WO2014010806A1 - 아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 - Google Patents

아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 Download PDF

Info

Publication number
WO2014010806A1
WO2014010806A1 PCT/KR2013/001386 KR2013001386W WO2014010806A1 WO 2014010806 A1 WO2014010806 A1 WO 2014010806A1 KR 2013001386 W KR2013001386 W KR 2013001386W WO 2014010806 A1 WO2014010806 A1 WO 2014010806A1
Authority
WO
WIPO (PCT)
Prior art keywords
tuberculosis
primer pair
probe
expression level
control gene
Prior art date
Application number
PCT/KR2013/001386
Other languages
English (en)
French (fr)
Inventor
이혜영
김성현
조상래
Original Assignee
연세대학교 원주산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 원주산학협력단 filed Critical 연세대학교 원주산학협력단
Publication of WO2014010806A1 publication Critical patent/WO2014010806A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to an information providing method for diagnosing tuberculosis using IP-10 (interferon inducible protein-10) mRNA target real-time reverse transcriptase polymerization and a kit for diagnosing tuberculosis.
  • IP-10 interferon inducible protein-10) mRNA target real-time reverse transcriptase polymerization
  • Tuberculosis is usually mycobacterium. Chronic infectious disease caused by M. tuberculosis, which is not only a major disease in developing countries but also increases its severity in developed countries around the world, with about 8 million new cases per year and about 300 Ten thousand patients die. Although tuberculosis may be asymptomatic for a significant time even after infection, the disease most commonly manifests as acute inflammation of the lungs, resulting in fever and unproductive cough, which if not treated usually leads to serious complications and death.
  • TST tuberculin skin test
  • TST cross-reacts in people who have been sensitized to non-tuberculosis mycobacteria (NTM), and the probability of false positives is very high when BCG vaccination is common in Korea.
  • NTM non-tuberculosis mycobacteria
  • a commonly used method is a culture method.
  • the bacteria are directly isolated from the patient's specimen in the laboratory and tested, the risk of infection is very high, and since the tuberculosis bacteria take at least 4-6 weeks to grow, there is a considerable time and cost.
  • the detection method using the blood of the patient is safer, faster, and can be performed using a part of the blood necessary for a general clinical test because it detects the immune response caused by the infection of Mycobacterium tuberculosis rather than Mycobacterium tuberculosis. It's a convenient way for everyone.
  • test methods for blood developed so far include serological methods for detecting antibodies to Mycobacterium tuberculosis antigens and IGRA assays for detecting the amount of IFN- ⁇ NCBI ACCESSION NO: NM_000619) secreted by Mycobacterium tuberculosis infection.
  • the serological diagnostic method has the advantage of being very easy to use, easy and quick to interpret the results, but has the disadvantage that the specificity and sensitivity are very low and the quantitative test cannot be performed.
  • the IGRA test which is a method of quantitatively analyzing IFN- ⁇ protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, was performed by QuantiFERON, an ELISA company using a single antibody against IFN- ⁇ , and T-Spot.TB using ELISPOT. It is widely used in developed countries because of its high specificity compared to the existing test method. However, IGRA testing has the following disadvantages that are difficult to commercialize worldwide.
  • the IGRA test requires about 3ml of whole blood of the patient, but it is very difficult to obtain the blood volume for children or the elderly who have difficulty collecting blood because blood must be collected through a syringe to obtain the blood volume. There was a very troublesome problem for the general public.
  • Korean Patent Publication No. 1020040092299 relates to a novel tuberculosis specific antigen and a tuberculosis diagnostic kit using the same, and proposes a new tuberculosis specific antigen (Mt-1), It provides an antigen composition comprising Mt-1 with improved sensitivity and specificity, and it is described that it can be usefully used for diagnosing and preventing tuberculosis by also presenting a diagnostic method and a diagnostic kit using the same.
  • Mt-1 tuberculosis specific antigen
  • Korean Patent Publication No. 1020080070262 relates to a composition for diagnosing tuberculosis comprising a HHHAA antigen and a diagnostic kit comprising the same, wherein HBHA antigen is used in antigen-antibody reactions with IgM in early tuberculosis patients and chronic tuberculosis patients. It has been shown to have a high response, have a strong specificity for IgM in patients with pulmonary tuberculosis and tuberculous pleurisy, and that the IgM antibody response of HBHA is expected to protect against the spread of pulmonary exotuberculous.
  • the present invention has been made in view of the above necessity, and an object of the present invention is to provide a method for diagnosing tuberculosis with high sensitivity and specificity.
  • Another object of the present invention is to provide a composition for said method.
  • the present invention comprises the steps of: a) treating tuberculosis-specific antigen in the blood of suspected tuberculosis; b) separating the full-length RNA from the blood treated with the tuberculosis-specific antigen; c) the isolated full length Synthesizing cDNA from RNA; d) comparing the synthesized cDNA with the expression level of a first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and IP-10 (interferon inducible protein-10) Performing RT-PCR using a second primer pair capable of amplifying a control gene for; And e) measuring the mRNA expression level of the amplified IP-10 and the mRNA expression level of a control gene; and providing information providing method for diagnosing tuberculosis.
  • the step d) may amplify the synthesized cDNA, a first primer pair capable of amplifying IP-10, a first probe capable of binding to the amplified site, and a control gene.
  • Realtime RT-PCR is preferably performed using a second primer pair and a second probe capable of binding to the amplified control gene region, but are not limited thereto.
  • step a it is preferable to further include the step of collecting blood of suspected tuberculosis patient before step a), but is not limited thereto.
  • the tuberculosis specific antigen of step b) is preferably one or more of ESAT-6, CFP-10 and TB7.7, but is not limited thereto.
  • control gene is preferably GAPDH, but is not limited thereto.
  • the first primer pair capable of amplifying the IP-10 is a primer pair consisting of SEQ ID NO: 1 and 2
  • the second primer pair capable of amplifying the control gene is a sequence It is preferably one of a primer pair consisting of Nos. 4 and 5, but is not limited thereto.
  • step e it is preferable to further include a step of comparing the mRNA expression level of IP-10 relative to the mRNA expression level of the control gene, but is not limited thereto.
  • the first probe is preferably a probe represented by SEQ ID NO: 3,
  • the second probe is preferably a probe represented by SEQ ID NO: 6, but is not limited thereto.
  • the present invention provides a composition for diagnosing tuberculosis comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.
  • the composition preferably further comprises a primer pair specifically binding to the gene in order to measure the mRNA expression level of the control gene, but is not limited thereto.
  • the primer pair is preferably a primer pair consisting of SEQ ID NOs: 4 and 5, but is not limited thereto.
  • the composition preferably further comprises a first probe and a second probe, but is not limited thereto.
  • the present invention provides a kit for diagnosing tuberculosis comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.
  • the kit preferably further comprises a primer pair specifically binding to the gene in order to measure the mRNA expression level of the control gene, but is not limited thereto.
  • the present invention comprises the steps of a) treating the tuberculosis specific antigen in the blood of suspected tuberculosis; b) separating the full-length RNA from the blood treated with the tuberculosis specific antigen; c) synthesizing cDNA from the isolated full-length RNA D) amplifying the synthesized cDNA to a control gene for contrast with the first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and the expression level of IP-10 (interferon inducible protein-10). Performing RT-PCR using a second primer pair, which may be present; And e) measuring the mRNA expression level of the amplified IP-10 and the mRNA expression level of a control gene.
  • IP-10 is a small sized chenmokine expressed by antigen presenting cells and is a major derivative of inducing inflammatory immune responses. The secretion of IP-10 begins when T-cells recognize when antigen presenting cells present Mycobacterium tuberculosis specific antigens on the cell surface. Since IP-10 is known to express higher amounts than IFN- ⁇ , targeting of IFN- ⁇ can lead to higher sensitivity in children, HIV-infected, and elderly people who have had sensitivity problems. It is a major biomarker that is being actively researched recently.
  • the step of treating the tuberculosis bacteria specific antigen by collecting blood of suspected tuberculosis; (2) separating the full-length RNA from the blood treated with Mycobacterium tuberculosis specific antigen; (3) synthesizing cDNA from the isolated full-length RNA; (4) the synthesized cDNA is a first primer pair capable of amplifying IP-10, a first probe capable of binding to the amplified site, and an agent capable of amplifying a control gene for contrast with the expression level of IP-10.
  • IP-10 is quantitatively analyzed at the mRNA expression level, not at the protein expression level, blood volume, test time, and test cost required for the TB test can be significantly reduced.
  • step (1) blood from tuberculosis and suspected tuberculosis patients is collected and treated with Mycobacterium tuberculosis-specific antigen.
  • the minimum amount of blood required is more than 3 ml.
  • blood In order to collect this amount of blood, blood must be drawn from a suspected tuberculosis patient through a syringe. Due to the difficulty of blood collection, the elderly, young children and women had a problem that the tuberculosis test is difficult.
  • the required blood volume is 1 ml or less, preferably 0.3 to 0.5 ml can provide information to determine whether tuberculosis, blood collection simply by a method using a low-volume blood collection tube It can do much of the psychological burden of blood collection.
  • the blood used in the present invention may preferably be whole blood.
  • the tuberculosis-specific antigen is treated in the blood of the collected tuberculosis and suspected tuberculosis patient. This is to provide information for determining tuberculosis through the mRNA expression level of IP-10 secreted by T cells in response to Mycobacterium tuberculosis-specific antigen, and in the present invention, IP-10 is not quantitatively expressed. Quantification of mRNA expression levels provides information for diagnosing tuberculosis.
  • the Mycobacterium tuberculosis-specific antigen that can be used in step (1) can be used for the IGRA test, and is specifically present only in Mycobacterium tuberculosis, and any conventional Mycobacterium tuberculosis specific antigen known to induce an immune response in the host can be used.
  • ESAT-6 NCBI ACCESSION NO: YP_178023
  • CFP-10 NCBI ACCESSION NO: NP_218391
  • TB7.7 NCBI ACCESSION NO: NP_217171
  • a Mycobacterium tuberculosis specific antigen within about 4 hours.
  • the patients with the tuberculosis bacterium specific antigen should be treated immediately after blood collection without isolation of full-length RNA.
  • the blood of the patients exposed to tuberculosis should be treated. This is because the treatment of tuberculosis antigens can express more IP-10 because T cells remember and show stronger immune responses than normal individuals.
  • Steps (2) and (3) of the present invention are a method for separating total RNA, which is commonly used as a preliminary step for performing real-time RT-PCR, and a method for synthesizing cDNA therefrom. Method, and a detailed description of this process can be found in Joseph Sambrook et al., Molecular Cloning, ALaboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, K. F. et al., Which may be incorporated by reference of the present invention.
  • RT-PCR is difficult to commercialize compared to real-time RT-PCR (qRT-PCR) used in the present invention.
  • the analysis time may be delayed because agarose gel electrophoresis, EtBr staining, and densitometer measurements are required to analyze the expression level of IP-10 mRNA after the amplification process (PCR).
  • PCR amplification process
  • the reproducibility of the test may be degraded because skilled persons are required for the test.
  • qRT-PCR used in the present invention does not require electrophoresis and EtBr staining, the existing total test time can be reduced, so that TB patients can be identified more quickly.
  • the machine since the machine reads the signal emitted by the probe labeled on the amplified product sensitively, it can be a more sensitive test than the conventional test.
  • another labeled probe may bind to the inside of the site amplified by the primer pair, and thus may have a higher specificity for the target.
  • the synthesized cDNA is compared with the expression level of the first primer pair capable of amplifying IP-10, the first probe capable of binding to the amplified site, and IP-10.
  • QRT-PCR was performed using a second primer pair capable of amplifying a control gene and a second probe capable of binding to an amplified control gene region to solve the above-described problems.
  • Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
  • Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the amplified target sequence (IP-10, control gene) can be labeled with a detectable label.
  • the labeling material may be a fluorescent, phosphorescent, chemiluminescent or radioactive material, but is not limited thereto.
  • the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3.
  • qRT-PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer so that the target sequence can be labeled with a detectable fluorescent labeling substance.
  • the label using the radioactive material may add radioactive isotopes such as 32 P or 35 S to the PCR reaction solution when qRT-PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. have.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification product may be incorporated into the amplification product while the amplification product is synthesized.
  • One or more sets of oligonucleotide primers used to amplify a target sequence can be used. Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption,
  • IP-10 is a protein secreted from cytokine and chemokine-activated antigen-presenting cells secreted from T cells stimulated by Mycobacterium tuberculosis-specific antigen, and in the present invention, the protein is expressed through qRT-PCR. Expression levels are measured at the mRNA level.
  • a novel primer pair and fluorescence-labeled probe specifically binding to the IP-10 gene are required.
  • [5 'ccagaatcgaaggccatcaaga 3' (SEQ ID NO: 1)] as a front primer and a rear primer [ 5 'agggaagtgatgggagaggca 3' (SEQ ID NO: 2)] is available.
  • [5'-FAM-tgcagtgcttccaaggatggaccaca-Quen-3 '(SEQ ID NO: 3)] may be used as a fluorescent labeling probe that binds to an amplification site of IP-10, but is not limited thereto. As long as it can provide a detectable signal to perform qRT-PCR, it can be used without limitation.
  • FAM and Quen (Quencher) means a fluorescent dye.
  • qRT-PCR may be performed using a primer and a fluorescently labeled probe capable of amplifying a control gene for contrast with the expression level of IP-10.
  • the control gene that can be applied to the present invention is a reference gene for relatively determining the expression level of IP-10, in the present invention, as an example of the control gene, the same GAPDH gene as the existing IFN- ⁇ qRT-PCR patent. (NCBI ACCESSION NO: NM_002046) can be used to perform qRT-PCR to express mRNA.
  • GAPDH gene is a housekeeping gene, which is a gene that is constantly expressed in a constant amount in order to maintain minimal function in human cells. There are many genes besides GAPDH, but GAPDH is the largest in quantitative qRT-PCR analysis. It is used.
  • the present invention is not limited thereto, and a gene which may be a reference for relatively determining the expression level of IP-10 may be applied to the present invention.
  • a GAPDH gene is used as a control gene, and thus a primer capable of specifically binding to the gene is required.
  • [5'-CCATCTTCCAGGAGCGAGATCC-3 '(SEQ ID NO: 4)] and a rear primer are used as forward primers.
  • [5'-FAM-ACTGGCGTCTTCACCACCAT-Quen-3 '(SEQ ID NO: 6)] can be used as a novel primer pair as [5'-ATGGTGGTGAAGACGCCAGTG-3' (SEQ ID NO: 5)] as a fluorescent labeling probe.
  • the qRT-PCR method applied to the present invention may be carried out through known procedures commonly used in the art.
  • step (5) the mRNA expression level of the amplified IP-10 and the mRNA expression level of the control gene are measured as step (5).
  • This step is for relatively measuring the expression level of mRNA of IFN- ⁇ and mRNA of the control gene, and can be used without limitation as long as it is a method for measuring the normal mRNA expression level, depending on the type of probe label used radioactive Measurement, fluorescence measurement or phosphorescence measurement may be performed, but is not limited thereto.
  • a fluorescence measurement method is performed by performing qRT-PCR by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance.
  • Labeled fluorescence can be measured using a fluorimeter.
  • the radiometric method is performed by adding radioisotopes such as 32 P or 35 S to the PCR reaction solution to label the amplification products when performing qRT-PCR, followed by radiometric measuring apparatus such as Geiger counter or Radioactivity can be measured using a liquid scintillation counter.
  • the PCR product amplified by the qRT-PCR attached to the fluorescence-labeled probe to give a fluorescence of a specific wavelength at the same time the amplification of the mRNA of IP-10 in the fluorescence meter of the qPCR device
  • Expression level and expression level of the mRNA of the control gene is measured in real time, and the measured value is calculated and visualized through the PC, the examiner can easily check the expression level.
  • the amount of expression of IP-10 and GAPDH mRNA is calculated for each blood sample (sample), and the amount of expression of IP-10 is corrected according to the amount of expression of GAPDH mRNA and Nil control, a negative control group.
  • Mycobacterium tuberculosis-specific antigens can be used to provide information that can be used to determine tuberculosis. It can be.
  • the diagnostic kit may be a kit for diagnosing tuberculosis, characterized in that it includes essential elements necessary to perform reverse transcriptase.
  • the reverse transcriptase polymerase kit may comprise respective primer pairs specific for the human IP-10 gene.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length, and more preferably SEQ ID NOs: 1 and 2 It may include a novel primer pair represented by and a fluorescently labeled probe represented by SEQ ID NO: 3.
  • the primer may include a novel primer pair consisting of SEQ ID NOs: 4 and 5 and a fluorescently labeled probe represented by SEQ ID NO: 6.
  • reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC - May include DEPCwater, sterile water, and the like.
  • reaction buffers pH and magnesium concentrations vary
  • enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase
  • DNAse RNAse inhibitor DEPC - May include DEPCwater, sterile water, and the like.
  • the conventional IGRA method for testing IFN- ⁇ and IP-10 protein requires at least 3ml or more blood, which can be burdensome for patients because blood is drawn using a larger blood cllection tube. Tuberculosis testing is possible with very small blood volumes of less than ml, so the use of a smaller blood collection tube can significantly reduce the burden on the patient, and is easier for elderly patients and children who have difficulty collecting blood.
  • the amount of expression of IP-10 itself is known to be very high compared to IFN- ⁇ , it led to the improvement of the insufficient sensitivity, which was considered as a limitation.
  • the present invention can be tested for tuberculosis with very little blood of 1 ml or less, so that the burden of the patient can be significantly reduced by using a smaller blood collection tube, and elderly patients who have difficulty in collecting blood. It is easy even in child patient.
  • the expression amount of IP-10 itself is known to be very high compared to IFN- ⁇ , there is an effect that can lead to the improvement of the insufficient sensitivity, which was considered as a conventional limitation.
  • 1 is a diagram related to the construction of a primer and TaqMan Probe for IP-10 mRNA target qRT-PCR
  • Figure 3 is a comparison of the results of IP-10 qRT-PCR and IFN- ⁇ qRT-PCR for patients and healthy people
  • Figure 4 is a view showing an antigen tube (three control / 1 person) containing Mycobacterium tuberculosis specific antigen (peptide),
  • FIG. 5 shows the results of IP-10 mRNA qRT-PCR of active TB patients and recent contacts, as shown in FIG. 5, in active TB patients and recent contacts. Since this is in progress, it can be seen that the amount of IP-10 mRNA expression is significantly increased when treated with Mycobacterium tuberculosis-specific antigen (TB Ag control) compared to before nil control (nil control).
  • TB Ag control Mycobacterium tuberculosis-specific antigen
  • the Ct value is about 24 to 26, but in Nil control, the Ct value is about 30, and the difference in Ct value is about 5 degrees.
  • the graph peak in TB Ag control was shown in PCR cycle of less cycle, more IP-10 mRNA was expressed in preparation for Nil control. This is an example of experiments using peripheral blood from tuberculosis patients.
  • the TB antigen tube is a tube containing three antigens, ESAT-6, CFP-10, and TB7.7, which are specific to Mycobacterium tuberculosis and are known to induce an immune response in the host.
  • the TB mitogen tube contains phytohaemagglutinin (PHA) that acts as a mitogen to help differentiate T cells and was used as a positive control in the IGRA test.
  • PHA phytohaemagglutinin
  • Example 1 the antigen-treated blood was centrifuged (3,000xg, 15 minutes), plasma was collected, and the existing IGRA test was performed. (Roche diagnostics) and completely hemolyzed using MagNA Pure LC (Roche Diagnostics) and MagNA Pure LC RNA Isolation Kit-High Performance, using the RNA HP Blood External Lysis protocol stored in the automated nucleic acid extractor Total RNA was extracted.
  • Example 4 IP-10 and GAPDH amplification using synthesized cDNA as a template
  • the composition of the qRT-PCR reactants was 50 mM KCl, Tris-HCl 10 mM (pH8.3), MgCl2 1.5 mM, gelatin 0.001% (w / v), 250 uM dNTP, 1 unit Tag DNA polymerase (Solgent), respectively.
  • the front primer and the back primer are 10 pmole.
  • oligo probes labeled with fluorescent probes were added to 5 pmole.
  • 3 ⁇ l of the synthesized cDNA was added thereto, and the final volume was 20 ⁇ l.
  • the base sequence of each primer added is as follows.
  • IP-10 primer (size of amplification product-144bp)
  • Probe-5 'FAM-tgcagtgcttccaaggatggaccaca-Quen 3' SEQ ID NO: 3
  • Probe-5 'FAM-ACTGGCGTCTTCACCACCAT-Quen 3' (SEQ ID NO: 6)
  • the RT-PCR reaction (ABI 7500 FAST real-time PCR system, Applied Biosystem) was performed once at a denaturation temperature of 95 ° C. for 5 minutes, 40 cycles of 10 seconds at denaturation temperature of 95 ° C. and 30 seconds at annealing temperature of 60 ° C. Repeated times were performed. The total run time is 1 hour (65 minutes).
  • the Ct value represents the number of cycles in which amplification began to increase significantly during the PCR process.
  • ⁇ Ct means the value of the vertical axis (mRNA expression ratio) in FIG. 3.
  • ⁇ Ct value of Nil Ct value of IP-10 in Nil-Ct value of reference (GAPDH) gene in Nil
  • R (expression) ⁇ Ct of mitogen- ⁇ Ct of nil
  • ⁇ Ct value in TB antigen Ct value of IP-10 in TB antigen-Ct value of reference (GAPDH) gene in IP-10
  • ⁇ Ct value of Nil Ct value of IP-10 in Nil-Ct value of reference (GAPDH) gene in Nil
  • R (expression) ⁇ Ct value in TB antigen- ⁇ Ct value of Nil
  • the Ct value of the reference gene used in this experiment represents the Ct value for GAPDH, and the reference gene may include other house keeping genes in addition to the GAPDH used in this experiment.
  • TB mitogen As a positive control, it is possible to confirm whether the expression level is actually overexpressed.
  • CXCL10 NCBI ACCESSION NO: NM_001565
  • NCBI GeneBank NCBI GeneBank amplifiable anterior and posterior primers and TaqMan probes were prepared (FIG. 1).
  • Table 1 is a table showing the clinical information of the clinical sample provider used in the present invention.
  • peripheral blood was collected from 87 patients and healthy individuals, and the IFN- ⁇ mRNA was developed by extracting total RNA from cells obtained after incubating the blood for 16-18 hours at 37 ° C with TB-specific antigen.
  • Targeted qRT-PCR and targeted qRT-PCR targeting IP-10 mRNA were performed, and the sensitivity of IP-10 qRT-PCR was confirmed compared to IFN- ⁇ qRT-PCR.
  • the mean value of the expression level of IP-10 was close to about 100 in patients with active pulmonary tuberculosis, and the expression level of IP-10 was about 10 in the case of IFN- ⁇ . It confirmed that it increased more than 10 times. Recently, the average value of the expression level of IP-10 was close to about 60 for IFN- ⁇ , and about 2.5 for IFN- ⁇ . It was confirmed to appear high. On the other hand, both biomarkers were confirmed to have no visible response to Mycobacterium tuberculosis specific antigen as 1 in the health control group (FIG. 3). These results confirm that IP-10 qRT-PCR results in higher sensitivity when IFN- ⁇ qRT-PCR is performed.
  • the concordance rate of the conventional commercialized IFN- ⁇ ELISA and IFN- ⁇ RT-PCR was about 79% (19/24), and the concordance rate of the IFN- ⁇ ELISA and IFN- ⁇ real-time qRT-PCR was about 88%.
  • the result of IFN- ⁇ real-time qRT-PCR (21/24) was 9% higher than that of IFN- ⁇ ELISA compared with IFN- ⁇ RT-PCR.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 IP-10(interferon inducible protein-10) mRNA 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트에 관한 것이다.

Description

아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
본 발명은 IP-10(interferon inducible protein-10) mRNA 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트에 관한 것이다.
일반적으로 결핵은 마이코박테리움. 튜베르쿨로시스(M. tuberculosis)로 감염되어 유발되는 만성 감염성 질병으로, 개발도상국에서 주요 질병일 뿐 아니라 세계 선진국에서도 그 심각성이 증가하고 있으며, 매년 약 8백만명의 환자가 새로 발병하며 약 3백 만명의 환자가 사망한다. 결핵은 감염되어도 상당한 시간 동안 증상이 없을 수 있지만, 이 질병은 가장 통상적으로 폐의 급성 염증으로 나타나서 열 및 비생산적 기침을 초래하며, 이를 치료하지 않으면, 통상적으로 심각한 합병증을 초래하고 사망에 이르게 된다.
따라서, 결핵의 조기 진단 및 치료가 무엇보다도 중요하며, 종래에 결핵균 감염의 모니터링에는 투베르쿨린 피부반응검사(Tuberculin Skin Test; TST)가 전 세계적으로 통용되어 왔다. TST는 결핵균 배양액을 가열 멸균한 후 여과하여 얻은 배양액을 정제한 투베르쿨린을 주사하고 2-3일 이후에 주사부위에 나타나는 반응(지연형 과민반응)의 정도를 측정하는 항원 특이적인 반응이다.
그러나 TST는 비결핵항산균(NTM)에 감작되었던 사람들에게서 교차반응을 보이며, 우리나라와 같이 BCG백신접종이 보편화되어 있는 경우에는 위양성의 확률이 매우 높다. 또한, 결핵환자 중에는 음성반응을 보이는 환자들도 있어 결핵 감염을 가리는 기준으로써 신빙성이 감소하였다. 그러나 특이도는 낮지만 민감도가 높고 저렴한 비용 때문에 아직도 개발도상국이나 후진국에서는 결핵균 감염을 검출하기 위한 방법으로써 널리 사용되고 있다.
통상적으로 많이 사용되던 방법은 배양법이다. 그러나 검사실에서 환자의 검체로부터 직접 균을 분리, 배양하여 검사를 할 경우 감염의 위험성이 매우 높으며, 결핵균이 자라는데 최소 4-6주 이상 소요되기 때문에 상당히 많은 시간과 비용이 소모되는 문제가 있었다.
반면에, 환자의 혈액을 이용한 검출방법은 결핵균이 아닌 결핵균 감염에 의한 면역반응을 보는 것이기 때문에 보다 안전하고, 빠르며, 또한 일반적인 임상 검사 시 필요한 혈액의 일부를 사용해 검사를 진행할 수 있기 때문에 환자와 검사자 입장에서 모두 편리한 방법이다.
현재까지 개발된 혈액을 대상으로 한 검사법에는 결핵균 항원에 대한 항체를 검출하는 혈청학적인 방법과, 결핵균 감염에 의해 분비되는 IFN-γ NCBI ACCESSION NO: NM_000619)의 양을 검출하는 IGRA검사법이 있다.
구체적으로 혈청학적 진단법은 사용이 아주 간편하고 쉽고 빠르게 결과를 해석할 수 있다는 장점이 있으나 특이도와 민감도가 매우 낮고 정량적인 검사를 할 수 없다는 단점이 있다.
이에 결핵균 특이항원에 의해 자극된 T세포가 분비하는 IFN-γ 단백질을 정량적으로 분석하는 방법인 IGRA 검사는 IFN-γ에 대한 단일항체를 이용한 ELISA 법인 QuantiFERON과 ELISPOT법을 이용한 T-Spot.TB가 기존의 검사법에 비해 높은 특이도를 보이기 때문에 선진국을 중심으로 널리 사용되어 지고 있다. 그러나 IGRA 검사는 세계적으로 상용화되기에 어려운 다음과 같은 단점들이 있다.
첫째, IGRA검사를 위해서는 환자의 전혈이 약 3ml 정도 필요하지만 이 정도 혈액량을 얻기 위해서는 주사기를 통해 혈액을 채취하여야 하기 때문에 채혈이 어려운 소아나 노인의 경우 검사에 필요한 혈액량을 얻기가 매우 어려울 뿐 아니라, 일반인들에게도 매우 번거로운 문제가 있었다.
둘째, 검사 시, 채취한 혈액에 결핵 특이 항원을 처리하는 시간이 16-24 시간 정도 소요되기 때문에 검사결과가 나오기까지 약 이틀의 시간이 소요된다.
셋째, 상업용 키트의 경우 전량 수입에 의존하고 있으며, 가격 역시 100테스트 당 500만원 정도로 현저하게 비싼 문제가 있다.
넷째, ELISA방법을 이용한 IGRA검사의 경우 검사 시마다 표준검량선(standard)을 설정해야 하기 때문에, 적은 수의 검체를 검사하기에 비용적인 부담이 있고, 한 번에 많은 수의 검체를 검사할 때에는 검사에 사용되는 발색 시약의작용이 지연될 수 있기 때문에 일정한 결과를 얻기 어려운 문제가 있다.
따라서, 이러한 단점을 극복하기 위해 IFN-γ mRNA을 표적으로 한 실시간 역전사 효소 증폭법이 개발되었으며, 이를 통해 검사에 필요한 혈액 양, 시간 및 노력을 현저히 줄일 수 있었고, 이로 인해 보다 효율적이고 손쉽게 검사를 진행할 수 있었으나, 검사의 민감도에 있어서 기존의 IGRA 검사법에 비해 향상된 점이 미미하였기 때문에 면역학적 결핵검사를 위해 기존 검사 표적인 IFN-γ외에 추가적인 바이오 마커의 추가가 필요한 실정이다.
관련 선행 특허로 대한민국 특허공개번호 제1020040092299호는 신규한 결핵 특이적 항원 및 이를 이용한 결핵 진단 킷트에 관한 것으로, 새로운 결핵 특이적 항원(Mt-1)을 제시하고, 기존의 항원 조성물 보다 항체에 대한 민감도 및 특이도가 더욱 향상된 Mt-1을 포함하는 항원 조성물을 제시하며, 이를 이용한 결핵 진단방법 및 진단킷트를 또한 제시함으로써 결핵을 진단하고 예방하는데 유용하게 이용될 수 있다고 기재되어 있으며,
다른 관련 선행 특허로 대한민국 특허공개번호 제1020080070262호는 ＨＢＨＡ 항원을 포함하는 결핵 진단용 조성물 및 이를 포함하는 진단용 키트에 관한 것으로, HBHA항원은 초기 결핵 환자 및 만성 결핵 환자에서 IgM과의 항원-항체반응에서 높은 반응을 나타내었으며, 폐결핵 및 결핵성 흉막염 환자에서 IgM에 대한 강한 특이성을 갖고, HBHA의 IgM 항체반응은 폐 외결핵의 전파에 대해 보호기능을 할 것으로 예상된다고 기재되어 있다.
본 발명은 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 민감도와 특이도가 높은 결핵진단법을 제공하는 것이다.
본 발명의 다른 목적은 상기 방법을 위한 조성물을 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계;b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계;c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;d) 상기 합성된 cDNA를 IP-10(interferon inducible protein-10)을 증폭할 수 있는 제 1 프라이머 쌍 및 IP-10(interferon inducible protein-10)의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제 2 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및 e) 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계;를 포함하는 결핵의 진단을 위한 정보제공방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 d) 단계는 상기 합성된 cDNA를 IP-10을 증폭할 수 있는 제1 프라이머 쌍,증폭된 부위에 결합할 수 있는 제1 프로브 및 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 구현예에 있어서, 상기 a) 단계 이전에 결핵 의심환자의 혈액을 채혈하는 단계를 더 포함하는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 또 다른 구현예에 있어서,상기 b) 단계의 결핵균 특이항원은 ESAT-6,CFP-10 및 TB7.7 중 어느 하나 이상인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 바람직한 구현예에 있어서,상기 대조군 유전자는 GAPDH인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 바람직한 구현예에 있어서,상기 IP-10을 증폭할 수 있는 제 1 프라이머 쌍은 서열번호 1 및 2로 구성되는 프라이머쌍이고, 상기 대조군 유전자를 증폭할 수 있는 제 2 프라이머 쌍은 서열번호 4 및 5로 구성되는 프라이머 쌍인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 일 구현예에 있어서,상기 e) 단계 이후, 대조군 유전자의 mRNA 발현수준을 기준으로 IP-10의 mRNA 발현수준을 상대적으로 비교하는 단계를 더 포함하는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 구현예에 있어서, 상기 제 1 프로브는 서열번호 3으로 표시된 프로브인 것이 바람직하고,
본 발명의 다른 구현예에 있어서, 상기 제2 프로브는 서열번호 6으로 표시된 프로브인 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 서열번호 1 및 2로 구성되는 프라이머 쌍을 유효성분으로 포함하는 결핵 진단용 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 조성물은 대조유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머 쌍을 더욱 포함하는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 다른 구현예에 있어서, 상기 프라이머 쌍은 서열번호 4 및 5로 구성되는 프라이머쌍인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 또 다른 구현예에 있어서, 상기 조성물은 제 1 프로브 및 제 2 프로브를 더욱 포함하는 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 서열번호 1 및 2로 구성되는 프라이머 쌍을 유효성분으로 포함하는 결핵 진단용 키트를 제공한다.
본 발명의 일 구현예에 있어서, 상기 키트는 대조유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머 쌍을 더욱 포함하는 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명은 a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계;b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계;c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;d) 상기 합성된 cDNA를 IP-10(interferon inducible protein-10)을 증폭할 수 있는 제 1 프라이머 쌍 및 IP-10(interferon inducible protein-10)의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제 2 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및 e) 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계;를 포함하는 결핵 진단방법을 제공한다.
이하 본 발명을 설명한다.
위에서 언급하였듯이, 본 발명은 결핵진단을 위한 표적을 IFN-γ로부터 대체 바이오마커를 찾기 위해 약 수백 가지의 바이오마커가 평가되었으나, 그 중 IP-10(interferon inducible protein-10)(NCBI ACCESSION NO: NM_001565)이 가장 의미있는 결과를 나타냈다. 따라서, 본 발명에서는 기존의 IFN-γ mRNA를 표적으로 한 실시간 역전사효소 증폭법과 더불어 대체 바이오마커인 IP-10 mRNA를 표적으로 한 실시간 역전사효소 증폭법을 추가하여 보다 민감도와 특이도가 높은 결핵진단법을 발명하였다.
IP-10은 항원제시세포(antigen presenting cell)에 의해 발현되는 작은 사이즈의 케모카인(chenmokine)이며, 염증성 면역반응을 유도하는 주요 유도체이다. IP-10의 분비는 항원제시세포가 결핵균 특이 항원을 세포표면에 제시했을 때 T-세포가 이를 인지하여 시작된다. IP-10은 IFN-γ에 비해 보다 많은 양이 발현된다고 알려져 있기 때문에, 기존의 IFN-γ를 표적으로 했을 때, 민감도 문제가 되었던 어린이, HIV감염자, 노인에서 보다 높은 민감도를 이끌어 낼 수 있는 표적으로써 최근 연구가 활발히 진행되고 있는 주요한 바이오 마커이다.
이에 본 발명에서는, (1) 결핵 의심환자의 혈액을 채취하여 결핵균 특이항원을 처리하는 단계; (2) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계; (3) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계; (4) 상기 합성된 cDNA를 IP-10를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 IP-10의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 qRT-PCR을 수행하는 단계; 및 (5) 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계를 포함하는 결핵의 진단을 위한 정보제공방법을 제공하여 상술한 문제의 해결을 모색하였다.
특히 IP-10을 단백질 발현수준이 아닌 mRNA 발현수준에서 정량적으로 분석하기 때문에 결핵검사 시 요구되는 혈액량, 검사시간 및 검사비용을 현저하게 저감할 수 있다.
먼저, (1) 단계로서 결핵 및 결핵 의심환자의 혈액을 채취하여 결핵균 특이항원을 처리한다. 종래의 IGRA 검사에서는 필요로하는 최소한의 혈액량이 3㎖ 이상이며 이 정도의 혈액을 채혈하기 위해서는 주사기를 통해 결핵 의심환자로부터 혈액을 채취하여야만 하였다. 상술한 채혈의 어려움으로 인하여 노인, 어린아이 및 여성들이 결핵검사를 받기 어려운 문제가 있었다. 그러나, 본 발명의 한 특징에 따르면 요구되는 혈액량이 1㎖ 이하로서 바람직하게는 0.3 ~ 0.5㎖를 통해 결핵여부를 판단할수 있는 정보를 제공할 수 있으므로, 저용량의 blood collection tube를 이용한 방법으로 간편하게 채혈할 수 있어 채혈의 심리적 부담감을 상당부분 해소할 수 있다.
한편, 본 발명에 사용되는 혈액은 바람직하게는 전혈일 수 있다. 그 뒤, 채혈된 결핵 및 결핵 의심환자의 혈액에 결핵균 특이항원을 처리한다. 이는 결핵균 특이항원에 반응한 T 세포가 분비하는 IP-10의 mRNA 발현수준을 통해 결핵을 판단하는 정보를 제공하기 위한 것으로서, 본 발명에서는 IP-10의 단백질의 발현수준의 정량이 아닌 IP-10 mRNA 발현수준의 정량을 통해 결핵을 진단하기 위한 정보를 제공한다. 그러므로, 상기 (1) 단계에서 사용될 수 있는 결핵균 특이항원은 통상적으로 IGRA 검사에 사용될 수 있는 것으로서, 결핵균에만 특이하게 존재하며, 숙주에서 면역반응을 유도한다고 알려진 통상의 결핵균 특이항원은 모두 사용될 수 있다. 바람직하게는 결핵균 특이항원으로서 ESAT-6(NCBI ACCESSION NO : YP_178023), CFP-10(NCBI ACCESSION NO : NP_218391) 및 TB7.7(NCBI ACCESSION NO : NP_217171)를 약 4시간 이내로 혼합하여 처리할 수 있다.
한편, 환자들에게 채혈 후 곧바로 전장 RNA를 분리하지 않고 상기 결핵균 특이항원을 처리하여야 하는데 이는 결핵에 노출된 환자의 경우 기억 T 세포에서 결핵에 대한 정보를 가지고 있기 때문에 결핵에 노출된 환자의 혈액에 결핵항원을 처리해주면 정상인에 비해 T cell이 기억하고 있다가 면역반응을 강하게 나타내기 때문에 더욱 많은 IP-10을 발현해낼 수 있기 때문이다.
다음, (2) 단계 및 (3) 단계로서 구체적으로 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA(Total RNA)를 분리하는 단계, (3) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계를 포함한다. 본 발명의 (2), (3) 단계는 real-time RT-PCR을 수행하기 위한 예비단계로서 일반적으로 사용되는 전장 RNA(Total RNA)를 분리하는 방법 및 이로부터 cDNA를 합성하는 방법은 공지된 방법을 통해 수행될 수 있으며, 이 과정에 대한 자세한 설명은 Joseph Sambrook 등, Molecular Cloning, ALaboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); 및 Noonan, K. F. 등에 개시되어 있어 본 발명의 참조로서 삽입될 수 있다.
한편, 본 발명에 사용되는 real-time RT-PCR(quantitative RT-PCR ; qRT-PCR)에 비하여 RT-PCR이 상용화 되기 어려운 몇 가지 단점이 있다. 첫째, 증폭과정(PCR) 이후에 IP-10 mRNA의 발현양을 분석하기 위해 아가로즈 젤 전기영동, EtBr 염색, densitometer (농도측정계) 측정의 과정들이 필요하므로 분석하는 시간이 지연될 수 있다. 둘째, 분석과정이 복잡하기 때문에, 검사를 위해 관련분야의 숙련자들이 필요하므로 검사의 재현성이 떨어질 수 있다. 셋째, 증폭된 증폭산물의 염색을 통한 분석이 이루어지기 때문에, 염색정도에 따른 결과의 민감도가 떨어질 수 있다(참고예 참조).
이에 반하여, 본 발명에서 사용되는 qRT-PCR은 전기영동과 EtBr염색과정이 필요 없으므로, 기존 총 검사 시간을 줄일 수 있으므로, 보다 빠르게 결핵환자를 판별해낼 수 있다. 또한, 증폭된 산물에 표지된 프로브에 의해 나오는 신호를 기계가 민감하게 읽어 냄으로써, 기존 검사에 비해 보다 민감도가 좋은 검사가 될 수 있다. 나아가, 추가로 형광 등이 표지된 프로브를 사용함으로써, 프라이머쌍에 의해 증폭된 부위의 내부에 또 다른 표지 프로브가 결합할 수 있으므로, 타겟에 대한 보다 높은 특이도를 가질 수 있다.
이에, 본 발명에서는 다음, (4) 단계로서, 상기 합성된 cDNA를 IP-10를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 IP-10의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 qRT-PCR을 수행하여 상술한 문제를 해결하였다.
본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속,철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열(IP-10, 대조군 유전자)은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광, 화학발광단 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 플루오리신(fluorescein), 피코에리트린(phycoerythrin), 로다민, 리사민 (lissamine) Cy-5 또는 Cy-3일 수 있다. 표적 서열의 증폭시 프라이머의 5'-말단 및/또는 3' 말단에 Cy-5 또는 Cy-3를 표지하여 qRT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다.
또한, 방사성 물질을 이용한 표지는 qRT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있다. 표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노 크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
본 발명의 한 측면에 따르면, IP-10은 결핵균 특이항원에 의해 자극된 T세포로부터 분비된 싸이토카인 및 케모카인에 의해 활성화된 항원제시세포로부터 분비하는 단백질로서 본 발명에서는 qRT-PCR을 통해 이를 단백질이 아닌 mRNA 수준에서 발현수준을 측정하게 된다. 이를 위하여 상기 IP-10 유전자에 특이적으로 결합하는 신규한 프라이머 쌍과 형광이 표지된 프로브가 요구되며, 본 발명에서는 전방 프라이머로서 [5' ccagaatcgaaggccatcaaga 3'(서열번호 1)] 및 후방 프라이머로서 [5' agggaagtgatgggagaggca 3'(서열번호 2)]인 신규한 프라이머 쌍을 이용할 수 있다. IP-10의 증폭부위에 결합하는 형광표지 프로브로서 [5'-FAM-tgcagtgcttccaaggatggaccaca-Quen-3'(서열번호 3)]을 사용할 수 있으나 이에 제한되는 것은 아니며, IP-10에 특이적으로 결합하여 검출 가능한 시그널을 제공하여 qRT-PCR을 수행할 수 있는 것이면, 제한 없이 사용될 수 있다. 상기에서 FAM과 Quen(Quencher)는 형광염료를 의미한다.
본 발명의 다른 측면에 따르면, IP-10의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 프라이머와 형광이 표지된 프로브를 이용하여 qRT-PCR을 수행할 수 있다. 이 때 본 발명에 적용될 수 있는 대조군 유전자는 IP-10의 발현 수준을 상대적으로 판단하기 위하여 기준이 되는 유전자로서, 본 발명에서는 상기 대조군 유전자의 일례로서 기존 IFN-γ qRT-PCR특허와 동일한 GAPDH 유전자(NCBI ACCESSION NO : NM_002046)를 사용하여 qRT-PCR을 수행하여 mRNA를 발현시킬 수 있다. GAPDH 유전자는 housekeeping gene으로써 일반적으로 인체의 세포 내에서 최소한의 기능을 유지하기 위해 일정한 양이 지속적으로 발현이 되고 있는 유전자로써, GAPDH 외에도 많은 유전자들이 존재하지만 정량적인 qRT-PCR분석에서는 GAPDH가 가장 많이 사용되고 있다.
그러므로 이에 제한되는 것은 아니며, IP-10의 발현수준을 상대적으로 판단하기 위하여 기준이 될 수 있는 유전자는 본 발명에 적용될 수 있다. 한편 본 발명에서는 대조 유전자로서 GAPDH 유전자를 사용하였으므로 상기 유전자에 특이적으로 결합할 수 있는 프라이머가 요구되며, 본 발명에서는 전방 프라이머로서 [5'-CCATCTTCCAGGAGCGAGATCC-3'(서열번호 4)] 및 후방 프라이머로서 [5'-ATGGTGGTGAAGACGCCAGTG-3'(서열번호 5)]인 신규한 프라이머쌍과 형광표지 프로브로서 [5'-FAM-ACTGGCGTCTTCACCACCAT-Quen-3'(서열번호 6)] 을 사용할 수 있다. 본 발명에 적용되는 qRT-PCR 방법은 당업계에서 통상적으로 사용되는 공지의 과정을 통해 수행될 수 있다.
다음, (5) 단계로서 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정한다. 본 단계는 IFN-γ의 mRNA 및 대조군 유전자의 mRNA의 발현수준을 상대적으로 측정하기 위한 것으로서, 통상의 mRNA 발현수준을 측정할 수 있는 방법이면 제한 없이 사용될 수 있으며, 사용한 프로브 표지의 종류에 따라 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 qRT-PCR을 수행하면 표적서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지 된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 qRT-PCR 수행 시32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
본 발명의 바람직한 일구현 예에 따르면, 상기 qRT-PCR을 통해 증폭된 PCR 산물에 형광이 표지된 프로브가 붙어 특정 파장의 형광을 내게 되고, 증폭과 동시에 qPCR 장치의 형광 측정기에서 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA의 발현수준을 실시간으로 측정하고, 측정된 값이 계산되어 PC를 통해 시각화 되게 되어 검사자는 쉽게 그 발현 정도를 확인할 수 있다. 다시 말해, 각각의 혈액 샘플(시료)마다 IP-10과 GAPDH mRNA의 발현량이 계산되고, IP-10의 mRNA 발현 양을 GAPDH의 mRNA 발현 양에 맞추어 그 값을 보정해 주고, 음성대조군인 Nil control에 비해 결핵균 특이 항원을 자극시킨 시료에서 IP-10 mRNA의 발현이 얼마나 증가했고 감소하였는지의 정도를 배수로 몇 배가 증가하고 감소하였는지 상대적으로 정량하는 방법을 통해 결핵환자임을 판별할 수 있는 정보를 제공할 수 있는 것이다.
본 발명의 다른 측면에 따르면 인간 IP-10 유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머와 형광이 표지된 프로브를 포함하는 결핵 진단용 조성물을 포함한다. 구체적인 일 양태로서, 상기 진단 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 결핵 진단용 키트일 수 있다. 역전사 중합효소반응 키트는 상기 인간 IP-10 유전자에 대한 특이적인 각각의 프라이머 쌍을 포함할 수 있다. 프라이머는 각 마커 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오타이드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp의 길이일 수 있으며 보다 바람직하게는 서열번호 1 및 2로 표시되는 신규한 프라이머 쌍 및 서열번호 3으로 표시되는 형광표지된 프로브를 포함할 수 있다.
또한 대조군 유전자의 핵산 서열에 특이적인 프라이머와 프로브를 포함할 수 있으며, 바람직하게는 GAPDH의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머와 프로브를 더 포함할 수 있으며, 보다 바람직하게는 상기 프라이머는 서열번호 4 및 5로 구성되는 신규한 프라이머쌍 및 서열번호 6으로 표시되는 형광표지된 프로브를 포함할 수 있다.
그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNAse, RNAse 억제제 DEPC-수(DEPCwater), 멸균수 등을 포함할 수 있다.
결국, 종래의 IFN-γ 및 IP-10 단백질을 검사하는 IGRA 방법은 최소 3㎖ 이상의 혈액을 요구하므로 보다 용량이 큰 blood cllection tube를 사용해 채혈하기 때문에 환자에게 부담이 될 수 있지만, 본 발명에서는 1㎖ 이하의 매우 적은 혈액만으로도 결핵검사가 가능하므로 보다 작은 blood collection tube를 사용함으로써 환자의 부담을 현저하게 저감할 수 있으며, 채혈이 힘든 노인환자나 어린아이에서 용이하다. 또한 IP-10의 발현양 자체가 IFN-γ에 비해 매우 높은 것으로 알려져 있기 때문에, 기존의 제한점으로 여겨졌던 부족한 민감도의 향상을 이끌어 냈다.
본 발명을 통하여 알 수 있는 바와 같이, 본 발명은 1㎖ 이하의 매우 적은 혈액만으로도 결핵검사가 가능하므로 보다 작은 blood collection tube를 사용함으로써 환자의 부담을 현저하게 저감할 수 있으며, 채혈이 힘든 노인환자나 어린이 환자에서도 용이하다. 또한 IP-10의 발현 양 자체가 IFN-γ에 비해 매우 높은 것으로 알려져 있기 때문에, 기존의 제한점으로 여겨졌던 부족한 민감도의 향상을 이끌어 낼 수 있는 효과가 있다.
도 1은 IP-10 mRNA 표적 qRT-PCR을 위한 프라이머 및 TaqMan Probe 제작과 관련된 도면,
도 2는 제작한 프라이머와 TaqMan프로브의 민감도 검사와 관련된 도면,
도 3은 환자 및 건강인을 대상으로 한 IP-10 qRT-PCR과 IFN-γ qRT-PCR의 결과 비교 도면,
도 4는 결핵균 특이항원(펩타이드)를 포함하고 있는 항원튜브 (3가지 대조군/1인)를 나타낸 도면,
도 5는 활동성 결핵환자 및 최근접촉자의 IP-10 mRNA qRT-PCR 결과로서 도 5에서 알 수 있는 바와 같이, 활동성 결핵 환자 및 최근 접촉자의 경우 결핵균에 대한 노출이 최근에 있었거나 현재 결핵으로의 병변이 진행중에 있으므로, IP-10 mRNA 발현양이 항원을 처리하기 전(nil control)에 대비 결핵균 특이항원을 처리하였을 때(TB Ag control), 상당히 증가하는 것을 확인할 수 있다. 도 5의 결과를 보면 TB Ag control의 경우 Ct 값이 약 24~26 사이로 나오지만, Nil control에서는 약 30 정도를 나타내 Ct 값의 차가 약 5정도 나타나는 것으로 보인다. 이 결과에서는 TB Ag control에서의 graph peak가 보다 적은 cycle의 PCR수행에서 나타났으므로, Nil control에 대비해 보다 많은 IP-10 mRNA 발현을 하고 있음을 알 수 있다. 결핵환자의 말초혈액을 이용해 실험한 한 예이다.
도 6은 정상인(건강인)의 IP-10 mRNA qRT-PCR 결과로서 정상인(건강인)은 결핵균에 대한 노출이 없었기 때문에, IP-10 mRNA 발현양이 항원을 처리하기 전(nil control)에 대비 결핵균 특이항원을 처리하였을 때(TB Ag control), 큰 변화가 없는 것을 확인할 수 있다. 도 6의 결과를 보면 TB Ag control의 경우 Ct 값이 약 30사이로 나오고, Nil control에서도 약 30 정도를 나타내 Ct 값의 차가 크게 없는 것으로 보인다. 이 결과에서는 TB Ag control에서와 Nil control에서의 graph peak 양상이 유사하게 나타나 결핵균 특이 항원에 대한IP-10 mRNA 발현이 없음을 알 수 있다. 정상인(건강인)의 말초혈액을 이용해 실험한 한 예이다.
이하 실시예를 통하여 본 발명의 구성을 보다 구체적으로 설명하지만,본 발명의 범위가 하기 실시예의 내용으로 한정되는 것은 아니다.
<실시예 1> 항원 처리된 혈액 제조
환자의 혈액(whole blood)에 결핵균 특이항원 처리환자로부터 혈액을 채혈한 후, IGRA검사에 사용되는 항원이 포함된 튜브를 호주의 Cellestis 사에서 수입하여 각 3개의 튜브에 혈액을 1 ml을 넣었다(도 4). Nil tube는 아무런 항원을 포함하지 않는 튜브로써 IGRA검사에서 음성대조군으로 사용된다. TB antigen 튜브는 결핵균에만 특이하게 존재하면서 숙주에서 면역반응을 유도한다고 알려진 3가지 항원 ESAT-6, CFP-10, TB7.7이 포함된 튜브이다. TB mitogen 튜브는 T세포의 분화를 돕는 mitogen 작용을 하는 phytohaemagglutinin (PHA)이 포함된 튜브로써 IGRA검사에서 양성대조로 사용하였다.
<실시예 2> 항원 처리된 혈액으로부터 total RNA의 분리
실시예 1에서 항원처리가 끝난 혈액을 원심분리(3,000xg, 15분)하여 플라즈마는 수집하여 기존 IGRA 검사를 진행하고 남아있는 세포층(적혈구, 백혈구, 혈소판)은 약 3배의 RNA/DNA stabilization solution(Roche diagnostics)에 넣고 완전히 용혈시킨 후 자동핵산추출기(MagNA Pure LC, Roche Diagnostics)와 MagNA Pure LC RNA Isolation Kit-High Performance를 이용하였으며, 자동핵산추출기에 저장되어 있는 RNA HP Blood External Lysis 프로토콜을 사용하여 total RNA를 추출하였다.
<실시예 3> 분리된 total RNA로부터 상보적인 cDNA의 합성
분리된 total RNA 9 ㎕, random primer(Invitrogen) 0.25ug, dNTP(Cosmo gene tech) 250uM, Tris-HCl(pH 8.3) 50mM, KCl 75mM, MgCl2 3mM, DTT 8mM 와 MMLV 역전사 중합효소 200units(Invitrogen)을 첨가하고 최종부피를 25ul가 되도록 DEPC treated DW를 넣고 교반하였다. 그 뒤 cDNA 합성 반응액을 thermocycler(GeneAmp PCR System 2700, Applied Biosystem)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성하였다.
<실시예 4> 합성된 cDNA를 주형으로 하여 IP-10 및 GAPDH 증폭
qRT-PCR 반응물의 조성은 KCl 50 mM, Tris-HCl 10 mM(pH8.3), MgCl2 1.5 mM, 젤라틴 0.001%(w/v), 250 uM dNTP, 1 unit Tag DNA중합효소(Solgent)와 각각의 전방 프라이머와 후방 프라이머 10 pmole이다. 덧붙여 형광 프로브가 표지된 올리고 프로브를 5pmole이 되게 첨가해준다. 여기에 합성된 cDNA 3 ㎕를 넣고 최종부피가 20 ㎕가 되도록 하였다. 첨가된 각각의 프라이머의 염기서열은 다음과 같다.
(1) IP-10 primer(증폭 산물의 크기-144bp)
Forward - 5' ccagaatcgaaggccatcaaga 3'(서열번호 1)
Reverse - 5' agggaagtgatgggagaggca 3'(서열번호 2)
Probe - 5' FAM-tgcagtgcttccaaggatggaccaca-Quen 3'(서열번호 3)
(2) GAPDH primer(증폭 산물의 크기-91bp)
Forward - 5' CGGGAAGCTTGTGATCAATGG 3'(서열번호 4)
Reverse - 5' GGCAGTGATGGCATGGACTG 3'(서열번호 5)
Probe - 5' FAM-ACTGGCGTCTTCACCACCAT-Quen 3' (서열번호 6)
q RT-PCR 반응 (ABI 7500 FAST real-time PCR system, Applied Biosystem) 은 변성 온도 95℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 10초, 어닐링 온도 60℃에서 30초인 사이클을 40회 반복 수행하였다. 총 수행 시간은 1시간(65분)이다.
<실시예 5> Software 분석을 통한 증폭여부 확인 및 증폭된 산물의 정량
Realtime RT-PCR이 끝난 후, 7500 Software V.2.04를 이용해 산물의 증폭을 확인하였다. 그리고 PCR효율 및 Ct값을 통해 결과를 분석 및 정량하였다.
한편 본 발명의 실시예에서 사용되는 세 가지 튜브인 TB mitogen튜브, TB antigen 튜브, Nil튜브로부터의 Ct 값을 확인하였으며, qRT-PCR의 특정유전자 발현량을 정량하는 방법 중 하나인 Comparative Ct Method를 이용하여 하기 관계식에 의거하여 측정하였고 이 공식은 7500 Software V.2.04에 내재되어 있어 자동으로 계산되어 나온다.
[관계식 1]
ΔΔCt= ΔCt(sample) - ΔCt(reference gene)
여기에서 Ct값이란 PCR과정중 증폭이 뚜렷하게 증가되기 시작한 Cycle의 수치를 나타낸다.
ΔΔCt는 하기 도 3에서 세로축의 수치(mRNA expression ratio)를 의미한다.
[관계식 2]
양성대조군에서 IP-10의 발현량 분석 관계식
Mitogen의 ΔCt 값 = Mitogen에서 IP-10의 Ct 값 - Mitogen에서 reference gene (GAPDH)의 Ct 값
Nil의 ΔCt 값 = Nil에서 IP-10의 Ct 값 - Nil에서 reference (GAPDH) gene의 Ct 값
R (발현량) = Mitogen의 ΔCt값 - Nil의 ΔCt값
[관계식 3]
TB항원의 자극에 대한 IP-10의 발현량 분석 관계식
TB항원에서의 ΔCt 값 = TB항원에서 IP-10의 Ct 값 - IP-10에서 reference(GAPDH) gene 의 Ct 값
Nil의 ΔCt 값 = Nil에서 IP-10의 Ct 값 - Nil에서 reference (GAPDH) gene의 Ct 값
R (발현량) = TB항원에서의 ΔCt값 - Nil의 ΔCt값
본 실험에서 사용된 reference gene의 Ct 값은 GAPDH에 대한 Ct값을 나타내며, reference gene이란 본 실험에 사용된 GAPDH이외에도 다른 house keeping gene이 포함될 수 있다.
TB mitogen : positive control 로써 실제로 발현량이 과발현 되었는지를 확인할 수 있다.
TB control 과 Nil control의 Ct값의 차: 결핵환자의 경우 Ct값의 차가 평균 2이상 났으며, 정상에서의 대조군간의 Ct값의 차는 2 이하로 나타났다(도 5 및 6).
<평가예 1> IP-10 mRNA 표적 qRT-PCR을 위한 프라이머 및 TaqMan Probe 제작
NCBI GeneBank에 등록되어 있는 IP-10(CXCL10)(NCBI ACCESSION NO: NM_001565)의 표준 염기서열을 기초로 증폭가능한 전방 및 후방프라이머와 TaqMan 프로브를 제작하였다(도 1).
<평가예 2> 제작한 프라이머와 TaqMan프로브의 민감도 검사
IP-10을 표적으로 한 프라이머의 민감도 검사 결과 프라이머의 민감도는 1x103 copy까지 증폭할 수 있음을 확인하였고, TaqMan 프로브를 이용해 IP-10 qRT-PCR을 수행한 결과 1x102 copy까지 증폭됨을 확인하였고, 프라이머만을 이용했을 때 보다 민감도가 10배 증가함을 확인하였다(도 2).
<평가예 3> 항원 처리된 혈액으로부터 분리된 IP-10 mRNA 정량을 통한 결핵 진단법의 가능성 평가
[규칙 제91조에 의한 정정 06.05.2013]　
표 1
Figure WO-DOC-TABLE-1
표 1은 본 발명에 사용된 임상검체 제공자의 임상정보를 나타낸 표이다.
연세대학교 신촌세브란스병원으로부터 약 87개의 임상검체와 QuatiFERON(IFN-γ ELISA; IGRA), tuberculin skin test(TST), 배양검사 및 의사임상진단 검사결과를 제공받았다. 이 임상검체는 항결핵치료 시작 전 이면서 폐결핵환자로 판명된 23명, 활동성결핵환자의 주변 접촉자 중 TST검사와 IGRA검사에서 양성이 나온 최근 접촉자 17명, 그리고 임상적으로 결핵에 대한 증상이 없고, IGRA검사에서 음성이 나온 건강인 47명을 포함한다(표 1).
따라서 87명의 환자 및 건강인을 대상으로 말초혈액을 채취하였고, 그 혈액을 결핵특이 항원에 의해 37℃에서 16~18시간 배양한 후 얻은 세포로부터 total RNA를 뽑아 기존에 개발된 IFN-γ mRNA를 표적으로 한 qRT-PCR과 IP-10 mRNA를 표적으로 한 qRT-PCR을 수행하였고, IP-10 qRT-PCR의 민감도가 IFN-γ qRT-PCR에 비해 그 민감도가 얼마나 향상되었는지 확인하였다.
그 결과, 활동성 폐결핵 환자에서 IP-10의 경우 발현 양의 평균값이 약 100에 가까웠으며, IFN- γ의 경우 약 10정도로 IP-10의 발현양이 IFN-γ에 비해 동일한 검체에서 그 발현양이 10배 이상 증가한 것을 확인하였다. 최근 접촉자의 경우 IP-10의 경우 발현양의 평균값이 약 60에 가까웠으며, IFN-γ의 경우 약 2.5정도로 활동성 폐결핵 환자에서와 마찬가지로, IP-10의 발현양이 IFN-γ의 발현양이 매우 높게 나타남을 확인하였다. 반면에 두 가지 바이오마커 모두 건강대조군에서는 1로서 결핵균 특이항원에도 눈에 뛰는 반응이 없음을 확인하였다(도 3). 이 결과들을 통해 IP-10 qRT-PCR을 수행할 경우 IFN-γ qRT-PCR을 수행하였을 때 보다 높은 민감도의 결과를 얻을 수 있음을 확인하였고, 또한 동량의 혈액을 사용했을 때 그 발현양이 상대적으로 매우 높았기 때문에, 기존의 혈액양인 1ml 이하를 사용하였을 때도, 의미있는 결과를 얻을 수 있을 것으로 예상되며, 활동성폐결핵 및 최근 접촉자에 비해 건강인 대조군에서 결핵항원에 특이 면역반응을 보이지 않았으므로, IFN-γ와 마찬가지로 IP-10도 결핵균 항원 특이하게 반응을 하는 것을 확인하여 검사의 특이도가 결핵진단에 적합함을 알 수 있었다.
<참고예>4시간 동안 결핵특이항원을 처리한 후 다양한 그룹에서의 IFN-γ RT-PCR과 real-time qRT-PCR 결과 비교
기존의 상용화된 IFN-γ ELISA와 IFN-γ RT-PCR의 결과 일치율이 약 79% (19/24) 였으며, IFN-γ ELISA와 IFN-γ real-time qRT-PCR의 결과 일치율이 약 88% (21/24)로 IFN-γ real-time qRT-PCR의 결과가 IFN-γ RT-PCR에 비해 IFN-γ ELISA와의 결과 일치도가 약 9%정도 높게 나오는 것을 확인하였다.
[규칙 제91조에 의한 정정 06.05.2013]　
표 2
Figure WO-DOC-TABLE-2

Claims (13)

  1. a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계;
    b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계;
    c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    d) 상기 합성된 cDNA를 IP-10(interferon inducible protein-10)을 증폭할 수 있는 제 1 프라이머 쌍 및 IP-10(interferon inducible protein-10)의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제 2 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및
    e) 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계;를 포함하는 결핵의 진단을 위한 정보제공방법.
  2. 제1항에 있어서, 상기 d) 단계는 상기 합성된 cDNA를 IP-10을 증폭할 수 있는 제1 프라이머 쌍,증폭된 부위에 결합할 수 있는 제1 프로브 및 대조군 유전자를증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하는 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  3. 제1항에 있어서,상기 b) 단계의 결핵균 특이항원은 ESAT-6,CFP-10 및 TB7.7 중 어느 하나 이상인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  4. 제1항에 있어서,상기 대조군 유전자는 GAPDH인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  5. 제1항 또는 제2항에 있어서,상기 IP-10을 증폭할 수 있는 제 1 프라이머 쌍은 서열번호 1 및 2로 구성되는 프라이머 쌍이고, 상기 대조군 유전자를 증폭할 수 있는 제 2 프라이머 쌍은 서열번호 4 및 5로 구성되는 프라이머 쌍인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  6. 제1항에 있어서,상기 e) 단계 이후, 대조군 유전자의 mRNA 발현수준을 기준으로 IP-10의 mRNA 발현수준을 상대적으로 비교하는 단계를 더 포함하는 결핵의 진단을 위한 정보제공방법.
  7. 제2항에 있어서,상기 제 1 프로브는 서열번호 3으로 표시된 프로브이고, 상기 제2 프로브는 서열번호 6으로 표시된 프로브인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  8. 서열번호 1 및 2로 구성되는 프라이머 쌍을 유효성분으로 포함하는 결핵 진단용 키트.
  9. 제 8항에 있어서,상기 키트는 대조유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머 쌍을 더욱 포함하는 결핵 진단용 키트.
  10. 제8항에 있어서, 상기 프라이머 쌍은 서열번호 4 및 5로 구성되는 프라이머쌍인 것을 특징으로 하는 결핵 진단용 키트.
  11. 제8항에 있어서, 상기 키트는 제 1 프로브 및 제 2 프로브를 더욱 포함하는 결핵 진단용 키트.
  12. 제11항에 있어서,상기 제 1 프로브는 서열번호 3으로 표시된 프로브이고, 상기 제2 프로브는 서열번호 6으로 표시된 프로브인 것을 특징으로 하는 결핵 진단용 키트.
  13. a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계;
    b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계;
    c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    d) 상기 합성된 cDNA를 IP-10(interferon inducible protein-10)을 증폭할 수 있는 제 1 프라이머 쌍 및 IP-10(interferon inducible protein-10)의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제 2 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및
    e) 상기 증폭된 IP-10의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계;를 포함하는 결핵 진단방법.
PCT/KR2013/001386 2012-07-12 2013-02-21 아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 WO2014010806A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2012-0075886 2012-07-12
KR1020120075886A KR20140008788A (ko) 2012-07-12 2012-07-12 ＩＰ-10(ｉｎｔｅｒｆｅｒｏｎ ｉｎｄｕｃｉｂｌｅ ｐｒｏｔｅｉｎ-10) ｍＲＮＡ표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트

Publications (1)

Publication Number Publication Date
WO2014010806A1 true WO2014010806A1 (ko) 2014-01-16

Family

ID=49916223

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/001386 WO2014010806A1 (ko) 2012-07-12 2013-02-21 아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트

Country Status (2)

Country Link
KR (1) KR20140008788A (ko)
WO (1) WO2014010806A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150299794A1 (en) * 2013-09-24 2015-10-22 M&D, Inc. Quantitative Reverse Transcription Polymerase Chain Reaction Kit for Breast Cancer Drug Screening Test and Early Diagnosis Using Tissue and Blood

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101590324B1 (ko) * 2014-04-24 2016-02-01 연세대학교 산학협력단 향상된 결핵 진단 방법
GB2547034A (en) * 2016-02-05 2017-08-09 Imp Innovations Ltd Biological methods and materials for use therein
KR102366607B1 (ko) * 2021-06-30 2022-02-23 대한민국 사료의 생균제 종 판별을 위한 프라이머 및 프로브 세트 조성물 및 이를 포함하는 키트
KR102411940B1 (ko) * 2021-12-17 2022-06-22 대한민국 살모넬라 종 판별용 프로브 조성물 및 이를 포함하는 살모넬라 종 판별용 키트

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110116644A (ko) * 2010-04-20 2011-10-26 연세대학교 산학협력단 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110116644A (ko) * 2010-04-20 2011-10-26 연세대학교 산학협력단 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HELLYER ET AL.: "Quantitative analysis of mRNA as a marker for viability of Mycobacterium tuberculosis", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 37, no. 2, 1999, pages 290 - 295 *
KASPROWICZ ET AL.: "A molecular assay for sensitive detection of pathogen-specific T- cells", PLOS ONE, ARTICLE E20606, vol. 6, no. 8, 2011, pages 1 - 10 *
RUHWALD ET AL.: "CXCL10/IP-10 release is induced by incubation of whole blood from tuberculosis patients with ESAT-6, CFP10 and TB7.7", MICROBES AND INFECTION, vol. 9, no. 7, 2007, pages 806 - 812 *
RUHWALD ET AL.: "IP-10 release assay in the diagnosis of tuberculosis infection: current status and future directions", EXPERT REVIEW OF MOLECULAR DIAGNOSTICS, vol. 12, no. 2, March 2012 (2012-03-01), pages 175 - 187 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150299794A1 (en) * 2013-09-24 2015-10-22 M&D, Inc. Quantitative Reverse Transcription Polymerase Chain Reaction Kit for Breast Cancer Drug Screening Test and Early Diagnosis Using Tissue and Blood

Also Published As

Publication number Publication date
KR20140008788A (ko) 2014-01-22

Similar Documents

Publication Publication Date Title
De Viedma Rapid detection of resistance in Mycobacterium tuberculosis: a review discussing molecular approaches
Massi et al. Rapid diagnosis of typhoid fever by PCR assay using one pair of primers from flagellin gene of Salmonella typhi
KR101458781B1 (ko) 결핵균군 및 마이코박테리아 속 구분 검출용 조성물 및 이를 이용한 실시간 다중 중합효소 연쇄반응에 의한 결핵균 및 마이코박테리아 속의 동시 분석 방법
WO2014010806A1 (ko) 아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
WO2012161385A1 (ko) 실시간 중합반응을 이용한 암의 진단을 위한 정보제공방법 및 이를 위한 암 진단용 키트
WO2010102460A1 (zh) 定性定量检测病原微生物遗传物质的方法及其试剂盒
CN109371148B (zh) 鉴别三种猪呼吸道细菌的荧光pcr试剂盒及定量检测方法
KR20210028968A (ko) 대상포진 예측 또는 진단을 위한 정보를 제공하는 방법
JP2002532103A (ja) マイコバクテリウムツバキュロシスにおける抗生物質耐性変異の特徴付けのための方法及びキット
KR20090111933A (ko) 특정 프라이머 세트를 포함하는 결핵균을 검출하기 위한등온증폭반응용 프라이머 조성물, 키트 및 상기 프라이머세트를 이용하여 결핵균을 검출하는 방법
Brugière et al. Diagnosis of smear-negative pulmonary tuberculosis using sequence capture polymerase chain reaction.
KR101336862B1 (ko) 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
Premanandh et al. Evaluation of a newly developed real-time PCR for the detection of Taylorella equigenitalis and discrimination from T. asinigenitalis
WO2021075912A1 (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
WO2011132872A2 (ko) 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
KR102247643B1 (ko) 결핵균 및 비결핵항산균을 검출하기 위한 2단계 진단방법 및 키트
WO2005030027A2 (en) Salmonella detection identification
KR20110116644A (ko) 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
WO2021141179A1 (ko) 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법
Hoque et al. Detection of Chlamydia trachomatis by immunological and genetic methods in female sex workers and the local female population of reproductive age in Mymensingh, Bangladesh
KR20220040834A (ko) 분자 비콘 프로브를 포함하는 covid-19 진단 멀티플렉스 lamp 조성물
WO2015083852A1 (ko) 개선된 자궁경부암 진단 방법 및 그 진단용 키트
WO2021215556A1 (ko) 코로나 바이러스 진단 키트를 제조하는 방법, 이로부터 제조된 코로나 바이러스 진단 키트 및 이를 사용하여 코로나 바이러스를 진단하는 방법
WO2008140832A2 (en) Method for rapid detection of clostridium botulinum
WO2023128429A1 (ko) 대장암 및 진행 선종의 선별 검사 방법 및 그 응용

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13816958

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13816958

Country of ref document: EP

Kind code of ref document: A1