WO2017175963A1 - 연골세포 세포외기질 유래 펩타이드 - Google Patents

연골세포 세포외기질 유래 펩타이드 Download PDF

Info

Publication number
WO2017175963A1
WO2017175963A1 PCT/KR2017/001419 KR2017001419W WO2017175963A1 WO 2017175963 A1 WO2017175963 A1 WO 2017175963A1 KR 2017001419 W KR2017001419 W KR 2017001419W WO 2017175963 A1 WO2017175963 A1 WO 2017175963A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
pharmaceutical composition
preventing
corneal
amino acid
Prior art date
Application number
PCT/KR2017/001419
Other languages
English (en)
French (fr)
Inventor
양재욱
Original Assignee
주식회사 아이바이오코리아
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020160043296A external-priority patent/KR101798183B1/ko
Priority claimed from KR1020160043298A external-priority patent/KR101794713B1/ko
Priority claimed from KR1020160043300A external-priority patent/KR101810158B1/ko
Priority claimed from KR1020160043305A external-priority patent/KR101810163B1/ko
Priority to EP17779264.5A priority Critical patent/EP3441081B1/en
Priority to US16/091,998 priority patent/US10709768B2/en
Priority to JP2019503878A priority patent/JP6770169B2/ja
Priority to AU2017247626A priority patent/AU2017247626B2/en
Priority to CN201910099020.1A priority patent/CN110025765B/zh
Application filed by 주식회사 아이바이오코리아 filed Critical 주식회사 아이바이오코리아
Priority to ES17779264T priority patent/ES2819030T3/es
Priority to CN201780035505.3A priority patent/CN109310731B/zh
Priority to EP19151372.0A priority patent/EP3539559B1/en
Publication of WO2017175963A1 publication Critical patent/WO2017175963A1/ko
Priority to US16/178,618 priority patent/US10532084B2/en
Priority to AU2019200063A priority patent/AU2019200063B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/39—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0048—Eye, e.g. artificial tears
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/08—Solutions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin or cold insoluble globulin [CIG]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to novel peptides and their use.
  • Extracellular matrix is a component of tissues other than cells, consisting of three-dimensional combinations of various structural functional molecules secreted by cells, and artificial fabrication is impossible because its characteristics and functions are not fully understood. Do. The extracellular matrix plays an important role in maintaining the cellular environment while determining the physical properties of the tissue, ie stretching force, compressive strength and elasticity, and controlling osmotic pressure and ion permeation.
  • the cell possesses a number of growth factors and cytokines to determine the function of the cell, especially in the fetus, growth phase, the direction of tissue growth while regulating the differentiation of cells, increase or decrease the cell adhesion, metabolic activity.
  • Extracellular matrix is a protein such as collagen or elastin that determines the physical properties of tissues, and glycoproteins such as fibronectin and laminin attach cells and extracellular matrix. It acts like an adhesive, contains many proteoglycans such as chondroitin sulfate to maintain tissue shape and volume, and to actively interact with cells in tissues to maintain and perform tissue or organ specific functions. It serves as a support to maintain the volume so that, but the components and structure of the extracellular matrix has not yet been fully identified.
  • proteoglycans such as chondroitin sulfate to maintain tissue shape and volume, and to actively interact with cells in tissues to maintain and perform tissue or organ specific functions. It serves as a support to maintain the volume so that, but the components and structure of the extracellular matrix has not yet been fully identified.
  • the present invention is to provide a novel peptide that can prevent or treat ocular surface diseases by inhibiting or improving pathological changes caused by angiogenesis, clouding, fibrosis and inflammation of the cornea.
  • the present invention provides a peptide having an amino acid sequence represented by SEQ ID NO: 1.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of ocular surface diseases containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention provides a health food for preventing or improving ocular surface diseases containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating macular degeneration containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention provides a health food for preventing or improving macular degeneration containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating dry eye, which contains an active ingredient of a peptide having an amino acid sequence represented by SEQ ID NO: 1.
  • the present invention provides a health food for preventing or improving dry eye containing the active ingredient of the peptide having the amino acid sequence represented by SEQ ID NO: 1.
  • the novel peptide of the present invention has the effect of reducing corneal haze, angiogenesis and fibrosis and inhibiting the expression of inflammation-inducing factors in animal models in which pathological changes of the ocular surface are induced by alkaline burns, and tissue changes induced retinal And effectively inhibiting angiogenesis in the choroid, preventing and improving macular degeneration, and inhibiting or improving pathological changes in corneal epithelial cells such as decreased eye tear, irregularities on corneal surface and loss of conjunctival goblet cells.
  • the composition containing the same as an active ingredient may be provided as a pharmaceutical composition and health food for preventing or treating eye diseases.
  • Figure 2 shows the results of analyzing the purity of hydroxy proline-GQDGLAGPK peptide using HPLC.
  • Figure 3 is the result of confirming the molecular weight of hydroxy proline-GQDGLAGPK peptide through Ion-Mass.
  • FIG. 4 is a result of confirming the effect of Hyp-GQDGLAGPK in alkaline burn rabbit cornea
  • Figure 4B is a graph showing the degree of corneal angiogenesis
  • Figure 4C is a graph showing the degree of corneal turbidity
  • t -P ⁇ 0.05 vs alkali burn group value was considered significant through the test.
  • 5B is a graph showing corneal thickness.
  • FIG. 8 shows the effect of Hyp-GQDGLAGPK on inflammatory markers in alkaline burn rabbits.
  • Figure 9 shows the results confirming the angiogenesis inhibitory effect in HUVEC cells treated with collagen, GDRGD (CPI) and hydroxy proline-GQDGLAGPK (CPII).
  • Figure 13 shows the animal model after laser irradiation, 5 ⁇ g concentration of Avastin or hydroxy proline-GQDGLAGPK (CPII), respectively, and 14 days after laser irradiation RNA extracted from the retina and choroid VEGF, ICAM and MCP-1 gene Real-time RT-PCR results confirming expression levels.
  • CPII hydroxy proline-GQDGLAGPK
  • FIG. 15 shows NOD.B10.H2b mice in which NOD.B10.H2b mice were treated with physiological saline, Hyp-GQDGLAGPK, collagen, CsA, DQS, and HA. After 3, 5, 7 and 10 days physiological saline, Hyp-GQDGLAGPK, collagen, CsA, DQS and HA were administered to the eye, the tear amount of the mice was measured, and the mean ⁇ standard deviation showed quantitative results.
  • & P ⁇ 0.05 vs. CsA treatment group * P ⁇ 0.05 vs. DS 10D group.
  • FIG. 16 shows the effects of the Hyp-GQDGLAGPK peptide on corneal surface flexibility.
  • Figure 2B shows the cornea of mice treated with saline, Hyp-GQDGLAGPK, collagen, CsA, DQS and HA As a result of confirming the change of the surface smoothness score, the quantitative result was shown as the mean ⁇ standard deviation. * P ⁇ 0.05 vs.
  • FIG. 17 shows the effect of Hyp-GQDGLAGPK peptide on corneal epithelial detachment.
  • Figure 3B is a quantitative result showing the mean ⁇ standard deviation of corneal epithelial cell detachment ( * P ⁇ 0.05 vs. DS) 10D group).
  • FIG. 18 shows the effect of Hyp-GQDGLAGPK peptide on the distribution of conjunctival goblet cells.
  • Scale bar 200 ⁇ m
  • Figure 4B is a quantitative result showing the mean ⁇ standard deviation of conjunctival goblet cell distribution ( * P ⁇ 0.05 vs. DS 10D group).
  • FIG. 19 shows immunohistochemical analysis of TNF- ⁇ , ICAM-1, VCAM-1, MMP-2 and MMP-9 expression levels in lacrimal glands of NOD.B10.H2b mice.
  • the present invention provides a peptide having an amino acid sequence represented by SEQ ID NO: 1.
  • the peptide may be hydroxy proline (Hyd), and more preferably, hydroxy proline-GQDGLAGPK (Hydroxy proline-GQDGLAGPK).
  • the peptide may be derived from collagen type II ⁇ 1, and the collagen type II ⁇ 1 may be isolated from animal chondrocyte-derived extracellular matrix.
  • the chondrocyte-derived extracellular matrix may be isolated from the chondrocyte-derived extracellular matrix formed by secretion from animal cartilage tissue and / or cartilage-derived chondrocytes, and the animal may be a pig, a horse, a cow, a sheep, a goat, or a monkey. It may be selected from the group consisting of, but is not limited thereto.
  • peptide of the present invention is generally a compound in which two or more ⁇ -amino acids are linked by peptide bonds, and are referred to as dipeptides, tripeptides, tetrapeptides, etc., depending on the number of constituent amino acids. Oligopeptides, which have a number of peptide bonds, are called polypeptides.
  • peptides of the present invention are prepared using chemical methods (Peptide Chemistry, A practical Textbook. Mikos Bodansky, Springer-Verlag, Berlin.). For example, peptides are synthesized by solid phase technology (Roberge JY et al (1995) Science 269: 202-204), cleaved in resin and subjected to high performance liquid chromatography (e.g. Creighton (1983) Protein Structures And Molecular Principles, WH Freeman and Co, New York NY).
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of ocular surface diseases containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the ocular surface disease may be any one selected from the group consisting of corneal haze, corneal neovascularization, corneal inflammation and corneal fibrosis.
  • corneal haze appeared immediately after alkali burn, as shown in FIG. 4A, and corneal angiogenesis and cloudiness increased after 7 days of alkali burn, but corneal blood vessels were increased.
  • the corneal haze score of the control group was significantly increased to 3.0 ⁇ 0.0 as shown in FIGS. 4B and 4C.
  • Figure 4B it was confirmed that the decrease in turbidity in the experimental group treated with the peptide.
  • Masson's trichrome staining was performed to determine the effect of Hyp-GQDGLAGPK peptide on the fibrosis of the cornea induced by alkali burns. It was confirmed that brown fibroblast formation was increased in the stromal portion by burns, but the increase in fibroblasts was suppressed in the experimental group treated with the Hyp-GQDGLAGPK peptide.
  • the epithelial proliferation, inflammatory cell invasion, interstitial edema and neovascularization were induced by the alkaline burn. It was confirmed.
  • corneal sections such as macrophages, TNF ⁇ , ICAM-1, IL-1 ⁇ , IL-6 and MMP-9
  • inflammatory markers corneal sections such as macrophages, TNF ⁇ , ICAM-1, IL-1 ⁇ , IL-6 and MMP-9
  • alkaline burns increased macrophage expression in epithelium, subepithelial and proliferative substrate, whereas macrophage expression was not observed in the experimental group treated with Hyp-GQDGLAGPK peptide. It was confirmed that it was effectively suppressed.
  • Hyp-GQDGLAGPK peptide is effective in preventing or treating ocular surface diseases such as corneal haze, corneal neovascularization, corneal inflammation and corneal fibrosis.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be derived from collagen type II ⁇ 1 isolated from a chondrocyte-derived extracellular matrix (CDEM).
  • the chondrocyte-derived extracellular matrix may be isolated from the chondrocyte-derived extracellular matrix formed by secretion from the chondrocyte and / or chondrocyte-derived chondrocytes of the animal, wherein the animal is a pig, a horse, a cow, It may be selected from the group consisting of sheep, goats and monkeys, but is not limited thereto.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be a peptide whose first amino acid is hydroxy proline, and more preferably, hydroxy proline-GQDGLAGPK (Hydroxy proline (Hyp) -GQDGLAGPK). have.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be contained in 0.1 to 50 parts by weight based on 100 parts by weight of the total pharmaceutical composition.
  • the pharmaceutical composition may be any one formulation selected from the group consisting of eye drops, injections, granules, tablets, pills, capsules, gels, syrups, suspensions, emulsions, drops and solutions.
  • the present invention can provide a health food for preventing or improving ocular surface diseases containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention can provide a pharmaceutical composition for preventing or treating macular degeneration containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the peptide may be derived from collagen type II ⁇ 1.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be a peptide in which the first amino acid is hydroxy proline, and more preferably, hydroxy proline-GQDGLAGPK (Hydroxy proline-GQDGLAGPK).
  • the peptide may prevent or treat macular degeneration by inhibiting neovascularization of the eye, and the macular degeneration may be senile macular degeneration, but is not limited thereto.
  • the mouse was irradiated with laser damage to the eyeball, and after 14 days, the eye was extracted and H & E staining was performed.
  • choroidal neovascular inhibitory effect of hydroxyproline-GQDGLAGPK (CPII), which showed the best anti-angiogenic activity in the in vitro tube formation experiment, was compared with Avastin, a positive control group, as shown in FIG. 11.
  • the lesion size was significantly reduced than that of the control group, and the same concentration of Avastin was found to be similar to the lesion size of the treated positive control group.
  • the hydroxy proline-GQDGLAGPK peptide from the above results can exhibit an excellent therapeutic effect on senile macular degeneration caused by angiogenesis.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be contained in 0.1 to 50 parts by weight based on 100 parts by weight of the total pharmaceutical composition.
  • the pharmaceutical composition may be any one formulation selected from the group consisting of eye drops, injections, granules, tablets, pills, capsules, gels, syrups, suspensions, emulsions, drops and solutions.
  • the present invention can provide a health food for preventing or improving macular degeneration containing a peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of dry eye containing the peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the peptide having the amino acid sequence represented by SEQ ID NO: 1 may be derived from collagen type II ⁇ 1 (collagen type II ⁇ 1).
  • the peptide may be a peptide isolated from chondrocyte-derived extracellular matrix (CDEM), and the chondrocyte-derived extracellular matrix may be derived from chondrocytes and / or cartilage-derived chondrocytes of animals. It may be isolated from the chondrocyte-derived extracellular matrix formed by secretion, the animal may be selected from the group consisting of pigs, horses, cattle, sheep, goats and monkeys, but is not limited thereto.
  • CDEM chondrocyte-derived extracellular matrix
  • the animal may be selected from the group consisting of pigs, horses, cattle, sheep, goats and monkeys, but is not limited thereto.
  • the peptide may be a peptide in which the first amino acid is hydroxy proline, and more preferably hydroxy proline-GQDGLAGPK [Hydroxy proline (Hyp) -GQDGLAGPK].
  • the peptides may reduce tear formation and dry corneal surface imbalance due to dry stress, and inhibit peeling of corneal epithelial cells and generation of inflammatory factors.
  • the amount of tears in the mice exposed to the dry stress was reduced by about 85.5% compared to the normal group (0.22 ⁇ 0.01 ⁇ L) (DS 10D group, 0.03 ⁇ 0.01 ⁇ L, p ⁇ 0.05).
  • the tear volume increased by 7.9 times (p ⁇ 0.05) at 10 days after treatment, and the saline treated group (0.08 ⁇ 0.01 ⁇ L) was negative control. It was confirmed that the tear amount was increased by about 1.7 times (p ⁇ 0.05) than that of the collagen treated group (0.13 ⁇ 0.02 ⁇ L), which was about 2.8 times (p ⁇ 0.05).
  • the tear amount of the Hyp-GQDGLAGPK treatment group was 1.7 times (p ⁇ 0.05), 1.4, respectively. As folds (p ⁇ 0.05) and 1.6 folds (p ⁇ 0.05) were increased, the effect of Hyp-GQDGLAGPK on tear improvement was found to be more effective than currently available dry eye treatments.
  • the peptide may be contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the pharmaceutical composition.
  • the pharmaceutical composition may be any one formulation selected from the group consisting of eye drops, injections, granules, tablets, pills, capsules, gels, syrups, suspensions, emulsions, drops and solutions.
  • the present invention can provide a health food for preventing or improving dry eye containing the peptide having the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the pharmaceutical composition for preventing or treating ocular surface diseases comprising the peptide as an active ingredient is suitable carriers, excipients, disintegrants, sweeteners, coatings, expanding agents, commonly used in the manufacture of pharmaceutical compositions, It may further comprise one or more additives selected from the group consisting of lubricants, lubricants, flavors, antioxidants, buffers, bacteriostatics, diluents, dispersants, surfactants, binders and lubricants.
  • the carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil can be used, and solid preparations for oral administration include tablets, pills, powders, granules, capsules.
  • solid preparations may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the composition.
  • excipients such as starch, calcium carbonate, sucrose or lactose, gelatin and the like
  • lubricants such as magnesium styrate and talc may also be used.
  • Oral liquid preparations include suspensions, solvents, emulsions, syrups, and the like, and may include various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and the like.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • Witsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like may be used as the base material of the suppository.
  • the pharmaceutical composition is intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, nasal, inhaled, topical, rectal, oral, intraocular or intradermal Via the route can be administered to the subject in a conventional manner.
  • Preferred dosages of the peptides may vary depending on the condition and weight of the subject, the type and extent of the disease, the form of the drug, the route of administration and the duration and may be appropriately selected by those skilled in the art.
  • the daily dosage may be 0.01 to 200 mg / kg, specifically 0.1 to 200 mg / kg, more specifically 0.1 to 100 mg / kg.
  • Administration may be administered once a day or divided into several times, thereby not limiting the scope of the invention.
  • the 'subject' may be a mammal including a human, but is not limited thereto.
  • the health food is used in conjunction with other food or food additives in addition to the peptide of the present invention, can be suitably used according to a conventional method.
  • the mixed amount of the active ingredient can be suitably determined depending on the purpose of use thereof, for example, prophylactic, health or therapeutic treatment.
  • the effective dose of the compound contained in the health food may be used in accordance with the effective dose of the therapeutic agent, but may be less than the above range in the case of long-term intake for health and hygiene purposes or health control purposes It is evident that the component can be used in an amount above the range because there is no problem in terms of safety.
  • New Zealand white rabbits weighing 2.0 to 2.5 kg were purchased from Samtako (Osan, Korea), ketamine hydrochloride (30 mg / kg body weight, Huons, Jecheon, Korea) and xylazine hydrochloride (2.5 mg / kg, Bayer) Korea Ltd., Seoul, Korea), the mixture was injected into the muscle and general anesthesia, and local anesthesia using alkaline propracaine eye drops (Alcon Inc., Seoul, Korea).
  • Alkaline burn group was administered with saline 4 times daily
  • peptide treated group was administered with 10 mg / mL Hyp-GQDGLAGPK peptide 4 times daily
  • the left eye was used as a control.
  • H & E staining After treatment with each treatment material for 10 days in the above method, H & E staining, Masson's trichrome staining and immunohistochemical staining (immunohistochemistry) were performed to confirm the changes in fibrosis, angiogenesis, inflammation and corneal structure.
  • Corneal neovascularization was evaluated from 0 to 3 points. If angiogenesis does not occur, it is assessed as 0 points, 1 point for angiogenesis around the cornea, 2 points for angiogenesis to the edge of the pupil, and 3 points for angiogenesis beyond the edge of the pupil. In the case of corneal angiogenesis evaluation, it was evaluated as 3 points if it was difficult to evaluate the degree of corneal angiogenesis due to the formation of significant haze and extensive gum adhesion.
  • corneal haze was evaluated from 0 to 3 points. 0 point for transparent cornea with clear iris, 1 point for partial turbidity in iris area, 2 points for rim of eye and weak part of iris, and 3 points for opacity of iris and eye part completely turbid Evaluated.
  • OCT optimal cutting temperature compound
  • Tissue sections were cut to 6 ⁇ m thickness and used for immunohistochemical analysis.
  • tissue sections were fixed with 3.5% paraformaldehyde, permeated 0.1% Triton X-100, inactivated 2% bovine serum albumin (BSA; all from Sigma, St. Louis, MO), and anti-CD31 ( 1: 1,000; Abcam Inc., Cambridge, MA), anti-bFGF (1: 1,000; Bioss Inc., Woburn, MA), anti-IL-1 ⁇ , anti-IL-6 (1: 1,000; Cloud-Clone Corp , Houston, TX), anti-MMP-9, anti-ICMA-1, anti-TNF ⁇ , anti-macrophage / monocytes (1: 1,000; Abnova Crop., Taipei, Taiwan) and anti-VEGF-A (Abbiotec , San Diego, CA) incubated overnight at 4 ° C with primary antibody.
  • BSA bovine serum albumin
  • DAB diaminobenzidine
  • Sections stained in this manner were photographed with a virtual microscope (NanoZoomer 2.0 RS, Hamamatsu, Japan).
  • hydroxyproline-GQDGLAGPK was confirmed by a tubing assay using human vascular endothelial cells (HUVEC).
  • HUVEC cells Staining HUVEC cells with calcein-AM and dispensing them in 48-well plates coated with Matrigel, concentration-treated collagen, CPI and CPII with 50 ng / ml recombinant human VEGF and in a 37 ° C. incubator After 4 hours, tube formation was observed with a fluorescence microscope (Leica), and the tube length was analyzed by Image lab software (Bio-Rad Laboratories).
  • C57BL / 6 mice were purchased from Orient Bio, and the animal experiments were performed according to the guidelines approved by Inje University College of Medicine (No, 2013-053) and ARVO for animal use for eye and vision studies.
  • Six-week-old C57BL / 6 mice were injured in the retinal optic nerve area using a diode green laser (532 nm, 150 mW, 0.1 sec, 50 ⁇ M, photocoagulator).
  • CP1, CPII, and positive control Avastin were dissolved in PBS and administered intraocularly for 5 days at 5 mg per day.
  • Each experimental group performed the experiment using both eyes of 5 mice each.
  • tissue samples treated in this way were stained with hematoxylin & eosin (H & E) and photographed and analyzed using a virtual microscope (NanoZoomer 2.0 RS, Hamamatsu, Japan).
  • mice were anesthetized and injected 100 ml retro-orbital with 25 mg / ml FITC-dextran. After 30 minutes, the mice were euthanized and the eyes were extracted, fixed with 10% formalin, and the cornea and lens were removed and mounted flat on the cover glass. New blood vessels stained with FITC-dextran were observed by fluorescence microscopy (Leica), and the lesion size was measured by Image J program.
  • RNA was extracted from the retinal and choroid mixtures of extracted mouse eye using RNeasy Mini kit (Qiagen), oligo (dT) primer and reverse transcriptase. CDNA was synthesized using. PCR products were amplified using the specific primer set of Table 1 (Cosmojintech, Korea) and SYBR Green PCR 2X PreMix (Enzynomics). 40 PCR cycles were performed for 15 seconds at 95 ° C, 30 seconds at 60 ° C, and 15 seconds at 72 ° C. Relative quantification was performed using the 2- (DDCT) method [Livak and Schmittgen, 2001; DDCT (CT, target-CT, actin) treatment (CT, target-CT, actin) control].
  • Target Primer sequence (5 ' ⁇ 3') Forward direction Reverse VEGF ATGAACTTTCTGCTGTCTTGGGTG TCACCGCCTCGGCTTGTCACA ICAM TGCGTTTTGGAGCTAGCGGACCA CGAGGACCATACAGCACGTGCCAG MCP-1 TGGCAAGATGATCCCAATGA GCAGCACTGTTCGTCACTTCA GAPDH ATGGTGAAGGTCGGTGTGAAC GTGCCGTTGAATTTGCCGTGA
  • mice The retina and choroid mixtures of mice were dissolved in Pro-PREP buffer (iNtRON) containing a protease inhibitory cocktail and a phosphatase inhibitory cocktail, and the proteins were extracted.
  • Pro-PREP buffer iNtRON
  • the extracted protein was quantified using a BCA assay kit (Pierce), mixed with SDS gel loading buffer and boiled at 100 ° C. for 5 minutes for denaturation. Proteins electrophoresed on SDS-PAGE gels were transferred to nitro cellulose membranes (Millipore), after which the membranes were left for 1 hour in 5% skim milk to block nonspecific protein binding, followed by VEGF, Flk-1, Flt- 1, Angiopoetin-2 and ⁇ -actin (Santa Cruz Biotechnology) were treated to perform a general immunoblot. Subsequently, the transreactive protein was detected by ECL kit (Advansta) and multiple Gel DOC system.
  • NOD.B10.H2 b mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA). Animal experiments were performed according to the guidelines approved by Inje University School of Medicine (No .; 2014-029) and ARVO for the use of animals for eye and vision studies. 12-16 week old NOD.B10.H2 b mice were exposed to 40-50% ambient humidity and fan ventilation for 18 hours a day under dry stress and injected subcutaneously with 0.5 mg / 0.2 mL muscarinic receptor blocker. In addition, scopolamine hydrobromide (Sigma-Aldrich, St. Louis, MO) was injected alternately into the hips of mice four times a day at 9 am, 12 pm, 3 pm and 6 pm for 10 days. . Mice treated with this method were euthanized after 10 days and did not limit animal behavior and food and water intake during the experiment.
  • Tear formation was reported using phenol red-impregnated cotton threads; Zone-Quick; Oasis, Glendora, Calif. (Villareal AL, Farley W, Pflugfelder SC. Effect of topical ophthalmic epinastine and olopatadine on tear volume in mice.Eye Contact Lens. 2006; 32 (6): 272-276.).
  • the tear amount was expressed in millimeters by using a medical tweezers for 20 seconds, the thread was placed in the lateral angle and the thread which turned wet and turned red was observed by a microscope (SZX7; Olympus corp, Tokyo, Japan).
  • the measured intramillimeter tears were compared to a standard curve represented by cotton thread moistened with a basic solution (1500 mL of 0.9% saline and 5 mL of 5 N NaOH) of anticipated volume of mice for 20 seconds.
  • the flexibility of the corneal surface was obtained by reflecting the white ring from the optical fiber ring illumination of stereomicroscope (SZX7; Olympus) after anesthetizing the animal.
  • Corneal smoothness was assessed by grading the irregularities of the corneal epithelial cells reflected in the white ring of the digital image.
  • the corneal irregularity severity score was calculated by dividing the reflective ring into quadrants and ranking them according to the degree of irregularity. No irregularity is grade 0, quarter equality is grade 1; Irregularities of two quarters; Three quarters of irregularities of grade 3; All four degree of irregularity; All rings were checked with a severity of 5 ratings.
  • Protein analysis of extracellular matrix derived from animal chondrocytes was performed in Baek's group of Center of Biomedical Mass Sepctrometry (Diatech Korea Co., Ltd., Seoul, Korea).
  • hydroxyproline-GQDGLAGPK (Hydroxy proline-GQDGLAGPK; Hyp-GQDGLAGPK; SEQ ID NO: 1) corresponding to a part of the amino acid sequence of collagen type II ⁇ 1 protein was obtained. ) was synthesized in BIOCELTRAN (Chuncheon, Korea).
  • corneal alkali burn Seven days after corneal alkali burn, a clinical evaluation of corneal angiogenesis and clouding was performed.
  • corneal haze appeared immediately after alkaline burn, and corneal angiogenesis and haze increased after 7 days of alkali burn.
  • Hyp-GQDGLAGPK peptide was effective in inhibiting corneal clouding.
  • the corneal thickness increased from 526.6 ⁇ m in the normal range to 960.6 ⁇ m after the alkali burn as shown in FIG. 5B.
  • the experimental group treated with the peptide showed that the corneal thickness was reduced to 550.0 ⁇ m (p ⁇ 0.05) compared with the alkaline burn group.
  • Masson's trichrome staining was performed to determine the effect of Hyp-GQDGLAGPK peptide on the fibrosis of cornea induced by alkali burns.
  • Hyp-GQDGLAGPK peptide was effective in inhibiting corneal fibrosis by inhibiting the increase of fibroblasts.
  • H & E staining was performed to confirm the histological changes of the cornea following alkaline burns.
  • Hyp-GQDGLAGPK peptide affects angiogenesis
  • the alkaline burned cornea was treated with Hyp-GQDGLAGPK peptide, and CD31, FGF and VEGF, which are specific markers of corneal angiogenesis, were used. Corneal sections were immunostained.
  • CD31, FGF and VEGF angiogenesis markers were confirmed to be strongly expressed in fibrotic stromal cells following alkaline burns.
  • Hyp-GQDGLAGPK peptide was effective in inhibiting corneal angiogenesis.
  • the alkaline burn increased the expression of macrophages in the epithelium, subepithelial and proliferative substrates, whereas macrophage expression was effectively suppressed in the experimental group treated with the Hyp-GQDGLAGPK peptide.
  • expression of inflammatory cytokines and ICAM-1 adhesion molecules including TNF ⁇ , IL-1 ⁇ , and IL-6 was confirmed, but the expression of the inflammatory factors was reduced in the experimental group treated with peptides.
  • the expression of MMP-9 was strongly expressed in the cornea of the alkaline burn group, whereas the expression of MMP-9 was suppressed in the experimental group treated with the peptide.
  • Tubing assay using human vascular endothelial cells was performed to confirm the antiangiogenic effect of hydroxyproline-GQDGLAGPK.
  • tube formation was increased by about 1.5 times or more than in the VEGF-untreated group, while in the experimental group treated with collagen, CPI, and CPII, all angiogenesis was significantly inhibited.
  • CPII inhibited tube formation in a concentration-dependent manner, and decreased almost identical to the degree of angiogenesis in the VEGF-untreated group. It was also found to be similar to the Avastin-treated group for treating age-related macular degeneration.
  • the mouse was irradiated with laser in the same manner as in Experimental Example 8, and after 14 days of laser irradiation, the eye was extracted and H & E staining was performed.
  • CPII hydroxyproline-GQDGLAGPK
  • the lesion size of the CPII treatment group was significantly reduced than the lesion size of the control group, as shown in FIG.
  • VEGF which is a representative neovascular gene
  • ICAM and MCP-1 genes were found to be about 300-fold and 10-fold increase in expression in the laser treatment group, respectively, but this was also found to be significantly reduced in the CPII treatment group.
  • proteins were extracted from the retina and choroid to evaluate the effect of CPII on the expression of angiogenesis-related protein markers, and VEGF, VEGFR-1 (Flt-1), VEGR-2 (Flk-1). ) And immunoblotting of Angiopoietin 2 was performed.
  • the degree of tear formation was measured by phenol red-impregnated cotton threads.
  • the dry stress was found to be reduced to about 85.5% significant level compared to the normal group (0.22 ⁇ 0.01 ⁇ L) of the NOD.B10.H2 b mice (DS 10D group, 0.03 ⁇ 0.01 ⁇ L, p ⁇ 0.05).
  • the hyp-GQDGLAGPK treated group (0.23 ⁇ 0.02 ⁇ L) increased the tear amount by 7.9 times (p ⁇ 0.05) after 10 days of dry stress, compared to the normal saline treated group (0.08 ⁇ 0.01 ⁇ L).
  • About 2.8 times (p ⁇ 0.05), compared with the positive control collagen treatment group (0.13 ⁇ 0.02 ⁇ L) tear amount was increased about 1.7 times (p ⁇ 0.05) was confirmed.
  • the amount of tears in the Hyp-GQDGLAGPK treatment group was 1.7 times, respectively. (p ⁇ 0.05), 1.4-fold (p ⁇ 0.05) and 1.6-fold (p ⁇ 0.05).
  • Hyp-GQDGLAGPK restores the reduced tear amount to a higher level than the currently available dry eye treatment.
  • the degree of curvature of the corneal surface of each experimental group was quantified to confirm the flexibility of the corneal surface.
  • the degree of curvature of the corneal surface of the mice exposed to dry stress for 10 days was increased by about 13 times (4.33 ⁇ 0.58 points; p ⁇ 0.05) compared to the normal cornea (0.33 ⁇ 0.58 points).
  • the curvature of corneal surface was significantly decreased by 53.8% ( p ⁇ 0.05) at 10 days after Hyp-GQDGLAGPK treatment group (2.0 ⁇ 0 points) after removal of dry stress, and the normal saline treatment group (3.33 ⁇ 1.53 points) was negative.
  • 40% ( p ⁇ 0.05), and 45.5% ( p ⁇ 0.05) than the collagen treatment group (3.67 ⁇ 1.16 points) that was a positive control group was confirmed.
  • Hyp-GQDGLAGPK is more effective in improving the corneal surface flexibility than the dry eye treatment.
  • corneas of mice in each experimental group were H & E stained.
  • epithelial cell detachment of the cornea increased by 24 times by dry stress (2.29 ⁇ 0.57 / 0.1 mm 2 , p ⁇ 0.05).
  • corneal epithelial detachment was decreased by 83.3% ( p ⁇ 0.05) in the Hyp-GQDGLAGPK treated group (0.38 ⁇ 0.17 / 0.1 mm 2 ) after dry stress removal.
  • 71.4% ( p ⁇ 0.05) corneal epithelial detachment was reduced compared to the normal control group (1.33 ⁇ 0.17 / 0.1mm 2 ), which was the negative control group, and the collagen treatment group (0.86 ⁇ 0.29 / 0.1mm 2 ) was a positive control group.
  • 55.6% ( p ⁇ 0.05) corneal epithelial cell detachment was reduced.
  • Hyp-GQDGLAGPK is more effective in reducing the detachment of corneal epithelial cells than the dry eye treatment.
  • TNF- ⁇ , ICAM-1, VCAM-1, MMP-2 and MMP-9 was performed in lacrimal glands to evaluate the effect of Hyp-GQDGLAGPK on the expression of inflammatory response factors in dry eye mouse models.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드에 관한 것으로, 보다 상세하게는 동물연골세포 유래 세포외기질에서 분리된 콜라겐 타입 II α1 기반의 펩타이드 및 이의 용도를 제공하고자 한다.

Description

연골세포 세포외기질 유래 펩타이드
본 발명은 신규한 펩타이드 및 이의 용도에 관한 것이다.
세포외기질(extracellular matrix; ECM)은 조직에서 세포를 제외한 나머지 성분으로, 세포들이 분비한 다양한 구조적 기능적 분자들의 3차원적 조합으로 이루어져 있으며, 아직 그 특성 및 기능을 완전히 밝혀내지 못하여 인공적 제작은 불가능하다. 세포외기질은 조직의 모양을 이루면서 조직의 물리적 성질, 즉 신연력, 압축강도와 탄력성을 결정하고, 삼투압, 이온의 투과 등을 조절하면서 세포의 환경을 유지하는 중요한 역할을 한다.
또한, 많은 성장인자와 사이토카인을 보유하고 있어 세포의 기능을 결정하는 역할을 하는데 특히 태아, 성장기에는 세포의 분화를 조절하거나, 세포의 접착, 대사활동을 증감시키면서 조직 성장의 방향을 제시한다.
세포외기질은 교원질(collagen), 엘라스틴(elastin)과 같은 단백질로 조직의 물리적 성질을 결정하며, 피브로넥틴(fibronectin), 라미닌(laminin)과 같은 당단백질(glycoprotein)이 세포와 세포외기질을 붙여주는 접착제와 같은 역할을 하고, chondroitin sulfate와 같은 많은 단백당(proteoglycan)이 있어 조직의 모양과 부피를 유지하고, 조직내에서 세포들과 활발한 상호작용을 하여 조직이나 장기 고유의 기능을 유지하고 수행할 수 있도록 부피를 유지하는 지지체 역할을 하고 있으나, 세포외기질의 성분과 구조는 아직 완전히 규명되지 않았다.
본 발명은 각막의 혈관신생, 혼탁화, 섬유화 및 염증에 따른 병리학적 변화를 억제 또는 개선하여 안구 표면질환을 예방하거나 치료할 수 있는 신규한 펩타이드를 제공하고자 한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 개선용 건강식품을 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 개선용 건강식품을 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분을 함유하는 건성안 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분을 함유하는 건성안 예방 또는 개선용 건강식품을 제공한다.
본 발명의 신규한 펩타이드는 알칼리 화상으로 안구 표면의 병리학적 변화가 유도된 동물모델에서 각막 혼탁, 혈관신생 및 섬유화를 감소시키고 염증 유발인자의 발현을 억제하는 효과를 나타내며, 조직변화가 유도된 망막 및 맥락막에서 혈관신생을 효과적으로 억제하여 황반변성을 예방 및 개선하고, 안구의 눈물량 감소, 각막 표면의 불규칙성 및 결막 배상세포 손실과 같은 각막 상피세포의 병리학적 변화를 억제 또는 개선하는 것으로 확인됨에 따라, 이를 유효성분으로 함유하는 조성물을 안구 질환 예방 또는 치료용 약학조성물 및 건강식품로 제공할 수 있다.
도 1은 합성된 히드록시 프롤린-GQDGLAGPK 펩타이드의 결과보고서이다.
도 2는 HPLC를 이용하여 히드록시 프롤린-GQDGLAGPK 펩타이드의 순도를 분석한 결과이다.
도 3은 Ion-Mass를 통하여 히드록시 프롤린-GQDGLAGPK 펩타이드의 분자량을 확인한 결과이다.
도 4는 알칼리 화상 토끼 각막에서 Hyp-GQDGLAGPK의 효과를 확인한 결과로, 도 4A는 알칼리 화상 후 0, 7 및 17일째 토끼 각막을 현미경(SZX7, Olympus, Tokyo, Japan)으로 촬영한 사진이며(Scale bar=10 mm), 도 4B는 각막 혈관신생 정도를 나타낸 그래프이며, 도 4C는 각막 혼탁화 정도를 나타낸 그래프로, 그래프 값은 각 실험군(n=5)의 평균±표준편차를 나타낸 것이며, t-테스트를 통하여 *P<0.05 vs 알칼리 화상군 값을 유의한 값으로 보았다.
도 5는 알칼리 화상 토끼 각막의 두께 변화에 대한 Hyp-GQDGLAGPK의 효과를 확인한 결과로, 도 5A는 가상 현미경(NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영한 조직 절편 사진이며(Scale bar=1 mm), 도 5B는 각막 두께를 나타내는 그래프이다.
도 6은 알칼리 화상 토끼에서 섬유화 변화에 대한 Hyp-GQDGLAGPK의 효과를 확인하기 위하여, 안구 섬유아세포를 Masson's trichrome 염색법으로 면역염색하고 가상 현미경(NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영한 사진(Scale bar=100 μm)으로, 갈색으로 나타난 부분이 섬유아세포이다.
도 7은 알칼리 화상 토끼에서 혈관신생 마커에 대한 Hyp-GQDGLAGPK의 효과를 확인한 결과로, 특이적 항체인 CD31, FGF 및 VEGF로 면역염색된 조직 절편을 가상 현미경(NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영한 사진이다(Scale bar=300 μm).
도 8은 알칼리 화상 토끼에서 염증 마커에 대한 Hyp-GQDGLAGPK의 효과를 확인한 결과로, 조직 절편을 대식세포, TNFα, ICAM-1, IL-1β, IL-6 및 MMP-9와 같은 특이적 항체로 면역염색 후 가상 현미경(NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 활영한 사진이다(Scale bar=300 μm).
도 9는 콜라겐, GDRGD(CPI) 및 히드록시 프롤린-GQDGLAGPK(CPII)가 처리된 HUVEC 세포에서 혈관형성 억제 효과를 확인한 결과이다.
도 10은 레이저 조사 14일 후 레이저 조사에 따른 조직 붕괴 및 신생혈관 형성 정도를 확인한 결과이다.
도 11은 동물모델에 레이저 조사 후, 2, 10 및 20 μg 농도의 콜라겐 또는 2 내지 20 μg 농도의 GDRGD(CPI) 및 히드록시 프롤린-GQDGLAGPK(CPII)를 각각 처리하여 맥락막 신생혈관 억제 효과를 확인한 결과이다.
12는 동물모델에 레이저 조사 후, 5 μg 농도의 아바스틴 또는 히드록시 프롤린-GQDGLAGPK(CPII)를 각각 처리하여 맥락막 신생혈관 억제 효과를 확인한 결과이다.
도 13은 동물모델에 레이저 조사 후, 5 μg 농도의 아바스틴 또는 히드록시 프롤린-GQDGLAGPK(CPII)를 각각 처리하고, 레이저 조사 14일 후 망막 및 맥락막에서 RNA를 추출하여 VEGF, ICAM 및 MCP-1 유전자 발현 수준을 확인한 실시간 RT-PCR 결과이다.
도 14는 동물모델에 레이저 조사 후, 5 μg 농도의 아바스틴 또는 히드록시 프롤린-GQDGLAGPK(CPII)를 각각 처리하고, 레이저 조사 14일 후 망막 및 맥락막 추출물에서 VEGF, VEGFR-1(Flt-1), VEGR-2(Flk-1) 및 Angiopoietin 2 단백질 발현 수준을 확인한 웨스턴 블롯 결과이다.
도 15는 건조 스트레스가 제거된 NOD.B10.H2b 생쥐에 각각 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA 처리에 따른 각 생쥐의 눈물량 변화를 확인한 결과로, NOD.B10.H2b 생쥐에 3, 5, 7 및 10일간 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA를 안구에 투여한 후 생쥐의 눈물량을 측정하고 평균 ± 표준편차로 정량적 결과를 나타내었다. *P < 0.05 vs. DS 10D군. #P < 0.05 vs. 생리식염수군. §P < 0.05 vs. Hyp-GQDGLAGPK 처리군. P < 0.05 vs. CsA 처리군. †P < 0.05 vs. DQS 처리군. ＆P < 0.05 vs. CsA 처리군.
도 16은 Hyp-GQDGLAGPK 펩타이드의 각막 표면 굴곡성에 미치는 영향을 확인한 결과로, 도 2A는 건조 스트레스가 제거된 NOD.B10.H2b 생쥐(DS)에 3, 5, 7 및 10일간 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA가 처리된 각 그룹의 안구 이미지 결과(Scale bar = 1 mm)이며, 도 2B는 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA가 처리된 생쥐의 각막 표면 매끄러움 점수의 변화를 확인한 결과로 평균 ± 표준편차로 정량적 결과를 나타내었다. *P < 0.05 vs. DS 10D군, #P < 0.05 vs. 생리식염수군, §P < 0.05 vs. Hyp-GQDGLAGPK 처리군, P < 0.05 vs. CsA 처리군, ＆P < 0.05 vs. CsA 처리군.
도 17은 각막 상피세포 박리에 미치는 Hyp-GQDGLAGPK 펩타이드의 영향을 확인한 결과로, 도 3A는 NOD.B10.H2b 생쥐의 각막에 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA 투여하고 10일 후 각막 상피 세포 박리 정도를 확인한 헤마톡실린＆에오신 염색결과(Scale bar = 100 μm)이며, 도 3B는 각막 상피 세포 박리 정도를 평균 ± 표준편차로 나타낸 정량적 결과이다(*P < 0.05 vs. DS 10D 그룹).
도 18은 결막 배상세포 분포에 미치는 Hyp-GQDGLAGPK 펩타이드 영향을 확인한 결과로, 도 4A는 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA가 투여된 NOD.B10.H2b 생쥐의 결막을 PAS 염색한 결과(Scale bar = 200 μm)이며, 도 4B는 결막 배상세포 분포 정도를 평균 ± 표준편차로 나타낸 정량적 결과이다(*P < 0.05 vs. DS 10D 그룹).
도 19는 NOD.B10.H2b 생쥐의 눈물샘에서 TNF-α, ICAM-1, VCAM-1, MMP-2 및 MMP-9 발현 정도를 확인한 면역조직화학 분석 결과로, 건조 스트레스를 제거시킨 생쥐에 생리식염수, Hyp-GQDGLAGPK, 콜라겐, CsA, DQS 및 HA를 투여하고, 10일 후 생쥐의 눈물샘에서 상기 염증성 인자의 발현 정도를 확인한 결과이다(Scale bar = 100 μm).
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 제공한다.
상기 펩타이드는 첫 번째 아미노산이 히드록시 프롤린(Hydroxy proline; Hyd)일 수 있으며, 보다 바람직하게는 히드록시 프롤린-GQDGLAGPK(Hydroxy proline-GQDGLAGPK)일 수 있다.
상기 펩타이드는 콜라겐 타입 II α1 유래일 수 있으며, 상기 콜라겐 타입 II α1은 동물연골세포 유래 세포외기질에서 분리될 수 있다.
상기 연골세포 유래 세포외기질은 동물의 연골조직 및/또는 연골유래 연골세포에서 분비되어 형성된 연골세포 유래 세포외기질에서 분리된 것일 수 있으며, 상기 동물은 돼지, 말, 소, 양, 염소 및 원숭이로 이루어진 군에서 선택될 수 있으나, 이에 한정되지는 않는다.
본 발명의 “펩타이드”는 일반적으로 2개 이상의 α-아미노산이 펩타이드결합으로 연결된 형태의 화합물로, 구성아미노산의 수에 따라 디펩타이드, 트리펩타이드, 테트라펩타이드 등이라 하며, 약 10개 이하의 펩타이드 결합이 있는 것을 올리고펩타이드, 다수의 펩타이드 결합으로 된 것을 폴리펩타이드라고 한다.
본 발명의 펩타이드는 화학 방법(Peptide Chemistry, A practical Textbook. Mikos Bodansky, Springer-Verlag, Berlin.)을 이용하여 제조된다. 예를 들어 펩타이드는 고형상 기술(Roberge JY et al (1995) Science 269: 202-204)에 의해 합성되고, 수지에서 절단되고 고성능 액체 크로마토그래피(예를 들어 Creighton (1983)Proteins Structures And Molecular Principles, WH Freeman and Co, New York NY)에 의해 정제될 수 있다.
또한, 본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 치료용 약학조성물을 제공한다.
상기 안구 표면질환은 각막 혼탁, 각막 혈관신생, 각막 염증 및 각막 섬유화로 이루어진 군에서 선택되는 어느 하나일 수 있다.
본 발명의 일실시예에 따르면, 알칼리 화상이 유도된 동물모델은 도 4A와 같이 알칼리 화상 후, 즉시 각막 혼탁이 나타났으며, 알칼리 화상 7일 후, 각막 혈관신생 및 혼탁이 증가하였으나, 각막 혈관신생 및 혼탁이 확인된 동물모델에 생리식염수 또는 Hyp-GQDGLAGPK 펩타이드를 각각 10일간 처리한 결과(알칼리 화상 17일 후), 도 4B 및 도 4C와 같이 대조군의 각막 혼탁 점수가 3.0±0.0으로 상당히 증가한 반면, 도 4B와 같이 펩타이드가 처리된 실험군에서 혼탁화의 감소가 나타나는 것을 확인할 수 있었다.
본 발명의 다른 일실시예에 따르면, 알칼리 화상에 의해 유도된 각막의 섬유화에 미치는 Hyp-GQDGLAGPK 펩타이드의 영향을 확인하기 위해 Masson's trichrome 염색을 수행한 결과, 도 6과 같이 알칼리 화상 대조군의 경우, 알칼리 화상에 의해 스트로마 부분에 갈색 섬유아세포 형성이 증가된 것을 확인할 수 있었으나, Hyp-GQDGLAGPK 펩타이드가 처리된 실험군에서는 섬유아세포의 증가가 억제된 것을 확인할 수 있었다. 또한, H&E 염색을 수행하여 알칼리 화상에 따른 각막의 조직학적 변화를 확인한 결과, 도 7의 윗부분을 참고하면, 알칼리 화상에 의해 각막에 상피 증식, 염증성 세포 침입, 간질 부종 및 신생혈관 형성을 유도된 것이 확인되었다.
그러나 상기 조직학적 변화에 대하여, Hyp-GQDGLAGPK 펩타이드가 처리 실험군에서는 향상된 개선 효과가 나타났으며, 도 5A와 같이 H&E 염색결과에서도 펩타이드가 처리된 조직에서 신생 혈관 형성이 유의하게 개선된 것을 확인할 수 있었다.
본 발명의 또 다른 일실시예에 따르면, 염증 마커 발현에 대한 각 펩타이드의 효과를 확인하기 위해, 각막 절편에 대식세포, TNFα, ICAM-1, IL-1β, IL-6 및 MMP-9과 같은 염증 특이적 마커로 면역염색을 수행한 결과, 도 8과 같이 알칼리 화상은 상피와 상피하 및 증식성 기질에서 대식세포 발현을 증가시킨 반면, Hyp-GQDGLAGPK 펩타이드가 처리된 실험군에서는 대식세포의 발현이 효과적으로 억제된 것을 확인할 수 있었다. 또한, 알칼리 화상군에서는 TNFα, IL-1β 및 IL-6를 포함하는 염증성 사이토카인과 ICAM-1 부착분자의 발현 증가가 확인되었으나, 펩타이드가 처리된 실험군에서는 상기 염증성 인자들의 발현이 감소된 것을 확인할 수 있었다. 추가적으로, 알칼리 화상군의 각막에서는 MMP-9의 발현이 강하게 나타난 반면, 펩타이드가 처리된 실험군에서 MMP-9의 발현이 억제된 것을 확인할 수 있었다.
상기 결과들로부터 Hyp-GQDGLAGPK 펩타이드는 안구 표면질환은 각막 혼탁, 각막 혈관신생, 각막 염증 및 각막 섬유화를 예방하거나 치료하는데 효과적임이 확인되었다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 연골세포 유래 세포외 기질(chondrocyte-derived extracellular matrix; CDEM)에서 분리된 콜라겐 타입 Ⅱα1(collagen type Ⅱ α1) 유래일 수 있다.
보다 상세하게는, 상기 연골세포 유래 세포외 기질은 동물의 연골조직 및/또는 연골유래 연골세포에서 분비되어 형성된 연골세포 유래 세포외 기질에서 분리된 것일 수 있으며, 상기 동물은 돼지, 말, 소, 양, 염소 및 원숭이로 이루어진 군에서 선택될 수 있으나, 이에 한정되지는 않는다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 첫 번째 아미노산이 히드록시 프롤린(Hydroxy proline)인 펩타이드일 수 있으며, 보다 바람직하게는 히드록시 프롤린-GQDGLAGPK(Hydroxy proline(Hyp)-GQDGLAGPK)일 수 있다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유될 수 있다.
상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형일 수 있다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 개선용 건강식품을 제공할 수 있다.
또한, 본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 치료용 약학조성물을 제공할 수 있다.
상기 펩타이드는 콜라겐 타입 Ⅱ α1(collagen type Ⅱα1) 유래일 수 있다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 첫 번째 아미노산이 히드록시 프롤린(Hydroxy proline)인 펩타이드일 수 있으며, 보다 바람직하게는 히드록시 프롤린-GQDGLAGPK(Hydroxy proline-GQDGLAGPK)일 수 있다.
상기 펩타이드는 안구의 신생혈관형성을 억제하여 황반변성을 예방하거나 치료할 수 있으며, 상기 황반변성은 노인성 황반변성일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일실시예에 따르면, 생쥐의 안구내에 레이저를 조사하여 손상을 입히고, 14일 후 안구를 적출하여 H&E 염색을 수행하였다.
그 결과, 도 10과 같이 레이저 조사 부위의 조직이 붕괴되면서 신생혈관이 형성된 것을 확인할 수 있었다. 반면, 도 11과 같이 레이저 조사 후 콜라겐, CPI 및 CPII를 각각 처리한 실험군에서는 모두 2 μg으로 처리되었을 때 CNV 병변이 감소된 것을 확인할 수 있었다.
또한, In vitro Tube formation 실험에서 가장 뛰어난 항혈관형성능을 보인 히드록시 프롤린-GQDGLAGPK (CPII)의 맥락막 신생혈관 억제 효과를 양성대조군인 아바스틴(Avastin)과 비교한 결과, 도 11과 같이 CPII 처리군의 병변 크기가 대조군의 병변 크기보다 유의하게 감소하였으며, 동일한 농도의 Avastin이 처리된 양성대조군의 병변 크기와 유사한 수준인 것으로 확인되었다.
상기 결과로부터 히드록시 프롤린-GQDGLAGPK 펩타이드는 혈관신생에의해 발병되는 노인성 황반변성에 우수한 치료효과를 나타낼 수 있다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유될 수 있다.
상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형일 수 있다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 개선용 건강식품을 제공할 수 있다.
또한, 본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 건성안 예방 또는 치료용 약학조성물을 제공한다.
상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 콜라겐 타입 Ⅱ α1(collagen type Ⅱα1) 유래인 것일 수 있다.
보다 상세하게는 상기 펩타이드는 연골세포 유래 세포외 기질(chondrocyte-derived extracellular matrix; CDEM)에서 분리된 펩타이드일 수 있으며, 상기 연골세포 유래 세포외 기질은 동물의 연골조직 및/또는 연골유래 연골세포에서 분비되어 형성된 연골세포 유래 세포외 기질에서 분리된 것일 수 있으며, 상기 동물은 돼지, 말, 소, 양, 염소 및 원숭이로 이루어진 군에서 선택될 수 있으나, 이에 한정되지는 않는다.
상기 펩타이드는 첫 번째 아미노산이 히드록시 프롤린(Hydroxy proline)인 펩타이드일 수 있으며, 보다 바람직하게는 히드록시 프롤린-GQDGLAGPK[Hydroxy proline(Hyp)-GQDGLAGPK]일 수 있다.
상기 펩타이드는 건조 스트레스에 의한 눈물생성 감소 및 각막 표면 불균형을 회복시키고 각막 상피세포의 박리 및 염증성 인자 생성을 억제할 수 있다.
본 발명의 일실시예에 따르면, 도 15와 같이 건조스트레스에 노출시킨 생쥐의 눈물량이 정상군 (0.22 ± 0.01 μL)보다 약 85.5% 감소(DS 10D group, 0.03 ± 0.01 μL, p < 0.05)되었으나, 건조 스트레스 제거 후 Hyp-GQDGLAGPK가 처리된 생쥐군(0.23 ± 0.02 μL)에서 처리 후 10일째에서 눈물량이 7.9배 (p < 0.05) 증가하였으며, 음성 대조군인 생리식염수 처리군(0.08 ± 0.01 μL)보다 약 2.8배 (p < 0.05), 양성 대조군인 콜라겐 처리군(0.13 ± 0.02 μL)보다 눈물량이 약 1.7배 (p < 0.05) 증가된 것으로 확인되었다.
또한, 건성안 치료제인 CsA, DQS 및 HA 처치군 (0.13 ± 0.02 μL; 0.16 ± 0.02 μL; 0.14 ± 0.01 μL)과 비교하여 Hyp-GQDGLAGPK 처리군의 눈물량은 각각 1.7배 (p < 0.05), 1.4배 (p < 0.05) 및 1.6배 (p < 0.05) 증가된 것으로 확인됨에 따라, 눈물량 개선에 대한 Hyp-GQDGLAGPK의 효과는 현재 시판되는 건성안 치료제보다 효과적인 것을 확인할 수 있었다.
상기 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유될 수 있다.
상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형일 수 있다.
본 발명은 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 건성안 예방 또는 개선용 건강식품을 제공할 수 있다.
본 발명의 다른 구체예에서, 상기 펩타이드를 유효성분으로 포함하는 안구 표면 질환 예방 또는 치료용 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 윤활제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
상기 펩타이드의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명에 있어서, 상기 '대상체'는 인간을 포함하는 포유동물일 수 있으나, 이들 예에 한정되는 것은 아니다.
또한, 본 발명에 있어서, 상기 건강식품은 본 발명의 펩타이드 이외에 다른 식품 또는 식품 첨가물과 함께 사용되고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적 예를 들어 예방, 건강 또는 치료적 처치에 따라 적합하게 결정될 수 있다.
상기 건강식품에 함유된 화합물의 유효용량은 상기 치료제의 유효용량에 준해서 사용할 수 있으나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 범위 이하일 수 있으며, 유효성분은 안전성 면에서 아무런 문제가 없기 때문에 상기 범위 이상의 양으로도 사용될 수 있음은 확실하다.
상기 건강식품의 종류에는 특별한 제한이 없고, 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제등을 들 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<실험예 1> 안구 표면질환 동물모델 제작
눈과 시력 연구를 위한 동물 실험은 인제대학교 의과대학교 및 ARVO Statement에서 승인받은 동물 실험 지침서에 따라 수행되었다(No.; 2014-028).
2.0 내지 2.5 kg의 뉴질랜드 흰색 토끼 26 마리를 Samtako (Osan, Korea)에서 구입하고, 케타민 하이드로클로라이드(30 mg/kg body weight, Huons, Jecheon, Korea) 및 자일라진 하이드로클로라이드(2.5 mg/kg, Bayer Korea Ltd., Seoul, Korea) 혼합물을 근육에 주사하여 전신 마취하였으며, 알카라인 프로프라카인(Alcaine propracaine) 점안액(Alcon Inc., Seoul, Korea)을 이용하여 국소 마취하였다.
그 후, 1 N NaOH를 적신 8 mm 필터 종이를 토끼의 오른쪽 각막 중심에 1분간 노출시켜 알칼리 화상 모델은 제작하고, 화상 7일 후 알칼리 화상에 따른 각막 혈관신생 및 각막 혼탁 증가를 확인하였다.
상기 토끼들을 무작위로 알칼리 화상군(n=5) 및 펩타이드 처리군(n=5)으로 나누었다. 알칼리 화상군은 생리식염수를 매일 4회 투여하였으며, 펩타이드 처리 군에는 Hyp-GQDGLAGPK 펩타이드 10 mg/mL을 매일 4회 투여하였으며, 왼쪽 눈을 대조군으로 사용하였다.
상기 방법으로 각각의 처리 물질들을 10일간 투여한 후, H&E 염색, Masson's trichrome 염색 및 면역조직화학 염색(immunohistochemistry)을 수행하여 섬유화, 혈관신생, 염증 및 각막 구조 변화 등을 확인하였다.
<실험예 3> 각막 혈관신생 및 혼탁화 확인
각막 혈관신생 및 혼탁화에 대한 임상 평가를 수행하였다.
각막 혈관신생 정도를 0점에서 3점까지 평가하였다. 혈관신생이 나타나지 않은 경우 0점, 각막 주변부의 혈관신생이 확인될 경우 1점, 눈동자 가장자리까지 혈관신생이 확장된 경우 2점 및 눈동자 가장자리는 넘어 각막 중심까지 혈관신생이 확장된 경우 3점으로 평가하였으며, 각막 혈관신생 평가시 상당한 혼탁 및 광범위한 검구 유착이 형성되어 각막 혈관신생 정도를 평가하기 어려울 경우, 3점으로 평가하였다.
또한, 각막 혼탁 정도를 0점에서 3점까지 평가하였다. 홍채 부분이 선명하게 보이는 투명한 각막의 경우 0점, 홍채 부분에 부분적인 혼탁이 확인될 경우 1점, 눈동자 가장자리와 홍채 부분이 약하게 보일 때 2점, 홍채 및 눈동자 부분이 완전히 혼탁화된 경우 3점으로 평가하였다.
<실험예 4> Masson's trichrome 염색
안구들을 3.5 % 파라포름알데하이드로 고정시킨 후 세척하고 파라핀이 박힌 조직 절편(6 μm)으로 제작 때까지 70 % 알콜에 저장하였다. 콜라겐 섬유화 및 섬유화 등급 정도를 시각화하기 위해, 절편에 Massons trichrome 염색을 수행하고 가상 현미경(virtual microscope; NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 절편의 이미지를 촬영하였다.
<실험예 5> 조직학적 분석을 위한 화학염색
조직학적 분석을 위해, 안구들을 3.5 % 파라포름알데하이드로 고정시킨 후 optimal cutting temperature compound(OCT; Tissue-Tek, Sakura Fine Technical Co., Ltd., Tokyo, Japan)에 박고 액체 질소에 냉동시켰다.
시료들을 4% 포름알데하이드에 24시간 동안 고정시키고, 건조시킨 후, 파라핀 왁스에 박았다. 그 후 8 μm 두께의 조직 절편으로 준비한 후 헤모톡실린/에오신(H&E)염색을 수행하고, 절편의 이미지를 가상 현미경(virtual microscope; NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영하였다.
<실험예 6> 면역 조직화학적 분석
조직 절편을 6 μm 두께로 절단하여 면역 조직화학 분석에 사용하였다.
먼저, 조직 절편을 3.5% 파라포름알데하이드로 고정시키고, 0.1% 트리톤 X-100, 불활성화된 2% 소혈청알부민(BSA; all from Sigma, St. Louis, MO)을 투과시키고, 항-CD31(1:1,000; Abcam Inc., Cambridge, MA), 항-bFGF(1:1,000; Bioss Inc., Woburn, MA), 항- IL-1β, 항-IL-6(1:1,000; Cloud-Clone Corp., Houston, TX), 항-MMP-9, 항-ICMA-1, 항-TNFα, 항-대식세포/단핵(1:1,000; Abnova Crop., Taipei, Taiwan) 및 항-VEGF-A(Abbiotec, San Diego, CA) 1차 항체로 4℃에서 하룻밤 동안 인큐베이션하였다.
그 후, 절편에 2차 항체를 45분간 인큐베이션하고 diaminobenzidine (DAB) chromogen으로 면역학적 반응을 시각화하고, 절편을 실온에서 30초간 Mayer's hematoxylin (Sigma)으로 대비염색하였다.
상기 방법으로 염색된 절편을 가상 현미경(virtual microscope; NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영하였다.
< 실험예 7> Tubing assay
히드록시 프롤린-GQDGLAGPK의 항혈관형성 효과를 사람 혈관내피세포 (HUVEC)를 이용한 Tubing assay를 수행하여 확인하였다.
HUVEC 세포를 calcein-AM으로 염색한 후 마트리겔(Matrigel)이 코팅된 48-웰 플레이트에 분주하고 50ng/ml 농도의 재조합 사람 VEGF와 함께 콜라겐, CPI 및 CPII를 농도별로 처리하고, 37℃ 인큐베이터에서 4시간 방치한 후 형광현미경 (Leica)으로 관(Tube) 형성을 관찰하고, 관 길이는 Image lab software (Bio-Rad Laboratories)로 분석하였다.
< 실험예 8> 실험동물 및 맥락막 신생혈관( CNV ) 모델 제작
C57BL/6 생쥐를 오리엔트 바이오에서 구입하였으며, 본 동물 실험은 눈과 시력 연구를 위한 동물 사용에 대하여 인제대학교 의과대학 (No,2013-053)과 ARVO에 승인된 지침에 따라 수행되었다. 6주령의 C57BL/6 생쥐에게 다이오드 그린 레이저(diode green laser; 532 nm, 150 mW, 0.1sec, 50 μM, photocoagulator)를 이용하여 망막 시신경 부위에 손상을 주었다. Laser 조사 직후 CP1, CPII 및 양성대조군 아바스틴(Avastin)을 PBS에 용해하여 하루에 5 mg씩 5일간 안구내에 투여하였다. 각 실험군은 각각 5마리씩 생쥐의 양쪽 눈을 이용하여 상기 실험을 진행하였다.
< 실험예 9> 조직학적 분석
레이저에 의한 조직 변화를 관찰하기 위하여, 마우스 안구를 적출하여 10% 포르말린으로 고정시키고, OCT 혼합물에 깊숙히 박았다.
상기 방법으로 처리된 8 μm 조직 시료를 헤마톡실린&에오신(H&E)으로 염색하고 가상 현미경(NanoZoomer 2.0 RS, Hamamatsu, Japan)을 이용하여 촬영 및 분석하였다.
< 실험예 10> 망막-맥락막 플랫 마운트(Flat-mount)
레이저 조사 14일 후 망막-맥락막 플랫 마운드를 수행하여 CPII의 CNV 병변 크기 억제 효과를 확인하였다. 생쥐를 마취시키고 25mg/ml의 FITC-덱스트란(dextran)을 retro-orbital로 100 ml 주사하였다. 30분 후 마우스를 안락사하고 안구를 적출하여 10% 포르말린으로 고정한 후 각막과 수정체를 제거하고 커버 글래스에 플랫 마운트하였다. FITC-덱스트란에 의해 염색된 신생혈관은 형광 현미경(Leica)을 통해 관찰하고, 그 병변 크기를 Image J program을 통하여 측정하였다.
< 실험예 11> 정량적 실시간 RT- PCR 분석
히드록시 프롤린-GQDGLAGPK의 신생혈관 관련 유전자 발현 억제 효과를 확인하기 위하여, 적출된 생쥐 안구의 망막과 맥락막 혼합물에서 RNeasy Mini kit (Qiagen)을 이용하여 RNA를 추출하고, 올리고(dT) 프라이머와 역전사 효소를 이용하여 cDNA를 합성하였다. PCR 산물은 표 1의 특이적 프라이머 세트(코스모진텍, Korea) 및 SYBR Green PCR 2X PreMix (Enzynomics)를 이용하여 증폭시켰으며, 수행된 PCR 조건으로는 시료를 95℃에서 10분 동안 배양한 후, 95℃에서 15초, 60℃에서 30초 및 72℃에서 15초 동안 진행하여 40 PCR 사이클을 수행하였다. 상대 정량화를 2-(DDCT)방법 [Livak and Schmittgen, 2001; DDCT = (CT,target-CT,actin) 처리구 (CT,target-CT,actin)대조구]으로 계산하였다.
Target 프라이머 서열( 5’→ 3’)
정방향 역방향
VEGF ATGAACTTTCTGCTGTCTTGGGTG TCACCGCCTCGGCTTGTCACA
ICAM TGCGTTTTGGAGCTAGCGGACCA CGAGGACCATACAGCACGTGCCAG
MCP-1 TGGCAAGATGATCCCAATGA GCAGCACTGTTCGTCACTTCA
GAPDH ATGGTGAAGGTCGGTGTGAAC GTGCCGTTGAATTTGCCGTGA
< 실험예 12> 웨스턴 블롯
생쥐의 망막과 맥락막 혼합물을 프로테아제 억제 칵테일 및 포스파타아제 억제 칵테일이 포함된 Pro-PREP buffer (iNtRON)로 용해한 후 단백질을 추출하였다.
추출된 단백질은 BCA assay kit (Pierce)를 이용하여 정량한 후, SDS gel loading buffer와 혼합하여 100℃에서 5분간 끓여 변성시켰다. SDS-PAGE 겔에서 전기영동된 단백질은 니트로 셀룰로스 막 (Millipore)으로 옮겨졌고, 그 후 비특이적 단백질 결합을 차단하기 위하여 막을 5% 탈지유에서 1시간 방치 후 1차 항체로 VEGF, Flk-1, Flt-1, Angiopoetin-2 및 β-actin (Santa Cruz Biotechnology)을 처리하여 일반적인 면역블롯을 수행하였다. 그 후 ECL kit (Advansta) 및 multiple Gel DOC system으로 변역반응성 단백질을 검출하였다.
< 실험예 13> 실험동물 및 건성안 모델 제작
NOD.B10.H2b 생쥐를 Jackson Laboratory (Bar Harbor, ME, USA)에서 구입하였다. 동물 실험은 눈과 시력 연구를 위한 동물 사용에 대하여 인제대학교 의과대학(No.; 2014-029)과 ARVO에 승인된 지침에 따라 수행되었다. 12 내지 16 주령의 NOD.B10.H2b 생쥐에게 건조 스트레스로 하루 18시간 동안 40-50% 주위습도와 팬을 이용한 통풍에 노출시켰으며 피하에 0.5 mg/0.2 mL 무스카린 수용체 차단제를 주사하였다. 또한, 10일 동안 오전 9시, 오후 12시, 오후 3시 및 오후 6시 하루 4번 브롬화수소산 스코폴라민(scopolamine hydrobromide; Sigma-Aldrich, St. Louis, MO)을 생쥐 엉덩이쪽에 번갈아가며 주사하였다. 상기 방법으로 처리된 생쥐를 10일 후 안락사시켰으며 실험기간 동안 동물의 행동과 음식 및 물 섭취를 제한하지 않았다.
안구 건조 스트레스 10일 후 스코폴라민 주사를 중단하고 일반 습도와 온도 환경으로 전환하고 건조 스트레스 제거한 후 10mg/ml Hyp-GQDGLAGPK 와 콜라겐은 생리식염수(normal saline)에 용해하여 5μL씩 하루에 5번 10일간 안구에 투여하였으며, 생리식염수 및 0.1% HA는 하루에 5번 10일간 안구에 투여하였다. 여섯 실험군은 각각 3마리씩 생쥐의 양쪽 눈을 이용하여 상기 실험을 진행하였으며 모든 실험은 반복적으로 진행되었다.
< 실험예 14> 눈물량 확인
눈물 생성을 페놀 레드-침윤 면 스레드 (phenol red-impregnated cotton threads; Zone-Quick; Oasis, Glendora, CA)를 이용하여 보고되어진 방법 (Villareal AL, Farley W, Pflugfelder SC. Effect of topical ophthalmic epinastine and olopatadine on tear volume in mice. Eye Contact Lens. 2006;32(6):272-276.)으로 측정하였다. 눈물량은 의료용 핀셋을 이용하여 스레드를 20초 동안 측면 안각에 위치시키고 눈물에 젖어 적색으로 변한 스레드를 현미경(SZX7; Olympus corp, Tokyo, Japan)으로 관찰하여 밀리미터로 표시하였다. 상기 측정된 밀리미터내 누액을 20초 동안 생쥐의 눈물량으로 예상되는 용량의 염기성 용액(0.9% 염분 1500 mL와 5 mL의 5 N NaOH)을 적신 면 스레드로 나타낸 표준곡선과 비교하였다.
< 실험예 15> 각막 표면의 굴곡성 평가
각막 표면의 굴곡성은 동물을 마취 후 실체현미경(SZX7; Olympus)의 광섬유 링 조명으로부터 흰색 링의 반사이미지를 얻었다. 각막 매끄러움을 디지털 이미지의 흰색 링에 반사된 각막상피 세포의 불규칙성을 등급화하여 평가하였다. 각막 불규칙성 심각도 점수는 반사 링을 4등분으로 나누어 불규칙성 정도에 따라 5등급으로 계산하였다. 불규칙성 없음은 0등급, 1/4등분의 불규칙성을 1등급; 2/4등분의 불규칙성은 2등급; 3/4 등분의 불규칙성을 3등급; 모두 불규칙한 정도를 4등급; 심각한 정도를 5등급으로 하여 모든 링을 확인하였다.
<실시예 1> 단백질 분석 및 펩타이드 합성
Baek's group of Center of Biomedical Mass Sepctrometry (Diatech Korea Co., Ltd., Seoul, Korea)에서 동물연골세포 유래 세포외기질의 단백질 분석을 수행하였다.
상기 단백질 분석을 통하여 콜라겐 타입 II α1 단백질의 아미노산 서열의 일부분에 해당되는 히드록시 프롤린-GQDGLAGPK(Hydroxy proline-GQDGLAGPK; Hyp-GQDGLAGPK; 서열번호 1)를 얻었으며, 상기 펩타이드를 도 1과 같이 (주)바이오셀트란(BIOCELTRAN; Chuncheon, Korea)에서 합성하였다.
HPLC를 수행하여 상기 합성된 히드록시 프롤린-GQDGLAGPK의 순도를 확인한 결과, 도 2와 같이 히드록시 프롤린-GQDGLAGPK 펩타이드가 순도 99.3%로 합성된 것을 확인할 수 있었다.
또한, Ion-Mass를 통하여 히드록시 프롤린-GQDGLAGPK 펩타이드의 분자량을 확인한 결과로, 도 3과 같이 히드록시 프롤린-GQDGLAGPK 펩타이드의 분자량이 654.99인 것으로 확인되었다.
<실시예 2> 폡타이드에 의한 각막 혈관신생 및 혼탁화 변화 확인
각막 알칼리 화상 7일 후, 각막 혈관신생 및 혼탁화에 대한 임상 평가를 수행하였다.
그 결과, 도 4A와 같이 알칼리 화상 후, 즉시 각막 혼탁이 나타났으며, 알칼리 화상 7일 후, 각막 혈관신생 및 혼탁이 증가한 것을 확인할 수 있었다.
각막 혈관신생 및 혼탁이 확인된 후 생리식염수 또는 Hyp-GQDGLAGPK 펩타이드를 각각 10일간 처리한 결과(알칼리 화상 17일 후), 도 4B 및 도 4C와 같이 대조군의 각막 혼탁 점수가 3.0으로 상당히 증가하였으며, 혈관신생점수는 2.8로 신생혈관이 눈동자 가장자리를 넘어 각막 중심까지 확장된 것을 확인할 수 있었다.
반면, 도 4B와 같이 펩타이드가 처리된 실험군에서 혼탁화의 감소 효과가 나타나는 것을 확인할 수 있었다.
상기 결과로부터 Hyp-GQDGLAGPK 펩타이드가 각막 혼탁화를 저해하는데 효과적임이 확인되었다.
<실시예 3> 펩타이드에 의한 각막 두께 변화 확인
가상 현미경(virtual microscope; NanoZoomer 2.0 RS, Hamamatsu, Japan)으로 촬영한 H&E 염색 절편의 각막두께를 NDP view 프로그램 (Hamamatsu, USA)을 이용하여 분석하였다.
그 결과, 도 5B와 같이 알칼리 화상 후, 각막 두께가 정상범위인 526.6μm에서 960.6μm로 증가한 것을 확인할 수 있었다.
그러나 Hyp-GQDGLAGPK 펩타이드 처리 10일 후, 펩타이드가 처리된 실험군에서는 각막 두께가 550.0μm (p<0.05)로 알칼리 화상군보다 감소된 것을 확인할 수 있었다.
<실시예 4> 펩타이드의 각막 섬유화 억제 효과 확인
알칼리 화상에 의해 유도된 각막의 섬유화에 미치는 Hyp-GQDGLAGPK 펩타이드의 영향을 확인하기 위해 Masson's trichrome 염색을 수행하였다.
그 결과, 도 6과 같이 알칼리 화상 대조군의 경우, 알칼리 화상에 의해 스트로마 부분에 갈색 섬유아세포 형성이 증가된 것이 확인되었으나, Hyp-GQDGLAGPK 펩타이드가 처리된 실험군에서는 섬유아세포의 증가가 억제된 것을 확인할 수 있었다.
상기 결과로부터 Hyp-GQDGLAGPK 펩타이드가 섬유아세포의 증가를 저해함으로써, 각막 섬유화를 억제하는데 효과적임이 확인되었다.
<실시예 5> 펩타이드의 각막 혈관신생 억제 효과 확인
H&E 염색을 수행하여 알칼리 화상에 따른 각막의 조직학적 변화를 확인하였다.
그 결과, 도 7의 윗부분을 참고하면, 알칼리 화상에 의해 각막에 상피 증식, 염증성 세포 침입, 간질 부종 및 신생혈관 형성을 유도된 것이 확인되었다.
그러나 상기 조직학적 변화에 대하여, Hyp-GQDGLAGPK 펩타이드가 처리 실험군에서는 향상된 개선 효과가 나타났으며, 도 5A와 같이 H&E 염색결과에서도 펩타이드가 처리된 조직에서 신생 혈관 형성이 유의하게 개선된 것을 확인할 수 있었다.
상기 결과로부터, Hyp-GQDGLAGPK 펩타이드가 신생혈관 형성에 영향을 미치는 것으로 확인됨에 따라, 알칼리 화상을 입힌 각막에서 Hyp-GQDGLAGPK 펩타이드 처리하고, 각막 혈관신생의 특이적 마커인 CD31, FGF 및 VEGF를 이용하여 각막 절편에 면역염색을 수행하였다.
그 결과, 도 7과 같이 CD31, FGF 및 VEGF 혈관신생 마커가 알칼리 화상에 따른 섬유화 기질 세포에서 강하게 발현되는 것을 확인할 수 있었다.
그러나 펩타이드가 처리된 실험군에서는 상피, 상피하 및 기질에서 CD31, FGF 및 VEGF의 유의한 감소를 확인할 수 있었다.
상기 결과로부터 Hyp-GQDGLAGPK 펩타이드가 각막 혈관신생을 저해하는데 효과적임이 확인되었다.
<실시예 6> 펩타이드의 항염증 효과 확인
앞선 H&E 염색 수행 결과, 알칼리 화상에 의해 염증 세포들이 각막으로 침투한 것을 확인할 수 있었다. 따라서, 염증 마커 발현에 대한 각 펩타이드의 효과를 확인하기 위해, 각막 절편에 대식세포, TNFα, ICAM-1, IL-1β, IL-6 및 MMP-9과 같은 염증 특이적 마커로 면역염색을 수행하였다.
그 결과, 도 8과 같이 알칼리 화상은 상피와 상피하 및 증식성 기질에서 대식세포 발현을 증가시킨 반면, Hyp-GQDGLAGPK 펩타이드가 처리된 실험군에서는 대식세포의 발현이 효과적으로 억제된 것을 확인할 수 있었다. 또한, 알칼리 화상군에서는 TNFα, IL-1β 및 IL-6를 포함하는 염증성 사이토카인과 ICAM-1 부착분자의 발현 증가가 확인되었으나, 펩타이드가 처리된 실험군에서는 상기 염증성 인자들의 발현이 감소된 것을 확인할 수 있었다. 추가적으로, 알칼리 화상군의 각막에서는 MMP-9의 발현이 강하게 나타난 반면, 펩타이드가 처리된 실험군에서 MMP-9의 발현이 억제된 것을 확인할 수 있었다.
< 실시예 7> 펩타이드의 혈관형성 억제 효과 확인
사람 혈관내피세포(HUVEC)를 이용한 Tubing assay를 수행하여 히드록시 프롤린-GQDGLAGPK의 항 혈관형성 효과를 확인하였다.
그 결과, 도 9와 같이 VEGF 처리군에서는 VEGF 비처리군보다 Tube formation이 약 1.5배 이상 증가된 반면, 콜라겐, CPI 및 CPII이 처리된 실험군에서는 모두 유의적으로 혈관형성이 억제되었다. 특히, CPII는 농도 의존적으로 Tube formation을 억제하였으며, VEGF 비처리군의 혈관형성 정도와 거의 동일하게 감소된 것으로 나타났다. 또한, 나이관련 황반변성 치료제인 Avastin 처리군과도 유사한 수준으로 확인되었다.
< 실시예 8> 펩타이드의 맥락막 신생혈관 억제 효과 확인
실험예 8과 같은 방법으로 생쥐 안구에 레이저를 조사하였으며, 레이저 조사 14일 후 안구를 적출하여 H&E 염색을 수행하였다.
그 결과, 도 10과 같이 레이저 조사 부위의 조직이 붕괴되면서 신생혈관이 형성된 것을 확인할 수 있었다. 반면, 도 3과 같이 콜라겐, CPI 및 CPII를 각각 안구내 주사로 5일 동안 처리한 실험군에서는 모두 2 μg으로 처리되었을 때 CNV 병변이 감소된 것을 확인할 수 있었다.
또한, 앞선 실험에서 확인한 바와 같이 In vitro Tube formation 실험에서 가장 뛰어난 항혈관형성능을 보인 히드록시 프롤린-GQDGLAGPK (CPII)의 맥락막 신생혈관 억제 효과를 양성대조군인 아바스틴(Avastin)과 비교하기 위하여, 레이저 조사 직후부터 CPII 및 아바스틴을 각각 5 μg 씩 5일간 연속적으로 안구내 주사하고, 레이저 조사 14일 후 안구를 적출한 후 혈관을 FITC-덱스트란으로 염색한 후, 플랫-마운드 실험을 수행하여 CNV 병변 크기를 측정하였다.
그 결과, 도 11과 같이 CPII 처리군의 병변 크기가 대조군의 병변 크기보다 유의하게 감소하였으며, 동일한 농도의 Avastin이 처리된 양성대조군의 병변 크기와 유사한 수준인 것으로 확인되었다.
< 실시예 9> 펩타이드의 신생혈관 관련 유전자 및 단백질 억제 효과 확인
생쥐에 레이저 조사 14일 후, 망막과 맥락막에서 RNA를 추출하여 실시간 RT-PCR로 유전자 발현을 분석하였다.
그 결과, 도 12와 같이 대표적인 신생혈관 관련 유전자인 VEGF가 레이저 처리군에서는 55배 정도 발현이 증가되었으나, 아바스틴 처리군 및 CPII 처리군에서는 레이저 비처리군과 비슷한 수준으로 감소된 것을 확인할 수 있었다.
한편, ICAM 및 MCP-1 유전자는 레이저 처리군에서 각각 약 300배 및 10배의 발현 증가가 확인되었으나, 이 역시 CPII 처리군에서는 유의적으로 감소된 것을 확인할 수 있었다.
또한, 신생혈관 관련 단백질 마커들의 발현에 있어 CPII의 효과를 평가하기 위해 레이저 조사 14일 후, 망막과 맥락막에서 단백질을 추출하여 VEGF, VEGFR-1 (Flt-1), VEGR-2 (Flk-1) 및 Angiopoietin 2의 면역 블롯팅을 수행하였다.
그 결과, 도 13과 같이, 레이저 조사에 의해 신생혈관 형성 촉진 인자인 Angiopoietin2와 VEGFR-1,-2의 발현이 현저히 증가된 것을 확인할 수 있었으며, 특히 신생혈관 형성에 가장 중요한 역할을 하다고 알려진 VEGF의 발현이 현저하게 증가되었다. 그러나 CPII가 처리된 실험군에서는 상기 단백질들의 발현이 현저히 감소하였으며, 나이관련 황반변성 치료제 아바스틴과 거의 유사한 수준을 나타내었다.
< 실시예 10> 눈물 생성 효과 확인
눈물 생성 정도를 페놀 레드-침윤 면 스레드(phenol red-impregnated cotton threads)로 측정하였다.
그 결과, 도 15와 같이 건조스트레스는 NOD.B10.H2b 생쥐의 눈물량을 정상군 (0.22 ± 0.01 μL) 과 비교하여 약 85.5% 유의적인 수준으로 감소된 것을 확인할 수 있었다(DS 10D group, 0.03 ± 0.01 μL, p < 0.05). 반면, 건조 스트레스 제거 후 Hyp-GQDGLAGPK 처리군(0.23 ± 0.02 μL)은 처리 10일째에서 눈물량이 7.9배 (p < 0.05) 증가되었으며, 음성 대조군인 normal saline 처리군 (0.08 ± 0.01 μL) 과 비교하여 약 2.8배 (p < 0.05), 양성 대조군인 콜라겐 처리군 (0.13 ± 0.02 μL)과 비교하여 눈물량이 약 1.7배 (p < 0.05) 증가된 것을 확인할 수 있었다.
또한, 건성안 치료제인 CsA(Cyclosporine A; 0.13 ± 0.02 μL), DQS(Diquas; 0.16 ± 0.02 μL) 및 HA(Hyaluni; 0.14 ± 0.01 μL)과 비교하여 Hyp-GQDGLAGPK 처리군의 눈물량은 각각 1.7배 (p < 0.05), 1.4배 (p < 0.05) 및 1.6배 (p < 0.05) 증가된 것으로 나타났다.
상기 결과로부터 Hyp-GQDGLAGPK는 현재 시판되는 건성안 치료제보다 높은 수준으로 감소된 눈물량을 회복시키는 것으로 확인되었다.
< 실시예 11> 각막표면의 굴곡성 확인
각 실험군의 각막표면 굴곡 정도를 수치화하여 각막 표면의 굴곡성을 확인하였다.
그 결과, 도 16과 같이 정상각막 (0.33 ± 0.58 점)과 비교하여 10일간 건조 스트레스에 노출된 생쥐의 각막표면의 굴곡 정도는 약 13배 (4.33 ± 0.58 점; p < 0.05) 증가한 것을 확인할 수 있었다. 반면, 건조 스트레스 제거 후 Hyp-GQDGLAGPK 처리군(2.0 ± 0 점) 10일째에서 각막 표면의 굴곡성이 53.8% (p < 0.05) 유의적으로 감소되었으며, 음성 대조군인 normal saline 처리군 (3.33 ± 1.53 점)보다는 40% (p < 0.05), 양성 대조군인 콜라겐 처리군 (3.67 ± 1.16 점)보다는 45.5% (p < 0.05)가 감소된 것을 확인할 수 있었다.
또한, 건성안 치료제인 CsA, DQS 및 HA 처리군(3.33 ± 0.58 점; 3.0 ± 1.0 점; 3.0 ± 0 점)과 비교하여 각각 40% (p < 0.05), 33.3% (p < 0.05) 및 33.3% (p < 0.05)로 각막 표면 굴곡 정도가 감소된 것을 확인할 수 있었다.
상기 결과로부터 Hyp-GQDGLAGPK는 건성안 치료제보다 각막 표면의 굴곡성 개선에 효과적인 것으로 확인되었다.
< 실시예 12> 각막 상피세포 박리 억제 효과 확인
각막 상피세포의 박리에 미치는 펩타이드의 영향을 확인하기 위해, 각 실험군 생쥐의 각막을 H&E 염색하였다.
그 결과, 도 17과 같이 건조 스트레스에 의해 각막의 상피 세포 박리가 24배 증가하였다(2.29 ± 0.57/0.1mm2, p < 0.05). 반면, 건조스트레스 제거 후 Hyp-GQDGLAGPK 처리군 (0.38 ± 0.17/0.1mm2)에서 각막의 상피세포 박리가 83.3% (p < 0.05) 감소되었다. 또한, 음성대조군인 normal saline 처리군 (1.33 ± 0.17/0.1mm2) 과 비교하여 71.4% (p < 0.05) 각막 상피세포 박리가 감소되었으며, 양성 대조군인 콜라겐 처리군 (0.86 ± 0.29/0.1mm2)보다는 55.6% (p < 0.05) 각막 상피세포 박리가 감소되었다.
또한, 건성안 치료제인 CsA, DQS 및 HA 처리군 (1.52 ± 0.33/0.1mm2; 0.095 ± 0.17/0.1mm2; 1.71 ± 0/0.1mm2)과 비교하여 각각 75% (p < 0.05), 60% (p < 0.05) 및 77.8% (p < 0.05) 유의적으로 감소된 것을 확인할 수 있었다.
상기 결과로부터 Hyp-GQDGLAGPK가 건성안 치료제보다 각막 상피세포의 박리를 감소시키는데 효과적인 것으로 확인되었다.
< 실시예 13> 결막 배상세포 분포에 미치는 영향 확인
건성안 생쥐 모델을 대상으로 점안에 따른 결막 배상세포의 분포를 관찰하였다.
그 결과, 도 18과 같이 건조 스트레스는 정상 결막 (14.38 ± 0.44/0.1mm2) 과 비교하여 58.2 % (6.02 ± 0.29/0.1mm2, p< 0.05) 배상세포를 감소시켰다. 반면, 건조스트레스 제거 후 Hyp-GQDGLAGPK 처리군 (13.9 ± 0.83/0.1mm2)에서는 감소된 배상세포가 2.3배 (p < 0.05) 회복되었으며, 음성 대조군인 normal saline 처리군 (5.43 ± 0.29/0.1mm2) 과 비교하여 2.6배 (p < 0.05) 증가되었고, 양성 대조군인 collagen 처리군 (11.05 ± 0.33/0.1mm2) 과 비교하여 1.3배 (p < 0.05) 증가된 것을 확인할 수 있었다.
또한, 건성안 치료제인 CsA, DQS 및 HA 처리군 (11.14 ± 0.76/0.1mm2; 8.86 ± 0.29/0.1mm2; 8.67 ± 0.17/0.1mm2) 과 비교하여 각각 1.2배 (p < 0.05), 1.5배 (p < 0.05) 및 1.6배 (p < 0.05) 유의하게 배상세포가 회복된 것을 확인할 수 있었다.
상기 결과로부터 결막의 배상세포 분포는 normal saline 처리를 제외한 나머지 처리군에서도 결막의 배상세포 분포가 개선되는 것으로 나타났지만, Hyp-GQDGLAGPK이 처리된 동물의 각막에서 현저하게 증가된 것을 확인할 수 있었다.
< 실시예 14> 건성안 생쥐 모델에서 항염증 효과 확인
건성안 생쥐 모델을 대상으로 염증반응 인자들의 발현에 있어 Hyp-GQDGLAGPK의 효과를 평가하기 위해 눈물샘에서 TNF-α, ICAM-1, VCAM-1, MMP-2 및 MMP-9의 면역 염색을 수행하였다.
그 결과, 도 19와 같이 건조스트레스에 의하여 눈물샘에서 염증성 사이토카인인 TNF-α와 부착 분자인 ICAM-1, VCAM-1의 발현을 현저히 증가된 것을 확인할 수 있었으며, 건조스트레스에 의해 눈물샘의 MMP-2와 MMP-9 역시 두드러지게 증가하였다. 그러나 Hyp-GQDGLAGPK가 처리된 생쥐 모델의 눈물샘에서는 염증관련 인자들의 발현을 현저하게 감소된 것을 확인할 수 있었으며, 건성안 치료제인 CsA, DQS 및 HA가 처리된 생쥐 모델보다도 두드러지게 억제된 것을 확인할 수 있었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (22)

  1. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드.
  2. 청구항 1에 있어서, 상기 펩타이드는 첫 번째 아미노산이 히드록시 프롤린(Hydroxy proline; Hyd)인 것을 특징으로 하는 펩타이드.
  3. 청구항 1에 있어서, 상기 펩타이드는 콜라겐 타입 II α1 유래인 것을 특징으로 하는 펩타이드.
  4. 청구항 3에 있어서, 상기 콜라겐 타입 II α1은 동물연골세포 유래 세포외기질에서 분리된 것을 특징으로 하는 펩타이드.
  5. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 치료용 약학조성물.
  6. 청구항 5에 있어서, 상기 안구 표면질환은 각막 혼탁, 각막 혈관신생, 각막 염증 및 각막 섬유화로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는 안구 표면질환 예방 또는 치료용 약학조성물.
  7. 청구항 5에 있어서, 상기 펩타이드는 연골세포 유래 세포외 기질(chondrocyte-derived extracellular matrix; CDEM)에서 분리된 콜라겐 타입 Ⅱα1(collagen type Ⅱ α1) 유래인 것을 특징으로 하는 안구 표면질환 예방 또는 치료용 약학조성물.
  8. 청구항 5에 있어서, 상기 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유되는 것을 특징으로 하는 안구 표면질환 예방 또는 치료용 약학조성물.
  9. 청구항 5에 있어서, 상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형인 것을 특징으로 하는 안구 표면질환 예방 또는 치료용 약학조성물.
  10. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 안구 표면질환 예방 또는 개선용 건강식품.
  11. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 치료용 약학조성물.
  12. 청구항 11에 있어서, 상기 펩타이드는 콜라겐 타입 Ⅱ α1(collagen type Ⅱα1) 유래인 것을 특징으로 하는 황반변성 예방 또는 치료용 약학조성물.
  13. 청구항 11에 있어서, 상기 펩타이드는 안구의 신생혈관형성을 억제하는 것을 특징으로 하는 황반변성 예방 또는 치료용 약학조성물.
  14. 청구항 11에 있어서, 상기 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유되는 것을 특징으로 하는 황반변성 예방 또는 치료용 약학조성물.
  15. 청구항 11에 있어서, 상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형인 것을 특징으로 하는 황반변성 예방 또는 치료용 약학조성물.
  16. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 황반변성 예방 또는 개선용 건강식품.
  17. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 건성안 예방 또는 치료용 약학조성물.
  18. 청구항 17에 있어서, 상기 펩타이드는 콜라겐 타입 Ⅱ α1(collagen type Ⅱα1) 유래인 것을 특징으로 하는 건성안 예방 또는 치료용 약학조성물.
  19. 청구항 17에 있어서, 상기 펩타이드는 건조 스트레스에 의한 눈물생성 감소 및 각막 표면 불균형을 회복시키고 각막 상피세포의 박리 및 염증성 인자 생성을 억제하는 것을 특징으로 하는 건성안 예방 또는 치료용 약학조성물.
  20. 청구항 17에 있어서, 상기 펩타이드는 약학조성물 총 100 중량부에 대하여 0.1 내지 50 중량부로 함유되는 것을 특징으로 하는 건성안 예방 또는 치료용 약학조성물.
  21. 청구항 17에 있어서, 상기 약학조성물은 점안제, 주사제, 과립제, 정제, 환제, 캡슐제, 겔, 시럽, 현탁제, 유제, 점적제 및 액제로 이루어진 군에서 선택된 어느 하나의 제형인 것을 특징으로 하는 건성안 예방 또는 치료용 약학조성물.
  22. 서열번호 1로 표시되는 아미노산 서열을 가지는 펩타이드를 유효성분으로 함유하는 건성안 예방 또는 개선용 건강식품.
PCT/KR2017/001419 2016-04-08 2017-02-09 연골세포 세포외기질 유래 펩타이드 WO2017175963A1 (ko)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP19151372.0A EP3539559B1 (en) 2016-04-08 2017-02-09 Collagen type ii alpha-1-based peptide for use in the treatment of macular degeneration
CN201780035505.3A CN109310731B (zh) 2016-04-08 2017-02-09 软骨细胞的细胞外基质来源的肽
ES17779264T ES2819030T3 (es) 2016-04-08 2017-02-09 Péptido basado en colágeno tipo II alfa-1 útil para el tratamiento de una enfermedad de la superficie ocular
EP17779264.5A EP3441081B1 (en) 2016-04-08 2017-02-09 Collagen type ii alpha-1-based peptide useful for the treatment of an ocular surface disease
US16/091,998 US10709768B2 (en) 2016-04-08 2017-02-09 Chondrocyte extracellular matrix-derived peptide
JP2019503878A JP6770169B2 (ja) 2016-04-08 2017-02-09 軟骨細胞の細胞外基質由来ペプチド
AU2017247626A AU2017247626B2 (en) 2016-04-08 2017-02-09 Chondrocyte extracellular matrix-derived peptide
CN201910099020.1A CN110025765B (zh) 2016-04-08 2017-02-09 软骨细胞的细胞外基质来源的肽
US16/178,618 US10532084B2 (en) 2016-04-08 2018-11-02 Chondrocyte extracellular matrix-derived peptide
AU2019200063A AU2019200063B2 (en) 2016-04-08 2019-01-07 Chondrocyte extracellular matrix-derived peptide

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
KR1020160043296A KR101798183B1 (ko) 2016-04-08 2016-04-08 건성안 예방 또는 치료용 약학조성물
KR10-2016-0043305 2016-04-08
KR1020160043305A KR101810163B1 (ko) 2016-04-08 2016-04-08 안구 표면질환 예방 또는 치료용 약학조성물
KR10-2016-0043298 2016-04-08
KR1020160043300A KR101810158B1 (ko) 2016-04-08 2016-04-08 연골세포 세포외기질 유래 펩타이드
KR1020160043298A KR101794713B1 (ko) 2016-04-08 2016-04-08 황반변성 예방 또는 치료용 약학조성물
KR10-2016-0043300 2016-04-08
KR10-2016-0043296 2016-04-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/091,998 A-371-Of-International US10709768B2 (en) 2016-04-08 2017-02-09 Chondrocyte extracellular matrix-derived peptide
US16/178,618 Continuation US10532084B2 (en) 2016-04-08 2018-11-02 Chondrocyte extracellular matrix-derived peptide

Publications (1)

Publication Number Publication Date
WO2017175963A1 true WO2017175963A1 (ko) 2017-10-12

Family

ID=60000731

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/001419 WO2017175963A1 (ko) 2016-04-08 2017-02-09 연골세포 세포외기질 유래 펩타이드

Country Status (7)

Country Link
US (2) US10709768B2 (ko)
EP (2) EP3539559B1 (ko)
JP (2) JP6770169B2 (ko)
CN (2) CN109310731B (ko)
AU (2) AU2017247626B2 (ko)
ES (2) ES2822289T3 (ko)
WO (1) WO2017175963A1 (ko)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018225961A1 (ko) * 2017-05-17 2018-12-13 주식회사 유유제약 신규한 펩타이드 및 이를 유효성분으로 포함하는 안구질환 치료용 약학 조성물
WO2020099925A3 (en) * 2018-11-14 2020-06-25 Yuyu Pharma, Inc. Peptides and pharmaceutical compositions for treating eye diseases
WO2020235932A1 (ko) * 2019-05-21 2020-11-26 주식회사 아이바이오코리아 신규한 펩타이드 화합물 또는 이의 약제학적으로 허용 가능한 염
US11613558B2 (en) 2018-11-14 2023-03-28 Yuyu Pharma, Inc. Peptides and pharmaceutical compositions for treating eye diseases
RU2819399C2 (ru) * 2018-11-14 2024-05-20 Юю Фарма, Инк. Пептиды и фармацевтические композиции для лечения глазных болезней

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230146455A1 (en) * 2020-03-05 2023-05-11 Yuyu Pharma, Inc. Treatment of inflammatory diseases with peptides and pharmaceutical compositions

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6110689A (en) * 1994-01-21 2000-08-29 Osteometer A/S Method of assaying collagen fragments in body fluids, a test kit and means for carrying out the method and use of the method to diagnose the presence of disorders associated with the metabolism of collagen
KR20060121836A (ko) * 2003-08-27 2006-11-29 (오에스아이) 아이테크, 인코포레이티드 안구의 혈관신생성 장애를 치료하기 위한 조합 치료법
US7718366B2 (en) * 2004-08-18 2010-05-18 National Health Research Institutes Methods and compositions relating to COL2A1 gene mutations and osteonecrosis
KR20100087188A (ko) * 2007-11-16 2010-08-03 알콘 리서치, 리미티드 안구 건조 치료 방법 및 조성물
KR101438744B1 (ko) * 2012-08-02 2014-09-15 전남대학교산학협력단 아디포넥틴을 유효성분으로 포함하는 안구건조증 또는 염증성 안구표면 질환의 예방 또는 치료용 조성물
KR20160079983A (ko) * 2014-12-26 2016-07-07 (주)에스앤에스 안구 표면 질환 예방 또는 치료용 약학조성물

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4041059A1 (de) * 1990-12-20 1992-06-25 Max Planck Gesellschaft Arthritis-unterdrueckende peptide sowie diese enthaltende pharmazeutische zubereitungen
WO2007102736A2 (en) * 2006-03-08 2007-09-13 Universitair Medisch Centrum Utrecht Interfering in activation of an immune cell by influencing interaction of lair and collagen.
EP2054442A2 (en) * 2006-06-14 2009-05-06 Cell-Matrix, Inc. Denatured collagen peptides and uses thereof
GB0818273D0 (en) * 2008-10-06 2008-11-12 Cambridge Entpr Ltd Modulation of cellular activity and differentiation
KR101555296B1 (ko) * 2013-12-10 2015-09-23 인제대학교 산학협력단 연골세포 유래 세포외 기질을 유효성분으로 함유하는 건성안 예방 또는 치료용 약학조성물
KR101690539B1 (ko) * 2015-07-30 2016-12-29 주식회사 아이바이오코리아 건성안 예방 또는 치료용 약학조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6110689A (en) * 1994-01-21 2000-08-29 Osteometer A/S Method of assaying collagen fragments in body fluids, a test kit and means for carrying out the method and use of the method to diagnose the presence of disorders associated with the metabolism of collagen
KR20060121836A (ko) * 2003-08-27 2006-11-29 (오에스아이) 아이테크, 인코포레이티드 안구의 혈관신생성 장애를 치료하기 위한 조합 치료법
US7718366B2 (en) * 2004-08-18 2010-05-18 National Health Research Institutes Methods and compositions relating to COL2A1 gene mutations and osteonecrosis
KR20100087188A (ko) * 2007-11-16 2010-08-03 알콘 리서치, 리미티드 안구 건조 치료 방법 및 조성물
KR101438744B1 (ko) * 2012-08-02 2014-09-15 전남대학교산학협력단 아디포넥틴을 유효성분으로 포함하는 안구건조증 또는 염증성 안구표면 질환의 예방 또는 치료용 조성물
KR20160079983A (ko) * 2014-12-26 2016-07-07 (주)에스앤에스 안구 표면 질환 예방 또는 치료용 약학조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CREIGHTON: "Proteins Structures and Molecular Principles", 1983, WH FREEMAN AND CO.
ROBERGE JY ET AL., SCIENCE, vol. 269, 1995, pages 202 - 204
VILLAREAL AL; FARLEY W; PFLUGFELDER SC: "Effect of topical ophthalmic epinastine and olopatadine on tear volume in mice", EYE CONTACT LENS, vol. 32, no. 6, 2006, pages 272 - 276

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018225961A1 (ko) * 2017-05-17 2018-12-13 주식회사 유유제약 신규한 펩타이드 및 이를 유효성분으로 포함하는 안구질환 치료용 약학 조성물
EP3643723A4 (en) * 2017-05-17 2021-03-31 Yuyu Pharma, Inc. NEW PEPTIDE AND PHARMACEUTICAL COMPOSITION FOR TREATMENT OF EYE DISEASES WITH SUCH NEW PEPTIDE AS THE ACTIVE SUBSTANCE
WO2020099925A3 (en) * 2018-11-14 2020-06-25 Yuyu Pharma, Inc. Peptides and pharmaceutical compositions for treating eye diseases
US11613558B2 (en) 2018-11-14 2023-03-28 Yuyu Pharma, Inc. Peptides and pharmaceutical compositions for treating eye diseases
EP3880690A4 (en) * 2018-11-14 2023-09-13 YUYU Pharma, Inc. PEPTIDES AND PHARMACEUTICAL COMPOSITIONS FOR TREATING EYE DISEASES
RU2819399C2 (ru) * 2018-11-14 2024-05-20 Юю Фарма, Инк. Пептиды и фармацевтические композиции для лечения глазных болезней
WO2020235932A1 (ko) * 2019-05-21 2020-11-26 주식회사 아이바이오코리아 신규한 펩타이드 화합물 또는 이의 약제학적으로 허용 가능한 염
KR20220062252A (ko) * 2019-05-21 2022-05-16 주식회사 아이바이오코리아 신규한 펩타이드 화합물 또는 이의 약제학적으로 허용 가능한 염
KR102523943B1 (ko) * 2019-05-21 2023-04-20 주식회사 아이바이오코리아 신규한 펩타이드 화합물 또는 이의 약제학적으로 허용 가능한 염

Also Published As

Publication number Publication date
EP3539559B1 (en) 2020-08-26
JP6770169B2 (ja) 2020-10-14
US10532084B2 (en) 2020-01-14
US20190111112A1 (en) 2019-04-18
EP3441081B1 (en) 2020-07-15
CN110025765A (zh) 2019-07-19
CN109310731A (zh) 2019-02-05
AU2017247626B2 (en) 2019-08-29
AU2019200063B2 (en) 2019-10-31
ES2819030T3 (es) 2021-04-14
CN109310731B (zh) 2022-03-29
EP3539559A1 (en) 2019-09-18
CN110025765B (zh) 2022-03-29
ES2822289T3 (es) 2021-04-30
AU2019200063A1 (en) 2019-01-24
JP2019519597A (ja) 2019-07-11
US20190100572A1 (en) 2019-04-04
US10709768B2 (en) 2020-07-14
AU2017247626A1 (en) 2018-11-29
JP2019065013A (ja) 2019-04-25
EP3441081A4 (en) 2019-09-18
JP6640311B2 (ja) 2020-02-05
EP3441081A1 (en) 2019-02-13

Similar Documents

Publication Publication Date Title
WO2017175963A1 (ko) 연골세포 세포외기질 유래 펩타이드
US9695218B2 (en) Pharmaceutical composition for preventing or treating ocular surface disease
Yeh et al. Soluble lumican glycoprotein purified from human amniotic membrane promotes corneal epithelial wound healing
US20120315256A1 (en) Use of transforming growth factor - beta 1 (tgf-b1) inhibitor peptides for the treatment of corneal fibrosis and/or haze
Sy et al. Atopic keratoconjunctivitis.
WO2017018613A1 (ko) 건성안 예방 또는 치료용 약학조성물
WO2013051767A1 (ko) 안지오제닌의 신규 용도
WO2020116810A1 (ko) Ｆａｓ 신호전달 억제용 펩티드를 포함하는 비만, 지방간 또는 지방간염의 예방 또는 치료용 약학적 조성물
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
KR101798183B1 (ko) 건성안 예방 또는 치료용 약학조성물
Abed et al. Clinical and histopathological study of the effect of adipose-derived mesenchymal stem cells on corneal neovascularization following alkali burn in a rabbit model.
KR101810163B1 (ko) 안구 표면질환 예방 또는 치료용 약학조성물
WO2021215836A1 (ko) 베르베논 유도체를 포함하는 안구질환의 치료 또는 예방용 약학조성물
WO2023113300A1 (ko) 신규한 펩타이드를 포함하는 황반변성의 치료용 조성물
EP3284475A1 (en) Agent for prevention or treatment of corneal disorders
WO2023128674A1 (ko) Hapln1을 포함하는 안구건조증의 예방 또는 치료용 조성물
WO2022025455A1 (ko) 염증성 질환의 예방 또는 치료용 조성물 및 이의 용도
Lai et al. Endothelin‐1 Enhances Corneal Fibronectin Deposition and Promotes Corneal Epithelial Wound Healing after Photorefractive Keratectomy in Rabbits
WO2019212199A1 (ko) 염증성 안구표면질환의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2019503878

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2017779264

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017779264

Country of ref document: EP

Effective date: 20181108

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17779264

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017247626

Country of ref document: AU

Date of ref document: 20170209

Kind code of ref document: A