halogen, -C(0)OR a , -C 3 -C 8 cycloalkyl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, or heteroaryl is optionally substituted with one or more -OH, halogen, -N0 2 , oxo, -CN, -R 5 , -OR 5 ,
  • Y 2 is selected from the group consisting of: -NR a - -(CR3 ⁇ 4)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 - -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0-, -N(R a )C(S)-, -C(S)N(R a )-, and -OC(0)0-; wherein the bond on the left
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C 3 -C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more -NH 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 is independently, at each occurrence, selected from the group consisting of -H, -Ci-C6alkyl, a 3-to 12-membered monocyclic or polycyclic heterocycle, C3-C8cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, -NH 2 , -OR a , -NHR a , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3-to 12-membered monocyclic or polycyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n NH 2 , -COOR a , -CONHR b , -CONH(CH 2 )nCOOR a , -NHCOOR 3 , -CF 3 , CHF 2 , or CH 2 F;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 - C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, -NR 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -Ci-Cealkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , - R 5 S(0)R 6 , -C(0)R 5 , or -C0 2 R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted
  • X 1 is N or C;
  • X 2 is N or CH;
  • B including the atoms at the points of attachment, is a monocyclic or polycyclic 5-to 12-membered heterocycle or a monocyclic or polycyclic 5-to 12-membered heteroaryl;
  • R 2 is independently H, -OR b , -NR 5 R 6 ,-CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -NH 2 , halogen, -C(0)OR a , -C 3 -C 8 cycloalkyl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, or heteroaryl is optionally substituted with one or more -OH, halogen, -N0 2 , oxo, -CN, -R 5 , -OR 5 ,
  • Y 2 is selected from the group consisting of: -NR a - -(CR3 ⁇ 4)m- -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO- -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0- -N(R a )C(S)-, -C(S)N(R a )-, and -OC(0)0-; wherein the bond on the left
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C3-C8cycloalkyl, and -Ci-C6alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more - H 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C2-C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0) R 5 R 6 , -S(0)R 5 , - R 5 S(0)R 6 , - R 5 S(0)R 6 , -S(0)R 5 , - R 5 S(0)R 6 , hetero
  • R 3 is independently, at each occurrence, selected from the group consisting of -H, -Ci-C 6 alkyl, a 3-to 12-membered monocyclic or polycyclic heterocycle, C 3 -C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, - H 2 , -OR a , - HR a , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3-to 12-membered monocyclic or polycyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n H 2 , -COOR a , -CO HR b , -CO H(CH 2 )nCOOR a , - HCOOR 3 , -CF 3 , CHF 2 , or CH 2 F;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 - C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -C 6 alkynyl, -C 3 -C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH 2 , -N0 2 , or -CN; m is independently 1, 2, 3, 4, 5 or 6; and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -Ci-Cealkynyl, -Cs-Csc cloalkyl, -OH, halogen, -NO2, -CN, - R 5 R 6 , -SR 5 , -S(0) 2 R 5 R 6 , -S(0) 2 R 5 , - R 5 S(0) 2 R 5 R 6 , - R 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , - R 5 S(0) R 5 R 6 , - R 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or cycloalkyl is optionally substituted with one
  • X 1 is N or C
  • X 2 is N or CH
  • B including the atoms at the points of attachment, is a monocyclic or polycyclic 5-to 12-membered heterocycle or a monocyclic or polycyclic 5-to 12-membered heteroaryl;
  • R 2 is independently H, -OR b , -NR 5 R 6 ,-CN, -Ci-Cealkyl, -C 2 -C 6 alkenyl, -C4-C 8 cycloalkenyl, -C 2 -Cealkynyl, -NH 2 , halogen, -C(0)OR a , -C3-C 8 cycloalkyl, aryl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5
  • Y 2 is selected from the group consisting of: - R a - -(CR3 ⁇ 4)m-, -C(O)-, -C(R a ) 2 NH- -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-, -N(R a )C(S)N(R a )-, -C(0)0-, -OC(O)-, -OC(0)N(R a )-, -N(R a )C(0)0-, -C(0)N(R a )0-, -N(R a )C(S)-, -C(S)N(R a )-, and -OC(0)0-; wherein the bond
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C 3 -C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more - H 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 is independently, at each occurrence, selected from the group consisting of -H, -Ci-C 6 alkyl, a 3-to 12-membered monocyclic or polycyclic heterocycle, C3-C 8 cycloalkyl, or -(CH 2 ) n -R b , wherein each alkyl, heterocycle, or cycloalkyl is optionally substituted with one or more -Ci-Cealkyl, -OH, -NH 2 , -OR a , -NHR a , -(CH 2 ) n OH, heterocyclyl, or spiroheterocyclyl; or
  • R 3 can combine with R a to form a 3-to 12-membered monocyclic or polycyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -Ci-C 6 alkyl, -OH, -NH 2 , heteroaryl, heterocyclyl, -(CH 2 ) n NH 2 , -COOR a , -CONHR b , -CONH(CH 2 )nCOOR a , -NHCOOR 3 , -CF 3 , CHF 2 , or CH 2 F;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C6alkyl, -C2-C 6 alkenyl, -C4-C8cycloalkenyl, -C2-C 6 alkynyl, -C 3 - Cscycl
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C3-C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, -NH2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • Another aspect of the invention relates to compounds of Formula X:
  • A is selected from the group consisting of 5- to 12-membered monocyclic or polycyclic cycloalkyl, heterocycloalkyl, aryl, or heteroaryl;
  • R 1 is independently, at each occurrence, -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C 4 -C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, -OH, halogen, -NO2, -CN, -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0)R 6 , -C(0)R 5 , or -CO2R 5 , wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, or
  • X 2 is N or CH
  • B including the atoms at the points of attachment, is a monocyclic or polycyclic 5-to 12-membered heterocycle or a monocyclic or polycyclic 5-to 12-membered heteroaryl;
  • R 2 is independently H, -OR b , - R 5 R 6 ,-CN, -Ci-Cealkyl, -Ci-Cealkenyl, -C 4 -C 8 cycloalkenyl, -Ci-Cealkynyl, -NH 2 , halogen, -C(0)OR a , -C 3 -C 8 cycloalkyl, heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O, or heteroaryl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, heterocyclyl, or heteroaryl is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , - R 5 R 6
  • Y 2 is selected from the group consisting of: - R a - -(CR3 ⁇ 4)m-, -C(O)-, -C(R a ) 2 H-, -(CR a 2 )mO-, -C(0)N(R a )-, -N(R a )C(0)-, -S(0) 2 N(R a )-, -N(R a )S(0) 2 -, -N(R a )C(0)N(R a )-
  • R a is independently, at each occurrence, selected from the group consisting of -H, -D, -OH, -C 3 -C 8 cycloalkyl, and -Ci-C 6 alkyl, wherein each alkyl or cycloalkyl is optionally substituted with one or more - H 2 , wherein 2 R a , together with the carbon atom to which they are both attached, can combine to form a 3- to 8-membered cycloalkyl;
  • R b is independently -H, -D,-Ci-C 6 alkyl, -Ci-C6cycloalkyl, -C 2 -C 6 alkenyl, or heterocyclyl containing 1-5 heteroatoms selected from the group consisting of N, S, P, or O; wherein each alkyl, cycloalkyl, alkenyl, or heterocycle is optionally substituted with one or more -OH, halogen, -NO2, oxo, -CN, -R 5 , -OR 5 , -NR 5 R 6 , -SR 5 , -S(0) 2 NR 5 R 6 , -S(0) 2 R 5 , -NR 5 S(0) 2 NR 5 R 6 , -NR 5 S(0) 2 R 6 , -NR 5 S(0) 2 R 6 , -S(0)NR 5 R 6 , -S(0)R 5 , -NR 5 S(0)NR 5 R 6 , -NR 5 S(0) 2 R 6 ,
  • R 3 can combine with R a to form a 3 -to 12-membered monocyclic or poly cyclic heterocycle, or a 5-to 12-membered spiroheterocycle, wherein each heterocycle or spiroheterocycle is optionally substituted with -C i-C 6 alkyl, -OH, -NH2, heteroaryl, heterocyclyl, -(CH 2 )n H2, -COOR a , -CO HR b , -CO H(CH 2 )nCOOR a , - HCOOR 3 , -CF 3 , CHF2, or CH2F;
  • R 5 and R 6 are each independently, at each occurrence, selected from the group consisting of -H, -D, -Ci-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 - C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12-membered heterocycle, -OR 7 , -SR 7 , halogen, - R 7 R 8 , -NO2, and -CN;
  • R 7 and R 8 are independently, at each occurrence, -H, -D, -C i-C 6 alkyl, -C2-C 6 alkenyl, -C4-C 8 cycloalkenyl, -C2-C 6 alkynyl, -C 3 -C 8 cycloalkyl, a monocyclic or polycyclic 3-to 12- membered heterocycle, wherein each alkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkyl, or heterocycle is optionally substituted with one or more -OH, -SH, - H2, -NO2, or -CN; m is independently 1, 2, 3, 4, 5 or 6; and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • Another aspect of the present disclosure relates to compounds, and pharmaceutically acceptable salts, prodrugs, solvates, hydrates, tautomers, or isomers thereof, in Table 1.
  • Another aspect of the present disclosure relates to compounds, and pharmaceutically acceptable salts, prodrugs, solvates, hydrates, tautomers, or isomers thereof, in Table 2.
  • aryl refers to cyclic, aromatic hydrocarbon groups that have 1 to 2 aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl or naphthyl. Where containing two aromatic rings (bicyclic, etc.), the aromatic rings of the aryl group may be joined at a single point (e.g., biphenyl), or fused (e.g., naphthyl). The aryl group may be optionally substituted by one or more substituents, e.g., 1 to 5 substituents, at any point of attachment.
  • substituents include, but are not limited to, -H, halogen, -O-Ci- Cealkyl, -Ci-Cealkyl, -OCi-Cealkenyl, -OCi-Cealkynyl, -C 2 -C 6 alkenyl, -Ci-Cealkynyl, -OH, -OP(0)(OH)2, -OC(0)Ci-C 6 alkyl, -C(0)Ci-C 6 alkyl, -OC(0)OCi-C 6 alkyl, - H 2 , - H(Ci-C 6 alkyl), -N(Ci-C 6 alkyl) 2 , -S(0) 2 -Ci-C 6 alkyl, -S(0) HCi-C 6 alkyl, and -S(0)N(Ci-C 6 alkyl) 2 .
  • the substituents can themselves be optionally substituted.
  • heteroaryl means a monovalent or multivalent monocyclic aromatic radical or a polycyclic aromatic radical of 5 to 24 ring atoms, containing one or more ring heteroatoms selected from N, S, P, and O, the remaining ring atoms being C.
  • Heteroaryl as herein defined also means a bicyclic heteroaromatic group wherein the heteroatom is selected from N, S, P, and O.
  • the aromatic radical is optionally substituted independently with one or more substituents described herein.
  • Examples include, but are not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indolyl, thiophen-2-yl, quinolyl, benzopyranyl, isothiazolyl, thiazolyl, thiadiazolyl, benzo[ ⁇ i]imidazolyl, thieno[3,2-£]thiophene, triazolyl, triazinyl, imidazo[l,2-£]pyrazolyl, furo[2,3-c]pyridinyl, imidazo[l,2-a]pyridinyl, indazolyl, 1-methyl- lH-indazolyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl
  • Alkyl refers to a straight or branched chain saturated hydrocarbon.
  • Ci-C 6 alkyl groups contain 1 to 6 carbon atoms. Examples of a Ci-C 6 alkyl group include, but are not limited to, methyl, ethyl, propyl, butyl, pentyl, isopropyl, isobutyl, sec-butyl and tert-butyl, isopentyl and neopentyl.
  • alkenyl means an aliphatic hydrocarbon group containing a carbon— carbon double bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Certain alkenyl groups have 2 to about 4 carbon atoms in the chain. Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkenyl chain. Exemplary alkenyl groups include ethenyl, propenyl, n- butenyl, and / ' -butenyl.
  • a C2-C6 alkenyl group is an alkenyl group containing between 2 and 6 carbon atoms.
  • alkynyl means an aliphatic hydrocarbon group containing a carbon— carbon triple bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Certain alkynyl groups have 2 to about 4 carbon atoms in the chain. Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkynyl chain. Exemplary alkynyl groups include ethynyl, propynyl, n- butynyl, 2-butynyl, 3-methylbutynyl, and «-pentynyl.
  • a C2-C6 alkynyl group is an alkynyl group containing between 2 and 6 carbon atoms.
  • cycloalkyl means monocyclic or polycyclic saturated carbon rings containing 3-18 carbon atoms.
  • cycloalkyl groups include, without limitations, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptanyl, cyclooctanyl, norboranyl, norborenyl, bicyclo[2.2.2]octanyl, or bicyclo[2.2.2]octenyl.
  • a C3-C8 cycloalkyl is a cycloalkyl group containing between 3 and 8 carbon atoms.
  • a cycloalkyl group can be fused (e.g., decalin) or bridged (e.g., norbornane).
  • cycloalkenyl means monocyclic, non-aromatic unsaturated carbon rings containing 4-18 carbon atoms.
  • examples of cycloalkenyl groups include, without limitation, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and norborenyl.
  • a C4-C8 cycloalkenyl is a cycloalkenyl group containing between 4 and 8 carbon atoms.
  • heterocyclyl or “heterocycloalkyl” or “heterocycle” refer to monocyclic or polycyclic 3 to 24-membered rings containing carbon and heteroatoms selected from oxygen, phosphorus, nitrogen, and sulfur and wherein there are no delocalized ⁇ electrons (aromaticity) shared among the ring carbon or heteroatoms.
  • Heterocyclyl rings include, but are not limited to, oxetanyl, azetidinyl, tetrahydrofuranyl, pyrrolidinyl, oxazolinyl, oxazolidinyl, thiazolinyl, thiazolidinyl, pyranyl, thiopyranyl, tetrahydropyranyl, dioxalinyl, piperidinyl, morpholinyl, thiomorpholinyl, thiomorpholinyl S- oxide, thiomorpholinyl S-dioxide, piperazinyl, azepinyl, oxepinyl, diazepinyl, tropanyl, and homotropanyl.
  • a heteroycyclyl or heterocycloalkyl ring can also be fused or bridged, e.g., can be a bicyclic ring.
  • heterocyclyl or “heterocycloalkyl” or “heterocycle” is a saturated, partially saturated or unsaturated, mono or bicyclic ring containing 3-24 atoms of which at least one atom is chosen from nitrogen, sulfur or oxygen, which may, unless otherwise specified, be carbon or nitrogen linked, wherein a -CH2- group can optionally be replaced by a -C(O)- or a ring sulfur atom may be optionally oxidised to form the S-oxides.
  • Heterocyclyl can be a saturated, partially saturated or unsaturated, mono or bicyclic ring containing 5 or 6 atoms of which at least one atom is chosen from nitrogen, sulfur or oxygen, which may, unless otherwise specified, be carbon or nitrogen linked, wherein a -CH2- group can optionally be replaced by a -C(O)- or a ring sulfur atom may be optionally oxidised to form S-oxide(s).
  • Non- limiting examples and suitable values of the term "heterocyclyl” are thiazolidinyl, pyrrolidinyl, pyrrolinyl, 2-pyrrolidonyl, 2,5-dioxopyrrolidinyl, 2-benzoxazolinonyl, 1, 1-dioxotetrahydro thienyl, 2,4-dioxoimidazolidinyl, 2-oxo-l,3,4-(4-triazolinyl), 2-oxazolidinonyl, 5,6-dihydro uracilyl, 1,3-benzodioxolyl, 1,2,4-oxadiazolyl, 2-azabicyclo[2.2.1]heptyl, 4-thiazolidonyl, ⁇ ⁇ , 2-oxotetrahydrofuranyl, tetrahydrofuranyl, 2,3-dihydrobenzofuranyl, benzothienyl, tetrahydro
  • halo or halogen means a fluoro, chloro, bromo, or iodo group.
  • Spirocycle or "spirocyclic” means carbogenic bicyclic ring systems with both rings connected through a single atom.
  • the ring can be different in size and nature, or identical in size and nature. Examples include spiropentane, spirohexane, spiroheptane, spirooctane, spirononane, or spirodecane.
  • One or both of the rings in a spirocycle can be fused to another carbocyclic, heterocyclic, aromatic, or heteroaromatic ring.
  • One or more of the carbon atoms in the spirocycle can be substituted with a heteroatom (e.g., O, N, S, or P).
  • a C5-C12 spirocycle is a spirocycle containing between 5 and 12 carbon atoms.
  • a C5-C12 spirocycle is a spirocycle containing from 5 to 12 carbon atoms.
  • One or more of the carbon atoms can be substituted with a heteroatom.
  • spirocyclic heterocycle is understood to mean a spirocycle wherein at least one of the rings is a heterocycle (e.g., at least one of the rings is furanyl, morpholinyl, or piperadinyl).
  • a spirocyclic heterocycle can contain between 5 and 12 atoms, at least one of which is a heteroatom selected from N, O, S and P.
  • a spirocyclic heterocycle can contain from 5 to 12 atoms, at least one of which is a heteroatom selected from N, O, S and P.
  • tautomers refers to a set of compounds that have the same number and type of atoms, but differ in bond connectivity and are in equilibrium with one another.
  • a "tautomer” is a single member of this set of compounds. Typically a single tautomer is drawn but it is understood that this single structure is meant to represent all possible tautomers that might exist. Examples include enol-ketone tautomerism. When a ketone is drawn it is understood that both the enol and ketone forms are part of the disclosure.
  • the SHP2 inhibitor may be administered alone as a monotherapy or in combination with one or more other therapeutic agent (e.g., an inhibitor of a MAP kinase pathway or an anti-cancer therapeutic agent) as a combination therapy.
  • the SHP2 inhibitor may be administered as a pharmaceutical composition.
  • the SHP2 inhibitor may be administered before, after, and/or concurrently with the one or more other therapeutic agent (e.g. , an inhibitor of a MAP kinase pathway or an anti-cancer therapeutic agent).
  • such administration may be simultaneous (e.g., in a single composition) or may be via two or more separate compositions, optionally via the same or different modes of administration (e.g., local, systemic, oral, intravenous, etc.).
  • the SHP2 inhibitor may be administered in combination with one or more MEK inhibitor as a combination therapy.
  • the SHP2 inhibitor may be administered as a pharmaceutical composition in combination with one or more MEK inhibitor as a combination therapy.
  • the SHP2 inhibitor may be administered before, after, and/or concurrently with the one or more MEK inhibitor. If administered concurrently with the one or more MEK inhibitor, such administration may be simultaneous (e.g., in a single composition) or may be via two or more separate compositions, optionally via the same or different modes of administration (e.g., local, systemic, oral, intravenous, etc.).
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor.
  • the tumor may contain a RAS pathway activating mutation.
  • the RAS pathway activating mutation confers cellular dependence on SHP2 (e.g., for reloading of GTP onto RAS).
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor comprising a cell that contains an NF l L0F mutation.
  • NF l is a GAP protein that modulates RAS activation by facilitating hydrolysis of GTP from GTP from active RAS-GTP, thereby inactivating RAS.
  • RAS oscillates between GDP -bound "off and GTP -bound "on.” Loss of function mutations in NF 1 reduce GTP hydrolysis by RAS, and shift the equilibrium toward activated RAS, thereby resulting in cancerous growth/proliferation and possibly oncogene addiction.
  • NF l mutations occur frequently in NSCLC (e.g., 8.3% per Cancer Genome Atlas Research Network "Comprehensive molecular profiling of lung adenocarcinoma.” Nature 51 1, 533-550 (2014)), and more than 80% of all constitutional NF1 mutations are F1 L0F (Philpott, 2017), yet no targeted therapies are available for treating F1 L0F subtype tumors.
  • SHP2 inhibition in F1 L0F cells resulted in dose dependent suppression of p-ERK signaling and proliferation (Example 1, FIGS. 6 A and 6B).
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor comprising a cell that contains a mutation in a RAS gene.
  • the RAS gene mutation renders the RAS pathway dependent on signaling flux through SHP2.
  • the RAS pathway mutation may be a KRAS, RAS, or HRAS mutation.
  • Oncogenic RAS mutations, such as KRAS mutations shift the RAS equilibrium to the GTP -bound "on" state, driving signaling to RAS effectors and oncogene addiction.
  • oncogene addiction refers to the phenomenon whereby a tumor cell exhibits apparent dependence on a single oncogenic pathway or protein for sustained proliferation and/or survival, despite its myriad of genetic alterations.
  • Treatment of KRAS cell line panels identified certain mutations as biomarkers of growth sensitivity to SHP2 inhibition (Example 1, Table 3).
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor comprising a cell that contains a KRAS G12C mutation.
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of an tumor comprising a cell that contains a KRAS G12A ; a KRAS G12D , a KRAS G12S , or a KRAS G12V mutation.
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor comprising a cell containing a RAF gene mutation.
  • the RAF gene mutation may render the RAS pathway dependent on signaling flux through SHP2.
  • the mutation is a Class III BRAF mutation.
  • the Class III BRAF mutation may be selected from the group consisting of: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • the mutation is an ARAF or CRAF mutation.
  • the SHP2 inhibitor is administered to the subject as a monotherapy for the treatment of a tumor comprising a cell containing a MEK gene mutation.
  • the MEK gene mutation may render the RAS pathway dependent on signaling flux through SHP2.
  • the MEK gene mutation is a Class I MEKl mutation.
  • the Class I MEKl mutation may be selected from the group consisting of D67N; P124L; P124S; and L177V.
  • the MEK gene mutation is a Class II MEKl mutation.
  • the Class II MEKl mutation may be selected from the group consisting of AE51-Q58; AF53-Q58; E203K; L177M; C 121 S; F53L; K57E; Q56P; and K57N.
  • the SHP2 inhibitor is administered to the subject in combination with one or more other therapeutic agent (e.g., an inhibitor of a MAP kinase pathway) as a combination therapy for the treatment of a tumor comprising a cell containing a RAS pathway mutation that renders the mutated protein dependent on signaling flux through SHP2.
  • one or more other therapeutic agent e.g., an inhibitor of a MAP kinase pathway
  • the mutation may comprise one or more of an F 1 L0F mutation; a RAS/RAF mutation; a KRAS mutation; a KRAS mutation selected from a KRAS G12A mutation; a KRAS G12C mutation; a KRAS G12D mutation; a KRAS G12S mutation; a KRAS G12V mutation; a Class III BRAF mutation; a BRAF mutation selected from D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E; a Class I MEKl mutation; a MEKl mutation selected from D67N; P124L; P124S; and L177V; a Class II MEKl mutation; and a MEKl mutation selected from ⁇ 51- Q58;
  • the mutation may comprise one or more of an ARAF or CRAF mutation.
  • the combination therapy may comprise administration of a SHP2 inhibitor and any other anti-cancer therapeutic agent known in the art or disclosed herein.
  • the SHP2 inhibitor may be administered to the subject in combination with an anti-cancer agent selected from, e.g., but not limited to, mitotic inhibitors such as a taxane, a vinca alkaloid, paclitaxel, docetaxel, vincristine, vinblastine, vinorelbine or vinflunine, and other anticancer agents, e.g.
  • a checkpoint inhibitor e.g., a checkpoint inhibitor antibody
  • a PD-1 antibody such as, e.g., pembrolizumab (or “Keytruda”, Merck) nivolumab (or “Opdivo", BMS), PDR001 (NVS), REGN2810 (Sanofi/Regeneron), a PD-L1 antibody such as, e.g., avelumab (or "MSB0010718C” or “Bavencio", PFE & Merck Kga), durvalumab (or “Imfinzi” or “MEDI-4736", Medimmune & Celgene), atezolizumab (or “Tecentriq” or "MPDL-3280A”, Genentech &
  • the RTK inhibitor may inhibit, e.g., one or more RTK selected from epidermal growth factor receptor (EGFR), platelet derived growth factor receptor (PDGFR), erbB2, erbB4, vascular endothelial growth factor receptor (VEGFR), tyrosine kinase with immunoglobulin-like and epidermal growth factor homology domains (TIE-2), insulin growth factor— I (IGFI) receptor, macrophage colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) receptors, Trk receptors (TrkA, TrkB, and TrkC), ephrin (eph) receptors, hepatocyte growth factor receptors (HGFR), the RET protooncogene, and ALK.
  • RTKI may inhibit, e.g., one or more RTK selected from epidermal growth factor receptor (EGFR), platelet derived growth factor receptor (PDGFR), erbB2, er
  • the TKI may include, but is not limited to, one or more TKI described in Cancers (Basel). 2015 Sep; 7(3): 1758-1784, incorporated herein by reference in its entirety.
  • the TKI may include, but is not limited to, an EGFR inhibitor or an Alk inhibitor.
  • the TKI may include, but is not limited to trastuzumab (Herceptin); cetuximab (Erbitux); panitumumab (vectibix); gefitinib (iressa); erlotinib (tarceva); lapatinib (tykerb); afatinib; sorafenib (nexavar); sunitinib (sutent); bevacizumab (avastin); soratinib; pazopanib; nilotinib; brivanib (BMS-540215); CHIR-258 (TKI-258); SGX523; and imatinib (gleevec).
  • trastuzumab Herceptin
  • cetuximab Erbitux
  • panitumumab vectibix
  • gefitinib iressa
  • erlotinib tarceva
  • lapatinib tykerb
  • TKIs that may be used according to the present disclosure in combination with a SHP2 inhibitor may include, but are not limited to the growth factor receptor inhibitor agents described in Kath, John C, Exp. Opin. Ther. Patents (2000) 10(6):803-818; Shawver et al DDT Vol 2, No. 2 February 1997; and Lofts, F. J. et al, "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy, ed. Workman, Paul and Kerr, David, CRC press 1994, London, incorporated herein by reference in its entirety.
  • the combination therapy may comprise a SHP2 inhibitor in combination with an inhibitor of the PI3K/AKT pathway ("PI3K/AKT inhibitor”) known in the art or disclosed herein.
  • the PI3K/AKT inhibitor may include, but is not limited to, one or more PI3K/AKT inhibitor described in Cancers (Basel). 2015 Sep; 7(3): 1758-1784, incorporated herein by reference in its entirety.
  • the PI3K/AKT inhibitor may be selected from one or more of NVP- BEZ235; BGT226; XL765/SAR245409; SF1126; GDC-0980; PI-103; PF-04691502; PKI- 587; GSK2126458.
  • the ALK inhibitor may include, but is not limited to, ceritinib, TAE-684 (also referred to herein as "NVP-TAE694"), PF02341066 (also referred to herein as "crizotinib” or “1066”), alectinib; brigatinib; entrectinib; Ensartinib (X-396); lorlatinib; ASP3026; CEP-37440; 4SC-203; TL-398; PLB1003; TSR-011; CT-707; TPX-0005, and AP26113. Additional examples of ALK kinase inhibitors are described in example 3-39 of WO 2005016894, incorporated herein by reference in its entirety.
  • the SHP2 inhibitor may be administered before, after, or concurrently with one or more of such anti-cancer agents. In some embodiments, such combinations may offer significant advantages, including additive or synergistic activity in therapy.
  • the present disclosure provides for method for treating a disease or disorder, e.g., a cancer, with a combination therapy comprising a SHP2 inhibitor known in the art or disclosed herein in combination with an inhibitor of the MAP kinase (MAPK) pathway (or "MAPK inhibitor") known in the art or disclosed herein.
  • a disease or disorder e.g., a cancer
  • a combination therapy comprising a SHP2 inhibitor known in the art or disclosed herein in combination with an inhibitor of the MAP kinase (MAPK) pathway (or "MAPK inhibitor”) known in the art or disclosed herein.
  • the MAPK inhibitor may be a MEK inhibitor.
  • MAPK inhibitors for use in the methods disclosed herein may include, but are not limited to, one or more MAPK inhibitor described in Cancers (Basel). 2015 Sep; 7(3): 1758-1784, incorporated herein by reference in its entirety.
  • the MAPK inhibitor may be selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY- 424704/ARRY-704); R05126766 (Roche, described in PLoS One.
  • the SHP2 inhibitor may be administered before, after, or concurrently with one or more of such MAPK inhibitor. In some embodiments, such combinations may offer significant advantages, including additive or synergistic activity in therapy.
  • the present disclosure provides for method for treating a disease or disorder, e.g., a cancer, with a combination therapy comprising a SHP2 inhibitor known in the art or disclosed herein in combination with an inhibitor of a RAS protein (or "RAS inhibitor") known in the art or disclosed herein.
  • the RAS inhibitor may inhibit KRAS, NRAS, or HRAS.
  • the RAS inhibitor may inhibit a specific KRAS, NRAS, or HRAS mutation.
  • the RAS inhibitor may be a KRAS G12C specific inhibitor.
  • the RAS inhibitor may be ARS-853 (Patricelli et al., 2016), which binds selectively to the cysteine residue of KRAS G12C in the GDP bound state.
  • the present disclosure also demonstrates the unexpected discovery that inhibition of SHP2 does not result in feedback driven activation RAS pathway signaling (FIG. 9), even though SHP2 inhibition does result in decreased ERK phosphorylation (FIG. 5B) and might, therefore, be expected to induce such feedback activation in the same manner as MEK inhibition does (FIG. 10). Further, SHP2 inhibition counteracted MEK inhibitor-induced activation of RAS (FIG. 11). Thus, unlike MAPK inhibitors, which may induce resistance, SHP2 inhibitors do not cause hyperactivation of RAS, and they are able to attenuate hyperactivation of RAS in response to MEK inhibitor treatment that may contribute to MEK inhibitor drug resistance.
  • the present disclosure provides a method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer, the method comprising administering the therapeutic agent in combination with a SHP2 inhibitor.
  • the SHP2 inhibitor may be administered before, after, or concurrently with the therapeutic agent.
  • the therapeutic agent is a MAPK inhibitor (e.g., MEK inhibitor).
  • MEK inhibitors induce feedback activation of RAS, which, as shown herein, may be blocked with a SHP2 inhibitor.
  • the administering may be in vivo, e.g., to a subject (such as a mammal, preferably a human).
  • a therapeutic agent e.g., an anti-cancer agent
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering a SHP2 inhibitor and a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering a MEK inhibitor and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155,
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Compound B and a MEK inhibitor selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSKl 120212.
  • a MEK inhibitor selected from one or more of Trametinib (GSKl 120212
  • the RAS pathway inhibitor is Abemaciclib or Ulixertinib.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib and a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155,;
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and Compound B.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and Compound A.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and Compound C.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and a compound selected from Table 1.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and a compound selected from Table 2.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and SHP099.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and NSC-87877.
  • the method for preventing or delaying the emergence of resistance in a cell (e.g., a tumor cell) to a therapeutic agent (e.g., an anti-cancer agent) targeting a RAS pathway signal transducer may comprise administering Trametinib (GSKl 120212) and a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I- X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155, and; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (
  • the present disclosure provides a method for re-sensitizing a tumor that is resistant to a therapeutic agent targeting a RAS pathway signal transducer, the method comprising administering a SHP2 inhibitor.
  • the therapeutic agent is a MAPK inhibitor (e.g., MEK inhibitor or an ERK inhibitor).
  • MAPK inhibitors are known in the art, are disclosed herein, and include, without limitation: MEK inhibitors, one or more MAPK inhibitor described in Cancers (Basel).
  • the present disclosure provides a method for treating cells (e.g., cancer cells) with a SHP2 inhibitor, wherein the cells have been rendered dependent on SHP2 by treatment with a therapeutic agent (e.g., a MAPK inhibitor).
  • a therapeutic agent e.g., a MAPK inhibitor
  • the therapeutic agent may be a MAPK inhibitor selected from a MEK inhibitor and an ERK inhibitor.
  • the therapeutic agent may induce overactivation of the RAS pathway via relief of a natural RAS pathway negative feedback mechanism, wherein the overactivated RAS pathway is dependent on SHP2 signaling (e.g., for priming the reloading of GTP onto RAS).
  • a SHP2 inhibitor in combination with the therapeutic agent may prevents such overactivation of the RAS pathway by the therapeutic agent.
  • Such cells may, but need not comprise a RAS pathway mutation that confers cellular dependence on SHP2 (e.g., for reloading of GTP onto RAS).
  • Treatment with a SHP2 inhibitor in combination with a MAPK inhibitor may prevent MAPK inhibitor-induced feedback activation of the RAS pathway.
  • the present invention also provides methods for determining whether a subject has tumor that will be responsive to SHP2 inhibition.
  • the method may comprise determining whether the tumor is classified as an F1 L0F subtype and administering to the subject an inhibitor of SHP2 if the tumor is classified as an F1 L0F subtype.
  • the determining may comprise empirical determining, e.g., via experimentation.
  • Such methods for determining a subtype of a tumor are known in the art and may include genotyping, measuring NF1 protein levels, determining the size of NF1 (e.g., via any suitable method such as western blot, mass spectrometry, size exclusion chromatography), or measuring by a functional assay such as, a RAS-GTP accumulation assay.
  • the present invention provides a method for determining whether a subject that has cancer will be responsive to SHP2 inhibition, the method comprising determining whether the cancer is classified as a KRAS G12C subtype and administering to the subject an inhibitor of SHP2 if the biological sample is classified as a KRAS G12C subtype.
  • KRAS subtypes are known in the art and are suitable for use according to the present disclosure including, but not limited to direct sequencing, next generation sequencing, and utilization of a high-sensitivity diagnostic assay (with CE-IVD mark), e.g., as described in Domagala, et al, Pol J Pathol 3 : 145-164 (2012), incorporated herein by reference in its entirety, including TheraScreen PCR; AmoyDx; PNAClamp; RealQuality; EntroGen; LightMix; StripAssay; Hybcell plexA; Devyser; Surveyor; Cobas; and TheraScreen Pyro.
  • a high-sensitivity diagnostic assay with CE-IVD mark
  • the present invention provides a method for determining whether a subject that has cancer will be responsive to SHP2 inhibition, the method comprising determining whether the cancer is classified as a KRAS G12D subtype and administering to the subject an inhibitor of SHP2 if the biological sample is classified as a KRAS G12D subtype.
  • the present invention provides a method for determining whether a subject that has cancer will be responsive to SHP2 inhibition, the method comprising determining whether the cancer is classified as a KRAS G12S subtype and administering to the subject an inhibitor of SHP2 if the biological sample is classified as a KRAS G12S subtype.
  • the present invention provides a method for determining whether a subject that has cancer will be responsive to SHP2 inhibition, the method comprising determining whether the cancer is classified as a KRAS G12V subtype and administering to the subject an inhibitor of SHP2 if the biological sample is classified as a KRAS G12V subtype.
  • the present disclosure provides methods of determining whether a treatment comprising a SHP2 inhibitor is optimal for administration to a patient suffering from a SHP2 related disease or disorder.
  • the disease or disorder is a cancer.
  • determining whether a patient should receive a treatment including a SHP2 inhibitor includes determining whether the cancer is classified as an NF 1 L0F subtype and, if so, determining that the patient should receive a SHP2 inhibitor treatment.
  • determining whether a patient should receive a treatment including a SHP2 inhibitor includes determining whether the cancer is classified as a KRAS G12C subtype and, if so, determining that the patient should receive a SHP2 inhibitor treatment.
  • determining whether a patient should receive a treatment including a SHP2 inhibitor includes determining whether the cancer is classified as a KRAS G12A subtype and, if so, determining that the patient should receive a SHP2 inhibitor treatment. In some aspects, determining whether a patient should receive a treatment including a SHP2 inhibitor includes determining whether the cancer is classified as a KRAS G12S subtype and, if so, determining that the patient should receive a SHP2 inhibitor treatment. In some aspects, determining whether a patient should receive a treatment including a SHP2 inhibitor includes determining whether the cancer is classified as a KRAS G12V subtype and, if so, determining that the patient should receive a SHP2 inhibitor treatment.
  • the present disclosure accordingly also provides methods of treating such a patient comprising an NF 1 L0F subtype, a KRAS G12A , a KRAS G12C subtype, a KRAS G12V subtype and/or a KRAS G12S subtype with a SHP2 inhibitor.
  • all of the therapeutic agents disclosed herein i.e., the specific TKI inhibitors, MEK inhibitors, ALK inhibitors, SHP2 inhibitors, EGFR inhibitors, etc.
  • TKI inhibitors i.e., the specific TKI inhibitors, MEK inhibitors, ALK inhibitors, SHP2 inhibitors, EGFR inhibitors, etc.
  • an embodiment comprising treatment with, e.g., a "SHP2 inhibitor,” generally, or a "TKI inhibitor” may comprise treatment with any one or more SHP2 inhibitor or TKI inhibitor, respectively, that is disclosed herein (unless context requires otherwise).
  • compositions and compounds e.g. , SHP2 inhibitors and/or other therapeutic agents
  • modes include systemic or local administration such as oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal or topical administration modes.
  • the disclosed compounds or pharmaceutical compositions can be in solid, semi-solid or liquid dosage form, such as, for example, injectables, tablets, suppositories, pills, time-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, or the like, sometimes in unit dosages and consistent with conventional pharmaceutical practices.
  • injectables tablets, suppositories, pills, time-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, or the like, sometimes in unit dosages and consistent with conventional pharmaceutical practices.
  • they can also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, and all using forms well known to those skilled in the pharmaceutical arts.
  • compositions suitable for the delivery of a SHP2 inhibitor (alone or, e.g., in combination with another therapeutic agent according to the present disclosure) and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation may be found, e.g., in Remington's Pharmaceutical Sciences, 19th Edition (Mack Publishing Company, 1995), incorporated herein in its entirety.
  • Illustrative pharmaceutical compositions are tablets and gelatin capsules comprising a SHP2 inhibitor alone or in combination with another therapeutic agent according to the disclosure and a pharmaceutically acceptable carrier, such as a) a diluent, e.g., purified water, triglyceride oils, such as hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof, corn oil, olive oil, sunflower oil, safflower oil, fish oils, such as EPA or DHA, or their esters or triglycerides or mixtures thereof, omega-3 fatty acids or derivatives thereof, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and/or glycine; b) a lubricant, e.g., silica, talcum, stearic acid, its magnesium or calcium salt, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride,
  • Liquid, particularly injectable, compositions can, for example, be prepared by dissolution, dispersion, etc.
  • a SFIP2 inhibitor (alone or in combination with another therapeutic agent according to the disclosure) is dissolved in or mixed with a pharmaceutically acceptable solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form an injectable isotonic solution or suspension.
  • a pharmaceutically acceptable solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like.
  • Proteins such as albumin, chylomicron particles, or serum proteins can be used to solubilize the SFIP2 inhibitor (alone or in combination with another therapeutic agent according to the disclosure).
  • the SFIP2 inhibitor can be also formulated as a suppository, alone or in combination with another therapeutic agent according to the disclosure, which can be prepared from fatty emulsions or suspensions; using polyalkylene glycols such as propylene glycol, as the carrier.
  • the SFIP2 inhibitor can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles, either alone or in combination with another therapeutic agent according to the disclosure.
  • Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines.
  • a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, as described for instance in U.S. Pat. No. 5,262,564, the contents of which are hereby incorporated by reference.
  • SFIP2 inhibitors can also be delivered by the use of monoclonal antibodies as individual carriers to which the disclosed compounds are coupled.
  • SFIP2 inhibitors can also be coupled with soluble polymers as targetable drug carriers.
  • Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues.
  • a SFIP2 inhibitor can be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.
  • a polymer e.g., a polycarboxylic acid polymer, or a polyacrylate.
  • Parental inj ectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions or solid forms suitable for dissolving in liquid prior to injection.
  • Another aspect of the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a SHP2 inhibitor (alone or in combination with another therapeutic agent according to the present disclosure) and a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier can further include an excipient, diluent, or surfactant.
  • compositions comprising one or more SHP2 inhibitor for use in a method disclosed herein, e.g., a SHP2 monotherapy.
  • Such compositions may comprise a SHP2 inhibitor and, e.g., one or more carrier, excipient, diluent, and/or surfactant.
  • compositions comprising one or more SHP2 inhibitor and one or more additional therapeutic agent for use in a method disclosed herein, e.g., a SHP2 combination therapy.
  • Such compositions may comprise a SHP2 inhibitor, an additional therapeutic agent (e.g., a TKI, a MAPK pathway inhibitor, an EGFR inhibitor, an ALK inhibitor, a MEK inhibitor) and, e.g. , one or more carrier, excipient, diluent, and/or surfactant.
  • compositions comprising one or more SHP2 inhibitor and one or more MEK inhibitor for use in a method disclosed herein, e.g., a SHP2 combination therapy.
  • Such compositions may comprise a SHP2 inhibitor, a MEK inhibitor and, e.g., one or more carrier, excipient, diluent, and/or surfactant.
  • Such compositions may consist essentially of a SHP2 inhibitor, a MEK inhibitor and, e.g., one or more carrier, excipient, diluent, and/or surfactant.
  • compositions may consist of a SHP2 inhibitor, a MEK inhibitor and, e.g., one or more carrier, excipient, diluent, and/or surfactant.
  • a composition of the present disclosure may comprise, consist essentially of, or consist of (a) a SHP2 inhibitor; (b) a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC- 0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSK1120212; and
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) a MEK inhibitor; (b) a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155,; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Compound B; (b) a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244); Cobimetinib (GDC- 0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSK1120212; and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • a MEK inhibitor selected from one or more of Trametinib (GSK1120212); Selumetinib (AZD6244
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Trametinib; (b) a SHP2 inhibitor selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155;; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Compound B; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Compound A; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Compound C; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) a compound selected from the compounds in Table 1; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • compositions of the present disclosure may comprise, consist essentially of, or consist of (a) a compound selected from the compounds in Table 2; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) SHP099; (b) Trametinib (GSKl 120212); and (c) one or more carrier, excipient, diluent, and/or surfactant.
  • composition of the present disclosure may comprise, consist essentially of, or consist of (a) Trametinib (GSKl 120212); (b) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula Xand (c) one or more carrier, excipient, diluent, and/or surfactant.
  • compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present pharmaceutical compositions can contain from about 0.1% to about 99%, from about 5% to about 90%, or from about 1% to about 20% of the disclosed Compound By weight or volume.
  • the dosage regimen utilizing the disclosed compound is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal or hepatic function of the patient; and the particular disclosed compound employed. A physician or veterinarian of ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition.
  • Effective dosage amounts of a SHP2 inhibitor when used for the indicated effects, range from about 0.5 mg to about 5000 mg as needed to treat the condition.
  • Compositions for in vivo or in vitro use can contain about 0.5, 5, 20, 50, 75, 100, 150, 250, 500, 750, 1000, 1250, 2500, 3500, or 5000 mg of the disclosed compound, or, in a range of from one amount to another amount in the list of doses.
  • the compositions are in the form of a tablet that can be scored.
  • Effective dosage amounts of an ALK inhibitor when used for the indicated effects, range from about 0.5 mg to about 5000 mg as needed to treat the condition.
  • Compositions for in vivo or in vitro use can contain about 0.5, 5, 20, 50, 75, 100, 150, 250, 500, 750, 1000, 1250, 2500, 3500, or 5000 mg of the disclosed compound, or, in a range of from one amount to another amount in the list of doses.
  • the compositions are in the form of a tablet that can be scored.
  • Effective dosage amounts of an EGFR inhibitor when used for the indicated effects, range from about 0.5 mg to about 5000 mg as needed to treat the condition.
  • Compositions for in vivo or in vitro use can contain about 0.5, 5, 20, 50, 75, 100, 150, 250, 500, 750, 1000, 1250, 2500, 3500, or 5000 mg of the disclosed compound, or, in a range of from one amount to another amount in the list of doses.
  • the compositions are in the form of a tablet that can be scored.
  • compositions for in vivo or in vitro use can contain about 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 5, 20, 50, 75, 100, 150, 250, 500, 750, 1000, 1250, 2500, 3500, or 5000 mg of the disclosed compound, or, in a range of from one amount to another amount in the list of doses.
  • the compositions are in the form of a tablet that can be scored. .
  • the means for determine comprises a means for determining whether the sample comprises an F1 L0F mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12S mutation, and/or a KRAS G12V mutation.
  • Such means include, but are not limited to direct sequencing, and utilization of a high-sensitivity diagnostic assay (with CE-IVD mark), e.g., as described in Domagala, et al, Pol J Pathol 3 : 145-164 (2012), incorporated herein by reference in its entirety, including TheraScreen PCR; AmoyDx; PNAClamp; RealQuality; EntroGen; LightMix; StripAssay; Hybcell plexA; Devyser; Surveyor; Cobas; and TheraScreen Pyro.
  • a high-sensitivity diagnostic assay with CE-IVD mark
  • Embodiment I As follows:
  • Embodiment I- 1 A method of treating a subject having a disease or disorder comprising a cell containing a mutation encoding the KRAS G12C variant, comprising providing to the subject an inhibitor of SHP2.
  • Embodiment I- la An inhibitor of SHP2 for use in a method of treating a disease or disorder comprising a cell containing a mutation encoding the KRAS G12C variant.
  • Embodiment I- lb Use of an inhibitor of SHP2 for the manufacture of a medicament for treating a disease or disorder comprising a cell containing a mutation encoding the KRAS G12C variant.
  • Embodiment 1-2 A method of treating a subject having a disease or disorder comprising a cell with a mutation encoding an NF1 loss of function ( F1 L0F ) variant, comprising providing to the subject an inhibitor of SHP2.
  • Embodiment I-2a An inhibitor of SHP2 for use in a method of treating a disease or disorder comprising a cell with a mutation encoding an NF1 loss of function ( F1 L0F ) variant.
  • Embodiment I-2b Use of an inhibitor of SHP2 for the manufacture of a medicament for treating a disease or disorder comprising a cell with a mutation encoding an NF1 loss of function ( F1 L0F ) variant.
  • Embodiment 1-3 A method of treating a subject having a disease or disorder associated with a RAS pathway mutation in a cell of the subject that renders the cell at least partially dependent on signaling flux through SHP2, comprising providing to the subject an inhibitor of SHP2.
  • Embodiment I-3a An inhibitor of SHP2 for use in a method of treating a disease or disorder associated with a RAS pathway mutation in a cell that renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment I-3b Use of an inhibitor of SHP2 for the manufacture of a medicament for treating a disease or disorder associated with a RAS pathway mutation in a cell that renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment 1-4 The method of Embodiment 1-3, wherein the RAS pathway mutation is a RAS mutation selected from a KRAS mutation, an NRAS mutation, a SOS mutation, a BRAF Class III mutation, a Class I MEK1 mutation, a Class II MEK1 mutation, and an NF1 mutation.
  • the RAS pathway mutation is a RAS mutation selected from a KRAS mutation, an NRAS mutation, a SOS mutation, a BRAF Class III mutation, a Class I MEK1 mutation, a Class II MEK1 mutation, and an NF1 mutation.
  • Embodiment 1-5 The method of Embodiment 1-4, wherein the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • Embodiment 1-6 The method of Embodiment 1-4, wherein the KRAS mutation is
  • Embodiment 1-7 The method of Embodiment 1-4, wherein the KRAS mutation is KRAS G12A .
  • Embodiment 1-8 The method of Embodiment 1-4, wherein the BRAF Class III mutation is selected from one or more of the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • Embodiment 1-9 The method of Embodiment 1-4, wherein the NF1 mutation is a loss of function mutation.
  • Embodiment I- 10 The method of Embodiment 1-4, wherein the Class I MEK1 mutation is selected from one or more of the following amino acid substitutions in human MEK1 : D67N; P124L; P124S; and L177V.
  • Embodiment I- 11 The method of Embodiment 1-4, wherein the Class II MEK1 mutation is selected from one or more of the following amino acid substitutions in human MEK1 : AE51-Q58; AF53-Q58; E203K; L177M; C121 S; F53L; K57E; Q56P; and K57N.
  • Embodiment 1-12 The method of any one of Embodiments 1-1 to I- 11 , further comprising providing to the subject an inhibitor of the RAS pathway.
  • Embodiment 1-13 The method of Embodiment 1-12, wherein the inhibitor of the RAS pathway is a MAPK inhibitor.
  • Embodiment 1-14 The method of Embodiment 1-13, wherein the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • Embodiment 1-15 The method of Embodiment 1-12, wherein the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY- 424704/ARRY-704); R05126766; ARS-853; LY3214996; BVD523; GSK1120212; Ulixertinib, and Abemaciclib.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimet
  • Embodiment 1-16 The method of any one of Embodiments 1-1 to 1-15, wherein the disease or condition is a tumor.
  • Embodiment 1-17 The method of Embodiment 1-16, wherein the tumor is selected from an NSCLC, a colon cancer , an oesophageal cancer, a rectal cancer, JMML, breast cancer, melanoma, Scwannoma, and a pancreatic cancer.
  • Embodiment 1-18 A method of treating a subject having a disease associated with an NF1 loss of function mutation, comprising providing to the subject an inhibitor of SHP2.
  • Embodiment I- 18a An inhibitor of SHP2 for use in a method of treating a disease associated with an NF1 loss of function mutation.
  • Embodiment I- 18b Use of an inhibitor of SHP2 for the manufacture of a medicament for treating a disease associated with an NF1 loss of function mutation.
  • Embodiment 1-19 The method of Embodiment 1-18, wherein the disease is a tumor comprising cells with an NF1 loss of function mutation.
  • Embodiment 1-20 The method of Embodiment 1-19, wherein the tumor is an NSCLC or melanoma tumor.
  • Embodiment 1-21 The method of Embodiment 1-18, wherein the disease is selected from neurofibromatosis type I, neurofibromatosis type II, schwannomatosis, and Watson syndrome.
  • Embodiment 1-22 The method of any one of Embodiments 1-18 to 1-21, further comprising providing to the subject an inhibitor of the RAS pathway.
  • Embodiment 1-23 The method of Embodiment 1-22, wherein the RAS pathway inhibitor is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY-424704/ARRY-704); R05126766; ARS-853; LY3214996; BVD523; GSK1120212; Ulixertinib, and Abemaciclib.
  • the RAS pathway inhibitor is selected from one or more of Trametinib, Binimetin
  • Embodiment 1-24 A method for treating a subject having a tumor comprising:
  • Embodiment I-24a An inhibitor of SHP2 for use in a method of treating a subject having a tumor, wherein the tumor comprises a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12S mutation, or a KRAS G12V mutation.
  • Embodiment I-24b A method of selecting a subject having a tumor for treatment: wherein the method comprises determining in vitro whether a biological sample obtained from the subject is classified as a KRAS mutant; and wherein the subject is selected for treatment if the biological sample is classified as a KRAS G12C mutant, a KRAS G12D mutant, a KRAS G12S mutant, or a KRAS G12V mutant.
  • Embodiment I-24c An inhibitor of SHP2 for use in a method for treating a tumor, wherein the method comprises:
  • Embodiment 1-25 A method for treating a subject having a tumor comprising:
  • Embodiment I-25a An inhibitor of SHP2 for use in a method of treating a subject having a tumor, wherein the tumor comprises a F1 L0F mutation.
  • Embodiment I-25b A method of selecting a subject having a tumor for treatment: wherein the method comprises determining in vitro whether a biological sample obtained from the subject is classified as a F1 L0F mutant; and wherein the subject is selected for treatment if the biological sample is classified as a F1 L0F mutant.
  • Embodiment I-25c An inhibitor of SHP2 for use in a method for treating a tumor, wherein the method comprises:
  • Embodiment 1-26 A method for treating a subject having a tumor comprising: (a) determining whether a biological sample obtained from the subject is classified as an Class 3 BRAF mutant; and
  • Embodiment I-26a An inhibitor of SHP2 for use in a method of treating a subject having a tumor, wherein the tumor comprises Class 3 BRAF mutation.
  • Embodiment I-26b A method of selecting a subject having a tumor for treatment: wherein the method comprises determining in vitro whether a biological sample obtained from the subject is classified as a Class 3 BRAF mutant; and wherein the subject is selected for treatment if the biological sample is classified as a Class 3 BRAF mutant.
  • Embodiment I-26c An inhibitor of SHP2 for use in a method for treating a tumor, wherein the method comprises:
  • Embodiment 1-27 A method for treating a subject having a tumor comprising:
  • Embodiment I-27a An inhibitor of SHP2 for use in a method of treating a subject having a tumor, wherein the tumor comprises a Class I MEKl mutation.
  • Embodiment I-27b A method of selecting a subject having a tumor for treatment: wherein the method comprises determining in vitro whether a biological sample obtained from the subject is classified as a Class I MEK1 mutant; and wherein the subject is selected for treatment if the biological sample is classified as a Class I MEK1 mutant.
  • Embodiment I-27c An inhibitor of SHP2 for use in a method for treating a tumor, wherein the method comprises:
  • Embodiment 1-28 A method for treating a subject having a tumor comprising:
  • Embodiment I-28a An inhibitor of SHP2 for use in a method of treating a subject having a tumor, wherein the tumor comprises a Class II MEKl mutation.
  • Embodiment I-28b A method of selecting a subject having a tumor for treatment: wherein the method comprises determining in vitro whether a biological sample obtained from the subject is classified as a Class II MEKl mutant; and wherein the subject is selected for treatment if the biological sample is classified as a Class II MEKl mutant.
  • Embodiment I-28c An inhibitor of SHP2 for use in a method for treating a tumor, wherein the method comprises:
  • Embodiment 1-2 A method for treating or preventing drug resistance in a subject receiving administration of a RAS pathway inhibitor, comprising administering to the subject an inhibitor of SHP2.
  • Embodiment I-29a An inhibitor of SHP2for use in a method for treating or preventing drug resistance in a subject receiving administration of a RAS pathway inhibitor.
  • Embodiment I-29b Use of an inhibitor of SHP2for the manufacture of a medicament for treating or preventing drug resistance in a subject receiving administration of a RAS pathway inhibitor.
  • Embodiment 1-30 The method of Embodiment 1-29, wherein the subject comprises a tumor containing cells with an F1 L0F mutation.
  • Embodiment 1-3 The method of Embodiment 1-29 or 1-30, wherein the subject comprises a tumor containing a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12A mutation, a KRAS G12S mutation, or a KRAS G12V mutation.
  • Embodiment 1-32 The method of any one of Embodiments 1-29 to 1-31, wherein the RAS pathway inhibitor is a MEK inhibitor.
  • Embodiment 1-33 The method Embodiment 1-32, wherein the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655), Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901, Refametinib (RDEA 119/BAY 86-9766), R05126766, AZD8330 (ARRY-424704/ARRY-704) , CH5126766, MAP855, and GSK1120212.
  • the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimet
  • Embodiment 1-34 The method of any one of Embodiments 1-29 to 1-31, wherein the RAS pathway inhibitor is an ERK inhibitor.
  • Embodiment 1-35 The method of Embodiment 1-34, wherein the ERK inhibitor is selected from any ERK inhibitor known in the art; LY3214996; Ulixertinib; and BVD523.
  • Embodiment 1-36 The method of any one of the preceding embodiments, wherein the inhibitor of SHP2 is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x)
  • Embodiment 1-37 A combination therapy comprising a RAS pathway inhibitor and an inhibitor of SHP2.
  • Embodiment 1-38 The combination therapy of Embodiment 1-37, wherein the RAS pathway inhibitor is a MEK inhibitor.
  • Embodiment 1-39 The combination therapy of Embodiment 1-38, wherein the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655), CI-1040; PD-0325901, Refametinib (RDEA 119/BAY 86-9766), R05126766, AZD8330 (ARRY-424704/ARRY-704), CH5126766, MAP855, and GSK1120212.
  • the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimas
  • Embodiment 1-40 The combination therapy of Embodiment 1-37, wherein the RAS pathway inhibitor is the KRAS G12C -specific inhibitor ARS-853.
  • Embodiment 1-4 The combination therapy of any one of Embodiments 1-37 to I-
  • the inhibitor of SHP2 is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound from Table 2, disclosed herein; and (xi) a combination thereof .
  • Embodiment 1-42 The combination therapy of any one of Embodiments 1-37 to I-
  • Embodiment 1-43 The combination therapy of Embodiment 1-42, wherein the tumor is selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck cancer; skin cancer; peritoneum cancer
  • Embodiment 1-44 A pharmaceutical composition comprising a RAS pathway inhibitor, a SHP2 inhibitor, and one or more pharmaceutically acceptable carrier, excipient, diluent, and/or surfactant.
  • Embodiment 1-45 The pharmaceutical composition of Embodiment 1-44, wherein the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a compound
  • Embodiment 1-46 The pharmaceutical composition of Embodiment 1-44 or 1-45, wherein the RAS pathway inhibitor is selected from one or more of Trametinib (GSKl 120212) Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY- 424704/ARRY-704); GSK1120212, Ulixertinib; and Abemaciclib.
  • Trametinib GSKl 120212
  • Selumetinib AZD6244
  • Cobimetinib GDC-0973/XL581
  • Embodiment 1-47 The pharmaceutical composition of any one of Embodiments I- 44 to 1-46, for use in the treatment of a tumor.
  • Embodiment 1-48 The pharmaceutical composition of Embodiment 1-47, wherein the tumor is selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck cancer; skin cancer; peritoneum cancer; intestinal cancer (small and large intesting); thyroid
  • Embodiment 1-49 The method of any one of Embodiment 1-16, 1-18, 1-19, 1-24 to 1-28, and 1-30 to 1-36, wherein the tumor is selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck
  • Embodiment 1-50 A method of inhibiting the growth or proliferation of a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2, the method comprising contacting the cell with an inhibitor of SHP2.
  • Embodiment I-50a An inhibitor of SHP2 for use in a method of inhibiting the growth or proliferation of a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment I-50b Use of an inhibitor of SHP2 for the manufacture of a medicament for inhibiting the growth or proliferation of a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment 1-51 A method of inhibiting RAS-GTP accumulation in a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2, the method comprising contacting the cell with an inhibitor of SHP2.
  • Embodiment 1-5 la. An inhibitor of SHP2 for use in a method of inhibiting RAS-GTP accumulation in a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment 1-5 Use of an inhibitor of SHP2 for the manufacture of a medicament for inhibiting RAS-GTP accumulation in a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment 1-52 A method of killing a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2, the method comprising contacting the cell with an inhibitor of SHP2.
  • Embodiment I-52a An inhibitor of SHP2 for use in a method of killing a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment I-52b Use of an inhibitor of SHP2 for the manufacture of a medicament for killing a cell containing a RAS pathway mutation, wherein the RAS pathway mutation renders the cell at least partially dependent on signaling flux through SHP2.
  • Embodiment 1-53 The method of any one of Embodiments 1-50 to 1-52, wherein the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (
  • Embodiment 1-54 The method of any one of Embodiments 1-50 to 1-53, wherein the RAS pathway mutation is selected from a KRAS mutation, an RAS mutation, an URAS mutation, a SOS mutation, a Class III BRAF mutation, and an NF1 loss of function mutation.
  • Embodiment 1-55 The method of Embodiment 1-54, wherein the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • the KRAS mutation is selected from a KRAS G12A mutation, a KRAS G12C mutation, a KRAS G12D mutation, a KRAS G12F mutation, a KRAS 0121 mutation, a KRAS G12L mutation, a KRAS G12R mutation, a KRAS G12S mutation, a KRAS G12V mutation, and a KRAS G12Y mutation.
  • Embodiment 1-56 The method of Embodiment 1-54, wherein the KRAS mutation is KRAS G12C .
  • Embodiment 1-57 The method of Embodiment 1-54, wherein the KRAS mutation is KRAS G12A .
  • Embodiment 1-58 The method of Embodiment 1-54, wherein the Class 3 BRAF mutation is selected from one or more of the following amino acid substitutions in human BRAF: D287H; P367R; V459L; G466V; G466E; G466A; S467L; G469E; N581 S; N581I; D594N; D594G; D594A; D594H; F595L; G596D; G596R and A762E.
  • Embodiment 1-59 The method of any one of Embodiments 1-50 to 1-58, further comprising contacting the cell with an inhibitor of the RAS pathway.
  • Embodiment 1-60 The method of Embodiment 1-59, wherein the inhibitor of the RAS pathway is a MAPK inhibitor.
  • Embodiment 1-61 The method of Embodiment 1-60, wherein the inhibitor of the RAS pathway is a MEK inhibitor or ERK inhibitor.
  • Embodiment 1-62 The method of Embodiment 1-61, wherein the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimetinib, Selumetinib, Cobimetinib, LErafAON (NeoPharm), ISIS 5132; Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655); CI-1040; PD-0325901; CH5126766; MAP855; AZD6244; Refametinib (RDEA 119/BAY 86-9766); GDC-0973/XL581; AZD8330 (ARRY- 424704/ARRY-704); R05126766; ARS-853; LY3214996; BVD523; GSK1120212; Ulixertinib; and Abemaciclib.
  • the inhibitor of the Ras pathway is selected from one or more of Trametinib, Binimet
  • Embodiment 1-63 The method of any one of Embodiment 1-1 to 1-36, 1-49 to 1-62 further comprising contacting the cell with a SOS inhibitor.
  • Embodiment 1-64 The method of Embodiment 1-63, wherein the SOS inhibitor is administered to a cell comprising higher than normal SOS levels or SOS activity.
  • Embodiment 1-65 The method of Embodiment 1-16, wherein the tumor is from a NSCLC tumor.
  • Embodiment 1-66 The method of Embodiment 1-16, wherein the tumor is a colon cancer tumor.
  • Embodiment 1-67 The method of Embodiment 1-16, wherein the tumor is an oesophageal cancer tumor.
  • Embodiment 1-68 The method of Embodiment 1-16, wherein the tumor is a rectal cancer tumor.
  • Embodiment 1-69 The method of Embodiment 1-16, wherein the tumor is a JMML tumor.
  • Embodiment 1-70 The method of Embodiment 1-16, wherein the tumor is a breast cancer tumor.
  • Embodiment 1-71 The method of Embodiment 1-16, wherein the tumor is a melanoma tumor.
  • Embodiment 1-72 The method of Embodiment 1-16, wherein the tumor is a Scwannoma tumor.
  • Embodiment 1-73 The method of Embodiment 1-16, wherein the tumor is a pancreatic cancer tumor.
  • Embodiment 1-74 The method of any one of the preceding embodiments, wherein the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x)
  • Embodiment 1-75 A method of inhibiting the growth of a tumor cell, comprising contacting the tumor cell a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • Embodiment I-75a A combination therapy comprising a MEK inhibitor and a SHP2 inhibitor for use in a method of inhibiting the growth of a tumor cell.
  • Embodiment I-75b Use of a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor for the manufacture of a medicament for inhibiting the growth of a tumor cell.
  • Embodiment 1-76 The method of Embodiment 1-75, wherein the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655), CI-1040; PD-0325901, CH5126766, MAP855, Refametinib (RDEA 119/BAY 86-9766), R05126766, AZD8330 (ARRY-424704/ARRY-704), and GSK1120212.
  • the MEK inhibitor is selected from one or more of Trametinib (GSK1120212), Selumetinib (AZD6244), Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimaser
  • Embodiment 1-77 The method of Embodiment 1-75 or 1-76, wherein the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC-87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I-Vl, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV-Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x) a
  • Embodiment 1-78 The method of any one of Embodiments 1-75 to 1-77, wherein the MEK inhibitor is Trametinib (GSK1120212).
  • Embodiment 1-79 The method of any one of Embodiments 1-75 to 1-78, wherein the SHP2 inhibitor is Compound B.
  • Embodiment 1-80 The method of Embodiment 1-75, wherein the MEK inhibitor is Trametinib (GSK1120212) and the SHP2 inhibitor is Compound B.
  • Embodiment 1-81 The method of any one of Embodiment I- 75 to 1-80, wherein the tumor cell is a cell from a tumor selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck cancer; skin cancer; peritone
  • Embodiment 1-82 The method of any one of Embodiments 1-75 to 1-80, wherein the tumor is from a NSCLC tumor.
  • Embodiment 1-83 The method of any one of Embodiments 1-75 to 1-82, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-84 The method of Embodiment 1-83, wherein the subject is a human.
  • Embodiment 1-85 The method of any one of Embodiments 1-75 to 1-84, wherein the contacting of the tumor cell with the combination therapy comprising the MEK inhibitor and the SHP2 inhibitor results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of the respective MEK and SHP2 inhibitors separately.
  • Embodiment 1-86 The method of any one of Embodiments 1-75 to 1-85, wherein the MEK inhibitor and the SHP2 inhibitor do not contact the tumor cell simultaneously.
  • Embodiment 1-87 The method of any one of Embodiments 1-75 to 1-85, wherein the MEK inhibitor and the SHP2 inhibitor contact the tumor cell simultaneously.
  • Embodiment 1-88 The method of any one of Embodiments 1-85 to 1-87, wherein the contacting is via administration of the MEK inhibitor and the SHP2 inhibitor to the subject.
  • Embodiment 1-89 The method of Embodiment 1-88, wherein the administration of the MEK inhibitor precedes the administration of the SHP2 inhibitor.
  • Embodiment 1-90 The method of Embodiment 1-88, wherein the administration of the SHP2 inhibitor precedes the administration of the MEK inhibitor.
  • Embodiment 1-91 The method of Embodiment 1-88, wherein the administration of the SHP2 inhibitor and the administration of the MEK inhibitor occurs simultaneously.
  • Embodiment 1-92 The method of Embodiment 1-91, wherein the SHP2 inhibitor and the MEK inhibitor are administered as a single pharmaceutical composition.
  • Embodiment 1-93 The method of Embodiment 1-91, wherein the SHP2 inhibitor and the MEK inhibitor are administered as separate pharmaceutical compositions.
  • Embodiment 1-94 The method of any one of Embodiments 1-75 to 1-93, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment 1-95 A method of inhibiting the growth of a tumor cell, comprising contacting the tumor cell a combination therapy comprising trametinib (GSK1120212) and Compound B.
  • Embodiment I-95a A combination therapy comprising trametinib (GSKl 120212) and Compound B for use in a method of inhibiting the growth of a tumor cell.
  • Embodiment I-95b Use of a combination therapy comprising trametinib (GSKl 120212) and Compound B for the manufacture of medicament for inhibiting the growth of a tumor cell.
  • GSKl 120212 trametinib
  • Compound B for the manufacture of medicament for inhibiting the growth of a tumor cell.
  • Embodiment 1-96 The method of Embodiment 1-95, wherein the tumor cell is from a NSCLC tumor.
  • Embodiment 1-97 The method of Embodiment 1-95 or 1-96, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-98 The method of Embodiment 1-97, wherein the subject is a human.
  • Embodiment 1-99 The method of any one of Embodiments 1-95 to 1-98, wherein the contacting of the tumor cell with the combination therapy comprising trametinib (GSKl 120212) and Compound B results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of trametinib (GSKl 120212) and Compound B separately.
  • Embodiment I- 100 The method of any one of Embodiments I- 95 to 1-99, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment I- 101 A method of treating a subject having a tumor, comprising contacting a tumor cell in the tumor in the subject with a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor.
  • Embodiment I-101a A combination therapy comprising a MEK inhibitor and a SHP2 inhibitor for use in a method of treating a subject having a tumor.
  • Embodiment I-101b Use of a combination therapy comprising a MEK inhibitor and a SHP2 inhibitor for the manufacture of medicament for treating a subject having a tumor.
  • Embodiment 1-102 The method of Embodiment 1-101, wherein the MEK inhibitor is selected from one or more of Trametinib (GSKl 120212); Selumetinib (AZD6244); Cobimetinib (GDC-0973/XL581), Binimetinib, Vemurafenib, Pimasertib, TAK733, R04987655 (CH4987655), CI-1040; PD-0325901; CH5126766; MAP855; Refametinib (RDEA 119/BAY 86-9766); R05126766, AZD8330 (ARRY-424704/ARRY-704); and GSK1120212.
  • Trametinib GSKl 120212
  • Selumetinib AZD6244
  • Cobimetinib GDC-0973/XL581
  • Binimetinib Binimetinib, Vemurafenib, Pimasert
  • Embodiment 1-103 The method of Embodiment 1-101 or 1-102, wherein the SHP2 inhibitor is selected from (i) Compound A; (ii) Compound B; (iii) SHP099; (iv) NSC- 87877; (v) a SHP2 inhibitor compound of any one of Formula I, of Formula II, of Formula III, of Formula I- VI, of Formula I-V2, of Formula I-W, of Formula I-X, of Formula I-Y, of Formula I-Z, of Formula IV, of Formula V, of Formula VI, of Formula IV-X, of Formula IV- Y, of Formula IV-Z, of Formula VII, of Formula VIII, of Formula IX, and of Formula X; (vi) TN0155; (vii) a SHP2 inhibitor disclosed in international PCT application PCT/US2017/041577 (WO2018013597), incorporated herein by reference in its entirety; (viii) Compound C; (ix) a compound from Table 1, disclosed herein; (x)
  • Embodiment 1-104 The method of Embodiment 1-101, wherein the MEK inhibitor is Trametinib (GSK1120212).
  • Embodiment 1-105 The method of any one of Embodiments 1-101 to 1-104, wherein the SHP2 inhibitor is Compound B.
  • Embodiment 1-106 The method of Embodiment I- 101 , wherein the MEK inhibitor is Trametinib (GSK1120212) and the SHP2 inhibitor is Compound B.
  • Embodiment 1-107 The method of any one of Embodiments 1-101 to 1-106, wherein the tumor cell is a cell from a tumor selected from tumors of hemopoietic and lymphoid system; a myeloproliferative syndrome; a myelodysplastic syndromes; leukemia; acute myeloid leukemia; juvenile myelomonocytic leukemia; esophageal cancer; breast cancer; lung cancer; colon cancer; gastric cancer; neuroblastoma; bladder cancer; prostate cancer; glioblastoma; urothelial carcinoma; uterine carcinoma; adenoid and ovarian sereous cystadenocarcinoma; paraganglioma; phaeochromocytoma; pancreatic cancer; adrenocortical carcinoma; stomach adenocarcinoma; sarcoma; rhabdomyosarcoma; lymphoma; head and neck cancer; skin cancer; peritone
  • Embodiment 1-108 The method of any one of Embodiments 1-101 to 1-107, wherein the tumor cell is from a NSCLC tumor.
  • Embodiment 1-109 The method of any one of Embodiments 1-101 to 1-108, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-110 The method of Embodiment 1-109, wherein the subject is a human.
  • Embodiment 1-111 The method of any one of Embodiments 1-101 to 1-110, wherein the contacting of the tumor cell with the combination therapy comprising the MEK inhibitor and the SHP2 inhibitor results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of the respective MEK and SHP2 inhibitors separately.
  • Embodiment 1-112 The method of any one of Embodiments 1-101 to 1-111, wherein the MEK inhibitor and the SHP2 inhibitor do not contact the tumor cell simultaneously.
  • Embodiment 1-113 The method of any one of Embodiments 1-101 to 1-111, wherein the MEK inhibitor and the SHP2 inhibitor contact the tumor cell simultaneously.
  • Embodiment 1-114 The method of any one of Embodiments 1-111 to 1-113, wherein the contacting is via administration of the MEK inhibitor and the SHP2 inhibitor to the subject.
  • Embodiment 1-115 The method of Embodiment 1-114, wherein the administration of the MEK inhibitor precedes the administration of the SHP2 inhibitor.
  • Embodiment I- 116 The method of Embodiment 1-114, wherein the administration of the SHP2 inhibitor precedes the administration of the MEK inhibitor.
  • Embodiment I- 117 The method of Embodiment 1-114, wherein the administration of the SHP2 inhibitor and the administration of the MEK inhibitor occurs simultaneously.
  • Embodiment 1-118 The method of Embodiment 1-117, wherein the SHP2 inhibitor and the MEK inhibitor are administered as a single pharmaceutical composition.
  • Embodiment 1-119 The method of Embodiment 1-117, wherein the SHP2 inhibitor and the MEK inhibitor are administered as separate pharmaceutical compositions.
  • Embodiment 1-120 The method of any one of Embodiments 1-101 to 1-119, wherein the treatment inhibits the growth of the tumor cell.
  • Embodiment 1-121 The method of Embodiment 1-120, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment 1-122 A method of treating a subject having a tumor, comprising contacting a tumor cell of the tumor in the subject with a combination therapy comprising trametinib (GSKl 120212) and Compound B.
  • a combination therapy comprising trametinib (GSKl 120212) and Compound B.
  • Embodiment I- 122a A combination therapy comprising trametinib (GSKl 120212) and Compound B for use in a method of treating a subject having a tumor.
  • GSKl 120212 trametinib
  • Compound B for use in a method of treating a subject having a tumor.
  • Embodiment I- 122b Use of a a combination therapy comprising trametinib (GSKl 120212) and Compound B for the manufacture of a medicament for treating a subject having a tumor.
  • a combination therapy comprising trametinib (GSKl 120212) and Compound B for the manufacture of a medicament for treating a subject having a tumor.
  • Embodiment 1-123 The method of Embodiment 1-122, wherein the tumor cell is from a NSCLC tumor.
  • Embodiment 1-124 The method of Embodiment 1-122 or 1-123, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-125 The method of Embodiment 1-124, wherein the subject is a human.
  • Embodiment 1-126 The method of any one of Embodiments 1-122 to 1-125, wherein the contacting of the tumor cell with the combination therapy comprising trametinib (GSKl 120212) and Compound B results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of trametinib (GSKl 120212) and Compound B separately.
  • Embodiment 1-127 The method of any one of Embodiments 1-122 to 1-126, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment 1-128 The method of any one of Embodiments 1-1 to 1-36, 1-49 to 1-78, 1-80 to 1-94, 1-101 to 1-104, 1-107 to 1-121, wherein the SHP2 inhibitor is Compound C.
  • Embodiment 1-129 The combination therapy of any one of Embodiments I- 37 to 1-43, wherein the SHP2 inhibitor is Compound C.
  • Embodiment 1-130 The pharmaceutical composition of any one of Embodiments 1-44 to 1-48, wherein the SHP2 inhibitor is Compound C.
  • Embodiment 1-131 A method of inhibiting the growth of a tumor cell, comprising contacting the tumor cell with a combination therapy comprising trametinib (GSKl 120212) and Compound C.
  • a combination therapy comprising trametinib (GSKl 120212) and Compound C.
  • Embodiment 1-13 la A combination therapy comprising trametinib (GSKl 120212) and Compound C for use in a method of inhibiting the growth of a tumor cell.
  • GSKl 120212 trametinib
  • Compound C for use in a method of inhibiting the growth of a tumor cell.
  • GSKl 120212 trametinib
  • Compound C for the manufacture of a medicament for inhibiting the growth of a tumor cell.
  • Embodiment 1-132 The method of Embodiment 1-131, wherein the tumor cell is from a NSCLC tumor.
  • Embodiment 1-133 The method of Embodiment 1-131 or 1-132, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-134 The method of Embodiment 1-133, wherein the subject is a human.
  • Embodiment 1-135. The method of any one of Embodiments 1-131 to 1-134, wherein the contacting of the tumor cell with the combination therapy comprising trametinib (GSKl 120212) and Compound C results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of trametinib (GSKl 120212) and Compound C separately.
  • Embodiment 1-136 The method of any one of Embodiments 1-131 to 1-135, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment 1-137 A method of treating a subject having a tumor, comprising contacting a tumor cell of the tumor in the subject with a combination therapy comprising trametinib (GSKl 120212) and Compound C.
  • Embodiment I- 137a A combination therapy comprising trametinib (GSKl 120212) and Compound C for use in a method of treating a subject having a tumor.
  • GSKl 120212 trametinib
  • Compound C for use in a method of treating a subject having a tumor.
  • Embodiment I- 137b Use of a combination therapy comprising trametinib (GSKl 120212) and Compound C for the manufacture of a medicament for treating a subject having a tumor.
  • GSKl 120212 trametinib
  • Compound C for the manufacture of a medicament for treating a subject having a tumor.
  • Embodiment 1-138 The method of Embodiment 1-137, wherein the tumor cell is from a NSCLC tumor.
  • Embodiment 1-139 The method of Embodiment 1-137 or 1-138, wherein the contacting occurs in vivo in a subject.
  • Embodiment 1-140 The method of Embodiment 1-139, wherein the subject is a human.
  • Embodiment 1-141 The method of any one of Embodiments 1-137 to 1-140, wherein the contacting of the tumor cell with the combination therapy comprising trametinib (GSKl 120212) and Compound C results in an inhibition of tumor growth that is more than merely additive with respect to the amount of tumor growth inhibition achievable by contacting the tumor cell with each of trametinib (GSKl 120212) and Compound C separately.
  • Embodiment 1-142 The method of any one of Embodiment 1-137 to 1-141, wherein the growth of the tumor cell is inhibited enough to case partial or complete regression of the tumor.
  • Embodiment 1-143 The method of any one of Embodiments 1-1 to 1-36 and 1-49, comprising administering an effective amount of the inhibitor of SHP2.
  • Embodiment 1-144 The method of any one of Embodiments 1-50 to 1-128 and 1-131 to 1-142, comprising contacting the cell with an effective amount of the inhibitor of SHP2.
  • Embodiment 1-145 The combination therapy of any one of Embodiments I- 37 to 1-43, I-75a, I-95a, I-101a, I-122a, 1-129, 1-13 la, and I- 137a, comprising an effective amount of the inhibitor of SHP2.
  • Embodiment 1-146 The pharmaceutical composition of any one of Embodiments 1-44 to 1-48 and 1-130, comprising an effective amount of the inhibitor of SHP2.
  • Embodiment 1-147 The inhibitor of SHP2 for use in a method according to any one of Embodiments I-la, I-2a, I-3a, I-18a, I-24a, I-24c, I-25a, I-25c, I-26a, I-26c, I-27a, I-27c, I-28a, I-28c, I-29a, I-50a, 1-5 la, and I-52a, wherein the inhibitor of SHP2 is used in an effective amount.
  • Embodiment 1-148 The use of an inhibitor of SHP2 according to any one of Embodiments I- lb, I-2b, I-3b, I- 18b, I-29b, I-50b, 1-5 lb, I-52b, I- , wherein the inhibitor of SHP2 is used in an effective amount.
  • Embodiment 1-149 The method of any one of Embodiments 1-1 to 1-36 and 1-49, comprising administering a therapeutically effective amount of the inhibitor of SHP2.
  • Embodiment 1-150 The method of any one of Embodiments 1-50 to 1-128 and 1-131 to 1-142, comprising contacting the cell with a therapeutically effective amount of the inhibitor of SHP2.
  • Embodiment 1-151 The combination therapy of any one of Embodiments I- 37 to 1-43, 1-75a, I-95a, I-101a, I-122a, 1-129, 1-13 la, and I-137a, comprising a therapeutically effective amount of the inhibitor of SHP2.
  • Embodiment 1-152 The pharmaceutical composition of any one of Embodiments 1-44 to 1-48 and 1-130, comprising a therapeutically effective amount of the inhibitor of SHP2.
  • Embodiment 1-153 The inhibitor of SHP2 for use in a method according to any one of Embodiments I-la, I-2a, I-3a, I-18a, I-24a, I-24c, I-25a, I-25c, I-26a, I-26c, I-27a, I-27c, I-28a, I-28c, I-29a, I-50a, 1-5 la, and I-52a, wherein the inhibitor of SHP2 is used in a therapeutically effective amount.
  • Embodiment 1-154 The use of an inhibitor of SHP2 according to any one of Embodiments I- lb, I-2b, I-3b, I- 18b, I-29b, I-50b, 1-5 lb, I-52b, I- , wherein the inhibitor of SHP2 is used in a therapeutically effective amount.
  • clarified lysates 500 ⁇ g total protein, quantified by BCA
  • glutathione resin which had been preincubated with GST-Raf-RBD.
  • the mixture was vortexed and incubated at 4° C for 1 hour with gentle rocking.
  • the resin was washed three times with lysis buffer and bound Ras-GTP eluted by addition of 2X reducing sample buffer.
  • Eluted proteins were separated by SDS-PAGE using a 4-15% Tris- glycine gel (BioRad).
  • Proteins were transferred to a nitrocellulose membrane for western blot using an anti-Ras antibody (Thermofisher, 1 :200) and a Licor IRDye-800 anti-mouse secondary antibody (1 :20,000).
  • the Licor Odyssey CLx was used for visualization.
  • test article or vehicle 50 mM acetate buffer, pH 4.6 containing 10% captisol, unless otherwise indicated
  • Body weight and tumor volume (using calipers) was measured biweekly until study endpoint.
  • Compound A or Compound B were administered by oral gavage daily.
  • the positive control, paclitaxel (30 mg/kg iv) in 5% ethanol, 5% cremophor EL, in 5% dextrose in deionized water was administered once every five days.
  • Trametinib (1 mg/kg PO in 0.5% Methylcellulose + 0.5% Tween 80) was administered by oral gavage daily.
  • the study endpoint was defined as a mean tumor volume of 2000 mm 3 in the control group or 22 days, whichever came first. Mean tumor volume data are reported for all animals that remained on study.
  • Compound B was a potent inhibitor of growth (CTG ICso range 0.4 to 7.87 ⁇ ) in 9/10 KRAS G12C lines, 2/2 KRAS G12A lines, 2/5 KRAS G12D lines, and also two KRAS G12V lines, H441 ( Figure 2; Ref #2 Crown Bio Project # E3105-U1703).
  • CCG ICso range 0.4 to 7.87 ⁇ 9/10 KRAS G12C lines, 2/2 KRAS G12A lines, 2/5 KRAS G12D lines, and also two KRAS G12V lines, H441 ( Figure 2; Ref #2 Crown Bio Project # E3105-U1703).
  • the effect of the SHP2 inhibitor on activation of the RAS-MAPK pathway was evaluated (see Figure 3).
  • Compound B produced a concentration-dependent inhibition of p-ERKl/2 levels in H358, H1792 and Calu-1 cells.
  • NFl is a RAS-GAP protein that facilitates the hydrolysis of RAS-GTP into its inactive RAS-GTP form, thereby inactivating RAS.
  • NFl is a tumor suppressor, and loss of function mutations in this gene result RAS-GTP accumulation and downstream signaling leading to cell growth in various human cancers (Nissan, Krauthammer, Redig). Therefore, we tested whether SFIP2 inhibition might effectively prevent RAS pathway signaling and cell growth in NF1 L0F models.
  • YUHEF carries three SOS1 mutations and RAF1P261L, a previously described MAPK pathway-activating Noonan Syndrome mutation ⁇ Kobayashi, 2010 #2532; Krauthammer, 2015 #2476 ⁇ .
  • the SFIP2 inhibitor Compound B produced a dose-dependent decrease in tumor volume in both the H358 KRAS G12C and MiaPaca-2 KRAS G12C xenograft models ( Figures 7 and 8).
  • the reduction in tumor volume was of a similar order of magnitude to that of the MEK inhibitor trametinib (1 m/kg PO) in the H358 model but was greater than trametinib (1 m/kg PO) in the MiaPaca-2 model.
  • Compound A was also a potent inhibitor of p-ERK (Figure 5B) and cell growth (crystal violet stain)(Figure 5C) in HI 838 F1 L0F NSCLC cells in vitro.
  • BRAF serine/threonine kinase BRAF
  • mutations in BRAF are commonly present in human cancer, and such mutations are oncogenic because of their resultant hyperactivation of pERK signaling.
  • Three classes of oncogenic BRAF mutations have been reported. Class I mutations occur at V600 and result in constitutively active BRAF monomers that are active regardless of their RAS-GTP state (Poulikakos, 2011). Class II mutations are dependent on dimerization, but also are active regardless of their RAS-GTP state (Yao, 2015). Class III mutations of BRAF are both RAF dimer and RAS-GTP dependent (Yao, 2017).
  • Class I and Class I mutations might be refractory to SHP2 inhibition because they singal independent of GTP, whereas, in contrast Class III mutations might be dependent on SHP2 signaling to promote adequate GTP loading, and cells containing these mutations might, therefore, be sensitive to SHP2 inhibition.
  • Class I and Class II BRAF mutant oncoproteins function downstream of RAS but drive strong, ERK-dependent negative feedback, leading to RAS-GTP suppression upstream of RAS.
  • Our data suggest this suppression is either insensitive to SHP2 inhibition, for example if suppression occurs via direct inhibition of SOS 1 (Corbalan-Garcia, 1996; Kamioka, 201 1), or sufficiently strong that the remaining low levels of RAS-GTP cannot be reliably quantified with our assay.
  • NCI-H358 cells (Lung, KRAS G 2C ) were grown into spheroids by seeding 5,000 cells/well in round bottom ultra-low attachment 96-well plates (Corning) in RPMI media (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Immediately after seeding, cells were spun down at 1000 RPM for 5 minutes, and incubated at 37°C in 5% C02 for five days to allow for spheroid formation. Spheroid formation was confirmed visually.
  • Spheroids were treated in triplicate with Compound B, staurosporine (Sigma), or DMSO (Sigma) (0.1% final), diluted in RPMI media supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin, and incubated at 37°C in 5% C02 for 20 hours.
  • Caspase 3/7 activity was measured using the Caspase-Glo 3/7 Assay System (Promega), following the manufacturer' s instructions. After addition of Caspase-Glo reagent, the well contents were pipetted several times and incubated at room temperature in the dark for 45 minutes to allow thorough cell lysis.
  • KRAS G12C is not a constitutively and fully active protein but rather the nucleotide state of KRAS G12C is in a state of dynamic flux that can be modulated by upstream signaling factors (Patricelli et al., 2016).
  • GAP GTPase activating protein
  • NF 1 L0F there is a shift towards the active, GTP -bound state of RAS which drives signaling to RAS effectors and growth addiction.
  • the wild type RAS undergoes nucleotide cycling which, as for KRAS G12C , makes it sensitive to upstream signaling inputs to maintain a highly active state.
  • cells which have acquired a Class 3 mutation in BRAF drive high pERK signaling in a manner that remains dependent on RAS-GTP, and therefore on upstream signaling factors.
  • KRAS G12C ; F1 L0F ; and BRAF Class 3 cell lines reflects modulation of these upstream factors, and hence the nucleotide state of mutant/WT RAS, by the inhibitor.
  • MDA- MB231 cells were seeded in 6-well plates and incubated overnight in full growth medium. Cells were treated for 24 hours with selumetinib (5 ⁇ ) or Compound A (1 and 5 ⁇ ) or left untreated (DMSO control). Lysates were generated using the lysis buffer provided with the kit (Phospho-RTK Array; R&D systems) with inclusion of a protease inhibitor cocktail. To control for protein concentration, total protein levels were quantified using BCA reagent kit. The levels of phospho-RTK were determined according to the manufacturer's instructions.
  • clarified lysates 500 ⁇ g total protein, quantified by BCA
  • glutathione resin which had been preincubated with GST- Raf-RBD.
  • the mixture was vortexed and incubated at 4° C for 1 hour with gentle rocking.
  • the resin was washed three times with lysis buffer and bound Ras-GTP eluted by addition of 2X reducing sample buffer.
  • Eluted proteins were separated by SDS-PAGE using a 4-15% Tris- glycine gel (BioRad).
  • Proteins were transferred to a nitrocellulose membrane for western blot using an anti-Ras antibody (Thermofisher, 1 :200) and a Licor IRDye-800 anti-mouse secondary antibody (1 :20,000).
  • the Licor Odyssey CLx was used for visualization.
  • Tyrosine phosphorylation of the C-terminal tail (Tyr-542 and Tyr-580) of SHP2 has been proposed to have both regulatory and functional consequences.
  • SHP2 acts as a scaffolding protein to link PDGFRP to Ras by interactions with Grb2-SOS (Bennett, 1994) via tyrosine phosphorylation after growth factor stimulation.
  • Grb2-SOS Tinnett, 1994
  • Grb2 binds to pY542 or pY580 in a cellular context, and whether this interaction is the main functional consequence of Y542/580 phosphorylation. Lu et.
  • Cells (MEFs, HEK 293E, H358) were plated in 6-well plates at a density of 750,000 cells/well in low serum (0.1% FBS) media and allowed to grow overnight. Cells were incubated with either DMSO (0.05%), or Compound B (5 ⁇ ) for 1 hour. Cells were stimulated with 50 ng/mL of EGF or PDGF for 5 minutes, washed with cold PBS, and 150 ⁇ . of lysis buffer (Thermo #1862301) with Halt Protease/Phosphatase inhibitor (Thermo #78440) was added. Cells were scraped, transferred to a cold Eppendorf tube and vortexed for 10 seconds.
  • lysis buffer Thermo #1862301
  • Halt Protease/Phosphatase inhibitor Thermo #78440
  • Lysates were spun at 4 C for 15 min at 13,000 rpm and transferred to a new tube. Lysate protein concentration was assessed using the BCA assay. Lysates (30 ⁇ g/lane) were run on a 4-15% Tris glycine gel and transferred to a nitrocellulose membrane using the iBlot2. Western blots were performed using phospho-SFIP2 antibodies from Cell Signaling Technologies; pY542 (#3751) and pY580 (#3703) were both used at 1 : 1000 dilution in 5% BS A in TBS. Membranes were incubated with primary antibody overnight with gentle shaking at 4 C. Beta actin antibody (Cell Signaling Technologies #8457, 1 :2000) was used as a loading control.
  • the secondary antibody (Licor IRDye 800 CW anti-rabbit) was used at a 1 :20000 dilution in 5% BSA in TBS for 1 hour shaking at room temperature. Blots were visualized using the Licor Odyssey Clx Imager.
  • SHP is allosterically activated through binding of bis-tyrosyl-phosphorylated peptides to its Src Homology 2 (SH2) domains.
  • SH2 Src Homology 2
  • the latter activation step leads to the release of the auto-inhibitory interface of SHP2, which in turn renders the SHP2 protein tyrosine phosphatase (PTP) active and available for substrate recognition and reaction catalysis.
  • PTP protein tyrosine phosphatase
  • the catalytic activity of SHP2 was monitored using the surrogate substrate DiFMUP in a prompt fluorescence assay format.
  • the phosphatase reactions were performed at room temperature in 96-well black polystyrene plate, flat bottom, non-binding surface (Corning, Cat # 3650) using a final reaction volume of 100 ⁇ _, and the following assay buffer conditions: 50 mM HEPES, pH 7.2, 100 mM NaCl, 0.5 mM EDTA, 0.05% P-20, 1 mM DTT.
  • the surrogate substrate DiFMUP (Invitrogen, Cat # D6567) was added to the reaction and activity was determined by a kinetic read using a microplate reader (Envision, Perkin-Elmer or Spectramax M5, Molecular Devices). The excitation and emission wavelengths were 340 nm and 450 nm, respectively. Initial rates were determined from a linear fit of the data, and the inhibitor dose response curves were analyzed using normalized ICso regression curve fitting with control based normalization.
  • N-terminally HA-tagged SOS-WT and SOS-F constructs were synthesized (Atum) and subcloned into the pcDNA5/FRT/TO vector (ThermoFisher) using the following primers: SOSl-HA-For 5'- ACAGGTAAGCTTATGTACCCATACGATGTTCCAGATTAC-3', SOS1-HA-REV 5'- AGACTAGCGGCCGCTCAGGAAGAATGGGCATTCTCCAA-3', and SOS-F-HA-REV 5'- GATCGAGCGGCCGCTCAGGAGAGCAC ACACTTGC AG-3 ' .
  • SOS- WT and SOS-F plasmids were co-transfected with the pOG44 Flp-recombinase expression vector (ThermoFisher) into the F£EK Flp-In T-Rex 293 cell line according to the manufacturer' s protocol.
  • Transfected cells were selected in drug media (200 ⁇ g/mL hygromycin B, 15 ⁇ g/mL blastidicin) and expression of SOS constructs was verified by western blot (SOS-1 : Cell Signaling Technologies # 5890; HA: Sigma 11867423001).
  • 30,000 HEK-293 cells per well were plated in 96-well plates in Biotin-free RPMI (Hyclone) supplemented with 0.1% fetal bovine serum, 0.02% bovine serum albumin and 1% penicillin/streptomycin. Expression of SOS 1 constructs was induced by the addition 0.1 ⁇ g/mL doxycycline (Sigma) for 24 hours. Cells were treated with serial 3 -fold dilutions of Compound B diluted in biotin-free media supplemented with 0.02% bovine serum albumin and 1% penicillin/streptomycin (final DMSO concentration equivalent to 0.1%) for one hour. For the final 5 minutes of drug treatment, cells were stimulated with 50 ng/mL EGF (Sigma), lysed and subjected to ERKl/2 phosphorylation analysis as described above.
  • EGF EGF
  • SOSl and GRB2 are the most closely related gene knockdowns to PTPN11 across all 7,837 genes in the Project DRIVE dataset (data not shown).
  • SHP2 is an essential member of a core RAS-regulatory module containing SOSl and GRB2.
  • Compound B downregulates RAS-GTP by disrupting the SHP2/SOS 1/GRB2 module that is required for GTP-loading of RAS.
  • KRAS G12C In NSCLC, these semi-autonomous driver mutations are observed frequently: KRAS G12C , F1 L0F , and BRAF class 111 mutations collectively represent about 3% of all cases in the US annually. Importantly, patients whose cancers carry these mutations are dramatically underserved, as no targeted therapies have been approved for these molecular subtypes. The data presented here raise the exciting possibility that a SHP2 inhibitor may make these mutations clinically actionable and improve the outlook for patients.
  • FIG. 16A and 16C show a Loewe Model of Additivity fit of the data from Figures 16A and 16C, respectively, wherein the numbers in the positive range (mapped in blue) are indicative of synergy.
  • mice Female athymic nude mice (6-8 weeks old). Mice were implanted with H358 tumor cells in 50% Matrigel (lxlO 7 cells/animal) subcutaneously in the flank. Once tumors reached an average size of -200 mm 3 mice were randomized to treatment groups and administration of test article or vehicle (50 mM acetate buffer, pH 4.6 containing 10%) captisol, unless otherwise indicated) initiated. Trametinib was formulated in a solution of 0.5%) Methylcellulose + 0.5% Tween 80. Body weight and tumor volume (using calipers) was measured every other day until study endpoints. Compounds were administered by oral gavage according to the schedule set forth in Table 5:
  • Compound B 10 mg/kg 0.5, 1, 2, , : 8, 24 h 2, 8, 24 h
  • Compound B 30 mg/kg 0.5, 1, 2, 4, : 8, 24 h 2, 8, 24 h
  • Compound B at both doses and trametinib as a single agent caused significant tumor growth inhibition as compared to the vehicle control.
  • the efficacy observed at 10 and 30 mg/kg treatment with Compound B reproduced previous data reported in Example 1 in the NCI-H358 xenograft model (FIG. 7).
  • Figure 18 All regimens were well tolerated for the duration of the study as evaluated by body weight, with the exception of one animal in the 30 mg/kg Compound B combination with 1 mg/kg trametinib, that lost >20% body weight on the last day of dosing and was euthanized for humane reasons..
  • Compound B exhibits statistically significant, biologically significant and dose- dependent efficacy in the NCI-H358 non-small cell lung cancer xenograft model following oral administration at lOmg/kg daily and 30mg/kg daily. Trametinib also exhibited efficacy in this model at 1 mg/kg, a dose level previously predicted to be clinically relevant. Importantly, both doses of Compound B in combination with this dose of trametinib were tolerated and caused significant tumor regressions, some of which were complete regression.
  • FIG. 21 shows the efficacy of repeated daily dosing of Compound C ("Cmp C") at 10 mg/kg PO with or without co-administration of a Ras pathway inhibitor in the H358 KRas G12C model of human non-small cell lung cancer.
  • FIGS. 21A and 21B show Compound C and Trametinib studies
  • FIGS. 21C and 2 ID show Compound C and Cobimetinib studies
  • FIGS. 21E and 21F show Compound C and Ulixertinib studies.
  • Each of Compound C (FIGS. 21A, 21C, and 21E), Trametinib (FIG. 21A), Cobimetinib (FIG.21C) and Ulixertinib (FIG.
  • each of the combinations of Cobimetinib at 2.5 mg/kg with Compound C at 10 mg/kg (FIG. 21C) and of Ulixertinib at 100 mg/kg with Compound C at 10 mg/kg (FIG. 21E) resulted in a significant increase in tumor regression (***p ⁇ 0.0005), assessed by an ordinary one way ANOVA of tumor volumes along with multiple comparisons via a post-hoc Tukey's test in Graphpad Prism software.
  • Figure 22 shows the efficacy of repeated daily dosing of Compound C at 30 mg/kg PO with or without co-administration of Abemaciclib at 50 mg/kg in the human pancreatic carcinoma MIA-Pa-Ca-2 xenograft model.
  • Each of Compound C and Abemaciclib caused significant tumor growth inhibition as a single agent as compared to the vehicle control (FIG. 22A).
  • the combination of Abemaciclib at 50 mg/kg and Compound C at 30 mg/kg resulted in a significant increase in tumor regression (***p ⁇ 0.0005), assessed by an ordinary one way ANOVA of tumor volumes along with multiple comparisons via a post-hoc Tukey's test in Graphpad Prism software (FIG. 22 A).
  • Compound C exhibits statistically significant, biologically significant, and dose-dependent efficacy in the NCI-H358 non-small cell lung cancer and in the MIA-Pa-Ca-2 xenograft models following oral administration at lOmg/kg daily and 30mg/kg daily.
  • Trametinib also exhibited efficacy in this model at 1 mg/kg, a dose level previously predicted to be clinically relevant, as did Cobimetinib, Ulixertinib, and Abemaciclib at clinically relevant doses of 2.5, 100, and 50 mg/kg, respectively.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2018/049744 2017-09-07 2018-09-06 SHP2 INHIBITOR COMPOSITIONS AND METHODS OF TREATING CANCER Ceased WO2019051084A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
BR112020004246-3A BR112020004246A2 (pt) 2017-09-07 2018-09-06 composições inibidoras de shp2 e métodos para o tratamento de câncer
EP18778734.6A EP3678703A1 (en) 2017-09-07 2018-09-06 Shp2 inhibitor compositions and methods for treating cancer
MX2020002608A MX2020002608A (es) 2017-09-07 2018-09-06 Composiciones que comprenden inhibidores de shp2 y metodos para tratar el cáncer.
KR1020207009441A KR20200051684A (ko) 2017-09-07 2018-09-06 암 치료를 위한 shp2 억제제 조성물 및 방법
SG11202001282UA SG11202001282UA (en) 2017-09-07 2018-09-06 Shp2 inhibitor compositions and methods for treating cancer
AU2018328273A AU2018328273A1 (en) 2017-09-07 2018-09-06 SHP2 inhibitor compositions and methods for treating cancer
CA3074690A CA3074690A1 (en) 2017-09-07 2018-09-06 Shp2 inhibitor compositions and methods for treating cancer
JP2020513824A JP7356414B2 (ja) 2017-09-07 2018-09-06 がんを治療するためのshp2阻害剤組成物および方法
RU2020112303A RU2805355C2 (ru) 2017-09-07 2018-09-06 Композиции на основе ингибитора shp2 и способы лечения рака
CN201880069854.1A CN111344017A (zh) 2017-09-07 2018-09-06 治疗癌症的shp2抑制剂组合物和方法
MA49353A MA49353B2 (fr) 2017-09-07 2018-09-06 Compositions d'inhibiteur de la shp2 et méthodes de traitement du cancer
IL272877A IL272877A (en) 2017-09-07 2020-02-24 SHP2 inhibitory compositions and methods for cancer treatment
US16/810,525 US11596633B2 (en) 2017-09-07 2020-03-05 SHP2 inhibitor compositions and methods for treating cancer
CONC2020/0002588A CO2020002588A2 (es) 2017-09-07 2020-03-09 Composiciones que comprenden un inhibidor de shp2 y metodos para tratar el cáncer
US18/166,150 US20240058341A1 (en) 2017-09-07 2023-02-08 SHP2 Inhibitor Compositions and Methods for Treating Cancer
JP2023118814A JP2023139151A (ja) 2017-09-07 2023-07-21 がんを治療するためのshp2阻害剤組成物および方法
US18/655,511 US20250090532A1 (en) 2017-09-07 2024-05-06 Shp2 inhibitor compositions and methods for treating cancer

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US201762555400P 2017-09-07 2017-09-07
US62/555,400 2017-09-07
US201762558255P 2017-09-13 2017-09-13
US62/558,255 2017-09-13
US201862653831P 2018-04-06 2018-04-06
US62/653,831 2018-04-06
US201862681001P 2018-06-05 2018-06-05
US62/681,001 2018-06-05

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/810,525 Continuation US11596633B2 (en) 2017-09-07 2020-03-05 SHP2 inhibitor compositions and methods for treating cancer

Publications (1)

Publication Number Publication Date
WO2019051084A1 true WO2019051084A1 (en) 2019-03-14

Family

ID=63684567

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/049744 Ceased WO2019051084A1 (en) 2017-09-07 2018-09-06 SHP2 INHIBITOR COMPOSITIONS AND METHODS OF TREATING CANCER

Country Status (14)

Country Link
US (3) US11596633B2 (https=)
EP (1) EP3678703A1 (https=)
JP (2) JP7356414B2 (https=)
KR (1) KR20200051684A (https=)
CN (1) CN111344017A (https=)
AU (1) AU2018328273A1 (https=)
BR (1) BR112020004246A2 (https=)
CA (1) CA3074690A1 (https=)
CO (1) CO2020002588A2 (https=)
IL (1) IL272877A (https=)
MX (2) MX2020002608A (https=)
SG (1) SG11202001282UA (https=)
TW (1) TWI852912B (https=)
WO (1) WO2019051084A1 (https=)

Cited By (98)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019183367A1 (en) 2018-03-21 2019-09-26 Relay Therapeutics, Inc. Shp2 phosphatase inhibitors and methods of use thereof
US10561655B2 (en) 2018-03-21 2020-02-18 Synblia Therapeutics, Inc. SHP2 inhibitors and uses thereof
US10590090B2 (en) 2016-07-12 2020-03-17 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric SHP2 inhibitors
WO2020081848A1 (en) 2018-10-17 2020-04-23 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
WO2020165732A1 (en) * 2019-02-12 2020-08-20 Novartis Ag Pharmaceutical combination comprising tno155 and a krasg12c inhibitor
WO2020180770A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heterocyclyl compounds and uses thereof
WO2020180768A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2020201991A1 (en) 2019-04-02 2020-10-08 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
WO2020223177A1 (en) * 2019-04-29 2020-11-05 The Board Of Trustees Of The University Of Illinois Mek inhibitors for corneal scarring and neovascularization
US10851110B2 (en) 2016-05-31 2020-12-01 Board Of Regents, The University Of Texas System Heterocyclic inhibitors of PTPN11
WO2020249079A1 (zh) * 2019-06-14 2020-12-17 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
WO2021000946A1 (zh) * 2019-07-04 2021-01-07 南方科技大学 一种探针以及使用其分析蛋白质复合物的方法
US10894797B2 (en) 2018-09-18 2021-01-19 Nikang Therapeutics, Inc. Fused tricyclic ring derivatives as SRC homology-2 phosphatase inhibitors
US10934285B2 (en) 2016-06-14 2021-03-02 Novartis Ag Compounds and compositions for inhibiting the activity of SHP2
US10954243B2 (en) 2018-05-02 2021-03-23 Navire Pharma, Inc. Substituted heterocyclic inhibitors of PTPN11
WO2021073439A1 (zh) * 2019-10-14 2021-04-22 杭州雷索药业有限公司 用于抑制shp2活性的吡嗪衍生物
WO2021079302A1 (en) * 2019-10-22 2021-04-29 Lupin Limited Pharmaceutical combination of prmt5 inhibitors
US11001561B2 (en) 2019-04-08 2021-05-11 Merck Patent Gmbh Pyrimidinone derivatives as SHP2 antagonists
WO2021091982A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021092115A1 (en) 2019-11-08 2021-05-14 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2021091956A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021091967A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021108683A1 (en) 2019-11-27 2021-06-03 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
US11033547B2 (en) 2019-03-07 2021-06-15 Merck Patent Gmbh Carboxamide-pyrimidine derivatives as SHP2 antagonists
WO2021127404A1 (en) 2019-12-20 2021-06-24 Erasca, Inc. Tricyclic pyridones and pyrimidones
WO2021142026A1 (en) * 2020-01-07 2021-07-15 Revolution Medicines, Inc. Shp2 inhibitor dosing and methods of treating cancer
US11104675B2 (en) 2018-08-10 2021-08-31 Navire Pharma, Inc. PTPN11 inhibitors
WO2021171261A1 (en) 2020-02-28 2021-09-02 Novartis Ag A triple pharmaceutical combination comprising dabrafenib, an erk inhibitor and a shp2 inhibitor
WO2021197452A1 (zh) * 2020-04-03 2021-10-07 上海翰森生物医药科技有限公司 含氮杂芳类衍生物自由碱的晶型
US11179397B2 (en) 2018-10-03 2021-11-23 Gilead Sciences, Inc. Imidazopyrimidine derivatives
WO2021257736A1 (en) 2020-06-18 2021-12-23 Revolution Medicines, Inc. Methods for delaying, preventing, and treating acquired resistance to ras inhibitors
US11220501B2 (en) 2019-06-07 2022-01-11 Revolution Medicines, Inc. Solid forms of {6-[(2-amino-3-chloropyridin-4-yl)sulfanyl]-3-[(3S,4S)-4-amino-3-methyl-2-oxa-8- azaspiro[4.5]decan-8-yl]-5-methylpyrazin-2-yl} methanol, a SHP2 inhibitor
WO2022060836A1 (en) 2020-09-15 2022-03-24 Revolution Medicines, Inc. Indole derivatives as ras inhibitors in the treatment of cancer
WO2022060583A1 (en) 2020-09-03 2022-03-24 Revolution Medicines, Inc. Use of sos1 inhibitors to treat malignancies with shp2 mutations
WO2022066805A1 (en) 2020-09-23 2022-03-31 Erasca, Inc. Tricyclic pyridones and pyrimidones
US20220160707A1 (en) * 2019-02-12 2022-05-26 Novartis Ag Pharmaceutical combination comprising tno155 and ribociclib
WO2022133345A1 (en) 2020-12-18 2022-06-23 Erasca, Inc. Tricyclic pyridones and pyrimidones
WO2022140427A1 (en) 2020-12-22 2022-06-30 Qilu Regor Therapeutics Inc. Sos1 inhibitors and uses thereof
WO2022208408A1 (en) 2021-04-01 2022-10-06 Array Biopharma Inc. Crystalline form of a shp2 inhibitor
US11466017B2 (en) 2011-03-10 2022-10-11 Board Of Regents, The University Of Texas System Heterocyclic inhibitors of PTPN11
US11466016B2 (en) 2018-03-02 2022-10-11 Otsuka Pharmaceutical Co., Ltd. Pharmaceutical compounds
WO2022235870A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors for the treatment of cancer
WO2022235866A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2022235864A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors
US11517573B2 (en) * 2019-09-13 2022-12-06 The Institute Of Cancer Research: Royal Cancer Hospital Therapeutic compositions, combinations, and methods of use
WO2022259157A1 (en) 2021-06-09 2022-12-15 Novartis Ag A triple pharmaceutical combination comprising dabrafenib, trametinib and a shp2 inhibitor
US11529347B2 (en) 2016-09-22 2022-12-20 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of use thereof
WO2022271966A1 (en) * 2021-06-24 2022-12-29 Erasca, Inc. Shp2 and cdk4/6 inhibitors combination therapies for the treatment of cancer
WO2022269525A1 (en) 2021-06-23 2022-12-29 Novartis Ag Pharmaceutical combinations comprising a kras g12c inhibitor and uses thereof for the treatment of cancers
WO2022271964A1 (en) * 2021-06-24 2022-12-29 Erasca, Inc. Erk1/2 and shp2 inhibitors combination therapy
US11591336B2 (en) 2017-05-26 2023-02-28 D. E. Shaw Research, Llc Substituted pyrazolo[3,4-b]pyrazines as SHP2 phosphatase inhibitors
US11596633B2 (en) 2017-09-07 2023-03-07 Revolution Medicines, Inc. SHP2 inhibitor compositions and methods for treating cancer
WO2023031781A1 (en) 2021-09-01 2023-03-09 Novartis Ag Pharmaceutical combinations comprising a tead inhibitor and uses thereof for the treatment of cancers
WO2023059785A1 (en) * 2021-10-06 2023-04-13 Navire Pharma, Inc. Substituted pyrimidin-4(3h)-ones for use in treating cancer
WO2023060253A1 (en) 2021-10-08 2023-04-13 Revolution Medicines, Inc. Ras inhibitors
US11629145B2 (en) 2016-10-24 2023-04-18 D. E. Shaw Research, Llc SHP2 phosphatase inhibitors and methods of use thereof
US11673896B2 (en) 2017-01-23 2023-06-13 Revolution Medicines, Inc. Pyridine compounds as allosteric SHP2 inhibitors
US11673901B2 (en) 2017-12-15 2023-06-13 Revolution Medicines, Inc. Polycyclic compounds as allosteric SHP2 inhibitors
US11702411B2 (en) 2017-10-12 2023-07-18 Revolution Medicines, Inc. Pyridine, pyrazine, and triazine compounds as allosteric SHP2 inhibitors
US11701354B2 (en) 2017-09-29 2023-07-18 D. E. Shaw Research, Llc Pyrazolo[3,4-b]pyrazine derivatives as SHP2 phosphatase inhibitors
US11731984B2 (en) 2019-12-11 2023-08-22 Eli Lilly And Company KRas G12C inhibitors
US11739093B2 (en) 2017-01-23 2023-08-29 Revolution Medicines, Inc. Substituted pyrazolopyrazines, imidazopyrazines and [1,2,4]triazolopyrazines as allosteric SHP2 inhibitors
WO2023168036A1 (en) 2022-03-04 2023-09-07 Eli Lilly And Company Method of treatment including kras g12c inhibitors and shp2 inhibitors
WO2023172940A1 (en) 2022-03-08 2023-09-14 Revolution Medicines, Inc. Methods for treating immune refractory lung cancer
WO2023194443A1 (en) * 2022-04-06 2023-10-12 Heparegenix Gmbh Pharmaceutical composition for the treatment of colon and lung cancer
US11827644B2 (en) 2019-03-04 2023-11-28 Suzhou Genhouse Pharmaceutical Co., Ltd Pyrazine derivative and application thereof in inhibiting SHP2
WO2023230205A1 (en) 2022-05-25 2023-11-30 Ikena Oncology, Inc. Mek inhibitors and uses thereof
WO2023240263A1 (en) 2022-06-10 2023-12-14 Revolution Medicines, Inc. Macrocyclic ras inhibitors
US11873296B2 (en) 2022-06-07 2024-01-16 Verastem, Inc. Solid forms of a dual RAF/MEK inhibitor
US11890281B2 (en) 2019-09-24 2024-02-06 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of making and using the same
US11952386B2 (en) 2014-01-17 2024-04-09 Novartis Ag N-azaspirocycloalkane substituted N-heteroaryl compounds and compositions for inhibiting the activity of SHP2
WO2024130444A1 (en) * 2022-12-23 2024-06-27 The Governing Council Of The University Of Toronto Use of dupd1 inhibitors in the treatment of inflammatory bowel disease and metabolic disorders
US12037345B2 (en) 2018-07-24 2024-07-16 Taiho Pharmaceutical Co., Ltd. Heterobicyclic compounds for inhibiting the activity of SHP2
US12097203B2 (en) 2021-05-05 2024-09-24 Huyabio International, Llc Combination therapies comprising SHP2 inhibitors and PD-1 inhibitors
WO2024206858A1 (en) 2023-03-30 2024-10-03 Revolution Medicines, Inc. Compositions for inducing ras gtp hydrolysis and uses thereof
WO2024211663A1 (en) 2023-04-07 2024-10-10 Revolution Medicines, Inc. Condensed macrocyclic compounds as ras inhibitors
WO2024211712A1 (en) 2023-04-07 2024-10-10 Revolution Medicines, Inc. Condensed macrocyclic compounds as ras inhibitors
WO2024216048A1 (en) 2023-04-14 2024-10-17 Revolution Medicines, Inc. Crystalline forms of ras inhibitors, compositions containing the same, and methods of use thereof
WO2024216016A1 (en) 2023-04-14 2024-10-17 Revolution Medicines, Inc. Crystalline forms of a ras inhibitor
EP4259638A4 (en) * 2020-12-11 2024-10-23 Erasca, Inc. COMBINATION THERAPIES FOR THE TREATMENT OF CANCER
WO2024229406A1 (en) 2023-05-04 2024-11-07 Revolution Medicines, Inc. Combination therapy for a ras related disease or disorder
US12138263B2 (en) 2018-03-21 2024-11-12 Relay Therapeutics, Inc. Pyrazolo[3,4-b]pyrazine SHP2 phosphatase inhibitors and methods of use thereof
WO2025034702A1 (en) 2023-08-07 2025-02-13 Revolution Medicines, Inc. Rmc-6291 for use in the treatment of ras protein-related disease or disorder
WO2025080946A2 (en) 2023-10-12 2025-04-17 Revolution Medicines, Inc. Ras inhibitors
WO2025137507A1 (en) 2023-12-22 2025-06-26 Regor Pharmaceuticals, Inc. Sos1 inhibitors and uses thereof
US12351566B2 (en) 2020-01-10 2025-07-08 Immuneering Corporation MEK inhibitors and therapeutic uses thereof
WO2025171296A1 (en) 2024-02-09 2025-08-14 Revolution Medicines, Inc. Ras inhibitors
US12390469B2 (en) 2021-05-05 2025-08-19 Huyabio International, Llc SHP2 inhibitor monotherapy and uses thereof
US12458640B2 (en) 2019-08-20 2025-11-04 Otsuka Pharmaceutical Co., Ltd. Pyrazolo[3,4-b]pyrazine SHP2 phosphatase inhibitors
WO2025240847A1 (en) 2024-05-17 2025-11-20 Revolution Medicines, Inc. Ras inhibitors
WO2025255438A1 (en) 2024-06-07 2025-12-11 Revolution Medicines, Inc. Methods of treating a ras protein-related disease or disorder
WO2025265060A1 (en) 2024-06-21 2025-12-26 Revolution Medicines, Inc. Therapeutic compositions and methods for managing treatment-related effects
WO2026015790A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026015801A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026015825A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Use of ras inhibitor for treating pancreatic cancer
WO2026015796A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026050446A1 (en) 2024-08-29 2026-03-05 Revolution Medicines, Inc. Ras inhibitors
WO2026072904A2 (en) 2024-09-26 2026-04-02 Revolution Medicines, Inc. Compositions and methods for treating lung cancer

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12122787B2 (en) 2019-09-20 2024-10-22 Shanghai Jemincare Pharmaceuticals Co., Ltd Fused pyridone compound, and preparation method therefor and use thereof
CN117083283A (zh) * 2020-12-11 2023-11-17 医睿世康药业研发公司 用于癌症治疗的联合疗法
EP4267134A4 (en) * 2020-12-22 2024-11-06 Novartis AG Pharmaceutical combinations comprising a kras g12c inhibitor and uses of a kras g12c inhibitor for the treatment of cancers
WO2023059771A1 (en) * 2021-10-06 2023-04-13 Erasca, Inc. Uses of tri-substituted heteroaryl derivatives as src homology-2 phosphatase inhibitors
WO2023108110A2 (en) * 2021-12-10 2023-06-15 Verastem, Inc. Combination therapy for treating abnormal cell growth
KR102665711B1 (ko) * 2021-12-21 2024-05-14 재단법인 아산사회복지재단 Ras 활성도를 이용한 신경섬유종증 치료제에 대한 감수성 예측용 바이오마커 조성물 및 Ras 활성 억제제를 포함하는 신경섬유종증 예방 또는 치료용 약학적 조성물
US20230304102A1 (en) * 2022-01-31 2023-09-28 D2G Oncology, Inc. Biomarkers for predicting responsiveness to shp2 inhibitor therapy
CN116763930A (zh) * 2023-07-03 2023-09-19 中国海洋大学 Shp2抑制剂联合肿瘤治疗药物在肿瘤耐药中的应用
CN118671349A (zh) * 2024-05-10 2024-09-20 浙江省肿瘤医院 一种抗胃癌药物的高通量筛选方法

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5262564A (en) 1992-10-30 1993-11-16 Octamer, Inc. Sulfinic acid adducts of organo nitroso compounds useful as retroviral inactivating agents anti-retroviral agents and anti-tumor agents
WO2005016894A1 (en) 2003-08-15 2005-02-24 Novartis Ag 2, 4-pyrimidinediamines useful in the treatment of neoplastic diseases, inflammatory and immune system disorders
WO2011022440A2 (en) 2009-08-17 2011-02-24 Memorial Sloan-Kettering Cancer Center Heat shock protein binding compounds, compositions, and methods for making and using same
WO2015007495A1 (en) 2013-07-18 2015-01-22 Siemens Aktiengesellschaft A method and a system for machining an object
WO2015107494A1 (en) 2014-01-17 2015-07-23 Novartis Ag 1 -(triazin-3-yi_/pyridazin-3-yl)-piper(-azine)idine derivatives and compositions thereof for inhibiting the activity of shp2
WO2015107493A1 (en) 2014-01-17 2015-07-23 Novartis Ag 1 -pyridazin-/triazin-3-yl-piper(-azine)/idine/pyrolidine derivatives and and compositions thereof for inhibiting the activity of shp2
WO2016203405A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2016203406A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2016203404A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2017079723A1 (en) 2015-11-07 2017-05-11 Board Of Regents, The University Of Texas System Targeting proteins for degradation
US20170204187A1 (en) 2014-06-13 2017-07-20 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2017156397A1 (en) 2016-03-11 2017-09-14 Board Of Regents, The University Of Texas Sysytem Heterocyclic inhibitors of ptpn11
WO2017211303A1 (en) 2016-06-07 2017-12-14 Jacobio Pharmaceuticals Co., Ltd. Novel heterocyclic derivatives useful as shp2 inhibitors
WO2018013597A1 (en) 2016-07-12 2018-01-18 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric shp2 inhibitors

Family Cites Families (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2636882A (en) 1950-08-11 1953-04-28 Quaker Oats Co Preparation of 3-pyridols from 2-acylfurans
BE758503A (fr) 1969-11-07 1971-05-05 Shell Int Research Compositions pesticides
GB1459571A (en) 1974-09-12 1976-12-22 Pfizer Ltd Thiophene-2-sulphonamide derivatives and their use as therapeutic agents sheet orienting apparatus
US4513135A (en) 1982-03-05 1985-04-23 Eli Lilly And Company Diaryl-pyrazine derivatives affecting GABA binding
JPH0249775A (ja) 1988-05-19 1990-02-20 Nippon Soda Co Ltd 6員環又は7員環を有する複素環化合物及びその製造方法
JPH04112877A (ja) 1990-09-04 1992-04-14 Nippon Soda Co Ltd 新規シアノピラジン誘導体及びその製造方法
EP0579835A4 (en) 1991-11-12 1994-06-01 Nippon Soda Co Wavelength conversion material for agriculture
AU713673B2 (en) 1996-02-07 1999-12-09 Neurocrine Biosciences Inc. Pyrazolopyrimidines as crf receptor antagonists
CA2293400A1 (en) 1997-06-13 1998-12-17 Gerald Mcmahon Novel heteroaryl compounds for the modulation of protein tyrosine enzyme related cellular signal transduction
WO2001016097A1 (en) 1999-08-27 2001-03-08 Sugen, Inc. Phosphate mimics and methods of treatment using phosphatase inhibitors
WO2003029422A2 (en) 2001-10-01 2003-04-10 Mount Sinai School Of Medicine Noonan syndrome gene
EP1492784A4 (en) 2002-03-28 2006-03-29 Merck & Co Inc SUBSTITUTED 2,3-DIPHENYLPYRIDINES
US20040116444A1 (en) 2002-09-12 2004-06-17 Corbett Jeffrey W. Substituted 1,4-pyrazine derivatives
CN101899114A (zh) 2002-12-23 2010-12-01 惠氏公司 抗pd-1抗体及其用途
GB0314057D0 (en) 2003-06-18 2003-07-23 Astrazeneca Ab Therapeutic agents
FR2856684B1 (fr) 2003-06-26 2008-04-11 Sanofi Synthelabo Derives de diphenylpyridine, leur preparation et leur application en therapeutique
CA2543644A1 (en) 2003-10-27 2005-05-06 Astellas Pharma Inc. Pyrazine derivatives and pharmaceutical use thereof
DE102004015954A1 (de) 2004-04-01 2005-11-10 Ina-Schaeffler Kg Umschlingungstrieb
TW200716594A (en) 2005-04-18 2007-05-01 Neurogen Corp Substituted heteroaryl CB1 antagonists
EP1948827B1 (en) 2005-10-21 2016-03-23 The Regents of The University of California C-kit oncogene mutations in melanoma
WO2007117699A2 (en) * 2006-04-07 2007-10-18 University Of South Florida Inhibition of shp2/ptpn11 protein tyrosine phosphatase by nsc-87877, nsc-117199 and their analogs
AU2007243280A1 (en) 2006-04-28 2007-11-08 Northwestern University Formulations containing pyridazine compounds for treating neuroinflammatory diseases
CN101679418A (zh) 2007-04-06 2010-03-24 诺瓦提斯公司 用作蛋白质激酶抑制剂的[2,6]萘啶类化合物
EP2157090A4 (en) 2007-06-21 2011-09-07 Taisho Pharmaceutical Co Ltd PYRAZINAMIDE COMPOUND
CA2695621A1 (en) 2007-08-09 2009-02-12 Merck Sharp & Dohme Corp. Pyridine carboxamide orexin receptor antagonists
WO2010011666A2 (en) 2008-07-21 2010-01-28 University Of South Florida Indoline scaffold shp-2 inhibitors and cancer treatment method
AU2009308982A1 (en) 2008-10-30 2010-05-06 Merck Sharp & Dohme Corp. Pyridazine carboxamide orexin receptor antagonists
WO2010121212A2 (en) 2009-04-17 2010-10-21 H. Lee Moffit Cancer Center And Research Institute, Inc. Indoline scaffold shp-2 inhibitors and method of treating cancer
US8163283B2 (en) 2009-09-03 2012-04-24 Vancouver Biotech Ltd. Monoclonal antibodies against gonadotropin-releasing hormone receptor
US8673913B2 (en) 2009-11-13 2014-03-18 Case Western Reserve University SHP-2 phosphatase inhibitor
JP5989547B2 (ja) 2010-03-05 2016-09-07 エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト ヒトcsf−1rに対する抗体及びその使用
GB201106829D0 (en) 2011-04-21 2011-06-01 Proximagen Ltd Heterocyclic compounds
CN103181918B (zh) * 2011-05-04 2014-10-29 厦门大学 脂肪酸类化合物在制备预防和治疗肝癌药物中的应用
US20150005311A1 (en) 2012-01-13 2015-01-01 Novartis Ag IP receptor agonist heterocyclic compounds
MX359651B (es) 2012-11-29 2018-10-05 Chemocentryx Inc Antagonistas de cxcr7.
WO2014113584A1 (en) 2013-01-16 2014-07-24 Rhode Island Hospital Compositions and methods for the prevention and treatment of osteolysis and osteoporosis
WO2014121885A1 (en) 2013-02-07 2014-08-14 Merck Patent Gmbh Substituted quinoxaline derivatives and their use as positive allosteric modulators of mglur4
JP6647868B2 (ja) 2013-02-20 2020-02-14 ノバルティス アーゲー ヒト化抗EGFRvIIIキメラ抗原受容体を用いたがんの処置
US10501531B2 (en) 2013-03-13 2019-12-10 Prothena Biosciences Limited Tau immunotherapy
JO3517B1 (ar) 2014-01-17 2020-07-05 Novartis Ag ان-ازاسبيرو الكان حلقي كبديل مركبات اريل-ان مغايرة وتركيبات لتثبيط نشاط shp2
US11331312B2 (en) 2014-04-25 2022-05-17 Memorial Sloan-Kettering Cancer Center Treatment of H-Ras-driven tumors
EP3247378B8 (en) 2015-01-09 2023-08-23 Revolution Medicines, Inc. Macrocyclic compounds that participate in cooperative binding and medical uses thereof
CN107250108B (zh) 2015-02-05 2020-11-27 特尔诺沃有限公司 用于治疗癌症的irs/stat3双重调节剂与抗癌剂的组合
WO2016151501A1 (en) * 2015-03-25 2016-09-29 Novartis Ag Pharmaceutical combinations
EP3277689B1 (en) 2015-04-03 2019-09-04 Incyte Corporation Heterocyclic compounds as lsd1 inhibitors
US10426842B2 (en) * 2015-07-15 2019-10-01 The Curators Of The University Of Missouri Targeted nanoparticle conjugate and method for co-delivery of siRNA and drug
EP4242304A3 (en) 2015-10-01 2024-02-07 Revolution Medicines, Inc. Methods and reagents for analyzing protein-protein interfaces
WO2017216706A1 (en) 2016-06-14 2017-12-21 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2018057884A1 (en) 2016-09-22 2018-03-29 Relay Therapeutics, Inc. Shp2 phosphatase inhibitors and methods of use thereof
TW202500565A (zh) 2016-10-24 2025-01-01 美商傳達治療有限公司 Shp2磷酸酶抑制劑及其使用方法
CA3048340A1 (en) 2017-01-10 2018-07-19 Novartis Ag Pharmaceutical combination comprising an alk inhibitor and a shp2 inhibitor
KR20190110588A (ko) 2017-01-23 2019-09-30 레볼루션 메디슨즈, 인크. 알로스테릭 shp2 억제제로서의 피리딘 화합물
JP7240319B2 (ja) 2017-01-23 2023-03-15 レヴォリューション・メディスンズ,インコーポレイテッド アロステリックshp2阻害剤としての二環式化合物
EA202190196A1 (ru) 2017-03-23 2021-08-31 Джакобио Фармасьютикалс Ко., Лтд. Новые гетероциклические производные, применимые в качестве ингибиторов shp2
IL269779B2 (en) 2017-04-05 2026-04-01 Revolution Medicines Inc Methods and reagents for the analysis of protein-protein interfaces
CA3058953A1 (en) 2017-04-05 2018-10-11 Revolution Medicines, Inc. Compounds that participate in cooperative binding and uses thereof
EP3630770B1 (en) 2017-05-26 2024-08-28 Relay Therapeutics, Inc. Pyrazolo[3,4-b]pyrazine derivatives as shp2 phosphatase inhibitors
CA3074690A1 (en) 2017-09-07 2019-03-14 Revolution Medicines, Inc. Shp2 inhibitor compositions and methods for treating cancer
TW201930292A (zh) 2017-10-12 2019-08-01 美商銳新醫藥公司 作為變構shp2抑制劑的吡啶、吡嗪和三嗪化合物
JP7361693B2 (ja) 2017-12-15 2023-10-16 レヴォリューション・メディスンズ,インコーポレイテッド アロステリックshp2阻害剤としての多環式化合物
MX2020010719A (es) 2018-04-10 2020-11-06 Revolution Medicines Inc Composiciones de inhibidores de shp2, metodos para tratar el cancer y metodos para identificar a un sujeto con mutaciones en shp2.
EP3860717A1 (en) 2018-10-03 2021-08-11 Gilead Sciences, Inc. Imidozopyrimidine derivatives
JP2022506887A (ja) 2018-11-07 2022-01-17 シャンハイ リンジーン バイオファーマ カンパニー リミテッド 窒素含有縮合複素環系shp2阻害剤化合物、製造方法及び使用
JP7377679B2 (ja) 2018-11-19 2023-11-10 アムジエン・インコーポレーテツド がん治療のためのkrasg12c阻害剤及び1種以上の薬学的に活性な追加の薬剤を含む併用療法
EP3889153A4 (en) 2018-11-30 2022-09-07 Tuojie Biotech (Shanghai) Co., Ltd. PYRIMIDINE AND FIVE-MEMBERED HETEROCYCLIC NITROGEN DERIVATIVE, METHOD OF MANUFACTURE THEREOF AND MEDICAL USES THEREOF
CN115141205A (zh) 2019-06-07 2022-10-04 锐新医药公司 Shp2抑制剂的固体形式

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5262564A (en) 1992-10-30 1993-11-16 Octamer, Inc. Sulfinic acid adducts of organo nitroso compounds useful as retroviral inactivating agents anti-retroviral agents and anti-tumor agents
WO2005016894A1 (en) 2003-08-15 2005-02-24 Novartis Ag 2, 4-pyrimidinediamines useful in the treatment of neoplastic diseases, inflammatory and immune system disorders
WO2011022440A2 (en) 2009-08-17 2011-02-24 Memorial Sloan-Kettering Cancer Center Heat shock protein binding compounds, compositions, and methods for making and using same
WO2015007495A1 (en) 2013-07-18 2015-01-22 Siemens Aktiengesellschaft A method and a system for machining an object
WO2015107494A1 (en) 2014-01-17 2015-07-23 Novartis Ag 1 -(triazin-3-yi_/pyridazin-3-yl)-piper(-azine)idine derivatives and compositions thereof for inhibiting the activity of shp2
WO2015107493A1 (en) 2014-01-17 2015-07-23 Novartis Ag 1 -pyridazin-/triazin-3-yl-piper(-azine)/idine/pyrolidine derivatives and and compositions thereof for inhibiting the activity of shp2
US20170204187A1 (en) 2014-06-13 2017-07-20 Genentech, Inc. Methods of treating and preventing cancer drug resistance
WO2016203405A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2016203404A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2016203406A1 (en) 2015-06-19 2016-12-22 Novartis Ag Compounds and compositions for inhibiting the activity of shp2
WO2017079723A1 (en) 2015-11-07 2017-05-11 Board Of Regents, The University Of Texas System Targeting proteins for degradation
WO2017156397A1 (en) 2016-03-11 2017-09-14 Board Of Regents, The University Of Texas Sysytem Heterocyclic inhibitors of ptpn11
WO2017211303A1 (en) 2016-06-07 2017-12-14 Jacobio Pharmaceuticals Co., Ltd. Novel heterocyclic derivatives useful as shp2 inhibitors
WO2018013597A1 (en) 2016-07-12 2018-01-18 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric shp2 inhibitors

Non-Patent Citations (51)

* Cited by examiner, † Cited by third party
Title
"Comprehensive molecular profiling of lung adenocarcinoma", NATURE, vol. 511, 2014, pages 533 - 550
"Methods in Enzymology", ACADEMIC PRESS, INC.
"Remington's Pharmaceutical Sciences, 19th ed", 1995, MACK PUBLISHING COMPANY
"Short Protocols in Molecular Biology", 1999, WILEY AND SONS
A. NIGAM AND A. AYYAGARI: "Lab Manual in Biochemistry: Immunology and Biotechnology", 2007
ARAKI, T; NAWA, H; NEEL, BG, J. BIOL. CHEM., vol. 278, 2003, pages 41677 - 41684
B. DETRICK, N. R. ROSE, AND J. D. FOLDS: "Manual of Clinical Laboratory Immunology", 2006
BENNET, AM; TANG, TL; SUGIMOTO, S; WALSH, CT; NEEL BG, PNAS, vol. 91, 1994, pages 7335 - 7339
CANCERS (BASEL)., vol. 7, no. 3, September 2015 (2015-09-01), pages 1758 - 1784
CANCERS (BASEL, vol. 7, no. 3, September 2015 (2015-09-01), pages 1758 - 1784
CHAN, R. J.; FENG, G. S.: "PTPN11 is the first identified proto-oncogene that encodes a tyrosine phosphatase", BLOOD, vol. 109, 2007, pages 862 - 867
CHEN CHUAN ET AL: "Identification of demethylincisterol A3as a selective inhibitor of protein tyrosine phosphatase Shp2", EUROPEAN JOURNAL OF PHARMACOLOGY, ELSEVIER SCIENCE, NL, vol. 795, 8 December 2016 (2016-12-08), pages 124 - 133, XP029879381, ISSN: 0014-2999, DOI: 10.1016/J.EJPHAR.2016.12.012 *
CHEN L ET AL., MOL PHARMACOL., vol. 70, no. 2, August 2006 (2006-08-01), pages 562 - 70
CHEN, YING-NAN P ET AL., NATURE, vol. 535, 7 July 2016 (2016-07-07)
CHEN, YING-NAN P., NATURE, vol. 535, 7 July 2016 (2016-07-07), pages 151
CLIN CANCER RES., vol. 17, no. 5, 1 March 2011 (2011-03-01), pages 989 - 1000
D. M. WEIR & C. C. BLACKWELL: "Handbook of Experimental Immunology", .
DOMAGALA ET AL., POL J PATHOL, vol. 3, 2012, pages 145 - 164
E. HARLOW AND D. LANE: "Using Antibodies: A Laboratory Manual", 1988
F. M. AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1987
GAO Y. ET AL., CANCER DISCOV., vol. 8, no. 5, May 2018 (2018-05-01), pages 648 - 661
GROSSMANN, K. S.; ROSARIO, M.; BIRCHMEIER, C.; BIRCHMEIER, W.: "The tyrosine phosphatase Shp2 in development and cancer", ADV. CANCER RES., vol. 106, 2010, pages 53 - 89
IVAN LEFKOVITS: "Immunology Methods Manual: The Comprehensive Sourcebook of Techniques", 1996
J. E. COLIGAN ET AL.: "Current Protocols in Immunology", 1991
J. M. MILLER & M. P. CALOS: "Gene Transfer Vectors for Mammalian Cells", 1987
J. POUND: "Immunochemical Protocols", 2003
KATH, JOHN C., EXP. OPIN. THER. PATENTS, vol. 10, no. 6, 2000, pages 803 - 818
LU, W; GONG, D; BAR-SAGI, D; COLE, PA, MOL. CELL, vol. 8, 2001, pages 759 - 769
MATOZAKI, T.; MURATA, Y.; SAITO, Y.; OKAZAWA, H.; OHNISHI, H.: "Protein tyrosine phosphatase SHP-2: a proto-oncogene product that promotes Ras activation", CANCER SCI., vol. 100, 2009, pages 1786 - 1793
MCDONALD ET AL., FEBS J., vol. 9, no. 2, 27 June 2012 (2012-06-27), pages 2156 - 2173
MOHI ET AL: "The role of Shp2 (PTPN11) in cancer", CURRENT OPINION IN GENETICS & DEVELOPMENT, CURRENT BIOLOGY LTD, XX, vol. 17, no. 1, 20 January 2007 (2007-01-20), pages 23 - 30, XP005736991, ISSN: 0959-437X, DOI: 10.1016/J.GDE.2006.12.011 *
MOHI, M. G.; NEEL, B. G.: "The role of Shp2 (PTPN11) in cancer", CURR. OPIN. GENET. DEV., vol. 17, 2007, pages 23 - 30, XP005736991, DOI: doi:10.1016/j.gde.2006.12.011
MULLIS ET AL.: "PCR: The Polymerase Chain Reaction", 1994
NICHOLS ROBERT J ET AL: "RAS nucleotide cycling underlies the SHP2 phosphatase dependence of mutant BRAF-, NF1- and RAS-driven cancers", NATURE CELL BIOLOGY, MACMILLAN MAGAZINES LTD, GB, vol. 20, no. 9, 13 August 2018 (2018-08-13), pages 1064 - 1073, XP036579143, ISSN: 1465-7392, [retrieved on 20180813], DOI: 10.1038/S41556-018-0169-1 *
NIETO, P. ET AL., NATURE, vol. 548, no. 7666, 10 August 2017 (2017-08-10), pages 239 - 243
OSTMAN, A.; HELLBERG, C.; BOHMER, F. D.: "Protein-tyrosine phosphatases and cancer", NAT. REV. CANCER, vol. 6, 2006, pages 307 - 320, XP055245205, DOI: doi:10.1038/nrc1837
P. HERDEWIJN: "Oligonucleotide Synthesis", 2004
PATRICELLI ET AL., CANCER DISCOV., vol. 6, no. 3, March 2016 (2016-03-01), pages 316 - 29
PHILPOTT ET AL., HUMAN GENOMICS, vol. 11, 2017, pages 13
PLOS ONE, vol. 9, no. 11, 25 November 2014 (2014-11-25)
PRAHALLAD, A.; BERNARDS, R. ET AL., CELL REP., vol. 12, 2015, pages 1978 - 1985
PREUSSER, M. ET AL., NAT. REV. NEUROL., 2015
R. I. FRESHNEY: "Animal Cell Culture", 1987
RUESS DIETRICH A ET AL: "MutantKRAS-driven cancers depend onPTPN11/SHP2 phosphatase", NATURE MEDICINE, NATURE PUB. CO, NEW YORK, vol. 24, no. 7, 28 May 2018 (2018-05-28), pages 954 - 960, XP036542066, ISSN: 1078-8956, [retrieved on 20180528], DOI: 10.1038/S41591-018-0024-8 *
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 3rd ed.", 2001, COLD SPRING HARBOR PRESS
SCHLESSINGER, CELL, vol. 103, 2000, pages 211 - 225
SHAWVER ET AL., DDT, vol. 2, no. 2, February 1997 (1997-02-01)
SUN, J.; LU, S.; LIN, L.; ZHUO, Y.; LIU, B.; CHIEN, S.; NEEL, B.G.; WANG, Y., NAT. COMM., vol. 4, 2013, pages 2037
WORKMAN, PAUL AND KERR, DAVID: "New Molecular Targets for Cancer Chemotherapy", 1994, CRC PRESS, article LOFTS, F. J. ET AL.: "Growth factor receptors as targets"
YAO, Z. ET AL., NATURE, vol. 548, no. 7666, 10 August 2017 (2017-08-10), pages 234 - 238
YING-NAN P. CHEN ET AL: "Allosteric inhibition of SHP2 phosphatase inhibits cancers driven by receptor tyrosine kinases", NATURE, vol. 535, no. 7610, 29 June 2016 (2016-06-29), London, pages 148 - 152, XP055295740, ISSN: 0028-0836, DOI: 10.1038/nature18621 *

Cited By (143)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11466017B2 (en) 2011-03-10 2022-10-11 Board Of Regents, The University Of Texas System Heterocyclic inhibitors of PTPN11
US11952386B2 (en) 2014-01-17 2024-04-09 Novartis Ag N-azaspirocycloalkane substituted N-heteroaryl compounds and compositions for inhibiting the activity of SHP2
US12209098B2 (en) 2014-01-17 2025-01-28 Novartis Ag N-azaspirocycloalkane substituted N-heteroaryl compounds and compositions for inhibiting the activity of SHP2
US11840536B2 (en) 2016-05-31 2023-12-12 Board Of Regents, The University Of Texas System Heterocyclic inhibitors of PTPN11
US10851110B2 (en) 2016-05-31 2020-12-01 Board Of Regents, The University Of Texas System Heterocyclic inhibitors of PTPN11
US10934285B2 (en) 2016-06-14 2021-03-02 Novartis Ag Compounds and compositions for inhibiting the activity of SHP2
US11905283B2 (en) 2016-06-14 2024-02-20 Novartis Ag Compounds and compositions for inhibiting the activity of SHP2
US10590090B2 (en) 2016-07-12 2020-03-17 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric SHP2 inhibitors
US11661401B2 (en) 2016-07-12 2023-05-30 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric SHP2 inhibitors
US12565476B2 (en) 2016-07-12 2026-03-03 Revolution Medicines, Inc. 2,5-disubstituted 3-methyl pyrazines and 2,5,6-trisubstituted 3-methyl pyrazines as allosteric SHP2 inhibitors
US11529347B2 (en) 2016-09-22 2022-12-20 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of use thereof
US11629145B2 (en) 2016-10-24 2023-04-18 D. E. Shaw Research, Llc SHP2 phosphatase inhibitors and methods of use thereof
US11673896B2 (en) 2017-01-23 2023-06-13 Revolution Medicines, Inc. Pyridine compounds as allosteric SHP2 inhibitors
US12365688B2 (en) 2017-01-23 2025-07-22 Revolution Medicines, Inc. Substituted pyrazolopyrazines, imidazopyrazines and [1,2,4]triazolopyrazines as allosteric SHP2 inhibitors
US11739093B2 (en) 2017-01-23 2023-08-29 Revolution Medicines, Inc. Substituted pyrazolopyrazines, imidazopyrazines and [1,2,4]triazolopyrazines as allosteric SHP2 inhibitors
US11591336B2 (en) 2017-05-26 2023-02-28 D. E. Shaw Research, Llc Substituted pyrazolo[3,4-b]pyrazines as SHP2 phosphatase inhibitors
US11596633B2 (en) 2017-09-07 2023-03-07 Revolution Medicines, Inc. SHP2 inhibitor compositions and methods for treating cancer
US11701354B2 (en) 2017-09-29 2023-07-18 D. E. Shaw Research, Llc Pyrazolo[3,4-b]pyrazine derivatives as SHP2 phosphatase inhibitors
US11702411B2 (en) 2017-10-12 2023-07-18 Revolution Medicines, Inc. Pyridine, pyrazine, and triazine compounds as allosteric SHP2 inhibitors
US11673901B2 (en) 2017-12-15 2023-06-13 Revolution Medicines, Inc. Polycyclic compounds as allosteric SHP2 inhibitors
US11466016B2 (en) 2018-03-02 2022-10-11 Otsuka Pharmaceutical Co., Ltd. Pharmaceutical compounds
EP4506035A2 (en) 2018-03-21 2025-02-12 Relay Therapeutics, Inc. Shp2 phosphatase inhibitors and methods of use thereof
US10934302B1 (en) 2018-03-21 2021-03-02 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of use thereof
US12331056B2 (en) 2018-03-21 2025-06-17 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of use thereof
US12138263B2 (en) 2018-03-21 2024-11-12 Relay Therapeutics, Inc. Pyrazolo[3,4-b]pyrazine SHP2 phosphatase inhibitors and methods of use thereof
WO2019183367A1 (en) 2018-03-21 2019-09-26 Relay Therapeutics, Inc. Shp2 phosphatase inhibitors and methods of use thereof
US10561655B2 (en) 2018-03-21 2020-02-18 Synblia Therapeutics, Inc. SHP2 inhibitors and uses thereof
US12084447B2 (en) 2018-03-21 2024-09-10 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of use thereof
US10954243B2 (en) 2018-05-02 2021-03-23 Navire Pharma, Inc. Substituted heterocyclic inhibitors of PTPN11
US11932643B2 (en) 2018-05-02 2024-03-19 Navire Pharma, Inc. Substituted heterocyclic inhibitors of PTPN11
US12037345B2 (en) 2018-07-24 2024-07-16 Taiho Pharmaceutical Co., Ltd. Heterobicyclic compounds for inhibiting the activity of SHP2
US11104675B2 (en) 2018-08-10 2021-08-31 Navire Pharma, Inc. PTPN11 inhibitors
US11945815B2 (en) 2018-08-10 2024-04-02 Navire Pharma, Inc. PTPN11 inhibitors
US11518772B2 (en) 2018-09-18 2022-12-06 Nikang Therapeutics, Inc. Fused tricyclic ring derivatives as Src homology-2 phosphate inhibitors
US11034705B2 (en) 2018-09-18 2021-06-15 Nikang Therapeutics, Inc. Fused tricyclic ring derivatives as Src homology-2 phosphate inhibitors
US10894797B2 (en) 2018-09-18 2021-01-19 Nikang Therapeutics, Inc. Fused tricyclic ring derivatives as SRC homology-2 phosphatase inhibitors
US11459340B2 (en) 2018-09-18 2022-10-04 Nikang Therapeutics, Inc. Tri-substituted heteroaryl derivatives as Src homology-2 phosphatase inhibitors
US12264167B2 (en) 2018-09-18 2025-04-01 Nikang Therapeutics, Inc. Fused tricyclic ring derivatives as SRC homology-2 phosphate inhibitors
US11179397B2 (en) 2018-10-03 2021-11-23 Gilead Sciences, Inc. Imidazopyrimidine derivatives
US12187721B2 (en) 2018-10-17 2025-01-07 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
WO2020081848A1 (en) 2018-10-17 2020-04-23 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
US20220160707A1 (en) * 2019-02-12 2022-05-26 Novartis Ag Pharmaceutical combination comprising tno155 and ribociclib
EP4249000A3 (en) * 2019-02-12 2023-12-27 Novartis AG Pharmaceutical combination comprising tno155 and a krasg12c inhibitor
WO2020165732A1 (en) * 2019-02-12 2020-08-20 Novartis Ag Pharmaceutical combination comprising tno155 and a krasg12c inhibitor
US12343344B2 (en) * 2019-02-12 2025-07-01 Novartis Ag Pharmaceutical combination comprising TNO155 and ribociclib
WO2020180770A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heterocyclyl compounds and uses thereof
WO2020180768A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
US11827644B2 (en) 2019-03-04 2023-11-28 Suzhou Genhouse Pharmaceutical Co., Ltd Pyrazine derivative and application thereof in inhibiting SHP2
US11033547B2 (en) 2019-03-07 2021-06-15 Merck Patent Gmbh Carboxamide-pyrimidine derivatives as SHP2 antagonists
US11696916B2 (en) 2019-03-07 2023-07-11 Merck Patent Gmbh Carboxamide-pyrimidine derivatives as SHP2 antagonists
US11884664B2 (en) 2019-04-02 2024-01-30 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
WO2020201991A1 (en) 2019-04-02 2020-10-08 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
US11634417B2 (en) 2019-04-02 2023-04-25 Array Biopharma Inc. Protein tyrosine phosphatase inhibitors
US11001561B2 (en) 2019-04-08 2021-05-11 Merck Patent Gmbh Pyrimidinone derivatives as SHP2 antagonists
US11702392B2 (en) 2019-04-08 2023-07-18 Merck Patent Gmbh Pyrimidinone derivatives as SHP2 antagonists
WO2020223177A1 (en) * 2019-04-29 2020-11-05 The Board Of Trustees Of The University Of Illinois Mek inhibitors for corneal scarring and neovascularization
US12528807B2 (en) 2019-06-07 2026-01-20 Revolution Medicines, Inc. Solid forms of {6-[(2-amino-3-chloropyridin-4-yl)sulfanyl]-3-[(3S,4S)-4-amino-3-methyl-2-oxa-8-azaspiro[4.5]decan-8-yl]-5-methylpyrazin-2-yl} methanol, a SHP2 inhibitor
US11220501B2 (en) 2019-06-07 2022-01-11 Revolution Medicines, Inc. Solid forms of {6-[(2-amino-3-chloropyridin-4-yl)sulfanyl]-3-[(3S,4S)-4-amino-3-methyl-2-oxa-8- azaspiro[4.5]decan-8-yl]-5-methylpyrazin-2-yl} methanol, a SHP2 inhibitor
CN114008035A (zh) * 2019-06-14 2022-02-01 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
CN117209471A (zh) * 2019-06-14 2023-12-12 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
WO2020249079A1 (zh) * 2019-06-14 2020-12-17 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
JP7335003B2 (ja) 2019-06-14 2023-08-29 北京盛諾基医薬科技股▲フン▼有限公司 Shp2ホスファターゼアロステリック阻害物質
CN117209475A (zh) * 2019-06-14 2023-12-12 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
US12209074B2 (en) 2019-06-14 2025-01-28 Beijing Shenogen Pharma Group Ltd. SHP2 phosphatase allosteric inhibitor
CN117209470A (zh) * 2019-06-14 2023-12-12 北京盛诺基医药科技股份有限公司 一种shp2磷酸酶变构抑制剂
JP2022535998A (ja) * 2019-06-14 2022-08-10 北京盛諾基医薬科技股▲フン▼有限公司 Shp2ホスファターゼアロステリック阻害物質
WO2021000946A1 (zh) * 2019-07-04 2021-01-07 南方科技大学 一种探针以及使用其分析蛋白质复合物的方法
US12458640B2 (en) 2019-08-20 2025-11-04 Otsuka Pharmaceutical Co., Ltd. Pyrazolo[3,4-b]pyrazine SHP2 phosphatase inhibitors
US11517573B2 (en) * 2019-09-13 2022-12-06 The Institute Of Cancer Research: Royal Cancer Hospital Therapeutic compositions, combinations, and methods of use
US20230277535A1 (en) * 2019-09-13 2023-09-07 The Institute Of Cancer Research: Royal Cancer Hospital Therapeutic compositions, combinations, and methods of use
US12280050B2 (en) * 2019-09-13 2025-04-22 The Institute Of Cancer Research: Royal Cancer Hospital Therapeutic compositions, combinations, and methods of use
US11890281B2 (en) 2019-09-24 2024-02-06 Relay Therapeutics, Inc. SHP2 phosphatase inhibitors and methods of making and using the same
WO2021073439A1 (zh) * 2019-10-14 2021-04-22 杭州雷索药业有限公司 用于抑制shp2活性的吡嗪衍生物
CN112724145A (zh) * 2019-10-14 2021-04-30 杭州雷索药业有限公司 用于抑制shp2活性的吡嗪衍生物
AU2020371295B2 (en) * 2019-10-22 2025-11-13 Lupin Limited Pharmaceutical combination of PRMT5 inhibitors
WO2021079302A1 (en) * 2019-10-22 2021-04-29 Lupin Limited Pharmaceutical combination of prmt5 inhibitors
US12447152B2 (en) 2019-10-22 2025-10-21 Lupin Limited Pharmaceutical combination of PRMT5 inhibitors
EP4696316A2 (en) 2019-11-04 2026-02-18 Revolution Medicines, Inc. Ras inhibitors
WO2021091967A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021091956A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
EP4656201A2 (en) 2019-11-04 2025-12-03 Revolution Medicines, Inc. Ras inhibitors
WO2021091982A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021092115A1 (en) 2019-11-08 2021-05-14 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
EP4620531A2 (en) 2019-11-08 2025-09-24 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
US11168102B1 (en) 2019-11-08 2021-11-09 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
US12258366B2 (en) 2019-11-08 2025-03-25 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2021108683A1 (en) 2019-11-27 2021-06-03 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
US11731984B2 (en) 2019-12-11 2023-08-22 Eli Lilly And Company KRas G12C inhibitors
WO2021127404A1 (en) 2019-12-20 2021-06-24 Erasca, Inc. Tricyclic pyridones and pyrimidones
WO2021142026A1 (en) * 2020-01-07 2021-07-15 Revolution Medicines, Inc. Shp2 inhibitor dosing and methods of treating cancer
JP2023509701A (ja) * 2020-01-07 2023-03-09 レヴォリューション・メディスンズ,インコーポレイテッド Shp2阻害剤投薬およびがんを処置する方法
US12351566B2 (en) 2020-01-10 2025-07-08 Immuneering Corporation MEK inhibitors and therapeutic uses thereof
WO2021171261A1 (en) 2020-02-28 2021-09-02 Novartis Ag A triple pharmaceutical combination comprising dabrafenib, an erk inhibitor and a shp2 inhibitor
WO2021197452A1 (zh) * 2020-04-03 2021-10-07 上海翰森生物医药科技有限公司 含氮杂芳类衍生物自由碱的晶型
WO2021257736A1 (en) 2020-06-18 2021-12-23 Revolution Medicines, Inc. Methods for delaying, preventing, and treating acquired resistance to ras inhibitors
WO2022060583A1 (en) 2020-09-03 2022-03-24 Revolution Medicines, Inc. Use of sos1 inhibitors to treat malignancies with shp2 mutations
CN120794999A (zh) * 2020-09-15 2025-10-17 锐新医药公司 作为ras抑制剂以治疗癌症的吲哚衍生物
WO2022060836A1 (en) 2020-09-15 2022-03-24 Revolution Medicines, Inc. Indole derivatives as ras inhibitors in the treatment of cancer
WO2022066805A1 (en) 2020-09-23 2022-03-31 Erasca, Inc. Tricyclic pyridones and pyrimidones
EP4259638A4 (en) * 2020-12-11 2024-10-23 Erasca, Inc. COMBINATION THERAPIES FOR THE TREATMENT OF CANCER
WO2022133345A1 (en) 2020-12-18 2022-06-23 Erasca, Inc. Tricyclic pyridones and pyrimidones
WO2022140427A1 (en) 2020-12-22 2022-06-30 Qilu Regor Therapeutics Inc. Sos1 inhibitors and uses thereof
WO2022208408A1 (en) 2021-04-01 2022-10-06 Array Biopharma Inc. Crystalline form of a shp2 inhibitor
WO2022235866A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2022235864A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors
US12390469B2 (en) 2021-05-05 2025-08-19 Huyabio International, Llc SHP2 inhibitor monotherapy and uses thereof
WO2022235870A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors for the treatment of cancer
EP4334318A4 (en) * 2021-05-05 2025-03-05 Huyabio International, LLC COMBINATION THERAPIES WITH SHP2 INHIBITORS AND PD-1 INHIBITORS
US12097203B2 (en) 2021-05-05 2024-09-24 Huyabio International, Llc Combination therapies comprising SHP2 inhibitors and PD-1 inhibitors
WO2022259157A1 (en) 2021-06-09 2022-12-15 Novartis Ag A triple pharmaceutical combination comprising dabrafenib, trametinib and a shp2 inhibitor
WO2022269525A1 (en) 2021-06-23 2022-12-29 Novartis Ag Pharmaceutical combinations comprising a kras g12c inhibitor and uses thereof for the treatment of cancers
WO2022271966A1 (en) * 2021-06-24 2022-12-29 Erasca, Inc. Shp2 and cdk4/6 inhibitors combination therapies for the treatment of cancer
WO2022271964A1 (en) * 2021-06-24 2022-12-29 Erasca, Inc. Erk1/2 and shp2 inhibitors combination therapy
WO2023031781A1 (en) 2021-09-01 2023-03-09 Novartis Ag Pharmaceutical combinations comprising a tead inhibitor and uses thereof for the treatment of cancers
WO2023059785A1 (en) * 2021-10-06 2023-04-13 Navire Pharma, Inc. Substituted pyrimidin-4(3h)-ones for use in treating cancer
WO2023060253A1 (en) 2021-10-08 2023-04-13 Revolution Medicines, Inc. Ras inhibitors
WO2023168036A1 (en) 2022-03-04 2023-09-07 Eli Lilly And Company Method of treatment including kras g12c inhibitors and shp2 inhibitors
WO2023172940A1 (en) 2022-03-08 2023-09-14 Revolution Medicines, Inc. Methods for treating immune refractory lung cancer
WO2023194443A1 (en) * 2022-04-06 2023-10-12 Heparegenix Gmbh Pharmaceutical composition for the treatment of colon and lung cancer
WO2023230205A1 (en) 2022-05-25 2023-11-30 Ikena Oncology, Inc. Mek inhibitors and uses thereof
US12509450B2 (en) 2022-06-07 2025-12-30 Verastem, Inc. Solid forms of a dual RAF/MEK inhibitor
US11873296B2 (en) 2022-06-07 2024-01-16 Verastem, Inc. Solid forms of a dual RAF/MEK inhibitor
WO2023240263A1 (en) 2022-06-10 2023-12-14 Revolution Medicines, Inc. Macrocyclic ras inhibitors
WO2024130444A1 (en) * 2022-12-23 2024-06-27 The Governing Council Of The University Of Toronto Use of dupd1 inhibitors in the treatment of inflammatory bowel disease and metabolic disorders
WO2024206858A1 (en) 2023-03-30 2024-10-03 Revolution Medicines, Inc. Compositions for inducing ras gtp hydrolysis and uses thereof
WO2024211712A1 (en) 2023-04-07 2024-10-10 Revolution Medicines, Inc. Condensed macrocyclic compounds as ras inhibitors
WO2024211663A1 (en) 2023-04-07 2024-10-10 Revolution Medicines, Inc. Condensed macrocyclic compounds as ras inhibitors
WO2024216016A1 (en) 2023-04-14 2024-10-17 Revolution Medicines, Inc. Crystalline forms of a ras inhibitor
WO2024216048A1 (en) 2023-04-14 2024-10-17 Revolution Medicines, Inc. Crystalline forms of ras inhibitors, compositions containing the same, and methods of use thereof
WO2024229406A1 (en) 2023-05-04 2024-11-07 Revolution Medicines, Inc. Combination therapy for a ras related disease or disorder
WO2025034702A1 (en) 2023-08-07 2025-02-13 Revolution Medicines, Inc. Rmc-6291 for use in the treatment of ras protein-related disease or disorder
WO2025080946A2 (en) 2023-10-12 2025-04-17 Revolution Medicines, Inc. Ras inhibitors
WO2025137507A1 (en) 2023-12-22 2025-06-26 Regor Pharmaceuticals, Inc. Sos1 inhibitors and uses thereof
WO2025171296A1 (en) 2024-02-09 2025-08-14 Revolution Medicines, Inc. Ras inhibitors
WO2025240847A1 (en) 2024-05-17 2025-11-20 Revolution Medicines, Inc. Ras inhibitors
WO2025255438A1 (en) 2024-06-07 2025-12-11 Revolution Medicines, Inc. Methods of treating a ras protein-related disease or disorder
WO2025265060A1 (en) 2024-06-21 2025-12-26 Revolution Medicines, Inc. Therapeutic compositions and methods for managing treatment-related effects
WO2026015825A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Use of ras inhibitor for treating pancreatic cancer
WO2026015796A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026015801A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026015790A1 (en) 2024-07-12 2026-01-15 Revolution Medicines, Inc. Methods of treating a ras related disease or disorder
WO2026050446A1 (en) 2024-08-29 2026-03-05 Revolution Medicines, Inc. Ras inhibitors
WO2026072904A2 (en) 2024-09-26 2026-04-02 Revolution Medicines, Inc. Compositions and methods for treating lung cancer

Also Published As

Publication number Publication date
JP7356414B2 (ja) 2023-10-04
US11596633B2 (en) 2023-03-07
JP2020533315A (ja) 2020-11-19
CO2020002588A2 (es) 2020-06-19
MX2020002608A (es) 2020-09-18
KR20200051684A (ko) 2020-05-13
TWI852912B (zh) 2024-08-21
CA3074690A1 (en) 2019-03-14
RU2020112303A (ru) 2021-10-07
US20250090532A1 (en) 2025-03-20
EP3678703A1 (en) 2020-07-15
IL272877A (en) 2020-04-30
US20240058341A1 (en) 2024-02-22
BR112020004246A2 (pt) 2020-09-01
AU2018328273A1 (en) 2020-03-12
TW201918260A (zh) 2019-05-16
JP2023139151A (ja) 2023-10-03
US20200368238A1 (en) 2020-11-26
SG11202001282UA (en) 2020-03-30
MX2023006766A (es) 2023-06-19
CN111344017A (zh) 2020-06-26

Similar Documents

Publication Publication Date Title
WO2019051084A1 (en) SHP2 INHIBITOR COMPOSITIONS AND METHODS OF TREATING CANCER
EP3863636A1 (en) Shp2 inhibitor compositions for use in treating cancer
EP3773590A1 (en) Shp2 inhibitor compositions, methods for treating cancer and methods for identifying a subject with shp2 mutations
KR20210146288A (ko) 이환식 헤테로사이클릴 화합물 및 이의 용도
KR101461680B1 (ko) 과다-증식성 장애 및 맥관형성과 관련된 질환의 치료에유용한 치환된 4-아미노-피롤로트리아진 유도체
US9718841B2 (en) Bicyclic pyrazolone compounds and methods of use
CN113474337A (zh) 作为fgfr抑制剂用于治疗癌症的7-((3,5-二甲氧基苯基)氨基)喹喔啉衍生物
JP2016538345A (ja) 癌の治療のためのRAF阻害剤としての1−(5−tert−ブチル−2−アリール−ピラゾール−3−イル)−3−[2−フルオロ−4−[3−オキソ−4H−ピリド[2,3−b]ピラジン−8−イル)オキシ]フェニル]尿素誘導体
CN112996794A (zh) 作为ret激酶抑制剂的稠合杂环化合物
CA3227902A1 (en) Compounds that inhibit pi3k isoform alpha and methods for treating cancer
US20260053761A1 (en) Use of thyromimetics for the treatment of cancer
WO2014177915A1 (en) Cancer combination therapy using imidazo[4,5-c]quinoline derivatives
JP2023507816A (ja) がんを治療するための方法及び組成物
WO2019104067A1 (en) Co-therapies including a metastasis inhibitor
WO2026090321A1 (en) Treatment of cancer with a kras inhibitor
EA049995B1 (ru) Соединения, ингибирующие изоформу альфа pi3k, и способы лечения онкологического заболевания
EA053155B1 (ru) Нацеливание на аллостерические и ортостерические карманы фосфоинозитид-3-киназы (pi3k) для лечения заболеваний
HK40081361A (en) Shp2 inhibitor dosing and methods of treating cancer
HK40060213A (en) 7-((3,5-dimethoxyphenyl)amino)quinoxaline derivatives as fgfr inhibitors for treating cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18778734

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3074690

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 122022024765

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020513824

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2020/0002588

Country of ref document: CO

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020004246

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018328273

Country of ref document: AU

Date of ref document: 20180906

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207009441

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: DZP2020000194

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 2018778734

Country of ref document: EP

Effective date: 20200407

WWP Wipo information: published in national office

Ref document number: NC2020/0002588

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112020004246

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200303

WWW Wipo information: withdrawn in national office

Ref document number: 762099

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: 272877

Country of ref document: IL

WWR Wipo information: refused in national office

Ref document number: 520411474

Country of ref document: SA