WO2015183044A1 - 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도 - Google Patents

신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도 Download PDF

Info

Publication number
WO2015183044A1
WO2015183044A1 PCT/KR2015/005434 KR2015005434W WO2015183044A1 WO 2015183044 A1 WO2015183044 A1 WO 2015183044A1 KR 2015005434 W KR2015005434 W KR 2015005434W WO 2015183044 A1 WO2015183044 A1 WO 2015183044A1
Authority
WO
WIPO (PCT)
Prior art keywords
botulinum toxin
cell
recombinant protein
peptide
protein
Prior art date
Application number
PCT/KR2015/005434
Other languages
English (en)
French (fr)
Inventor
이병규
이강진
김민중
박홍규
Original Assignee
주식회사 프로셀테라퓨틱스
주식회사 에이티지씨
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프로셀테라퓨틱스, 주식회사 에이티지씨 filed Critical 주식회사 프로셀테라퓨틱스
Priority to BR112016027773-2A priority Critical patent/BR112016027773B1/pt
Priority to CN201580028681.5A priority patent/CN106459155B/zh
Priority to EP15800126.3A priority patent/EP3156412B1/en
Priority to KR1020167032746A priority patent/KR101882461B1/ko
Priority to JP2017515651A priority patent/JP6243577B2/ja
Priority to US15/313,259 priority patent/US10300118B2/en
Priority to CA2949653A priority patent/CA2949653C/en
Priority to RU2016146659A priority patent/RU2670135C2/ru
Publication of WO2015183044A1 publication Critical patent/WO2015183044A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/4886—Metalloendopeptidases (3.4.24), e.g. collagenase
    • A61K38/4893—Botulinum neurotoxin (3.4.24.69)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/08—Clostridium, e.g. Clostridium tetani
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0014—Skin, i.e. galenical aspects of topical compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/04—Antipruritics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/24—Metalloendopeptidases (3.4.24)
    • C12Y304/24069—Bontoxilysin (3.4.24.69), i.e. botulinum neurotoxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a novel cell permeable peptide and a cell permeable botulinum toxin recombinant protein fused to one end of the cell permeable peptide and the botulinum toxin light chain and their use.
  • Botulinum toxin is a neurotoxin produced by Clostridium botulinum , a gram-positive anaerobic bacterium that grows in rotten canned or spoiled meat. It is classified into eight neurotoxins, of which seven (A, B, C, D, E, F, G) can cause nerve paralysis. It is about 150 kDa in size, and consists of a complex of non-toxins in addition to the botulinum toxin protein. The size of each complex is generated up to 900 kDa depending on the type of neurotoxin. Depending on the botulinum toxin type, the type of action, the subject, and the duration of activity vary. Among them, botulinum toxin type A is known as one of the deadly biological agents.
  • Botulinum toxin acts as a paralytic by blocking signals that cause muscle spasms or contractions, which has been used for therapeutic or cosmetic purposes since the US FDA approval in 1989.
  • neuromuscular diseases such as strabismus, torticollis or blepharospasm
  • cosmetic purposes for wrinkles, frown removal and square jaw treatment, hyperhidrosis or migraine It is used as an injection.
  • Adverse events such as dysphagia, voice change, dry mouth and blurred vision have been reported, but there are no direct deaths due to botulinum toxin, but if used properly It is considered a safe drug.
  • the application is limited in pregnant or lactating women.
  • botulinum toxin In the current application of botulinum toxin, the duration of botulinum toxin injected into the skin tissue is within 3-6 months, and when the signal between nerve and muscle is blocked by the botulinum toxin, a new nerve branch is created, which is caused by botulinum toxin. Regular treatment is necessary because it reduces the paralysis effect of nerves. In addition, when the botulinum toxin is repeatedly administered, an antibody to the botulinum toxin in vivo is formed, and thus the effect is reduced.
  • the skin which is a body tissue that is always in contact with the external environment, plays a major role as a protective barrier that prevents fluid leakage, infection, and water loss, and is composed of epidermis, dermis and subcutaneous tissue.
  • the stratum corneum of the epidermis is in the outermost part of the skin and prevents the skin from drying out by inhibiting the loss of moisture and electrolytes out of the skin and provides an environment for normal biochemical metabolism of the skin.
  • the stratum corneum of the skin protects the body from external physical damage and chemicals, and plays an important role in preventing bacteria, fungi, viruses, etc. from invading the skin.
  • the stratum corneum of the skin is a natural constituent of the keratinocyte (keratinocyte) is a natural death and forms a dense structure in the outermost layer of the skin, due to the sweat and various lipid components show an acidity of pH around 5.
  • keratinocyte keratinocyte
  • the molecular weight should be as small as 1,000 or less, and that it should have lipophilic properties.
  • Low molecular synthetic compounds or natural compounds which are frequently used as cosmetic and medical raw materials, are known to be easily transferred into cells.
  • macromolecules such as proteins, peptides, and nucleic acids have a double lipid membrane structure due to their molecular weight and hydrophilic properties. Since it is difficult to penetrate into the cell membrane, the permeation efficiency of low molecular weight materials is extremely low due to the intrinsic properties of the stratum corneum which actually constitutes the skin barrier, and the permeation efficiency of high molecular weight materials is known to be lower.
  • PTDs protein transduction domains
  • HIV-Tat and antennapedia are short-charged peptides that are positively charged and contain DNA, RNA, fat, carbohydrates, compounds, or viruses as well as proteins. Is known to be able to deliver intracellularly, and is receptor-independent and has been reported to penetrate the cell membrane as a mechanism of endocytosis or phagocytosis.
  • MTD macromolecular transfer domain
  • the cell membrane permeation of these peptides can increase the value of development as a new therapeutic drug by transferring a nucleic acid material such as therapeutic protein, DNA or siRNA, which was difficult to use as a drug due to rapid in vivo half-life or cell membrane permeation.
  • MTD is known to be highly useful when developing an external preparation of botulinum toxin because the delivery efficiency of compounds, peptides, and proteins, such as cargo materials, is higher than that of HIV-Tat-derived peptides.
  • the light or light chain derivative of skin permeation and neuronal cell permeation botulinum toxin to be pursued in the present invention should be limited to the concentration of 1 ⁇ 10ppm in order to ensure safety even after attenuation (toxicity attenuation) process
  • PTD toxicity attenuation
  • MTD can simultaneously penetrate the skin barrier and penetrate nerve cells and penetrate the skin barrier in a concentration-dependent manner even at low concentrations. The development of an MTD having such characteristics or using a new one was required.
  • the present invention is designed to efficiently penetrate the botulinum toxin protein that is difficult to deliver through the skin due to the size of the molecular weight and the intrinsic properties of the stratum corneum as described above, and then to the nerve cells present in the skin tissue, botulinum toxin It is an object of the present invention to provide a novel cell-penetrating peptide capable of mediating intracellular transport of biologically active molecules derived from the translocation domain of the heavy chain.
  • the present invention provides a composition comprising the botulinum toxin recombinant protein as an active ingredient, more specifically, it enables the transdermal delivery of cell permeable botulinum toxin recombinant protein, and for various dermatological and cosmetic purposes It is yet another object to provide a composition which can be used topically for this purpose.
  • the present invention provides a peptide capable of mediating the delivery of a biologically active molecule into a cell, wherein the peptide provides a cell permeable peptide consisting of the amino acid sequence of SEQ ID NO: 1.
  • the present invention provides a polynucleotide encoding the peptide.
  • the polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 2.
  • the present invention provides a cell-permeable botulinum toxin recombinant protein in which a cell-permeable peptide consisting of the amino acid sequence of SEQ ID NO: 1 is fused to one side or sock end of a botulinum toxin light chain.
  • the botulinum toxin recombinant protein may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO: 31 to SEQ ID NO: 58.
  • the botulinum toxin light chain may consist of an amino acid sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 9.
  • the botulinum toxin light chain may further include a hexahistidine tag at one end.
  • the botulinum toxin light chain may be selected from the group consisting of botulinum toxin serotypes A, B, C, D, E, F and G.
  • the fusion may be a cell-penetrating peptide fused to the carboxy terminal, amino terminal or both of the botulinum toxin light chain.
  • the fusion may be made by peptide bond or covalent bond.
  • the present invention provides a polynucleotide encoding the cell permeable botulinum toxin recombinant protein.
  • the polynucleotide may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 59 to SEQ ID NO: 86.
  • the present invention provides a recombinant expression vector comprising the polynucleotide.
  • the recombinant expression vector is an affinity label selected from the group consisting of His, HAT, FLAG, c-myc, SBP, Chitin-binding domain, Glutathione-S transferase and Maltose-binding protein tag).
  • the present invention provides a bacterium transformed with the recombinant expression vector.
  • the present invention provides a pharmaceutical composition for treating a disease selected from the group consisting of migraine, anal pruritus and hyperhidrosis.
  • the pharmaceutical composition may be for transdermal administration.
  • the present invention provides an external composition for skin comprising the cell permeable botulinum toxin recombinant protein as an active ingredient.
  • the present invention provides a cosmetic composition comprising the cell-permeable botulinum toxin recombinant protein as an active ingredient.
  • the composition may be applied to improve wrinkles, square jaws and pointed jaws, wounds, softening, scars, acne, pores, elasticity or keloids.
  • the present invention facial spasm, eyelid spasm, quadrilateral, blepharospasm, cervical myotonic dystrophy, pharyngeal central myotonic dystrophy, convulsive dyskinesia, migraine headaches comprising transdermal administration of the cell permeable botulinum toxin recombinant protein to the subject It provides a method for treating a disease selected from the group consisting of anal pruritus and hyperhidrosis.
  • the present invention provides a method of improving wrinkles, softening, scars, acne, pores, elasticity or keloids, comprising the step of transdermally administering the cell permeable botulinum toxin recombinant protein to an individual.
  • the present invention is directed from the group consisting of facial convulsions, eyelid convulsions, quadriceps, blepharospasm, cervical dystonia, central pharyngeal dystonia, convulsive dysphonia, migraine, anal pruritus and hyperhidrosis of the cell-permeable botulinum toxin recombinant protein. Provides use for treating the disease of choice.
  • the present invention provides a use of the cell permeable botulinum toxin recombinant protein for use in ameliorating wrinkles, square and pointed jaws, wounds, softening, scars, acne, pores, elasticity or keloid symptoms.
  • the present invention provides a cell permeable botulinum toxin recombinant protein production method comprising culturing the transformed bacteria.
  • Botulinum toxin works by causing paralysis by blocking signals that cause muscle spasms or contractions.
  • the muscle paralysis effect of botulinum toxin is currently used in the treatment of facial spasms, dystonia, migraine, disorder of the jaw joint, hyperhidrosis, and aesthetic and cosmetic fields such as wrinkle improvement, pore reduction, acne, elasticity and square jaw relief.
  • a topical application of botulinum toxin that does not require injection would be a safer and more desirable therapeutic alternative.
  • the cell-penetrating peptide-botulinum toxin recombinant protein of the present invention can exhibit activity by cleaving a snare protein of nerve cells through the skin complex layer and nerve cells, the molecular weight of the botulinum toxin Significantly small, the possibility of antibody production can be significantly reduced, thereby reducing the efficacy of neutralizing antibody formation.
  • the cell-penetrating peptide-botulinum toxin recombinant protein of the present invention can be delivered through the percutaneous, retaining the inherent efficacy of botulinum toxin, and at the same time, the ease of use is expanded, and thus, various diseases can be treated, aesthetic and / or cosmetic purposes using the same. It can be effectively used as a topical agent.
  • botulinum toxin type A expresses severe toxicity with only a few picograms (pg), but the cell-permeable botulinum toxin according to the present invention has been attenuated to express toxicity at the microgram ( ⁇ g) level. Full safety from toxicity can be ensured.
  • Figure 1 shows the characteristics of the cell permeable peptide TD1 in a table.
  • Figure 2 is a graphical illustration of the structure of the cell permeable peptide TD1.
  • 3A and 3B confirm the in vitro permeability of the cell permeable peptide TD1 to the keratinocytes (HaCaT cells) using flow cytometry.
  • 3c shows the in vitro permeability of the cell permeable peptide TD1 to neurons (SiMa cells) using flow cytometry.
  • 3d shows the in vitro permeability of cell permeable peptide TD1 to neurons (U-87MG cells) using flow cytometry.
  • 3e shows the in vitro permeability of the cell permeable peptide TD1 to HeLa cells using flow cytometry.
  • Figure 4a is confirmed by the confocal microscopy (Confocal microscopy) of the cell permeable peptide TD1 in vitro transmission in keratinocytes (HaCaT cells).
  • 4b shows the in vitro transmission ability of the cell-permeable peptide TD1 in neurons (SiMa cell) using confocal microscopy.
  • Figure 4c is confirmed by the confocal microscopy (confocal microscopy) of the cell permeable peptide TD1 in vitro transmission in neurons (U-87MG cells).
  • 4d shows the in vitro permeability of the cell permeable peptide TD1 in HeLa cells using confocal microscopy.
  • FIG. 5 is a schematic diagram showing the purification of the botulinum toxin recombinant protein TD1-Lc bound to the cell permeable peptide TD1.
  • Figure 6 shows the purity and molecular weight of the purified cell permeable botulinum toxin recombinant protein TD1-Lc through SDS-PAGE.
  • FIG. 7a shows the in vitro permeability of the cell-permeable botulinum toxin recombinant protein TD1-Lc to nerve cells (SiMa cells) using flow cytometry.
  • 7b shows the in vitro permeability of the cell-permeable botulinum toxin recombinant protein TD1-Lc in neurons (SiMa cell) using confocal microscopy.
  • FIG. 7C shows the in vitro permeability of the cell-permeable botulinum toxin recombinant protein TD1-Lc in keratinocytes (HaCaT cells) using confocal microscopy.
  • Figure 8 confirms the permeability of the cell-permeable botulinum toxin recombinant protein TD1-Lc in artificial skin mimetics.
  • Figure 9 shows the in vitro SNAP25 cleavage activity of the purified cell permeable botulinum toxin recombinant protein TD1-Lc by SDS-PAGE.
  • Figure 10a confirms the in vitro SNAP25 cleavage activity of the cell permeable botulinum toxin recombinant protein TD1-Lc in keratinocytes (HaCaT cells).
  • Figure 10b confirms the in vitro SNAP25 cleavage activity of the cell-permeable botulinum toxin recombinant protein TD1-Lc in neurons (SiMa cell).
  • FIG. 11A evaluates the cytotoxicity of the cell permeable botulinum toxin recombinant protein TD1-Lc in keratinocytes (HaCaT cells).
  • FIG. 11B shows the cytotoxicity of the cell-permeable botulinum toxin recombinant protein TD1-Lc in neuronal cells (SiMa cells).
  • Figure 12 confirms the stability of the purified cell permeable botulinum toxin recombinant protein TD1-Lc according to the storage period by SDS-PAGE.
  • 13 is a result of evaluating the safety and skin irritation test of the cell-permeable botulinum toxin recombinant protein TD1-Lc prepared in a cosmetic preparation through a clinical laboratory.
  • 14a, 14b and 14c are the results of evaluating the clinical efficacy of the cell-permeable botulinum toxin recombinant protein TD1-Lc prepared in a cosmetic preparation through a clinical laboratory.
  • the present invention provides a novel cell permeable peptide and a transdermal delivery composition and method of a botulinum toxin light chain using the same.
  • the novel cell-penetrating peptide TD1 developed has been found to be suitable as a delivery system that allows botulinum toxin light chains to be administered transdermally by topical application of an appropriate agent.
  • the botulinum toxin is expressed as a polypeptide, but is divided into a heavy chain (H chain) of about 100 kDa and a light chain (L chain) of about 50 kDa by the reconstitution process after expression.
  • the chains are connected by disulfide bonds.
  • the H chain binds to receptors on nerve cells, allowing botulinum toxin to enter through endocytosis.
  • the L chain of botulinum toxin enters the cell, then exits the endosomes, enters the cytoplasm, and cleaves the SNARE protein in the cytoplasm to inhibit acetylcholine secretion, thereby exhibiting muscle paralysis effects.
  • the isolated botulinum toxin light chain having a molecular weight of 50 kDa cannot penetrate the cell membrane and thus cannot function by itself.
  • the help of a botulinum toxin heavy chain of about 100 kDa is necessary for the botulinum toxin light chain to be delivered to the cytoplasm of neurons and thus exhibit botulinum toxin-specific activity.
  • the botulinum toxin heavy chain is composed of two sites: a receptor-binding domain that binds to receptors of the neuronal membrane and a translocation domain that is internal to the cell membrane to facilitate the translocation of the light chain.
  • the botulinum toxin As a result of research on a method for efficiently delivering the botulinum toxin, more specifically, the botulinum toxin light chain to the skin and nerve cells, through the structural analysis of the botulinum toxin heavy chain, a novel Cell permeable peptides were developed.
  • the three-dimensional structure of the translocation domain of the botulinum toxin heavy chain was analyzed in silico to extract and select a sequence of a protein binding site that may be developed as a cell permeable peptide.
  • the MTD which is a signal protein or a viral protein-derived peptide involved in the secretion of various proteins, penetrates the cell membrane and mediates the introduction of macromolecules such as proteins into the cell.
  • Macromolecule Transduction Domain Karl Patent No. 10-1258279
  • the peptide is amphiphilic, and the arrangement of polar amino acids increases cell membrane accessibility, improves physical properties and solubility, and adds a non-polar amino acid to give hydrophobicity suitable for permeation of the cell membrane to develop a novel cell-permeable peptide,
  • the novel cell permeable peptide has been confirmed to possess permeability to human skin keratinocytes and neurons at the same time, and completed the present invention based thereon.
  • the present invention provides a novel cell permeable peptide, and more specifically, as a peptide capable of mediating the intracellular transport of a biologically active molecule, provides a cell permeable peptide consisting of the amino acid sequence of SEQ ID NO: 1.
  • the novel cell permeable peptide is a peptide capable of mediating the delivery of biologically active molecules into cells, and was named "TD1".
  • Theoretical pi can be analyzed as 9.31;
  • amphiphilic peptides having at least 60% hydrophobic amino acid composition of the fragments
  • GRAVY Gram Average of Hydropathicity
  • the SVM value is a sequence with a property of -0.15.
  • the cell permeable peptide itself preferably does not have a defined enzyme or therapeutic biological activity, but acts as a carrier to enable intracellular transmission through the cell membrane. It may be attached to the N-terminus or C-terminus of the cargo to be transferred into the cell and to the sock end, and may be attached forward or reverse at each end.
  • the peptide according to the present invention is preferably applied as a monomer, but is not limited thereto, and may be used in the form of a dimer or a polymer.
  • the peptide according to the present invention may be a peptide containing the amino acid sequence of SEQ ID NO: 1 in minimum units.
  • one or more amino acids may be added to one or the sock end to change cell membrane accessibility, permeability and physical properties.
  • the present invention provides a polynucleotide encoding the peptide. That is, it encodes a cell-penetrating peptide consisting of the amino acid sequence of SEQ ID NO: 1, but may consist of the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • the polynucleotides according to the invention may be in the form of RNA or DNA, wherein the DNA comprises cDNA and synthetic DNA.
  • DNA can be single stranded or double stranded. If single stranded, it may be a coding strand or a non-coding (antisense) strand.
  • the coding sequence may be identical to the nucleotide sequence of SEQ ID NO: 2, or may be another coding sequence, wherein the coding sequence may contain the same polypeptide as a result of the degeneracy or redundancy of the genetic code. Can be encoded.
  • the present invention provides a cell-permeable botulinum toxin recombinant protein in which a cell-permeable peptide consisting of the amino acid sequence of SEQ ID NO: 1 is fused to one side or sock end of the botulinum toxin light chain.
  • cell-permeable botulinum toxin recombinant protein includes a novel cell-permeable peptide TD1 and a botulinum toxin light chain, and means a binder formed by chemical bonds such as peptide bonds or covalent bonds. That is, the cell-permeable botulinum toxin recombinant protein delivers botulinum toxin light chain into the cell efficiently by fusion of a specific cell-permeable peptide to the botulinum toxin light chain, which is a large molecule that is not easily introduced into the cell.
  • the cell permeable peptide may be fused to a carboxy terminal, an amino terminal, or both of the botulinum toxin light chain.
  • botulinum toxin means any known kind of botulinum toxin, whether or not it can be subsequently found, including variants or fusion proteins produced or engineered by bacteria or by recombinant technology. do.
  • the botulinum toxin light chain may be selected from the group consisting of botulinum toxin serotypes A, B, C, D, E, F and G, wherein the botulinum toxin light chain is SEQ ID NO: 3 to SEQ ID NO: It may consist of an amino acid sequence selected from the group consisting of nine.
  • one end may further include a hexahistidine tag.
  • the botulinum toxin light chain may alternatively be a botulinum toxin derivative, ie, a compound having botulinum toxin activity but optionally one or more modifications in part or sequence.
  • a botulinum toxin derivative ie, a compound having botulinum toxin activity but optionally one or more modifications in part or sequence.
  • light chain endopeptidase may be applied by methods such as deletion, modification, replacement, or chimeric fusion on the amino acid sequence.
  • the modified form may be modified in such a manner as to maintain the activity of the compound and enhance the properties or reduce the side effects.
  • a portion of a botulinum toxin light chain or a botulinum toxin light chain prepared by recombinant or chemical synthesis can be used.
  • the cell permeable botulinum toxin recombinant protein may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO: 31 to SEQ ID NO: 58, the polynucleotide encoding them is selected from the group consisting of SEQ ID NO: 59 to SEQ ID NO: 86
  • the base sequence may be formed, but is not limited thereto.
  • the skin keratinocytes HaCaT cell
  • nerve cells SiMa cell, U-87 MG cell
  • skin-derived artificial membrane It was confirmed that the cell permeability was significantly superior to (Start-M) (see Examples 6 and 7).
  • the present invention provides a recombinant expression vector comprising a polynucleotide encoding the cell permeable botulinum toxin recombinant protein.
  • a "recombinant expression vector” refers to a gene construct that is capable of expressing a protein of interest or RNA of interest in a suitable host cell, and includes a gene construct comprising essential regulatory elements operably linked to express the gene insert.
  • operably linked means that the nucleic acid expression control sequence and the nucleic acid sequence encoding the protein or RNA of interest are functionally linked to perform a general function.
  • a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect the expression of the encoding nucleic acid sequence.
  • Operative linkage with recombinant expression vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art.
  • Expression vectors usable in the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like. Suitable expression vectors include membrane targeting or in addition to expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers. It may be prepared in various ways according to the purpose, including a signal sequence (leader sequence) or a signal sequence for secretion. The promoter of the expression vector may be constitutive or inducible.
  • the expression vector may include a selection marker for selecting a host cell containing the vector, and may include the origin of replication when the expression vector capable of replication. Also, from the group consisting of His, HAT, FLAG, c-myc, SBP, chitin-binding domain, glutathione-S transferase and maltose-binding protein The affinity tag selected may also be included.
  • the present invention provides a transformed bacterium transformed with the recombinant expression vector.
  • the present invention provides a method for producing a cell-permeable botulinum toxin recombinant protein comprising the step of culturing the transforming bacteria.
  • the production method is carried out by culturing the transformed bacteria under appropriate media and conditions such that the polynucleotide encoding the cell permeable botulinum toxin recombinant protein of the present invention is expressed in the recombinant expression vector introduced into the transformed bacterium of the present invention.
  • Methods for culturing the transformed bacteria to express the recombinant protein are known in the art, for example, inoculated in a suitable medium in which the transformed bacteria can grow, followed by seed culture, and then inoculated in the medium for culture and suitable Expression of the protein can be induced by culturing in the presence of conditions such as isopropyl- ⁇ -D-thiogalactoside (IPTG), which is a gene expression inducer.
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • substantially pure recombinant protein Upon completion of the culture, substantially pure recombinant protein can be recovered from the culture.
  • substantially pure in the present invention means that the sequence of the recombinant protein of the present invention and the polynucleotide encoding it is substantially free of other proteins derived from host cells.
  • Recovery of the recombinant protein expressed in the transgenic bacteria can be carried out through various separation and purification methods known in the art, and typically centrifuged cell lysate to remove cell debris, culture impurities, etc.
  • precipitation for example, salting out (ammonium sulfate precipitation and sodium phosphate precipitation), solvent precipitation (protein fraction precipitation using acetone, ethanol, isopropyl alcohol, etc.) and the like can be carried out, and dialysis, electrophoresis and Various column chromatography can be performed.
  • chromatography techniques such as ion exchange chromatography, gel-filtration chromatography, HPLC, reverse phase-HPLC, adsorption chromatography, affinity column chromatography, and ultrafiltration may be used alone or in combination.
  • the recombinant protein expressed in bacteria transformed with the recombinant expression vector may be classified into a soluble fraction and an insoluble fraction depending on the characteristics of the protein when the protein is separated. If most of the expressed protein is in the soluble fraction, the protein can be easily isolated and purified according to the method described above, but most of the expressed protein is in the form of an insoluble fraction, i.e. an inclusion body. In the case of dissolving the protein as much as possible with a solution containing a protein denaturant such as urea, surfactant, etc., it can be purified by centrifugation to carry out dialysis, electrophoresis and various column chromatography filled with various kinds of resin.
  • a protein denaturant such as urea, surfactant, etc.
  • the desalting and reconstituting may be performed by dialysis and dilution using a solution containing no protein denaturant, or centrifugation using a filter.
  • the salt concentration in the solution used for purification is high, such a desalting and reconstitution step can be performed.
  • the activity of the botulinum toxin is maintained even in the cell-permeable botulinum toxin recombinant protein (TD1-Lc) It was confirmed that the same function as the botulinum toxin (see Examples 8 and 9). In addition, it was confirmed that not only cytotoxicity was observed in human keratinocytes (HaCaT cells) and neurons (SiMa cells) (see Example 10), but also excellent stability (see Example 11). Therefore, the cell permeable botulinum toxin recombinant protein (TD1-Lc) according to the present invention can be effectively used as a topical agent for various disease treatment, aesthetic and / or cosmetic purposes.
  • the present invention comprises a cell-permeable botulinum toxin recombinant protein, facial spasm, eyelid spasm, quadrilateral, eyelid spasm, cervical dystonia, pharyngeal dystonia,
  • a pharmaceutical composition for treating a disease selected from the group consisting of convulsive dysphonia, migraine, anal pruritus and hyperhidrosis.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier in addition to the cell permeable botulinum toxin recombinant protein as an active ingredient, wherein the pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention includes saline, Buffered saline, water, glycerol and ethanol, and the like, but are not limited to this. Any suitable agent known in the art may be used.
  • the present invention provides a skin external composition or cosmetic composition comprising a botulinum toxin recombinant protein as an active ingredient.
  • the composition may be applied to alleviate or ameliorate wrinkles, square jaw and point jaw correction, wounds, softening, scars, acne, pore reduction, elasticity, lifting or keloid symptoms, but is not limited thereto.
  • the compositions according to the invention can be used to induce paralysis in muscles or glandular structures beneath the skin to relieve contraction or cause relaxation or to deliver an effective amount for other cosmetically desired effects.
  • the cosmetic composition of the present invention may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and the like can be formulated, but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, or powder.
  • the cosmetically effective carrier contained in the cosmetic composition of the present invention a carrier commonly used in the art may be used depending on the dosage form.
  • a carrier commonly used in the art may be used depending on the dosage form.
  • the formulation of the present invention is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components.
  • a carrier commonly used in the art may be used depending on the dosage form.
  • a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Soluble cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide.
  • Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • the components included in the cosmetic composition of the present invention may include components conventionally used in cosmetic compositions, for example, moisturizers, antioxidants, fragrances, fillers, thickeners, dyes, colorants, surfactants. , Natural or synthetic oils, preservatives, penetrants, hydrating agents, antifungal agents, emulsifier solvents, emollients, deodorants, waxes, and the like, optionally with plant extracts, conditioning agents, pigmented or whitening agents, sunscreens, wetting agents, vitamins and Other components conventionally used in such products, including derivatives and the like.
  • components conventionally used in cosmetic compositions for example, moisturizers, antioxidants, fragrances, fillers, thickeners, dyes, colorants, surfactants.
  • Natural or synthetic oils preservatives, penetrants, hydrating agents, antifungal agents, emulsifier solvents, emollients, deodorants, waxes, and the like, optionally with plant extracts, conditioning agents, pigmente
  • the present invention provides facial spasms, eyelid spasms, quadriceps, blepharospasm, cervical dystonia, comprising the steps of local administration of the cell-permeable botulinum toxin recombinant protein to a subject.
  • Treatment of diseases selected from the group consisting of central pharyngeal dystonia, convulsive dysphonia, migraine, anal pruritus and hyperhidrosis or improvement of wrinkles, square jaw and pointed jaw, wound, skin softening, scar, acne, pores, elasticity or keloid Provide a method.
  • "individual” means a subject in need of treatment of a disease or improvement of skin, and more specifically human or non-human primates, mice, rats, dogs, cats, horses And mammals such as cows.
  • Topical administration means the direct administration of a drug to or near an area on or in an animal body in need of the biological effect of the medicament.
  • Topical administration excludes systemic routes of administration such as intravenous or oral administration.
  • Topical administration is included as a form of topical administration in which the pharmaceutical formulation is applied to the skin of a human.
  • the composition of the present invention is preferably administered transdermally for the dermatological and cosmetic desired effect.
  • the total effective amount of the recombinant protein of the present invention may be administered to a patient in a single dose, and the fractionated treatment protocol in which multiple doses are administered for a long time. It may be administered by, and the content of the active ingredient may vary depending on the degree of symptoms. This means an amount that is sufficient but intrinsically safe to produce the desired muscle paralysis or biological or aesthetic effect.
  • the effective dose of the recombinant protein may be determined in consideration of various factors such as the age, weight, health condition, sex, severity of the disease, diet, and excretion rate, as well as the route and frequency of treatment of the drug. .
  • a novel dermal and cell permeable peptide has been developed that enables transdermal delivery of botulinum toxin light chains.
  • the structure and function of the botulinum toxin heavy and light chains were analyzed, and the sequence was selected based on the fact that the heavy chain plays an important role in neuronal permeation of botulinum toxin type A.
  • the amphiphilic arrangement of polar amino acids increases cell membrane accessibility, improves physical properties and solubility, and adds nonpolar amino acids to hydrophobicity suitable for cell membrane permeation.
  • TD1 The cell permeable peptide designed as above was named TD1, and its characteristics and structure were analyzed by the ProtParam program ( http://web.expacy.org/protparam), and the results are shown in FIGS. 1 and 2.
  • HaCaT cells were cultured using DMEM complete media (10% FBS, 1% penicillin / streptomycin). For flow cytometry, transfer from 12 well plates and incubate for another 16 to 24 hours, each sample for 1 hour (treatment concentration 5 ⁇ M, 10 ⁇ M) and 3 hours (serum free medium) without FBS. Concentrations of 2.5 ⁇ M, 5 ⁇ M, 10 ⁇ M). After the reaction time is over, the sample is washed twice with DPBS to remove the residual sample, treated with 0.05% trypsin-EDTA, and reacted for 10 minutes with light blocking, and then the trypsin-EDTA is burned using complete media.
  • SiMa cell has a weak cell adhesion to the culture plate, and uses a culture plate coated with gelatin (sigma, G2500), coated with 0.1% gelatin solution on the culture plate, removes the solution after 1 hour at room temperature, and dried. Used as. Complete media were passaged at 80% or more confluency using RPMI1640 (10% FBS, 1% penicillin / streptomycin). Cells were stabilized by repeated passage and inoculated with 5 ⁇ 10 5 / well per 100 mm dish, and then cultured overnight in an incubator at 37 ° C. with 5% CO 2 .
  • Each sample (control: cell only, FITC only, comparative: HIV-Tat & kFGF4-derived peptide, test substance: TD1) was treated at 5 ⁇ M concentration for 1 and 6 hours in non-serum medium without FBS. . After the reaction time was completed, the sample was washed twice with DPBS to remove the residual sample, treated with 0.05% trypsin-EDTA, and reacted for 10 minutes while blocking the light, followed by inactivation of trypsin-EDTA using complete media. Cells were then collected in the prepared tube, 3 mL of phosphate buffer solution was added, and centrifuged at 2,000 rpm for 3 minutes.
  • Trypsin-EDTA was inactivated using complete media. Cells were then collected in the prepared tube, 3 mL of phosphate buffer solution was added, and centrifuged at 2,000 rpm for 3 minutes. After removing the supernatant, 200 ⁇ L of phosphate buffer solution was added to each FACS tube, and the cells were fully resuspended to perform flow cytometry. FL-1 wavelength was used to measure the level of FITC transmitted into the cells, and the transmission capacity was determined based on the scramble peptide value to correct the fluorescence value of the sample at the measured geo.mean value of Fl-1. As a result, as shown in Figure 3d, it was confirmed that TD1 exhibits excellent cell permeability in neurons (U-87 MG cell) compared to the peptide known from the cell-penetrating peptide, kFGF4.
  • HeLa cells Human cervix adenocarcinoma cells
  • MEM complete media 10% FBS, 1% penicillin / streptomycin
  • the cells were transferred from 12 well plates and incubated for 16 to 24 hours, and each sample was reacted with each time and concentration in a serum free medium without FBS. After completion of the reaction time, the sample was washed twice with DPBS to remove the residual sample, treated with 0.05% trypsin-EDTA, and reacted for 10 minutes while blocking the light. Trypsin-EDTA using complete media was inactivated.
  • phosphate buffer solution was added, and centrifuged at 2,000 rpm for 3 minutes. After removing the supernatant, 200 ⁇ L of phosphate buffer solution was added to each FACS tube, and the cells were fully resuspended to perform flow cytometry.
  • TD1, HIV-Tat and kFGF4-derived peptides were used as the experimental group, and the transmission capacity of each time and concentration was determined by the measured geo.mean value of Fl-1.
  • TD1 flows into the cells in a concentration-dependent manner within 12 hours in HeLa cells, HIV-Tat and kFGF4-derived peptides are mostly introduced into the cells at a concentration of 5 ⁇ M or more, It can be seen that it is quite weak compared to TD1. As described above, it was confirmed that TD1 showed very excellent cell permeability in HeLa cells.
  • DMEM complete media (10% FBS, 1% penicillin / streptomycin) to check the cell permeability in HaCaT cells, skin keratinocytes.
  • 12 mm cover glass was flame sterilized and then placed in each well of each 24 well plate, inoculated with HaCaT cells and incubated for 16 to 24 hours.
  • Samples (control: Vehicle, comparative: HIV-Tat, peptide derived from kFGF4, test substance: TD1) were treated at 3 ⁇ M and 5 ⁇ M concentrations in serum-free medium without FBS for 1 and 3 hours.
  • the medium was completely removed by suction, and then phosphate buffered solution was added thereto, shaken lightly and washed twice. Then, 200 ⁇ L of 10% formalin solution was added to each well, and the mixture was lightly stirred for 10 minutes. Cells were fixed. After cell fixation, fixative was removed and washed twice with phosphate buffer for 10 minutes. Thereafter, a counterstain was performed at room temperature for 10 minutes in a shaded state using Hoechst and DAPI staining solution. After the reaction, the dyeing solution was removed and washed twice with phosphate buffer. After that, the cover glass was recovered, and the cover glass was slowly lowered and mounted so that air bubbles did not enter the slide glass in which the mounting solution was deposited.
  • SiMa cells complete media were cultured at 80% confluency using RPMI1640 (10% FBS, 1% penicillin / streptomycin). After stabilization of the cells by repeated passage, flame sterilization of 12 mm cover glass for microscopic analysis, and then inoculated SiMa cells into each well of each 24 well plate and inoculated with SiMa cells for 16 to 24 hours. Each sample (HIV-Tat, kFGF4-derived peptide, TD1) was treated at 5 ⁇ M concentration for 6 hours in non-serum medium without FBS. After the reaction was completed, the medium was completely removed by inhalation, and then phosphate buffered solution was added and gently shaken twice.
  • RPMI1640 % FBS, 1% penicillin / streptomycin
  • the solution was washed twice with 200 ⁇ L of 10% formalin solution in each well and lightly stirred for 10 minutes. Cells were fixed. After cell fixation, fixative was removed and washed twice with phosphate buffer for 10 minutes. Thereafter, a counterstain was performed at room temperature for 10 minutes in a shaded state. After the reaction, the dyeing solution was removed and washed twice with phosphate buffer. After that, the cover glass was recovered, and the cover glass was slowly lowered and mounted so that air bubbles did not enter the slide glass in which the mounting solution was deposited. After drying sufficiently in a shaded state, cells were observed using a confocal microscope (Zeiss LSM700). As a result, as shown in Fig. 4b, compared with the kFGF4-derived peptide, excellent cell permeability of TD1 was also confirmed in neurons.
  • U-87 MG cells were cultured using DMEM complete media (10% FBS, 1% penicillin / streptomycin) to confirm cell permeability in U-87 MG cells.
  • DMEM complete media 10% FBS, 1% penicillin / streptomycin
  • 12 mm cover glass was flame sterilized, and then one was put into each well of each 24 well plate, and the cells were inoculated and incubated for 16 to 24 hours.
  • Each sample (kFGF4-derived peptide, TD1) was treated at 5 ⁇ M concentration for 6 hours in serum-free medium without FBS. After the reaction was completed, the treated samples were removed and washed twice with PBS. Then, 200 ⁇ L of 10% formalin solution was added to each well, and the cells were fixed for 10 minutes.
  • the fixation solution was removed and washed twice with PBS for 10 minutes, and then stained with the Hoechst and DAPI staining solutions for 10 minutes at room temperature in a shaded state. After staining, the solution was removed, washed twice with PBS, and the cover glass was recovered to mount the bubbles in the slide glass in which the mounting solution was deposited. After drying in a shaded state, the cells were observed using a confocal microscope (Zeiss LSM700). As a result, as shown in Fig. 4C, neurons In U-87 MG cells, TD1 was visually confirmed to show excellent cell permeability compared to the kFGF4-derived peptide.
  • HeLa cells Human cervix adenocarcinoma cells
  • MEM complete media 10% FBS, 1% penicillin / streptomycin.
  • 12 mm cover glass was flame sterilized, and then one in each well of each 24 well plate was inoculated with the cells and incubated for 16 to 24 hours.
  • Each sample (HIV-Tat, kFGF4-derived peptide, TD1) was reacted for 6 hours and 24 hours at 5 ⁇ M concentration in a serum free medium without FBS. After the reaction was completed, the treated samples were removed and washed twice with PBS.
  • botulinum toxin type A light chain protein (Lc) and recombinant protein combining MTD (TD1) and botulinum toxin light chain protein (Lc) was prepared.
  • the codon-optimized botulinum neurotoxin type A light chain sequence synthesized by Bioneer was polymerized with primer pairs specifically designed for each. Enzyme chain reaction (PCR) was performed. At this time, the sequence information of each primer is shown in Table 1 below.
  • the PCR reaction was carried out with 50 ng of codon optimized Lc template, a final concentration of 0.4 mM each dNTP mixture, 1 ⁇ M of each primer, 5 ⁇ l of 10 ⁇ EX taq buffer, and 0.25 ⁇ l of EX taq polymerase (Takara). It carried out as a reaction liquid. PCR reaction conditions were first denatured at 95 ° C. for 5 minutes, and then repeated 30 times at 95 ° C., 1 minute at 58 ° C. and 1 minute at 72 ° C. for 30 minutes, and finally amplified at 72 ° C. for 8 minutes. It was. After the reaction, electrophoresis was performed on 1% agarose gel to confirm the amplified product.
  • the amplified recombinant fragment was recovered from the agarose gel, and then used as a commercial gel extraction kit (Intron, Korea) extracted and purified. Each purified PCR product was treated with NdeI and XhoI enzymes at 37 ° C. for 2 hours, followed by electrophoresis on an agarose gel to digest each recombinant fragment with a gel extraction kit (Intron, Korea). Was purified. Meanwhile, the recombinant vector pET-21b (+) vector (Novagen, USA) having histidine-tag and T7 promoter was cut under the same conditions using restriction enzymes NdeI and XhoI to purify each recombinant.
  • the fragment and the cleaved pET-21b (+) vector were mixed, followed by ligation at 16 ° C. for 16 hours after the addition of T4 DNA ligase (Intron, Korea). This was transformed into E. coli DH5 ⁇ -sensitized cells to finally obtain a recombinant protein expression vector.
  • the expression vector was treated with the same NdeI and XhoI restriction enzymes and 1% agarose gel electrophoresis. +) It was confirmed that it was correctly inserted into the vector.
  • the resulting recombinant protein expression vectors were named pET21b (+)-Lc and pET21b (+)-TD1-Lc, respectively.
  • IPTG which is an inducer of protein expression
  • Example 5-1 The soluble fraction obtained in Example 5-1 was purified using Fast Protein Liquid Chromatography (FPLC, Bio-rad). The soluble fraction was bound to an affinity chromatography column while flowing in FPLC, and washed by flowing a washing buffer. Thereafter, the imidazole concentration was gradually increased to obtain a purified sample, and dialyzed while stirring at 4 ° C. for 16-20 hours using a dialysis membrane in phosphate buffer or PBS.
  • FPLC Fast Protein Liquid Chromatography
  • FITC-labeled protein was prepared. In the shaded state, 50 mM Boric acid, 0.1 ng / mL FITC and 0.5 ⁇ g / mL of protein were mixed to make 10 mL of protein suspension and reacted at 4 ° C. for 8 hours. After the reaction was completed, the protein suspension was placed in a dialysis tube, and the dialysis proceeded by replacing with DPBS at intervals of 4 hours-4 hours-16 hours for 3 days at 4 ° C in a shaded state.
  • the FITC labeled protein was filtered using a 0.2 ⁇ m syringe filter, and the obtained protein was quantified by Bradford assay and selectively concentrated according to the required concentration.
  • the fluorescence intensity (RFU) was measured by diluting to the lowest concentration of the measured protein.
  • the fluorescence intensity of the FITC fusion protein used for verification was compared based on the measured RFU.
  • SiMa cell The cell permeability of the cell permeable botulinum toxin recombinant protein (TD1-Lc) on the neuronal cell line, SiMa cell, was evaluated.
  • SiMa cell has a weak cell adhesion to the culture plate, and uses a culture plate coated with gelatin (sigma, G2500), coated with 0.1% gelatin solution on the culture plate, removes the solution after 1 hour at room temperature, and dried. Used as. Complete media were passaged at 80% or more confluency using RPMI1640 (10% FBS, 1% penicillin / streptomycin). Cells were stabilized by repeated passage and inoculated with 5 ⁇ 10 5 / well per 100 mm dish, incubated for 16-20 hours in an incubator at 37 ° C, 5% CO 2 , and used for experiments. .
  • Each sample (vehicle, FITC only, Lc-FITC, TD1-Lc-FITC) was treated at concentrations of 1.5 ⁇ g / ml and 7.5 ⁇ g / ml for 6 hours in non-serum medium without FBS. After the reaction time was completed, the sample was washed twice with DPBS to remove the residual sample, treated with 0.05% trypsin-EDTA, and reacted for 10 minutes while blocking the light, followed by inactivation of trypsin-EDTA using complete media. Cells were then collected in the prepared tube, 3 mL of phosphate buffer solution was added, and centrifuged at 2,000 rpm for 3 minutes.
  • TD1-Lc cell-permeable botulinum toxin recombinant protein
  • SiMa cells complete media was used at 80% or more confluency using RPMI1640 (10% FBS, 1% penicillin / streptomycin). Cells were cultured. After stabilizing the cells by repeated passage, flame sterilized the 12 mm cover glass for microscopic analysis, and then put one cover glass into each well of each 24 well plate and inoculating SiMa cells and incubating for 16 to 24 hours. Each sample (vehicle, Lc, TD1-Lc) was treated at a concentration of 5 ⁇ g / ml for 3 hours in serum-free medium without FBS.
  • the medium was completely removed through an inhaler, washed twice with phosphate buffer solution, 200 ⁇ L of 10% formalin solution was added to each well, and the cells were fixed for 10 minutes.
  • the fixative was removed and washed twice with phosphate buffer for 10 minutes.
  • the dye solution was removed and washed twice with phosphate buffer.
  • the cover glass was recovered for cell observation, and the cover glass was slowly lowered and mounted so that no bubbles entered the slide glass in which the mounting solution was deposited. After drying in a shaded state, the cells were observed using a confocal microscope (Zeiss LSM700).
  • DMEM complete media (10% FBS, 1% penicillin / streptomycin) to confirm the cell permeability of the cell permeable botulinum toxin recombinant protein (TD1-Lc) against HaCaT cells, skin keratinocytes.
  • TD1-Lc botulinum toxin recombinant protein
  • 12 mm cover glass was flame sterilized and then placed in each well of each 24 well plate, inoculated with HaCaT cells and incubated for 16 to 24 hours.
  • Each sample (Vehicle, Lc, TD1-Lc) was treated at 5 ⁇ M concentration for 1 hour, 3 hours and 6 hours in serum-free medium without FBS.
  • the medium of each well was removed and washed twice with phosphate buffer solution, and then 200 ⁇ L of 10% formalin solution was added to each well, and the cells were fixed for 10 minutes.
  • the fixer was removed, washed twice with phosphate buffer for 10 minutes, and counterstained at room temperature for 10 minutes using a Hoechst and DAPI staining solution in a shaded state.
  • the staining solution was removed, washed twice with phosphate buffer, and the cover glass was recovered for cell observation.
  • the mounting solution was slowly lowered to prevent air bubbles from entering the slide glass. After drying in a shaded state, the cells were observed using a confocal microscope (Zeiss LSM700).
  • the TD1-Lc recombinant protein to which the cell-penetrating peptide was bound showed a remarkably excellent cell permeability even in keratinocytes as compared with the Lc protein.
  • the automatic skin permeator (MicroettePlus) on the skin-simulated artificial membrane (Start-M) was confirmed.
  • Skin simulation artificial membrane is composed of PES (polyether sulfone) which inhibits absorption and polyolefin of lower layer which can differentiate absorption by creating porous structure. It is easy to store and can be directly applied to the system without pretreatment. There is this. In addition, the amount of penetration that is difficult to measure in actual skin can be quantified under conditions similar to that of skin, and thus it is widely used.
  • SNAP25 protein is a kind of SNARE protein that is cut by the light chain of botulinum toxin type A.
  • the SNAP25 cleavage assay is used in vitro to examine the activity of botulinum toxin.
  • BoNT / A Light chain (Lc) cleavage assay was performed.
  • cleavage assay buffer (10 mM DTT, 10 mM HEPES, 10 mM NaCl & 20 uM ZnCl 2 ) was added to 2 ⁇ g of GST-SNAP25-EGFP fusion protein, and the concentration of recombinant protein TD1-Lc was 10, 30, 90, 270, respectively. After addition at a concentration of 810 ng, the reaction was carried out at 37 °C for 4 hours. As a positive control, 270 ng of botulinum toxin mixture (BoNT / A complex) was added, and the total volume was adjusted to 20 ⁇ l with tertiary distilled water and reacted under the same conditions.
  • BoNT / A complex botulinum toxin mixture
  • a SNAP25 cleavage assay was performed by western blot method to confirm the efficacy through cleavage of SNAP25 protein.
  • HaCaT cells were incubated for 24 hours at a cell number of 1 ⁇ 10 4 / well in a 24 well plate, transfected with pcDNA3.1-SNAP25 plasmid, and cotransfection with pcDNA3.1-Lc plasmid as a positive control. After overexpressing SNAP25 through 16 hours of incubation, the medium was replaced with FBS-free medium.
  • SiMa cells which are human neuroblastoma cells
  • a SNAP25 cleavage assay was performed by western blot method to confirm the efficacy through cleavage of SNAP25 protein.
  • differentiation medium (10% FBS, RPMI, Glutamax, 1X NEAA, 1X B27, 1X N2, 5uM RA, 2.5uM PUR) was prepared by inducing differentiation.
  • Neurons (SiMa cells) were incubated in a cell number of 5 ⁇ 10 5 / well in a 24well plate and then differentiated according to neuronal differentiation method. The cells were exchanged for the last differentiation medium and treated with recombinant protein TD1-Lc after 4 hours. After 48 hours of protein treatment, the medium was removed, washed with PBS, and 200 ⁇ l of RIPA buffer (intron) was added to each well to lyse the cells, and centrifuged at 4 ° C.
  • RIPA buffer intron
  • the second antibody (Millipore, AP192P) was diluted 1: 5500 in 5% BSA and reacted at room temperature for 1 hour. .
  • membranes were washed three times or more at 10-minute intervals with PBST, treated with ECL solution for further reactions, transferred to cassettes, and confirmed by photosensitive X-ray film in the dark.
  • Figure 10b it was confirmed that only the TD1-Lc protein can effectively penetrate the neurons. This confirmed that TD1-Lc protein can effectively penetrate not only skin cells but also nerve cells.
  • MTT assay was performed to measure cell viability.
  • keratinocytes HaCaT cells
  • HaCaT cells keratinocytes
  • MTT assay was performed to measure cell viability.
  • Human neurons (SiMa cells) were cultured in a 24 well plate at a cell number of 5 ⁇ 10 5 / well, and differentiation was induced according to neuronal differentiation methods.
  • the recombinant protein TD1-Lc was treated. The protein was treated from 0.625 ⁇ g / ml to a concentration of 40 ⁇ g / ml, and reacted for 48 hours. After 5 mg / ml of MTT (sigma) was added, 10 ⁇ l of each was further reacted for 4 hours.
  • each of the recombinant proteins TD1-Lc was dissolved and subjected to electrophoresis on a 12% SDS-PAGE gel according to the course of each period. Check for changes. As a result, as shown in Figure 12, even after six months it was confirmed that the recombinant protein is maintained stable without a change in the pattern of the protein.
  • Example 12 Cell Permeability Peptide Botulinum Toxin Recombinant Protein TD1-bound with TD1 Lc Preparation of cosmetic composition and evaluation of skin irritation safety
  • liposomes were entrusted to H & A pharmachem and processed and then processed into cosmetic raw materials to produce cosmetic compositions.
  • the test was submitted to ICI Korea Co., Ltd. (Korea), a specialized clinical trial agency (CRO).
  • Kirea a specialized clinical trial agency
  • 31 healthy men and women were placed in the IQ chamber and placed on the back skin.
  • the dermatologist judged the safety of human skin and evaluated and analyzed the degree of stimulation.
  • the patch method was performed by a single and closed patch test, and the stimulus degree was evaluated and analyzed by Flosch & Kligman's designed measurement method by applying the CTFA guideline commonly used for skin irritation evaluation.
  • the volunteers selected 32 healthy adult men and women who met the criteria of selection and exclusion of subjects through medical history examination, questionnaire and screening, and promotion if necessary.
  • the investigator and the investigator shall do their best to the safety of the subject, and in the event of any skin abnormality, take prompt and appropriate measures to minimize the reaction.
  • the investigator and the investigator take appropriate measures together with the dermatological evaluation and record the case and the situation in detail.
  • the measurement of the result was made by the subject visiting the laboratory and waiting at least 15 minutes in a constant temperature and humidity room (22 ⁇ 2 ° C and 50 ⁇ 5%) to stabilize the skin.
  • the skin roughness parameter was analyzed using a PRIMOS system after scanning the nasolabial folds before and after 4 weeks of use of the sample.
  • Parameters expressing skin roughness are as follows.
  • Ra arithmetic average
  • Skin elasticity was measured by using a custometer to measure the elasticity (elastic resilience) of the pores. The procedure of inhalation for 2 seconds and reduction for 2 seconds at 400 mb was repeated three times. The pretension time was set to 0.1 seconds to increase the reproducibility of the measurement results.
  • the meaning of each parameter value obtained as a measured value when the skin is inhaled and relaxed is as follows.
  • nasolabial fold roughness was verified before and after the use of the sample. The results were interpreted before and after using the sample, roughness of the nasolabial folds, skin elasticity parameters, and dermatologist's nasal wrinkle evaluation When there was a significant change in, it was interpreted that the nasolabial folds or elasticity were improved.
  • SPSS 14.0 was used, and the normality of the data of the instrument measurement was verified by Shapiro-Wilk test. All 22 subjects were selected as suitable subjects, and all subjects completed the test normally until the last visit, and the last 22 subjects (average 46.1 years old) obtained valid data.
  • the cell-penetrating peptide-botulinum toxin recombinant protein of the present invention can be delivered through the transdermal and retains the inherent efficacy of botulinum toxin, and at the same time, ease of use, and can be a safer and preferred therapeutic alternative. It can be effectively used as a topical agent for the treatment of a variety of diseases, aesthetic and / or cosmetic purposes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pain & Pain Management (AREA)
  • Toxicology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Birds (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)

Abstract

본 발명은 신규한 세포투과성 펩타이드 및 상기 세포투과성 펩타이드와 보툴리눔 독소 경쇄가 융합된 세포투과성 보툴리눔 독소 재조합 단백질 조성물 및 이들의 용도에 관한 것이다. 보다 상세하게는 세포투과성 보툴리눔 독소 재조합 단백질의 경피를 통한 전달을 가능하게 하고, 피부학적 다양한 치료 및 미용학적 목적을 위해 국소적으로 이용될 수 있는 조성물에 관한 것이다. 본 발명의 세포투과성 펩타이드-보툴리눔 독소 재조합 단백질은 경피를 통한 전달이 가능함으로써 보툴리눔 독소 고유의 효능을 보유함과 동시에 이용 편의성이 확대되어, 이를 이용한 다양한 질환 치료, 심미 및/또는 미용 목적을 위해 국소작용제로 효과적으로 활용될 수 있다.

Description

신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
본 발명은 신규한 세포투과성 펩타이드 및 상기 세포투과성 펩타이드와 보툴리눔 독소 경쇄의 일측 말단이 융합된 세포투과성 보툴리눔 독소 재조합 단백질 및 이들의 용도에 관한 것이다.
보툴리눔 독소는 썩은 통조림이나 상한 고기에서 자라는 그람 양성 혐기성 박테리아인 클로스트리디움 보툴리눔(Clostridium botulinum)이 만들어내는 신경독소이다. 이는 8가지 신경독소로 분류되며, 이중 7종(A, B, C, D, E, F, G)은 신경의 마비를 유발할 수 있다. 크기는 약 150 kDa으로, 보툴리눔 독소 단백질 이외에 비독소 단백질(non-toxin)의 복합체로 구성되어 각 복합체의 크기는 신경독소의 종류에 따라 최대 900 kDa까지 생성된다. 보툴리눔 독소형에 따라 작용 형태와 대상, 활성기간 등이 달라지는데 그 중 보툴리눔 독소 A형의 경우 치명적인 생물학적 작용제 중 하나로 알려져 있다.
보툴리눔 독소는 근육의 경련 또는 수축을 유발하는 신호를 차단하여 마비를 초래하는 작용을 하는데, 이러한 기능으로 1989년 미국 FDA 승인 이후, 치료 또는 미용 목적으로 사용되고 있다. 치료 목적으로는 사시(strabismus), 사경(torticollis) 또는 안면 경련(blepharospasm)과 같은 신경근육질환에, 미용 목적으로는 주름, 찌푸린 주름 제거 및 사각턱 치료, 다한증(hyperhidrosis) 또는 편두통(migraine) 치료에 주사제로 사용되고 있다. 부작용으로는 연하곤란(dysphagia), 목소리 변화(voice change), 구강건조 (dry mouth) 및 몽롱(blurred vision) 등과 같은 사례들이 보고되었으나, 아직 보툴리눔 독소로 인한 직접적인 사망사고가 없어 적절하게 사용하면 매우 안전한 약품으로 평가받고 있다. 다만, 약물에 대한 과민증이 있거나, 근골격계통 질환이 있는 경우, 임산부나 수유부의 경우에는 적용에 제한이 있다.
현재의 보툴리눔 독소의 활용에 있어서, 피부 조직에 주사된 보툴리눔 독소의 지속 시간은 3~6개월 이내이며, 보툴리눔 독소에 의해 신경과 근육 사이의 신호전달이 차단되면 새로운 신경가지가 만들어져 보툴리눔 독소에 의한 신경의 마비 효과를 경감시키므로, 정기적인 처치가 필요하다. 또한, 보툴리눔 독소를 반복해서 투여할 경우 생체 내 보툴리눔 독소에 대한 항체가 형성되어 효과가 감소하는 한계가 있다.
또한, 이러한 보툴리눔 독소의 근육 마비 효과는 대부분 주사제를 통해서만 활용되고 있기에, 이용 대상자에 대한 편의성을 제공할 수 있는 다른 효과적인 전달 수단을 찾기 위해 많은 연구가 이루어지고 있으나, 아직 미비한 실정이다.
한편, 외부의 환경과 항상 접하고 있는 신체 조직인 피부는 체액 누출 및 감염 방지, 수분 소실을 막는 보호장벽으로서의 주요 기능을 담당하며, 구성은 표피, 진피 및 피하조직으로 구성되어 있다. 표피의 각질층은 피부 최외각에 존재하면서, 피부 밖으로의 수분과 전해질의 소실을 억제함으로써 피부의 건조를 막고, 피부의 정상적인 생화화적 대사를 할 수 있는 환경을 제공한다. 또한 피부 각질층은 외부의 물리적 손상과 화학물질로부터 인체를 보호하고, 세균, 곰팡이, 바이러스 등이 피부로 침범하는 것을 방지하는 중요한 역할을 한다.
피부를 통한 흡수 경로는 각질층을 통한 흡수, 모낭과 피지선을 통한 흡수, 땀샘을 통한 흡수 등 3가지 경로가 있는데, 피부를 통한 활성물질의 전달은 피부의 구조적, 물리적 특성상 여러 가지 제한이 있다. 특히, 피부 각질층은 피부의 주요 구성 세포인 각질형성세포(keratinocyte)가 자연사되어 피부 최외각층에 치밀한 구조를 이루고 있으며, 땀과 각종 지질 성분으로 인하여 pH 5 부근의 산성도를 보인다. 이러한 각질층 장벽을 투과하기 위해서는 통상적으로 분자량이 1,000 이하로 작아야 하고, 친지질 특성을 보유하고 있어야 가능하다는 보고가 있다.
미용 및 의약용 원료로 빈번하게 사용되는 저분자 합성 화합물이나 또는 천연화합물들은 쉽게 세포 내로 전달될 수 있다고 알려져 있으나 단백질, 펩타이드 및 핵산과 같은 거대분자들은 분자량의 크기와 친수성 성질 때문에 이중 지질막 구조로 되어 있는 세포막 안으로 투과하기 어려우므로, 실제로 피부 장벽을 구성하는 각질층의 고유 특성으로 인해 저분자량 물질들의 투과 효율이 극히 낮으며, 고분자량 물질들의 투과 효율은 더욱 낮은 것으로 알려져 있다.
따라서, 보툴리눔 독소를 경피로 전달하기 위해서는, 이러한 피부 장벽을 투과하여, 보툴리눔 독소를 전달할 수 있는 전송체가 필수적으로 요구된다. 이러한 저분자 및 거대분자들이 세포의 원형질막을 통과하는 효율을 증폭시키기 위한 방법으로서 단백질 전달체를 적용할 수 있다. 널리 알려진 단백질 전달체(Protein transduction domain, PTD)로는 먼저, HIV-Tat, antennapedia등의 PTD를 예로 들 수 있는데, 양전하를 띄는 짧은 길이의 펩타이드로서 단백질뿐 아니라 DNA, RNA, 지방, 탄수화물, 화합물 또는 바이러스를 세포 내로 전달할 수 있는 것으로 알려져 있으며, 수용체 비의존적이고, 엔도사이토시스(endocytosis)나 파고사이토시스(phagocytosis)의 메커니즘으로 세포막을 투과한다고 보고되고 있다. 이러한 PTD의 오랜 역사만큼이나 이를 이용한 다양한 응용이 시도되었으나, 현재까지 성공적인 개발사례는 없는 것으로 파악된다. HIV-Tat 유래 PTD의 경우는 펩타이드가 바이러스에서 유래하므로, 안전성 측면에서 문제가 제기되며, 특히, 이러한 PTD 계열의 전송도메인들은 단독으로 사용 시, 종류에 따라 2~5 μM 이하의 저농도에서 세포 내 전송률이 급격히 저하하는 문제점이 있는 것으로 알려져 있다. 또한 분자량이 30,000 Da 이상인 단백질과 PTD를 결합하여 세포 내로 전송하고자 할 경우, PTD-단백질 융합체는 대부분 음세포작용(Endocytosis)으로 엔도좀(Endosome) 형태로 세포 내에 전송되는 경향을 보이며, 엔도좀은 세포질 내의 라이소솜과 결합하여 라이소솜 내에 존재하는 가수분해 효소에 의해 대부분의 PTD-단백질 융합체가 분해되고, 일부 손상되지 않은 PTD-단백질 융합체 만이 세포질 내로 유리된다고 보고되기도 하였다. 따라서, PTD를 활용한 기능성 단백질의 피부전송을 위해서는 기대하는 효능 발현을 위하여 다량의 PTD 융합단백질이 필요하게 되고 이는 경제성 측면에서 바람직하지 않은 결과를 초래하게 될 것이다.
이러한 PTD가 가진 문제점을 해결함과 동시에 약물적인 가치를 높이기 위하여, 기존의 PTD와는 다른 특성을 가진 소수성 또는 양친매성 펩타이드인 거대분자 전송 도메인 MTD(Macromolecule Transduction Domain) (대한민국 특허등록 제10-1258279호)가 개발되었다. MTD는 PTD에 비해 세포 내 물질전달 효율이 향상되고, 구조 및 정전기적 특성이 다른 새로운 세포투과성 펩타이드(cell penetrating peptide)이다. MTD의 세포 내 전송과정은 PTD와 달리, 내포작용(endocytosis) 및 에너지는 필요로 하지 않고, 세포막의 강직성(rigidity)과 완전성(integrity)이 중요 요소로 작용하기 때문에 세포막과의 직접적인 상호작용(direct interaction)이 중요하다고 제안되었다. 이러한 펩타이드의 세포막 투과 현상은 빠른 생체 내 반감기 또는 세포막 투과가 어려워 약물로 사용하기 어려웠던 치료용 단백질, DNA 또는 siRNA와 같은 핵산물질을 세포 내로 전송하여 신규 치료약물로의 개발 가치를 높일 수 있다. 또한, MTD는 기존의 세포투과성 펩타이드인 HIV-Tat 유래 펩타이드에 비하여 화합물, 펩타이드 및 단백질 등 일명 화물(cargo material)의 전달 효율이 높기 때문에 보툴리눔 독소의 외용제 개발 시 그 활용성이 높을 것으로 판단된다.
또한, 본 발명에서 추구하고자 하는 피부투과 및 신경말단 세포투과 보툴리눔 독소의 경쇄 또는 경쇄 유도체는 약독화(toxicity attenuation) 과정을 거치더라도 안전성을 확보하기 위하여 1~10ppm 농도로 그 사용량이 제한되어야 함에 따라, PTD를 피부투과 및 신경세포 투과수단으로의 활용은 적합하지 않은 것으로 판단되며, 이를 극복하기 위한 방안으로 피부장벽 투과와 신경세포에 투과성을 동시에 가지며 낮은 농도에서도 농도 의존적으로 피부장벽을 투과하는 MTD를 활용하거나 또는 신규로 이 같은 특성을 갖는 MTD의 개발이 요구되었다.
본 발명은 상기와 같이 분자량의 크기와 피부 각질층의 고유 특성으로 인해 피부를 통해 전달되기 어려운 보툴리눔 독소 단백질을 효율적으로 투과시키고, 이어 피부조직에 존재하고 있는 신경세포까지 전달하기 위해 고안된 것으로서, 보툴리눔 독소의 중쇄(heavy chain)의 translocation domain에서 유래된, 생물학적 활성 분자의 세포 내 운반을 매개할 수 있는 신규의 세포투과성 펩타이드를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 세포투과성 펩타이드가 보툴리눔 독소 경쇄의 일측 또는 양측 말단에 융합된 세포투과성 보툴리눔 독소 재조합 단백질을 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 상기 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는 조성물을 제공하며, 보다 상세하게는 세포투과성 보툴리눔 독소 재조합 단백질의 경피를 통한 전달을 가능하게 하고, 피부학적 다양한 치료 및 미용학적 목적을 위해 국소적으로 이용될 수 있는 조성물을 제공하는 것을 또 다른 목적으로 한다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은 생물학적 활성 분자의 세포 내로의 운반을 매개할 수 있는 펩타이드로서, 상기 펩타이드가 서열번호 1의 아미노산 서열로 이루어진 세포투과성 펩타이드를 제공한다.
본 발명은, 상기 펩타이드를 인코딩하는 폴리뉴클레오티드를 제공한다.
본 발명의 일 구현예로, 상기 폴리뉴클레오티드가 서열번호 2의 염기서열로 이루어질 수 있다.
본 발명은, 보툴리눔 독소 경쇄의 일측 또는 양말단에 서열번호 1의 아미노산 서열로 이루어진 세포투과성 펩타이드가 융합된, 세포 투과성 보툴리눔 독소 재조합 단백질을 제공한다.
본 발명의 일 구현예로, 상기 보툴리눔 독소 재조합 단백질은 서열번호 31 내지 서열번호 58로 이루어진 군으로부터 선택되는 아미노산 서열로 이루어질 수 있다.
본 발명의 다른 구현예로, 상기 보툴리눔 독소 경쇄는 서열번호 3 내지 서열번호 9로 이루어진 군으로부터 선택되는 아미노산 서열로 이루어질 수 있다.
본 발명의 또 다른 구현예로, 상기 보툴리눔 독소 경쇄는 일측 말단에 헥사히스티딘(hexahistidine) 태그(tag)를 더 포함할 수 있다.
본 발명의 또 다른 구현예로, 상기 보툴리눔 독소 경쇄는 보툴리눔 독소 혈청형(serotype) A, B, C, D, E, F 및 G로 이루어진 군으로부터 선택될 수 있다.
본 발명의 또 다른 구현예로, 상기 융합은 상기 보툴리눔 독소 경쇄의 카복시 말단, 아미노 말단 또는 이들 모두에 상기 세포투과성 펩타이드가 융합될 수 있다.
본 발명의 또 다른 구현예로, 상기 융합은 펩타이드 결합 또는 공유결합에 의해 이루어질 수 있다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 인코딩하는 폴리뉴클레오티드를 제공한다.
본 발명의 일 구현예로, 상기 폴리뉴클레오티드가 서열번호 59 내지 서열번호 86으로 구성된 군으로부터 선택되는 염기서열로 이루어질 수 있다.
본 발명은, 상기 폴리뉴클레오티드를 포함하는 재조합 발현벡터를 제공한다.
본 발명의 일 구현예로, 상기 재조합 발현벡터는 His, HAT, FLAG, c-myc, SBP, Chitin-binding domain, Glutathione-S transferase 및 Maltose-binding protein으로 구성된 군으로부터 선택되는 친화성 표지(affinity tag)를 포함할 수 있다.
본 발명은, 상기 재조합 발현벡터로 형질전환된 세균을 제공한다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질 및 약학적으로 허용가능한 담체를 포함하는, 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환 치료용 약제학적 조성물을 제공한다.
본 발명의 일 구현예로, 상기 약제학적 조성물은 경피 투여용일 수 있다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는 피부 외용제 조성물을 제공한다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는 화장료 조성물을 제공한다.
본 발명의 일 구현예로, 상기 조성물은 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드를 개선시키는데 적용될 수 있다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 개체에 경피 투여하는 단계를 포함하는 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환 치료방법을 제공한다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 개체에 경피 투여하는 단계를 포함하는 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드 개선방법을 제공한다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질의 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환을 치료하는 용도를 제공한다.
본 발명은, 상기 세포투과성 보툴리눔 독소 재조합 단백질의 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드 증상을 개선하는데 이용되는 용도를 제공한다.
본 발명은, 상기 형질전환 세균을 배양하는 단계를 포함하는 세포투과성 보툴리눔 독소 재조합 단백질 생산방법을 제공한다.
보툴리눔 독소는 근육 경련 또는 수축을 유발하는 신호들을 차단하여 마비를 초래하는 작용을 한다. 이러한 보툴리눔 독소의 근육 마비 효과는 오늘날 안면 경련, 근긴장, 편두통, 악관절 장애, 다한증 등의 치료와 주름개선, 모공 축소, 여드름, 탄력 부여, 사각턱 완화 등의 심미적, 미용학적 분야에서 활용되고 있다. 그러나, 현재까지는 경피전달을 위한 효과적인 수단이 없어, 상기의 원하는 효과를 얻기 위해서는 주사를 통한 시술 방법에만 의존해온 것이 대부분이다. 따라서, 주사를 요구하지 않는 보툴리눔 독소의 국소 적용이 가능하다면 보다 안전하고 바람직한 치료적 대안이 될 수 있을 것이다. 이에, 본 발명의 세포 투과성 펩타이드-보툴리눔 독소 재조합 단백질에 따르면, 피부 복합층과 신경세포를 통과하여 신경세포의 스네어 단백질(SNARE protein)을 절단하여 활성을 나타낼 수 있으며, 일반 보툴리눔 독소에 비해 분자량이 현저히 작아 항체 생성의 가능성을 현저히 감소시킬 수 있어, 중화항체 형성에 따른 효능저하를 감소시킬 수 있다.
또한, 본 발명의 세포투과성 펩타이드-보툴리눔 독소 재조합 단백질은 경피를 통한 전달이 가능함으로써 보툴리눔 독소 고유의 효능을 보유함과 동시에 이용 편의성이 확대되어, 이를 이용한 다양한 질환 치료, 심미 및/또는 미용 목적을 위해 국소작용제로 효과적으로 활용될 수 있다.
또한, 보툴리눔 독소 A형은 수 피코그람(pg)의 양만으로도 심각한 독성을 발현하지만, 본 발명에 따른 세포투과성 보툴리눔 독소는 마이크로그람(㎍) 수준에서 독성이 발현되도록 약독화되었는바, 보툴리눔 독소의 독성으로부터 안전성이 충분히 확보될 수 있다.
도 1은 세포투과성 펩타이드 TD1의 특성을 표로 나타낸 것이다.
도 2는 세포투과성 펩타이드 TD1의 구조를 분석하여 그림으로 나타낸 것이다.
도 3a 및 도 3b는 각질 형성 세포(HaCaT cell)에 대한 세포투과성 펩타이드 TD1의 in vitro 투과능을 유세포 측정(Flow Cytometry)을 이용하여 확인한 것이다.
도 3c는 신경 세포(SiMa cell)에 대한 세포투과성 펩타이드 TD1의 in vitro 투과능을 유세포 측정(Flow Cytometry)을 이용하여 확인한 것이다.
도 3d는 신경 세포(U-87MG cell)에 대한 세포투과성 펩타이드 TD1의 in vitro 투과능을 유세포 측정(Flow Cytometry)을 이용하여 확인한 것이다.
도 3e는 HeLa cell에 대한 세포투과성 펩타이드 TD1의 in vitro 투과능을 유세포 측정(Flow Cytometry)을 이용하여 확인한 것이다.
도 4a는 각질 형성 세포(HaCaT cell)에서 세포투과성 펩타이드 TD1의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 4b는 신경 세포(SiMa cell)에서 세포투과성 펩타이드 TD1의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 4c는 신경 세포(U-87MG cell)에서 세포투과성 펩타이드 TD1의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 4d는 HeLa cell에서 세포투과성 펩타이드 TD1의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 5는 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc의 정제과정을 모식도로 나타낸 것이다.
도 6은 정제된 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 순도 및 분자량을 SDS-PAGE를 통해 확인한 것이다.
도 7a는 신경 세포(SiMa cell)에 대한 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro 투과능을 유세포 측정(Flow Cytometry)을 이용하여 확인한 것이다.
도 7b는 신경 세포(SiMa cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 7c는 각질 형성 세포(HaCaT cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro 투과능을 공초점 현미경(Confocal microscopy)을 이용하여 확인한 것이다.
도 8은 인공 피부 모사막에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 투과능을 확인한 것이다.
도 9는 정제된 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro SNAP25 cleavage 활성을 SDS-PAGE로 확인한 것이다.
도 10a는 각질 형성 세포(HaCaT cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro SNAP25 cleavage 활성을 확인한 것이다.
도 10b는 신경 세포(SiMa cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro SNAP25 cleavage 활성을 확인한 것이다.
도 11a는 각질 형성 세포(HaCaT cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 세포독성을 평가한 것이다.
도 11b는 신경 세포(SiMa cell)에서 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 세포독성을 평가한 것이다.
도 12는 보관기간에 따른 정제된 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 안정성을 SDS-PAGE로 확인한 것이다.
도 13은 화장용 제제로 조성한 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 안전성 및 피부자극시험을 임상시험기관을 통해 평가한 결과이다.
도 14a, 도 14b 및 도 14c는 화장용 제제로 조성한 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 임상효능을 임상시험기관을 통해 평가한 결과이다.
도 15는 화장용 제제로 조성한 세포투과성 보툴리눔 독소 재조합 단백질 TD1-Lc의 팔자주름에 대한 임상효능을 임상시험기관을 통해 평가한 결과이다.
본 발명은 신규의 세포투과성 펩타이드와 이를 이용한 보툴리눔 독소 경쇄(light chain)의 경피전달 조성물 및 방법을 제공한다. 본 발명에 따르면, 개발된 신규의 세포투과성 펩타이드 TD1은 보툴리눔 독소 경쇄가 적절한 제제의 국소 적용에 의해, 경피적으로 투여될 수 있게 하는 전송시스템으로 적합한 것으로 확인되었다.
보툴리눔 독소는 하나의 폴리펩타이드로 발현이 되지만 발현 후 재구성 과정에 의해 약 100 kDa의 중쇄(Heavy chain, H 사슬)와 약 50 kDa의 경쇄(Light chain, L 사슬)로 나뉘어 지게 되며 H 사슬과 L 사슬은 디설파이드 결합으로 연결되어 있다. H 사슬은 신경세포의 수용체와 결합하여 엔도시토시스를 통해 보툴리눔 독소가 내부로 들어갈 수 있도록 한다. 보툴리눔 독소의 L 사슬은 세포 안으로 들어간 후 엔도좀을 빠져나와 세포질로 들어가고, 세포질 내의 스네어 단백질(SNARE protein)을 절단하여 아세틸콜린 분비를 억제시켜 근육 마비 효과를 나타낸다. 따라서, 신경세포의 아세틸콜린 분비 억제는 L 사슬 단독으로도 가능하며 H 사슬과 L 사슬은 각각 독립적으로 기능할 수 있다. 이에 착안하여, 근육 마비 효과를 가지는 L 사슬만을 적용하여 경피전달이 가능한 형태로 개발하고자 하였다.
그러나, 분리된 분자량 50 kDa의 보툴리눔 독소 경쇄는 세포막을 투과할 수 없어 그 자체로는 기능을 할 수 없다. 일반적으로 보툴리눔 독소 경쇄가 신경세포 내 세포질로 전달되어 보툴리눔 독소 특유의 활성을 나타내기 위해서는 약 100 kDa의 보툴리눔 독소 중쇄의 도움이 반드시 필요하다. 보툴리눔 독소 중쇄는 신경세포막의 수용체에 결합하는 부위(receptor-binding domain)와 세포막으로 내재되어 경쇄의 이동(translocation)을 용이하게 하는 부위(translocation domain)의 두 부위로 구성되어 있다.
본 발명에서는, 보툴리눔 독소, 보다 구체적으로는 보툴리눔 독소 경쇄를 피부 내부 및 신경세포에 효율적으로 전달하기 위한 방법을 연구 노력한 결과, 보툴리눔 독소 중쇄의 구조적인 분석을 통해, 세포 내 전송을 가능케 하는 신규의 세포투과성 펩타이드를 개발하였다.
먼저, 보툴리눔 독소 중쇄 중 전송부위(translocation domain)의 3차원 구조를 in silico에서 분석하여 세포투과성 펩타이드로서의 개발 가능성이 있는 단백질 결합 부위(protein binding site)의 서열을 추출, 선별하였다. 이어 여러 단백질들의 분비에 관여하는 신호 단백질(signal protein) 또는 바이러스 단백질(viral protein) 유래의 펩타이드 및 세포막을 관통하여 세포의 내부로 단백질 등의 거대분자 유입을 매개하는 기존의 거대분자 전달 도메인(MTD, Macromolecule Transduction Domain)(대한민국 등록특허 제10-1258279호)과의 서열 비교를 통해 선별된 서열에서 투과능이 부여될 수 있도록 아미노산을 제거하고, 치환하는 등 수 차례의 시뮬레이션 과정을 수행하였다. 상기의 펩타이드는 양친매성으로 극성 아미노산의 배치로 세포막 접근성을 증가시키고, 물성과 가용성을 개선시켰으며 비극성 아미노산의 추가로 세포막 투과에 적합한 소수성을 부여하는 과정을 거쳐 신규의 세포투과성 펩타이드를 개발하고, 상기 신규의 세포투과성 펩타이드는 인간 피부 각질 형성 세포와 신경세포에 대한 투과성을 동시에 보유함을 확인하고, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명은 신규의 세포투과성 펩타이드를 제공하며, 보다 구체적으로, 생물학적 활성 분자의 세포 내 운반을 매개할 수 있는 펩타이드로서, 서열번호 1의 아미노산 서열로 이루어진 세포투과성 펩타이드를 제공한다.
본 발명에서, 상기 신규의 세포투과성 펩타이드는 생물학적 활성분자의 세포 내로의 운반을 매개할 수 있는 펩타이드로서, "TD1"이라 명명하였다.
본 발명의 세포투과성 펩타이드 TD1은
1) 13개의 아미노산으로 이루어져 있고;
2) 분자량이 약 1537 Da이며;
3) Theoretical pI는 9.31로 분석될 수 있고;
4) 단편들의 소수성 아미노산 구성이 60% 이상인 양친매성 펩타이드이며;
5) ProtParam 프로그램(http://web.expacy.org/protparam 참조)을 이용하여 분석된 instability index가 49.65의 값으로 서열의 안정성이 평가되고;
6) Aliphatic index가 97.69의 값으로 전체 분자의 부피가 평가되고;
7) GRAVY (Grand Average of Hydropathicity)가 0으로 평가되어 펩타이드의 응집(aggregation)이 개선되고;
8) 서포트 벡터 머신(Support Vector Machine, SVM) 분류 알고리즘을 기반으로 세포투과성 펩타이드를 예측하는 분석에서는, SVM 값이 -0.15로 평가된 특성을 보유한 서열이다.
본 발명에서, 세포투과성 펩타이드 자체는, 바람직하게는 정의된 효소 또는 치료적 생물학적 활성을 갖지 않으나, 세포막을 통해 세포 내 전송을 가능하게 하는 전송체(carrier)로써 역할을 한다. 이는 세포 내로 전송하고자 하는 cargo의 N-말단 또는 C-말단 그리고, 양말단에 부착될 수 있으며, 각각의 말단에서 정방향 또는 역방향으로 부착될 수 있다. 또한, 본 발명에 따른 펩타이드는 바람직하게는 단위체(monomer)로 적용될 것이나, 이에 한정하지 않으며, 이합체(dimer) 또는 중합체(polymer) 형태의 구성으로도 이용될 수 있다. 더욱이, 본 발명에 따른 펩타이드는 서열번호 1의 아미노산 서열을 최소의 단위로 포함하는 펩타이드 일 수 있다. 본 발명에 따른 펩타이드 서열 TD1을 기준으로 어느 한쪽 또는 양말단에 하나 이상의 아미노산을 추가하여 세포막 접근성, 투과성 및 물성에 변화를 줄 수 있다. 바람직하게는 25 내지 75% 범위의 소수성(hydrophobicity)를 갖도록 선택되며, 재조합 단백질의 정제과정에서 응집되는 현상이 발생될 경우, 친수성(hydrophilicity)의 특징을 갖는 서열을 추가하여 활용될 수도 있다.
본 발명의 다른 양태로서, 본 발명은 상기 펩타이드를 인코딩하는 폴리뉴클레오티드를 제공한다. 즉, 서열번호 1의 아미노산 서열로 이루어진 세포 투과성 펩타이드를 인코딩하며, 서열번호 2의 염기서열로 이루어질 수 있으나, 이것으로 제한되는 것은 아니다.
본 발명에 따른 폴리뉴클레오티드는 RNA 또는 DNA의 형태일 수 있는데, 상기 DNA는 cDNA 및 합성 DNA를 포함한다. DNA는 단일 가닥이거나 이중 가닥일 수 있다. 만약 단일 가닥이라면, 이는 코딩 가닥 또는 비-코딩(안티센스) 가닥일 수 있다. 상기 코딩 서열은 서열번호 2의 염기 서열과 동일할 수 있고, 또는 다른 코딩 서열일 수 있는데, 상기 코딩 서열은, 유전적 코드의 축퇴성(degeneracy) 또는 중복성(redundancy)의 결과로서, 동일한 폴리펩티드를 인코딩(encoding)할 수 있다.
본 발명의 일 실시예에서는, 본 발명에 따른 세포투과성 펩타이드 TD1의 세포투과성을 확인한 결과, 피부 각질 형성세포(HaCaT cell), 신경세포(SiMa cell, U-87 MG cell) 및 HeLa cell에서 모두 현저히 우수한 세포투과성을 나타냄을 확인하였다(실시예 2 및 3 참조).
본 발명의 또 다른 양태로서, 본 발명은 보툴리눔 독소 경쇄의 일측 또는 양말단에 서열번호 1의 아미노산 서열로 이루어진 세포투과성 펩타이드가 융합된, 세포투과성 보툴리눔 독소 재조합 단백질을 제공한다.
본 발명에서, "세포투과성 보툴리눔 독소 재조합 단백질" 이란 신규의 세포투과성 펩타이드 TD1과 보툴리눔 독소 경쇄(light chain)를 포함하며, 이들의 펩타이드 결합이나 공유결합과 같은 화학적 결합으로 형성된 결합체를 의미한다. 즉, 세포투과성 보툴리눔 독소 재조합 단백질은 세포 내로의 도입이 용이하지 않은 거대분자인 보툴리눔 독소 경쇄에 특정한 세포투과성 펩타이드를 융합시켜 세포투과성을 부여함으로써 보툴리눔 독소 경쇄를 세포 내로 고효율로 전달하는 것이다. 이때 상기 융합은 상기 보툴리눔 독소 경쇄의 카복시 말단, 아미노 말단 또는 이들 모두에 상기 세포투과성 펩타이드가 융합될 수 있다.
본 발명에서, 용어 "보툴리눔 독소"는 세균에 의해 또는 재조합 기술에 의해 생성되거나 조작된 변이체들 또는 융합 단백질을 포함하여 뒤이어 발견될 수 있는 것인지 여부에 관계없이 임의의 공지된 종류의 보툴리눔 독소를 의미한다.
본 발명에서, 보툴리눔 독소 경쇄는 보툴리눔 독소 혈청형(serotype) A, B, C, D, E, F 및 G로 이루어진 군으로부터 선택될 수 있으며, 이때, 상기 보툴리눔 독소 경쇄는 서열번호 3 내지 서열번호 9로 이루어진 군으로부터 선택되는 아미노산 서열로 이루어질 수 있다. 또한, 일측 말단에 헥사히스티딘(hexahistidine) 태그(tag)를 더 포함할 수 있다.
본 발명에서, 보툴리눔 독소 경쇄는 대안적으로 보툴리눔 독소 유도체, 즉, 보툴리눔 독소 활성을 가지나 임의로 부분 또는 서열 상에 하나 이상의 변형을 갖는 화합물 일 수 있다. 예를 들어, 7종의 혈청형의 보툴리눔 독소 경쇄 단백질에 대비해, 아미노산 서열 상의 결실(deletion), 수정(modification), 치환(replacement) 또는 키메라 융합(chimeric fusion) 등의 방법을 적용하여 경쇄의 endopeptidase의 활성이 유지됨과 동시에 특성을 강화하거나 부작용을 감소시키는 방법으로 변형된 형태일 수 있다. 또는 재조합 또는 화학적인 합성으로 제조된 보툴리눔 독소 경쇄 또는 보툴리눔 독소 경쇄의 일부분이 이용될 수 있다.
본 발명에서, 상기 세포투과성 보툴리눔 독소 재조합 단백질은 서열번호 31 내지 서열번호 58로 구성된 군으로부터 선택되는 아미노산 서열로 이루어질 수 있으며, 이들을 인코딩하는 폴리뉴클레오티드는 서열번호 59 내지 서열번호 86으로 구성된 군으로부터 선택되는 염기서열로 이루어질 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 실시예에서는, 본 발명에 따른 세포투과성 보툴리눔 독소 재조합 단백질의 세포투과성을 확인한 결과, 피부 각질 형성세포(HaCaT cell), 신경세포(SiMa cell, U-87 MG cell) 및 피부모사 인공막(Start-M)에 대하여 현저히 우수한 세포투과성을 나타냄을 확인하였다(실시예 6 및 7 참조).
본 발명의 또 다른 양태로서, 본 발명은 상기 세포투과성 보툴리눔 독소 재조합 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 재조합 발현벡터를 제공한다.
본 발명에서 "재조합 발현벡터"란 적당한 숙주세포에서 목적 단백질 또는 목적 RNA를 발현할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 컨스트럭트를 의미한다.
본 발명에서 용어, "작동 가능하게 연결된(operably linked)"은 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질 또는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(functional linkage)되어 있는 것을 의미한다. 예컨대, 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동 가능하게 연결되어 코딩하는 핵산 서열의 발현에 영향을 미칠 수 있다. 재조합 발현벡터와의 작동적 연결은 당해 기술 분야에 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에 일반적으로 알려진 효소 등을 사용한다.
본 발명에 사용가능한 발현벡터는 플라스미드 벡터, 코스미드(cosmid) 벡터, 박테리오파아지 벡터, 바이러스 벡터 등을 포함하지만, 이에 제한되지 않는다. 적합한 발현벡터는 프로모터(promoter), 오퍼레이터(operator), 개시코돈(initiation codon), 종결코돈(termination codon), 폴리아데닐화 신호(polyadenylation signal), 인핸서(enhancer)와 같은 발현 조절서열 외에도 막 표적화 또는 분비를 위한 신호서열(signal sequence) 또는 리더서열(leader sequence)을 포함하여 목적에 따라 다양하게 제조될 수 있다. 발현벡터의 프로모터는 구성적(constitutive) 또는 유도성(inducible)일 수 있다. 또한, 발현벡터는 벡터를 함유하는 숙주세포를 선택하기 위한 선택마커를 포함할 수 있고, 복제가 가능한 발현벡터인 경우 복제 기원을 포함할 수 있다. 또한, His, HAT, FLAG, c-myc, SBP, 키틴-결합 부위 (Chitin-binding domain), 글루타치온-S 트란스페라제(transferase) 및 말토스-결합 단백질(Maltose-binding protein)로 구성된 군으로부터 선택되는 친화성 표지(affinity tag)도 포함할 수 있다.
본 발명의 또 다른 양태로서, 본 발명은 상기 재조합 발현벡터로 형질전환된 형질전환 세균을 제공한다.
본 발명의 또 다른 양태로서, 본 발명은 상기 형질전환 세균을 배양하는 단계를 포함하는 세포투과성 보툴리눔 독소 재조합 단백질의 생산방법을 제공한다.
상기 생산방법은 본 발명의 형질전환 세균에 도입된 재조합 발현벡터에서 본 발명의 세포투과성 보툴리눔 독소 재조합 단백질을 암호화하는 폴리뉴클레오티드가 발현되도록 형질전환 세균을 적절한 배지 및 조건 하에서 배양하는 것에 의해 수행된다. 상기 형질전환 세균을 배양하여 재조합 단백질을 발현시키는 방법은 당해 분야에 공지되어 있으며, 예를 들면 형질전환 세균이 성장할 수 있는 적합한 배지에 접종하여 종균 배양한 후, 이를 본 배양용 배지에 접종하고 적합한 조건, 예컨대 유전자 발현 유도제인 아이소프로필-β-D-티오갈락토사이드(isopropyl-β-D-thiogalactoside, IPTG)의 존재 하에서 배양함으로써 단백질의 발현을 유도할 수 있다. 배양이 완료되면, 상기 배양물로부터 실질적으로 순수한 재조합 단백질을 회수할 수 있다. 본 발명에서 용어 "실질적으로 순수한"은 본 발명의 재조합 단백질 및 이를 코딩하는 폴리뉴클레오티드의 서열이 숙주세포로부터 유래된 다른 단백질을 실질적으로 포함하지 않는 것을 의미한다.
상기 형질전환 세균에서 발현된 재조합 단백질의 회수는 당해 분야에 공지된 다양한 분리 및 정제 방법을 통해 수행할 수 있으며, 통상적으로 세포 조각(cell debris), 배양 불순물 등을 제거하기 위하여 세포 용해물을 원심분리한 후, 침전, 예를 들어, 염석(황산암모늄 침전 및 인산나트륨 침전), 용매 침전(아세톤, 에탄올, 이소프로필 알콜 등을 이용한 단백질 분획 침전) 등을 수행할 수 있고, 투석, 전기영동 및 각종 컬럼 크로마토그래피 등을 수행할 수 있다. 상기 크로마토그래피로는 이온교환 크로마토그래피, 겔-여과 크로마토그래피, HPLC, 역상-HPLC, 흡착 크로마토그래피, 친화성(affinity) 컬럼 크로마토그래피 및 한외여과 등의 기법을 단독 또는 병용하여 이용할 수 있다.
한편, 재조합 발현벡터로 형질전환된 세균에서 발현된 재조합 단백질은 단백질 분리 시 단백질의 특성에 따라 용해성 분획(soluble fraction)과 불용해성 분획(insoluble fraction)으로 구분될 수 있다. 발현된 단백질의 대부분이 용해성 분획에 있을 경우에는 상기에 기술된 방법에 따라 용이하게 단백질을 분리 및 정제할 수 있으나, 발현된 단백질의 대부분이 불용해성 분획, 즉, 봉입체(inclusion body) 형태로 존재하는 경우에는 우레아, 계면활성제 등의 단백질 변성제가 포함된 용액으로 최대한 단백질을 용해시킨 후 원심분리하여 투석, 전기영동 및 다양한 종류의 레진이 충진된 각종 컬럼 크로마토그래피 등을 수행함으로써 정제할 수 있다. 이때, 단백질 변성제가 포함된 용액에 의해 단백질의 구조가 변형되어 그 활성을 잃을 수 있으므로 불용해성 분획으로부터 단백질을 정제하는 과정 중에는 탈염 및 원상화(refolding) 단계가 필요하다. 즉, 상기 탈염 및 원상화 단계는 단백질 변성제가 포함되지 않은 용액을 이용하여 투석 및 희석을 수행하거나 또는 필터를 이용하여 원심분리를 할 수 있다. 또한, 상기 용해성 분획으로부터 단백질을 정제하는 과정 중에도 정제 시 사용하는 용액 내의 염 농도가 높을 경우에는 이러한 탈염 및 원상화 단계를 수행할 수 있다.
한편, 본 발명의 또 다른 실시예에서는, 본 발명에 따른 세포투과성 보툴리눔 독소 재조합 단백질의 효능을 평가한 결과, 본 발명에 따른 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc) 에서도 보툴리눔 독소의 활성이 유지되고 있으며, 보툴리눔 독소와 동일한 기능을 하는 것을 확인하였다(실시예 8 및 9 참조). 또한, 인간 각질 형성 세포(HaCaT cell) 및 신경세포(SiMa cell)에서 세포독성이 나타나지 않을 뿐만 아니라(실시예 10 참조), 안정성도 매우 우수함을 확인하였다(실시예 11 참조). 따라서, 본 발명에 따른 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)은 다양한 질환 치료, 심미 및/또는 미용 목적을 위해 국소작용제로 효과적으로 활용될 수 있다.
이에, 본 발명의 또 다른 양태로서, 본 발명은 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는, 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환 치료용 약제학적 조성물을 제공한다. 본 발명의 약제학적 조성물은 유효성분인 세포투과성 보툴리눔 독소 재조합 단백질 외에 약제학적으로 허용 가능한 담체를 더 포함할 수 있으며, 이때 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체로는 식염수, 완충 식염수, 물, 글리세롤 및 에탄올 등이 있으나 이에 한정되지 않으며, 당해 기술 분야에 알려진 적합한 제제는 모두 사용 가능하다.
본 발명의 또 다른 양태로서, 본 발명은 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는 피부 외용제 조성물 또는 화장료 조성물을 제공한다. 상기 조성물은 주름살, 사각턱 및 뾰쪽턱 교정, 상처, 피부연화, 흉터, 여드름, 모공 축소, 탄력부여, 리프팅 또는 켈로이드 증상을 완화 또는 개선시키는데 적용될 수 있으나, 이것으로 제한되는 것은 아니다. 본 발명에 따른 조성물을 이용하여 피부 아래의 근육 또는 선구조체들에 마비를 유도하여 수축을 완화하거나 이완을 일으키거나 다른 미용학적 원하는 효과들을 위해 유효량을 전달시킬 수 있다.
본 발명의 또 다른 실시예에서는, 본 발명에 따른 세포투과성 보툴리눔 독소 재조합 단백질의 주름 개선 효능평가를 실시한 결과, 상기 세포투과성 보툴리눔 독소 재조합 단백질을 4주 간 연속적으로 사용 시 피부 팔자 주름과 피부 탄력 개선에 도움을 주는 것을 확인하였다(실시예 13 참조).
본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 및 왁스 파운데이션 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 또는 파우더의 제형으로 제조될 수 있다.
본 발명의 화장료 조성물에 함유된 화장품학적으로 유효한 담체는 제형에 따라, 당업계에서 통상적으로 이용되는 담체가 이용될 수 있다. 본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제,에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
본 발명의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
본 발명의 화장료 조성물에 포함되는 성분은 유효 성분과 담체 성분 이외에, 화장료 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예컨대 보습제, 항산화제, 방향제, 충진제, 점증제, 염료, 착색제, 계면활성제, 천연 또는 합성오일, 보존제, 침투제, 수화제, 항진균제, 유화제 용매, 연화제, 탈취제, 왁스 등을 포함할 수 있고, 선택적으로 식물추출물, 컨디셔닝제, 색소침착제 또는 미백제, 자외선차단제, 습윤제, 비타민 및 유도체 등을 포함하는, 그와 같은 제품들에서 통상적으로 이용되는 기타 성분들을 포함할 수 있다.
본 발명의 또 다른 양태로서, 본 발명은 상기 세포 투과성 보툴리눔 독소 재조합 단백질을 개체에 국부 투여(local administration)하는 단계를 포함하는 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환의 치료방법 또는 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드 개선방법을 제공한다. 본 발명에서 "개체"란 질병의 치료 또는 피부의 개선을 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
본 발명에 적용되는 "국부 투여(local administration)"는 약제의 생물학적 효과를 필요로 하는 동물 신체 상의 또는 체내의 부위 또는 그 부근에 약물을 직접 투여하는 것을 의미한다. 국부 투여는 정맥투여 또는 경구투여와 같은 전신적 경로의 투여는 배제한다. 국소 투여(topical administration)는 약제학적 제제를 사람의 피부에 도포하는, 국부 투여의 한 형태로 포함된다. 본 발명의 조성물은 상기의 피부학적, 미용학적 원하는 효과를 위해 경피적으로 투여되는 것이 바람직하다.
본 발명의 조성물에 있어서, 본 발명의 재조합 단백질의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수도 있고, 증상의 정도에 따라 유효성분의 함량을 달리할 수 있다. 이는 원하는 근육 마비 또는 생물학적 또는 심미효과를 가져오기에 충분하나 내재적으로 안전한 양을 의미한다. 그러나 상기 재조합 단백질의 농도는 약의 투여경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[ 실시예 ]
실시예 1. 신규한 세포투과성 펩타이드의 제작
보툴리눔 독소 경쇄의 경피전달을 실현시킬 수 있는 신규의 피부투과성 및 세포투과성 펩타이드를 개발하였다. 먼저 보툴리눔 독소 중쇄 및 경쇄의 구조와 기능을 분석하고, 보툴리눔 독소 A형의 신경세포 투과에 중쇄가 중요한 역할을 한다는 점에 착안하여 이를 기반으로 서열을 선별하였다. 또한, 기존의 거대분자 세포 내 전송도메인 MTD의 서열과 비교 분석하여, 양친매성으로 극성 아미노산의 배치로 세포막 접근성을 증가시키고, 물성과 가용성을 개선시켰으며 비극성 아미노산의 추가로 세포막 투과에 적합한 소수성을 부여하는 과정을 거쳐 서열번호 1의 아미노산 서열로 이루어진 신규의 세포투과성 펩타이드를 설계하였다. 위와 같이 설계된 세포투과성 펩타이드를 TD1으로 명명하고, 이의 특성과 구조를 ProtParam 프로그램(http://web.expacy.org/protparam)으로 분석하였고, 그 결과를 도 1 및 도 2에 나타내었다.
실시예 2. 유세포 측정(Flow Cytometry )을 이용한 세포투과성 펩타이드 TD1의 in vitro 세포투과능 확인
상기 실시예 1에 의해 제작된 신규의 세포투과성 펩타이드 TD1의 피부세포 및 신경세포에 대한 투과능 확인을 위해 유세포 측정(Flow Cytometry)을 이용하여 실험을 실시하였다. TD1의 세포투과성을 비교하기 위하여, 기존에 개발된 세포투과성 펩타이드인 kFGF4와 대표적인 단백질 전송서열 PTD(protein translocation domain)인 HIV-Tat을 대조 MTD로 사용하였고, 각 펩타이드 시료는 FITC로 형광 표지하여, 펩타이드 합성 전문기관(GL Biochem Ltd.(Sanghai, China)을 통해 합성하여 준비하였다.
2-1. 피부 각질 형성세포( HaCaT cell)에서의 정량적 세포투과능 확인
피부 각질 형성세포인 HaCaT cell에서 세포투과능을 확인하기 위하여, DMEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 HaCaT cell을 배양하였다. 유세포 측정을 위하여, 12 well plate에서 옮겨 16~24시간 추가 배양하고, 각 시료는 FBS가 첨가되지 않은 비혈청배지(serum free medium)에서 1시간(처리농도 5 μM, 10μM)과 3시간(처리농도 2.5 μM, 5 μM, 10μM) 동안 처리하였다. 반응시간이 끝난 후 DPBS로 2회 세척하여 잔여분의 시료를 제거하고, 0.05% 트립신-EDTA를 처리, 빛을 차단한 채 10분간 반응시킨 후 완전배지(complete media)를 이용하여 트립신-EDTA를 불활성화시켰다. 이후 준비한 튜브에 세포를 회수하여, 인산완충용액 3 mL를 가하고 2,000rpm에서 3분 간 원심분리하였다. 상층액 제거 후, 각각의 FACS 튜브에 인산완충용액 200 μL를 넣어준 뒤 세포를 충분히 재현탁시켜 유세포 측정을 수행하였다. 실험그룹으로는 Cell only 및 FITC only, Scramble peptide, HIV-Tat, kFGF4 유래 펩타이드를 사용하였고, 세포투과능이 없다고 생각되는 Scramble peptide에 대비하여 HIV-Tat, kFGF4 유래 펩타이드 및 TD1의 전송능을 결정하였다. 그 결과, 도 3a 및 도 3b에 나타낸 바와 같이, TD1이 대조군에 비교하여, 각질 형성세포에서 현저히 우수한 세포투과성을 나타냄을 확인할 수 있었다.
2-2. 신경세포(SiMa cell)에서의 정량적 세포투과능 확인
신경세포주인 SiMa cell에 대한 세포투과능을 확인하였다. SiMa cell은 배양접시에 대한 세포부착능이 약하여, gelatin(sigma, G2500)을 코팅한 배양접시를 사용하는데 0.1% gelatin 용액을 배양접시에 코팅하고, 상온에서 1시간 후 용액을 제거하고, 건조된 상태로 사용하였다. Complete media는 RPMI1640(10% FBS, 1% penicillin/streptomycin)을 이용하여 80% 이상의 confluency에서 계대배양하였다. 세포는 반복적인 계대배양으로 안정화 시킨 후 100mm 배양접시 당 5X105/well 으로 세포를 접종하고, 37℃의 5% CO2 조건의 배양기(incubator)에서 overnight 배양 후, 실험하였다.
각 시료(대조물질: cell only, FITC only, 비교물질: HIV-Tat & kFGF4 유래 펩타이드, 실험물질: TD1)는 FBS가 첨가되지 않은 비혈청배지에서 1시간과 6시간 동안 5 μM 농도로 처리하였다. 반응시간이 끝난 후 DPBS로 2회 세척하여 잔여분의 시료를 제거하고, 0.05% 트립신-EDTA를 처리, 빛을 차단한 채 10분간 반응시킨 후 complete media를 이용하여 트립신-EDTA를 불활성화시켰다. 이후 준비한 튜브에 세포를 회수하여, 인산완충용액 3 mL를 가하고 2,000rpm에서 3분간 원심분리하였다. 상층액 제거 후, 각각의 FACS 튜브에 인산완충용액 200 μL를 넣어준 뒤 세포를 충분히 재현탁시켜 유세포 측정을 수행하였다. 측정된 Fl-1의 기하평균(geometric mean; geo.mean) 값에서 kFGF4 유래 펩타이드에 대비하여 HIV-Tat, kFGF4 유래 펩타이드 및 TD1의 전송능을 결정하였다. 그 결과, 도 3c에 나타낸 바와 같이, TD1이 대조군에 비교하여, 신경세포에서도 우수한 세포투과성을 나타냄을 확인할 수 있었다.
2-3. 신경세포(U-87 MG cell)에서의 정량적 세포투과능 확인
신경세포(U-87 MG cell)에서 세포투과능을 확인하기 위하여, MEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 세포를 배양하였다. 유세포 측정을 위하여, 12 well plate에서 세포를 접종하여 16~24 시간 동안 배양하고, 각 시료(대조물질: cell only, FITC only, scramble peptide, 비교물질: kFGF4 유래 펩타이드, 실험물질: TD1)는 FBS가 첨가되지 않은 비혈청배지(serum free medium)에서 각 1시간과 6시간 동안 5 μM, 10 μM 농도로 처리하였다. 반응이 끝난 후 DPBS로 2회 세척하여 잔여분의 시료를 제거하고, 0.05% 트립신-EDTA를 처리, 빛을 차단한 채 10분간 반응시킨 후, complete media를 이용하여 트립신-EDTA를 불활성화시켰다. 이후 준비한 튜브에 세포를 회수하여, 인산완충용액 3 mL를 가하고 2,000rpm에서 3분 간 원심분리하였다. 상층액 제거 후, 각각의 FACS 튜브에 인산완충용액 200 μL를 넣어준 뒤 세포를 충분히 재현탁시켜 유세포 측정을 수행하였다. 세포 내로 투과된 FITC 수준 측정을 위하여 FL-1 파장을 이용하였으며, 측정된 Fl-1의 geo.mean 값에서 시료의 형광값을 보정해주기 위해 scramble peptide값을 기준으로 전송능을 결정하였다. 그 결과, 도 3d에 나타낸 바와 같이, TD1이 기존에 알려진 세포투과성 펩타이드인 kFGF4 유래 펩타이드와 비교하여, 신경세포(U-87 MG cell)에서 우수한 세포투과성을 나타냄을 확인할 수 있었다.
2-4. HeLa cell에서의 정량적 세포투과능 확인
HeLa cell(Human cervix adenocarcinoma cell)에서 세포투과능을 확인하기 위하여, MEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 세포를 배양하였다. 유세포 측정을 위하여, 12 well plate에서 옮겨 16~24시간 추가 배양하고, 각 시료는 FBS가 첨가되지 않은 비혈청배지(serum free medium)에서 각 시간과 처리농도에 따라 반응시켰다. 반응시간이 끝난 후 DPBS로 2회 세척하여 잔여분의 시료를 제거하고, 0.05% 트립신-EDTA를 처리한 다음, 빛을 차단한 채 10분간 반응시키고, 완전배지(complete media)를 이용하여 트립신-EDTA를 불활성화시켰다. 이후 준비한 튜브에 세포를 회수하여, 인산완충용액 3 mL를 가하고 2,000rpm에서 3분 간 원심분리하였다. 상층액 제거 후, 각각의 FACS 튜브에 인산완충용액 200 μL를 넣어준 뒤 세포를 충분히 재현탁시켜 유세포 측정을 수행하였다. 실험그룹으로는 TD1, HIV-Tat 및 kFGF4 유래 펩타이드를 사용하였고, 측정된 Fl-1의 geo.mean 값으로 각 시간 별, 농도 별의 전송능을 결정하였다. 그 결과, 도 3e에 나타낸 바와 같이, TD1은 HeLa cell 에서 12시간 이내에 농도의존적으로 세포 내에 유입됨을 알 수 있으며, HIV-Tat 및 kFGF4 유래 펩타이드는 대부분 5 μM 이상의 농도에서 세포 내로 유입되나, 투과량은 TD1에 비해 상당히 미약함을 알 수 있다. 이와 같이 TD1이 대조군에 비교하여, HeLa cell 에서 매우 우수한 세포투과성을 나타냄을 확인할 수 있었다.
실시예 3. 공초점현미경 (Confocal microscopy)을 이용한 세포투과성 펩타이드 TD1의 in vitro 세포투과능 확인
3-1. 피부 각질 형성세포(HaCaT cell)에서의 정성적 세포투과능 확인
피부 각질 형성세포주인 HaCaT 세포에서 세포투과능을 확인하기 위하여 DMEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 세포를 배양하였다. 현미경 분석을 위하여 12mm cover glass를 화염멸균 한 후, 24 well plate 각각의 well에 1개씩 넣고 HaCaT 세포를 접종하여 16~24시간 동안 배양하였다. 시료(대조물질: Vehicle, 비교물질: HIV-Tat, kFGF4 유래 펩타이드, 실험물질: TD1)는 FBS가 첨가되지 않은 무혈청 배지에서 1시간과 3시간 동안 3 μM, 5 μM 농도로 처리하였다. 반응이 끝난 후, 배지는 흡입기(suction)을 통해 완전히 제거한 다음, 인산완충용액을 넣고 가볍게 흔들어 2회 반복하여 세척하고, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 약하게 교반하며 세포를 고정시켰다. 세포 고정 후, 고정액은 제거하고 10분 간 2회, 인산완충액으로 세척하였다. 이후 Hoechst와 DAPI 염색 용액을 이용하여 차광한 상태에서 10분간 상온에서 대조염색을 수행하고, 반응 후, 염색용액은 제거하고 인산완충액으로 2회 세척하였다. 이후 cover glass는 회수하여, mounting 용액이 점적된 slide glass에 기포가 들어가지 않게 서서히 내려놓고 mounting하였다. 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 4a에 나타낸 바와 같이, HIV-Tat, kFGF4 유래 펩타이드와 비교하여, TD1의 우수한 세포투과성을 각질 형성세포에서 확인할 수 있었다.
3-2. 신경세포(SiMa cell)에서의 정성적 세포투과능 확인
신경세포주인 SiMa cell에 대한 세포투과능을 확인하기 위하여, complete media는 RPMI1640(10% FBS, 1% penicillin/streptomycin)을 이용하여 80% 이상의 confluency 에서 세포를 배양하였다. 세포는 반복적인 계대배양으로 안정화 시킨 후, 현미경 분석을 위하여 12mm cover glass를 화염멸균 한 후, 24 well plate 각각의 well에 cover galss 1개씩 넣고 SiMa cell을 접종하여 16~24시간 동안 배양하였다. 각 시료(HIV-Tat, kFGF4 유래 펩타이드, TD1)는 FBS가 첨가되지 않은 비혈청배지에서 6시간 동안 5 μM 농도로 처리하였다. 반응이 끝난 후, 배지는 흡입기(suction)를 통해 완전히 제거한 다음, 인산완충용액을 넣고 가볍게 흔들어 2회 반복하여 세척하고, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 약하게 교반하며 세포를 고정시켰다. 세포 고정 후, 고정액은 제거하고 10분 간 2회, 인산완충액으로 세척하였다. 이후 차광한 상태에서 10분간 상온에서 대조염색을 수행하고, 반응 후, 염색용액은 제거하고 인산완충액으로 2회 세척하였다. 이후 cover glass는 회수하여, mounting 용액이 점적된 slide glass에 기포가 들어가지 않게 서서히 내려놓고 mounting하였다. 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 4b에 나타낸 바와 같이 kFGF4 유래 펩타이드와 비교하여, TD1의 우수한 세포투과성을 신경세포에서도 확인할 수 있었다.
3-3. 신경세포(U-87 MG cell)에서의 정성적 세포투과능 확인
신경세포주인 U-87 MG세포에서 세포투과능을 확인하기 위하여 DMEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 U-87 MG 세포를 배양하였다. 형광현미경 관찰을 위하여 12 mm cover glass를 화염 멸균한 후, 24well plate 각각의 well에 1개씩 넣고 세포를 접종하여 16~24시간 동안 배양하였다. 각 시료(kFGF4 유래 펩타이드, TD1)는 FBS가 첨가되지 않은 무혈청 배지에서 6시간동안 5 μM 농도로 처리하였다. 반응이 끝난 후, 처리한 시료를 제거하고 PBS로 2회 반복하여 세척한 뒤, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 세포를 고정하였다. 이후, 고정액은 제거하고 PBS로 10분 간 2회 세척한 뒤, 차광한 상태에서 Hoechst와 DAPI 염색 용액을 이용하여 10분 간 상온에서 세포를 염색하였다. 염색 후, 용액은 제거하고 PBS로 2회 세척한 뒤, cover glass를 회수하여 mounting solution이 점적된 slide glass에 기포가 들어가지 않게 mounting하였다. 이는 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 4c에 나타낸 바와 같이, 신경세포 U-87 MG cell에서도 TD1이 kFGF4 유래 펩타이드와 비교하여, 우수한 세포투과성을 나타냄을 시각적으로 확인할 수 있었다.
3-4. HeLa cell에서의 정성적 세포투과능 확인
HeLa cell(Human cervix adenocarcinoma cell)에서 세포투과능을 확인하기 위하여, MEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 세포를 배양하였다. 형광현미경 관찰을 위하여 12 mm cover glass를 화염 멸균한 후, 24 well plate 각각의 well에 1개씩 넣고 세포를 접종하여 16~24시간 동안 배양하였다. 각 시료(HIV-Tat, kFGF4 유래 펩타이드, TD1)는 FBS가 첨가되지 않은 비혈청배지(serum free medium)에서 5 μM 농도로 6시간과 24시간 동안 반응시켰다. 반응이 끝난 후, 처리한 시료를 제거하고 PBS로 2회 반복하여 세척한 뒤, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 세포를 고정하였다. 이후, 고정액은 제거하고 PBS로 10분 간 2회 세척한 뒤, 차광한 상태에서 Hoechst와 DAPI 염색 용액을 이용하여 10분 간 상온에서 세포를 염색하였다. 염색 후, 용액은 제거하고 PBS로 2회 세척한 뒤, cover glass를 회수하여 mounting solution이 점적된 slide glass에 기포가 들어가지 않게 mounting하였다. 이는 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 4d에 나타낸 바와 같이, TD1이 대조군에 비교하여, HeLa cell에서도 매우 우수한 세포투과성을 보임을 확인할 수 있었다.
실시예 4. 보툴리눔 독소 경쇄 단백질(BoNT/A Light chain(Lc)) 및 MTD(TD1)와 보툴리눔 독소 경쇄 단백질( Lc )을 결합한 재조합 단백질(TD1- Lc )의 발현 컨스트 럭트 제작
보툴리눔 독소 A형 경쇄 단백질(Lc) 및 MTD(TD1)와 보툴리눔 독소 경쇄 단백질 (Lc)을 결합한 재조합 단백질의 발현 컨스트럭트를 제작하였다. 먼저, 바이오니아사에서 합성한 코돈 최적화(codon optimization)된 보툴리눔 신경독소 A형(botulinum neurotoxin type A) 경쇄(Lc; light chain) 서열을 주형으로 각각에 대해 특이적으로 고안된 프라이머(primer) 쌍과 중합효소 연쇄반응(PCR)을 수행하였다. 이때, 각각의 프라이머의 서열정보는 하기 표 1에 나타내었다.
Lc Forward primer GGAATTCCATATGCCCTTTGTCAACAAACAGTTC (서열번호 87)
Lc Reverse primer CCGCTCGAGCTTGTTGTAGCCTTTGTCAAG (서열번호 88)
TD1-LcForward primer GGAATTCCATATGAAGGCCATGATCAATATTAACAAGTTCTTAAATCAATGTCCCTTTGTCAACAAACAGTTC (서열번호 89)
TD1-LcReverse primer CTTGACAAAGGCTACAACAAGCACCACCACCACAGCGGCGGTGGTATGTGACTCGAGCGG (서열번호 90)
PCR 반응은 codon optimized Lc를 주형 100ng, 각 0.4mM의 최종농도 dNTP 혼합물, 1μM의 각 프라이머, 10x EX taq 완충용액 5㎕, EX taq 중합효소(Takara) 0.25㎕를 포함하는 용액을 최종 부피 50㎕ 반응액으로 하여 수행하였다. PCR 반응조건은 먼저 95℃에서 5 분간 열 변성(denaturing)시킨 후 95℃에서 30 초, 58℃에서 1분 및 72℃에서 1분의 반응을 30 회 반복하였고, 최종적으로 72℃에서 8 분간 증폭하였다. 반응이 끝난 후 1％ 아가로스 겔(Agarose gel)에 전기영동(electrophoresis)을 수행하여 증폭된 생성물을 확인하였고, 증폭된 재조합 단편은 아가로스 겔에서 회수한 후, 상용의 gel extraction kit(Intron, Korea)를 이용하여 추출, 정제하였다. 정제된 각각의 PCR 산물은 NdeI과 XhoI 효소를 37℃에서 2 시간 동안 처리하고, 다시 아가로스 겔에서 전기영동을 수행하여, gel extraction kit(Intron, Korea)로 절단(digestion)된 각각의 재조합 단편을 정제하였다. 한편, 히스티딘-표지(histidine-tag)와 T7 프로모터를 가진 발현벡터 pET-21b(+) 벡터(Novagen, USA)를 제한효소 NdeI과 XhoI을 사용해 상기와 동일한 조건으로 절단하여, 정제된 각각의 재조합 단편과 절단된 pET-21b(+) 벡터를 혼합하고, T4 DNA 연결효소(ligase; Intron, Korea)를 첨가한 후 16℃에서 16시간 동안 라이게이션(ligation)을 수행하였다. 이는 대장균 DH5α 감응세포에 형질전환시켜 최종적으로 재조합 단백질 발현벡터를 수득하였고, 발현벡터는 상기와 동일한 NdeI과 XhoI 제한효소 처리 및 1％아가로스 겔 전기영동을 통해 각각의 재조합 단편이 pET-21b(+) 벡터에 올바르게 삽입되었음을 확인하였다. 수득된 재조합 단백질 발현벡터는 각각 pET21b(+)-Lc, pET21b(+)-TD1-Lc 로 명명하였다.
실시예 5. 보툴리눔 독소 경쇄 단백질(Lc) 및 MTD(TD1)와 보툴리눔 독소 경쇄 단백질 (Lc)을 결합한 재조합 단백질(TD1-Lc)의 발현 균주 배양 및 정제
본 발명에 따른 재조합 단백질의 발현 균주 배양 및 정제과정을 하기와 같이 진행하였으며, 이에 대한 개략적인 모식도를 도 5에 나타내었다.
5-1. 균주 배양
대장균 BL21(DE3) RIL-CodonPlus에 상기에서 획득한 재조합 발현벡터 pET21b(+)-Lc, pET21b(+)-TD1-Lc 각각을 열 충격(heat shock) 방법으로 형질전환 시킨 후, 50 ㎍/㎖의 암피실린(ampicillin)이 함유된 LB 배지에서 배양하였다. 이후 상기 재조합 단백질 유전자가 도입된 대장균을 25 ㎖ LB 배지에 접종하고 37℃에서 overnight 배양한 후, 이 1차 배양액을 다시 9ℓ LB 배지에 접종하고 37℃에서 OD600(Optical density at 600nm)이 0.4 내지 0.8에 도달할 때까지 배양하였다. 이후 배양액에 단백질 발현의 유도제인 1mM의 IPTG를 첨가하고, 18℃에서 overnight으로 추가 배양한 후, 배양액을 4℃에서 8,000rpm, 10분간 원심 분리하여 상등액을 제거하고 균체를 회수하였다. 회수한 균체는 인산 완충액에 현탁하고 lysozyme을 처리한 후, 소니케이터(sonicator)를 이용하여 세포를 파쇄하였고, 이를 13,000rpm으로 30분간 원심 분리하여 용해성 분획을 수득하였다.
5-2. 단백질의 정제 및 순도확인(SDS-PAGE)
상기 실시예 5-1에서 수득한 용해성 분획을 고속 단백질 액체 크로마토그래피(Fast Protein Liquid Chromatography: FPLC, Bio-rad)를 이용하여 정제를 진행하였다. 용해성 분획을 FPLC에 흘려주면서 친화 크로마토그래피(affinity chromatography) 컬럼에 결합시키고, 세척 완충액(washing buffer)을 흘려주어 세척하였다. 이후 imidazole 농도를 점진적으로 증가시켜 정제 시료를 수득하고, 인산 완충용액 또는 PBS에서 투석막(dialysis membrane)을 이용하여 4℃ 조건에서 16~20시간동안 교반하면서 투석하였다.
정제된 시료는 순도를 검정하기 위하여 12％ SDS-PAGE 겔에서 전기영동을 수행하였다. 겔은 쿠마시 브릴리언트 블루 R(coomassie brilliant blue R)로 가볍게 진탕하면서 염색(staining) 하였고, 목적 단백질의 밴드가 명확해질 때까지 탈색액(destaining buffer)을 이용하여 탈색하였다. 그 결과, 도 6에 나타난 바와 같이, 정제된 단백질은 SDS-PAGE 상에서 95% 이상의 순도임을 확인할 수 있었다.
실시예 6. 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 세포투과능 평가
6-1. 형광 표지 단백질 제작
세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 in vitro 세포투과능을 평가하기 위하여, FITC가 표지된 단백질을 제조하였다. 차광한 상태에서 50 mM Boric 산과 0.1 ng/mL FITC 그리고 각각 0.5 ㎍/mL의 단백질을 혼합하여 10 mL의 단백질 현탁액를 만들고, 4℃에서 8시간 동안 반응시켰다. 반응이 끝난 후, 단백질 현탁액을 투석 튜브에 넣고, 차광한 상태의 4℃에서 3일 간 4시간-4시간-16시간 간격으로 DPBS로 교체해주며 투석을 진행하였다. 투석이 종료된 후 FITC 표지단백질을 0.2 μm syringe filter를 이용하여 여과하고, 수득한 단백질은 Bradford 분석법으로 정량하여 필요 농도에 따라 선택적으로 농축하였다. 측정된 농도 중 제일 낮은 농도의 단백질에 맞게 희석시켜 형광강도(fluorescence intensity,RFU)를 측정하였다. 측정된 RFU를 기준으로 검증에 사용한 FITC 융합 단백질의 형광강도를 비교하였다.
6-2. 유세포 측정(Flow Cytometry)을 이용한 신경 세포 투과능 확인
신경세포주인 SiMa cell에 대한 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 세포투과능을 평가하였다. SiMa cell은 배양접시에 대한 세포부착능이 약하여, gelatin(sigma, G2500)을 코팅한 배양접시를 사용하는데 0.1% gelatin 용액을 배양접시에 코팅하고, 상온에서 1시간 후 용액을 제거하고, 건조된 상태로 사용하였다. Complete media는 RPMI1640(10% FBS, 1% penicillin/streptomycin)을 이용하여 80% 이상의 confluency 에서 계대배양하였다. 세포는 반복적인 계대배양으로 안정화 시킨 후 100mm 배양접시 당 5X105/well으로 세포를 접종하고, 37℃의 5% CO2조건의 배양기(incubator)에서 16~20시간 동안 배양 후, 실험에 사용하였다.
각 시료(vehicle, FITC only, Lc-FITC, TD1-Lc-FITC)는 FBS가 첨가되지 않은 비혈청배지에서 6시간 동안 1.5 μg/ml 및 7.5 μg/ml의 농도로 처리하였다. 반응시간이 끝난 후 DPBS로 2회 세척하여 잔여분의 시료를 제거하고, 0.05% 트립신-EDTA를 처리, 빛을 차단한 채 10분간 반응시킨 후 complete media를 이용하여 트립신-EDTA를 불활성화시켰다. 이후 준비한 튜브에 세포를 회수하여, 인산완충용액 3 mL를 가하고 2,000rpm에서 3분 간 원심분리하였다. 상층액 제거 후, 각각의 FACS 튜브에 인산완충용액 200 μL를 넣어준 뒤 세포를 충분히 재현탁시켜 유세포 측정을 수행하였다. 측정된 Fl-1의 geo.mean 값에서 형광값을 보정하기 위하여, vehicle의 값을 기준으로 보툴리눔 독소 A형 경쇄(LC) 및 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 전송능을 결정하였다. 그 결과, 도 7a에 나타낸 바와 같이, 세포투과성 펩타이드가 결합된 TD1-Lc 재조합 단백질이 세포투과성 펩타이드가 결합되지 않은 Lc 단백질과 비교하여, 신경세포에서 현저히 우수한 세포투과성을 나타냄을 정량적으로 확인할 수 있었다. 이는 단백질 등 거대분자의 전송체로서 TD1의 가능성을 세포 수준에서 확인한 결과이다.
6-3. 공초점현미경(Confocal microscopy)을 이용한 신경 세포 투과능 확인
신경세포주인 SiMa cell에 대한 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 세포투과능을 확인하기 위하여, complete media는 RPMI1640(10% FBS, 1% penicillin/streptomycin)을 이용하여 80% 이상의 confluency 에서 세포를 배양하였다. 세포는 반복적인 계대배양으로 안정화 시킨 후, 현미경 분석을 위하여 12mm cover glass를 화염멸균 한 후, 24 well plate 각각의 well에 cover glass 1개씩 넣고 SiMa cell을 접종하여 16~24시간 동안 배양하였다. 각 시료(vehicle, Lc, TD1-Lc)는 FBS가 첨가되지 않은 무혈청 배지에서 3시간 동안 5 μg/ml의 농도로 처리하였다. 반응이 끝난 후, 배지는 흡입기를 통해 완전히 제거한 다음, 인산완충용액으로 2회 반복하여 세척하고, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 세포를 고정시켰다. 세포 고정 후, 고정액은 제거하고, 인산완충액으로 10분 간 2회 세척하였다. 이후 차광한 상태에서 10분 간 상온에서 대조염색을 수행한 뒤, 염색용액을 제거하고 인산완충액으로 2회 세척하였다. 세포 관찰을 위해 cover glass는 회수하여, mounting 용액이 점적된 slide glass에 기포가 들어가지 않게 서서히 내려놓고 mounting하였다. 이는 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 7b에 나타낸 바와 같이, Lc 단백질과 비교하여, 세포투과성 펩타이드가 결합된 TD1-Lc 재조합 단백질이 신경세포에서 현저히 우수한 세포투과성을 나타냄을 시각적으로도 확인할 수 있었다.
6-4. 공초점현미경(Confocal microscopy)을 이용한 각질 형성 세포 투과능 확인
피부 각질 형성세포주인 HaCaT 세포에 대한 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)의 세포투과능을 확인하기 위하여 DMEM complete media(10% FBS, 1% penicillin/streptomycin)를 이용하여 세포를 배양하였다. 현미경 분석을 위하여 12mm cover glass를 화염멸균 한 후, 24 well plate 각각의 well에 1개씩 넣고 HaCaT 세포를 접종하여 16~24시간 동안 배양하였다. 각 시료(Vehicle, Lc, TD1-Lc)는 FBS가 첨가되지 않은 무혈청배지에서 1시간, 3시간 및 6시간 동안 5 μM 농도로 처리하였다. 반응이 끝난 후, 각 well의 배지는 제거하고 인산완충용액으로 2회 반복하여 세척한 다음, 각 well에 10% 포르말린 용액을 200 μL씩 넣고 차광하여 10분 동안 세포를 고정시켰다. 세포 고정 후, 고정액은 제거하고, 인산완충액으로 10분 간 2회 세척한 뒤, 차광한 상태에서 Hoechst와 DAPI 염색 용액을 이용하여 10분 간 상온에서 대조염색을 수행하였다. 염색 후, 염색용액은 제거하고 인산완충액으로 2회 세척한 뒤, 세포 관찰을 위하여 cover glass를 회수하여, mounting 용액이 점적된 slide glass에 기포가 들어가지 않게 서서히 내려놓고 mounting하였다. 이는 차광 상태에서 충분히 말린 뒤 confocal microscope(Zeiss LSM700)를 이용하여 세포를 관찰하였다. 그 결과, 도 7c에 나타낸 바와 같이 Lc 단백질과 비교하여, 세포투과성 펩타이드가 결합된 TD1-Lc 재조합 단백질이 각질 형성 세포에서도 현저히 우수한 세포투과성을 나타냄을 시각적으로 확인하였다.
실시예 7. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc의 피부모사 인공막에 대한 투과 효능 평가
세포투과성 펩타이드(TD1)와 보툴리눔 독소 경쇄 단백질(Lc)을 결합한 재조합 단백질(TD1-Lc)의 피부장벽 투과 효능을 평가하기 위하여, 피부모사 인공막(Start-M)에 대해 자동피부투과기(MicroettePlus)를 이용하여 피부투과 효능을 확인하였다. 피부모사 인공막은 흡수를 저해하는 상층의 PES(polyether sulfone) 와 다공성 구조 생성으로 흡수에 차별성을 줄 수 있는 하층의 polyolefin으로 구성되어 있고, 보관이 쉬우며 전처리 과정 없이 바로 시스템에 적용할 수 있는 장점이 있다. 또한, 실제 피부에서 측정하기 어려운 투과량을 피부와 유사한 조건에서 정량할 수 있어 널리 이용되고 있다. 준비된 피부모사 인공막에서의 투과 효능 평가를 위하여, vertical cell 하단에 PBS를 넣고, 중간에 완충용액과 피부모사 인공막이 빈 공간이 없도록 결합시킨 뒤 vertical cell 상단에 시료를 넣고 준비하였다. 하단의 완충용액을 시간이 지남에 따라 10%의 양을 채취한 뒤 같은 양의 완충용액을 채워주고 이를 반복하였다. 채취한 시료는 실험이 끝난 뒤 ELISA 분석법을 이용하여 양을 측정하였다. 그 결과, 도 8에 나타낸 바와 같이, 신규의 세포투과성 펩타이드 MTD가 결합된 TD1-Lc가 보툴리눔 독소 경쇄 단백질 Lc에 비해, 피부모사 인공막에서 투과능이 약 20% 이상 우수한 것을 확인할 수 있었다. 시간에 따른 피부모사막의 투과 정도는 6시간 까지 유사하게 보이나, 12시간 이후 24시간까지는 TD1-Lc 단백질의 투과능이 보다 우수한 것을 확인할 수 있다.
실시예 8. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc의 효능 평가 ( In vitro SNAP25 cleavage assay)
SNAP25 단백질은 SNARE protein의 일종으로 보툴리눔 독소 A형의 경쇄가 잘라주는 단백질로, 일반적으로 보툴리눔 독소의 활성을 보기 위하여 시험관에서 SNAP25 cleavage assay 방법을 사용한다. 본 실시예에서도 보툴리눔 독소 경쇄(BoNT/A Light chain(Lc))의 활성을 확인하기 위하여, cleavage assay를 수행하였다. 2 ㎍의 GST-SNAP25-EGFP 융합 단백질에 2 ㎕의 cleavage assay buffer(10mM DTT, 10mM HEPES, 10mM NaCl & 20uM ZnCl2)를 넣고, 재조합 단백질 TD1-Lc를 각각 농도 10, 30, 90, 270, 810 ng의 농도로 첨가한 후, 37℃에서 4시간 동안 반응시켰다. 양성대조군으로는 270 ng의 보툴리눔 독소 혼합체(BoNT/A complex)를 첨가하고, 3차 증류수로 전체 용량을 20 ㎕로 맞추어 동일한 조건에서 반응시켰다. 위의 반응이 종료된 혼합액은 5X reduced buffer를 첨가하여 100℃에서 10분 간 가열한 후, 12% SDS-PAGE gel을 이용하여, 80V 20분, 120V 1시간 동안 전기영동을 진행하였다. SDS-PAGE gel은 staining buffer(0.25% coomassie brilliant blue, 45% methnaol, 10% acetic acid)로 염색한 후 destaining buffer(30% methanol, 10% acetic acid))로 탈색하여 단백질의 패턴을 확인하였다. 그 결과, 도 8에 나타낸 바와 같이, TD1-Lc의 재조합 단백질에서도 보툴리눔 독소의 활성이 유지되고 있음을 확인할 수 있었다. 상기 결과로부터 TD1-Lc의 재조합 단백질이 보툴리눔 독소와 동일한 기능을 할 것으로 예상할 수 있었다.
실시예 9. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc의 in vitro 효능 평가
9-1. 인간 각질 형성 세포(HaCaT cell)에서의 SNAP25 cleavage 확인
각질 형성 세포(HaCaT cell)에서의 재조합 단백질 TD1-Lc의 피부투과 및 효능을 평가하기 위하여, SNAP25 단백질의 절단여부를 통해 효능을 확인할 수 있는 SNAP25 cleavage assay를 western blot 방법으로 수행하였다. 각질 형성 세포(HaCaT cell)는 24 well plate에 1X104/well의 세포수로 24시간 배양한 후, pcDNA3.1-SNAP25 plasmid를 transfection하고, 양성 대조군으로 pcDNA3.1-Lc plasmid를 cotransfection 하였다. 16시간 배양을 통해 SNAP25를 과발현 시킨 후, FBS가 없는 배지로 교환하고, TD1-Lc 단백질 처리 후에는 48시간 뒤 배지를 제거하고 PBS로 세척하였다. 이후, 각 well에 RIPA buffer(intron) 200 ㎕씩 넣어 세포를 용해시킨 뒤 4℃ 8,000rpm에서 10분간 원심분리하여, 상등액을 얻었다. 수득한 각 시료는 5X reducing sample buffer와 혼합한 뒤 100℃에서 10분간 가열하고, 15% SDS-PAGE gel에 80V에서 20분, 120V에서 1시간 동안 전기영동을 수행하였다. 전기영동이 끝난 gel은 PVDF membrane(Millipore, IPVH00010)으로 90V에서 1시간 10분동안 전사(transfer)시키고, 전사된 membrane은 5% BSA를 넣고 2시간 동안 blocking 하였다. 이후, Primary antibody(Covance, SMI-81)를 1:1000으로 5% BSA에 희석하여 넣고, 4℃에서 16시간 반응시켰다. 반응이 끝난 membrane은 PBST를 이용하여 10분 간격으로 3회 이상 세척하는 과정을 거쳐, second antibody(Millipore, AP192P)를 1:2500으로 5% BSA에 희석하여 넣고, 다시 1 시간동안 실온에서 반응시켰다. 2차 반응이 끝난 membrane은 PBST로 10분 간격으로 3회 이상 세척하고, ECL solution을 처리하여 추가 반응을 시켜 카세트로 옮긴 후 암실에서 X-ray film에 감광시켜 확인하였다. 그 결과, 도 10a에 나타낸 바와 같이, plasmid 상태에서 Lc를 내부에서 발현한 경우와 단백질을 외부에서 처리한 경우 모두 SNAP25의 절단을 확인할 수 있었다. 이는 외부에서 처리한 TD1-Lc의 단백질이 피부세포를 투과하여 내부에서 발현된 SNAP25를 절단하였다는 것을 의미한다. 따라서, 재조합 단백질 TD1-Lc가 우수한 피부세포 투과성과 활성을 가지고 있음을 확인할 수 있었다.
9-2. 인간 신경세포(SiMa cell)에서의 SANP25 cleavage 확인
인간 신경세포(Human neuroblastoma cell)인 SiMa cell에서의 재조합 단백질 TD1-Lc의 피부투과 및 효능을 평가하기 위하여, SNAP25 단백질의 절단여부를 통해 효능을 확인할 수 있는 SNAP25 cleavage assay를 western blot 방법으로 수행하였다.
먼저, SiMa cell을 24 well plate에 10% FBS, 1% P/S를 포함한 RPMI 배지에 넣어 5X105/well로 seeding 한다. 37℃의 5% CO2조건의 배양기(incubator)에서 overnight 배양 후, 분화배지(10% FBS, RPMI, Glutamax, 1X NEAA, 1X B27, 1X N2, 5uM RA, 2.5uM PUR) 1ml로 교환하여 24시간 배양한 뒤, 분화배지(10% FBS, RPMI, Glutamax, 1X NEAA, 1X B27, 1X N2, 5uM RA, 2.5uM PUR)에 25ug/mL의 농도로 GT1b를 첨가하고, 1ml로 교환하였다. 24시간 배양 후 분화배지(10% FBS, RPMI, Glutamax, 1X NEAA, 1X B27, 1X N2, 5uM RA, 2.5uM PUR) 1ml로 교환하여 분화를 유도시켜 준비하였다. 신경세포(SiMa cell)는 24well plate에 5X105/well의 세포수로 배양한 뒤 신경세포 분화방법에 따라 분화시키는데 마지막 분화배지로 교환하고, 4시간 후에 재조합 단백질 TD1-Lc를 처리하였다. 단백질 처리 48시간 후, 배지를 제거하고 PBS로 세척한 뒤, 각 well 당 RIPA buffer(intron) 200 ㎕씩 넣어 세포를 용해시키고, 4℃ 8,000rpm에서 10분간 원심분리하여 상등액을 수득하였다. 수득한 각 시료는 5X reducing sample buffer와 혼합하여, 100℃에서 10분간 가열하고, 이를 15% SDS-PAGE gel에 80V 20분, 120V 1시간 동안 전기영동을 수행하였다. 전기영동이 끝난 gel은 PVDF membrane(Millipore, IPVH00010)으로 90V에서 1시간 10분 동안 전사(transfer)시키고, 전사된 membrane은 5% BSA를 넣고 2시간 동안 blocking 하였다. 이후, Primary antibody(Covance, SMI-81)를 1:1000으로 5% BSA에 희석하여 넣고, 4℃에서 16시간 반응시켰다. 반응이 끝난 membrane은 PBST를 이용하여 10분 간격으로 3회 이상 세척하는 과정을 거쳐, second antibody(Millipore, AP192P)를 1:2500으로 5% BSA에 희석하여 넣고, 다시 1 시간동안 실온에서 반응시켰다. 2차 반응이 끝난 membrane은 PBST로 10분 간격으로 3회 이상 세척하고, ECL solution을 처리하여 추가 반응을 시켜 카세트로 옮긴 후 암실에서 X-ray film에 감광시켜 확인하였다. 그 결과, 도 10b에 나타낸 바와 같이, TD1-Lc 단백질 만으로도 신경세포를 효과적으로 투과할 수 있음을 확인할 수 있었다. 이것으로 TD1-Lc 단백질이 피부세포 뿐만 아니라 신경세포도 효과적으로 투과할 수 있다는 것을 확인할 수 있었다.
실시예 10. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1- Lc의 피부 세포 독성 평가
10-1. 인간 각질 형성 세포(HaCaT cell)에서의 세포 독성 평가
재조합 단백질 TD1-Lc의 인간 피부 세포에 대한 세포 독성을 평가하기 위하여, 세포 생존율을 측정하는 MTT assay를 수행하였다. 먼저, 각질 형성 세포(HaCaT cell)를 24well plate에 1X104/well의 세포수로 배양하여, 재조합 단백질 TD1-Lc를 처리하기 4시간 전에 FBS가 없는 배지로 교환하였다. 단백질은 0.625㎍/㎖에서 40㎍/㎖의 농도까지 처리하고, 48시간 동안 반응시킨 후, 5㎎/㎖의 MTT(sigma)를 각 10㎕씩 첨가하여 추가로 4시간 동안 반응시켰다. 반응이 끝난 배양액은 버리고 각 시료에 100㎕의 DMSO를 첨가하여 실온에서 10분 간 반응시킨 뒤, OD570에서 흡광도(absorbance)를 측정하였다. 상기 실험의 대조군으로는 세포투과성 펩타이드 TD1이 결합되지 않은 보툴리눔 독소 경쇄 단백질(Lc)을 함께 실험하였다. 그 결과, 도 11a에 나타낸 바와 같이, 재조합 단백질 TD1-Lc가 각질 형성 세포(HaCaT cell)에 대해 40㎍/㎖의 높은 농도에서도 세포 생존율이 유지됨으로써 세포독성이 나타나지 않음을 확인할 수 있었다.
10-2. 인간 신경세포(SiMa cell)에서의 세포 독성 평가
재조합 단백질 TD1-Lc의 인간 신경세포(SiMa cell)에 대한 세포 독성을 평가하기 위하여, 세포 생존율을 측정하는 MTT assay를 수행하였다. 인간 신경세포(SiMa cell)를 24well plate에 5X105/well의 세포수로 배양하여, 신경세포 분화방법에 따라 분화를 유도하였다. 마지막 분화배지로 교환하고 4시간 후, 재조합 단백질 TD1-Lc를 처리하였다. 단백질은 0.625㎍/㎖에서 40㎍/㎖의 농도까지 처리하고, 48시간 동안 반응시킨 후, 5㎎/㎖의 MTT(sigma)를 각 10㎕씩 첨가하여 추가로 4시간 동안 반응시켰다. 반응이 끝난 배양액은 버리고 각 시료에 100㎕의 DMSO를 첨가하여 실온에서 10분 간 반응시킨 뒤, OD570에서 흡광도(absorbance)를 측정하였다. 상기 실험의 대조군으로는 세포투과성 펩타이드 TD1이 결합되지 않은 보툴리눔 독소 경쇄 단백질(Lc)을 함께 실험하였다. 그 결과, 도 11b에 나타낸 바와 같이, 재조합 단백질 TD1-Lc을 처리한 인간 신경세포(SiMa cell)의 세포 생존율이 유지됨으로써 고농도에서도 재조합 단백질 TD1-Lc로 인한 세포독성이 나타나지 않음을 확인할 수 있었다.
실시예 11. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc의 안정성 평가
보툴리눔 독소의 경쇄는 정제 후 두개의 경쇄 단백질이 dimer를 형성하며, 형성된 경쇄 dimer는 self-cleavage activity를 가지며, 보관 조건에 따라 self-cleavage activity의 활성에 차이를 보인다. 그리하여, 재조합 단백질 TD1-Lc의 보관 기간에 따른 안정성을 확인하기 위하여, 각 기간 별 단백질의 패턴 변화를 SDS-PAGE 전기영동으로 확인하였다. 재조합 단백질 TD1-Lc은 정량하여 10㎍씩 각각의 튜브에 분주하여 -80℃ 초저온 냉동고에 보관하였다. 보관한 지 1달, 3달, 6달 경과 후, 이후, 각 기간의 경과에 따라, 각각의 재조합 단백질 TD1-Lc을 녹여 12% SDS-PAGE gel에 전기영동을 수행하여 단백질의 순도 및 패턴의 변화가 있는지 확인하였다. 그 결과, 도 12에 나타낸 바와 같이, 6개월이 지난 후에도 단백질의 패턴의 변화가 없이 재조합 단백질이 안정하게 유지되고 있음을 확인할 수 있었다.
실시예 12. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1- Lc의 화장용 조성물의 제조 및 피부자극 안전성 평가
재조합 단백질 TD1-Lc의 임상시험을 위하여 H&A pharmachem 사에 리포좀화를 위탁하여 가공 후 화장품 원료와 2차 가공하여 화장품 조성물로 제작하였다.
또한, 사람을 대상으로 한, 피부자극 안전성 평가를 위하여 전문 임상시험대행기관(CRO)인 아이이씨코리아㈜(한국)에 시험을 의뢰하여 평가하였다. 시험은 건강한 남녀 31명을 대상으로 시료를 IQ chamber에 담아 등 피부에 첩포하고, 48시간 후 인체피부에 대한 안전성을 피부과 전문의가 판단하여 자극 정도를 평가, 분석하였다. 첩포 방법은 단회·밀폐 첩포시험으로 수행하였으며, 피부자극평가에 통용되는 평가기준(CTFA guideline)을 응용하여 Flosch & Kligman의 고안된 측정 평가법으로 자극 정도를 평가, 분석하였다. 피시험 자원자는 피부과 의사인 시험 책임자와 연구원의 병력조사, 문진 및 시진과 필요한 경우 촉진 등을 통해 피험자의 선정 및 제외 기준에 적합한 건강한 성인 남녀 32명을 선발하였으나 1명이 중도 탈락하였고, 연령분포는 만 20세에서 36세 사이, 평균 연령은 25.7±5.4세, 성비는 남자와 여자는 각 13명: 18명 이었다. 시험을 완전히 종료한 피시험자 31명을 대상으로 단회 첩포시험 후 평가기준에 의거한 피부자극도를 판독하였고, 그 결과를 도 13에 나타내었다. 피부 자극반응의 결과를 통해 자극도를 평가할 때 인체피부반응에서 적용되는 세계적인 공통기준은 정해진 바 없으나, 통상 50명 이하의 자원자를 대상으로 하는 시험에서는 단회 첩포시험의 판독 시 총 자원자의 20%를 초과하는 빈도로 반응이 출현하는 시료(본 시험의 경우 31명의 20%인 7명 이상) 혹은 매회 판독 시 +2 이상 자극반응이 총 자원자의 10% 초과하여 관찰된 시료는 유의하게 자극을 유발할 가능성이 있는 물질로 간주할 수 있다. 상기 시험에서 48시간 동안 31명의 피험자 등 피부에 첩포한 후 피부 반응을 관찰한 결과, 의뢰한 시료는 무자극으로 피부에 안전하게 사용될 수 있을 것으로 판단할 수 있었다.
실시예 13. 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1- Lc의 주름개선 효능평가
재조합 단백질 TD1-Lc의 주름개선 효능평가를 위하여 전문 임상시험대행기관(CRO)인 아이이씨코리아㈜(한국)에 의뢰하여 임상시험을 수행하였다. 시험은 30세에서 59세 사이의 팔자주름을 가진 한국인 성인여성 피험자 22명을 대상으로 시료 1종을 하루 2회씩 4주 간 피험자 스스로 자택에서 사용하도록 한 후, 피부 팔자주름의 거칠기와 피부탄력을 측정하고 임상사진촬영 및 피부과 전문의의 팔자주름 육안평가를 병행하여 재조합 단백질 TD1-Lc의 피부 주름개선의 효능을 평가하였다. 팔자주름의 거칠기는 PRIMOS System을 이용하여 측정하였고, 피부탄력은 Cutometer MPA580을 이용하여 측정하였다.
본 인체적용시험은 헬싱키선언의 정신과 GCP 가이드라인의 내용에 따라 피험자의 권리, 안전, 복지를 우선적으로 보호할 수 있도록 수행하였다. 연구자는 피험자의 안전을 보장할 수 있도록 다음 사항을 충실하게 이행하였다.
- 시험 진행 중 시험 책임자와 시험담당자는 피험자의 안전에 최선을 다해야 하며, 모든 피부 이상 증상 발생시 신속하고 적절한 조치를 취하여 그 반응을 최소화 하여야 한다.
- 시험 진행 중 피험자가 시료에 의하여 피부 자극 또는 이상 증상 사례를 보고하는 경우에는 즉시 사용된 시료를 닦아내고, 증상이 호전되지 않을 경우 시험책임자에 의한 피부과적 평가와 적절한 치료를 받는다.
- 정상적인 시험과정에도 불구하고 피부 이상 증상이 발생할 경우, 적절한 피부과적 평가와 치료를 받도록 한다.
- 기타 비정상적인 피부 반응이 발생할 경우 시험책임자와 시험 담당자는 피부과적 평가와 함께 적절한 조치를 취하며 증례 및 상황에 대하여 상세히 기록을 한다.
- 결과의 측정은 피험자가 실험실로 방문하여 항온항습실(22±2℃ 50±5%)에서 15분 이상 대기하여 피부 안정을 취하도록 한 후, 측정 및 평가를 실시하였다.
상기 시험에서는 시료 사용 전과 사용 4주 후에 팔자 주름 부위를 scanning 한 후 PRIMOS system을 이용하여 피부 거칠기(Roughness) parameter를 분석하였다. 피부 거칠기를 표현하는 parameter는 다음과 같다.
- Ra : arithmetic average(평균거칠기)
- Rmax : Maximum peak to vally roughness(최대거칠기)
- R3z : Arithmetic mean third height
- Rt : distance between the highest and the lowest point
- Rz : Average maximum height(10 point height)
피부탄력은 빰 모공 부위의 탄력(탄성 복원력)을 Custometer를 이용하여 측정하였다. 400mb의 압력으로 2초 간 흡입하고 2초 간 환원하는 과정을 3회 반복하였고, 측정 결과의 재현성을 높이기 위하여 pretension time를 0.1초로 설정하였다. 피부를 흡입, 이완하였을 때 측정값으로 얻어지는 각 parameters 값의 의미는 다음과 같다.
- R5 : Net elasticity of the skin without viscous deformation
- R7 : Portion of the elasticity compared to the complete curve
팔자 주름의 육안평가는 시료를 사용하기 전(D+0)과 4주 사용 후(D+28)에 피부과 전문의가 각 피험자의 좌 또는 우측의 팔자 주름 상태를 photographic scale에 따라 육안평가하였다.
시료 사용 전·후에 대해 팔자 주름 거칠기, 피부 탄력 및 피부과 전문의의 육안평가의 통계적 유의성을 검증하였으며, 결과 해석 방법은 시료 사용 전과 후, 팔자주름의 거칠기, 피부탄력 parameters, 피부과 전문의의 팔자주름 육안평가에서 유의한 변화가 있는 경우 팔자주름 또는 탄력이 개선된 것으로 해석하였다.
통계 분석 프로그램은 SPSS 14.0을 사용하였고 기기측정 결과 데이터의 정규성을 각각 Shapiro-Wilk test로 검증하였다. 피험자 22명은 모두 적합한 피험자로 선정되었고, 최종 방문일 까지 모든 피험자가 정상적으로 시험을 종료하여 최종 22명(평균 46.1세)의 유효한 데이터를 획득하였다.
그 결과, 도 14a에 나타낸 바와 같이, 시료사용 4주 후, 팔자주름 부위의 피부 거칠기를 나타내는 Ra, Rmax, R3z, Rz, Rt parameter가 유의하게 감소하여 팔자주름이 개선된 것으로 나타났다. 또한, 도 14b에 나타낸 바와 같이, 시료 사용 4주 후, 피부 탄력을 나타내는 R5, R7 parameter가 유의하게 증가하여 피부탄력이 개선된 것으로 나타났다. 팔자주름의 육안평가 결과 또한, 도 14c에 나타낸 바와 같이, 시료 사용 4주 후 팔자주름이 유의하게 감소하였으며, 도 15와 같이 주름 개선 효능을 시각적으로도 확인할 수 있었다.
이로써 세포투과성 펩타이드 TD1을 결합한 보툴리눔 독소 재조합 단백질 TD1-Lc을 이용한 피부 개선 효능을 임상시험을 통해 평가한 결과, 시료를 4주 간 연속적으로 사용 시 피부 팔자 주름과 피부 탄력 개선에 도움을 주는 것으로 확인되었다. 이는 국소적으로 적용된 세포투과성 보툴리눔 독소 재조합 단백질(TD1-Lc)이 경피에 효과적으로 전달됨으로써, 피부의 미세한 주름 및 굵은 주름을 감소시키는데 있어서 유의미한 효과를 제공하고 있음을 보여준다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 세포투과성 펩타이드-보툴리눔 독소 재조합 단백질은 경피를 통한 전달이 가능함으로써 보툴리눔 독소 고유의 효능을 보유함과 동시에 이용 편의성이 확대되어, 보다 안전하고 바람직한 치료적 대안이 될 수 있는바, 이를 이용한 다양한 질환 치료, 심미 및/또는 미용 목적을 위해 국소작용제로 효과적으로 활용될 수 있다.

Claims (23)

  1. 생물학적 활성 분자의 세포 내로의 운반을 매개할 수 있는 펩타이드로서, 상기펩타이드가 서열번호 1의 아미노산 서열로 이루어진, 세포투과성 펩타이드.
  2. 제1항의 펩타이드를 인코딩하는 폴리뉴클레오티드.
  3. 제2항에 있어서,
    상기 폴리뉴클레오티드가 서열번호 2의 염기서열로 이루어진 것을 특징으로 하는, 폴리뉴클레오티드.
  4. 보툴리눔 독소 경쇄의 일측 또는 양말단에 서열번호 1의 아미노산 서열로 이루어진 세포투과성 펩타이드가 융합된, 세포투과성 보툴리눔 독소 재조합 단백질.
  5. 제4항에 있어서,
    상기 보툴리눔 독소 재조합 단백질은 서열번호 31 내지 서열번호 58로 이루어진 군으로부터 선택되는 아미노산 서열로 이루어진 것을 특징으로 하는, 세포투과성 보툴리눔 독소 재조합 단백질.
  6. 제4항에 있어서,
    상기 보툴리눔 독소 경쇄는 서열번호 3 내지 서열번호 9으로 이루어진 군으로부터 선택되는 아미노산 서열로 이루어진 것을 특징으로 하는, 세포투과성 보툴리눔 독소 재조합 단백질.
  7. 제4항에 있어서,
    상기 보툴리눔 독소 경쇄는 일측 말단에 헥사히스티딘(hexahistidine) 태그(tag)를 더 포함하는 것을 특징으로 하는, 세포투과성 보툴리눔 독소 재조합 단백질.
  8. 제4항에 있어서,
    상기 보툴리눔 독소 경쇄는 보툴리눔 독소 혈청형(serotype) A, B, C, D, E, F 및 G로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 세포투과성 보툴리눔 독소 재조합 단백질.
  9. 제4항에 있어서,
    상기 융합은 상기 보툴리눔 독소 경쇄의 카복시 말단, 아미노 말단 또는 이들 모두에 상기 세포투과성 펩타이드가 융합되는 것을 특징으로 하는, 세포 투과성 보툴리눔 독소 재조합 단백질.
  10. 제4항에 있어서,
    상기 융합은 펩타이드 결합 또는 공유결합에 의해 이루어지는 것을 특징으로 하는, 세포투과성 보툴리눔 독소 재조합 단백질.
  11. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 인코딩하는 폴리뉴클레오티드.
  12. 제11항에 있어서,
    상기 폴리뉴클레오티드가 서열번호 59 내지 서열번호 86으로 구성된 군으로부터 선택되는 염기서열로 이루어진 것을 특징으로 하는, 폴리뉴클레오티드.
  13. 제11항의 폴리뉴클레오티드를 포함하는 재조합 발현벡터.
  14. 제13항에 있어서,
    상기 재조합 발현벡터는 His, HAT, FLAG, c-myc, SBP, Chitin-binding domain, Glutathione-S transferase 및 Maltose-binding protein으로 이루어진 군으로부터 선택되는 친화성 표지(affinity tag)를 포함하는 것을 특징으로 하는, 재조합 발현벡터.
  15. 제13항의 재조합 발현벡터로 형질전환된 세균.
  16. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는, 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환 치료용 약제학적 조성물.
  17. 제16항에 있어서,
    상기 약제학적 조성물은 경피 투여용인 것을 특징으로 하는, 조성물.
  18. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는, 피부 외용제 조성물.
  19. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 유효성분으로 포함하는, 화장료 조성물.
  20. 제18항 또는 제19항에 있어서,
    상기 조성물은 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드 증상을 개선시키는데 적용되는 것을 특징으로 하는, 조성물.
  21. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 개체에 경피 투여하는 단계를 포함하는, 안면경련, 눈꺼풀 경련, 사경(斜頸), 안검경련, 경부 근긴장 이상증, 인두 중앙부 근긴장 이상증, 경련성 발성 장애, 편두통, 항문 소양증 및 다한증으로 구성된 군으로부터 선택되는 질환 치료방법.
  22. 제4항의 세포투과성 보툴리눔 독소 재조합 단백질을 개체에 경피 투여하는 단계를 포함하는, 주름살, 사각턱 및 뾰쪽턱, 상처, 피부연화, 흉터, 여드름, 모공, 탄력 또는 켈로이드 개선방법.
  23. 제15항의 형질전환 세균을 배양하는 단계를 포함하는, 세포투과성 보툴리눔 독소 재조합 단백질 생산방법.
PCT/KR2015/005434 2014-05-29 2015-05-29 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도 WO2015183044A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
BR112016027773-2A BR112016027773B1 (pt) 2014-05-29 2015-05-29 Proteína recombinante célula-penetrante de toxina botulínica,composição farmacêutica, composição para um agente dérmico externo e composição cosmética
CN201580028681.5A CN106459155B (zh) 2014-05-29 2015-05-29 新颖细胞穿透肽、其与肉毒杆菌毒素的缀合物以及其用途
EP15800126.3A EP3156412B1 (en) 2014-05-29 2015-05-29 Novel cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof
KR1020167032746A KR101882461B1 (ko) 2014-05-29 2015-05-29 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
JP2017515651A JP6243577B2 (ja) 2014-05-29 2015-05-29 新規な細胞透過性ペプチド及びこれとボツリヌストキシン結合体、およびこれらの用途
US15/313,259 US10300118B2 (en) 2014-05-29 2015-05-29 Cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof
CA2949653A CA2949653C (en) 2014-05-29 2015-05-29 Novel cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof
RU2016146659A RU2670135C2 (ru) 2014-05-29 2015-05-29 Новый проникающий в клетки пептид, его конъюгат с ботулотоксином и их применение

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462004426P 2014-05-29 2014-05-29
US62/004,426 2014-05-29

Publications (1)

Publication Number Publication Date
WO2015183044A1 true WO2015183044A1 (ko) 2015-12-03

Family

ID=54699302

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/005434 WO2015183044A1 (ko) 2014-05-29 2015-05-29 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도

Country Status (9)

Country Link
US (1) US10300118B2 (ko)
EP (1) EP3156412B1 (ko)
JP (1) JP6243577B2 (ko)
KR (1) KR101882461B1 (ko)
CN (1) CN106459155B (ko)
BR (1) BR112016027773B1 (ko)
CA (1) CA2949653C (ko)
RU (1) RU2670135C2 (ko)
WO (1) WO2015183044A1 (ko)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106117352A (zh) * 2016-07-05 2016-11-16 中国人民解放军军事医学科学院军事兽医研究所 抗A型肉毒毒素的人源单链抗体E3‑scFv及其应用
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
US20180169182A1 (en) * 2015-06-11 2018-06-21 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US10300118B2 (en) * 2014-05-29 2019-05-28 Procell Therepautics Inc. Cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof
WO2019241315A1 (en) 2018-06-12 2019-12-19 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
WO2020086742A1 (en) 2018-10-24 2020-04-30 Obsidian Therapeutics, Inc. Er tunable protein regulation
KR102192191B1 (ko) * 2019-12-06 2020-12-17 주식회사 칸젠 신규한 세포 투과성 펩타이드 및 이의 용도
KR102192192B1 (ko) * 2019-12-06 2020-12-17 주식회사 칸젠 보툴리눔 독소 및 세포 투과성 펩타이드를 포함하는 재조합 단백질과 이를 포함하는 화장료 조성물
WO2021046451A1 (en) 2019-09-06 2021-03-11 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
US11155802B2 (en) 2017-07-06 2021-10-26 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum neurotoxins with increased duration of effect
WO2022228443A1 (en) * 2021-04-26 2022-11-03 Shanghaitech University Intramuscular compositions of botulinum neurotoxins
US11952601B2 (en) 2017-06-20 2024-04-09 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum toxin with increased duration of effect
US11969461B2 (en) 2016-03-02 2024-04-30 Merz Pharma Gmbh & Co. Kgaa Composition comprising botulinum toxin
KR102666595B1 (ko) 2023-06-16 2024-05-16 ㈜에스에이치랩 박테리오파지 유래 펩타이드를 포함하는 피부 주름 개선용 생분해성 고분자 필러 및 이의 제조방법

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101636846B1 (ko) * 2016-06-08 2016-07-07 (주)넥스젠바이오텍 피부 세포 증식 및 항산화 효과가 증가한 보툴리눔 톡신-인간상피세포성장인자 융합단백질 및 이를 유효성분으로 함유하는 피부 재생 및 주름 개선용 화장료 조성물
EP3644960A1 (en) * 2017-06-30 2020-05-06 Allergan, Inc. Dissolving film for delivery of a clostridial derivative
WO2019015673A1 (en) 2017-07-21 2019-01-24 Shanghaitech University TOPICAL COMPOSITIONS AND USES THEREOF
US11547649B2 (en) 2018-06-14 2023-01-10 Avixgen Inc. Fusion protein bound to cell-permeable peptide, and composition comprising fusion protein or cell-permeable peptide and epithelial cell growth factor as active ingredients
EP3808842A4 (en) * 2018-06-14 2022-11-23 Avixgen Inc. PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF SEVERE COMPLEX IMMUNE DEFICIENCY WITH A CELL-PERFORMING PEPTIDE AND ADENOSINDEAMINASE FUSION PROTEIN
KR101968873B1 (ko) * 2018-09-21 2019-04-29 아이큐어 주식회사 세포 침투 효과가 우수한 보툴리늄 유래 펩타이드를 포함하는 화장료 조성물
JP7262105B2 (ja) 2019-03-29 2023-04-21 国立研究開発法人理化学研究所 細胞透過性配列を有するポリペプチド及びそれを含む組成物
WO2020222315A1 (ko) * 2019-04-29 2020-11-05 주식회사 바이오셀트란 피부 또는 세포 투과능이 우수한 피부 주름 개선 또는 치료용 조성물
KR102449119B1 (ko) * 2019-12-17 2022-09-30 휴젤(주) 보툴리눔 독소 유래 펩타이드 단편, 및 이를 포함하는 피부 주름 개선용 화장료 조성물
KR102274876B1 (ko) * 2020-12-24 2021-07-08 주식회사 아임뉴런바이오사이언스 신규한 세포 투과성 펩타이드 및 이의 용도
KR102274877B1 (ko) * 2020-12-24 2021-07-08 주식회사 아임뉴런바이오사이언스 신규한 세포 투과성 펩타이드 및 이의 용도
KR20230057931A (ko) 2021-10-22 2023-05-02 비피메드(주) 보툴리눔 유래 펩타이드를 포함하는 탈모개선용 조성물
WO2023068485A1 (ko) * 2021-10-22 2023-04-27 비피메드(주) 보툴리눔 유래 펩타이드를 포함하는 탈모개선용 조성물
KR20230059121A (ko) 2021-10-25 2023-05-03 비피메드(주) 보툴리눔 유래 펩타이드를 포함하는 통증개선용 조성물
WO2023075060A1 (ko) * 2021-10-25 2023-05-04 비피메드(주) 보툴리눔 유래 펩타이드를 포함하는 통증개선용 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040209797A1 (en) * 2003-03-04 2004-10-21 Michael Karas Intracellular delivery of small molecules, proteins, and nucleic acids
US7192596B2 (en) * 1996-08-23 2007-03-20 The Health Protection Agency Ipsen Limited Recombinant toxin fragments
KR20090103957A (ko) * 2007-01-29 2009-10-01 주식회사 프로셀제약 신규한 거대분자 전달 도메인 및 이의 동정 방법 및 용도
US8568740B2 (en) * 2005-11-17 2013-10-29 Revance Therapeutics, Inc. Compositions and methods of topical application and transdermal delivery of botulinum toxins with reduced non-toxin proteins

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040009180A1 (en) * 2002-07-11 2004-01-15 Allergan, Inc. Transdermal botulinum toxin compositions
WO2005030119A2 (en) * 2003-04-11 2005-04-07 Allergan, Inc. Botulinum toxin a peptides and methods of predicting and reducing immunoresistance to botulinum toxin therapy
US20100266638A1 (en) * 2004-02-26 2010-10-21 Allergan, Inc. Headache treatment method
KR100612673B1 (ko) * 2004-08-20 2006-08-14 (주)바이오버드 세포도입성 보톡신 융합단백질
US8273865B2 (en) * 2006-03-15 2012-09-25 Allergan, Inc. Multivalent clostridial toxins
KR101258279B1 (ko) 2011-11-23 2013-04-25 주식회사 프로셀제약 세포 투과능을 개선한 개량형 신규 거대 분자 전달 도메인 개발 및 이의 이용방법
ES2621337T3 (es) * 2011-11-23 2017-07-03 Procell Therapeutics Inc. Desarrollo de nuevo dominio de transducción macromolecular con mejor permeabilidad celular y método de uso del mismo
US8420106B1 (en) * 2012-03-12 2013-04-16 William J. Binder Extramuscular treatment of traumatic-induced migraine headache
ES2759478T3 (es) * 2012-03-12 2020-05-11 William J Binder Tratamiento de las cefaleas por migraña con neurotoxina presináptica
CA2880897C (en) * 2012-11-21 2020-01-14 Syntaxin Limited Methods for the manufacture of proteolytically processed polypeptides
CA2949653C (en) * 2014-05-29 2019-12-17 Procell Therapeutics Inc. Novel cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7192596B2 (en) * 1996-08-23 2007-03-20 The Health Protection Agency Ipsen Limited Recombinant toxin fragments
US20040209797A1 (en) * 2003-03-04 2004-10-21 Michael Karas Intracellular delivery of small molecules, proteins, and nucleic acids
US8568740B2 (en) * 2005-11-17 2013-10-29 Revance Therapeutics, Inc. Compositions and methods of topical application and transdermal delivery of botulinum toxins with reduced non-toxin proteins
KR20090103957A (ko) * 2007-01-29 2009-10-01 주식회사 프로셀제약 신규한 거대분자 전달 도메인 및 이의 동정 방법 및 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BRUNGER, A. T. ET AL.: "Botulinum neurotoxin heavy chain belt as an intramolecular chaperone for the light chain", PLOS PATHOGENS, vol. 1, no. 10, 2006, pages 1191 - 1194, XP055240720, ISSN: 0021-9258 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10300118B2 (en) * 2014-05-29 2019-05-28 Procell Therepautics Inc. Cell penetrating peptide, conjugate thereof with botulinum toxin, and use thereof
US20180169182A1 (en) * 2015-06-11 2018-06-21 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US10603353B2 (en) * 2015-06-11 2020-03-31 Merz Pharma Gmbh & Co. Kgaa Recombinant clostridial neurotoxins with increased duration of effect
US11357821B2 (en) 2015-06-11 2022-06-14 Merz Pharma Gmbh & Co. Kgaa Recombinant clostridial neurotoxins with increased duration of effect
US11969461B2 (en) 2016-03-02 2024-04-30 Merz Pharma Gmbh & Co. Kgaa Composition comprising botulinum toxin
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
CN106117352A (zh) * 2016-07-05 2016-11-16 中国人民解放军军事医学科学院军事兽医研究所 抗A型肉毒毒素的人源单链抗体E3‑scFv及其应用
CN106117352B (zh) * 2016-07-05 2020-10-09 中国人民解放军军事医学科学院军事兽医研究所 抗A型肉毒毒素的人源单链抗体E3-scFv及其应用
US11952601B2 (en) 2017-06-20 2024-04-09 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum toxin with increased duration of effect
US11155802B2 (en) 2017-07-06 2021-10-26 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum neurotoxins with increased duration of effect
WO2019241315A1 (en) 2018-06-12 2019-12-19 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
WO2020086742A1 (en) 2018-10-24 2020-04-30 Obsidian Therapeutics, Inc. Er tunable protein regulation
WO2021046451A1 (en) 2019-09-06 2021-03-11 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
WO2021112458A1 (ko) * 2019-12-06 2021-06-10 주식회사 칸젠 신규한 세포 투과성 펩타이드 및 이의 용도
KR102192192B1 (ko) * 2019-12-06 2020-12-17 주식회사 칸젠 보툴리눔 독소 및 세포 투과성 펩타이드를 포함하는 재조합 단백질과 이를 포함하는 화장료 조성물
KR102192191B1 (ko) * 2019-12-06 2020-12-17 주식회사 칸젠 신규한 세포 투과성 펩타이드 및 이의 용도
WO2022228443A1 (en) * 2021-04-26 2022-11-03 Shanghaitech University Intramuscular compositions of botulinum neurotoxins
KR102666595B1 (ko) 2023-06-16 2024-05-16 ㈜에스에이치랩 박테리오파지 유래 펩타이드를 포함하는 피부 주름 개선용 생분해성 고분자 필러 및 이의 제조방법

Also Published As

Publication number Publication date
JP6243577B2 (ja) 2017-12-06
CN106459155A (zh) 2017-02-22
RU2670135C2 (ru) 2018-10-18
CN106459155B (zh) 2019-10-25
CA2949653C (en) 2019-12-17
EP3156412A4 (en) 2017-11-29
RU2016146659A (ru) 2018-05-29
JP2017527300A (ja) 2017-09-21
KR101882461B1 (ko) 2018-07-27
BR112016027773A2 (pt) 2017-10-31
US20170246266A1 (en) 2017-08-31
EP3156412A1 (en) 2017-04-19
CA2949653A1 (en) 2015-12-03
BR112016027773B1 (pt) 2023-12-26
RU2016146659A3 (ko) 2018-05-29
EP3156412B1 (en) 2020-01-08
KR20170002475A (ko) 2017-01-06
US10300118B2 (en) 2019-05-28

Similar Documents

Publication Publication Date Title
WO2015183044A1 (ko) 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
US8569243B2 (en) Sirtuin 6 activating peptides and cosmetic or pharmaceutical composition containing them
KR101393397B1 (ko) 세포내 분자 전송 펩티드를 이용한 피부 생리 활성 분자의 경피 전달시스템
CN102408470A (zh) 用作神经递质分泌抑制剂和肌肉松弛诱导物的合成肽
WO2019240430A1 (ko) 세포 투과 펩티드와 결합된 융합 단백질 및 융합 단백질 또는 세포 투과 펩티드와 상피세포성장인자를 유효성분으로 포함하는 조성물
KR102132274B1 (ko) 근육 이완용 조성물
WO2017213287A1 (ko) 피부 세포 증식 및 항산화 효과가 증가한 보툴리눔 톡신-인간상피세포성장인자 융합단백질 및 이를 유효성분으로 함유하는 피부 재생 및 주름 개선용 화장료 조성물
WO2017209347A1 (ko) 피부 세포 증식 효과가 증가한 열 안정성 인간 상피세포성장인자-거미독 융합단백질 및 이를 유효성분으로 함유하는 피부 주름 개선 및 탄력 유지용 화장료 조성물
WO2020060128A1 (ko) 세포 침투 효과가 우수한 보툴리늄 유래 펩타이드를 포함하는 화장료 조성물
US20180193435A1 (en) Hybrid neurotoxins and uses thereof
Stavisky et al. Melatonin enhances the in vitro and in vivo repair of severed rat sciatic axons
EP4098656A1 (en) Peptide inhibiting formation of snare complex and use thereof
WO2021112458A1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
KR102246906B1 (ko) 피부 또는 세포 투과능이 우수한 피부주름 방지 또는 개선용 화장료 조성물
WO2017122969A1 (ko) 열 안정성이 증가한 인간성장호르몬 융합단백질 및 이를 유효성분으로 함유하는 피부 주름 개선 및 탄력 유지용 화장료 조성물
WO2018088733A1 (ko) 신규의 프로테인 트랜스덕션 도메인 및 이의 용도
CN107446027A (zh) 具有核定位能力的透皮短肽及其应用
US20110123466A1 (en) Pharmaceutical and/or cosmetic composition containing an active principle activator of cytochrome c
KR102192191B1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
WO2016006744A1 (ko) 세포 내 분자 전송 펩티드를 이용한 경피 전달용 펩티드-sirna 복합체 및 이의 용도
US20220040079A1 (en) Recombinant proteins comprising botulinum toxin and cell penetrating peptide and cosmetic composition comprising thereof
KR102550756B1 (ko) 세포로부터 신경전달물질 분비를 저해하는 펩티드, 및 그의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15800126

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2949653

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 15313259

Country of ref document: US

ENP Entry into the national phase

Ref document number: 20167032746

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2016146659

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017515651

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015800126

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015800126

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016027773

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112016027773

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20161125