WO2018088733A1 - 신규의 프로테인 트랜스덕션 도메인 및 이의 용도 - Google Patents

신규의 프로테인 트랜스덕션 도메인 및 이의 용도 Download PDF

Info

Publication number
WO2018088733A1
WO2018088733A1 PCT/KR2017/011916 KR2017011916W WO2018088733A1 WO 2018088733 A1 WO2018088733 A1 WO 2018088733A1 KR 2017011916 W KR2017011916 W KR 2017011916W WO 2018088733 A1 WO2018088733 A1 WO 2018088733A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
seq
amino acid
acid sequence
egf
Prior art date
Application number
PCT/KR2017/011916
Other languages
English (en)
French (fr)
Inventor
장상호
이길환
황정순
박준호
박주희
Original Assignee
주식회사 바이오셀트란
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오셀트란 filed Critical 주식회사 바이오셀트란
Priority to EP17868564.0A priority Critical patent/EP3401324A4/en
Priority to JP2019545213A priority patent/JP2020510645A/ja
Priority to US16/346,373 priority patent/US20190336427A1/en
Publication of WO2018088733A1 publication Critical patent/WO2018088733A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/485—Epidermal growth factor [EGF], i.e. urogastrone
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A61K47/6455—Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
    • A61K8/0241—Containing particulates characterized by their shape and/or structure
    • A61K8/0245—Specific shapes or structures not provided for by any of the groups of A61K8/0241
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
    • A61K8/44—Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • the present invention relates to a novel protein transduction domain and its use, and more particularly, to a novel protein transduction domain (PTD), which is a peptide having the amino acid sequence set forth in SEQ ID NO: 1, and its use. .
  • PTD novel protein transduction domain
  • PTD Protein transduction domain
  • amino acid sequences 48-60 of HIV-derived TAT proteins were first known to have cell permeation sequences, and were able to transfer various biological substances into cells. Subsequently, as the mechanism of intracellular permeation was revealed, a large number of cationic sequences that could adhere well to negatively charged cell membranes began to be prepared.
  • amphiphilic peptides transportan, PEP1, MPG, pVEC, MAP, CADY
  • cationic peptides polyarginine, TAT, penetratin, P22N
  • hydrophobic peptide K-FGF, C105Y
  • PTD can penetrate cells through which biological molecules can't pass, which can enter cells through glycosaminoglycans (GAGs) on cell membranes, and can also enter through endocytosis pathways.
  • GAGs glycosaminoglycans
  • the binding between the PTD and the biological material can be accomplished through various means including covalent bonds, ionic bonds, electrostatic attraction, and the like.
  • an important advantage of PTD is its low toxicity and low immune rejection response to treatment when delivering biological molecules into cells for therapeutic or diagnostic purposes. Through this, it is also possible to improve the problem according to the high concentration treatment method by a stepwise treatment technique.
  • PTD protein transduction domain
  • the present invention provides a peptide having the amino acid sequence set forth in SEQ ID NO: 1.
  • the amino acid sequence of SEQ ID NO: 1 may be preferably encoded by the nucleic acid sequence described in SEQ ID NO: 2.
  • the peptide may be, for example, a Protein Transduction Domain (PTD).
  • the peptide may be, for example, a gene carrier.
  • the present invention provides a conjugate formed by chemically bonding a substance having a amino acid sequence described in SEQ ID NO: 1 with the amino acid sequence of SEQ ID NO.
  • the chemical bond may be preferably a covalent bond or a non-covalent bond.
  • the covalently linked substance may be, for example, a peptide or a protein.
  • the non-covalent bond may be, for example, a bond by ionic bond or electrostatic attraction or a bond by hydrophobic interaction.
  • the material that can be bonded by the ionic bond or electrostatic attraction may be, for example, a material having a charge, the material having a charge, for example, may be DNA or RNA.
  • the present invention provides a complex in which a substance having hydrophobic interaction or electrostatic attraction to a peptide having the amino acid sequence of SEQ ID NO: 1 is mixed with the amino acid sequence of SEQ ID NO.
  • the material that can be coupled by the electrostatic attraction may be, for example, a material having a charge
  • the material having a charge may be, for example, DNA or RNA.
  • the present invention is a hydrophobic interaction to a peptide having an amino acid sequence described in SEQ ID NO: 1 or a conjugate formed of a substance that can be chemically bonded to the peptide having the amino acid sequence of SEQ ID NO: 1 is bonded to the amino acid sequence of SEQ ID NO:
  • a cosmetic composition comprising a complex in which a substance capable of being bound by hydrophobic interaction or electrostatic attraction is mixed with an amino acid sequence of SEQ ID NO: 1.
  • the present invention is a hydrophobic interaction with a peptide formed by binding to an amino acid sequence of SEQ ID NO: 1 or a substance capable of chemically bonding to the peptide having the amino acid sequence of SEQ ID NO: 1 It provides a pharmaceutical composition comprising a complex in which a substance capable of being bound by hydrophobic interaction or electrostatic attraction is mixed with the amino acid sequence of SEQ ID NO: 1.
  • the present invention binds a peptide having an amino acid sequence as set out in SEQ ID NO: 1 to a substance that can be chemically bonded to a peptide having an amino acid sequence as set out in SEQ ID NO.
  • the present invention is a mixture of a peptide having the amino acid sequence of SEQ ID NO: 1 with a substance capable of binding to the peptide having the amino acid sequence of SEQ ID NO: 1 by hydrophobic interaction or electrostatic attraction, Hydrophobic interaction to the peptide having the amino acid sequence of SEQ ID NO: 1, characterized by introducing into the cell a substance capable of hydrophobic interaction or electrostatic attraction to the peptide having the amino acid sequence of SEQ ID NO: 1 A method for introducing a mammal into a cell using a substance that can be bound by hydrophobic interaction or electrostatic attraction.
  • a biological molecule such as protein, peptide, DNA, etc. can be easily introduced into a cell at high yield.
  • 1 is a map of a typical GFP expression vector.
  • 2 is a map of a TAT-GFP expression vector.
  • 3 is a map of a PEP1-GFP expression vector.
  • 10 is a map of a STeP-EGF expression vector.
  • FIG. 11 shows expression results of EGF recombinant proteins (PEP1-EGF, STeP-EGF).
  • Figure 13 shows the cell proliferation efficacy results (EGF, PEP1-EGF, STeP-EGF) of EGF recombinant protein.
  • Figure 16 is a comparison of the 'cell' permeability of cell permeable peptide-FITC mixture.
  • 17 is a comparison result of the 'skin' penetration of the cell-penetrating peptide-FITC mixture.
  • Figure 19 is a comparison of the skin permeability of the cell permeable peptide and FGF2 mixture.
  • the present inventors have made efforts to develop more efficient peptides and drug delivery systems using the same, which can deliver a target substance into cells, and have developed the cell permeation peptide of SEQ ID NO: 1.
  • the peptide described in SEQ ID NO: 1 has an amphiphilic property, it was confirmed that can be efficiently applied to the intracellular delivery of the target material, the present invention was completed.
  • the present invention provides a peptide having the amino acid sequence set forth in SEQ ID NO: 1.
  • the amino acid sequence of SEQ ID NO: 1 may be preferably encoded by the nucleic acid sequence described in SEQ ID NO: 2.
  • the peptide set forth in SEQ ID NO: 1 of the present invention can be used as a Protein Transduction Domain (PTD) or as a gene carrier.
  • PTD Protein Transduction Domain
  • the present invention provides a conjugate formed by chemically bonding a substance which can be chemically bonded to the peptide having the amino acid sequence of SEQ ID NO: 1 to the amino acid sequence of SEQ ID NO: 1.
  • “Chemical bond” is a concept including all chemical bonds, for example, may be a covalent or non-covalent bond.
  • Covalent bond means, for example, that the target substance (substance to be introduced into cells or skin) through peptide bonds to the N-terminus or C-terminus of the amino acid sequence of SEQ ID NO: 1 of the present invention.
  • the target substance may be a peptide or protein exhibiting a specific purpose, for example, skin aesthetic efficacy, and may be a peptide or protein exhibiting medicinal efficacy in a cell.
  • Examples of peptides may include Dipeptide Diaminobutyroyl Benzylamide Diacetate (trade name: SYN-AKE), Acetyl hexapeptide-8 (trade name: Argireline), and the like.
  • proteins include Epid (Epidermis growth factor), FGF1 (Fibroblast growth factor-1), FGF2 (Fibroblast growth factor-2), SOD1 (Superoxide dismutase-1), CAT (Catalase), (FK506bp: FK506-binding protein ), BonT / A Light chain (Botulinum neurotoxin type A light chain) may be.
  • the non-covalent bond may be, for example, a bond or hydrophobic interaction by ionic bond or electrostatic attraction.
  • various biological substances eg, siRNAs, nucleic acids, small molecules, proteins, cytotoxic drugs, imaging agents, etc.
  • the material that can be bonded by the ionic bond or electrostatic attraction may be, for example, a material having a charge, for example, may be DNA or RNA.
  • the present invention provides a complex in which a peptide having the amino acid sequence of SEQ ID NO: 1 is mixed with a substance capable of hydrophobic interaction or electrostatic attraction and the amino acid sequence of SEQ ID NO: 1.
  • a target substance capable of binding to the peptide of SEQ ID NO: 1 of the present invention by hydrophobic interaction or electrostatic attraction by only mixing without inducing artificial chemical bonding It was confirmed that the peptide described in SEQ ID NO: 1 of the present invention can be introduced into cells or into skin by binding to hydrophobic interaction or electrostatic attraction.
  • the material that can be coupled by the electrostatic attraction may be, for example, a material having a charge, and the material having a charge may be, for example, DNA or RNA.
  • the present invention is a hydrophobic interaction to a peptide having an amino acid sequence described in SEQ ID NO: 1 or a conjugate formed of a substance that can be chemically bonded to the peptide having the amino acid sequence of SEQ ID NO: 1 is bonded to the amino acid sequence of SEQ ID NO:
  • a cosmetic composition comprising a complex in which an amino acid sequence described in SEQ ID NO: 1 is mixed with a substance capable of being bonded by hydrophobic interaction or electrostatic attraction.
  • the cosmetic composition of the present invention is not limited to a specific form (formulation), but includes all formulations, for example, lotion, gel, water-soluble liquid, cream, essence, oil-in-water (O / W) type and water-in-oil (W) / O) emulsion, ointment base cosmetic formulation, oil-in-water and water-in-oil makeup base, foundation, skin cover, lipstick, lip gloss, face powder, two-way cake, eye shadow, teak color and eyebrow pencils It is preferably any one selected from color cosmetic formulations.
  • the cosmetic compositions of the present invention may contain conventional auxiliaries such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preservatives, antioxidants, solvents, fragrances, fillers, blocking agents, pigments, odorants and dyes in the cosmetic field. Can be.
  • auxiliaries such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preservatives, antioxidants, solvents, fragrances, fillers, blocking agents, pigments, odorants and dyes in the cosmetic field. Can be.
  • the present invention is a hydrophobic interaction with a peptide formed by binding to an amino acid sequence of SEQ ID NO: 1 or a substance capable of chemically bonding to the peptide having the amino acid sequence of SEQ ID NO: 1
  • a pharmaceutical composition comprising a complex in which an amino acid sequence described in SEQ ID NO: 1 is mixed with a substance capable of binding by hydrophobic interaction or electrostatic attraction.
  • compositions of the present invention include all formulations that are not necessarily limited to specific formulations, and examples of specific formulations include PLASTERS, GRANULES, LOTIONS, LINIMENTS, LIMONADES, AROMATIC WATERS, POWDERS, SYRUPS, OPHTHALMIC OINTMENTS, LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, ELIXIRS, OINTMENTS, FLUIDEXTRACTS, Emulsions, SUSPENSIONS, DECOCTIONS, INFUSIONS, OPHTHALMIC SOLUTIONS, TABLETS, Suppositories (SUPPOSITORIES), INJECTIONS, INJECTIONS, SPIRITS, CATASLSMA, CAPSULES, CREAMS, TROCHES, TINCHES, PASTES ), Pills (PILLS), soft or hard gelatin capsules.
  • specific formulations include PLASTERS, GRANULES, LOTIONS, LINIMENTS, LIMONADES, A
  • compositions of the present invention may preferably further comprise a pharmaceutically acceptable carrier, diluent or excipient.
  • Carriers, excipients or diluents which may be used include lactose, dextrose, sucrose, sorbitol, mannitol, xyitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils, one or more of which may be selected.
  • the present invention binds a peptide having an amino acid sequence as set out in SEQ ID NO: 1 to a substance that can be chemically bonded to a peptide having an amino acid sequence as set out in SEQ ID NO.
  • the present invention is prepared by mixing a peptide having an amino acid sequence as set out in SEQ ID NO: 1 with a substance capable of binding to a peptide having an amino acid sequence as set out in SEQ ID NO: 1 by hydrophobic interaction or electrostatic attraction.
  • Hydrophobic interaction to the peptide having the amino acid sequence of SEQ ID NO: 1 characterized by introducing into the cell a substance capable of hydrophobic interaction or electrostatic attraction to the peptide having the amino acid sequence of SEQ ID NO: 1
  • the target substance to be introduced into the cell can be easily introduced into the cell in high yield.
  • a technique required for introduction of a target substance into a cell may be known in the art.
  • the present invention through the peptide consisting of the 27 amino acid sequence described in SEQ ID NO: 1 is capable of cell permeation, and suggests that the protein and gene can be delivered.
  • the present invention may be a basic data suggesting an effective method for mass transfer using PTD.
  • the peptide described in SEQ ID NO: 1 of the present invention has the advantage that can be delivered by simple mixing, it will be usefully used as a carrier.
  • recombinant protein expression vectors were prepared by fusing peptides having cellular and skin permeability and proteins to be delivered.
  • the target protein (cargo) to be delivered in order to easily analyze the delivery ability of how the fusion protein can be delivered to cells and skin, the target protein (cargo) to be delivered, called Green Fluorescence Protein (hereinafter referred to as "GFP") ) Is selected.
  • GFP Green Fluorescence Protein
  • TAT or PEP1 which is a well-known PTD, was fused to GFP to compare the newly developed STeP (SEQ ID NO: 1) with intracellular and skin delivery ability.
  • a DNA fragment corresponding to the base sequence of GFP was subcloned into XhoI and BamHI sites of plasmid pET15b to prepare pGFP that expresses GFP protein. Since the pGFP expression vector has not been fused with cells and peptides having skin permeability, and GFP is a hydrophilic polymer protein of about 29 kDa, it can be said that the GFP expressed in this vector is incapable of delivering to cells and skin. Therefore, it was prepared as a control for comparing the cell and skin permeability.
  • DNA fragments corresponding to the nucleotide sequence of GFP were polymerized by Pfu DNA polymerase (PCR) using plasmid pEGFP-C2 (Clontech) to amplify the complete sequence of GFP.
  • the forward primer is 5'-CTCGAGGTGAGCAAGGGCGAGGAGCTG-3 'and the sequence of the reverse primer is 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3'.
  • the PCR product was cut with Xho I-Bam HI and subcloned into the XhoI-BamHI site of pET15b (Invitrogen, Carlsbad, Calif.) To prepare pGFP that expressed a general GFP protein. 1 is a map of a typical GFP expression vector.
  • PTAT-GFP expressing GFP fused with HIV-1 TAT was constructed by the following method.
  • the sequences encoding the nine amino acids of the HIV-1 TAT are the upper chain 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 'and the lower chain 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'.
  • Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pTAT-GFP expressing the TAT-GFP protein.
  • 2 is a map of a TAT-GFP expression vector.
  • PPEP1-GFP expressing GFP fused with PEP1 was constructed by the following method. First, two oligonucleotide top chains 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAACGTAAAGTGC-3 'and the bottom chain 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTsynthetic-synthesizedcodingPPC2-speptide-couplings were prepared.
  • Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pPEP1-GFP expressing PEP1-GFP protein.
  • 3 is a map of a PEP1-GFP expression vector.
  • PSTeP-GFP expressing the STeP fused GFP of the present invention was produced by the following method. First, two oligonucleotide top chains 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3 'and the bottom chain 5'-TCGAGACGACGACGCTGACGACGTTGTTCCCCCTCGTGTTCTCCGTGTGT Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pSTeP-GFP expressing STeP-GFP protein. 4 is a map of the STeP-GFP expression vector.
  • the protein was expressed from the recombinant vectors prepared in the above example.
  • Four types of expression vectors were each transformed into E. coli Rosetta-gami 2 (DE3) cells.
  • the transformed bacterial cells were cultured at 37 ° C. until the OD 600 value was 0.6 using 1,000 ml of LB medium containing empicillin, and further cultured for 24 hours by introducing 0.5 mM IPTG at 22 ° C. Expression of the protein was induced.
  • GFP protein was purified and purified using His tag affinity column. Purification methods of the four GFP proteins were purified using the same method as follows.
  • pET15-GFP, pTAT-GFP, pPEP1-GFP, pSTeP-GFP transformed cells were disrupted in 1X Native buffer (50 mM NaPO 4 , 0.5M NaCl) using an ultrasonic wave, and then centrifuged to separate the aggregate body and the inclusion body. Isolate into cytoplasm (supernatant).
  • HaCaT human keratinocyte cells were incubated for 24 hours on a culture slide. The culture medium was then removed, washed three times with HBSS and treated with GFP and cell permeable GFP proteins (PEP1-GFP, TAT-GFP, STeP-GFP). When the cells were treated, a stock was prepared so that the concentration of each protein was 10mM, diluted 1/10 in the medium, and treated to a final 10 ⁇ M, followed by incubation for 2 hours. After 2 hours, the medium was removed, the cells were washed with PBS, and the cells were fixed at ⁇ 20 ° C. for 10 minutes using cold methanol. Cells were sufficiently washed with PBS, and then stained with PBS diluted nuclear staining reagent (DAPI) for 10 minutes under light blocking. Washed sufficiently with PBS, mounted and analyzed using a confocal scanning laser microscope.
  • DAPI PBS diluted nuclear staining reagent
  • Pork skin (0.7 mm thick, Medikinetics) was mounted between the top and bottom of the cell, and treated with 300 ⁇ l of 50 ⁇ M GFP protein on the top. After 24 hours, the pig skin was removed and washed three times with PBS. After washing, the cryo molds were treated with an OCT embedding matrix (Cell Path Ltd., UK) to freeze tissues at -70 ° C. The frozen tissues were cross-sectioned to a thickness of 7 ⁇ m at ⁇ 20 ° C. using cryotome (HM520, Germany) to prepare section slides.
  • OCT embedding matrix Cell Path Ltd., UK
  • Tissue sections fixed on slide glass in order to stain the nuclei of skin cells were placed in PBS diluted with 1/5000 nuclear staining reagent (DAPI) and stained for 10 minutes under light blocking. Washed twice. After mounting it was analyzed using a confocal scanning laser microscope.
  • DAPI nuclear staining reagent
  • 'LUT Image' is an image in which contrast is improved by using a look up table (LUT).
  • GFP protein was used to easily observe cell and skin permeability caused by STeP, but to explain that the effect of STeP is not limited to GFP, the epidermal growth factor (EGF) STeP was fused to prepare a recombinant protein expression vector.
  • EGF epidermal growth factor
  • Epidermal growth factor is a hormone that promotes cell division of epithelial cells. It is a peptide with 53 amino acid residues and has a molecular weight of 6,200 Daltons. Epithelial growth factor is a polypeptide protein with three disulfide bonds (Cys6-Cys20, Cys14-Cys31, Cys33-Cys42) that play an essential role in physiological action.
  • Epidermal growth factor is known as a factor that has the effect of proliferating epithelial cells in the body and healing them when a wound occurs.
  • Epithelial growth factor has various activities such as mitosis, cell growth, and gastric acid secretion on various cells including epithelial and mesenchymal cells, which can be used as a wound or gastric ulcer treatment for skin or cornea.
  • mitosis a factor that has the effect of proliferating epithelial cells in the body and healing them when a wound occurs.
  • epithelial growth factor has various activities such as mitosis, cell growth, and gastric acid secretion on various cells including epithelial and mesenchymal cells, which can be used as a wound or gastric ulcer treatment for skin or cornea.
  • PEP1 and STeP were fused to EGF, respectively, to compare the newly developed STeP with cell proliferation efficacy and intracellular delivery ability.
  • Human epidermal growth factor fusion protein expression vectors were prepared to prepare skin permeable human epidermal growth factor (rhEGF).
  • a protein expression vector for fusion protein expression of human epidermal growth factor and PEP1 (KETWWETWWTEWSQPKKKRKV) peptide was prepared.
  • Human epidermal growth factor was synthesized two initiators based on the cDNA sequence.
  • Sense initiator 5'-ACACTCGAGAATAGTGACTCTGAATGTC-3 'contains the XhoI restriction enzyme cleavage site and antisense initiator 5'-TGTGGATCCTTAGCGCAGTTCC-3' has the BamHI restriction enzyme cleavage site.
  • Polymerase chain reaction (PCR) was performed and the polymerase chain reaction product was linked to a TA-cloning vector.
  • cleaved oligonucleotide was linked to the pET15b vector using T4 DNA ligase (Takara, Otsu, Shiga, Japan) and transformed into E.coli DH5 cells.
  • T4 DNA ligase Takara, Otsu, Shiga, Japan
  • the pEGF vector was purified from the transformed bacteria.
  • Double chain oligonucleotides were directly subcloned into NdeI-XhoI of pEGF to produce pPEP1-EGF expressing the PEP1-EGF protein.
  • 9 is a map of a PEP1-EGF expression vector.
  • PSTeP-EGF expressing STF-fused EGF was produced by the following method. First, two oligonucleotide top chains 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3 'and the bottom chain 5'-TCGAGACGACGACGCTGACGACGTTGTTCCCCCTCGTGTTCTCCGTGT Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pEGF to produce pSTeP-EGF expressing STeP-EGF protein. 10 is a map of a STeP-EGF expression vector.
  • the protein was expressed from the recombinant vector prepared in Example.
  • a commercially available EGF was used for the purpose of comparing the efficacy and effect with cell and skin permeable EGF (PEP1-EGF, STeP-EGF), and in this example, expression and purification were not performed from the production of the vector.
  • EGF EGF on the market is about 6 kDa protein and lacks the ability to deliver to cells and skin.
  • E. coli BL21 (DE3) cells.
  • the transformed bacterial cells were cultured at 37 ° C. until the OD 600 value was 0.6 using 1,000 ml of LB medium containing empicillin, and further cultured at 37 ° C. for 8 hours by introducing 0.5 mM IPTG to PEP1. Induced expression of -EGF and STeP-EGF proteins.
  • each EGF protein was observed by harvesting cultured cells before and after induction expression of the target protein by the addition of IPTG, followed by SDS-PAGE electrophoresis, and staining the protein with Coomassie brilliant blue. .
  • PEP1-EGF was confirmed that the protein having a size of 11.9kDa, STeP-EGF 12.4kDa.
  • 11 shows expression results of EGF recombinant proteins (PEP1-EGF, STeP-EGF).
  • the cells recovered through cell culture and expression of pPEP1-EGF and pSTeP-EGF transformed cells were destroyed in a 50mM Tris buffer (50mM Tris, 0.5M NaCl, 2% Triton X-100, pH 8.0) using an ultrasonic wave. This was centrifuged to separate the inclusion body and the cytoplasm (supernatant).
  • the two EGF proteins are expressed in aggregate form, and most of the protein of interest is contained in the aggregates by centrifugation after cell disruption. Therefore, solubilization should be performed using 8M urea buffer for pure separation and purification of the target protein.
  • each of the solubilized EGF samples can be purified using a Ni 2+ -NTA affinity column (GE Healthcare, USA) using these properties. Can be.
  • the supernatant containing each EGF protein was purified by Ni 2+ -NTA affinity column (Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA). Equilibration of the column and binding of EGF protein were used in 50mM Tris buffer (50mM Tris, 8M urea, pH 8.0). Washing and elution were used to prepare imidazole by concentration in the column's equilibration and binding buffer. Purely isolated purified proteins were named PEP1-EGF and STeP-EGF, respectively.
  • Each pure purified protein was diluted 10-fold with a stirrer using refolding reduction buffer (50 mM Na 2 CO 3, 1 mM L-Cysteine, pH 9.6) and further reacted at 25 ° C. for 1 hour. Subsequently, L-cystine was added to the final 5 mM for refolding oxidation and reacted at 4 ° C. for 15 hours by a stirrer. The completed refolding solution was centrifuged to remove precipitates generated during the refolding process, and the obtained refolding supernatant was concentrated and subjected to HPLC purification.
  • refolding reduction buffer 50 mM Na 2 CO 3, 1 mM L-Cysteine, pH 9.6
  • L-cystine was added to the final 5 mM for refolding oxidation and reacted at 4 ° C. for 15 hours by a stirrer.
  • the completed refolding solution was centrifuged to remove precipitates generated during the
  • each concentrated EGF protein was acidified using 6M HCl (pH 2.7 to pH 3.0), filtered through a 0.2 ⁇ m filter, and sample preparation was performed. The first purification was performed using MPLC.
  • HPLC HPLC used water and acetonitrile (ACN) with 0.1% trifluoroacetic acid (TFA) (v / v) as the mobile phase and a column of C18 50 ⁇ 250 mm. Purity of 95% or more was obtained by using a UV detector as a gradient method of gradually increasing acetonitrile (ACN) concentration, and after concentration, dialysis was performed using a stabilization buffer (50mm Na 2 CO 3, 10% Glycerol, pH 9.6). . 12 shows the results of purification of EGF recombinant proteins (PEP1-EGF, STeP-EGF).
  • ACN acetonitrile
  • TFA trifluoroacetic acid
  • mice fibroblasts (Balb / c 3T3 clone A31 cells).
  • Mouse fibroblasts were incubated for 24 hours in growth medium and starvation for 20 hours in serum-free medium, followed by treatment with each recombinant protein for 24 hours, followed by culturing for 24 hours.
  • 100 ⁇ l of DMEM medium (growth medium) containing 10% BCS was added to 10 4 Bal / c 3T3 clone A31 cells in a 96 well plate and incubated for 24 hours, followed by transfer to 0% BCS medium (serum-free medium). He gave Starvation for an hour.
  • EGF, PEP1-EGF, STeP-EGF protein was prepared by diluting three times from the concentration of up to 90ng / ml and put into each well and treated for 24 hours.
  • the final measurement method was WST assay (Takara, Otsu, Shiga, Japan) products, the method was carried out according to the product manual, the protein treatment concentration of absorbance showing ED50 (50% effective dose) concentration to 1 unit And quantified.
  • EGF PEP1-EGF STeP-EGF Activity result (unit / mM) 6.27 ⁇ 10 6 13.90 ⁇ 10 6 14.34 ⁇ 10 6
  • Blocking tissue was treated with anti-EGF antibody (Santa cruz, green) and reacted at 4 ° C. for 18 hours. The next day, washed with PBST and then treated with Alexa Fluor 488 secondary antibody at room temperature for 2 hours, washed again with PBST. Then, the reaction was stained with Hoechst 33342 (blue) at room temperature for 10 minutes, and then sealed with a fluorescence medium and observed under a fluorescence microscope.
  • EGF was observed only in the stratum corneum, and in the case of PEP1-EGF, the epithelium was observed.
  • STeP-EGF of the present invention was confirmed that it can be delivered more efficiently into the skin than PEP1-EGF. 14 is a comparison result of skin permeability of EGF protein.
  • the present inventors synthesized a cell permeable peptide to confirm that cell permeability is improved through non-covalent binding between the cell permeable peptide and the target substance.
  • PEP1 peptide and novel cell permeable peptide STeP which are known to enhance cell permeability through non-covalent binding, were synthesized, respectively.
  • the peptide manufacturer the peptide was synthesized according to the liquid phase solidification method, and the sequence thereof is shown in Table 2 below.
  • HaCaT cells cultured in DMEM medium containing 10% FBS were aliquoted into 96-well plates at 2.5 ⁇ 10 4 and incubated for 24 hours, followed by washing twice with HBSS.
  • PEP1 and STeP which are cell permeable peptides, were dissolved in DW at concentrations of 50 ⁇ M, 100 ⁇ M, and 200 ⁇ M, respectively, and diluted in media so that the final concentrations were 2.5 ⁇ M, 5 ⁇ M, and 10 ⁇ M, and then treated with cells.
  • the reaction was carried out in 2 incubators. After incubation, the supernatant was removed and the WST solution was diluted 1: 9 in the medium and treated with the cells. After incubation for 3 hours, the absorbance value was measured at 450 nm, and cell viability was calculated by comparing cells of the non-peptide group with cells of the treated group.
  • FITC Fluorescein isothiocyanate
  • FITC and cell permeable peptides were prepared by dissolving in borax buffer (pH 8.0). Mixing is a mixture of FITC and cell permeable peptides (PEP1, STeP) in a molar ratio of 1: 0, 1: 1, 1: 2 and reacted for 30 minutes at 37 °C, the final 5 ⁇ M cell permeable peptide-FITC mixture to the cells Treated. After treating the cells with the mixture, the cells were incubated for 1 hour and 30 minutes, and then cultured for 30 minutes by adding the same amount of medium as the mixture. After 30 minutes, the medium was removed, the cells were washed with PBS, and the cells were fixed at ⁇ 20 ° C.
  • the green fluorescence was the brightest in the group treated with the STeP-FITC mixture, and was brighter at 1: 2 molar ratio than 1: 1.
  • STeP improves the intracellular permeability of FITC more than PEP1.
  • 16 is a comparison of cell permeability of the cell-penetrating peptide-FITC mixture.
  • FITC and cell permeable peptides were prepared by dissolving in borax buffer (pH 8.0). Mixing is a mixture of FITC and cell permeable peptides (PEP1, STeP) in a molar ratio of 1: 0 and 1: 2, followed by reaction at 37 ° C for 30 minutes, and 200 ⁇ l of the final 100 ⁇ M cell permeable peptide-FITC mixture on top of the Franz cell. It was. After 24 hours, the pig skin was removed and washed three times with PBS. After washing, the cryo mold was treated with an OCT embedding matrix (Cell Path Ltd., UK) to freeze the tissue at -70 ° C.
  • OCT embedding matrix Cell Path Ltd., UK
  • Frozen tissues were cross-sectioned to 7 ⁇ m thickness at ⁇ 20 ° C. using cryotome (HM520, Germany) to make section slides.
  • tissue sections fixed on slide glass were placed in PBS, diluted with 1/5000 nuclear staining reagent (DAPI), stained for 10 minutes under light blocking, and then stained with PBS. Washed twice. After mounting, the analysis was performed using a confocal scanning laser microscope.
  • DAPI nuclear staining reagent
  • FITC was found in the stratum corneum of porcine skin, while the STeP-FITC mixture of the present invention could be efficiently delivered into the skin. 17 is a comparison result of skin permeability of the cell permeable peptide-FITC mixture.
  • the present invention by confirming that the physiological activity through skin permeation is increased by using a peptide having a skin physiological activity, it was intended to prove that the present invention can be used as a cosmetic raw material having an effect of improving wrinkles.
  • DDBD Dipeptide Diaminobutyroyl Benzylamide Diacetate (trade name: SYN-AKE), which is known to help improve wrinkles by preventing signals of muscle contraction, was used.
  • DDBD is a peptide synthesized by mimicking a snake venom called Waglerin 1.
  • FITC-linked FITC fusion DDBD (FITC-DDBD) was synthesized.
  • FITC-DDBD FITC-linked FITC fusion DDBD
  • BALB / 3T3 cells were incubated for 24 hours on a culture slide. Thereafter, the culture medium (DMEM + 10% BCS, 1% antibiotics) was removed, washed three times with HBSS, and treated with a mixture of STeP and FITC-DDBD. In the mixing, FITC-DDBD and STeP were mixed at a molar ratio of 1: 5, and then reacted at room temperature for 10 minutes, and the final 10 uM FITC-DDBD was treated to cells. After 60 minutes, the medium was removed, the cells were washed with HBSS, and the cells were fixed at ⁇ 20 ° C. for 10 minutes using cold methanol. Cells were sufficiently washed with PBS, and then stained with PBS diluted nuclear staining reagent (DAPI) for 10 minutes under light blocking. Washed sufficiently with PBS, mounted and analyzed using a confocal scanning laser microscope.
  • DAPI PBS diluted nuclear staining reagent
  • FGF2 Fibroblast growth factor-2, a basic fibroblast growth factor
  • FGF2 FGF2
  • FGF2 is known to stimulate keratinocytes and fibroblasts, which make up the skin, and restore skin regeneration and healthy skin condition.
  • FGF2 is difficult to penetrate into the skin because it is a polymer hydrophilic substance.
  • FGF2 and PEP1-FGF2 and STeP and FGF2 mixtures were treated in Franz cells using Porcine skin. After 24 hours, the pig skin between the Franz cells was taken out and washed in distilled water, followed by tissue staining. Porcine skin exposed to donor cells was cut and fixed in 10% buffered formalin, and then paraffin blocks were prepared. Tissues were prepared at 7 ⁇ m using a microtome. Was sectioned. Thereafter, the tissue was mounted on the slide and then paraffin was removed, and after hydration, the tissue sections were blocked for 30 minutes.
  • Blocking tissue was treated with anti-FGF2 antibody (Cell signaling, green) and reacted for 18 hours at 4 °C. The next day, the cells were washed with PBST and then treated with Alexa Fluor 488 secondary antibody at room temperature for 2 hours, and washed again with PBST. Subsequently, the tissue sections were put in nuclear staining reagent (DAPI) diluted to 1/5000 in PBS, stained for 10 minutes in a light-blocked state and washed three times with PBS. After mounting it was analyzed using a confocal scanning laser microscope.
  • DAPI nuclear staining reagent

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Birds (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Dermatology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Geometry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드인 신규의 프로테인 트랜스덕션 도메인 (PTD; Protein transduction domain) 및 그 용도에 관한 것으로, 본 발명의 서열번호 1에 기재된 펩타이드를 PTD로써 사용할 경우, 단백질, 펩타이드, DNA 등 생물학적 분자 (목적 물질)를 세포 내로 용이하게 고수율로 도입시킬 수 있는 장점이 있다.

Description

신규의 프로테인 트랜스덕션 도메인 및 이의 용도
본 발명은 신규의 프로테인 트랜스덕션 도메인 및 그 용도에 관한 것으로, 더욱 상세하게는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드인 신규의 프로테인 트랜스덕션 도메인 (PTD; Protein transduction domain) 및 그 용도에 관한 것이다.
PTD (Protein transduction domain)는 펩타이드, 단백질, DNA 등의 전달에 유용한 펩타이드로써, 5~30개의 아미노산 서열로 이루어져 있다. PTD는 투과시키고자 하는 생물학적 분자 (목적 물질)과의 융합이 간편하고, 생물학적 분자의 구조 또는 기능에 영향을 끼치지 않아 안정적이기 때문에, 화장품, 의약품 등에서 최근 각광받고 있다.
PTD 계열 중, HIV에서 유래된 TAT 단백질의 48~60번 아미노산 서열은 세포투과 서열을 가지고 있는 것으로 처음 알려졌고, 다양한 생물학적 물질들을 세포 내로 전달할 수 있었다. 그 후, 세포 내 투과 과정의 기전이 밝혀지면서 음전하를 띠는 세포막에 잘 붙을 수 있는 양이온 계열의 서열들이 많이 제조되기 시작했다.
현재까지 알려진 PTD는 크게 3가지로 나뉠 수 있는데, (i) 양친매성 펩타이드(transportan, PEP1, MPG, pVEC, MAP, CADY), (ii) 양이온 펩타이드(polyarginine, TAT, penetratin, P22N) 및 (iii) 소수성 펩타이드(K-FGF, C105Y)이다. 양친매성과 양이온 펩타이드는 비교적 많이 알려져 있으나, 소수성 펩타이드는 서열들의 인위적 합성으로 만들어진 것이 아니라서 현재까지 알려진 펩타이드의 수가 매우 제한적이다.
PTD는 생물학적 분자들이 통과하지 못하는 세포투과를 할 수 있는데, 이는 세포막의 글라이코사미노글라이칸(glycosaminoglycan, GAG)을 통해 세포 내로 들어갈 수 있는 것이며, 그 외 엔도사이토시스 경로를 통해 유입될 수도 있다.
PTD와 생물학적 물질(예컨대, siRNA, 핵산, 작은 분자, 단백질, 세포독성 약물, 이미징제 등) 간의 결합은 공유결합, 이온결합, 정전기적 인력 등을 포함하는 다양한 수단을 통해 이루어질 수 있다.
기존의 전달체(예컨대, 리포좀, 폴리머 등)와 비교하여, PTD의 중요한 장점은, 치료 목적이나 진단용으로 세포 내에 생물학적 분자들을 전달하고자 할 때, 낮은 독성과 치료에 대한 면역거부반응이 적다는 것이다. 이를 통해, 고농도의 처리 방법에 따른 문제점을 단계적인 처리기법으로 개선할 수 있기도 하다.
그럼에도 불구하고 현재 임상에서 사용되는 PTD는 아직까지 극히 드물고, 바이러스에서 유래된 PTD의 경우, 면역반응에 영향을 미치는 등의 문제점을 지니고 있어, 바이러스에서 유래되지 않으면서 전달 효율이 높은 전달체 발굴이 당업계에서 시급히 요구되고 있다.
본 발명에서는 목적 물질의 전달 효율이 높으면서도 여러 부작용의 발생이 현저히 저감된 새로운 PTD (Protein transduction domain)를 개발하여 제공하고자 한다.
본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 제공한다. 이때, 상기 서열번호 1의 아미노산 서열은, 바람직하게 서열번호 2에 기재된 핵산 서열로 암호화되는 것일 수 있다. 또한, 상기 펩타이드는 일 예로, 프로테인 트랜스덕션 도메인 (Protein Transduction Domain, PTD)일 수 있다. 또한, 상기 펩타이드는 일 예로, 유전자 전달체인 것일 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 화학결합되어 형성된 결합체를 제공한다. 이때, 상기 화학결합은 바람직하게 공유결합 또는 비공유결합일 수 있다. 상기 공유결합될 수 있는 물질은, 일 예로 펩타이드 또는 단백질일 수 있다. 또한, 상기 비공유결합은 일 예로, 이온결합 또는 정전기적 인력에 의한 결합 또는 소수성 상호작용 (hydrophobic interaction)에 의한 결합일 수 있다. 또한, 상기 이온결합 또는 정전기적 인력으로 결합될 수 있는 물질은 일 예로, 전하를 띄고 있는 물질일 수 있고, 상기 전하를 띄고 있는 물질은, 일 예로 DNA 또는 RNA일 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체를 제공한다. 이때, 상기 정전기적 인력으로 결합될 수 있는 물질은 일 예로, 전하를 띄고 있는 물질일 수 있고, 상기 전하를 띄고 있는 물질은 일 예로, DNA 또는 RNA일 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합되어 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체를 포함하는 화장료 조성물을 제공한다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합하여 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체를 포함하는 약학 조성물을 제공한다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질에 결합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법을 제공한다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 혼합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법을 제공한다.
본 발명의 서열번호 1에 기재된 펩타이드를 PTD로써 사용할 경우, 단백질, 펩타이드, DNA 등 생물학적 분자 (목적 물질)를 세포 내로 용이하게 고수율로 도입시킬 수 있는 장점이 있다.
도 1은 일반적인 GFP 발현 벡터의 맵이다.
도 2는 TAT-GFP 발현 벡터의 맵이다.
도 3은 PEP1-GFP 발현 벡터의 맵이다.
도 4는 STeP-GFP 발현 벡터의 맵이다.
도 5는 GFP 재조합 단백질의 발현 결과이다.
도 6은 GFP 재조합 단백질의 정제 결과이다.
도 7은 GFP 단백질의 세포 투과력 비교 결과이다.
도 8은 GFP 단백질의 피부 투과력 비교 결과이다.
도 9는 PEP1-EGF 발현 벡터의 맵이다.
도 10은 STeP-EGF 발현 벡터의 맵이다.
도 11은 EGF 재조합 단백질 (PEP1-EGF, STeP-EGF)의 발현 결과이다.
도 12는 EGF 재조합 단백질 (PEP1-EGF, STeP-EGF)의 정제 결과이다.
도 13은 EGF 재조합 단백질의 세포 증식 효능 결과 (EGF, PEP1-EGF, STeP-EGF)이다.
도 14는 EGF 단백질의 피부 투과력 비교 결과이다.
도 15는 세포투과성 펩타이드의 세포 독성 확인 결과이다.
도 16은 세포투과성 펩타이드-FITC 혼합물의 '세포' 투과력 비교 결과이다.
도 17은 세포투과성 펩타이드-FITC 혼합물의 '피부' 투과력 비교 결과이다.
도 18은 세포투과성 펩타이드와 FITC-DDBD 혼합물의 '세포' 투과력 비교 결과이다.
도 19는 세포투과성 펩타이드와 FGF2 혼합물의 피부 투과력 비교 결과이다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 목적 물질을 세포 내로 전달할 수 있는 보다 효율적인 펩타이드 및 이를 이용한 약물전달체(drug delivery system)를 개발하고자 노력한 결과, 서열번호 1에 기재된 세포투과 펩타이드를 개발하였다.
서열번호 1에 기재된 펩타이드는 양친매성 특성을 띄며, 목적 물질의 세포 내 전달에 효율적으로 적용될 수 있는 것이 확인됨으로써, 본 발명이 완성되었다.
이와 같은 결과로부터 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 제공한다. 이때, 상기 서열번호 1의 아미노산 서열은, 바람직하게 서열번호 2에 기재된 핵산 서열로 암호화되는 것일 수 있다. 또한, 필요 목적에 따라, 본 아미노산 서열의 N-말단 또는 C-말단에 필요 목적의 구현을 위한 펩타이드를 결합시킬 수도 있다.
본 발명의 서열번호 1에 기재된 펩타이드는 프로테인 트랜스덕션 도메인 (Protein Transduction Domain, PTD) 또는 유전자 전달체로 사용될 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이, 서열번호 1에 기재된 아미노산 서열에 화학결합되어 형성된 결합체를 제공한다.
'화학결합'이라 함은 일체의 화학적 결합을 모두 포함하는 개념이며, 일 예로 공유결합 또는 비공유결합일 수 있다. 공유결합은 일 예로 본 발명의 서열번호 1에 기재된 아미노산 서열의 N-말단 또는 C-말단에 펩티드 결합을 통해 목적 물질 (세포 또는 피부 내로의 도입 대상 물질)이 될 수 있음을 의미한다. 이때, 목적 물질은 세포 내에서 특정 목적, 예를 들어 피부미용적 효능을 발휘하는 펩타이드 또는 단백질일 수 있으며, 의약적 효능을 발휘하는 펩타이드 또는 단백질일 수 있다. 펩타이드의 예로는, Dipeptide Diaminobutyroyl Benzylamide Diacetate (상품명: SYN-AKE), Acetyl hexapeptide-8 (상품명: Argireline) 등이 있을 수 있다. 단백질의 예로는, EGF(Epidermis growth factor), FGF1(Fibroblast growth factor-1), FGF2(Fibroblast growth factor-2), SOD1(Superoxide dismutase-1), CAT(Catalase), (FK506bp: FK506-binding protein), BonT/A Light chain(Botulinum neurotoxin type A light chain) 등이 있을 수 있다.
한편, 본 발명의 결합체에 있어서, 상기 비공유결합은 일 예로, 이온결합 또는 정전기적 인력에 의한 결합 또는 소수성 상호작용 (hydrophobic interaction)일 수 있다. 이온결합 또는 정전기적 인력 또는 소수성 상호작용에 의해 여러 생물학적 물질(예컨대, siRNA, 핵산, 작은 분자, 단백질, 세포독성 약물, 이미징제 등)이 본 발명의 서열번호 1에 기재된 펩타이드에 결합되어 세포 또는 피부 내로 도입될 수 있는 것이다. 상기 이온결합 또는 정전기적 인력으로 결합될 수 있는 물질은 일 예로, 전하를 띄고 있는 물질일 수 있는데, 일 예로 DNA 또는 RNA일 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 서열번호 1에 기재된 아미노산 서열이 혼합되어 있는 복합체를 제공한다. 본 발명에 의할 경우, 인위적인 화학결합을 유도하지 않고, 혼합시키는 것 만에 의해서도, 본 발명의 서열번호 1에 기재된 펩타이드와 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합할 수 있는 목적 물질이 본 발명의 서열번호 1에 기재된 펩타이드와 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합하여, 세포 내 또는 피부 내로 도입될 수 있음이 확인되었다. 이때, 상기 정전기적 인력으로 결합될 수 있는 물질은 일 예로, 전하를 띄고 있는 물질일 수 있고, 상기 전하를 띄고 있는 물질은 일 예로, DNA 또는 RNA일 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합되어 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 서열번호 1에 기재된 아미노산 서열이 혼합되어 있는 복합체를 포함하는 화장료 조성물을 제공한다. 하기 본 발명의 실험에 의할 경우, 본 발명의 결합체 또는 복합체로 제조될 경우, 피부 침투 효과가 우수함이 확인되었다.
본 발명의 화장료 조성물은 특정의 형태(제형)에 국한되지 않고, 모든 제형을 다 포함하는데, 일 예로 화장수, 젤, 수용성 리퀴드, 크림, 에센스, 수중유(O/W)형 및 유중수(W/O)형의 에멀젼, 연고로 이루어진 기초화장료 제형, 수중유형 및 유중수형 메이크업베이스, 파운데이션, 스킨커버, 립스틱, 립그로스, 페이스파우더, 투웨이케익, 아이새도, 치크칼라 및 아이브로우 펜슬류로 이루어진 색조화장료 제형 중에서 선택되는 어느 하나인 것이 좋다.
또한, 본 발명의 화장료 조성물은 화장 분야에서 통상적인 보조제 예컨대 친수성 또는 친유성 겔화제, 친수성 또는 친유성 활성제, 보존제, 항산화제, 용매, 방향제, 충전제, 차단제, 안료, 흡취제 및 염료를 함유할 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합하여 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 서열번호 1에 기재된 아미노산 서열이 혼합되어 있는 복합체를 포함하는 약학 조성물을 제공한다.
본 발명의 약학 조성물은 특정의 제형으로 반드시 한정되는 것이 아닌 모든 제형을 포함하며, 구체적인 제형의 예로는 경고제(PLASTERS), 과립제(GRANULES), 로션제(LOTIONS), 리니멘트제(LINIMENTS), 리모나데제(LEMONADES), 방향수제(AROMATIC WATERS), 산제(POWDERS), 시럽제(SYRUPS), 안연고제(OPHTHALMIC OINTMENTS), 액제(LIQUIDS AND SOLUTIONS), 에어로솔제(AEROSOLS), 엑스제(EXTRACTS), 엘릭실제(ELIXIRS), 연고제(OINTMENTS), 유동엑스제(FLUIDEXTRACTS), 유제(EMULSIONS), 현탁제(SUSPENSIONS), 전제(DECOCTIONS), 침제(INFUSIONS), 점안제(OPHTHALMIC SOLUTIONS), 정제(TABLETS), 좌제(SUPPOSITORIES), 주사제(INJECTIONS), 주정제(SPIRITS), 카타플라스마제(CATAPLSMA), 캅셀제(CAPSULES), 크림제(CREAMS), 트로키제(TROCHES), 틴크제(TINCTURES), 파스타제(PASTES), 환제(PILLS), 연질 또는 경질 젤라틴 캅셀 중 선택되는 어느 하나일 수 있다.
또한, 본 발명의 약학 조성물은 바람직하게 약제학적으로 허용 가능한 담체, 희석제 또는 부형제를 더욱 포함할 수 있다. 사용가능한 담체, 부형제 또는 희석제로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자이리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유가 있으며, 이중 선택되는 하나 이상을 사용할 수 있다.
한편, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질에 결합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법을 제공한다.
또한, 본 발명은 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 혼합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법을 제공한다.
본 발명의 방법을 통해, 세포 내로 도입시키고자 하는 목적 물질을 용이하게 고수율로 세포 내로 도입시킬 수 있다. 이때, 본 발명의 서열번호 1에 아미노산 서열을 갖는 펩타이드를 사용하는 것 외에 목적 물질의 세포 내 도입을 위해 필요한 기술은 당업계의 공지 기술을 사용할 수 있다.
이상과 같이 본 발명은, 서열번호 1에 기재된 27개의 아미노산 서열로 구성된 펩타이드를 통해 세포투과가 가능하며, 단백질 및 유전자를 전달할 수 있는 것을 제시한다. 또한, 전달물질의 위치에 따라 그 효율이 달라지므로, 본 발명은 PTD를 이용한 물질전달에 효과적인 방법을 제시하는 기초적인 자료가 될 수도 있을 것이다. 또한, 본 발명의 서열번호 1에 기재된 펩타이드는 단순한 혼합으로도 물질을 전달할 수 있는 장점을 지니고 있어, 전달체로서 유용하게 사용될 것이다.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 일 구현예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
[실시예 1. 세포 및 피부 투과성 GFP 단백질 발현 벡터의 제작]
거대 분자 단백질 또는 펩타이드를 세포 및 피부 내로 용이하게 전달할 수 있도록 하기 위하여 세포 및 피부 투과능을 갖는 펩타이드와 전달하고자 하는 단백질(cargo)을 융합하여 재조합 단백질 발현 벡터를 제조하였다.
본 실시예에서는 이러한 융합 단백질이 얼마나 세포 및 피부에 전달될 수 있는지의 전달 능력을 용이하게 분석하기 위하여 전달하고자 하는 목적 단백질(cargo)로써, 녹색 형광 단백질(Green Fluorescence Protein: 이하“GFP”라 약칭함)을 선택하였다.
기존에 잘 알려진 PTD인 TAT 또는 PEP1을 GFP에 융합하여, 본 발명에서 신규로 개발된 STeP (서열번호 1)와 세포 및 피부 내 전달 능력을 비교하고자 하였다.
(1) pGFP 벡터 제작
GFP의 염기서열에 해당하는 DNA 절편을 플라스미드 pET15b의 XhoI, BamHI 자리에 서브클론하여 GFP 단백질을 발현시키는 pGFP를 제조하였다. pGFP 발현 벡터에는 세포 및 피부투과능을 갖는 펩타이드가 융합되지 않았고, GFP는 약 29kDa의 친수성 고분자 단백질이기 때문에, 이 벡터에서 발현된 GFP는 세포 및 피부에 전달할 수 있는 능력이 없다고 할 수 있다. 따라서, 세포 및 피부 투과성 비교를 위한 대조군으로써 제작한 것이다.
GFP의 염기서열에 해당하는 DNA 절편을 플라스미드 pEGFP-C2(클론텍)를 이용하여 Pfu DNA 중합효소로 중합효소 연쇄반응(PCR)시켜 GFP의 완전한 서열을 증폭하였다. 정방향 개시체(sense primer)는 5'- CTCGAGGTGAGCAAGGGCGAGGAGCTG-3'이고, 역방향 개시체(antisense primer)의 서열은 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3'이다. PCR산물은 Xho I- Bam HI으로 잘리며, pET15b(Invitrogen, Carlsbad, CA)의 XhoI - BamHI 자리에 서브클론되어 일반적인 GFP 단백질을 발현시키는 pGFP를 제조하였다. 도 1은 일반적인 GFP 발현 벡터의 맵이다.
(2) pTAT-GFP 벡터 제작
HIV-1 TAT와 융합된 GFP를 발현시키는 pTAT-GFP는 다음의 방법으로 제작하였다. 첫째, 두 개의 올리고뉴클레오타이드가 제조되어 HIV-1 TAT의 9개의 아미노산을 코딩하는 이중사슬 올리고뉴클레오타이드로 합성되었다. HIV-1 TAT의 9개 아미노산을 코딩하는 서열은 위쪽 사슬 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3'과 아래쪽 사슬 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'이다. 이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 TAT-GFP 단백질을 발현시키는 pTAT-GFP를 제작하였다. 도 2는 TAT-GFP 발현 벡터의 맵이다.
(3) pPEP1-GFP 벡터 제작
PEP1이 융합된 GFP를 발현시키는 pPEP1-GFP는 다음의 방법으로 제작하였다. 첫째, 두 개의 올리고뉴클레오타이드 위쪽사슬 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAAAACGTAAAGTGC-3'과 아래쪽 사슬 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'이 합성되어 PEP1 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다.
이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 PEP1-GFP 단백질을 발현시키는 pPEP1-GFP를 제작하였다. 도 3은 PEP1-GFP 발현 벡터의 맵이다.
(4) pSTeP-GFP 벡터 제작
본 발명의 STeP이 융합된 GFP를 발현시키는 pSTeP-GFP는 다음의 방법으로 제작하였다. 첫째, 두 개의 올리고뉴클레오타이드 위쪽사슬 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3'과 아래쪽 사슬 5'- TCGAGACGACGACGCTGACGACGTTTTTTACGGCCATACGGCTGGGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'이 합성되어 STeP 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다. 이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 STeP-GFP 단백질을 발현시키는 pSTeP-GFP를 제작하였다. 도 4는 STeP-GFP 발현 벡터의 맵이다.
[실시예 2. GFP 재조합 단백질의 발현]
본 실시예에서는 상기 실시예에서 제작된 재조합 벡터들로부터 해당 단백질을 발현하고자 하였다. 네 종류의 발현 벡터들을 각각 E. coli Rosetta-gami 2(DE3) 세포 내로 형질 전환시켰다. 형질 전환된 박테리아 세포는 엠피실린이 포함된 1,000ml의 LB배지를 이용하여 OD600 값이 0.6이 될 때까지 37℃에서 배양하였고, 22℃에서 0.5mM IPTG를 도입하여 24시간 동안 추가 배양하여 GFP 단백질의 발현을 유도하였다.
각각의 GFP 단백질 발현 유무 확인은 IPTG의 첨가에 의한 목적 단백질의 유도 발현 전과 후의 배양 세포들을 수확하여 SDS-PAGE 전기영동을 한 뒤, 쿠마시 브릴리언트블루 (Coomassie brilliant blue)로 단백질을 염색하여 관찰하였다.
그 결과, 도 5에서 확인되는 바와 같이, GFP는 29.35kDa, TAT-GFP는 30.54kDa, PEP1-GFP는 32.18kDa, STeP-GFP는 32.95kDa의 크기를 가지는 단백질이 발현됨을 확인할 수 있었다. 도 5는 GFP 재조합 단백질의 발현 결과이다.
[실시예 3. GFP 재조합 단백질의 정제]
본 실시예에서는 상기 실시예에서 각각 발현된 단백질에 대하여 세포 파쇄 공정 실시 후, His tag 친화 컬럼을 이용하여 GFP 단백질만을 순수 분리 정제하고자 하였다. 4가지 GFP 단백질의 정제 방법은 아래와 같이 동일한 방법을 이용하여 정제하였다.
pET15-GFP, pTAT-GFP, pPEP1-GFP, pSTeP-GFP 형질 전환 세포를 1X Native 완충액(50mM NaPO4, 0.5M NaCl)에서 초음파기를 이용하여 파괴한 후, 이것을 원심분리하여 응집체(inclusion body)와 세포질(상청액)로 분리하였다.
4가지 GFP 단백질에는 모두 His6 태깅되어(tagging) 있으므로 이러한 특성을 이용하여 세포 파쇄 후 원심분리에 의해 분리된 각각의 상청액을 Ni2+-NTA 친화 컬럼(Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA)으로 정제하였다.
컬럼의 평형 및 GFP 단백질의 결합은 1X Native 완충액을 사용하였으며, 세척(Washing)과 용출(Elution)은 1X Native 완충액에 농도별 이미다졸(Imidazole)을 제조하여 사용하였다. 순수 분리 정제된 GFP 단백질은 안정화 버퍼 (50mm NaPO4, 0.1M NaCl, 10% Glycerol, pH 7.5)를 이용하여 투석을 실시하였다. 여기서 얻어진 최종 산물을 각각 GFP, Tat-GFP, PEP1-GFP, STeP-GFP라 명명하였다. 도 6은 GFP 재조합 단백질의 정제 결과이다.
[실시예 4. 세포 및 피부 투과성 GFP 단백질의 세포 투과 분석]
본 실시예에서는 상기 실시예에서 정제된 4가지의 GFP 단백질의 세포 투과 능력을 비교하고자 HaCaT(human keratinocyte) 세포에서 GFP 녹색 형광을 이용한 세포 내 투과를 관찰하였다.
HaCaT(human keratinocyte) 세포는 배양용 슬라이드에서 24시간 동안 배양하였다. 그 후 배양 배지를 제거한 후, HBSS로 3회 세척 후 GFP 및 세포투과성 GFP 단백질(PEP1-GFP, TAT-GFP, STeP-GFP)을 세포에 처리하였다. 세포에 처리 시 각각의 단백질의 농도가 10mM이 되도록 스탁(stock)을 만들어 배지에 1/10로 희석하여 최종 10μM이 되도록 처리한 후 2시간 동안 배양하였다. 2시간 뒤 배지를 제거하고 PBS를 이용하여 세포를 세척한 후, 냉각 메탄올을 이용하여 10분간 -20℃에서 세포를 고정하였다. 세포는 PBS로 충분히 세척한 뒤 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색시켰다. PBS로 충분히 세척하고, 마운팅(mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
그 결과, STeP-GFP 단백질 처리 그룹의 세포 내 녹색 형광이 가장 밝게 보이는 것으로 보아, STeP가 세포 내 투과 효과를 크게 향상시켜줌을 알 수 있었다. 도 7은 GFP 단백질의 세포 투과력 비교 결과이다.
[실시예 5. 세포 및 피부 투과성 GFP 단백질의 피부 투과 분석]
세포뿐만 아니라 피부에서도 STeP에 의해 GFP 단백질의 투과가 향상되는지 알아보기 위해, 프란츠 셀(Franz cell, 직경 9mm)을 이용하였다.
셀의 상단과 하단 사이에 돼지 피부(0.7mm 두께, Medikinetics)를 장착하고, 그 상단에 50μM GFP 단백질을 300μl 처리하였다. 24시간 후, 돼지 피부를 빼낸 뒤 PBS로 3회 세척하였다. 세척 후, 크라이요 몰드 (cryo mold)에 OCT 임베딩 매트릭스 (OCT embedding matrix, Cell Path Ltd., UK)를 처리하여 조직을 -70℃에서 동결하였다. 동결 조직은 크라이요톰(cryotome, HM520, Germany)을 이용하여 -20℃에서 7 μm의 두께로 크로스 섹션 (cross-section)하여 절편 슬라이드를 제작하였다. 피부 세포의 핵을 염색하기 위하여 슬라이드 글라스 (slide glass)에 고정시킨 조직 절편은 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)을 넣고 빛이 차단된 상태에서 10분간 염색한 후 PBS로 3회 세척하였다. 마운팅(mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
실험결과, GFP는 돼지 피부 조직 내로 전혀 전달되지 않음에 반해, 본 발명의 STeP-GFP는 피부 내로 효율적으로 전달이 가능함을 확인할 수 있었다. 도 8은 GFP 단백질의 피부 투과력 비교 결과이다. 도 8에서 'LUT Image'는 LUT(Look Up Table)을 이용하여 명암 대비를 향상시킨 이미지이다.
[실시예 6. 세포 및 피부 투과성 EGF 단백질 발현 벡터의 제작]
STeP에 의한 세포 및 피부 투과능을 용이하게 관찰하기 위해 GFP 단백질을 이용하였으나, STeP의 효과가 GFP에 국한된 것이 아님을 설명하기 위하여 또 다른 실시예로 상피세포 성장인자(Epidermal Growth factor, EGF)에 STeP을 융합하여 재조합 단백질 발현 벡터를 제조하였다.
상피세포 성장인자는 상피세포의 세포분열을 촉진하는 호르몬으로 53개의 아미노산 잔기를 가진 펩타이드이며, 분자량은 6,200달톤이다. 상피세포 성장 인자는 생리적인 작용에 있어서 필수적인 역할을 하는 세 개의 황 결합(disulfide bonds: Cys6-Cys20, Cys14-Cys31, Cys33-Cys42)을 가진 폴리펩타이드 단백질이다.
상피세포 성장인자는 체내에서 상피세포의 증식 그리고 상처가 생겼을 때 이를 치유하는 작용을 가지는 인자로 알려져 있다. 상피세포 성장인자는 상피세포와 간엽(messenchymal) 세포를 포함한 각종 세포들에 대해 유사분열 촉진, 세포성장 촉진 및 위산분비 억제 등의 활성이 있어 피부 또는 각막의 상처 치료제 또는 위궤양 치료제로 사용할 수 있는 것으로 알려져 있다.
PEP1과 STeP을 각각 EGF에 융합하여, 신규 개발된 STeP과 세포 증식 효능 및 피부 내 전달 능력을 비교하고자 하였다.
(1) pPEP1-EGF 벡터 제작
피부 투과성 인간 상피세포 성장인자 (human Epidermal Growth Factor ; rhEGF)를 제조하기 위하여 인간 상피 세포 성장인자 융합 단백질 발현 벡터를 제조하였다.
인간 상피세포 성장인자와 PEP1 (KETWWETWWTEWSQPKKKRKV) 펩타이드의 융합 단백질 발현을 위한 단백질 발현벡터가 제조되었다. 인간 상피세포 성장인자는 cDNA 서열에 기초하여 두 개의 개시체가 합성되었다. 센스 개시체 5'-ACACTCGAGAATAGTGACTCTGAATGTC-3'는 XhoⅠ 제한효소 절단부위를 함유하고, 안티센스 개시체 5'-TGTGGATCCTTAGCGCAGTTCC-3'는 BamHⅠ제한효소 절단부위를 가진다. 중합효소 체인반응(PCR)이 수행되고 중합효소 체인반응 생성물을 TA-클로닝 벡터에 연결하였다. 그 후 XhoⅠ과 BamHⅠ으로 절단하고, 절단된 올리고뉴클레오타이드를 용출시켰다(Invitek, Berlin,German). T4 DNA 리가아제(Takara, Otsu, Shiga, Japan)를 이용하여 상기 절단된 올리고 뉴클레오타이드를 pET15b 벡터에 연결하고, E.coli DH5 세포에 형질전환시켰다. 형질 전환된 박테리아로부터 pEGF벡터를 정제하였다.
위쪽 사슬 5'-GGGGAATTCCATATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCTCAGCCGAAAAAAAAACGTAAAGTGCCTCGAGTATAT-3'과 아래쪽 사슬 (bottom strand) 5'-ATATACTCGAGGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCATATGGAATTCCCC-3'을 합성하고, 이를 어닐 (anneal)하여 Pep-1 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다. 이중사슬 올리고뉴클레오타이드는 직접 pEGF의 NdeI - XhoI으로 서브클론되어 PEP1-EGF 단백질을 발현시키는 pPEP1-EGF를 제작하였다. 도 9는 PEP1-EGF 발현 벡터의 맵이다.
(2) pSTeP-EGF 벡터 제작
STeP이 융합된 EGF를 발현시키는 pSTeP-EGF는 다음의 방법으로 제작하였다. 첫째, 두 개의 올리고뉴클레오타이드 위쪽사슬 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3'과 아래쪽 사슬 5'- TCGAGACGACGACGCTGACGACGTTTTTTACGGCCATACGGCTGGGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'이 합성되어 STeP 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다. 이중사슬 올리고뉴클레오타이드는 직접 pEGF의 NdeI - XhoI으로 서브클론되어 STeP-EGF 단백질을 발현시키는 pSTeP-EGF를 제작하였다. 도 10은 STeP-EGF 발현 벡터의 맵이다.
[실시예 7. EGF 재조합 단백질의 발현 (PEP1-EGF, STeP-EGF)]
본 실시예에서는 상기 실시예에서 제작된 재조합 벡터로부터 해당 단백질을 발현하고자 하였다. 세포 및 피부 투과성 EGF(PEP1-EGF, STeP-EGF)와의 효능 및 효과 비교를 목적으로 시중에 판매되고 있는 일반 EGF를 사용하였으며, 본 실시예에서는 벡터의 제작부터 발현, 정제는 실시하지 않았다. 시중에 판매되고 있는 일반 EGF는 약 6kDa의 단백질로서 세포 및 피부에 전달할 수 있는 능력이 없다.
두 종류의 발현 벡터들을 각각 E. coli BL21(DE3) 세포 내로 형질 전환시켰다. 형질 전환된 박테리아 세포는 엠피실린이 포함된 1,000ml의 LB배지를 이용하여 OD600 값이 0.6이 될 때까지 37℃에서 배양하였고, 0.5mM IPTG를 도입하여 8시간 동안 37℃에서 추가 배양하여 PEP1-EGF 및 STeP-EGF 단백질의 발현을 유도하였다.
각각의 EGF 단백질 발현 유무 확인은 IPTG의 첨가에 의한 목적 단백질의 유도 발현 전과 후의 배양 세포들을 수확하여 SDS-PAGE 전기 영동을 한 뒤, 쿠마시 브릴리언트 블루 (Coomassie brilliant blue)로 단백질을 염색하여 관찰하였다.
그 결과, 도 11에서 확인되는 바와 같이, PEP1-EGF는 11.9kDa, STeP-EGF는 12.4kDa의 크기를 가지는 단백질이 발현됨을 확인할 수 있었다. 도 11은 EGF 재조합 단백질(PEP1-EGF, STeP-EGF)의 발현 결과이다.
[실시예 8. EGF 재조합 단백질의 순수 분리 정제 (PEP1-EGF, STeP-EGF)]
본 실시예에서는 상기 실시예에서 각각 발현된 단백질에 대하여 세포 파쇄 공정 실시 후, His tag 친화 컬럼을 이용하여 목적하고자 하는 PEP1-EGF 및 STeP-EGF 단백질만을 순수 분리 정제하고자 하였다. 2가지 EGF 단백질의 정제 방법은 아래와 같이 동일한 방법을 이용하여 정제하였다.
pPEP1-EGF, pSTeP-EGF 형질 전환 세포를 세포 배양 및 발현을 통해 회수된 균체를 50mM Tris 완충액(50mM Tris, 0.5M NaCl, 2% Triton X-100, pH 8.0)에서 초음파기를 이용하여 파괴한 후, 이것을 원심분리하여 응집체(inclusion body)와 세포질(상청액)로 분리하였다.
2가지 EGF 단백질은 응집체 형태로 발현되며 세포 파쇄 후 원심분리에 의해 목적 단백질의 대부분이 응집체에 포함되어 있다. 따라서 목적 단백질의 순수 분리 정제를 위하여 8M 우레아 완충액을 이용하여 가용화(solubilization)를 시켜야 한다.
또한, 2가지 EGF 단백질에는 모두 His6 태깅(tagging) 되어 있으므로 이러한 특성을 이용하여 가용화된 각각의 EGF 시료를 Ni2+-NTA 친화 컬럼(Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA)으로 정제할 수 있다.
세포 파쇄 후 원심분리에 의하여 회수된 각각의 응집체는 8M 우레아가 있는 50mM Tris 완충액(50mM Tris, 8M urea, pH 8.0)에 의해 가용화시켰으며, 원심 분리하여 가용화되지 않는 불순물과 각각의 EGF 단백질이 함유된 상청액으로 분리하였다.
각각의 EGF 단백질이 함유된 상청액은 Ni2+-NTA 친화 컬럼(Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA)으로 정제를 실시하였다. 컬럼의 평형 및 EGF 단백질의 결합은 50mM Tris 완충액(50mM Tris, 8M urea, pH 8.0)을 사용하였으며, 세척과 용출은 컬럼의 평형 및 결합 완충액에 농도별 이미다졸(Imidazole)을 제조하여 사용하였다. 순수 분리 정제된 단백질은 각각 PEP1-EGF, STeP-EGF라 명명하였다.
[실시예 9. EGF 재조합 단백질의 리폴딩 및 HPLC 정제 (PEP1-EGF, STeP-EGF)]
순수 분리 정제된 2가지의 단백질은 활성을 갖도록 리폴딩 공정을 추가 실시하였다. 2가지 EGF 단백질의 리폴딩 방법은 아래와 같이 동일한 방법을 이용하여 리폴딩하였다.
순수 분리 정제된 각각의 단백질은 리폴딩 환원 완충액(50mM Na2CO3, 1mM L-Cysteine, pH 9.6)을 이용하여 교반기에 의해 10배 희석하였으며, 25℃에서 1시간 동안 추가로 반응시켰다. 이어서 리폴딩 산화를 위하여 L-시스틴(L-Cystine)을 최종 5mM이 되도록 첨가하였으며, 교반기에 의해 4℃에서 15시간 동안 반응시켰다. 반응이 완료된 리폴딩 용액은 원심분리를 통해 리폴딩 과정 중에 발생된 침전물을 제거하였으며 얻어진 리폴딩 상청액은 농축 후 HPLC 정제를 실시하였다.
리폴딩 후 농축된 각각의 EGF 단백질을 6M HCl을 이용하여 산성화 (pH 2.7 ~ pH 3.0) 한 후 0.2㎛ 필터로 여과하여 시료 준비를 하였고, MPLC를 이용하여 1차 정제를 하였다.
이동상으로는 0.1% 트리플루오로아세트산(TFA)(v/v)을 넣은 물과 아세토나이트릴(ACN)을 사용하였고, 컬럼은 C18 40g 카트리지(cartridge)를 사용하였다. 아세토니트릴(ACN) 농도를 점차적으로 증가시키는 그래디언트(gradient) 방법으로 UV 검출기를 이용하여 정제를 하여 HPLC를 이용하여 분석한 결과, PEP1-EGF 및 STeP-EGF에 해당하는 피크(peak)에 대한 순도가 50~80%인 것을 모아 회전 증발기(Rotary evaporator)로 농축하였다.
또한, 95% 이상의 고순도 PEP-EGF 및 STeP-EGF단백질을 얻고자 2차로 HPLC를 이용하여 추가 정제하였다. HPLC는 이동상으로 0.1% 트리플루오로아세트산(TFA)(v/v)을 넣은 물과 아세토니트릴 (ACN)을 사용하였고, 컬럼은 C18 50×250㎜를 사용하였다. 아세토니트릴(ACN) 농도를 점차적으로 증가시키는 그레디언트 방법으로 UV 검출기를 이용하여 순도가 95% 이상인 것을 획득하였으며, 농축 후 안정화 버퍼 (50mm Na2CO3, 10% Glycerol, pH 9.6)를 이용하여 투석을 실시하였다. 도 12는 EGF 재조합 단백질 (PEP1-EGF, STeP-EGF)의 정제 결과이다.
[실시예 10. EGF 재조합 단백질의 세포 증식 활성도 측정 (PEP1-EGF, STeP-EGF)]
EGF, PEP1-EGF 및 STeP-EGF에 의한 세포 증식 효과를 측정하기 위하여 마우스 섬유아세포(Balb/c 3T3 clone A31 cells)에 대해 각각의 정제된 단백질을 농도별로 처리하여 세포의 성장률을 측정하였다. 마우스 섬유아세포는 생장 배지에 24시간 배양하고 무혈청 배지에서 20시간 동안 스타베이션(Starvation)한 후, 각각의 재조합 단백질을 농도별로 처리한 후 24시간을 배양하는 방법으로 진행하였으며, 자세한 방법으로는 10% BCS가 담겨 있는 DMEM 배지(생장 배지) 100μl씩 96 웰 플레이트에 Balb/c 3T3 clone A31 cells을 104개/well로 넣고 24시간 배양 후, 0% BCS 배지(무혈청 배지)로 옮겨 20시간 정도 스타베이션(Starvation)을 주었다. 그 후, EGF, PEP1-EGF, STeP-EGF 단백질을 최대 90ng/ml 농도부터 3배씩 희석하여 준비하여 각 well에 넣어서 24시간 처리하였다.
최종 측정 방법은 WST assay (Takara, Otsu, Shiga, Japan) 제품을 이용하였고, 그 방법은 제품 사용설명서에 의거하여 수행하였으며 ED50(50% effective dose)농도를 보이는 흡광도의 단백질 처리 농도를 1 unit으로 정하여 정량하였다.
그 결과, 정제된 EGF, PEP1-EGF 및 STeP-EGF 대하여 6 X 106 unit/mM 이상의 세포 증식 활성도를 보임을 확인하였다. 특히, EGF에 비해 PEP1-EGF, STeP-EGF의 세포 증식 활성이 우월하였으며, 이는 PTD와의 융합 상태임에도 불구하고 세포에 있는 EGF 수용체와의 결합에는 문제가 없음을 알 수 있었다. 도 13은 EGF 재조합 단백질의 세포 증식 효능 결과 (EGF, PEP1-EGF, STeP-EGF)이다.
EGF 재조합 단백질의 세포 증식 활성 Unit 값
Sample name EGF PEP1-EGF STeP-EGF
Activity result(unit/mM) 6.27×106 13.90×106 14.34×106
[실시예 11. 세포 및 피부 투과성 EGF 단백질의 피부 투과 분석]
조직 염색을 통한 STeP-EGF의 피부 투과성 분석을 위해서, 돼지 피부(Porcine skin)를 이용한 프란츠 셀(Franz cell)에 동일한 양 (42uM)의 Normal EGF와 PEP1-EGF, STeP-EGF를 처리하였다. 24시간 뒤에 프란츠 셀(Franz cell) 사이에 있는 돼지피부를 꺼내어 증류수에 세척한 뒤 조직염색 과정을 진행하였다. 도너 세포(Donor cell)에 노출된 돼지피부 부위를 절단한 뒤에 10% 버퍼드 포르말린(buffered formalin)에서 고정시킨 뒤 파라핀 블록(paraffin block)을 제조하였으며, 마이크로톰(Microtome)을 이용하여 7μm로 조직을 구분(section)하였다. 그 후, 슬라이드 위에 조직을 마운팅(mounting)한 다음 파라핀을 제거하고, 수화과정을 거친 후 조직 절편을 30분간 블락킹(blocking)하였다. 블락킹(Blocking)이 끝난 조직에 anti-EGF 항체 (Santa cruz, green)를 처리하여 4℃에서 18시간 반응시켰다. 다음날, PBST로 씻어준 다음 Alexa Fluor 488 2차 항체를 상온에서 2시간 처리하고, PBST로 다시 한번 씻어 주었다. 이후, 대조 염색을 위해 Hoechst 33342 (blue)로 상온에서 10분간 반응한 후, 형광 배지(fluorescence medium)로 봉입하고 형광 현미경으로 관찰하였다.
실험 결과, EGF는 각질층에서만 관찰이 되었고, PEP1-EGF의 경우는 상피층까지 관찰되었다. 본 발명의 STeP-EGF는 PEP1-EGF 보다도 피부 내로 효율적으로 전달이 가능함을 확인할 수 있었다. 도 14는 EGF 단백질의 피부 투과력 비교 결과이다.
[실시예 12. 펩타이드 합성]
본 발명자들은 세포투과성 펩타이드와 목표 물질 사이의 비공유 결합을 통해 세포 투과능이 향상됨을 확인하기 위해, 세포투과성 펩타이드를 합성하였다. 기존에 이미 비공유 결합을 통해 세포 투과능을 향상시킨다고 알려져 있는 PEP1 펩타이드와 신규 세포투과성 펩타이드 STeP을 각각 합성하였다. 펩타이드 제조업체에 의뢰하여, 액상 고상법에 따라, 펩타이드를 합성하였고, 그 서열은 하기 표 2와 같았다.
펩타이드 아미노산 서열
PTD 아미노산 서열
PEP1 KETWWETWWTEWSQPKKKRKVC
STeP KETWWETWWTEWSQPYGRKKRRQRRRC
[실시예 13. 세포투과성 펩타이드의 세포 독성 확인]
본 발명의 펩타이드가 생체 내 고분자 전달 시 무해하게 사용 가능한지 확인하기 위해 세포독성을 확인하였다.
10% FBS가 포함된 DMEM 배지에서 배양된 HaCaT 세포를 2.5×104씩 96웰 플레이트에 분주하여 24시간 배양한 후 HBSS로 2회 세척하여 주었다. 세포투과성 펩타이드인 PEP1과 STeP을 각각 50μM, 100μM, 200μM의 농도로 D.W에 녹인 후 최종농도가 2.5μM, 5μM, 10μM이 되도록 배지에 희석해 세포에 처리하고, 24시간동안 37℃, 5% CO2 인큐베이터에서 반응시켰다. 배양 후, 상층액을 제거하고 WST 용액을 배지에 1:9 비율로 희석하여 세포에 처리해 주었다. 3시간 동안 배양 후 450nm에서 흡광값을 측정하고, 펩타이드 비처리군의 세포와 처리군의 세포를 비교하여 세포생존율을 계산하였다.
그 결과, 도 15에 나타나는 것과 같이, PEP1, STeP 모두 10 μM의 농도에서도 세포독성을 나타내지 않음을 확인하였다. 도 15는 세포투과성 펩타이드의 세포 독성 확인 결과이다.
[실시예 14. 세포투과성 펩타이드-FITC 혼합물의 세포 투과 분석]
본 실시예에서는 세포투과성 펩타이드가 목표 물질과 비공유 결합 상태에서 세포 내로 전달하는 능력을 용이하게 분석하기 위하여 녹색 형광 단백질(Fluorescein isothiocyanate: 이하, “FITC”라 약칭함)을 목적 물질로 선택하였다.
FITC와 세포투과성 펩타이드(PEP1, STeP)을 보락스 버퍼 (borax buffer, pH 8.0)에 녹여 준비하였다. 혼합은 FITC와 세포투과성 펩타이드(PEP1, STeP)을 1:0, 1:1, 1:2의 몰 비율로 섞어준 뒤 37℃에서 30분간 반응시키고, 최종 5μM 세포투과성 펩타이드-FITC 혼합물을 세포에 처리하였다. 세포에 혼합물을 처리한 후, 1시간 30분 동안 배양하고 혼합물과 같은 양의 배지를 추가하여 30분 더 배양하였다. 30분 뒤 배지를 제거하고 PBS를 이용하여 세포를 세척한 후 냉각 메탄올을 이용하여 10분간 -20℃에서 세포를 고정하였다. 세포는 PBS로 충분히 세척한 뒤 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색시켰다. PBS로 충분히 세척하고, 마운팅 (mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
그 결과, STeP-FITC 혼합물을 처리한 그룹에서 녹색 형광이 가장 밝았으며, 1:1 보다는 1:2 몰 비에서 더 밝았다. 즉, PEP1보다 STeP이 FITC의 세포 내 투과력을 더 향상시킴을 알 수 있었다. 도 16은 세포투과성 펩타이드-FITC 혼합물의 세포 투과력 비교 결과이다.
[실시예 15: 세포투과성 펩타이드-FITC 혼합물의 피부 투과 분석]
세포뿐만 아니라 피부에서도 STeP과 비공유 결합 상태에서 FITC의 투과가 향상되는지 알아보기 위해, 프란츠 셀(Franz cell, 직경 9mm)을 이용하였다.
FITC와 세포투과성 펩타이드(PEP1, STeP)을 보락스 버퍼 (borax buffer, pH 8.0)에 녹여 준비하였다. 혼합은 FITC와 세포투과성 펩타이드(PEP1, STeP)을 1:0, 1:2의 몰 비율로 섞어준 뒤 37℃에서 30분간 반응시키고, 최종 100μM 세포투과성 펩타이드-FITC 혼합물을 프란츠 셀 상단에 200μl 처리하였다. 24시간 후, 돼지 피부를 빼낸 뒤 PBS로 3회 세척하였다. 세척 후 크라이요 몰드 (cryo mold)에 OCT 임베딩 매트릭스 (OCT embedding matrix, Cell Path Ltd., UK)를 처리하여 조직을 -70℃에서 동결하였다. 동결 조직은 크라이요톰(cryotome, HM520, Germany)을 이용하여 -20℃에서 7 μm의 두께로 크로스-섹션(cross-section)하여 절편 슬라이드를 제작하였다. 피부 세포의 핵을 염색하기 위하여 슬라이드 글라스 (slide glass)에 고정시킨 조직 절편은 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색한 후 PBS로 3회 세척하였다. 마운팅(mounting) 한 뒤, 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
그 결과, FITC는 돼지 피부 각질층에 있는 반면, 본 발명의 STeP-FITC 혼합물은 피부 내로 효율적으로 전달이 가능함을 확인할 수 있었다. 도 17은 세포투과성 펩타이드-FITC 혼합물의 피부 투과력 비교 결과이다.
[실시예 16. 세포투과성 펩타이드-(Dipeptide Diaminobutyroyl Benzylamide Diacetate) 혼합물의 세포 투과 분석]
본 실시예에서는 피부 생리 활성을 갖는 펩타이드를 이용하여 피부 투과를 통한 생리활성이 증대됨을 확인하여 본 발명이 주름 개선 효능을 갖는 화장품 원료로 사용될 수 있음을 입증하고자 하였다.
피부 생리 활성을 갖는 펩타이드로, 근육 수축에 대한 신호를 방지하여 주름 개선에 도움이 된다고 알려진, DDBD (Dipeptide Diaminobutyroyl Benzylamide Diacetate, 상표명: SYN-AKE)를 이용하였다. DDBD는 와글레린(Waglerin) 1이라는 뱀독을 모방하여 합성된 펩타이드이다.
DDBD의 세포 전달 능력을 용이하게 분석하기 위하여 FITC를 연결한 FITC 융합 DDBD(FITC-DDBD)를 합성하였다. STeP과 비공유 결합 상태에서 DDBD의 세포 내 투과가 향상되는지 알아보기 위해, BALB/3T3(mouse embryonic fibroblast cell line) 세포에서 FITC 녹색 형광을 이용한 DDBD의 세포 내 투과를 관찰하였다.
BALB/3T3 세포는 배양용 슬라이드에서 24시간 동안 배양하였다. 그 후 배양 배지(DMEM+10% BCS, 1% antibiotics)를 제거한 후, HBSS로 3회 세척 후 STeP과 FITC-DDBD을 섞은 혼합물을 처리하였다. 혼합은 FITC-DDBD와 STeP을 1:5의 몰 비로 섞어준 뒤 실온에서 10분간 반응시키고, 최종 10uM FITC-DDBD를 세포에 처리하였다. 60분 뒤 배지를 제거하고 HBSS를 이용하여 세포를 세척한 후 냉각 메탄올을 이용하여 10분간 -20℃에서 세포를 고정하였다. 세포는 PBS로 충분히 세척한 뒤 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색시켰다. PBS로 충분히 세척하고, 마운팅(mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
그 결과, FITC-DDBD만을 처리한 그룹보다 STeP을 혼합하여 FITC-DDBD를 넣어주었을 때, 세포 내 투과가 더 향상됨을 확인할 수 있었다. 도 18은 세포투과성 펩타이드와 FITC-DDBD 혼합물의 '세포' 투과력 비교 결과이다.
[실시예 17. 세포투과성 펩타이드-FGF2 혼합물의 피부 투과 분석]
DDBD처럼 작은 분자량의 펩타이드 뿐만 아니라, 분자량이 큰 단백질을 이용하여 피부 투과를 통한 생리활성이 증대됨을 확인하고자, FGF2(Fibroblast growth factor-2, 염기성섬유아세포성장인자)를 이용하였다. FGF2는 피부를 구성하는 각질형성세포와 섬유아세포를 자극하여 피부의 재생과 건강한 피부 상태로 회복시켜준다고 알려져 있으나, 고분자 친수성 물질이기 때문에 피부 내 투과가 어렵다.
조직 염색을 통한 FGF2의 피부 투과성 분석을 위해서, 돼지 피부(Porcine skin)를 이용한 프란츠 셀(Franz cell)에 동일한 양 (500 μg)의 FGF2와 PEP1-FGF2 및 STeP과 FGF2 혼합물을 처리하였다. 24시간 뒤에 프란츠 셀(Franz cell) 사이에 있는 돼지피부를 꺼내어 증류수에 세척한 뒤 조직염색 과정을 진행하였다. 도너 세포(Donor cell)에 노출된 돼지피부 부위를 절단한 뒤에 10% 버퍼드 포르말린(buffered formalin)에서 고정시킨 뒤 파라핀 블록(paraffin block)을 제조하였으며, 마이크로톰(Microtome)을 이용하여 7 μm로 조직을 구분(section)하였다. 그 후, 슬라이드 위에 조직을 마운팅(mounting)한 다음 파라핀을 제거하고, 수화과정을 거친 후 조직 절편을 30분간 블락킹(blocking)하였다. 블락킹(Blocking)이 끝난 조직에 anti-FGF2 항체 (Cell signaling, green)를 처리하여 4℃에서 18시간 반응시켰다. 다음날, PBST로 씻어준 다음 Alexa Fluor 488 2차 항체를 상온에서 2시간 처리하고, PBST로 다시 한번 씻어주었다. 이후, 조직 절편은 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색한 후 PBS로 3회 세척하였다. 마운팅(mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다.
그 결과, FGF2는 돼지 피부 조직 내로 전혀 전달되지 않음에 반해, PEP1-FGF2는 돼지 피부 조직의 피부 내로 효율적으로 전달됨을 확인하였다. 이때, STeP과 FGF2는 단순 혼합물임에도 불구하고, PEP1-FGF2를 능가하는 피부 전달 능력을 가짐을 확인할 수 있었다. 도 19는 세포투과성 펩타이드와 FGF2 혼합물의 '피부' 투과력 비교 결과이다.

Claims (17)

  1. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드.
  2. 제1항에 있어서,
    상기 서열번호 1의 아미노산 서열은,
    서열번호 2에 기재된 핵산 서열로 암호화되는 것을 특징으로 하는 펩타이드.
  3. 제1항에 있어서,
    상기 펩타이드는,
    프로테인 트랜스덕션 도메인 (Protein Transduction Domain, PTD)인 것을 특징으로 하는 펩타이드.
  4. 제1항에 있어서,
    상기 펩타이드는,
    유전자 전달체인 것을 특징으로 하는 펩타이드.
  5. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 화학결합되어 형성된 결합체.
  6. 제5항에 있어서,
    상기 화학결합은,
    공유결합 또는 비공유결합인 것을 특징으로 하는 결합체.
  7. 제6항에 있어서,
    상기 공유결합될 수 있는 물질은,
    펩타이드 또는 단백질인 것을 특징으로 하는 결합체.
  8. 제6항에 있어서,
    상기 비공유결합은,
    이온결합 또는 정전기적 인력에 의한 결합 또는 소수성 상호작용 (hydrophobic interaction)에 의한 결합인 것을 특징으로 하는 결합체.
  9. 제8항에 있어서,
    상기 이온결합 또는 정전기적 인력으로 결합될 수 있는 물질은,
    전하를 띄고 있는 물질인 것을 특징으로 하는 결합체.
  10. 제9항에 있어서,
    상기 전하를 띄고 있는 물질은,
    DNA 또는 RNA인 것을 특징으로 하는 결합체.
  11. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체.
  12. 제11항에 있어서,
    상기 정전기적 인력으로 결합될 수 있는 물질은,
    전하를 띄고 있는 물질인 것을 특징으로 하는 복합체.
  13. 제12항에 있어서,
    상기 전하를 띄고 있는 물질은,
    DNA 또는 RNA인 것을 특징으로 하는 복합체.
  14. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합되어 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체를 포함하는 화장료 조성물.
  15. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열에 결합하여 형성된 결합체 또는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질이 서열번호 1에 기재된 아미노산 서열과 혼합되어 있는 복합체를 포함하는 약학 조성물.
  16. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질에 결합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드와 화학결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법.
  17. 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질과 혼합시켜, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 세포 내로 도입시키는 것을 특징으로 하는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드에 소수성 상호작용 (hydrophobic interaction) 또는 정전기적 인력으로 결합될 수 있는 물질을 이용한 포유동물의 세포 내 도입 방법.
PCT/KR2017/011916 2016-11-09 2017-10-26 신규의 프로테인 트랜스덕션 도메인 및 이의 용도 WO2018088733A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP17868564.0A EP3401324A4 (en) 2016-11-09 2017-10-26 NEW DOMAIN OF PROTEIN TRANSDUCTION AND USE THEREOF
JP2019545213A JP2020510645A (ja) 2016-11-09 2017-10-26 新規のプロテイントランスダクションドメイン及びその用途
US16/346,373 US20190336427A1 (en) 2016-11-09 2017-10-26 Novel protein transduction domain and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160148578A KR101797167B1 (ko) 2016-11-09 2016-11-09 신규의 프로테인 트랜스덕션 도메인 및 이의 용도
KR10-2016-0148578 2016-11-09

Publications (1)

Publication Number Publication Date
WO2018088733A1 true WO2018088733A1 (ko) 2018-05-17

Family

ID=60385963

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/011916 WO2018088733A1 (ko) 2016-11-09 2017-10-26 신규의 프로테인 트랜스덕션 도메인 및 이의 용도

Country Status (6)

Country Link
US (1) US20190336427A1 (ko)
EP (1) EP3401324A4 (ko)
JP (1) JP2020510645A (ko)
KR (1) KR101797167B1 (ko)
CN (1) CN108070024A (ko)
WO (1) WO2018088733A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020222315A1 (ko) * 2019-04-29 2020-11-05 주식회사 바이오셀트란 피부 또는 세포 투과능이 우수한 피부 주름 개선 또는 치료용 조성물
KR20240032203A (ko) * 2022-08-30 2024-03-12 주식회사 바이오셀트란 미백용 복합 펩타이드 및 이를 함유하는 화장료 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005253408A (ja) * 2004-03-12 2005-09-22 Eisaku Kondo 超高効率タンパク分子・ペプチドトランスポーター及びそれを用いた目的物質細胞内導入方法およびそのキット。
KR20150034746A (ko) * 2012-07-11 2015-04-03 주식회사 젬백스앤카엘 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
KR20150083600A (ko) * 2014-01-10 2015-07-20 주식회사 젬백스앤카엘 혈뇌장벽 투과성 펩티드 및 이를 포함하는 컨쥬게이트
KR20160063349A (ko) * 2013-10-17 2016-06-03 서울대학교산학협력단 알파나선형 세포 투과 펩타이드 다합체，이의 제조방법 및 그 용도
KR20160064726A (ko) * 2014-11-28 2016-06-08 서울대학교산학협력단 세포 투과 펩타이드-항암제 접합체 및 이를 포함하는 암 치료용 조성물

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6841535B2 (en) * 2000-07-31 2005-01-11 Active Motif Peptide-mediated transfection agents and methods of use
MXPA06012076A (es) * 2004-04-20 2007-01-25 Nastech Pharm Co Metodos y composiciones para mejorar el suministro de arn bicatenario o un acido nucleico hibrido bicatenario para regular la expresion genetica en celulas de mamifero.
KR100787393B1 (ko) * 2006-03-23 2007-12-21 학교법인 한림대학교 세포 도입성 ｆｋ506 결합 단백질의 융합 단백질
US20070293449A1 (en) * 2006-06-20 2007-12-20 Nastech Pharmaceutical Company Inc. Compositions and methods for delivery of double-stranded rna
WO2009002274A1 (en) * 2007-06-28 2008-12-31 Agency For Science, Technology And Research Cationic peptide for delivering an agent into a cell
ES2722924T3 (es) * 2012-12-05 2019-08-20 Univ Heidelberg Ruprecht Karls Conjugados de proteínas y péptidos multivalentes de penetración celular y sus usos
GB201322396D0 (en) 2013-12-18 2014-02-05 Univ Nottingham Transduction

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005253408A (ja) * 2004-03-12 2005-09-22 Eisaku Kondo 超高効率タンパク分子・ペプチドトランスポーター及びそれを用いた目的物質細胞内導入方法およびそのキット。
KR20150034746A (ko) * 2012-07-11 2015-04-03 주식회사 젬백스앤카엘 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
KR20160063349A (ko) * 2013-10-17 2016-06-03 서울대학교산학협력단 알파나선형 세포 투과 펩타이드 다합체，이의 제조방법 및 그 용도
KR20150083600A (ko) * 2014-01-10 2015-07-20 주식회사 젬백스앤카엘 혈뇌장벽 투과성 펩티드 및 이를 포함하는 컨쥬게이트
KR20160064726A (ko) * 2014-11-28 2016-06-08 서울대학교산학협력단 세포 투과 펩타이드-항암제 접합체 및 이를 포함하는 암 치료용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3401324A4 *

Also Published As

Publication number Publication date
CN108070024A (zh) 2018-05-25
JP2020510645A (ja) 2020-04-09
KR101797167B1 (ko) 2017-11-13
US20190336427A1 (en) 2019-11-07
EP3401324A4 (en) 2019-08-07
EP3401324A1 (en) 2018-11-14

Similar Documents

Publication Publication Date Title
WO2014046478A1 (ko) 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2014046490A1 (ko) 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
WO2015183044A1 (ko) 신규한 세포투과성 펩타이드 및 이와 보툴리눔 독소 결합체 및 이들의 용도
KR101169030B1 (ko) 신규한 세포막 투과 도메인 및 이를 포함하는 세포내 전달 시스템
WO2019240430A1 (ko) 세포 투과 펩티드와 결합된 융합 단백질 및 융합 단백질 또는 세포 투과 펩티드와 상피세포성장인자를 유효성분으로 포함하는 조성물
WO2015137705A1 (ko) 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
WO2017142367A1 (ko) 중간엽 줄기세포 또는 xcl1을 포함하는 근육질환의 예방 또는 치료용 약학적 조성물
Bustos-Valenzuela et al. Expression, purification, bioactivity, and partial characterization of a recombinant human bone morphogenetic protein-7 produced in human 293T cells
WO2015005723A1 (ko) 세포 투과성 펩티드 및 이를 포함하는 컨쥬게이트
WO2013077680A1 (ko) 세포 투과능을 개선한 개량형 신규 거대 분자 전달 도메인 개발 및 이의 이용방법
WO2018088733A1 (ko) 신규의 프로테인 트랜스덕션 도메인 및 이의 용도
WO2020060128A1 (ko) 세포 침투 효과가 우수한 보툴리늄 유래 펩타이드를 포함하는 화장료 조성물
WO2017209347A1 (ko) 피부 세포 증식 효과가 증가한 열 안정성 인간 상피세포성장인자-거미독 융합단백질 및 이를 유효성분으로 함유하는 피부 주름 개선 및 탄력 유지용 화장료 조성물
WO2017043920A1 (ko) 피부 투과성 펩티드 및 그 이용방법
WO2021206328A1 (ko) 신규 재조합 엑소좀 및 그의 용도
WO2021153946A1 (ko) Snare 복합체의 형성을 저해하는 펩티드, 및 그의 용도
WO2022255708A1 (ko) 화물분자 수송 도메인 rmmr1, 이의 변이체, 이를 포함하는 재조합 화물분자 및 이를 이용한 화물분자 수송 방법
WO2018021778A1 (ko) Lrg1 당단백질을 포함하는 융합 단백질을 함유하는 발기부전, 허혈성 질환 또는 말초 신경질환의 예방 또는 치료용 조성물
KR102195740B1 (ko) 세포 투과성 펩티드 이량체, 이의 제조방법 및 이를 이용한 카고 전달 시스템
KR102398339B1 (ko) 일산화질소 전달용 융합 펩타이드 및 이의 용도
WO2020222315A1 (ko) 피부 또는 세포 투과능이 우수한 피부 주름 개선 또는 치료용 조성물
KR100490362B1 (ko) 올리고라이신 수송 도메인, 올리고라이신-화물분자 복합체및 그 용도
WO2022240055A1 (ko) 화물분자 수송 도메인 rmad1, 이의 변이체, 재조합 화물분자 및 이를 이용한 화물분자 수송 방법
WO2020138674A1 (ko) 근육 이완용 조성물

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2017868564

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017868564

Country of ref document: EP

Effective date: 20180809

ENP Entry into the national phase

Ref document number: 2019545213

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE