WO2014100689A1 - Anti-gdf15 antibodies - Google Patents

Anti-gdf15 antibodies Download PDF

Info

Publication number
WO2014100689A1
WO2014100689A1 PCT/US2013/077139 US2013077139W WO2014100689A1 WO 2014100689 A1 WO2014100689 A1 WO 2014100689A1 US 2013077139 W US2013077139 W US 2013077139W WO 2014100689 A1 WO2014100689 A1 WO 2014100689A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
variable region
chain variable
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/077139
Other languages
English (en)
French (fr)
Inventor
Lorena Lerner
Sandra ABBOTT
Ailin Bai
Ting Chen
Maria Isabel Chiu
Qing Liu
Laura POLING
Nianjun Tao
Solly Weiler
Zhigang Weng
William M. Winston
Jeno Gyuris
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aveo Pharmaceuticals Inc
Original Assignee
Aveo Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aveo Pharmaceuticals Inc filed Critical Aveo Pharmaceuticals Inc
Priority to JP2015549810A priority Critical patent/JP6758832B2/ja
Priority to MX2015007751A priority patent/MX370720B/es
Priority to EA201591198A priority patent/EA038645B1/ru
Priority to CA2896076A priority patent/CA2896076C/en
Priority to DK13827058.2T priority patent/DK2934584T3/da
Priority to CN201380073317.1A priority patent/CN105073133B/zh
Priority to ES13827058T priority patent/ES2791183T3/es
Priority to EP20156883.9A priority patent/EP3689370B1/en
Priority to HK16103611.5A priority patent/HK1215670B/en
Priority to KR1020157019881A priority patent/KR102208861B1/ko
Priority to EP13827058.2A priority patent/EP2934584B1/en
Priority to BR112015014768-2A priority patent/BR112015014768B1/pt
Priority to AU2013364133A priority patent/AU2013364133B2/en
Publication of WO2014100689A1 publication Critical patent/WO2014100689A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/02Nutrients, e.g. vitamins, minerals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material

Definitions

  • the field of the invention is molecular biology, immunology, cachexia and cachexia-like disorders, and oncology. More particularly, the field is therapeutic antibodies.
  • Cachexia is a wasting disorder involving involuntary weight loss and may be associated with systemic inflammation and/or an acute inflammatory response. Thomas (2007) CLIN. NUTRITION 26:389-399. Loss of fat mass as well as fat- free mass, such as muscle mass, often is a prominent clinical feature of cachexia. In many but not all cases, cachexia progresses through stages that have been designated precachexia, cachexia and refractory cachexia (Fearon et al. (201 1) LANCET ONC. 12:489-495).
  • Respiratory function may also be impaired with a reduced vital capacity.
  • muscle protein is rapidly mobilized in order to provide the immune system, liver and gut with amino acids, particularly glutamine.
  • Sarcopenia often is a disease of the elderly; however, its development may also be associated with muscle disuse and malnutrition, and may coincide with cachexia.
  • Sarcopenia can be diagnosed based upon functional observations such as low muscle weight and low gait speed. See, e.g., Muscaritoli et al. (2010) CLIN. NUTRITION 29: 154-159.
  • Naturally occurring antibodies are multimeric proteins that contain four polypeptide chains (FIG. 1). Two of the polypeptide chains are called heavy chains (H chains), and two of the polypeptide chains are called light chains (L chains).
  • the immunoglobulin heavy and light chains are connected by an interchain disulfide bond.
  • the immunoglobulin heavy chains are connected by interchain disulfide bonds.
  • a light chain consists of one variable region (VL in FIG. 1) and one constant region (CL in FIG. 1).
  • the heavy chain consists of one variable region (VH in FIG. 1) and at least three constant regions (CHI, Cm and CH3 in FIG. 1). The variable regions determine the specificity of the antibody.
  • FIG. 22 is a sequence alignment showing the CDRi, CDR 2 , and CDR 3 sequences for each of the immunoglobulin light chain variable region sequences in FIG. 21.
  • FIG. 24 is a graph summarizing results from an experiment to measure cachectic inhibitory activity of anti-GDF 15 antibodies 06C1 1 ( ⁇ ), Hu06Cl 1-27 ( ), and Hu06Cl 1-30 (A ), and a murine IgG control ( ⁇ ) dosed at 2 mg/kg in an HT-1080 fibrosarcoma tumor xenograft model in ICR-SCID mice.
  • the arrow indicates intra-peritoneal injection of antibody.
  • the anti-GDF 15 antibodies disclosed herein are based on the antigen binding sites of certain monoclonal antibodies that have been selected on the basis of binding and neutralization of human GDF15 (hGDF15).
  • the antibodies contain immunoglobulin variable region CDR sequences that define a binding site for hGDF15.
  • a CDR HI comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1 (01G06, 08G01, Ch01G06 Chimeric, Hu01G06 IGHVl-18, Hu01G06 IGHVl-69, Sh01G06 IGHVl-18 M69L, Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S I69L, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu01G06 IGHVl-18 Fl, Hu01G06 IGHVl-18 F2, Hu01G06 IGHVl-69 Fl, Hu01G06 IGHVl-69 F2), SEQ ID NO:2 (03G05), SEQ ID NO:3 (04F08), SEQ ID NO:4 (06C11, Ch06Cll Chimeric, HE LM 06C11 IGHV2-70, Hu06Cll IGHV2-5)
  • a CDR H2 comprises an amino acid sequence selected from the group consisting of SEQ ID NO:7 (01G06, Ch01G06 Chimeric, Hu01G06 IGHVl-18, Hu01G06 IGHVl-69, Sh01G06 IGHVl-18 M69L, Sh01G06 IGHVl-69 T30S I69L), SEQ ID NO:8 (03G05), SEQ ID NO:9 (04F08, 06C11, Ch06Cll Chimeric, Hu06Cll IGHV2-5), SEQ ID NO: 10 (08G01), SEQ ID NO: 11 (14F11, Chl4Fll Chimeric, Shl4Fll IGHV2-5, Shl4Fll IGHV2-70), SEQ ID NO: 12 (17B11), SEQ ID NO: 13 (Sh01G06 IGHVl-18 M69L K64Q
  • a CDR H3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 15 (01G06, 08G01, Ch01G06 Chimeric, Hu01G06 IGHVl-18, Hu01G06 IGHVl-69, Sh01G06 IGHVl-18 M69L, Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S I69L, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu01G06 IGHVl-18 Fl, Hu01G06
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO:2 (03G05), a CDR H 2 comprising the amino acid sequence of SEQ ID NO:8 (03G05), and a CDR H 3 comprising the amino acid sequence of SEQ ID NO: 16 (03G05).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO:5
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO:6 (17B11), a CDR H 2 comprising the amino acid sequence of SEQ ID NO: 12 (17B11), and a CDR H 3 comprising the amino acid sequence of SEQ ID NO:20 (17B11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDR H i comprising the amino acid sequence of SEQ ID NO: l (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO: l (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu01G06 IGHVl-18 Fl, Hu01G06 IGHVl-18 F2, Hu01G06 IGHVl-69 Fl, Hu01G06 IGHVl-69 F2), a CDR H2 comprising the amino acid sequence of SEQ ID NO:237 (Hu01G06 IGHVl-18 F2), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO: l (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu01G06 IGHVl-18 Fl, Hu01G06 IGHVl-18 F2, Hu01G06 IGHVl-69 Fl, Hu01G06 IGHVl-69 F2), a CDR H2 comprising the amino acid sequence of SEQ ID NO:238 (Hu01G06 IGHVl-69 Fl), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO: 1 (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L K64Q, Sh01G06 IGHVl-69 T30S K64Q I69L, Hu01G06 IGHVl-18 Fl, Hu01G06 IGHVl-18 F2, Hu01G06 IGHVl-69 Fl, Hu01G06 IGHVl-69 F2), a CDR H2 comprising the amino acid sequence of SEQ ID NO:239 (Hu01G06 IGHVl-69 F2), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Sh01G06 IGHVl-18 M69L K64Q G44S, Sh01G06 IGHVl-18 M69L
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising the amino acid sequence of SEQ ID NO:4 (HE LM 06C11 IGHV2-70), a CDR H2 comprising the amino acid sequence of SEQ ID NO: 14 (HE LM 06C11 IGHV2-70), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 18 (HE LM 06C11 IGHV2-70).
  • the CDR H i, CDR H 2, and CDR H3 sequences are interposed between fully human or humanized immunoglobulin FR sequences.
  • the antibody comprises (a) an immunoglobulin light chain variable region comprising the structure CDR L i-CDR L 2-CDR L3 , and (b) an immunoglobulin heavy chain variable region, wherein the immunoglobulin light chain variable region and the immunoglobulin heavy chain variable region together define a single binding site for binding hGDF15.
  • a CDR L3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO:32 (01G06, Ch01G06 Chimeric, H11OIGO6 IGKVl-39, H11OIGO6 IGKVl-39 S43A V48I, H11OIGO6 IGKVl-39 V48I, 08G01, H11OIGO6 IGKVl-39 Fl), SEQ ID NO:244 (Hu01G06 IGKVl-39 F2), SEQ ID NO:33 (03G05), SEQ ID NO:34 (04F08), SEQ ID NO:35 (06C11, Ch06Cll Chimeric, Sh06Cll IGKVl-16), SEQ ID NO:36 (14
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRLI comprising the amino acid sequence of SEQ ID NO:21 (01G06, Ch01G06 Chimeric, H11OIGO6 IGKVl-39, H11OIGO6 IGKVl-39 S43A V48I, H11OIGO6 IGKVl-39 V48I, H11OIGO6 IGKVl-39 Fl, H11OIGO6 IGKVl-39 F2), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (01G06, Ch01G06 Chimeric, H11OIGO6 IGKVl-39, H11OIGO6 IGKVl-39 S43A V48I, H11OIGO6 IGKVl-39 V48I,
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRLI comprising the amino acid sequence of SEQ ID NO:21 (01G06, Ch01G06 Chimeric, H11OIGO6 IGKVl-39, H11OIGO6 IGKVl-39 S43A V48I, H11OIGO6 IGKVl-39 V48I, H11OIGO6 IGKVl-39 Fl, H11OIGO6 IGKVl-39 F2), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (01G06, Ch01G06 Chimeric, H11OIGO6 IGKVl-39, Hu01G06 IGKV1-39 S43A V48I, Hu01G06 IGKVl-39 V48I, H11OIGO6 IGKVl-39 Fl, Hu01G06 IGKVl-39 F2), and a CDR L3 comprising the amino acid sequence of
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRLI comprising the amino acid sequence of SEQ ID NO:23 (04F08), a CDR L2 comprising the amino acid sequence of SEQ ID NO:28 (04F08), and a CDR L 3 comprising the amino acid sequence of SEQ ID NO:34 (04F08).
  • the antibody comprises an immunoglobulin light chain variable region comprising a CDRLI comprising the amino acid sequence of SEQ ID NO:23 (06C11, Ch06Cll Chimeric, Sh06Cll IGKVl-16), a CDR L2 comprising the amino acid sequence of SEQ ID NO:28 (06C11, Ch06Cll Chimeric, Sh06Cll IGKVl-16), and a CDR L3 comprising the amino acid sequence of SEQ ID NO:35 (06C11, Ch06Cll Chimeric,
  • the antibody comprises: (a) an immunoglobulin heavy chain variable region comprising the structure CDR H i-CDR H2 -CDR H3 and (b) an immunoglobulin light chain variable region comprising the structure CDR LI -CDR L2 -CDR L3 , wherein the heavy chain variable region and the light chain variable region together define a single binding site for binding hGDF15.
  • the CDR H i is an amino acid sequence selected from the group consisting of SEQ ID NO: 1 (01G06, 08G01, Ch01G06 Chimeric, Hu01G06 IGHVl-18, Hu01G06
  • the CDR L i is an amino acid sequence selected from the group consisting of SEQ ID NO:21 (01G06, Ch01G06 Chimeric, Hu01G06 IGKV1-39, Hu01G06 IGKVl-39 S43A V48I, Hu01G06 IGKV1-39 V48I, Hu01G06 IGKVl-39 Fl, Hu01G06 IGKVl-39 F2), SEQ ID NO:22 (03G05), SEQ ID NO:23 (04F08, 06C11, Ch06Cll
  • the CDR L2 is an amino acid sequence selected from the group consisting of SEQ ID NO:26 (01G06, Ch01G06 Chimeric, Hu01G06 IGKVl- 39, Hu01G06 IGKVl-39 S43A V48I, Hu01G06 IGKVl-39 V48I, Hu01G06 IGKVl-39 Fl, Hu01G06 IGKVl-39 F2), SEQ ID NO:27 (03G05), SEQ ID NO:28 (04F08, 06C11,
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:38 (Hu01G06 IGHV1-18 Fl), a CDR H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO:236 and SEQ ID NO:240 (Hu01G06 IGHV1-18 Fl), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Hu01G06 IGHV1-18 Fl); and an immunoglobulin light chain variable region comprising a CDR L i comprising the amino acid sequence of SEQ ID NO:21 (Hu01G06 IGKVl-39 Fl), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (Hu01G06 IGKVl-39 Fl), and a CDR L 3 comprising the amino acid sequence of SEQ ID NO:32
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:38 (Hu01G06 IGHV1-18 F2), a CDR H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO:237 and SEQ ID NO:241 (Hu01G06 IGHVl-18 F2), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Hu01G06 IGHVl-18 F2); and an immunoglobulin light chain variable region comprising a CDR L i comprising the amino acid sequence of SEQ ID NO:21 (Hu01G06 IGKVl-39 F2), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (Hu01G06 IGKVl-39 F2), and a CDR L3 comprising the amino acid sequence of SEQ ID NO:244
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:234 (Hu01G06 IGHVl-69 Fl), a CDR H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO:238 and SEQ ID NO:241 (Hu01G06 IGHVl-69 Fl), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Hu01G06 IGHVl-69 Fl); and an immunoglobulin light chain variable region comprising a CDR L i comprising the amino acid sequence of SEQ ID NO:21 (Hu01G06 IGKVl-39 Fl), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (Hu01G06 IGKVl-39 Fl), and a CDR L3 comprising the amino acid sequence of SEQ ID NO:32
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:234 (Hu01G06 IGHVl-69 F2), a CDR H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO:239 and SEQ ID NO:240 (Hu01G06 IGHVl-69 F2), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Hu01G06 IGHVl-69 F2); and an immunoglobulin light chain variable region comprising a CDR L i comprising the amino acid sequence of SEQ ID NO:21 (Hu01G06 IGKVl-39 Fl), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (Hu01G06 IGKVl-39 Fl), and a CDR L3 comprising the amino acid sequence of SEQ ID NO:32
  • the antibody comprises an immunoglobulin heavy chain variable region comprising a CDRHI comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:234 (Hu01G06 IGHVl-69 F2), a CDR H2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO:239 and SEQ ID NO:240 (Hu01G06 IGHVl-69 F2), and a CDR H3 comprising the amino acid sequence of SEQ ID NO: 15 (Hu01G06 IGHVl-69 F2); and an immunoglobulin light chain variable region comprising a CDR L i comprising the amino acid sequence of SEQ ID NO:21 (Hu01G06 IGKVl-39 F2), a CDR L2 comprising the amino acid sequence of SEQ ID NO:26 (Hu01G06 IGKVl-39 F2), and a CDR L3 comprising the amino acid sequence of SEQ ID NO:244
  • the antibody comprises an immunoglobulin light chain variable region selected from the group consisting of SEQ ID NO:76 (01G06, Ch01G06 Chimeric), SEQ ID NO:78 (03G05), SEQ ID NO:80 (04F08), SEQ ID NO:82 (06C11, Ch06Cll Chimeric), SEQ ID NO:84 (08G01), SEQ ID NO:86 (14F11, Chl4Fll Chimeric), SEQ ID NO:88 (17B11), SEQ ID NO:90 (Hu01G06 IGKVl-39), SEQ ID NO:92 (Hu01G06 IGKVl-39 S43A V48I or Hu01G06 IGKVl-39 Fl), SEQ ID NO:94 (Hu01G06 IGKVl-39 V48I), SEQ ID NO:96 (Sh06Cll IGKVl-16), SEQ ID NO:254 (Hu01G06 IGKVl-39 F2), and SEQ ID NO:98 (Hul), SEQ ID NO:76 (
  • the antibody comprises an immunoglobulin heavy chain variable region selected from the group consisting of SEQ ID NO:40 (01G06, Ch01G06 Chimeric), SEQ ID NO:42 (03G05), SEQ ID NO:44 (04F08), SEQ ID NO:46 (06C11, Ch06Cll Chimeric), SEQ ID NO:48 (08G01), SEQ ID NO:50 (14F11, Chl4Fll Chimeric), SEQ ID NO:52 (17B11), SEQ ID NO:54 (Hu01G06 IGHV1-18), SEQ ID NO:56 (Hu01G06 IGHV1-69), SEQ ID NO:58 (Sh01G06 IGHV1-18 M69L), SEQ ID NO:60 (Sh01G06 IGHV1-18 M69L K64Q G44S), SEQ ID NO:62 (Sh01G06 IGHV1-18 M69L K64Q), SEQ ID NO:64 (Sh01G06 IGHV1-69 T30S I69L), SEQ ID NO:40 (01G06,
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:42 (03G05), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:78 (03G05).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:48 (08G01), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:84 (08G01).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:50 (14F11), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:86 (14F11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:52 (17B11), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:88 (17B11).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:54 (Hu01G06 IGHVl-18), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:56 (Hu01G06 IGHVl-69), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:58 (Sh01G06 IGHVl-18 M69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:60 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:62 (Sh01G06 IGHVl-18 M69L K64Q), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:64 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:66 (Sh01G06 IGHVl-69 T30S K64Q I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:40 (Ch01G06 Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (Hu01G06 IGKVl-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:54 (Hu01G06 IGHVl-18), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (Hu01G06 IGKVl-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:56 (Hu01G06 IGHVl-69), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (Hu01G06 IGKVl-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:58 (Sh01G06 IGHVl-18 M69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (Hu01G06 IGKVl-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:60 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (H11OIGO6 IGKV1-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:62 (Sh01G06 IGHVl-18 M69L K64Q), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (H11OIGO6 IGKV1-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:64 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (H11OIGO6 IGKVl-39).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:66 (Sh01G06 IGHVl-69 T30S K64Q I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:90 (H11OIGO6 IGKVl-39).
  • the antibody comprises an immuoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:40 (Ch01G06 Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (H11OIGO6 IGKVl-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:54 (H11OIGO6 IGHVl-18), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (H11OIGO6 IGKVl-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:56 (H11OIGO6 IGHVl-69), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (H11OIGO6 IGKVl-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:58 (Sh01G06 IGHVl-18 M69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (H11OIGO6 IGKVl-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:60 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (Hu01G06 IGKV1-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:62 (Sh01G06 IGHVl-18 M69L K64Q), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (Hu01G06 IGKV1-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:64 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (Hu01G06 IGKV1-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:66 (Sh01G06 IGHVl-69 T30S K64Q I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (Hu01G06 IGKV1-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:40 (Ch01G06 Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (Hu01G06 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:54 (Hu01G06 IGHVl-18), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (Hu01G06 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:56 (Hu01G06 IGHVl-69), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (Hu01G06 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:58 (Sh01G06 IGHVl-18 M69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (H11OIGO6 IGKV1-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:60 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (H11OIGO6 IGKV1-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:62 (Sh01G06 IGHVl-18 M69L K64Q), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (H11OIGO6 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:64 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:94 (H11OIGO6 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:66 (Sh01G06 IGHVl-69 T30S K64Q I69L), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 94 (H11OIGO6 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:246 (H11OIGO6 IGHVl-18 Fl), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:92 (H11OIGO6 IGKVl-39 Fl).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:248 (H11OIGO6 IGHVl-18 F2), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:254 (H11OIGO6 IGKVl-39 F2).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:252 (Hu01G06 IGHV1-69 F2), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:254 (Hu01G06 IGKV1-39 F2).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:68 (HE LM 06C11
  • IGHV2-70 an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:82 (Ch06Cll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:70 (Hu06Cll IGHV2-5), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:82 (Ch06Cll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:46 (Ch06Cll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:96 (Sh06Cll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:68 (HE LM 06C11 IGHV2-70), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:96 (Sh06Cll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:70 (Hu06Cll IGHV2-5), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:96 (Sh06Cll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:72 (Shl4Fll IGHV2-5), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:86 (Chl4Fll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:74 (Shl4Fll IGHV2-70), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:86 (Chl4Fll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:50 (Chl4Fll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:98 (Hul4Fll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:72 (Shl4Fll IGHV2-5), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:98 (Hul4Fll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:74 (Shl4Fll IGHV2-70), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:98 (Hul4Fll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:46 (Ch06Cll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 80 (04F08).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:50 (Chl4Fll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO: 80 (04F08).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:44 (04F08), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:82 (Ch06Cll Chimeric). [00141] In some embodiments, the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:50 (Chl4Fll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:82 (Ch06Cll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:44 (04F08), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:86 (Chl4Fll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:46 (Ch06Cll Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:86 (Chl4Fll Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:48 (08G01), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID NO:76 (Ch01G06 Chimeric).
  • the antibody comprises an immunoglobulin heavy chain variable region comprising the amino acid sequence of SEQ ID NO:40 (Ch01G06 Chimeric), and an immunoglobulin light chain variable region comprising the amino acid sequence of SEQ ID O:84 (08G01).
  • the antibodies disclosed herein comprise an
  • the antibody comprises an immunoglobulin heavy chain selected from the group consisting of SEQ ID NO: 100 (01G06), SEQ ID NO: 104 (03G05), SEQ ID NO: 108 (04F08), SEQ ID NO: 1 12 (06C11), SEQ ID NO: 116 (08G01), SEQ ID NO: 120 (14F11), SEQ ID NO: 124 (17B11), SEQ ID NO: 176 (Ch01G06 Chimeric), SEQ ID NO: 178 (Hu01G06 IGHV1-18), SEQ ID NO: 180 (Hu01G06 IGHV1-69), SEQ ID NO: 182 (Sh01G06 IGHV1-18 M69L), SEQ ID NO: 184 (Sh01G06 IGHV1-18 M69L K64Q G44S), SEQ ID NO: 186 (Sh01G06 IGHV1-18 M69L K64Q), SEQ ID NO: 188 (Sh01G06 IGHV
  • the antibody comprises an immunoglobulin light chain selected from the group consisting of SEQ ID NO: 102 (01G06), SEQ ID NO: 106 (03G05), SEQ ID NO: 110 (04F08), SEQ ID NO: 114 (06C11), SEQ ID NO: 118 (08G01), SEQ ID NO: 122 (14F11), SEQ ID NO: 126 (17B11), SEQ ID NO:204 (Ch01G06 Chimeric), SEQ ID NO:206 (Hu01G06 IGKV1-39), SEQ ID NO:208 (Hu01G06 IGKV1-39 S43A V48I or Hu01G06 IGKV1-39 Fl), SEQ ID NO:210 (Hu01G06 IGKVl-39 V48I), SEQ ID NO:264 (Hu01G06 IGKVl-39 F2), SEQ ID NO:212 (Ch06Cll Chimeric), SEQ ID NO:214
  • the antibody comprises (i) an immunoglobulin heavy chain selected from the group consisting of SEQ ID NO: 100 (01G06), SEQ ID NO: 104 (03G05), SEQ ID NO: 108 (04F08), SEQ ID NO: 112 (06C11), SEQ ID NO: 116 (08G01), SEQ ID NO: 120 (14F11), SEQ ID NO: 124 (17B11), SEQ ID NO: 176 (Ch01G06 Chimeric), SEQ ID NO: 178 (Hu01G06 IGHVl-18), SEQ ID NO: 180 (Hu01G06 IGHVl-69), SEQ ID NO: 182 (Sh01G06 IGHVl-18 M69L), SEQ ID NO: 184 (Sh01G06 IGHVl-18 M69L K64Q G44S), SEQ ID NO: 186 (Sh01G06 IGHVl-18 M69L K64Q), SEQ ID NO: 188 (Sh01G06 IGHVl-69 T30S I
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 176 (Ch01G06 Chimeric), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:204
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 192 (Ch06Cll Chimeric), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:212
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 198 (Chl4Fll Chimeric), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:216
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 178 (Hu01G06 IGHVl-18), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:206
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 180 (Hu01G06 IGHVl-69), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:206
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 184 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:210 (Hu01G06 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 188 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:210 (Hu01G06 IGKVl-39 V48I).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 184 (Sh01G06 IGHVl-18 M69L K64Q G44S), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:208 (Hu01G06 IGKV1-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 188 (Sh01G06 IGHVl-69 T30S I69L), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:208 (Hu01G06 IGKVl-39 S43A V48I).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:256 (Hu01G06 IGHVl-18 Fl), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:208
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:258 (Hu01G06 IGHVl-18 F2), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:264
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:260 (Hu01G06 IGHVl-69 Fl), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:208
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:262 (Hu01G06 IGHVl-69 F2), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:208
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:262 (Hu01G06 IGHVl-69 F2), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:264
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 194 (HE LM 06C11 IGHV2-70), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:214 (Sh06Cll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO: 196 (Hu06Cll IGHV2-5), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:214 (Sh06Cll IGKV1-16).
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:200 (Shl4Fll IGHV2-5), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:218
  • the antibody comprises an immunoglobulin heavy chain comprising the amino acid sequence of SEQ ID NO:202 (Shl4Fll IGHV2-70), and an immunoglobulin light chain comprising the amino acid sequence of SEQ ID NO:218
  • an isolated antibody that binds hGDF15 comprises an immunoglobulin heavy chain variable region comprising an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the FR sequence of SEQ ID NO:40 (01G06, Ch01G06 Chimeric), SEQ ID NO:42 (03G05), SEQ ID NO:44 (04F08), SEQ ID NO:46 (06C11, Ch06Cll Chimeric), SEQ ID NO:48 (08G01), SEQ ID NO:50 (14F11, Chl4Fll Chimeric), SEQ ID NO:52 (17B11), SEQ ID NO:54 (Hu01G06 IGHVl-18), SEQ ID NO:56 (Hu01G06 IGHVl-69), SEQ ID NO:58 (Sh01G06 IGHVl-18 M69L), SEQ ID NO:60 (Sh01G06 IGHVl-18 M69L K64Q G44S), SEQ ID NO:40 (01G
  • an isolated antibody that binds hGDF15 comprises an immunoglobulin light chain variable region comprising an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire variable region or the FR sequence of SEQ ID NO:76 (01G06, Ch01G06 Chimeric), SEQ ID NO:78 (03G05), SEQ ID NO:80 (04F08), SEQ ID NO:82 (06C11, Ch06Cll Chimeric), SEQ ID NO:84 (08G01), SEQ ID NO:86 (14F11, Chl4Fll Chimeric), SEQ ID NO:88 (17B11), SEQ ID NO:90 (Hu01G06 IGKVl-39), SEQ ID NO:92 (Hu01G06 IGKVl-39 S43A V48I or H11OIGO6 IGKVl-39 Fl), SEQ ID NO:94 (Hu01G06 IGKVl-39 V48I), SEQ ID NO:94 (Hu01
  • Sequence identity may be determined in various ways that are within the skill of a person skilled in the art, e.g., using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
  • BLAST Basic Local Alignment Search Tool
  • analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al, (1990) PROC. NATL. ACAD. SCI. USA 87:2264-2268; Altschul, (1993) J. MOL. EVOL. 36:290-300; Altschul et al, (1997) NUCLEIC ACIDS RES.
  • immunoglobulin heavy chain variable region sequences and/or light chain variable region sequences that together bind human GDF15 may contain amino acid alterations (e.g., at least 1, 2, 3, 4, 5, or 10 amino acid substitutions, deletions, or additions) in the framework regions of the heavy and/or light chain variable regions.
  • the antibody binds hGDF15 with a K D of about 300 pM, 250 pM, 200 pM, 190 pM, 180 pM, 170 pM, 160 pM, 150 pM, 140 pM, 130 pM, 120 pM, 110 pM, 100 pM, 90 pM, 80 pM, 70 pM, 60 pM, 50 pM, 40 pM, 30 pM, 20 pM, or 10 pM, or lower.
  • K D values are determined by surface plasmon resonance methods or biolayer interferometry under the conditions described in Examples 8, 14, and 15.
  • a monoclonal antibody binds to the same epitope on hGDF15 (e.g., mature hGDF15 or cleaved rhGDF15) bound by one or more of the antibodies disclosed herein (e.g., antibodies 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1, or 17B1 1).
  • a monoclonal antibody competes for binding to hGDF 15 with one or more of the antibodies disclosed herein (e.g., antibody 01G06, 03G05, 04F08, 06C11, 08G01, 14F1 1, or 17B1 1).
  • Competition assays for determining whether an antibody binds to the same epitope as, or competes for binding with, an anti-GDF 15 antibody disclosed herein are known in the art.
  • Exemplary competition assays include immunoassays (e.g., ELISA assays, RIA assays), surface plasmon resonance analysis (e.g., using a BIAcoreTM instrument), biolayer
  • a competition assay involves the use of an antigen (e.g., a hGDF 15 protein or fragment thereof) bound to a solid surface or expressed on a cell surface, a test anti- GDF15-binding antibody and a reference antibody (e.g., antibody 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1, or 17B1 1).
  • the reference antibody is labeled and the test antibody is unlabeled.
  • Competitive inhibition is measured by determining the amount of labeled reference antibody bound to the solid surface or cells in the presence of the test antibody.
  • the test antibody is present in excess (e.g., lx, 5x, lOx, 20x or lOOx).
  • Antibodies identified by competition assay include antibodies binding to the same epitope, or similar (e.g., overlapping) epitopes, as the reference antibody, and antibodies binding to an adjacent epitope sufficiently proximal to the epitope bound by the reference antibody for steric hindrance to occur.
  • a reference anti-GDF15 antibody (e.g., antibody 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1, or 17B1 1) is biotinylated using commercially available reagents.
  • the biotinylated reference antibody is mixed with serial dilutions of the test antibody or unlabeled reference antibody (self-competition control) resulting in a mixture of various molar ratios (e.g., lx, 5x, lOx, 20x or lOOx) of test antibody (or unlabeled reference antibody) to labeled reference antibody.
  • the antibody mixture is added to a hGDF 15 polypeptide coated-ELISA plate.
  • HRP horseradish peroxidase
  • strepavidin horseradish peroxidase- strepavidin is added to the plate as the detection reagent.
  • the amount of labeled reference antibody bound to the target antigen is detected following addition of a chromogenic substrate (e.g., TMB (3,3',5,5'-tetramethylbenzidine) or ABTS (2,2"-azino-di-(3-ethylbenzthiazoline-6- sulfonate)), which are known in the art.
  • Optical density readings (OD units) are measured using a SpectraMax ® M2 spectrometer (Molecular Devices). OD units corresponding to zero percent inhibition are determined from wells without any competing antibody.
  • % inhibition (1- (OD units - 100% inhibition)/(0% inhibition - 100% inhibition ))* 100.
  • a competition assay may be conducted in both directions to ensure that the presence of the label does not interfere or otherwise inhibit binding. For example, in the first direction the reference antibody is labeled and the test antibody is unlabeled, and in the second direction, the test antibody is labeled and the reference antibody is unlabeled. [00177] A test antibody competes with the reference antibody for specific binding to the antigen if an excess of one antibody (e.g., lx, 5x, lOx, 20x or lOOx) inhibits binding of the other antibody, e.g., by at least 50%, 75%, 90%, 95% or 99%, as measured in a competitive binding assay.
  • an excess of one antibody e.g., lx, 5x, lOx, 20x or lOOx
  • Two antibodies bind to the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
  • Two antibodies bind to overlapping epitopes if only a subset of the amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
  • DNA molecules encoding light chain variable regions and/or heavy chain variable regions can be chemically synthesized using the sequence information provided herein.
  • Synthetic DNA molecules can be ligated to other appropriate nucleotide sequences, including, e.g., constant region coding sequences, and expression control sequences, to produce conventional gene expression constructs encoding the desired antibodies. Production of defined gene constructs is within routine skill in the art.
  • sequences provided herein can be cloned out of hybridomas by conventional hybridization techniques or polymerase chain reaction (PCR) techniques, using synthetic nucleic acid probes whose sequences are based on sequence information provided herein, or prior art sequence
  • Nucleic acids encoding desired antibodies can be incorporated (ligated) into expression vectors, which can be introduced into host cells through conventional transfection or transformation techniques.
  • Exemplary host cells are E.coli cells, Chinese hamster ovary
  • Transformed host cells can be grown under conditions that permit the host cells to express the genes that encode the immunoglobulin light and/or heavy chain variable regions.
  • Specific expression and purification conditions will vary depending upon the expression system employed. For example, if a gene is to be expressed in E.
  • coli it is first cloned into an expression vector by positioning the engineered gene downstream from a suitable bacterial promoter, e.g., Trp or Tac, and a prokaryotic signal sequence.
  • a suitable bacterial promoter e.g., Trp or Tac
  • the expressed secreted protein accumulates in refractile or inclusion bodies, and can be harvested after disruption of the cells by French press or sonication.
  • the refractile bodies then are solubilized, and the proteins refolded and cleaved by methods known in the art.
  • the engineered gene is to be expressed in eukayotic host cells, e.g., CHO cells, it is first inserted into an expression vector containing a suitable eukaryotic promoter, a secretion signal, a poly A sequence, and a stop codon.
  • the vector or gene construct may contain enhancers and introns.
  • This expression vector optionally contains sequences encoding all or part of a constant region, enabling an entire, or a part of, a heavy or light chain to be expressed.
  • the gene construct can be introduced into eukaryotic host cells using conventional techniques.
  • the host cells express VL or VH fragments, VL-VH heterodimers, VH-VL or VL-VH single chain polypeptides, complete heavy or light immunoglobulin chains, or portions thereof, each of which may be attached to a moiety having another function (e.g., cytotoxicity).
  • a host cell is transfected with a single vector expressing a polypeptide expressing an entire, or part of, a heavy chain (e.g., a heavy chain variable region) or a light chain (e.g., a light chain variable region).
  • a host cell is transfected with a single vector encoding (a) a polypeptide comprising a heavy chain variable region and a polypeptide comprising a light chain variable region, or (b) an entire immunoglobulin heavy chain and an entire immunoglobulin light chain.
  • a host cell is co- transfected with more than one expression vector (e.g., one expression vector expressing a polypeptide comprising an entire, or part of, a heavy chain or heavy chain variable region, and another expression vector expressing a polypeptide comprising an entire, or part of, a light chain or light chain variable region).
  • a polypeptide comprising an immunoglobulin heavy chain variable region or light chain variable region can be produced by growing (culturing) a host cell transfected with an expression vector encoding such a variable region, under conditions that permit expression of the polypeptide. Following expression, the polypeptide can be harvested and purified or isolated using techniques known in the art, e.g., affinity tags such as glutathione-S-transferase (GST) or histidine tags.
  • GST glutathione-S-transferase
  • a monoclonal antibody that binds hGDF15, or an antigen-binding fragment of the antibody can be produced by growing (culturing) a host cell transfected with: (a) an expression vector that encodes a complete or partial immunoglobulin heavy chain, and a separate expression vector that encodes a complete or partial immunoglobulin light chain; or (b) a single expression vector that encodes both chains (e.g., complete or partial heavy and light chains), under conditions that permit expression of both chains.
  • the intact antibody (or antigen-binding fragment) can be harvested and purified or isolated using techniques known in the art, e.g., Protein A, Protein G, affinity tags such as glutathione-S-transferase (GST) or histidine tags. It is within ordinary skill in the art to express the heavy chain and the light chain from a single expression vector or from two separate expression vectors.
  • antibodies and antibody fragments are known in the art.
  • the antibodies When the antibodies are to be administered to a human, the antibodies preferably are "humanized" to reduce or eliminate antigenicity in humans.
  • each humanized antibody has the same or substantially the same affinity for the antigen as the non-humanized mouse antibody from which it was derived.
  • chimeric proteins are created in which mouse immunoglobulin constant regions are replaced with human immunoglobulin constant regions. See, e.g., Morrison et al, 1984, PROC. NAT. ACAD. SCI. 81 :6851-6855, Neuberger et al, 1984, NATURE 312:604-608; U.S. Patent Nos. 6,893,625 (Robinson); 5,500,362 (Robinson); and 4,816,567 (Cabilly).
  • CDR grafting the CDRs of the light and heavy chain variable regions are grafted into frameworks from another species.
  • murine CDRs can be grafted into human FRs.
  • the CDRs of the light and heavy chain variable regions of an anti-GDF 15 antibody are grafted into human FRs or consensus human FRs.
  • consensus human FRs FRs from several human heavy chain or light chain amino acid sequences are aligned to identify a consensus amino acid sequence. CDR grafting is described in U.S. Patent Nos.
  • human CDR sequences are chosen from human germline genes, based on the structural similarity of the human CDRs to those of the mouse antibody to be humanized. See, e.g., U.S. Patent No. 6,881,557 (Foote); and Tan et al, 2002, J. IMMUNOL. 169: 1 1 19- 1 125.
  • ACTIVMABTM technology Vaccinex, Inc., Rochester, NY
  • a vaccinia virus-based vector to express antibodies in mammalian cells.
  • High levels of combinatorial diversity of IgG heavy and light chains are said to be produced. See, e.g., U.S. Patent Nos. 6,706,477 (Zauderer); 6,800,442 (Zauderer); and 6,872,518 (Zauderer).
  • any suitable approach including any of the above approaches, can be used to reduce or eliminate human immunogenicity of an antibody.
  • Fully human mAbs can also be prepared and optimized from phage display libraries by techniques referenced in, e.g., Knappik et al, J. MOL. BIOL. 296:57- 86, 2000; and Krebs et al, J. Immunol. Meth. 254:67-84 2001).
  • the antibodies disclosed herein can be used to treat a variety of disorders, for example, cachexia and/or sarcopenia.
  • the antibodies disclosed herein e.g., 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1, or 17B1 1
  • the antibodies disclosed herein are used to inhibit the loss of muscle mass, for example, the loss of muscle mass associated with an underlying disease.
  • Underlying diseases associated with cachexia include, but are not limited to, cancer, chronic heart failure, chronic kidney disease, COPD, AIDS, multiple sclerosis, rheumatoid arthritis, sepsis, and tuberculosis.
  • the disclosed antibodies inhibit loss of muscle mass by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100%.
  • a loss of muscle mass is accompanied by a loss of fat mass.
  • the antibodies disclosed herein e.g., 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1, or 17B1 1
  • the antibodies disclosed herein are used to treat one or more features accompanying cachexia and/or sarcopenia, e.g., involuntary body weight loss.
  • the antibodies revert involuntary body weight loss by at least 2%, 5%, 10%, 15%, 20%, 25%, 30% or 35%.
  • the antibodies disclosed herein are used to inhibit loss of organ mass, for example, loss of organ mass associated with an underlying disease.
  • Underlying diseases associated with cachexia include, but are not limited to, cancer, chronic heart failure, chronic kidney disease, COPD, AIDS, multiple sclerosis, rheumatoid arthritis, sepsis, and tuberculosis.
  • the disclosed antibodies inhibit loss of organ mass by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100%.
  • loss of organ mass is observed in heart, liver, kidney, and/or spleen.
  • the loss of organ mass in accompanied by a loss of muscle mass, a loss of fat mass and/or involuntary weight loss.
  • Antibody 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F 11, or 17B1 1 can be used in therapy.
  • antibody 01G06, 03G05, 04F08, 06C11, 08G01, 14F1 1, or 17B11 can be used to treat cachexia and/or sarcopenia.
  • Use of antibody 01G06, 03G05, 04F08, 06C11, 08G01, 14F1 1, or 17B1 1 to treat cachexia and/or sarcopenia in a mammal comprises administering to the mammal a therapeutically effective amount of the antibody.
  • one or more of the anti-GDF antibodies of the invention can be used to treat a subject suffering from, or who has been diagnosed with, sarcopenia, a muscle wasting disorder and/or significant muscle weight loss, whether or not the subject has, or has been diagnosed with, cachexia or decreased appetite.
  • Such a method comprises administering a therapeutically effective amount of one or more antibodies of the invention to the subject in need thereof.
  • the Fc-rhGDF15 fusion proteins disclosed herein can be used to treat obesity.
  • the hFc-rhGDF15 fusion proteins disclosed herein are used to inhibit weight gain or to reduce body weight by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50%.
  • Use of an hFc-hGDF15 fusion protein to treat obesity in a mammal comprises administering to the mammal a therapeutically effective amount of the fusion protein.
  • treat means the treatment of a disease in a mammal, e.g., in a human. This includes: (a) inhibiting the disease, i.e., arresting its development; and (b) relieving the disease, i.e., causing regression of the disease state.
  • a therapeutically effective amount of an active component is in the range of 0.1 mg/kg to 100 mg/kg, e.g., 1 mg/kg to 100 mg/kg, e.g., 1 mg/kg to 10 mg/kg, e.g., 2.0 mg/kg to 10 mg/kg.
  • the amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health of the patient, the in vivo potency of the antibody or fusion protein, the pharmaceutical formulation, the serum half-life of the antibody or fusion protein, and the route of administration.
  • the initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level.
  • the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment.
  • Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study designed to run from 0.5 mg/kg to 20 mg/kg.
  • Dosing frequency can vary, depending on factors such as route of administration, dosage amount, serum half-life of the antibody or fusion protein, and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks. In some embodiments, dosing is once every two weeks.
  • a preferred route of administration is parenteral, e.g., intravenous infusion. Formulation of monoclonal antibody-based drugs and fusion protein-based drugs are within ordinary skill in the art.
  • the antibody or fusion protein is lyophilized, and then reconstituted in buffered saline, at the time of administration.
  • a second active agent for example, an anti-cancer agent or the other agents discussed below, will also follow the principles discussed hereinabove and will be chosen so as to elicit the required therapeutic benefit in the patient.
  • an antibody preferably is combined with a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient.
  • Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art.
  • compositions containing antibodies or fusion proteins can be presented in a dosage unit form and can be prepared by any suitable method.
  • a pharmaceutical composition should be formulated to be compatible with its intended route of administration. Examples of routes of administration are intravenous (IV), intradermal, inhalation, transdermal, topical, transmucosal, and rectal administration. A preferred route of administration for monoclonal antibodies is IV infusion.
  • Useful formulations can be prepared by methods known in the pharmaceutical art. For example, see Remington 's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).
  • Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl paraben
  • antioxidants such as ascorbic acid or sodium bisulfite
  • chelating agents such as EDTA
  • buffers such as acetates, citrates or phosphates
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
  • the carrier should be stable under the conditions of manufacture and storage, and should be preserved against microorganisms.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol), and suitable mixtures thereof.
  • composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.
  • cytokines implicated in cachexia include Activin A and IL-6. Increased activin levels have been associated with cancer-associated cachexia and gonadal tumors. See, e.g., Marino et al. (2013) CYTOKINE & GROWTH FACTOR REV. 24:477-484.
  • Activin A is a member of the TGF- beta family, and is a ligand of the activin type 2 receptor, ActRIIB. See, e.g., Zhou et al.
  • Circulating levels of IL-6 have been shown to correlate with weight loss in cancer patients, as well as with reduced survival. See, e.g., Fearon et al. (2012) CELL METABOLISM 16: 153-166.
  • one or more inhibitors of Activin-A or the Activin-A receptor, ActRIIB, IL-6 or the IL-6 receptor (IL-6R) may be administered in combination with (for example, administered at the same time as, administered before, or administered after) an antibody of the present invention that inhibits GDF-15 activity.
  • Exemplary inhibitors of Activin A or ActRIIB include, for example, an anti- Activin-A antibody or an antigen binding fragment thereof, an anti -ActRIIB antibody or an antigen binding fragment thereof, a small molecule inhibitor of Activin-A, a small molecule inhibitor of ActRIIB, and a 'decoy' receptor of ActRIIB, such as a soluble ActRIIB receptor and a fusion of the soluble ActRIIB receptor with an Fc molecule (ActRIIB-Fc). See, for example, Zhou et al. (2010), supra.
  • Suitable inhibitors of IL-6 or IL-6R include an anti-IL-6 antibody or an antigen binding fragment thereof, an anti-IL-6R antibody or an antigen binding fragment thereof, a small molecule inhibitor of IL-6, a small molecule inhibitor of IL-6R, and a 'decoy' receptor of IL-6R, such as a soluble IL-6 receptor and a fusion of the soluble IL-6 receptor with an Fc molecule (IL6R-Fc).
  • IL6R-Fc Fc molecule
  • Suitable inhibitors of IL-6 or IL-6R may include, for example, Tocilizumab (Actemra®, Hoffmann-LaRoche), a humanized anti-IL-6R monoclonal antibody approved for treatment of rheumatoid arthritis, and
  • Sarilumab/REGN88 (Regeneron), a humanized anti-IL6R antibody in clinical development for treatment of rheumatoid arthritis; and Selumetinib/ AZD6244 (AstraZeneca), an allosteric inhibitor of MEK, which has been shown to inhibit IL-6 production. Prado et al. (2012) BRITISH J. CANCER 106: 1583-1586.
  • TNFa and IL-1 are cytokines known to be involved in mediation of the
  • TNFa also known as "cachectin”
  • IL-1 is a potent trigger of the acute-phase inflammatory response, and it has been shown that infusion of IL-1 can lead to marked weight loss and appetite loss.
  • IL-1 has been shown to contribute to the initiation of cancer cachexia in mice bearing a murine colon-26 adenocarcinoma (Strassmann et al. (1993) J. IMMUNOL. 150:2341).
  • TNFa inhibitors and IL- 1 inhibitors that are used in the treatment of rheumatoid arthritis may also be useful in the treatment of cachexia.
  • one or more inhibitors of TNFa or IL-1 may be administered in combination with (for example, administered at the same time as, administered before, or administered after) an antibody of the present invention that inhibits GDF-15 activity.
  • Suitable inhibitors of TNFa or IL-1 include an anti-TNFa antibody or an antigen binding fragment thereof, an anti-IL- 1 antibody or an antigen binding fragment thereof, a small molecule inhibitor of TNFa or IL-1, and a 'decoy' receptor of TNFa or IL-1, such as a soluble TNFa or IL-1 receptor and a fusion of the soluble form of TNFa or IL- 1 with an Fc molecule.
  • Suitable inhibitors of TNFa include for example, etanercept (Enbrel®, Pfizer/Amgen), infliximab (Remicade®, Janssen Biotech), adalimumab (Humira®, Abbvie), golimumab (Simponi®, Johnson and Johnson/Merck), and certolizumab pegol (Cimzia®, UCB).
  • Suitable IL-1 inhibitors include, for example, Xilonix® antibody that targets IL-1 a (XBiotech), anikinra (Kinaret®, Amgen), canakinumab (Ilaris®, Novartis), and rilonacept (Arcalyst®, Regeneron).
  • the TNFa inhibitor or IL-1 inhibitor which is typically administered systemically for the treatment of rheumatoid arthritis may be administered locally and directly to the tumor site.
  • Myostatin also known as GDF-8, is a member of the TGF- ⁇ family of peptides that is a negative regulator of muscle mass, as shown by increased muscle mass in myostatin deficient mammals.
  • Myostatin is a ligand of the activin type 2 receptor, ActRllB.
  • one or more inhibitors of myostatin or its receptor may be administered in combination with (for example, administered at the same time as, administered before, or administered after) an antibody of the invention that inhibits GDF-15 activity.
  • Suitable inhibitors of myostatin or ActRllB include an anti- myostatin antibody or an antigen binding fragment thereof, an anti-ActRIIB antibody or an antigen binding fragment thereof, a small molecule inhibitor of myostatin, a small molecule inhibitor of ActRllB, and a 'decoy' receptor of GDF-8, such as a soluble ActRllB and a fusion of the soluble form of ActRllB with an Fc molecule.
  • Myostatin inhibitors that may be suitable for the present invention include REGN1033 (Regeneron); see Bauerlein et al. (2013) J. CACHEXIA SARCOPENIA MUSCLE: Abstracts of the 7 th Cachexia Conference, Kobe/Osaka, Japan, December 9-11, 2013, Abstract 4-06; LY2495655 (Lilly), a humanized anti-myostatin antibody in clinical development by Eli Lilly; see also "A PHASE 2 STUDY OF LY2495655 IN PARTICIPANTS WITH PANCREATIC CANCER,” available on the world wide web at
  • Ghrelin or ghrelin mimetics may be useful for increasing food intake and body weight in humans.
  • GHS-Rla growth hormone secretagogues
  • Suitable ghrelin mimetics include anamorelin (Helsinn, Lugano, CH); See Temel et al. (2013) J.
  • GHS molecules can be identified, for example, using the growth hormone secretagogue receptor Ghrelin competition assay described in PCT Publication Nos.
  • Agonists of the androgen receptor may be useful in treating cachexia and/or sarcopenia. See, e.g., Mohler et al. (2009) J. MED. CHEM. 52:3597-3617; Nagata et al. (2011) BlOORGANIC AND MED. CHEM. LETTERS 21 : 1744-1747; and Chen et al. (2005) MOL. INTERV. 5: 173-188.
  • SARMs should act as full agonists, like testosterone, in anabolic target tissues, such as muscle and bone, but should demonstrate only partial or pure androgen receptor antagonistic activities on prostate tissue.
  • Suitable SARMs can be identified, for example, by use of the methods and assays described in Zhang et al. (2006) BlOORG. MED. CHEM. LETT. 16:5763-5766; and Zhang et al. (2007) BlOORG. MED. CHEM. LETT. 17:439-443.
  • Suitable SARMs include, for example, GTx- 024 (enobosarm, Ostarine®, GTx, Inc.), a SARM in phase II clinical development by GTx, Inc. See also, Dalton et al. (2011) J. CACHEXIA SARCOPENIA MUSCLE 2: 153-161.
  • Other suitable SARMs include 2-(2,2,2)-trifluoroethyl-benzimidazoles (Ng et al. (2007) BlOORG. MED.
  • beta-blockers have been studied for their effect on body weight in cachexic subjects, and have been associated with partial reversal of cachexia in patients with congestive heart failure. See, e.g., Hryniewicz et al. (2003) J. CARDIAC
  • Beta-blocker MT-102 (PsiOxus Therapeutics, Ltd.) has been evaluated in a phase 2 clinical trial for subjects with cancer cachexia. See Coats et al. (2011) J. CACHEXIA SARCOPENIA MUSCLE 2:201-207.
  • one or more inhibitors of a melanocortin peptide or a melanocortin receptor may be administered in combination (for example, administered at the same time as, administered before, or administered after) with an antibody of the invention that inhibits GDF- 15 activity.
  • Suitable inhibitors of melanocortins or melanocortin receptors include an anti- melanocortin peptide antibody or an antigen binding fragment thereof, an anti-melanocortin receptor antibody or an antigen binding fragment thereof, a small molecule inhibitor of a melanocortin peptide, a small molecule inhibitor of a melanocortin receptor, and a 'decoy' receptor of a melanocortin receptor, such as soluble melanocortin receptor and a fusion of a soluble melanocortin receptor with an Fc molecule.
  • Suitable melacortin receptor inhibitors include, for example, the melanocortin receptor antagonist agouri-related peptide (AgRP(83- 132)), which has been demonstrated to prevent cachexia-related symptoms in a mouse model of cancer-related cachexia ( oppa et al. (2007) PEPTIDES 28:636-642).
  • AgRP(83- 132) the melanocortin receptor antagonist agouri-related peptide
  • Anti-cancer agents especially those that can cause cachexia and elevate GDF- 15 levels, such as cisplatin, may be used in methods of the present invention in combination with (for example, administered at the same time as, administered before, or administered after) an anti-GDF-15 antibody of the invention.
  • Many cancer patients are weakened by harsh courses of radio- and/or chemotherapy, which can limit the ability of the patient to tolerate such therapies, and hence restrict the dosage regimen.
  • Certain cancer agents themselves, such as fluorouracil, Adriamycin, methotrexate and cisplatin may contribute to cachexia, for example by inducing severe gastrointestinal complications. See, e.g., Inui (2002) CANCER J. FOR CLINICIANS 52:72-91.
  • an anti-cancer agent is administered in combination with an anti-GDF-15 antibody of the invention, it is possible to decrease the incidence and/or severity of cachexia, and ultimately increase the maximum tolerated dose of such an anti-cancer agent. Accordingly, efficacy of treatment with anti-cancer agents that may cause cachexia can be improved by reducing the incidence of cachexia as a dose-limiting adverse effect, and by allowing administration of higher doses of a given anticancer agent.
  • the present invention includes pharmaceutical compositions comprising an anti-GDF-15 antibody of the present invention in combination with an agent selected from the group consisting of: an inhibitor of Activin-A, an inhibitor of ActRIIB, an inhibitor of IL-6 or an inhibitor of IL-6R, a ghrelin, a ghrelin mimetic or a GHS-Rla agonist, a SARM, a TNFa inhibitor, an IL-la inhibitor, a myostatin inhibitor, a beta-blocker, a melanocortin peptide inhibitor, a melanocortin receptor inhibitor, and an anti-cancer agent.
  • an agent selected from the group consisting of: an inhibitor of Activin-A, an inhibitor of ActRIIB, an inhibitor of IL-6 or an inhibitor of IL-6R, a ghrelin, a ghrelin mimetic or a GHS-Rla agonist, a SARM, a TNFa inhibitor, an IL-la inhibitor, a
  • the present invention also includes methods of treating, preventing or minimizing cachexia and/or sarcopenia in a mammal comprising administering to a mammal in need thereof a pharmaceutical composition or compositions comprising an effective amount of an anti-GDF-15 antibody of the invention in combination with an effective amount of an inhibitor of Activin-A, an inhibitor of ActRIIB, an inhibitor of IL-6 or an inhibitor of IL-6R, a ghrelin, a ghrelin mimetic or a GHS-Rla agonist, a SARM, a TNFa inhibitor, an IL-la inhibitor, a myostatin inhibitor, a beta-blocker, a melanocortin peptide inhibitor, or a melanocortin receptor inhibitor.
  • the invention comprises a method of inhibiting loss of muscle mass associated with an underlying disease comprising administering to a mammal in need thereof a pharmaceutical composition or compositions comprising an effective amount of an anti-GDF-15 antibody of the invention in combination with an effective amount of an inhibitor of Activin-A, an inhibitor of ActRIIB, an inhibitor of IL-6 or an inhibitor of IL-6R, a ghrelin, a ghrelin mimetic or a GHS-Rla agonist, a SARM, a TNFa inhibitor, an IL-la inhibitor, a myostatin inhibitor, a beta-blocker, a melanocortin peptide inhibitor, or a melanocortin receptor inhibitor to prevent or reduce loss of muscle mass.
  • the underlying disease may be selected from the group consisting of cancer, chronic heart failure, chronic kidney disease, COPD, AIDS, multiple sclerosis, rheumatoid arthritis, sepsis, and tuberculosis. Additionally, in certain embodiments, the loss of muscle mass is accompanied by a loss of fat mass.
  • the present invention comprises a method of inhibiting or reducing involuntary weight loss in a mammal comprising administering to a mammal in need thereof a pharmaceutical composition or pharmaceutical compositions comprising an effective amount of an anti-GDF-15 antibody of the invention in combination with an effective amount of an inhibitor of Activin-A, an inhibitor of ActRIIB, an inhibitor of IL-6 or an inhibitor of IL-6R, a ghrelin, a ghrelin mimetic or a GHS-Rla agonist, a SARM, a TNFa inhibitor, a IL-la inhibitor, a myostatin inhibitor, a beta-blocker, a melanocortin peptide inhibitor, or a melanocortin receptor inhibitor.
  • the present invention comprises a method of treating cancer, while preventing, minimizing or reducing the occurrence, frequency or severity of cachexia, sarcopenia, or muscle wasting, bone wasting or involuntary loss of body weight in a mammal, comprising administering to a mammal in need thereof a pharmaceutical composition comprising an effective amount of an anti-GDF-15 antibody of the present invention in combination with with one or more anti-cancer agents.
  • the invention comprises a method of treating cancer, while preventing, minimizing or reducing the occurrence, frequency or severity of cachexia, sarcopenia or muscle wasting, bone wasting or involuntary loss of body weight in a mammal, comprising administering to a mammal in need thereof a pharmaceutical composition comprising an effective amount of an anti-GDF-15 antibody of the invention in combination with one or more anti-cancer agents known to cause or increase the occurrence, frequency or severity of cachexia, sarcopenia, or muscle wasting, bone wasting or involuntary loss of body weight in a mammal.
  • the amount of hGDF 15 in the serum of mice bearing various xenograft tumors was measured. Serum was collected from three mice for each of the following tumor xenograft models: Chago, RPMI7951, PC3, TOV21G, HT-1080, K-562, and LS1034. Serum was also collected from three naive mice as a control. Human GDF15 serum levels were determined by ELISA (R&D Systems, Cat. No. DY957E).
  • mice bearing human xenograft tumors that induce cachexia had serum levels of hGDF 15 above 2 ng/mL, while mice bearing human xenograft tumors that do not induce cachexia had serum levels of hGDF 15 below 1 ng/mL (FIG. 2). Naive mice had no detectable hGDF 15 (control). These results indicate that a serum level of approximately 2 ng/mL GDF15 is a threshold for inducing cachexia in this mouse model. Similar levels of hGDF 15 were also observed in plasma when determined by ELISA.
  • Example 2 Non-Tumor Bearing Mouse Model of Cachexia
  • rhGDF15 corresponds to amino acids 197 to 308 of hGDF 15 protein.
  • Mature rhGDF15 can be produced in the yeast Pichia pastoris as described in Fairlie et al. (2000) GENE 254:67-76).
  • Cleaved-rhGDF15 corresponds to amino acids 197 to 308 of hGDF15 protein released from an Fc-rhGDF15 fusion protein.
  • cleaved-rhGDF 15 was produced by enzymatic digestion of mFc-rhGDF 15 fusion protein with Factor Xa, and subsequent purification, prior to injection in mice.
  • cleaved-rhGDF15 To investigate the half-life of cleaved-rhGDF15, plasma was collected from a group of three mice after single dose of cleaved-rhGDF 15 (1 ⁇ ) at different time points (2, 5, 8, 11, and 23 hours). Human GDF15 plasma levels were determined by ELISA (R&D Systems, Cat. No. DY957E). As shown in FIG. 3, cleaved-rhGDF 15 was rapidly cleared from the plasma following injection. Eleven hours post- injection, the amount of cleaved-rhGDF 15 in the plasma was below 10 ng/mL, and, within 23 -hours, cleaved-rhGDF 15 was almost completely cleared from the plasma.
  • mice The rapid clearance of cleaved-rhGDF 15 in non-tumor bearing mice was further investigated. Eight- week old female ICR-SCID mice were randomized into two groups often mice each. Mice were dosed subcutaneously into the flank every eight hours for three days (a total of nine doses) with one of the following treatments: PBS (control) or cleaved-rhGDF 15 at 1 ⁇ . Body weight was measured daily. Statistical analyses were performed using a two- way ANOVA.
  • mice treated with multiple doses of PBS demonstrated a body weight drop due to the stress of repeated dosing and handling.
  • the GDF15 fusion proteins were designed using methods known in the art.
  • the mFc-rhGDF15 DNA sequences were constructed from fragments using overlap extension PCR to include (in the following order): 5' Hindlll restriction site, Kozak consensus sequence, amino terminal signal sequence, mouse IgGl Fc, Factor Xa cleavage site, a polypeptide linker (GGGGS) (SEQ ID NO: 139), mature hGDF15, stop codon, and a 3' EcoRI restriction site.
  • the rFc-rmGDF15 amino acid sequences were converted to codon-optimized DNA sequences and synthesized to include (in the following order): 5' Hindlll restriction site, Kozak consensus sequence, amino terminal signal sequence, rabbit IgGl Fc, a polypeptide linker (GGGG) (SEQ ID NO: 265), mature mouse GDF15, stop codon, and a 3 ' EcoRI restriction site.
  • the GDF15 fusion proteins were subcloned into the mammalian expression vector pEE14.4 (Lonza, Basel, Switzerland) via Hindlll and EcoRI sites using In-FusionTM PCR cloning (Clontech, Mountain View, CA). GDF15 fusion proteins were stably expressed in CHOK1 SV cells using the GS SystemTM (Lonza Biologies) in order to produce large quantities of purified protein. Each expression vector was linearized and transfected into CHOK1SV cells. Stable clones were selected in the presence of methionine sulfoximine. Secreted proteins produced by CHOK1SV stably transfected cell lines were purified by Protein A and size exclusion chromatography.
  • mFc-rhGDF 15 contains mouse IgGl Fc from amino acids 1-222, Factor Xa cleavage site from amino acids 223-228, an artificial linker sequence from amino acids 229-233, and mature hGDF15 from amino acids 234-345.
  • rFc-rmGDF 15 contains rabbit IgGl Fc from amino acids 1-223, an artificial linker sequence from amino acids 224-227, and mature mouse GDF 15 from amino acids 228-342.
  • hFc-rhGDF15 The following sequences represent exemplary protein sequences for human IgGl Fc-mature human GDF15 fusion proteins (hFc-rhGDF15).
  • hFc-rhGDF15 Xa consists of human IgGl Fc from amino acids 1-227, Factor Xa cleavage site from amino acids 228-233, an artificial linker sequence from amino acids 234-238, and mature hGDF15 from amino acides 239-350.
  • hFc-rhGDF15 consists of human IgGl Fc from amino acids 1-227, an artificial linker sequence from amino acids 228-232, and mature hGDF15 from amino acids 233-344.
  • This Example describes the generation of an Fc-GDF 15 -induced cachexia model in mice.
  • Immune-competent (Balb/C) and immune-incompetent (CB17-Scid) mice were randomized into three groups often mice each. Each group received one of the following treatments: PBS (control), mFc-rhGDF15 (as described in Example 3), or rFc-rmGDF15 (as described in Example 3) at l ⁇ g/g.
  • Eight-week old female mice were dosed subcutaneously into the flank for three days (Balb/C) or once (CB17-Scid). Body weight was measured daily.
  • fusion proteins mFc-rhGDF15 and rFc-rmGDF15
  • ICR- SCID immune-incompetent mice strains.
  • the administration of mFc-rhGDF 15 or rFc- rmGDF15 induced cachexia, as measured by body weight loss. Similar results were obtained regardless of whether mFc-rhGDF 15 was dosed subcutaneously or intraperitoneally.
  • mice of different ages 7, 13 and 25 weeks old were divided into two groups of ten and treated with three doses per day of mFc-rhGDF 15 or PBS (0.8 ⁇ , 7 week old mice; 0.6 ⁇ , 13 week old mice; or 0.4 ⁇ , 25 week old mice).
  • mFc-rhGDF 15 -induced weight loss was observed in all three mice age populations. In each age population, the mice lost approximately 10% of their body weight following treatment with mFc-rhGDF 15 measured at ten days post treatment.
  • mFc-rhGDF 15 induction of cachexia was investigated by measuring the loss of body weight, the loss of muscle mass, the loss of fat mass, and the expression levels of two molecular markers indicative of muscle degradation (i.e., mMuRF l and mAtrogin).
  • MuRFl and Atrogin are E3-ubquitin ligases that are upregulated in multiple models of muscle atrophy and cachexia (Glass, D. (2010) CURR. OPIN. CLIN. NUTR. MET. CARE 13 :225-229).
  • mice Eight-week old female ICR-SCID mice were randomly divided into ten groups of ten mice each. Five groups (ten mice each) were dosed subcutaneous ly in the flank with PBS (control) and five groups (ten mice each) were dosed subcutaneously in the flank with mFc- rhGDF15 at 1.6 ⁇ g/g on day one. Body weight was measured daily for up to 17 days. One control group and one treatment group were sacrificed at different time points (0, 1, 3, 7 and 16 days post dose). Gonadal fat and gastrocnemius muscles were removed surgically from each group of mice at the indicated sacrifice time, and weighed. Tissues were snap frozen in liquid nitrogen, and RNA was isolated from the gastrocnemius muscle samples. Levels of mMuRFl and mAtrogin mRNA were measured by qRT-PCR in samples corresponding to groups collected after 1, 7, and 16 days post dose. Statistical analyses were performed using a two- way ANOVA.
  • mFc-rhGDF 15 induced body weight loss in ICR-SCID mice. Percent body weight was 79.4 percent when measured after 16 days following one dose of mFc-rhGDF 15 (p ⁇ 0.001). mFc-rhGDF 15 also induced loss of fat (adipose tissue), as observed by the loss of gonadal fat (FIG. 6B; p ⁇ 0.01 at day 7 and p ⁇ 0.001 at day 16) and loss of muscle, as observed by the loss of gastrocnemius muscle (FIG. 6C; p ⁇ 0.05 at days 1 and 3, and p ⁇ 0.0001 at days 7 and 16).
  • mFc-rhGDF 15 also elevated gene expression of two enzymes associated with muscle degradation and cachexia, mMuRFl (FIG. 6D; 6 ⁇ 0.001 at days 1, 7, and 16) and mAtrogin (FIG. 6E; p ⁇ 0.001 at days 1 and 7, and p ⁇ 0.01 at day 16).
  • the serum hGDF 15 levels were measured following administration of mFc-rhGDF 15, to determine the half-life of rhGDF15 in this model.
  • Eight- week old female Balb/C nude mice were randomly divided into two groups of twelve mice each. Mice were dosed subcutaneously in the flank every twelve hours for three days (a total of six doses) with one of the following treatments: PBS (control) or mFc-rhGDF 15 at 1.33 ⁇ g/g.
  • Body weight was measured daily.
  • mFc-rhGDF 15 induced sustained body weight loss for at least one week after the final injection.
  • hGDF15 serum levels were measured 0.2, 5, and 8 days after the last dose of mFc-rhGDF15. Mice were sacrificed at the indicated time, and sera were collected. Human GDF15 serum levels were determined by ELISA (R&D Systems, Cat. No. DY957E). Table 1 provides the serum levels ⁇ g/mL) for each mouse in the study.
  • Serum samples from day 0.2 and day 5 after the last dose were also analyzed by Western blot (reducing gel; blot with an antibody against hGDF15 (R&D Systems, Cat. No AF957)) and quantified by Licor to determine the stability of mFc-rhGDF 15 in the serum. Unexpectedly, two bands were observed. The upper band was approximately 40 kDa, and appeared to be mFc-rhGDF 15. The lower band was approximately 15 kDa, and appeared to be cleaved mature rhGDF15. This indicated that mature rhGDF15 was released from mFc- rhGDF 15 in the serum.
  • Quantification of the two bands showed that about 90% of the rhGDF15 present in the serum was in the form of mFc-rhGDF 15, with about 10% of the total rhGDF15 in the serum being present as the cleaved mature form (FIG. 8). Quantification showed a slight decrease in mFc-rhGDF15 in the serum samples collected five days after the last dose, but, surprisingly, a constant level of mature rhGDF 15 remained in the serum. The ratio of mature rhGDF 15 to mFc-rhGDF 15 slightly increased over time, as a result of a decrease in mFc-rhGDF 15 in the serum. Similar results were observed when rFc-rmGDF15 was injected into mice.
  • a single dose of mFc-rhGDF 15 at 0.1 ⁇ g/g was sufficient to induce significant body weight loss for at least eight days (FIG. 9A; ten ICR-SOD mice dosed intrapertioneally with 0.1 ⁇ g/g on day 1).
  • the data in Table 1 revealed that rhGDF 15 serum levels were stable for at least eight days, when rhGDF 15 was administered as an mFc-rhGDF 15 fusion protein.
  • mice dosed with 0.1 ⁇ g/g mFc-rhGDF 15 served as an internal control, because these mice had sustained body weight loss indicating that at least one of the two forms must be active.
  • This Example describes the production of anti-GDF15 monoclonal antibodies. Immunizations, fusions, and primary screens were conducted using conventional methods following the Repetitive Immunization Multiple Sites (RTMMS) protocol. Five AJ mice and five Balb/c mice were immunized with 6XHis (SEQ ID NO: 266) tagged recombinant human GDF15 (His-rhGDF 15) (R&D Systems, Inc., Minneapolis, MN). Two Balb/c mice with sera displaying the highest anti-GDF 15 activity by Enzyme Linked Immunosorbent Assay (ELISA) were chosen for subsequent fusion. Spleens and lymph nodes from the appropriate mice were harvested.
  • RTMMS Repetitive Immunization Multiple Sites
  • B-cells were harvested and fused with a myeloma line. Fusion products were serially diluted onto forty 96-well plates to near clonality. Two AJ mice with sera displaying the highest anti-GDF15 activity by ELISA were chosen for subsequent fusion. Spleens and lymph nodes from the appropriate mice were harvested. B-cells were harvested and fused with a myeloma line. Fusion products were serially diluted onto forty 96-well plates to near clonality.
  • the light chain isotype and heavy chain isotype of each monoclonal antibody in Example 6 was determined using the IsoStripTM Mouse Monoclonal Antibody Isotyping Kit according the kit vendor's instructions (Roche Applied Science, Indianapolis, IN). All antibodies were found to be kappa light chain, and IgGl or IgG2b heavy chain.
  • the heavy and light chain variable regions of the mouse monoclonal antibodies were sequenced using 5' RACE (Rapid Amplification of cDNA Ends).
  • Total RNA was extracted from each monoclonal hybridoma cell line using the RNeasy ® Miniprep kit according to the kit vendor's instructions (Qiagen, Valencia, CA).
  • Full-length first strand cDNA containing 5 ' ends was generated using the SMART erTM RACE cDNA Amplification Kit (Clontech, Mountain View, CA) according to the kit vendor's instructions for 5' RACE.
  • variable regions of the light (kappa) and heavy (IgGlor IgG2b) chains were amplified by PCR using KOD Hot Start Polymerase (EMD Chemicals, Gibbstown, NJ) according to the kit vendor's instructions.
  • KOD Hot Start Polymerase EMD Chemicals, Gibbstown, NJ
  • the Universal Primer Mix A primer (Clontech), a mix of:
  • 5' CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT 3' was used as a 5' primer.
  • Heavy chain variable regions were amplified using the above 5' primers and a 3 ' IgGl constant region specific primer, 5' TATGCAAGGCTTACAACCACA 3 ' (SEQ ID NO:226), or a 3 ' IgG2b constant region specific primer, 5' AGGACAGGGGTTGATTGTTGA 3' (SEQ ID NO:227).
  • Kappa chain variable regions were first amplified with the above 5' primers and a 3 ' kappa constant region specific primer, 5' CTCATTCCTGTTGAAGCTCTTGACAAT 3' (SEQ ID NO:228).
  • the light chains were subjected to a second, nested, round of PCR using the Nested Universal Primer A (Clontech) 5' primer, 5' AAGCAGTGGTATCAACGCAGAGT 3 ' (SEQ ID NO:229) and a nested 3 ' kappa constant region specific primer, 5' CGACTGAGGCACCTCCAGATGTT 3 ' (SEQ ID NO:229)
  • PCR products were either purified using the Qiaquick ® PCR Purification kit or isolated by agarose gel electrophoresis and purified using the Qiaquick ® Gel Purification kit according to the kit vendor's instructions (Qiagen). The PCR products were subsequently cloned into the pCR ® 4Blunt plasmid using the Zero Blunt ® TOPO ® PCR Cloning according to the kit vendor's instructions (Invitrogen) and transformed into DH5-a bacteria (Invitrogen) through standard molecular biology techniques. Plasmid DNA isolated from transformed bacterial clones was sequenced using Ml 3 Forward
  • variable region sequences 5' CAGGAAACAGCTATGACC 3 ') (SEQ ID NO:232) by Beckman Genomics (Danvers, MA), using standard dideoxy DNA sequencing methods to identify the sequence of the variable region sequences.
  • the sequences were analyzed using Vector NTI software (Invitrogen) and the IMGT/V-Quest web server (imgt.cines.fr) to identify and confirm variable region sequences.
  • nucleic acid sequences encoding and the protein sequences defining variable regions of the murine monoclonal antibodies are shown below (amino terminal signal peptide sequences are not shown).
  • CDR sequences are indicated by bold font and underlining in the amino acid sequences.
  • Protein Sequence Defining the Heavy Chain Variable Region of the 01G06 Antibody (SEQ ID NO:40) 1 evllqqsgpe lvkpgasvki pckasgytft dynmdwvkqs hgkslewigg inpnnggiff 61 nqkfkgkatl tvdkssntaf mevrsltsed tavyycarea i vgamdyw gqgtsvtvss
  • Table 2 shows the SEQ ID NO. of each sequence discussed in this Example.
  • each variable sequence above is combined with its respective constant region.
  • a complete heavy chain comprises a heavy variable sequence followed by the murine IgGl or IgG2b heavy chain constant sequence
  • a complete kappa chain comprises a kappa variable sequence followed by the murine kappa light chain constant sequence.
  • sequences represent the actual or contemplated full length heavy and light chain sequence (i.e., containing both the variable and constant regions sequences) for each antibody described in this Example.
  • Signal sequences for proper secretion of the antibodies e.g., signal sequences at the 5' end of the DNA sequences or the amino terminal end of the protein sequences
  • stop codons for termination of translation required at the 3 ' end of the DNA sequences. It is within ordinary skill in the art to select a signal sequence and/or a stop codon for expression of the disclosed full length immunoglobulin heavy chain and light chain sequences.
  • the variable region sequences can be ligated to other constant region sequences to produce active full length immunoglobulin heavy and light chains.
  • Variable Region and Constant Region of 03G05 (SEP ID NO: 106) 1 divltqspas lavslgqrat iscrasesvd nygisfmnwf qqkpgqppkl liyaasnqgs
  • Table 5 shows the correspondence between the full-length sequences of the antibodies discussed in this Example with those presented in the Sequence Listing.
  • Buffer, mFc-rhGDF15, cleaved- rhGDF15, His-rhGDF15, or rhGDF 15 diluted in running buffer was injected sequentially over a reference surface (no antibody captured) and the active surface (antibody to be tested) for 240 seconds at 60 ⁇ / ⁇ .
  • the dissociation phase was monitored for up to 1500 seconds.
  • the surface was then regenerated with two 60-second injections of 10 mM Glycine-HCl, pH 1.7, at a flow rate of 30 ⁇ / ⁇ .
  • the GDF15 concentration range tested was 30 nM to 0.625 nM.
  • Kinetic parameters were determined using the kinetic function of the BIAevaluation software (GE Healthcare) with double reference subtraction. Kinetic parameters for each antibody, k a (association rate constant), j (dissociation rate constant), and K D (equilibrium dissociation constant) were determined. Kinetic values of the monoclonal antibodies on mFc- rhGDF15, cleaved rhGDF15, His-rhGDF15, or rhGDF15 are summarized in Tables 6, 7, 8, and 9, respectively.
  • This Example demonstrates the reversal of cachexia (as indicated by body weight loss) by antibody 01G06, 03G05, 04F08, 06C1 1, 14F11, or 17B 11 in an mFc-rhGDF15- induced cachexia model.
  • mFc-rhGDF15 (2 ⁇ ) was administered subcutaneous ly into the flank of 8-week old female ICR-SCID mice. Body weight was measured daily. When body weight reached 93%, the mice were randomized into seven groups often mice each. Each group received one of the following treatments: murine IgG control, 01G06, 03G05, 04F08, 06C1 1, 14F11, or 17B 11 at 10 mg/kg. Treatment was administered once by intra-peritoneal injection. Treatment with antibody 01G06, 03G05, 04F08, 06C11, 14F 11, or 17B 11 resulted in body weight increase relative to initial weight or about 100% (p ⁇ 0.001) (FIG. 14 and Table 10).
  • Example 10 Reversal of Cachexia in an HT-1080 Xenograft Tumor Model
  • This Example demonstrates the reversal of cachexia (as indicated by body weight loss) by antibody 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1 or 17B1 1 in an HT-1080 fibrosarcoma xenograft model.
  • HT-1080 cells were grown in culture at 37°C in an atmosphere containing 5% CO 2 , using Eagle's Minimum Essential Medium (ATCC, Catalog No. 30-2003) containing 10% FBS. Cells were inoculated subcutaneous ly into the flank of 8-week old female ICR SCID mice with 5 x 10 6 cells per mouse in 50% matrigel. Body weight was measured daily. When body weight reached 93%, the mice were randomized into eight groups of ten mice each.
  • HT-1080 cells were grown and inoculated subcutaneous ly into the flank of 8-week old female ICR SCID mice as described above. When body weight reached 93%, the mice were randomized into two groups of ten mice each. Each group received one of the following treatments: murine IgG control or 01G06 at 10 mg/kg.
  • Treatment was administered once by intra-peritoneal injection. As shown in FIG. 16A, treatment with antibody 01G06 resulted in body weight increase to initial weight or 100% (pO.001) (FIG. 16A).
  • mice were sacrificed at the time of the dose (baseline or 93% body weight, without treatment) and at the end of study (seven days post dose, either mlgG or 01G06).
  • Gonadal fat and the gastrocnemius muscles were removed surgically and weighed as described above in Example 4 and tissues were snap frozen in liquid nitrogen.
  • RNA was isolated from the gastrocnemius muscle samples to determine the levels of mMuRFl and mAtrogin mRNA by RT-PCR, as described in Example 4.
  • mice treated with mlgG displayed significant gastrocnemius muscle loss compared to the baseline group, while the group of mice treated with antibody 01G06 did not (FIG. 16D).
  • the levels of muscular degradation markers, mMuRF 1 and mAtrogin were significantly higher in the mlgG group compared to the 01G06 group (FIG. 16E).
  • Example 11 Reversal of Cachexia in an HT-1080 Xenograft Tumor Model
  • This Example demonstrates the reversal of cachexia (as indicated by body weight loss) by antibody 01G06 in an HT-1080 fibrosarcoma xenograft model.
  • HT-1080 cells were grown in culture at 37°C in an atmosphere containing 5% CO 2 , using Eagle's Minimum Essential Medium (ATCC, Catalog No. 30-2003) containing 10% FBS. Cells were inoculated subcutaneously into the flank of 8-week old female ICR SCID mice with 5 x 10 6 cells per mouse in 50% matrigel. Body weight was measured daily. When body weight reached 80%, the mice were randomized into two groups of five mice each. Each group received one of the following treatments: murine IgG control, 01G06 dosed at 2 mg/kg on day 1 and day 7.
  • Treatment was administered by intra-peritoneal injection. Treatment with antibody 01G06 resulted in body weight increase relative to initial weight or about 100% (pO.001) (FIG. 17A and Table 12).
  • FIGS. 17A-B and Table 12 indicate that the disclosed anti-GDF 15 antibodies can reverse cachexia in an HT- 1080 fibrosarcoma xenograft model.
  • mice were sacrificed at the time of dosing (baseline or 80% body weight loss, without treatment) and at the end of study (seven days post dose, either mIgG or 01 G06). Liver, heart, slpeen, kidney, gonadal fat and the gastrocnemius muscles were removed surgically and weighed. As shown in FIG. 17B, a significant loss in liver, heart, spleen, kidney, gonadal fat and gastrocnemius muscle mass was observed seven days post dose with mIgG, but not in the group treated with antibody 01 G06. In addition, mice treated with antibody 01G06 displayed significant liver and gonadal muscle gain compared to the baseline group (FIG. 17B).
  • Example 12 Reversal of Cachexia in a K-562 Xenograft Tumor Model
  • This Example demonstrates the reversal of cachexia (as indicated by body weight loss) by antibody 01 G06, 03G05, 04F08, 06C1 1 , 08G01 , 14F 1 1 or 17B 1 1 in a K-562 leukemia xenograft model.
  • K-562 cells were grown in culture at 37°C in an atmosphere containing 5% C0 2 , using Iscove's Modified Dulbecco's Medium (ATCC Catalog No. 30-2005) containing 10% FBS. Cells were inoculated subcutaneous ly into the flank of 8-week old female
  • mice with 2.5 x 10 6 cells per mouse in 50% matrigel. Body weight was measured daily. When body weight reached 93%, the mice were randomly distributed into eight groups of ten mice each. Each group received one of the following treatments: murine IgG control, 01G06, 03G05, 04F08, 06C11, 08G01, 14F1 1 or 17B1 1 at 10 mg/kg. Treatment was administered every three days by intra-peritoneal injection. Treatment with antibody 01G06, 03G05, 04F08, 06C1 1, 08G01, 14F1 1 or 17B 11 resulted in body weight increase relative to initial weight or about 100% (p ⁇ 0.001) (FIG. 18 and Table 13).
  • Antibody 01G06 was tested in additional tumor xenograft models including the TOV-21G ovarian xenograft model and the LS1034 colon xenograft model. In each model, antibody 01G06 reversed body weight loss compared to a PBS control (p ⁇ 0.001 for the TOV- 21G model and p ⁇ 0.01 for the LSI 034 model).
  • This Example describes the humanization and chimerization of three murine antibodies, designated 01G06, 06C11, and 14F11, and the characterization of the resulting humanized antibodies.
  • the humanized anti-GDF15 antibodies were designed, affinity matured by targeted CDR mutagenesis, and optimized using methods known in the art.
  • the amino acid sequences were converted to codon-optimized DNA sequences and synthesized to include (in the following order): 5' Hind!II restriction site, Kozak consensus sequence, amino terminal signal sequence, humanized variable region, human IgGl or Kappa constant region, stop codon, and a 3' EcoRI restriction site.
  • Chimeric (murine variable region and human constant region) 01G06, 06C11, and 14F11 heavy (human IgGl) and light (human Kappa) chains were also constructed.
  • the murine variable regions were fused to the human constant region, and codon-optimized DNA sequences were synthesized, including (in the following order): 5' Hindlll restriction site, Kozak consensus sequence, amino terminal signal sequence, mouse variable region, human IgGl or Kappa constant region, stop codon, and 3' EcoRI restriction site.
  • the humanized and chimeric heavy chains were subcloned into pEE6.4 (Lonza, Basel, Switzerland) via Hindlll and EcoRI sites using In-FusionTM PCR cloning (Clontech, Mountain View, CA).
  • the humanized and chimeric Kappa light chains were subcloned into pEE14.4 (Lonza) via Hindlll and EcoRI sites using In-FusionTM PCR cloning.
  • immunoglobulin heavy chain and immunoglobulin light chain variable regions is set forth below in Table 14.
  • nucleic acid sequences and the encoded protein sequences defining variable regions of the chimeric and humanized 01G06, 06C1 1, and 14F11 antibodies are summarized below (amino terminal signal peptide sequences are not shown).
  • CDR sequences (Kabat definition) are shown in bold and are underlined in the amino acid sequences.
  • Variable Region (SEQ ID NO: 64) 1 qvqlvqsgae vkkpgssvkv sckasgytfs dynmdwvrqa pgqglewmgq inpnnggiff 61 nqkfkgrvtl tadkststay melsslrsed tavyycarea ittvgamdyw gqgtlvtvss
  • Region (SEQ ID NO:248) 1 qvqlvqsgae vkkpgasvkv sckasgytft dynmdwvrqa pgqslewmgg inpnngliff
  • Region (SEQ ID NO: 94) 1 diqmtqspss lsasvgdrvt itcrtsenlh nylawyqqkp gkspklliyd aktladgvps 61 rfsgsgsgtd ytltisslqp edfatyycqh fwsspytfgq gtkleik
  • FIG. 19 The amino acid sequences defining the immunoglobulin heavy chain variable regions for the antibodies produced in Example 13 are aligned in FIG. 19. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDRi, CDR 2 , and CDR 3 (Kabat definition) are identified by boxes. FIG. 20 show an alignment of the separate CDRi, CDR 2 , and CDR 3 sequences for each of the variable region sequences shown in FIG. 19.
  • FIG. 21 The amino acid sequences defining the immunoglobulin light chain variable regions for the antibodies in Example 13 are aligned in FIG. 21. Amino terminal signal peptide sequences (for proper expression/secretion) are not shown. CDRi, CDR 2 and CDR 3 are identified by boxes. FIG. 22 shows an alignment of the separate CDRi, CDR 2 , and CDR3 sequences for each of the variable region sequences shown in FIG. 21.
  • Table 19 is a concordance chart showing the SEQ ID NO. of each sequence discussed in this Example.
  • each variable sequence above is combined with its respective human constant region.
  • a complete heavy chain comprises a heavy variable sequence followed by a human IgGl heavy chain constant sequence.
  • a complete kappa chain comprises a kappa variable sequence followed by the human kappa light chain constant sequence.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Diabetes (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2013/077139 2012-12-21 2013-12-20 Anti-gdf15 antibodies Ceased WO2014100689A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
JP2015549810A JP6758832B2 (ja) 2012-12-21 2013-12-20 抗gdf15抗体
MX2015007751A MX370720B (es) 2012-12-21 2013-12-20 Anticuerpos anti-gdf15.
EA201591198A EA038645B1 (ru) 2012-12-21 2013-12-20 Антитела к gdf15
CA2896076A CA2896076C (en) 2012-12-21 2013-12-20 Anti-gdf15 antibodies
DK13827058.2T DK2934584T3 (da) 2012-12-21 2013-12-20 Anti-gdf15-antistoffer
CN201380073317.1A CN105073133B (zh) 2012-12-21 2013-12-20 抗gdf15抗体
ES13827058T ES2791183T3 (es) 2012-12-21 2013-12-20 Anticuerpos anti-GDF15
EP20156883.9A EP3689370B1 (en) 2012-12-21 2013-12-20 Anti-gdf15 antibodies
HK16103611.5A HK1215670B (en) 2012-12-21 2013-12-20 Anti-gdf15 antibodies
KR1020157019881A KR102208861B1 (ko) 2012-12-21 2013-12-20 항-gdf15 항체
EP13827058.2A EP2934584B1 (en) 2012-12-21 2013-12-20 Anti-gdf15 antibodies
BR112015014768-2A BR112015014768B1 (pt) 2012-12-21 2013-12-20 Anticorpos anti-gdf15, seu método de produção, seu uso, e composição farmacêutica compreendendo os mesmos
AU2013364133A AU2013364133B2 (en) 2012-12-21 2013-12-20 Anti-GDF15 antibodies

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261745508P 2012-12-21 2012-12-21
US61/745,508 2012-12-21
US201361827325P 2013-05-24 2013-05-24
US61/827,325 2013-05-24

Publications (1)

Publication Number Publication Date
WO2014100689A1 true WO2014100689A1 (en) 2014-06-26

Family

ID=50069279

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/077139 Ceased WO2014100689A1 (en) 2012-12-21 2013-12-20 Anti-gdf15 antibodies

Country Status (13)

Country Link
US (6) US9175076B2 (https=)
EP (2) EP3689370B1 (https=)
JP (3) JP6758832B2 (https=)
KR (1) KR102208861B1 (https=)
CN (1) CN105073133B (https=)
AR (1) AR094271A1 (https=)
AU (1) AU2013364133B2 (https=)
CA (1) CA2896076C (https=)
DK (1) DK2934584T3 (https=)
EA (1) EA038645B1 (https=)
ES (1) ES2791183T3 (https=)
MX (1) MX370720B (https=)
WO (1) WO2014100689A1 (https=)

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2524553A (en) * 2014-03-26 2015-09-30 Julius Maximillians Universitã T Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and use thereof for treating cancer cachexia
GB2524552A (en) * 2014-03-26 2015-09-30 Julius Maximillians Universitã T Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and use thereof for treating cancer
WO2015144855A1 (en) * 2014-03-26 2015-10-01 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (gdf-15), and uses thereof for treating cancer cachexia and cancer
US9161966B2 (en) 2013-01-30 2015-10-20 Ngm Biopharmaceuticals, Inc. GDF15 mutein polypeptides
WO2015196142A1 (en) * 2014-06-20 2015-12-23 Aveo Pharmaceuticals, Inc. Treatment of congestive heart failure and other cardiac dysfunction using a gdf15 modulator
WO2015196145A1 (en) * 2014-06-20 2015-12-23 Aveo Pharmaceuticals, Inc. Treatment of chronic kidney disease and other renal dysfunction using a gdf15 modulator
WO2016049470A1 (en) * 2014-09-25 2016-03-31 Aveo Pharmaceuticals, Inc. Methods of reversing cachexia and prolonging survival comprising administering a gdf15 modulator and an anti-cancer agent
WO2016050796A1 (en) * 2014-09-30 2016-04-07 Universiteit Gent A method of treating joint disease
WO2016172703A3 (en) * 2015-04-23 2016-11-24 Haemalogix Pty. Ltd. Kappa myeloma antigen chimeric antigen receptors and uses thereof
US9550819B2 (en) 2012-03-27 2017-01-24 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
WO2017055613A2 (en) 2015-10-02 2017-04-06 Julius-Maximilians-Universität Würzburg Combination therapy using inhibitors of human growth and differentiation factor 15 (gdf-15) and immune checkpoint blockers
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
US9828415B2 (en) 2013-01-30 2017-11-28 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9834586B2 (en) 2014-07-30 2017-12-05 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9862752B2 (en) 2013-07-31 2018-01-09 Amgen Inc. Growth differentiation factor 15 (GDF-15) constructs
US9920118B2 (en) 2014-10-31 2018-03-20 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
KR20180054867A (ko) 2015-10-02 2018-05-24 율리우스-막시밀리안스 우니버지태트 뷔르츠부르크 면역 체크포인트 차단제를 이용한 치료의 임상적인 경과를 예측하기 위한 진단 마커로서의 gdf-15
WO2018102854A1 (en) * 2016-12-06 2018-06-14 St Vincent's Hospital Sydney Limited Treatment of obesity and eating disorders
JP2018528935A (ja) * 2015-07-17 2018-10-04 ジャン, シソンJIANG, Shisong アポトーシス促進抗体およびその使用
US10174119B2 (en) 2016-03-31 2019-01-08 Ngm Biopharmaceuticals, Inc. Binding proteins and methods of use thereof
US10336798B2 (en) 2012-01-26 2019-07-02 Amgen Inc. Growth differentiation factor 15 (GDF-15) polypeptides
WO2020039321A2 (en) 2018-08-20 2020-02-27 Pfizer Inc. Anti-gdf15 antibodies, compositions and methods of use
US10588980B2 (en) 2014-06-23 2020-03-17 Novartis Ag Fatty acids and their use in conjugation to biomolecules
WO2020053147A1 (en) * 2018-09-10 2020-03-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of an inhibitor of ntsr1 activation or expression for preventing weight loss, muscle loss, and protein blood level decrease in subjects in need thereof
US10603359B2 (en) 2014-10-30 2020-03-31 Acceleron Pharma Inc. Methods and compositions using GDF15 polypeptides for increasing red blood cells
US10752664B2 (en) 2011-04-08 2020-08-25 Amgen Inc. Method of treating or ameliorating metabolic disorders using growth differentiation factor 15 (GDF-15)
US10781251B2 (en) 2012-09-26 2020-09-22 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15)
US10919953B2 (en) 2012-08-24 2021-02-16 Chugai Seiyaku Kabushiki Kaisha FcgammaRIIB-specific Fc region variant
WO2021112185A1 (ja) 2019-12-06 2021-06-10 大塚製薬株式会社 抗gdf15抗体
US11046784B2 (en) 2006-03-31 2021-06-29 Chugai Seiyaku Kabushiki Kaisha Methods for controlling blood pharmacokinetics of antibodies
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
US11161889B2 (en) 2018-04-09 2021-11-02 Amgen Inc. Growth differentiation factor 15 fusion proteins
US11180548B2 (en) 2015-02-05 2021-11-23 Chugai Seiyaku Kabushiki Kaisha Methods of neutralizing IL-8 biological activity
US11236168B2 (en) 2012-08-24 2022-02-01 Chugai Seiyaku Kabushiki Kaisha Mouse FcγammaRII-specific Fc antibody
US11248053B2 (en) 2007-09-26 2022-02-15 Chugai Seiyaku Kabushiki Kaisha Method of modifying isoelectric point of antibody via amino acid substitution in CDR
US11267868B2 (en) 2013-04-02 2022-03-08 Chugai Seiyaku Kabushiki Kaisha Fc region variant
US11359009B2 (en) 2015-12-25 2022-06-14 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies and methods of use
US11359194B2 (en) 2008-04-11 2022-06-14 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding two or more antigen molecules repeatedly
WO2022189936A1 (en) * 2021-03-08 2022-09-15 Medimmune, Llc Antibodies directed against gdf-15
US11454633B2 (en) 2014-12-19 2022-09-27 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies, polypeptides containing variant Fc regions, and methods of use
WO2022207846A1 (en) 2021-03-31 2022-10-06 Cambridge Enterprise Limited Therapeutic inhibitors of gdf15 signalling
WO2023018803A1 (en) 2021-08-10 2023-02-16 Byomass Inc. Anti-gdf15 antibodies, compositions and uses thereof
RU2795457C2 (ru) * 2018-08-20 2023-05-03 Пфайзер Инк. Анти-gdf15 антитела, композиции и способы применения
WO2023079430A1 (en) 2021-11-02 2023-05-11 Pfizer Inc. Methods of treating mitochondrial myopathies using anti-gdf15 antibodies
WO2023122213A1 (en) 2021-12-22 2023-06-29 Byomass Inc. Targeting gdf15-gfral pathway cross-reference to related applications
WO2023217068A1 (zh) 2022-05-09 2023-11-16 舒泰神(北京)生物制药股份有限公司 特异性识别gdf15的抗体及其应用
US11891434B2 (en) 2010-11-30 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to plurality of antigen molecules repeatedly
WO2025072516A1 (en) * 2023-09-27 2025-04-03 Aveo Pharmaceuticals, Inc. Methods of reducing weight loss using anti-gdf15 antibodies
WO2025146488A1 (en) 2024-01-05 2025-07-10 Catalym Gmbh Anti-hgdf-15 antibody for use in the treatment of cancer in a patient in combination with a cancer antigen-targeted drug conjugate that induces cancer cell stress
US12497447B2 (en) 2020-11-10 2025-12-16 Catalym Gmbh Anti-GDF15 antibody and a dosage regimen for the treatment of cancer
US12544427B2 (en) 2019-10-04 2026-02-10 Amgen Inc. Use of GDF15 for treating cardiometabolic syndrome and other conditions

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2791183T3 (es) * 2012-12-21 2020-11-03 Aveo Pharmaceuticals Inc Anticuerpos anti-GDF15
CN105765386B (zh) * 2013-10-31 2019-07-16 瑞泽恩制药公司 用于检测中和抗体的竞争性配体结合测定法
ES2902533T3 (es) 2013-11-21 2022-03-28 Brigham & Womens Hospital Inc Composiciones y métodos para tratar la hipertensión pulmonar
JP2017518958A (ja) 2014-03-19 2017-07-13 マッカイ メディカル ファウンデイション ザ プレスビテリアン チャーチ イン タイワン マッカイ メモリアル ホスピタルMackay Medical Foundation The Presbyterian Church In Taiwan Mackay Memorial Hospital 免疫原性グリコペプチドに対する抗体、それを含む組成物、及びそれらの使用
EP3174550B1 (en) * 2014-08-01 2020-01-29 The Brigham and Women's Hospital, Inc. Methods and compositions relating to treatment of pulmonary arterial hypertension
GB201512733D0 (en) * 2015-07-20 2015-08-26 Genagon Therapeutics Ab Therapeutic agents for treating conditions associated with elevated GDF15
EP3368567B1 (en) 2015-10-28 2025-10-01 Yale University Humanized anti-dkk2 antibody and uses thereof
US11492386B2 (en) * 2016-02-01 2022-11-08 Eli Lilly And Company Parathyroid hormone-anti-RANKL antibody fusion compounds
CN108697795A (zh) * 2016-02-29 2018-10-23 伊莱利利公司 Gfral受体疗法
US20170299608A1 (en) * 2016-03-04 2017-10-19 Ngm Biopharmaceuticals, Inc. Compositions and methods for modulating body weight
US10336812B2 (en) * 2016-05-10 2019-07-02 Janssen Biotech, Inc. GDF15 fusion proteins and uses thereof
NL2017267B1 (en) * 2016-07-29 2018-02-01 Aduro Biotech Holdings Europe B V Anti-pd-1 antibodies
BR112019002331A2 (pt) * 2016-08-05 2019-06-18 Allakos Inc anticorpos anti-siglec-7 para o tratamento do câncer e métodos para obtenção dos mesmos
GB201700567D0 (en) 2017-01-12 2017-03-01 Genagon Therapeutics Ab Therapeutic agents
EP3655026A4 (en) 2017-07-17 2021-07-28 Janssen Biotech, Inc. ANTIGBINDING REGIONS AGAINST FIBRONECTIN TYPE III DOMAINS AND METHOD OF USING THEREOF
US11912766B2 (en) 2018-01-11 2024-02-27 Allakos, Inc. Anti-Siglec-7 antibodies having reduced effector function
TWI724392B (zh) * 2018-04-06 2021-04-11 美商美國禮來大藥廠 生長分化因子15促效劑化合物及其使用方法
WO2020033797A1 (en) * 2018-08-09 2020-02-13 The Wistar Institute Anti-follicule stimulating hormone receptor antibodies
KR102238927B1 (ko) * 2018-08-30 2021-04-12 서울대학교산학협력단 세포 내에서 nag-1 단백질의 이동을 조절하는 펩티드 및 이의 용도
EA202191105A1 (ru) 2018-10-22 2021-08-03 Янссен Фармацевтика Нв Слитые белки, полученные из глюкагоноподобного пептида 1 (glp1) и ростового фактора дифференцировки 15 (gdf15), и их применение
WO2021066751A1 (en) * 2019-10-02 2021-04-08 Aslan Pharmaceuticals Pte. Ltd. Antigen specific binding domains and antibody molecules
CN114560938B (zh) * 2020-03-30 2023-05-23 中国人民解放军第四军医大学 抗gdf15中和性单克隆抗体及其应用
TWI894280B (zh) * 2020-05-26 2025-08-21 南韓商愛思阿爾法數字醫療科技有限公司 用以治療癌症惡病質之系統、用以治療癌症惡病質之運算系統及其操作方法、以及非暫態電腦可讀取媒體
US12398211B2 (en) 2020-06-04 2025-08-26 Daegu Gyeongbuk Institute Of Science And Technology GFRAL-antagonistic antibody and use thereof
KR20230095097A (ko) * 2020-10-30 2023-06-28 히데아키 하라 눈 조직 섬유화의 저해에 사용하기 위한 gdf15 조절 물질
US20250092124A1 (en) * 2022-01-26 2025-03-20 Yunnan Baiyao Group Co., Ltd. Antibody molecule against growth and differentiation factor 15 and use thereof
CN116041497A (zh) * 2022-12-22 2023-05-02 杭州贤至生物科技有限公司 一种猫杯状病毒(fcv)重组蛋白单克隆抗体及制备方法
CN116444667B (zh) * 2023-06-13 2023-09-01 上海驯鹿生物技术有限公司 一种靶向gdf15的全人源抗体及其应用

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
WO1993011794A1 (en) 1991-12-13 1993-06-24 Xoma Corporation Methods and materials for preparation of modified antibody variable domains and therapeutic uses thereof
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US5869619A (en) 1991-12-13 1999-02-09 Xoma Corporation Modified antibody variable domains
US6054297A (en) 1991-06-14 2000-04-25 Genentech, Inc. Humanized antibodies and methods for making them
US6072035A (en) 1992-09-25 2000-06-06 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US6706477B2 (en) 1997-09-22 2004-03-16 University Of Rochester Methods for producing polynucleotide libraries in vaccinia virus
US6881557B2 (en) 2001-07-12 2005-04-19 Arrowsmith Technologies Llp Super humanized antibodies
US6893625B1 (en) 1986-10-27 2005-05-17 Royalty Pharma Finance Trust Chimeric antibody with specificity to human B cell surface antigen
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
WO2009021293A1 (en) * 2007-08-16 2009-02-19 St Vincent's Hospital Sydney Limited Agents and methods for modulating macrophage inhibitory cytokine (mic-1) activity
WO2011117254A1 (en) 2010-03-22 2011-09-29 Prosidion Limited Piperidine amides as modulators of the ghrelin receptor
US20110262444A1 (en) * 2010-03-03 2011-10-27 Detroit R&D, Inc. Form-specific antibodies for nag-1 (mic-1, gdf-15), h6d and other tgf-beta subfamily and heart disease and cancer diagnoses
US8192735B2 (en) 2004-04-13 2012-06-05 St Vincent's Hospital Sydney Limited Method for modulating appetite
WO2012113103A1 (en) 2011-02-25 2012-08-30 Helsinn Healthcare S.A. Asymmetric ureas and medical uses thereof

Family Cites Families (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6180602B1 (en) 1992-08-04 2001-01-30 Sagami Chemical Research Center Human novel cDNA, TGF-beta superfamily protein encoded thereby and the use of immunosuppressive agent
WO1994003599A1 (fr) 1992-08-04 1994-02-17 Sagami Chemical Research Center ADNc HUMAIN ET PROTEINE POUR LAQUELLE CODE CET ADNc
US6521227B1 (en) 1999-11-18 2003-02-18 Peter L. Hudson Polynucleotides encoding prostatic growth factor and process for producing prostatic growth factor polypeptides
US5994102A (en) 1994-12-15 1999-11-30 Human Genome Sciences, Inc. Polynucleotides encoding prostatic growth factor and process for producing prostatic growth factor polypeptides
WO1996018730A1 (en) 1994-12-15 1996-06-20 Human Genome Sciences, Inc. Prostatic growth factor
ES2324433T3 (es) 1995-06-22 2009-08-06 St Vincent's Hospital Sydney Limited Tgf-beta novedoso similar a citocina.
WO1999006445A1 (en) 1997-07-31 1999-02-11 The Johns Hopkins University School Of Medicine Growth differentiation factor-15
CA2345024C (en) 1998-10-07 2009-05-19 Stryker Corporation Modified tgf-.beta. superfamily proteins
US6465181B2 (en) 1999-03-25 2002-10-15 Abbott Laboratories Reagents and methods useful for detecting diseases of the prostate
JP2002543841A (ja) 1999-05-17 2002-12-24 バイオファーム ゲゼルシャフト ツア バイオテクノロジシェン エントヴィックルング ウント ツム フェルトリーブ フォン ファルマカ エムベーハー TGF−βスーパーファミリーの新規のメンバーであるGDF―15の神経保護特性
ATE470863T1 (de) 2000-04-20 2010-06-15 St Vincents Hosp Sydney Diagnostischer assay mit makrophagenhemmendem zytokin-1 (mic-1)
AU2001288770A1 (en) 2000-09-08 2002-03-22 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services A non-steroidal anti-inflammatory drug activated gene with anti-tumorigenic properties
CA2390820A1 (en) 2002-06-17 2003-12-17 St. Vincent's Hospital Sydney Limited Methods of diagnosis, prognosis and treatment of cardiovascular disease
US7919084B2 (en) 2002-06-17 2011-04-05 St. Vincent's Hospital Sydney Limited Methods of diagnosis, prognosis and treatment of cardiovascular disease
EP1578367A4 (en) 2002-11-01 2012-05-02 Genentech Inc COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE DISEASES
EP1575512A4 (en) 2002-11-08 2007-08-29 Barnes Jewish Hospital METHOD AND COMPOSITIONS FOR THE EPITHELIAL CELL DIFFERENTIATION IN THE PROSTATE
US20060188889A1 (en) 2003-11-04 2006-08-24 Christopher Burgess Use of differentially expressed nucleic acid sequences as biomarkers for cancer
GB2423429B (en) 2003-10-10 2007-04-25 That Corp Low-power integrated-circuit signal processor with wide dynamic range
WO2005092383A1 (ja) 2004-03-26 2005-10-06 Takeda Pharmaceutical Company Limited 呼吸器疾患の予防・治療剤
CA2534871C (en) 2006-02-15 2015-08-04 The Ohio State University Research Foundation Three-gene test to differentiate malignant from benign thyroid nodules
US20070237713A1 (en) 2006-04-04 2007-10-11 Fan Rong A PCan065 Antibody Compositions and Methods of Use
EP1884777A1 (en) 2006-08-04 2008-02-06 Medizinische Hochschule Hannover Means and methods for assessing the risk of cardiac interventions based on GDF-15
MX2009000914A (es) 2006-08-04 2009-06-18 Hannover Med Hochschule Medios y metodos para evaluar el riesgo de intervenciones cardiacas basadas en el factor 15 de diferenciacion del crecimiento.
CN101896192A (zh) 2007-10-09 2010-11-24 圣文森特医院悉尼有限公司 一种通过去除或灭活巨噬细胞抑制因子-1而治疗恶病质的方法
EP2103943A1 (en) 2008-03-20 2009-09-23 F. Hoffman-la Roche AG GDF-15 for assessing a cardiovascular risk with respect to the administration of antiinflammatory drugs
WO2009141357A1 (en) 2008-05-20 2009-11-26 Roche Diagnostics Gmbh Gdf-15 as biomarker in type 1 diabetes
GB0902793D0 (en) * 2009-02-20 2009-04-08 Univ Gent GDF15 as molecular tool to monitor and enhance phenotypic stability of articular chondrocytes
TWI452136B (zh) * 2010-11-17 2014-09-11 中外製藥股份有限公司 A multiple specific antigen-binding molecule that replaces the function of Factor VIII in blood coagulation
US8790651B2 (en) * 2011-07-21 2014-07-29 Zoetis Llc Interleukin-31 monoclonal antibody
ES2791183T3 (es) 2012-12-21 2020-11-03 Aveo Pharmaceuticals Inc Anticuerpos anti-GDF15
AU2015276800B2 (en) 2014-06-20 2021-03-04 Aveo Pharmaceuticals, Inc. Treatment of chronic kidney disease and other renal dysfunction using a GDF15 modulator
JP6910800B2 (ja) 2014-06-20 2021-07-28 アベオ ファーマシューティカルズ, インコーポレイテッド Gdf15調節剤を用いたうっ血性心不全及びその他の心機能不全の治療

Patent Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
US6893625B1 (en) 1986-10-27 2005-05-17 Royalty Pharma Finance Trust Chimeric antibody with specificity to human B cell surface antigen
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5693761A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Polynucleotides encoding improved humanized immunoglobulins
US7022500B1 (en) 1988-12-28 2006-04-04 Protein Design Labs, Inc. Humanized immunoglobulins
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US6180370B1 (en) 1988-12-28 2001-01-30 Protein Design Labs, Inc. Humanized immunoglobulins and methods of making the same
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US6054297A (en) 1991-06-14 2000-04-25 Genentech, Inc. Humanized antibodies and methods for making them
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5821123A (en) 1991-12-13 1998-10-13 Xoma Corporation Modified antibody variable domains
US5766886A (en) 1991-12-13 1998-06-16 Xoma Corporation Modified antibody variable domains
US5770196A (en) 1991-12-13 1998-06-23 Xoma Corporation Modified antibody variable domains and therapeutic uses thereof
US5869619A (en) 1991-12-13 1999-02-09 Xoma Corporation Modified antibody variable domains
WO1993011794A1 (en) 1991-12-13 1993-06-24 Xoma Corporation Methods and materials for preparation of modified antibody variable domains and therapeutic uses thereof
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US6072035A (en) 1992-09-25 2000-06-06 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US6706477B2 (en) 1997-09-22 2004-03-16 University Of Rochester Methods for producing polynucleotide libraries in vaccinia virus
US6872518B2 (en) 1997-09-22 2005-03-29 University Of Rochester Methods for selecting polynucleotides encoding T cell epitopes
US6800442B2 (en) 1997-09-22 2004-10-05 University Of Rochester Methods of selecting polynucleotides encoding antigens
US6881557B2 (en) 2001-07-12 2005-04-19 Arrowsmith Technologies Llp Super humanized antibodies
US8192735B2 (en) 2004-04-13 2012-06-05 St Vincent's Hospital Sydney Limited Method for modulating appetite
WO2009021293A1 (en) * 2007-08-16 2009-02-19 St Vincent's Hospital Sydney Limited Agents and methods for modulating macrophage inhibitory cytokine (mic-1) activity
US20110262444A1 (en) * 2010-03-03 2011-10-27 Detroit R&D, Inc. Form-specific antibodies for nag-1 (mic-1, gdf-15), h6d and other tgf-beta subfamily and heart disease and cancer diagnoses
WO2011117254A1 (en) 2010-03-22 2011-09-29 Prosidion Limited Piperidine amides as modulators of the ghrelin receptor
WO2012113103A1 (en) 2011-02-25 2012-08-30 Helsinn Healthcare S.A. Asymmetric ureas and medical uses thereof

Non-Patent Citations (65)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY
ALLAN ET AL., J. STEROID BIOCHEM. & MOL. BIOL., vol. 103, 2007, pages 76 - 83
ALTSCHUL ET AL., NATURE GENETICS, vol. 6, 1994, pages 119 - 129
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
ALTSCHUL, J. MOL. EVOL., vol. 36, 1993, pages 290 - 300
ARGILES ET AL., EUR. J. PHARMACOL., vol. 668, 2011, pages S81 - S86
BAUERLEIN ET AL., J. CACHEXIA SARCOPENIA MUSCLE: ABSTRACTS OF THE 7TH CACHEXIA CONFERENCE, 2013
BAUMGARTNER ET AL., MECH. AGEING DEV., vol. 147, 1999, pages 755 - 763
BAUSKIN ET AL., CANCER RES., vol. 66, 2006, pages 4983 - 4986
BOVEE ET AL., J. STEROID BIOCHEM. & MOL. BIOL., vol. 118, 2010, pages 85 - 92
BREIT SAMUEL N ET AL: "The TGF-[beta] superfamily cytokine, MIC-1/GDF15: a pleotrophic cytokine with roles in inflammation, cancer and metabolism", GROWTH FACTORS, HARWOOD ACADEMIC PUBLISHERS GMBH, XX, vol. 29, no. 5, 1 October 2011 (2011-10-01), pages 187 - 195, XP008152690, ISSN: 0897-7194 *
CHCN ET AL., MOL. INTERV., vol. 5, 2005, pages 173 - 188
COATS ET AL., J. CACHEXIA SARCOPENIA MUSCLE, vol. 2, 2011, pages 201 - 207
DALTON ET AL., J. CACHEXIA SARCOPENIA MUSCLE, vol. 2, 2011, pages 153 - 161
DEBOER; MARKS, TRENDS IN ENDOCRINOLOGY AND METABOLISM, vol. 17, 2006, pages 199 - 204
EIICHI HINOI ET AL: "Positive regulation of osteoclastic differentiation by growth differentiation factor 15 upregulated in osteocytic cells under hypoxia", JOURNAL OF BONE AND MINERAL RESEARCH, vol. 27, no. 4, 1 April 2012 (2012-04-01), pages 938 - 949, XP055106394, ISSN: 0884-0431, DOI: 10.1002/jbmr.1538 *
ENOMOTO ET AL., BIOCHEM. AND BIOPHYS. RES. COMM., vol. 323, 2004, pages 1096 - 1102
EVANS ET AL., CLIN. NUTR., vol. 27, 2008, pages 793 - 799
FAIRLIE ET AL., GENE, vol. 254, 2000, pages 67 - 76
FEARON ET AL., CELL METABOLISM, vol. 16, 2012, pages 153 - 166
FEARON ET AL., LANCET ONC., vol. 12, 2011, pages 489 - 495
FISHWILD ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 845 - 851
FONG ET AL., AM. J. PHYSIOL. - REGULATORY, INTEGRATIVE AND COMPARATIVE PHYSIOL., vol. 256, 1989, pages R659 - R665
GLASS, D., CURR. OPIN. CLIN. NUTR. MET. CARE, vol. 13, 2010, pages 225 - 229
GUILLORY ET AL., VITAMINS AND HORMONES, vol. 92, 2013
HENIKOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 - 10919
HRYNIEWICZ ET AL., J. CARDIAC FAILURE, vol. 9, 2003, pages 464 - 468
INUI, CANCER J. FOR CLINICIANS, vol. 52, 2002, pages 72 - 91
JOHNEN ET AL., NAT. MED., vol. 13, 1997, pages 1333 - 1340
JOHNEN ET AL., NAT. MED., vol. 13, 2007, pages 1333 - 1340
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
JOPPA ET AL., PEPTIDES, vol. 28, 2007, pages 636 - 642
KARLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 2264 - 2268
KNAPPIK ET AL., J. MOL. BIOL., vol. 296, 2000, pages 57 - 86
KREBS ET AL., J. IMMUNOL. METH., vol. 254, 2001, pages 67 - 84
LOKIREDDY ET AL., BIOCHEM. J., vol. 446, no. 1, 2012, pages 23 - 26
LONBERG ET AL., NATURE, vol. 368, 1994, pages 856 - 859
MARINO ET AL., CYTOKINE & GROWTH FACTOR REV., vol. 24, 2013, pages 477 - 484
MATHYS; BILLIAU, NUTRITION, vol. 13, 1997, pages 763 - 770
MENDEZ ET AL., NATURE GENETICS, vol. 15, 1997, pages 146 - 156
MOHLER ET AL., J. MED. CHEM., vol. 52, 2009, pages 3597 - 3617
MORRISON ET AL., PROC. NAT. ACAD. SCI., vol. 81, 1984, pages 6851 - 6855
MUSCARITOLI ET AL., CLIN. NUTRITION, vol. 29, 2010, pages 154 - 159
NAGATA ET AL., BIOORGANIC AND MED. CHEM. LETTERS, vol. 21, 2011, pages 1744 - 1747
NEUBERGER ET AL., NATURE, vol. 312, 1984, pages 604 - 608
NG ET AL., BIOORG. MED. CHEM. LETT., vol. 17, 2007, pages 1784 - 1787
P. ROTH ET AL: "GDF-15 Contributes to Proliferation and Immune Escape of Malignant Gliomas", CLINICAL CANCER RESEARCH, vol. 16, no. 15, 9 June 2010 (2010-06-09), pages 3851 - 3859, XP055106395, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-10-0705 *
PRADO ET AL., BRITISH J. CANCER, vol. 106, 2012, pages 1583 - 1586
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327
ROGUSKA ET AL., PROT. ENGINEER, vol. 9, 1996, pages 895 - 904
RUEGG; GLASS, ANNUAL REV. PHARMACOL. TOXICOL., vol. 51, 2011, pages 373 - 395
STEINMAN; DEBOER, VITAMINS AND HORMONES, vol. 92, 2013
STRASSMANN ET AL., J. IMMUNOL., vol. 150, 1993, pages 2341
TAN ET AL., J. IMMUNOL., vol. 169, 2002, pages 1119 - 1125
TEMEL ET AL., J. CACHEXIA SARCOPENIA MUSCLE: ABSTRACTS OF THE 71B CACHEXIA CONFERENCE, 2013
THOMAS, CLIN. NUTRITION, vol. 26, 2007, pages 389 - 399
TISDALE, NAT. REV. CANCER, vol. 2, 2002, pages 862 - 871
TSAI ET AL., J. CACHEXIA SARCOPENIA MUSCLE, vol. 3, 2012, pages 239 - 243
TUCA ET AL., ONCOLOGY/HEMATOLOGY, vol. 88, 2013, pages 625 - 636
VASWAMI ET AL., ANNALSOF ALLERGY, ASTHMA, & IMMUNOL., vol. 81, 1998, pages 105
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536
WINTER, FEBS LETT, vol. 430, 1998, pages 92 - 94
ZHANG ET AL., BIOORG. MED. CHEM. LETT., vol. 16, 2006, pages 5763 - 5766
ZHANG ET AL., BIOORG. MED. CHEM. LETT., vol. 17, 2007, pages 439 - 443
ZHOU ET AL., CELL, vol. 142, 2010, pages 531 - 543

Cited By (109)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11046784B2 (en) 2006-03-31 2021-06-29 Chugai Seiyaku Kabushiki Kaisha Methods for controlling blood pharmacokinetics of antibodies
US12473375B2 (en) 2006-03-31 2025-11-18 Chugai Seiyaku Kabushiki Kaisha Methods for controlling blood pharmacokinetics of antibodies
US11248053B2 (en) 2007-09-26 2022-02-15 Chugai Seiyaku Kabushiki Kaisha Method of modifying isoelectric point of antibody via amino acid substitution in CDR
US12122840B2 (en) 2007-09-26 2024-10-22 Chugai Seiyaku Kabushiki Kaisha Method of modifying isoelectric point of antibody via amino acid substitution in CDR
US12116414B2 (en) 2007-09-26 2024-10-15 Chugai Seiyaku Kabushiki Kaisha Method of modifying isoelectric point of antibody via amino acid substitution in CDR
US11371039B2 (en) 2008-04-11 2022-06-28 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly
US11359194B2 (en) 2008-04-11 2022-06-14 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding two or more antigen molecules repeatedly
US12617847B2 (en) 2010-11-30 2026-05-05 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to plurality of antigen molecules repeatedly
US11891434B2 (en) 2010-11-30 2024-02-06 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to plurality of antigen molecules repeatedly
US10752664B2 (en) 2011-04-08 2020-08-25 Amgen Inc. Method of treating or ameliorating metabolic disorders using growth differentiation factor 15 (GDF-15)
US11739131B2 (en) 2012-01-26 2023-08-29 Amgen Inc. Growth differentiation factor 15 (GDF-15) polypeptides
US10336798B2 (en) 2012-01-26 2019-07-02 Amgen Inc. Growth differentiation factor 15 (GDF-15) polypeptides
US10869909B2 (en) 2012-03-27 2020-12-22 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9550819B2 (en) 2012-03-27 2017-01-24 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US10195250B2 (en) 2012-03-27 2019-02-05 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US11236168B2 (en) 2012-08-24 2022-02-01 Chugai Seiyaku Kabushiki Kaisha Mouse FcγammaRII-specific Fc antibody
US10919953B2 (en) 2012-08-24 2021-02-16 Chugai Seiyaku Kabushiki Kaisha FcgammaRIIB-specific Fc region variant
US11891436B2 (en) 2012-09-26 2024-02-06 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15)
US10781251B2 (en) 2012-09-26 2020-09-22 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15)
US10323075B2 (en) 2013-01-30 2019-06-18 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9161966B2 (en) 2013-01-30 2015-10-20 Ngm Biopharmaceuticals, Inc. GDF15 mutein polypeptides
US10610568B2 (en) 2013-01-30 2020-04-07 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9827291B2 (en) 2013-01-30 2017-11-28 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9828415B2 (en) 2013-01-30 2017-11-28 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US11267868B2 (en) 2013-04-02 2022-03-08 Chugai Seiyaku Kabushiki Kaisha Fc region variant
US10894814B2 (en) 2013-07-31 2021-01-19 Amgen Inc. Growth differentiation factor 15 (GDF-15) constructs
US9862752B2 (en) 2013-07-31 2018-01-09 Amgen Inc. Growth differentiation factor 15 (GDF-15) constructs
GB2524553B (en) * 2014-03-26 2017-06-28 Julius-Maximillians-Universitãt Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and uses thereof for treating cancer cachexia
GB2524552B (en) * 2014-03-26 2017-07-12 Julius-Maximilians-Universitãt Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and use thereof for treating cancer
US11760795B2 (en) 2014-03-26 2023-09-19 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and uses thereof for treating cancer cachexia and cancer
EP4316596A3 (en) * 2014-03-26 2024-04-17 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (gdf-15), and uses thereof for treating cancer cachexia and cancer
US10604565B2 (en) 2014-03-26 2020-03-31 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and uses thereof for treating cancer cachexia and cancer
GB2524553A (en) * 2014-03-26 2015-09-30 Julius Maximillians Universitã T Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and use thereof for treating cancer cachexia
WO2015144855A1 (en) * 2014-03-26 2015-10-01 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (gdf-15), and uses thereof for treating cancer cachexia and cancer
EP3653644A1 (en) * 2014-03-26 2020-05-20 Julius-Maximilians-Universität Würzburg Monoclonal antibodies to growth and differentiation factor 15 (gdf-15), and uses thereof for treating cancer cachexia and cancer
US11634482B2 (en) 2014-03-26 2023-04-25 Julius-Maxmilians-Universitat Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and uses thereof for treating cancer cachexia and cancer
GB2524552A (en) * 2014-03-26 2015-09-30 Julius Maximillians Universitã T Wurzburg Monoclonal antibodies to growth and differentiation factor 15 (GDF-15), and use thereof for treating cancer
WO2015196142A1 (en) * 2014-06-20 2015-12-23 Aveo Pharmaceuticals, Inc. Treatment of congestive heart failure and other cardiac dysfunction using a gdf15 modulator
WO2015196145A1 (en) * 2014-06-20 2015-12-23 Aveo Pharmaceuticals, Inc. Treatment of chronic kidney disease and other renal dysfunction using a gdf15 modulator
US11897948B2 (en) 2014-06-20 2024-02-13 Aveo Pharmaceuticals, Inc. Treatment of chronic kidney disease and other renal dysfunction using a GDF15 modulator
US10786576B2 (en) 2014-06-23 2020-09-29 Novartis Ag Fatty acids and their use in conjugation to biomolecules
US10588980B2 (en) 2014-06-23 2020-03-17 Novartis Ag Fatty acids and their use in conjugation to biomolecules
US11752211B2 (en) 2014-06-23 2023-09-12 Novartis Ag Fatty acids and their use in conjugation to biomolecules
US9834586B2 (en) 2014-07-30 2017-12-05 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US11358995B2 (en) 2014-07-30 2022-06-14 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
EP3851122A1 (en) 2014-09-25 2021-07-21 Aveo Pharmaceuticals Inc. Methods of reversing cachexia and prolonging survival comprising administering a gdf15 modulator and an anti-cancer agent
EP3197493B1 (en) 2014-09-25 2021-03-10 Aveo Pharmaceuticals Inc. Methods of reversing cachexia and prolonging survival comprising administering a gdf15 modulator and an anti-cancer agent
WO2016049470A1 (en) * 2014-09-25 2016-03-31 Aveo Pharmaceuticals, Inc. Methods of reversing cachexia and prolonging survival comprising administering a gdf15 modulator and an anti-cancer agent
WO2016050796A1 (en) * 2014-09-30 2016-04-07 Universiteit Gent A method of treating joint disease
US11642394B2 (en) 2014-10-30 2023-05-09 Acceleron Pharma Inc. Methods and compositions using GDF15 polypeptides for increasing red blood cells
EP3922259A1 (en) 2014-10-30 2021-12-15 Acceleron Pharma Inc. Methods and compositions using gdf15 polypeptides for increasing red blood cells
US10603359B2 (en) 2014-10-30 2020-03-31 Acceleron Pharma Inc. Methods and compositions using GDF15 polypeptides for increasing red blood cells
US10562965B2 (en) 2014-10-31 2020-02-18 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US9920118B2 (en) 2014-10-31 2018-03-20 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US12173060B2 (en) 2014-10-31 2024-12-24 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
US11530260B2 (en) 2014-10-31 2022-12-20 Ngm Biopharmaceuticals, Inc. Compositions and methods of use for treating metabolic disorders
RU2799522C2 (ru) * 2014-12-19 2023-07-05 Чугаи Сеияку Кабусики Кайся Антитела к миостатину, полипептиды, содержащие варианты fc-областей, и способы их применения
US12169205B2 (en) 2014-12-19 2024-12-17 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies, polypeptides containing variant fc regions, and methods of use
US11454633B2 (en) 2014-12-19 2022-09-27 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies, polypeptides containing variant Fc regions, and methods of use
US11180548B2 (en) 2015-02-05 2021-11-23 Chugai Seiyaku Kabushiki Kaisha Methods of neutralizing IL-8 biological activity
US12595299B2 (en) 2015-02-05 2026-04-07 Chugai Seiyaku Kabushiki Kaisha FC variants
WO2016172703A3 (en) * 2015-04-23 2016-11-24 Haemalogix Pty. Ltd. Kappa myeloma antigen chimeric antigen receptors and uses thereof
US11305011B2 (en) 2015-04-23 2022-04-19 Haemalogix Pty. Ltd. Kappa myeloma antigen chimeric antigen receptors and uses thereof
JP7016165B2 (ja) 2015-07-17 2022-02-04 シャンハイ ジェーダブリュー インフリンヒックス カンパニー、リミテッド アポトーシス促進抗体およびその使用
JP2018528935A (ja) * 2015-07-17 2018-10-04 ジャン, シソンJIANG, Shisong アポトーシス促進抗体およびその使用
KR20180054867A (ko) 2015-10-02 2018-05-24 율리우스-막시밀리안스 우니버지태트 뷔르츠부르크 면역 체크포인트 차단제를 이용한 치료의 임상적인 경과를 예측하기 위한 진단 마커로서의 gdf-15
US12473354B2 (en) 2015-10-02 2025-11-18 Julius-Maximilians-Universität Würzburg GDF-15 as a diagnostic marker to predict the clinical outcome of a treatment with immune checkpoint blockers
US11464856B2 (en) 2015-10-02 2022-10-11 Julius-Maximilians-Universität Würzburg Combination therapy using inhibitors of human growth and differentiation factor 15 (GDF-15) and immune checkpoint blockers
KR20180054868A (ko) 2015-10-02 2018-05-24 율리우스-막시밀리안스 우니버지태트 뷔르츠부르크 인간 증식 및 분화 인자 15 (gdf-15)의 저해제와 면역 체크포인트 차단제를 이용한 병용 요법
WO2017055613A2 (en) 2015-10-02 2017-04-06 Julius-Maximilians-Universität Würzburg Combination therapy using inhibitors of human growth and differentiation factor 15 (gdf-15) and immune checkpoint blockers
US11262360B2 (en) 2015-10-02 2022-03-01 Julius-Maximilians-Universität Würzburg GDF-15 as a diagnostic marker to predict the clinical outcome of a treatment with immune checkpoint blockers
EP4218809A2 (en) 2015-10-02 2023-08-02 Julius-Maximilians-Universität Würzburg Combination therapy using inhibitors of human growth and differentiation factor 15 (gdf-15) and immune checkpoint blockers
US11359009B2 (en) 2015-12-25 2022-06-14 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies and methods of use
US12252532B2 (en) 2015-12-25 2025-03-18 Chugai Seiyaku Kabushiki Kaisha Anti-myostatin antibodies and methods of use
US10174119B2 (en) 2016-03-31 2019-01-08 Ngm Biopharmaceuticals, Inc. Binding proteins and methods of use thereof
US12180289B2 (en) 2016-03-31 2024-12-31 Ngm Biopharmaceuticals, Inc. Binding proteins and methods of use thereof
US10975154B2 (en) 2016-03-31 2021-04-13 Ngm Biopharmaceuticals, Inc. Binding proteins and methods of use thereof
US11312766B2 (en) 2016-04-27 2022-04-26 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
WO2017189724A1 (en) 2016-04-27 2017-11-02 Novartis Ag Antibodies against growth differentiation factor 15 and uses thereof
CN109071647A (zh) * 2016-04-27 2018-12-21 诺华股份有限公司 抗生长分化因子15的抗体及其用途
US11780912B2 (en) 2016-08-05 2023-10-10 Chugai Seiyaku Kabushiki Kaisha Composition for prophylaxis or treatment of IL-8 related diseases
US11053308B2 (en) 2016-08-05 2021-07-06 Chugai Seiyaku Kabushiki Kaisha Method for treating IL-8-related diseases
US12516115B2 (en) 2016-08-05 2026-01-06 Chugai Seiyaku Kabushiki Kaisha Composition for prophylaxis or treatment of IL-8 related diseases
WO2018102854A1 (en) * 2016-12-06 2018-06-14 St Vincent's Hospital Sydney Limited Treatment of obesity and eating disorders
CN110072541B (zh) * 2016-12-06 2023-05-02 圣文森特医院悉尼有限公司 肥胖和饮食失调的治疗
CN110072541A (zh) * 2016-12-06 2019-07-30 圣文森特医院悉尼有限公司 肥胖和饮食失调的治疗
US12054527B2 (en) 2018-04-09 2024-08-06 Amgen Inc. Growth differentiation factor 15 fusion proteins
US11161889B2 (en) 2018-04-09 2021-11-02 Amgen Inc. Growth differentiation factor 15 fusion proteins
AU2019323790B2 (en) * 2018-08-20 2026-01-29 Pfizer Inc. Anti-GDF15 antibodies, compositions and methods of use
US11566066B2 (en) 2018-08-20 2023-01-31 Pfizer Inc. Anti-GDF15 antibodies, compositions and methods of use
US20220380448A1 (en) * 2018-08-20 2022-12-01 Pfizer Inc. Anti-gdf15 antibodies, compositions and methods of use
TWI803682B (zh) * 2018-08-20 2023-06-01 美商輝瑞股份有限公司 抗-gdf15抗體、組成物及使用方法
WO2020039321A2 (en) 2018-08-20 2020-02-27 Pfizer Inc. Anti-gdf15 antibodies, compositions and methods of use
WO2020039321A3 (en) * 2018-08-20 2020-05-07 Pfizer Inc. Anti-gdf15 antibodies, compositions and methods of use
RU2795457C2 (ru) * 2018-08-20 2023-05-03 Пфайзер Инк. Анти-gdf15 антитела, композиции и способы применения
US12227564B2 (en) 2018-08-20 2025-02-18 Pfizer Inc. Anti-GDF15 antibodies, compositions and methods of use
WO2020053147A1 (en) * 2018-09-10 2020-03-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of an inhibitor of ntsr1 activation or expression for preventing weight loss, muscle loss, and protein blood level decrease in subjects in need thereof
US12544427B2 (en) 2019-10-04 2026-02-10 Amgen Inc. Use of GDF15 for treating cardiometabolic syndrome and other conditions
WO2021112185A1 (ja) 2019-12-06 2021-06-10 大塚製薬株式会社 抗gdf15抗体
US12497447B2 (en) 2020-11-10 2025-12-16 Catalym Gmbh Anti-GDF15 antibody and a dosage regimen for the treatment of cancer
WO2022189936A1 (en) * 2021-03-08 2022-09-15 Medimmune, Llc Antibodies directed against gdf-15
US11845791B2 (en) 2021-03-08 2023-12-19 Medimmune, Llc Antibodies directed against GDF-15
WO2022207846A1 (en) 2021-03-31 2022-10-06 Cambridge Enterprise Limited Therapeutic inhibitors of gdf15 signalling
WO2023018803A1 (en) 2021-08-10 2023-02-16 Byomass Inc. Anti-gdf15 antibodies, compositions and uses thereof
WO2023079430A1 (en) 2021-11-02 2023-05-11 Pfizer Inc. Methods of treating mitochondrial myopathies using anti-gdf15 antibodies
WO2023122213A1 (en) 2021-12-22 2023-06-29 Byomass Inc. Targeting gdf15-gfral pathway cross-reference to related applications
WO2023217068A1 (zh) 2022-05-09 2023-11-16 舒泰神(北京)生物制药股份有限公司 特异性识别gdf15的抗体及其应用
WO2025072516A1 (en) * 2023-09-27 2025-04-03 Aveo Pharmaceuticals, Inc. Methods of reducing weight loss using anti-gdf15 antibodies
WO2025146488A1 (en) 2024-01-05 2025-07-10 Catalym Gmbh Anti-hgdf-15 antibody for use in the treatment of cancer in a patient in combination with a cancer antigen-targeted drug conjugate that induces cancer cell stress

Also Published As

Publication number Publication date
ES2791183T3 (es) 2020-11-03
DK2934584T3 (da) 2020-05-18
EA038645B1 (ru) 2021-09-28
JP2019056018A (ja) 2019-04-11
JP2021061864A (ja) 2021-04-22
AU2013364133A1 (en) 2015-07-16
EP3689370C0 (en) 2026-03-04
US20240166734A1 (en) 2024-05-23
US10597444B2 (en) 2020-03-24
KR102208861B1 (ko) 2021-01-27
US11725047B2 (en) 2023-08-15
EP2934584B1 (en) 2020-02-19
EP2934584A1 (en) 2015-10-28
EP3689370A1 (en) 2020-08-05
CN105073133A (zh) 2015-11-18
BR112015014768A2 (pt) 2017-10-10
CN105073133B (zh) 2021-04-20
US9175076B2 (en) 2015-11-03
JP2016508984A (ja) 2016-03-24
CA2896076A1 (en) 2014-06-26
US20140193427A1 (en) 2014-07-10
JP6758832B2 (ja) 2020-09-30
US20160083465A1 (en) 2016-03-24
US20210101968A1 (en) 2021-04-08
MX370720B (es) 2019-12-20
AR094271A1 (es) 2015-07-22
EA201591198A1 (ru) 2015-11-30
EP3689370B1 (en) 2026-03-04
US9725505B2 (en) 2017-08-08
AU2013364133B2 (en) 2018-10-11
HK1215670A1 (en) 2016-09-09
KR20150100837A (ko) 2015-09-02
CA2896076C (en) 2022-12-06
MX2015007751A (es) 2015-11-30
US20250277019A1 (en) 2025-09-04
US20180142013A1 (en) 2018-05-24
US12258391B2 (en) 2025-03-25

Similar Documents

Publication Publication Date Title
US12258391B2 (en) Anti-GDF-15 antibodies
US8481688B2 (en) Anti-FGFR2 antibodies
AU2011245636B2 (en) Anti-ErbB3 antibodies
US8829164B2 (en) Anti-ron antibodies
WO2011156617A2 (en) Anti-egfr antibodies
WO2012003472A1 (en) Anti-notch1 antibodies
BR112015014768B1 (pt) Anticorpos anti-gdf15, seu método de produção, seu uso, e composição farmacêutica compreendendo os mesmos

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201380073317.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13827058

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2015/007751

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2896076

Country of ref document: CA

Ref document number: 2015549810

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015014768

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2013827058

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013364133

Country of ref document: AU

Date of ref document: 20131220

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201591198

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 20157019881

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112015014768

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150619