WO2011149897A1 - Fast results hybrid capture assay and associated strategically-truncated probes - Google Patents
Fast results hybrid capture assay and associated strategically-truncated probes Download PDFInfo
- Publication number
- WO2011149897A1 WO2011149897A1 PCT/US2011/037684 US2011037684W WO2011149897A1 WO 2011149897 A1 WO2011149897 A1 WO 2011149897A1 US 2011037684 W US2011037684 W US 2011037684W WO 2011149897 A1 WO2011149897 A1 WO 2011149897A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- hpv
- sample
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
Definitions
- the present invention relates to methods, reagents, high throughput systems, and kits for determining the presence of a nucleic acid in a sample.
- RNA or DNA for many microorganisms and viruses have been isolated and sequenced.
- Nucleic acid probes have been examined for a large number of infections. Detectable nucleic acid sequences that hybridize to complementary RNA or DNA sequences in a test sample have been previously utilized. Detection of the probe indicates the presence of a particular nucleic acid sequence in the test sample for which the probe is specific.
- DNA or RNA probes can be used to detect the presence of viruses and microorganisms such as bacteria, yeast and protozoa as well as genetic mutations linked to specific disorders in patient samples.
- Nucleic acid hybridization probes have the advantages of high sensitivity and specificity over other detection methods and do not require a viable organism.
- Hybridization probes can be labeled, for example with a radioactive substance that can be easily detected, or with biochemical markers such as, for example, biotin, that allows for their capture and detection.
- Highly sensitive strategically-truncated probes may also be constructed by eliminating sequence regions exhibiting cross-reactive with undesirable or unwanted regions.
- Nucleic acid molecules may also by captured by a first antibody that is specific to DNA hybrids, wherein the hybrids may comprise DNA-RNA hybrids, DNA-DNA hybrids or RNA-RNA hybrids. The hybrids may subsequently be detected by a second, labeled, antibody that may be, for example, labeled with a biochemical marker such as alkaline phosphatase or any other marker capable of detection.
- the present disclosure relates to polynucleotide probes at least 1 kilobase in length wherein the polynucleotide probe is capable of hybridizing to a high risk HPV nucleic acid, but does not cross-react with a low risk HPV nucleic acid.
- the polynucleotide probe comprises at least one sequence having from 70% to 100%
- the polynucleotide probe does not contain any sequences of at least 100 contiguous bases which have about 70% to 100% complementarity to at least 100 contiguous bases of a low risk HPV nucleic acid.
- the polynucleotide probe does not comprise any sequences having about 70% to 100% identity to SEQ ID NO: 44 to SEQ ID NO: 57, SEQ ID NO: 111 to SEQ ID NO: 115, or a complement thereof.
- the polynucleotide probe is specific for a high risk HPV nucleic acid selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 17 and SEQ ID NO: 104 to SEQ ID NO: 110, SEQ ID NO: 116, or a complement thereof.
- the polynucleotide probe comprises a sequence having about 70%> to 100%) identity to a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 103 or a complement thereof.
- the polynucleotide probe consists essentially of or consists of a sequence selected from the group consisting of SEQ ID NO: 97 to SEQ ID NO: 103 or a complement thereof.
- the present disclosure provides for a nucleic acid comprising a sequence at least 1 kilobase in length sharing 70% or more; 75% or more, 80%> or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, S
- the present disclosure also provides for a probe set of one or more probes comprising, consisting essentially of, or consisting of a nucleic acid sharing 70%> or more; 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO:
- the disclosure provides for a method for determining the presence of a target nucleic acid molecule in a sample including:
- the polynucleotide probe is a strategically-truncated probe specific for a high risk HPV nucleic acid, wherein the deleted portion shares high sequence identity or cross reactivity to a HPV low risk type.
- the HPV high risk strategically-truncated probe is specific for or capable of hybridizing to one or more HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 and the deleted portion exhibits cross reactivity or specificity with one or more of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the deleted portion of the probe comprises a sequence sharing 75% or more, 80%> or more, 85% or more, 90%> or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57.
- the polynucleotide probes are nucleic acid sequences sharing 75% or more, 80%> or more, 85% or more, 90%> or more, 95% or more, 98%> or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, OR SEQ ID NO: 1 17, SEQ ID NO: 1 1 1 , SEQ ID NO: 1 12, SEQ ID NO: 113, SEQ ID NO: 1 14, SEQ ID NO: 1 15, or a complement thereof.
- Another aspect relates to the rapid detection of target nucleic acid molecules in a sample using the probes disclosed herein.
- the detection method may be automated, either fully automated, or partially automated - in other words requiring some human input.
- Another aspect relates to the detection of target nucleic acid molecules in multiple samples at the same time or within a very short period of time, for example in a machine or a series of machines, using the probes disclosed herein.
- Another aspect relates to a kit for the detection of a target nucleic acid molecule in a sample comprising the probes disclosed herein.
- Fig. 1 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV33.
- Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation. Template sequences can be found at SEQ ID NO: 5 (including vector sequences) and SEQ ID NO: 104 (HPV sequences only).
- Fig. 4 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV56.
- Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation. Template sequences can be found at SEQ ID NO: 11 (including vector sequences) and SEQ ID NO: 107 (HPV sequences only).
- Fig. 5 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV58.
- Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation. Template sequences can be found at SEQ ID NO: 12 (including vector sequences) and SEQ ID NO: 108 (HPV sequences only).
- Fig. 6 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV66.
- Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation. Template sequences can be found at SEQ ID NO: 14 (including vector sequences) and SEQ ID NO: 109 (HPV sequences only).
- Fig. 7 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV68. Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation. Template sequences can be found at SEQ ID NO: 15 (including vector sequences) and SEQ ID NO: 110 (HPV sequences only). [0022] Fig. 8 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV26 (SEQ ID NO: 116). Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation.
- Fig. 9 exhibits the sequence for an exemplary template which can be used to generate strategically-truncated probes specific for HPV73.
- Underlined text indicates binding sites for the deletion primers. Hatched underlining indicates overlapping sites for the deletion primers. Lower-case text indicates sequences selected for truncation.
- Fig. 10 exhibits a restriction map of the HPV26XX strategically-truncated probe and its sequence (SEQ ID NO: 117). Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 11 exhibits a restriction map of the HPV33X strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 12 exhibits a restriction map of the HPV39XX strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 13 exhibits a restriction map of the HPV52X strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 14 exhibits a restriction map of the HPV56XX strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 15 exhibits a restriction map of the HPV58X strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 16 exhibits a restriction map of the HPV66XX strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. Note that indicates the site at which the primers pHPV66XFl (SEQ ID NO: 76) and pHPV66XRl (SEQ ID NO: 77) would bind in the template. The promoter site is indicated by bolded, italicized, and double underlined text.
- Fig. 17 exhibits a restriction map of the HPV68XX strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 18 exhibits a restriction map of the HPV73XX strategically-truncated probe and its sequence. Deletion primer binding sites are indicated by single underlining, with primer overlap indicated by hatched underlining. The promoter site is indicated by bolded, italicized, and double underlined text. Shaded text indicates probe sequences.
- Fig. 19 exhibits a sample schematic for generating truncated HR-HPV probes.
- a plasmid comprising the deletion probe is generated according to the following steps: 1.
- the target HPV template plasmid is methylated. 2.
- Plasmids are amplified, minus the targeted deletion, using two primers with overlapping tails (deletion primers).
- the resulting PCR products are linear double stranded DNA minus the segment targeted for deletion. 4.
- the PCR plasmid mixture is transformed into wild-type E.coli.
- the host cell circularizes the deleted plasmid and expressed Mcr C nuclease digests the original methylated target plasmid. This leaves only the unmethylated truncated plasmid which is replicated.
- Linear probes may then be generated from the truncated plasmid, such as by the exemplary method at Fig. 31.
- Fig. 20 demonstrates a sample schematic for generating the HPV 26XX strategically-truncated probe.
- a methylated plasmid bearing the HPV26 sequence according to GenBank accession number X74472 was amplified with the primer pair p26F and p26Rl set forth at A to generate single strategically-truncated plasmid HPV26X, which is then cloned. The binding site for each primer is indicated on plasmid HPV 26 v2.
- HPV26X is amplified using the primer pair p26XF3 and p26XR3 to generate HPV26XX. The binding site for each primer is indicated on plasmid HPV 26X.
- Fig. 21 exhibits a restriction map and a sample digestion of HPV26XX
- Fig. 22 demonstrates a sample schematic for generating the HPV 33X
- Fig. 23 demonstrates a sample schematic for generating the HPV 52X
- Fig. 24 demonstrates a sample schematic for generating the HPV 58X
- Fig. 25 demonstrates a sample schematic for generating the HPV 39XX strategically-truncated plasmid.
- Fig. 26 demonstrates a sample schematic for generating the HPV 56XX strategically-truncated plasmid.
- Fig. 27 demonstrates a sample schematic for generating the HPV 66XX strategically-truncated plasmid.
- Fig. 28 demonstrates a sample schematic for generating the HPV 68XX strategically-truncated plasmid.
- Fig. 29 demonstrates a sample schematic for generating the HPV 73XX strategically-truncated plasmid.
- Fig. 30 demonstrates the results of a sequence alignment between high risk and low risk HPV-types using Vector NTI 10.3.0 software (Invitrogen Corp., Carlsbad, CA). Shaded cells indicate sequences having a high risk of cross-reactivity. Sequences having from about 70% to 100%) sequence identity are deemed to have a high risk of cross-reactivity. Sequences having from about 75% to 100% sequence identity are deemed to have a moderately high risk of cross-reactivity. Sequences having from about 80%> to 100% sequence identity are deemed to have very high risk of cross-reactivity.
- Fig. 31 demonstrates an exemplary scheme for generating linearized probes from truncated plasmids.
- each template is cloned from L2 to LI as Xhol/Not I fragments with a promoter sequence (ctcactatagggcgaattgg) (SEQ ID NO: 96).
- ctcactatagggcgaattgg a promoter sequence
- all of the HPV nucleic acids are in the same orientation and can be linearized with one enzyme, Xhol, prior to RNA transcription.
- the T7 polymerase initiates RNA transcription at the promoter sequence, which terminates at the end of LI to produce the full length probe without including any of the vector sequence.
- the sequence of each linearized RNA probe generated in this manner is set forth at SEQ ID NO: 97-105.
- the present disclosure includes methods, compositions, reagents, systems, and kits for rapidly determining the presence of a nucleic acid molecule in a sample.
- the methods, compositions, reagents, systems, and kits may be used for clinical diagnostic purposes, including but not limited to the detection and identification of pathogenic organisms and the detection of a genetic predisposition to a particular disease.
- nucleic acid probes are disclosed, said probes having the ability to detect a first HPV nucleic acid without substantially cross-reacting with a second HPV nucleic acid.
- said nucleic acid probes are generated by a method comprising: a) providing a template nucleic acid comprising a sequence at least 1 kilobase in length sharing from about 70% to 100% identity with the first nucleic acid; b) comparing the sequence of the template nucleic acid with the sequence of the second nucleic acid; and c) truncating any regions of the template nucleic acid that share from about 70% to 100% identity with a region of the second nucleic acid.
- the present disclosure provides for a nucleic acid comprising a sequence at least 1 kilobase in length sharing 70%> or more; 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO:
- the present disclosure also provides for a probe set of one or more probes comprising, consisting essentially of, or consisting of a nucleic acid sharing 70%> or more; 75% or more, 80%> or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:
- the probe set comprises at least one nucleic acid probe comprising, consisting essentially of, or consisting of a sequence sharing 70% or more; 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity with a sequence selected from the group consisting of SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103, OR SEQ ID NO: 117, SEQ ID NO: 117, or a complement thereof.
- the present disclosure provides for a nucleic acid comprising, consisting essentially of, or consisting of a sequence sharing 75% or more, 80%> or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, OR SEQ ID NO: 117, SEQ ID NO: 117, or fragments or complements thereof.
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample.
- the method includes:
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample including suspending a sample in a collection medium including a detergent; denaturing a target nucleic acid molecule; contacting one or more polynucleotide probes with the target nucleic acid molecule under conditions that allow the probes and the target nucleic acid molecule to hybridize or bind, and capturing the double-stranded nucleic acid hybrid on a solid support coated with a first antibody specific for the double-stranded hybrid nucleic acid hybrid.
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample including suspending a sample in a collection medium including a detergent; denaturing a target nucleic acid molecule; contacting one or more polynucleotide probes with the target nucleic acid molecule under conditions that allow the probes and the target nucleic acid molecule to hybridize or bind, capturing the double- stranded nucleic acid hybrid on a solid support coated with a first antibody specific for the double-stranded hybrid nucleic acid hybrid and separating the double-stranded nucleic acid hybrid/solid support complex from unbound nucleic acid.
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample including suspending a sample in a collection medium including a detergent; denaturing a target nucleic acid molecule; contacting one or more polynucleotide probes with the target nucleic acid molecule under conditions that allow the probes and the target nucleic acid molecule to hybridize or bind, capturing the double- stranded nucleic acid hybrid on a solid support coated with a first antibody specific for the double-stranded hybrid nucleic acid hybrid, thereby forming a double-stranded nucleic acid hybrid/solid support complex; and separating the double-stranded nucleic acid hybrid/solid support complex from unbound nucleic acid; conjugating the complex with a second antibody that is specific for either the double-stranded nucleic acid hybrid or specific for the first antibody to form a double-stranded nucleic acid hybrid/solid support antibody complex.
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample including suspending a sample in a collection medium including a detergent; denaturing a target nucleic acid molecule; contacting one or more polynucleotide probes with the target nucleic acid molecule under conditions that allow the probes and the target nucleic acid molecule to hybridize or bind, capturing the double- stranded nucleic acid hybrid on a solid support coated with a first antibody specific for the double-stranded hybrid nucleic acid hybrid, thereby forming a double-stranded nucleic acid hybrid/solid support complex; and separating the double-stranded nucleic acid hybrid/solid support complex from unbound nucleic acid; conjugating the complex with a second antibody that is specific for either the double-stranded nucleic acid hybrid or specific for the first antibody to form a double-stranded nucleic acid hybrid/solid support antibody complex; wherein the second antibody is labele
- the present disclosure provides a method for determining the presence of a target nucleic acid molecule in a sample, the method comprising:
- polynucleotide probes used in the methods described herein are N-(2-nucleotide probes
- the polynucleotide probes are HPV high risk probes and the deleted portion exhibits high sequence identity or cross reactivity to a HPV low risk type.
- the HPV high risk probe is specific for or capable of hybridizing to one or more of HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 and the deleted portion shares cross reactivity or specificity with one or more of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the polynucleotide probes comprise, consist, or consist essentially of a sequence sharing 75% or more, 80% or more, 85%> or more, 90%> or more, 95%> or more, 98% or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103, OR SEQ ID NO: 117, SEQ ID NO: 117, or fragments or complements thereof.
- the solid support includes a modified paramagnetic bead that is coated or has attached thereto a first antibody immunospecific for double-stranded hybrid nucleic acids.
- a magnetic field can be used to separate the double-stranded nucleic acid-magnetic bead- antibody complex from non-bound nucleic acid.
- the method does not include a sample pre-treatment step.
- the detergent-based collection medium allows for reduced sample preparation time which, in turn, can lead to accelerated detection of target nucleic acid molecules.
- the sample can be analyzed by methods, assays, or the apparatus of the disclosure in a direct-to-assay manner.
- purification steps are not performed on the sample prior to evaluation using assays of the disclosure.
- crude lysate is directly analyzed by the methods, assays, or the apparatus of the disclosure.
- the sample does not undergo a target amplification step.
- One aspect relates to a method of diagnosing cancer by utilizing methods, kits, assays, and the apparatus provided herein.
- cervical cancer is detected by identifying nucleic acid molecules associated with HPV and HPV variants.
- cervical intraepithelial neoplasia CIN
- the detected cancer can be subsequently treated after being diagnosis by the methods, kits, assays, and the apparatus provided herein.
- the diagnosed cancer is cervical cancer and variants thereof.
- the disclosure provides for a composition comprising
- the disclosure provides for a composition
- a composition comprising (a) a biological sample suspended in a collection medium comprising about 0.5% to about 2.0% NP-40, about 0.10% to about 0.40% sodium deoxycholate, about 25 mM to about 75 mM Tris-HCl, about 10 mM to about 50 mM EDTA, about 50 mM to about 200 mM NaCl, and about 0.01%) to about 0.10% sodium azide;
- the disclosure provides for a composition comprising
- a biological sample suspended in a collection medium comprising about 0.5%> to about 2.0% NP-40, about 0.10% to about 0.40% sodium deoxycholate, about 25 mM to about 75 mM Tris-HCl, about 10 mM to about 50 mM EDTA, about 50 mM to about 200 mM NaCl, and about 0.01%) to about 0.10% sodium azide;
- the disclosure provides for a composition comprising
- a biological sample suspended in a collection medium comprising about 0.5%> to about 2.0% NP-40, about 0.10% to about 0.40% sodium deoxycholate, about 25 mM to about 75 mM Tris-HCl, about 10 mM to about 50 mM EDTA, about 50 mM to about 200 mM NaCl, and about 0.01%) to about 0.10% sodium azide;
- the disclosure provides for a composition comprising
- the polynucleotide probes used in the compositions described herein are HPV high-risk strategically-truncated probes.
- the polynucleotide probes are HPV high risk probes and the deleted portion exhibits high sequence identity or cross reactivity to a HPV low risk type.
- the HPV high risk probe is specific for or capable of hybridizing to one or more of HPV types 16, 18, 26, 31 , 33, 35, 39, 45, 51 , 52, 56, 58, 59, 66, 68, 73, and 82 and the deleted portion shares cross reactivity or specificity with one or more of low risk HPV types 1 , 2, 3, 4, 5, 6, 8, 1 1 , 13, 30, 34, 40, 42, 43, 44, 53, 61 , 67, 69, 70, 71 , 72, 74, 81 , 83, 84, and 89.
- the polynucleotide probes are nucleic acid sequences sharing 75% or more, 80%> or more, 85%> or more, 90%> or more, 95%> or more, 98%> or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, or SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, or SEQ ID NO: 103, OR SEQ ID NO: 1 17, SEQ ID NO: 1 17, or fragments or complements thereof.
- high risk HPV refers to HPV types associated with an elevated risk of developing cancer, which are well known to a person having ordinary skill in the art.
- low risk HPV refers to HPV types that are not associated with an elevated risk of developing cancer, which are well known to a person having ordinary skill in the art.
- any of the above compositions may be used may be used with any of the collection mediums described herein.
- the biological sample in the above compositions is a cervical cell sample or a human cervical cell sample.
- the nucleic acid molecules in the biological sample are denatured.
- the biological sample in the above compositions can exhibit stability when stored in the collection medium for at least 21 days at 33°C.
- the second antibody is labeled with a detectable marker.
- Methods of the present disclosure may be used to detect the presence of a target nucleic acid molecule from samples, including, without limitation, a specimen or culture (e.g., cellular, microbiological and viral cultures) including biological and environmental samples.
- Biological samples may be from an animal, including a human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
- Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items.
- the biological samples may include, but are not limited to, cervical epithelial cells (e.g., a sample obtained from a cervical swab), adenoid cells, anal epithelial cells, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
- the sample may comprise a double-stranded nucleic acid molecule or may comprise a single-stranded nucleic acid molecule. If a double-stranded nucleic acid molecule is present, it may be prepared for hybridization analysis by a variety of methods known in the art, e.g. , using alkali, using proteinase K/SDS, chaotropic salts.
- the process of preparing a double-stranded nucleic acid molecule for hybridization analysis generally involves converting it into a single-stranded nucleic acid molecule. This process is generally known as denaturation. However, it is also contemplated that a double-stranded nucleic acid molecule may be detected without
- denaturation e.g., through a triple-stranded construct.
- the target nucleic acid molecule in a sample can be DNA or R A or both DNA and RNA.
- the target nucleic acid molecule can be contained within a larger nucleic acid molecule. Detection of either the target nucleic acid molecule or the larger nucleic acid molecule containing the target nucleic acid molecule is contemplated by this disclosure.
- the biological sample may comprise cervical cells, especially human cervical cells.
- the sample can be collected with any method or device known in the art, including a chemically inert collection device such as a DACRON tipped swab.
- a chemically inert collection device such as a DACRON tipped swab.
- Other acceptable collection devices may be used including, but not limited to, cotton swab, cervical brush, flocked swab (a swab shaped like a DACRON swab but made with nylon fibers enabling collection of more cells and easier release of cells), cervical broom, mini broom, lavage, or any collection device often used in Pap smear testing.
- the methods include collecting a sample from a woman at least 30 years of age.
- the method can also include collecting a sample from a woman at least 30 years via a Pap smear or comparable test.
- the sample collected by the Pap smear or comparable test can be a cervical cell sample.
- the sample may be placed in a sample tube.
- the tube can be sealed to prevent contamination.
- the collection device (swab, brush, etc.) may further contain a mechanism by which it can be moved once it is inside the sample tube.
- the collection device contains an insert that can be moved using a magnet.
- this insert comprises a metal.
- this insert comprises a magnetic material. Magnetic material includes paramagnetic, ferromagnetic, and diamagnetic materials.
- One advantage of moving the collection device once it is inside the sample tube is to avoid the collection device from making contact with any sample extraction or sample detection devices. Examples of a sample extraction device include pipettes, automated pipettor, and pipette tips. Examples of sample detection devices include probes and probe tips.
- sample tube may be closed or sealed to minimize contamination.
- the closure may be permanent or removable. Examples of removable closures include snap caps, screw caps, rubber septa, foil, and film.
- the closure may contain one or more openings or perforations, which when pierced may be re-sealable.
- One advantage of a closure that contains such openings or perforations is that the closure is not rendered ineffective when pierced by, for example, a sample extraction device or sample detection device. Once the sample extraction device or sample detection device is removed, the closure re-seals, thereby minimizing contamination.
- the sample may be stored by drying it with a substrate, or in a preservative medium, or both. Desiccation is accomplished by pressure drying or drying with chemicals. This removes most of the water and is suitable for long-term stability.
- the sample may be lyophilized (freeze-dried) with a substrate like trehalose to ensure stability of the sample.
- the sample may be stored by suspending in a preservative medium, known and apparent to one of skill in the art.
- the purpose of the preservative medium is to protect biological components that can degrade.
- the sample cells, the probe mixture, the antibody: bead complex used in the capture step, and the secondary antibody used in the detection step are all susceptible to degradation.
- a preservative medium at the initial step of collection ideally provides sample stability and integrity and can affect downstream steps in the process of nucleic acid capture and detection.
- the sample may be collected and stored in a collection medium.
- the collection medium has several functions including as a preservative medium to preserve nucleic acids and inhibit nucleases to prevent degradation of nucleic acids prior to analysis.
- the collection medium contains at least one detergent.
- the collection medium contains at least two detergents, at least three detergents, or at least four detergents. In an aspect, each of the detergents is different.
- the detergent-based collection medium comprises two different detergents, one which is able to control background signal and another detergent that improves magnetic bead behavior, for example, migration through a viscous sample, collection, i.e., how well the magnetic beads gather together at the bottom of the sample well, and retention, i.e., how well the magnetic beads stay in place when a supernatant is either removed from a container containing the sample.
- heat is employed during the hybridization, capture, and detection steps of the assay. Even with detergent and the application of heat, antibodies used in the assay remain functional.
- the detergent-based collection medium may comprise, consist essentially of, or consist of one, two, three, or four or more detergents.
- Detergents are known in the art and may include, but are not limited to, cationic detergents such as but not limited to cetyl pyridinium bromide, cetyltrimethylammonium bromide (collectively known as cetrimonium compounds) and alkylbenzyldimethylammonium chlorides (collectively known as benzalkonium
- NP-40 is also known as Tergitol-type NP-40, which is nonyl
- NP-40 is not powerful enough to break the nuclear membrane, but can break the plasma membrane. As such, it can be used to obtain the cytoplasmic contents of a cellular culture.
- a detergent-based collection medium comprises an anionic detergent such as sodium deoxycholate, which controls background noise and NP-40, which may improve magnetic bead behavior.
- the detergent-based collection medium improves removal of the specimen from the collection device as the sample is dissolved more easily.
- the detergent-based collection medium improves the homogeneity of the sample compared with other collection media such as but not limited to PRESERVCYT (uses a 40% methanol solution), STM (uses a chaotropic agent), and alcohol.
- the detergent-based collection medium also reduced sample viscosity after mixing (either manual or automated).
- the concentration of NP-40 in the collection medium can range from about 0.5% to about 2.0%, from about 0.1% to about 1.0%, as well as any number within the recited ranges.
- the NP-40 is present at a concentration from about 0.8% to about 1.5 %; from about 0.9% to about 1.2% and in certain aspects is about 1.0%.
- the NP-40 is present at a concentration from about 0.1%>, about 0.2%>, about 0.3%>, about 0.4%>, about 0.5%>, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.1%, about 1.2%, about
- the concentration of sodium deoxycholate in the collection medium can range from about 0.10% to about 0.40%, from about 0.20% to about 0.30%, as well as any number within the recited ranges. In one aspect, the concentration of sodium deoxycholate is about 0.10%, about 0.15%, about 0.20%, about 0.25%, about 0.30%, about 0.35%, or about 0.40%.
- the detergent-based collection medium may comprise, consist essentially of, or consist of a buffer, two detergents, a chelator and a preservative.
- the buffer may be Tris-HCl in a concentration of from about 25 mM to about 75mM; from about 30 mM to about 60 mM; from about 40 mM to about 50 mM, and from about 45 mM to about 55 mM as well as any number within the recited ranges.
- the buffer may also be Tris-HCl in a concentration of about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, or about 75 mM.
- any preservative can be used and the choice can depend on factors such as desired functionality, minimization side-effects, cost, etc. Suitable preservatives include gentomycin, ProClin, dimersol, and sodium azide.
- concentration of the preservative in the collection medium depends on factors such as the type of preservative, its efficacy, its side- effects, etc.
- concentration of sodium azide can range from about 0.01% to about 0.1%, from about 0.025% to about 0.075%, and from about 0.04% to about 0.06%), as well as any number within the recited ranges.
- the preservative for example, sodium azide
- the detergent-based collection medium comprises, consists essentially of, or consists of 1.0% NP-40, 0.25%> sodium deoxycholate, 50 mM Tris-HCl, 25 mM EDTA, 150 mM NaCl and 0.09% sodium azide.
- the detergent-based collection medium comprises, consists essentially of, or consists of about 0.5%> to about 2.0% NP-40, about 0.10% to about 0.40% sodium deoxycholate, about 25 mM to about 75 mM Tris-HCl, about 10 mM to about 50 mM EDTA, about 50 mM to about 200 mM NaCl, and about 0.01% to about 0.10%) sodium azide.
- the detergent-based collection medium comprises, consists essentially of, or consists of about 0.8% to about 1.5% NP-40, about 0.20% to about 0.40% sodium deoxycholate, about 30 mM to about 60 mM Tris-HCl, about 20 mM to about 40 mM
- the detergent-based collection medium comprises, consists essentially of, or consists of about 0.9%> to about 1.2% NP-40, about 0.20%> to about 0.30%> sodium deoxycholate, about 30 mM to about 60 mM Tris-HCl, about 20 mM to about 30 mM EDTA, about 100 mM to about 150 mM NaCl, and about 0.04% to about 0.06% sodium azide.
- the collection medium comprises, consists essentially of, or consists of NP-40 and EDTA. In another aspect, the collection medium comprises, consists essentially of, or consists of NP-40, EDTA, and sodium azide. In one aspect, the collection medium comprises, consists essentially of, or consists of sodium deoxycholate, EDTA, and sodium azide. In an aspect, the collection medium comprises, consists essentially of, or consists of about NP- 40, sodium deoxycholate, EDTA, and sodium azide. In an aspect, the collection medium comprises, consists essentially of, or consists of NP-40, sodium deoxycholate, Tris-HCl, EDTA, and sodium azide.
- the collection medium comprises, consists essentially of, or consists of 0.5% to about 2.0% NP-40 and 10 mM to about 50 mM EDTA. In another aspect, the collection medium comprises, consists essentially of, or consists of 0.5%> to about 2.0% NP- 40, 10 mM to about 50 mM EDTA, and about 0.01 % to about 0.10 % sodium azide. In one aspect, the collection medium comprises, consists essentially of, or consists of about 0.10% to about 0.40% sodium deoxycholate, 10 mM to about 50 mM EDTA, and about 0.01% to about 0.10%) sodium azide.
- the collection medium comprises, consists essentially of, or consists of about 0.5% to about 2.0% NP-40, about 0.10% to about 0.40% sodium deoxycholate, 10 mM to about 50 mM EDTA, and about 0.01% to about 0.10% sodium azide.
- the collection medium comprises, consists essentially of, or consists of about 0.5% to about 2.0%> NP-40, about 0.10% to about 0.40% sodium deoxycholate, about 25 mM to about 75 mM Tris- HCl, about 10 mM to about 50 mM EDTA, and about 0.01% to about 0.10% sodium azide.
- the collection medium is a non-chaotropic medium. That is, for example, the collection medium does not include a chaotropic medium or chaotropic salts.
- the collection medium does not include guanidine hydrochloride or urea.
- a potential advantage of using a non-chaoptropic collection medium is better resuspension of a sample, more reproducible testing, and more uniform testing aliquots relative to a medium which includes a chaotropic medium or chaotropic salts.
- An advantage of using a detergent-based collection medium is that it preserves the stability of the sample.
- a sample stored in a detergent-based collection medium as disclosed is stable for at least 31 days, and, when held at temperatures from 15°C to 33°C is stable for at least 21 days.
- a sample is stable when frozen in a detergent-based collection medium at - 20°C for at least six months.
- a cervical cell sample is stable for at least 31 days, for at least 21 days when held at temperatures from 15°C to 33°C, and for at least 6 months in a detergent-based collection medium at -20°C.
- a detergent-based collection medium also leads to improved assay performance under rigorous hybridization and capture conditions (for example, at temperatures between 65° - 75°) relative to collection medium containing a denaturant.
- the presence of one, two, three, four or more detergents can reduce sample viscosity, which aids in the removal of the liquid phase from the magnetic beads, as well as aids in the mixing of samples.
- a sample such as blood or an exfoliated cervical cell specimen can be collected and suspended in a detergent-based collection medium.
- the sample can be is collected with a chemically inert collection device such as a DACRON tipped swab. Any other suitable swab may be used such as nylon fiber swabs.
- the sample may be stored in a detergent- based collection medium, to prevent degradation of nucleic acids prior to analysis and to maintain stability of the sample.
- Samples may be collected in other known collection mediums and then can be used in the methods described herein.
- Examples of other collection media include
- sample/Specimen Transport Medium Certain collection media are nucleic acid specific. For example DCM is not used when the target nucleic acid is RNA. Samples collected in some of these media may require processing before the nucleic acids in the samples can be detected and analyzed.
- Various methods of processing samples are known in the art. For example, cervical cell samples collected for cytological analysis in medium such as PRESERVCYT may be combined with a detergent-based lysis buffer followed by the addition of magnetic beads comprising nucleic acid binding surfaces.
- other cell samples collected in other known commonly available collection mediums may be combined with a detergent-based lysis buffer followed by the addition of magnetic beads comprising nucleic acid binding surfaces.
- the lysis buffer includes 150mM Tris-HCI (pH 8.0), 0.09%
- the lysis buffer includes between about 100 mM to about 200 mM Tris-HCI at between about pH 7.5 and about 8.5, between about 0.05% and about 0.10% (w/v) sodium azide, between about 2.5% to about 7.5% (v/v) Triton x- 100, and between about 200mM to about 400mM Diethanolamine (w/v), with a final pH of between 9.0 and about 10.0.
- Pre- treatment includes between about 100 mM to about 200 mM Tris-HCI at between about pH 7.5 and about 8.5, between about 0.05% and about 0.10% (w/v) sodium azide, between about 2.5% to about 7.5% (v/v) Triton x- 100, and between about 200mM to about 400mM Diethanolamine (w/v), with a final pH of between 9.0 and about 10.0.
- the assay does not include a sample pre-treatment preparation step.
- the assay does not include sample pre-treatment preparation when a detergent- based collection medium is used.
- a sample pre-treatment preparation is not required when the detergent-based collection medium comprises, consists essentially of, or consists of about 0.5% to about 2.0% NP-40, about 0.10% to about 0.40%> sodium deoxycholate, about 25 mM to about 75 mM Tris-HCl, about 10 mM to about 50 mM EDTA, about 50 mM to about 200 mM NaCl, and about 0.01% to about 0.10% sodium azide. Any combination of the components is also contemplated.
- the assay can include a pre-sample treatment preparation step when either PRESERVCYT or SUREPATH are used as the collection medium.
- the pre-treating may be done manually or may be automated.
- One example of an automated pre-treatment machine is a Pre- Analytic System
- PAS liquid based cytology
- LBC liquid based cytology
- ETU extraction tube unit
- the throughput of the system is about 35 minutes to the completion of the first ETU with subsequent ETUs completed at about 2 minute intervals.
- the instrument can process ETUs in a parallel manner. Each ETU passes through 10 steps before the processing is complete. These steps are grouped with similar steps to create six processing modules, identified by the station letters. The ETUs are moved between the six stations by a six-axis robot at about two minute intervals. Because of incubation times, some steps require the ETU to remain at the station for more than about two minutes. In this case, additional locations are supplied in the station to accommodate a first-in-first-out process.
- the PAS can include several components, such as: 1) an ETU transport mechanism; 2) an ETU and ETU gripper; 3) a magnet station for attracting paramagnetic beads; and 4) a pipettor station that transfers concentrated nucleic acid from ETU to plate.
- the PAS can produce up to ten 96-well plates of extracted DNA from liquid based cytology samples in less than 5 hours for subsequent analysis in an instrument designed to run the method for determining of the presence of the target nucleic acid molecules.
- the PAS is designed to address some of the current challenges of extracting DNA from liquid based cytology testing including volume of sample required (4 mL), limited automation and the low throughput of manual sample conversion protocol.
- the target nucleic acid molecules include, without limitation, nucleic acid molecules found in specimens or cultures (e.g., cellular, microbiological and viral cultures) including biological and environmental samples.
- the target nucleic acid molecules may be found in biological samples from an animal, including a human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
- Target nucleic acid molecules may be found in environmental samples and include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items.
- the target nucleic acid molecules found in biological samples include, but not limited to cervical samples (e.g. , a sample obtained from a cervical swab) or cervical cell samples, adenoid cells, anal epithelial cells, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, urine and semen.
- the target nucleic acid molecules may be from other viral, bacteria, mycobacteria or plasmodia, for example cytomegalovirus (CMV), herpes, HIV, H1N1, chlamydia, gonorrhea, Trichomonas vaginalis, Staphylococcus aureus, tuberculosis, SARS-associated coronavirus or influenza.
- CMV cytomegalovirus
- herpes HIV, H1N1, chlamydia, gonorrhea
- Trichomonas vaginalis Staphylococcus aureus
- tuberculosis SARS
- the target nucleic acid molecules are 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to nucleic acid molecules associated with any one of cervical samples (e.g., a sample obtained from a cervical swab) or cervical cell samples, adenoid cells, anal epithelial cells, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, urine and semen, other viral, bacteria, mycobacteria or plasmodia, for example cytomegalovirus (CMV), herpes, HIV, H1N1, chlamydia, gonorrhea, Neisseria gonorrhoeae (GC), Chlamydia trachomatis (CT), Trichomonas vaginalis, Staphylococcus aureus, tuberculosis, SARS-associated coronavirus or influenza.
- CMV cytomegalovirus
- the target nucleic acid molecules are human papillomavirus (HPV) and include genetic variants of HPV.
- HPV human papillomavirus
- a variant includes polymorphisms, mutants, derivatives, modified, altered, or the like forms of the target nucleic acid.
- the target nucleic acid is an HPV nucleic acid.
- the HPV nucleic acid is HPV DNA of a high risk HPV type.
- the HPV nucleic acid is HPV RNA of a high risk HPV type.
- target nucleic acids are any one of high risk HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82or any one of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the target nucleic acid molecule is 75% or more, 80% or more,
- the target nucleic acids are 75%o or more, 80%> or more, 85%> or more, 90%> or more, 95%> or more, 98%> or more, or 100% identical to nucleic acid molecules associated with any one of high risk HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 or any one of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the target nucleic acid molecule may be DNA or RNA.
- the probe is preferably RNA and when the target nucleic acid is RNA, the probe is preferably DNA.
- a DNA probe can be used with DNA target nucleic acid molecule and an RNA probe can be used with RNA target nucleic acid molecule.
- the target nucleic acid molecule may determine the collection medium used.
- the sample may be treated with a denaturation reagent to render the target nucleic acid molecule accessible to hybridization.
- the sample is denatured with an alkaline solution. Any alkali that can bring a solution pH to about pH 12, about pH 13, or about pH 14 may be used. Additionally, any alkali that can bring a solution pH to a range of about pH 12 to about pH 13, from about pH 12 to about pH 14, and from about pH 13 to about pH 14 can be used.
- Suitable concentrations of alkali include from about 1.0 N to about 2.0 N, from about 1.25 N to about 1.75 N, and from about 1.25 N to about 1.5 N, and about 1.5 N as well as any number within the recited ranges.
- suitable alkali include NaOH and KOH.
- the sample suspended in a detergent-based collection medium can be treated with about one-half volume of 1.75 N NaOH solution. For example, in certain aspects approximately a 50 ⁇ aliquot is removed from a sample suspended in a detergent-based collection medium and approximately 25 ⁇ of 1.75 N NaOH solution is added to the 50 ⁇ aliquot sample.
- the sample treated with the denaturation reagent can be mixed by hand mixing or mechanical shaking at about 800 rpm, about 900 rpm, about 1000 rpm, between about 600 and about 1000 rpm, or between about 600 and 1200 rpm.
- the pH of the sample after addition of denaturation reagent can be about 14.
- the pH can be about pH 12 or pH 13.
- Such basic pH will both nick and denature a majority of the nucleic acid in the specimen.
- alkaline treatment can disrupt interactions between peptides and nucleic acids to improve accessibility of the target nucleic acid and degrade protein.
- the oil may be silicone oil.
- an oil or oil-type substance is added to the sample prior to heating.
- the oil may have a viscosity of about 0.5 Cst to about 20 Cst, about 1.0 Cst to about 10 Cst, or about 2.0 Cst to about 5 Cst.
- the volume is about 5 Cst.
- about 10 ⁇ to about 45 ⁇ of the above silicone oil is added to 1 mL or more of collection media and evaluated on an automated platform.
- 1.5 N to 2.0 N NaOH is added to the sample and heated.
- 1.75 N NaOH is added to the sample and heated.
- the sample with denaturation reagent may be heated to about 60°C to about 80°C for about 30 minutes, to about 65°C to about 75°C for about 30 minutes, to about 67°C to about 70°C for about 30 minutes, or to about 70°C for about 30 minutes, or any number within the recited ranges.
- the sample with denaturation reagent is heated to about 60°C to about 80°C for about 20 to about 40 minutes, or to about 65°C to about 75°C for about 20 to about 40 minutes, to about 67°C to about 70°C for about 20 to about 40 minutes, or to about 70°C for about 30 minutes, or any number within the recited ranges.
- a goal of the described time and temperature conditions is to provide for maximal denaturation of the sample in a minimum amount of time, while leaving the target nucleic acid in a suitable condition for carrying out the remaining steps of hybridization, capture, washing, and detection.
- the sample may be heated in denaturation reagent for about 5 to about 120 minutes, about 10 to about 60 minutes, about 20 minutes to about 40 minutes, about 30 minutes, or any number within the recited ranges. It will be readily understood by one of ordinary skill in the art that longer periods of incubation at lower temperatures, or shorter periods of incubation at higher temperatures, may be balanced to provide a similar effect to the conditions described herein.
- the sample containing the nucleic acid is denatured, it is contacted with one or more polynucleotide probes under a condition sufficient for the one or more polynucleotide probes to hybridize to the target nucleic acid in the sample to form a double-stranded nucleic acid hybrid.
- the probe can be full length, truncated, or synthetic DNA or full length, truncated, or synthetic RNA. If the target nucleic acid is DNA, then the probe may be RNA and if the target nucleic acid is RNA, then the probe may be DNA.
- the one or more polynucleotide probes may be DNA.
- polynucleotide probes are diluted in a probe diluent that also can act as a neutralizing
- hybridization buffer (to neutralize the basic denaturation reagent).
- the probe diluent used for DNA or RNA probes will differ due to the different requirements necessary for DNA versus RNA stability.
- the probes are RNA
- the probe diluent can be used to dissolve and dilute the probe and also help restore the sample to about a neutral pH, e.g., about pH 6 to about pH 9, to provide a more favorable environment for hybridization.
- Sufficient volume of probe diluent preferably one-half volume of the sample, may be used to neutralize the base-treated sample.
- the probe diluent comprises a buffer, polyacrylic acid, NaOH and sodium azide.
- the probe diluent may comprise acetic acid.
- the probe diluent comprises 2.2 M BES (N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic acid), 2.6% polyacrylic acid (PAA), 0.7 N NaOH and 0.09% sodium azide.
- the probe diluent may contain from about 1.2 M to about 2.6 M BES, from about 1.5 M to about 2.5 M BES; from about 1.75 M to about 2.25 M BES; from about 2 M to 2.4 M BES, or about 2.2 M BES, as well as any number within the recited ranges. In one aspect the probe diluent may contain from about 2% to about 3.0% PAA or, as well as any number within the recited ranges. In another aspect, the PAA
- the probe diluent may contain from about 0.6 N to about 0.8 N NaOH, for example, about 0.7 N NaOH.
- the concentration of NaOH generally increases as the amount of BES increases.
- the probe diluent has a viscosity that permits accurate dispensing by automatic pipetting techniques.
- the viscosity of the probe diluent is adjusted so that the desired volume can be accurately and automatically pipetted. If the viscosity is too low, the probe diluent cannot form a stable drop. On the other hand, if the viscosity is too high, the probe diluent drop will be too large. When such a drop enters the sample tube, it may cause significant disturbance of the contents already in the sample tube (e.g., by splashing against the walls of the sample tube).
- a heated alkaline solution may be added to the sample, then probe diluent may be added to the sample at room temperature, and then the sample may be reheated.
- probe diluent may be added to the sample at room temperature, and then the sample may be reheated.
- Such a process can inhibit secondary structure from forming.
- Antibodies tend to irreversibly bind to structures with secondary structure.
- heating the solutions or sample may not be necessary because secondary structures issues are not present.
- the sample is not heated when used with truncated or synthetic probes.
- an aliquot of neutralization buffer in an aspect the probe diluent described, in which the one or more probes are dissolved, can be added to the sample under appropriate conditions to allow hybridization or binding of the probe and the target nucleic acid to occur.
- the neutralization buffer may contain a single buffering salt. In an aspect, the neutralization buffer does not contain more than a single buffering salt.
- the hybridization condition is sufficient to allow the one or more polynucleotide probes to anneal to a corresponding complementary nucleic acid sequence, if present, in the sample to form a double-stranded nucleic acid hybrid.
- Hybridization conditions suitable for the particular probes and diluents described herein are employed.
- the probes and sample nucleic acids can be incubated for a hybridization time, preferably at least about 5 to about 30 minutes, about 5 to about 20 minutes, or from about 7 to about 15 minutes, or about 10 minutes, as well as any number within the recited ranges sufficient to allow the one or more polynucleotide probes to anneal to a corresponding complementary nucleic acid sequence.
- the hybridization condition can include a hybridization temperature of at least about 65°C, about 68.5°C, and about 67°C to about 70°C, as well as any number within the recited ranges.
- stringent hybridization conditions may be controlled by increasing the temperature, increasing the ionic conditions to above 0.5M (for example, NaCl), or reducing the concentration of PAA.
- stringent hybridization conditions may include performing a hybridization reaction at elevated temperatures, such as of at least about 65°C, at least about 68.5°C, between about 67°C to about 70°C , and between about 69°C to about 70°C.
- Stringent hybridization conditions may also include elevated temperatures, such as of at least about 65°C, at least about 68.5°C, and between about 67°C to about 70°C.
- the probe is capable of hybridizing or binding to nucleic acid molecules 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to nucleic acid molecules associated with HPV, genetic variants of
- HPV HPV, HPV DNA of a high risk HPV type, or HPV RNA of a high risk HPV type, or any one of high risk HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 or any one of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the probe is complementary to HPV, genetic variants of HPV, HPV DNA of a high risk HPV type, HPV RNA of a high risk HPV type, or any one of high risk HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 or any one of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the sample is suspended in detergent-based collection medium
- the target nucleic acid is denatured with a denaturation reagent
- hybridized to nucleic acid probes suspended in a neutralizing buffer is the neutralizing buffer.
- the neutralizing buffer is the probe diluent of the present invention.
- the probe diluent can comprises 2.2 M BES (N,N-bis(2- hydroxyethyl)-2-aminoethanesulfonic acid), 2.6% polyacrylic acid, 0.7 N NaOH and 0.09% sodium azide.
- the hybrid is captured by a molecule that is specific for the double-stranded nucleic acid hybrid.
- Molecules specific for the double stranded nucleic acid hybrids include, but are not limited to, monoclonal antibodies, polyclonal antibodies, proteins such as but not limited to RNAse H, nucleic acids including but not limited to aptamers, or sequence specific nucleic acids. Aptamers are short stretches of random sequences that are successively selected from a library of sequences by hybridizing to a target, amplifying the hybridized aptamers, and repeating the selection process.
- the molecule specific for the double stranded nucleic acid hybrid is captured by an antibody, known as an anti-hybrid antibody.
- a first anti-hybrid antibody is immobilized onto a support using techniques that are standard in the art.
- suitable supports include covalent linkages or adsorption, for example, protein-protein interactions, protein-G beads, biotin-streptavidin interaction, ED AC to link to a carboxyl or tosyl group, etc., or hybridization directly onto the solid support using, for example, sequence specific nucleic acids in an affinity column.
- Supports include but are not limited to beads, magnetic beads, which as indicated previously include paramagnetic, diamagnetic, ferromagnetic, ferromagnetic, and diamagnetic beads, columns, plates, filter paper, polydimethylsiloxane (PDMS), and dipsticks. Any support can be used as long as it allows extraction of the liquid phase and provides the ability to separate out bound and unbound antibodies. Magnetic beads are particularly useful in that they can be left in the solution and the liquid phase can be extracted or decanted, if a magnetic field is applied to immobilize the beads. Beads that are small and have a high surface area are preferable, such as beads about 1 ⁇ in diameter. Other beads that employ charge switching or silica capture (as opposed to magnetic fields) may be used as well.
- PDMS polydimethylsiloxane
- the hybrids are incubated with the anti-hybrid antibody attached to the support for a sufficient amount of time to allow capture of the double-stranded nucleic acid hybrids by the immobilized anti-hybrid antibodies.
- the support is a bead.
- the anti-hybrid antibody may be monoclonal or polyclonal. In one aspect the antibody is monoclonal. In one aspect, the antibody is coupled to support by an l-ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride (ED AC) linker. In one aspect, the support is a polystyrene bead. In an aspect, the support or bead coupled to the antibody is diluted in a bead dilution buffer. The bead dilution buffer is helpful in minimizing protein denaturation on the bead. One example of a bead dilution buffer comprises 6% casein, 100 mM Tris-HCl, 300 mM NaCl, and 0.05% sodium azide.
- a bead dilution buffer comprises 6% casein, 100 mM Tris-HCl, 300 mM NaCl, and 0.05% sodium azide.
- the beads coated with the anti-hybrid antibody are incubated with the sample at about 67°C to about 70°C for about 30 minutes. In another aspect, the beads and sample are incubated at about 68°C to about 69°C for about 30 minutes. In yet another aspect, the beads and sample are incubated at about 68.5°C for 30 minutes.
- the incubation time can range from about 5 minutes to about 60 minutes, from about 15 minutes to about 45 minutes, from about 20 minutes to about 40 minutes, or any number within the recited ranges, and is generally inversely proportional to the temperature. It will be understood by those skilled in the art that the incubation time, temperature and/or shaking conditions can be varied to achieve alternative capture kinetics as desired.
- Another step in the method can involve providing a second antibody that is also specific for double stranded nucleic acids hybrids or alternatively is specific for the first antibody.
- the second antibody may be detectably labeled, either directly or indirectly, and may be a monoclonal or polyclonal antibody. In an aspect, the second antibody is monoclonal. In another aspect, the second antibody is directly labeled with a detectable marker and is monoclonal. The second antibody is used to detect the presence of double-stranded nucleic acid hybrids.
- the second antibody has a label that must react with a substrate to provide a signal that can be detected.
- the second antibody may be dissolved in a suitable buffer.
- the buffer comprises 100 mM TrisHCl, pH 7.4, 0.5 M NaCl, 0.1 mM ZnCl 2 , 1.0 mM MgCl 2 , 0.25% Tween 20, 0.2 mg/ml RNase A, 4% hydroxypropyl-b-cyclodextrin (cyclodextrin), 30%) bead dilution buffer as discussed previously, 0.05%> goat IgG, 0.09%> sodium azide.
- the conjugation reaction takes place at room temperature.
- the conjugation reaction takes place at about 37°C, about 45°C, or about 50°C. In an aspect the conjugation reaction takes place at about 37°C, about 45°C, or about 50°C, between 35°C and about 40°C, between 40°C and about 50°C for between about 20 minutes and 40 minutes. In an aspect the conjugation reaction takes place at about 37°C, about 45°C, or about 50°C for between about 20 minutes and 40 minutes. In another aspect the conjugation reaction takes place at about 45°C for about 30 minutes.
- any detectable label such as, but not limited to, an enzyme, radioactive molecule, fluorescent molecule, or metal particle such as gold particle can be used.
- the detectable label is alkaline phosphatase.
- Methods of conjugating a label to an antibody are known. For example, an antibody can be reduced with dithiothreitol (DTT) to yield monovalent antibody fragments. The reduced antibody can then be directly conjugated to maleinated alkaline phosphatase by the methods of Ishikawa et ah, J. Immunoassay 4:209-237 (1983) and Means et ah, Chem.
- the double-stranded nucleic acid hybrids can be detected with a second anti-hybrid antibody that is not directly labeled.
- the second antibody can be a mouse immunoglobulin that is detected by a labeled goat anti-mouse antibody.
- the wash buffer may contain one or more detergents or may be free of a detergent. If the wash buffer contains a detergent, the detergent may be an ionic or a non-ionic detergent.
- a non-ionic detergent is Triton-X.
- the detergent may be present in the wash buffer at a concentration of about 0.05% to about 1.5%, or from about 0.075% to about 1.0%, or from about 0.1% to about 0.75%, or about 0.5% or any number within the recited ranges.
- a suitable wash buffer comprises 40 mM Tris, pH 8.2, 100 mM NaCl, 0.5% Triton-X 100 and 0.05% sodium azide.
- the wash buffer contains 0.5 mM to about 2.0 mM Tris and 0.02-
- the wash buffer comprises, consists essentially of, or consists of about 0.5 mM to about 2.0 mM Tris and 0.02- 0.10%) sodium azide at a pH between about 7.5 to about 8.5.
- the wash buffer comprises, consists essentially of, or consists of about 1.0 mM Tris and about 0.09%> sodium azide.
- the wash buffer has a pH of between about 7.6 to about 8.4.
- the sample may be washed with the wash buffer from one to ten times, or from three to seven times, or from four to six times, four times, or five times, or any number within the recited ranges. In an aspect, the sample is washed at least four times with two different wash buffers. In another aspect, the sample is washed at least four times with three washes taking place with one buffer and another wash step taking place with a different buffer.
- the sample may also be washed with a single wash buffer or with multiple wash buffers. Each wash may use the same wash buffer or a different wash buffer. For example, a detergent-containing wash buffer may be used for one wash while a detergent- free wash buffer may be used for another wash. In an aspect, one of the wash buffers does not include Triton.
- the label present on the second, or third, or more, antibody is detected to thus indicate the presence of the target nucleic acid molecule.
- Methods for detecting various labels are known in the art. For example, colorimetry, radioactive, surface plasmon resonance, or chemiluminescence methods are described by e.g., Coutlee et al., J. Clin. Microbiol. 27: 1002- 1007 (1989), the contents of which are incorporated herein by reference in its entirety.
- a bound alkaline phosphatase conjugate can be detected by chemiluminescence with a reagent such as a LUMI-PHOS 530 reagent (Lumigen, Detroit, MI) or DR2 (Applied Biosystems, Foster City, CA) using a detector such as an E/LUMINA
- Luminometer MGM Instruments, Hamden, CT, or the like, such as a Veritas Microplate Luminometer by Turner Biosystems.
- a fluorometer may be used to detect the conjugate. Multiple detection techniques can also be used in sequence or in parallel.
- the conjugate may be detected by chemiluminescence and fluorescence.
- the conjugate can be detected by chemiluminescence.
- Detectors using different detection techniques for the conjugate may be reversible or irreversibly attached, for example in a modular fashion, to a machine that is capable of performing the method for determining the presence of a target nucleic acid molecule in a sample.
- detection of the label on the second antibody is indicative of the presence of one or more of the target nucleic acid molecules in the sample that are complementary to the one or more probes.
- the sample is suspended in a detection buffer that for example, contains the substrate for the label on the second antibody.
- the sample is comprised of cervical cells.
- the method for determining the presence of a target nucleic acid molecule in a sample of cervical cells comprises suspending the sample in a detergent-based collection medium and mixing by hand mixing.
- the mixing is mechanical.
- An approximately 50 ⁇ aliquot of the sample is removed and mixed with about 25 ⁇ of a denaturation reagent.
- the sample is mixed by hand mixing or mechanical shaking at between about 600 to about 1200 rpm for about 30 to about 60 seconds and heated at about 70°C for about 30 minutes.
- High risk HPV RNA probes are prepared in a diluent and diluted to about 375 ng/ml. About 40 ⁇ of diluted probe is added to the sample on a 70°C heating block.
- the samples are further incubated at approximately 68.5°C with shaking at about 1150 rpm for about 30 minutes.
- the supernatant can be removed by a dropper bottle or other low tech device.
- About 35 ⁇ of the detection reagent is added to the sample.
- the detection reagent contains a second antibody that is labeled.
- the second antibody is specific for double-stranded nucleic acid hybrids.
- the sample containing the detection reagent is incubated at about 45°C for about 30 minutes, placed on a magnetic rack for about 30 seconds to 3 minutes and the supernatant is decanted.
- the sample containing the detection reagent is incubated at room temperature. The sample is then washed with wash buffer about four or five times.
- the double-stranded nucleic acid hybrids formed in accordance with the present invention can be captured and detected using antibodies that are specific to double-stranded nucleic acid hybrids.
- the antibody is specific to double-stranded hybrids, such as but not limited to RNA-DNA; DNA-DNA; R A-R A; and mimics thereof, where mimics refer to molecules that behave similarly to RNA-DNA, DNA-DNA, or RNA-RNA hybrids.
- the anti-double- stranded nucleic acid hybrid antibody i.e., the anti-hybrid antibody that is utilized will depend on the type of double-stranded nucleic acid hybrid formed. In one aspect, the anti-hybrid antibody is immunospecific to RNA-DNA hybrids.
- polyclonal or monoclonal anti-hybrid antibodies can be used and/or coupled to beads and/or immobilized on a support in the present assay as described below.
- Monoclonal antibody prepared using standard techniques can be used in place of the polyclonal antibodies.
- Monoclonal antibodies may be produced by methods that are standard in the art.
- the antibodies used for capture and detection of the target nucleic acid are monoclonal antibodies.
- monoclonal antibodies support high stringency incubation temperatures during the capture step. Without being limited, the high stringency incubation temperatures during the capture step may be between about 65° to about 75°C or between about 68° to about 75°C.
- the first and second antibodies may be the same for capture and detection ⁇ i.e., produced by the same hybrid myeloma cell line) or may be different and produced by different hybrid myeloma cell lines.
- the first and second monoclonal antibodies used for capture and/or detection are the same and are specific for RNA-DNA hybrids. Also included are immunofragments or derivatives of antibodies specific for double-stranded hybrids, where such fragments or derivatives contain binding regions of the antibody.
- RNA-DNA hybrid antibody derived from myeloma cells fused to spleen cells that are immunized with an RNA-DNA hybrid
- the hybrid-specific antibody can be purified by affinity purification against RNA-DNA hybrids immobilized on a solid support, for example as described in Kitawaga et al., Mol. Immunology, 19:413 (1982); and U. S. Patent No. 4,732, 847, the contents of each of which are incorporated herein by reference in their entirety.
- Suitable methods of producing or isolating antibodies can be used, including, for example, methods that select recombinant antibody (e.g., single chain F v or F a b, or other fragments thereof) from a library, or which rely upon immunization of transgenic animals (e.g., mice) capable of producing a repertoire of human antibodies (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362: 255 (1993); and U.S. Pat. No. 5,545,806 and U.S. Pat. No. 5,545, 807, the contents of each of which are incorporated herein by reference in their entirety).
- recombinant antibody e.g., single chain F v or F a b, or other fragments thereof
- transgenic animals e.g., mice
- the target nucleic acid to be detected is DNA (e.g., HPV genomic
- DNA or cDNA DNA or cDNA
- RNA e.g., mRNA, ribosomal RNA, nuclear RNA, transfer RNA, viral RNA, heterogeneous nuclear RNA
- the one or more polynucleotide probes are
- the double-stranded nucleic acid hybrids are DNA-RNA hybrids formed by hybridization of target DNA and probe RNA, and can be detected using an antibody that is immunospecific to RNA- DNA hybrids.
- a monoclonal anti-RNA-DNA hybrid antibody derived from a hybridoma cell line is used.
- hybridoma cell lines are described in U.S. Pat. No. 4,865,980, U.S. Pat. No. 4,732,847, and U.S. Pat. No. 4,743,535, the contents of each of which are incorporated herein by reference in their entirety.
- Hybrid-specific monoclonal antibodies may be prepared using techniques that are standard in the art. The hybrid-specific monoclonal antibody may be used for both capturing and detecting the target nucleic acid.
- DNA hybrid antibodies goats or rabbits are preferred.
- a goat or rabbit is immunized with a synthetic poly(A)-poly(dT) hybrid by injecting the hybrid into the animal in accordance with conventional injection procedures.
- Polyclonal antibodies may be collected and purified from the blood of the animal with antibodies specific for the species of the immunized animal in accordance with well-known antibody isolation techniques.
- the spleen can be removed from the animal after a sufficient amount of time, and splenocytes can be fused with the appropriate myeloma cells to produce hybridomas.
- Hybridomas can then be screened for the ability to secrete the anti-hybrid antibody.
- Selected hybridomas may then be used for injection into the peritoneal cavity of a second animal for production of ascites fluid, which may be extracted and used as an enriched source of the desired monoclonal antibodies incorporated herein by reference.
- the polynucleotide probes are designed to hybridize or bind with the target nucleic acid molecules. In another aspect, the polynucleotide probes are designed to bind to target nucleic acid molecules. In one aspect, the probes are capable of hybridizing or binding to HPV and HPV high risk variants. In an additional aspect, the polynucleotide probes are specific for HPV and HPV high risk variants. High risk (HR) nucleic acid probes can include probes for HPV high risk types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82.
- High Risk nucleic acid probes can include probes for HPV high risk types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, and 82.
- the RNA or DNA probes are fragments.
- the probes are about 6 to about 8 kilobases in length, about 7.5 kilobases, and may be produced using a plasmid template using a BLUESCRIPT vector.
- RNA probes described herein are known in the art and could also be used to produce the RNA probes described herein.
- the probes may vary in amount from about 7.5 ng to about 60 ng per HPV type per assay, or from about 20 ng to about 45 ng per HPV type per assay, or about 30 ng of probe for each HPV type per assay is used.
- the HR probes consist of or consist essentially of one or more probes for HPV high risk types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 or low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89 wherein about 30 ng of each probe is used per assay for detection of the target nucleic acid molecule.
- a combination or set of nucleic acid molecules is targeted.
- a set of target nucleic acid molecules can include high risk HPV types 16, 18, and 45.
- the set of nucleic acid molecules to be targeted include only high risk HPV types 16, 18, and 45.
- a set of target nucleic acid molecules can comprise, consist essentially of, or consist of polynucleotide probes hybridize with or are specific for high risk HPV types 16, 18, and 45 and may be used with any of the methods disclosed herein.
- the RNA probes may be short synthetic RNA probes that specifically bind only to the target nucleic acid molecule. Examples are described in U.S. Pat. Appl. No. 12/426,076, filed on April 17, 2009, the contents of which are incorporated herein by reference in its entirety.
- a probe mixture comprising multiple sets of probes is used to simultaneously screen for any one of a mixture of desired target nucleic acids.
- SEQ ID NO: 117 SEQ ID NO:
- the strategically-truncated probes are capable of hybridizing, binding to, or are specific for HPV high-risk types.
- the strategically-truncated probes are capable of hybridizing, binding to, or are specific for HPV high risk types and the deleted portion exhibits high sequence identity or cross reactivity to a HPV low risk type.
- the strategically-truncated probes are truncated at both the El and E2 positions of the HPV sequence where identity with LR types tends to be highest (See Figures 1-9).
- the strategically-truncated probes may also be truncated at the El, E2, and LI positions of the plasmid (See Figures 1, 4, 7-8) or truncated at the El, E2, and L2 positions of the plasmid (See Figure 9) in areas of the HPV genome showing high sequence identity with the low risk types.
- the total amount of deleted sequence in the one (X) or two (XX) deletions range from approximately 1.4 to 2.4 Kb.
- the deletion is from about 100 to about 200 base pairs, from about 150 to about 300 base pairs, from about 200 to about 500 base pairs, from about 500 to about 1000 base pairs, from about 1200 to about 1500 base pairs, or from about 1000 to about 2000 base pairs.
- a first deletion is from about 150 to about 300 base pairs or about 200 to about 500 base pairs and a second deletion is from about from about 1200 to about 1500 base pairs or from about 1000 to about 2000 base pairs.
- the deleted portion exhibits high sequence identity, cross reactivity, or hybridizes to a HPV low risk type, such as to low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- a HPV low risk type such as to low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the polynucleotide probes are strategically-truncated probes about 75% or more, 80% or more, 85%> or more, 90%> or more, 95%> or more, 98%> or more, or 100% identical to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 116, or SEQ ID NO: 117,.
- the strategically-truncated probes are fragments from about 100 to about 200 base pairs, from about 150 to about 300 base pairs, from about 200 to about 500 base pairs, from about 500 to about 1000 base pairs, from about 1200 to about 1500 base pairs, or from about 1000 to about 2000 base pairs contiguous base pairs in length of SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 116, or SEQ ID NO: 117.
- the one or more polynucleotide probes include a probe set of one or more probes sharing at least about 75%> or more, 80%> or more, 85%> ore more, 90%> or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103, OR SEQ ID NO: 116, or SEQ ID NO: 117.
- the disclosure also provides for probe sets including one or more, two or more, three or more, four or more, or five or more of the probes described herein.
- the strategically-truncated probes are capable of reducing cross reactivity, hybridization, or binding with low risk HPV types.
- one of more strategically-truncated probes of SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103 are capable of reducing cross reactivity with one or more low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the present disclosure provides an isolated polynucleotide at least about 50% or more, 75% or more, 80%> or more, 85% or more, 90%> or more, 95% or more, 98%> or more, or 100% identical to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103, OR SEQ ID NO: 117, or fragments or complements thereof.
- the disclosure provides for an isolated polynucleotide capable of hybridizing or specifically binding to HPV 26 comprising a sequence 50%> or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to SEQ ID NO: 87 or SEQ ID NO: 97 (26XX), fragments, or complements thereof; an isolated polynucleotide capable of hybridizing or specifically binding to HPV 33 comprising a sequence at least 50% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to SEQ ID NO: 88 or SEQ ID NO: 98 (33X), fragments, or complements thereof; an isolated polynucleotide capable of hybridizing or specifically binding to HPV 39 comprising a sequence at least 50% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or
- hybridizing or specifically binding to HPV 52 comprising a sequence 50% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to SEQ ID NO: 90 or SEQ ID NO: 100 (52X), fragments, or complements thereof; an isolated polynucleotide capable of hybridizing or specifically binding to HPV 56 comprising a sequence 50%o or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to SEQ ID NO: 91 or SEQ ID NO: 101 (56XX), fragments, or complements thereof; an isolated polynucleotide capable of hybridizing or specifically binding to HPV 58 comprising a sequence 50% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 100% identical to SEQ ID NO: 92 or SEQ ID NO: 102 (58X), fragments, or complements
- high risk HPV sequences exhibiting cross-reactivity or specificity to low risk HPV sequences are identified for target deletions.
- Cross-reactivity may be predicted by percent identity from sequence alignments using any known sequence identifying database, such as any of the bioinformatics tools described herein.
- a portion of the sequence exhibiting cross-reactivity or identity to low risk HPV sequences is removed.
- a second, third, fourth, fifth or more deletion can be made if significant cross-reactivity is present after the first deletion.
- deletions are initiated using the Invitrogen GeneTailorTM Site-Directed Mutagenesis System.
- Bioinformatics tools can be employed to determine the one or more
- Oligoarray 2.0 a software program that designs specific oligonucleotides can be utilized. Oligoarray 2.0 is described by Rouillard et ah, Nucleic Acids Research, 31 : 3057-3062 (2003), which is incorporated herein by reference. Oligoarray 2.0 is a program which combines the functionality of BLAST (Basic Local Alignment Search Tool) and Mfold (Genetics Computer Group, Madison, WI). BLAST, which implements the statistical matching theory by Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87:2264 (1990); Proc. Natl. Acad. Sci.
- polynucleotide probes of a specified length and compared to the parameters, after which secondary structure also can be examined. Once all parameters of interest are satisfied, cross hybridization can be checked with the Mfold package, using the similarity determined by BLAST.
- the various programs can be adapted to determine the one or more polynucleotide probes meeting the desired specificity requirements.
- the parameters of the program can be set to prepare polynucleotides of 25nt length, Tm range of 55-95°C, a GC range of 35- 65%, and no secondary structure or cross-hybridization at 55°C or below.
- the present invention also provides for assay compositions, probes, and conditions wherein cross-reactivity between HPV HR probe sets and low risk HPV types is dramatically reduced when compared to the standard FDA approved HPV assay and probe set.
- the HPV HR probe set is selected from the group consisting of HPV high risk types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 or low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- cross-reactivity between low risk HPV types and high risk HPV probes is reduced. See, for example, U.S. Pat. Appl. No. 12/426,076.
- the present invention also provides a method for determining the presence of a target nucleic acid molecule, such as HPV, in a sample in about 2 hours or less, about 2.5 hours or less, about 3 hours or less, about 3.5 hours or less, about 4 hours or less, about 5 hours or less, about 6 hours or less, about 7 hours or less, about 8 hours or less, about 12 hours or less, about 24 hours or less, in other aspects, less than about 3.5 hours for at least 10 samples using the methods discussed above.
- a target nucleic acid molecule such as HPV
- signal amplification may be used to accurately detect the presence of HPV or other target nucleic acid molecules.
- the methods of the disclosure may include a signal amplification step.
- the methods of the disclosure do not include a target amplification step.
- the methods of the disclosure may include a signal amplification step and no target amplification step.
- the present disclosure also provides methods and assays for detecting cancer, for example cervical cancer, by detecting the presence of a target nucleic acid molecule, such as HPV, in a sample in about 2 hours or less, about 2.5 hours or less, about 3 hours or less, about 3.5 hours or less, about 4 hours or less, about 5 hours or less, about 6 hours or less, about 7 hours or less, about 8 hours or less, about 12 hours or less, about 24 hours or less, in other aspects, less than about 3.5 hours for at least 10 samples using the methods and assays as discussed above.
- a target nucleic acid molecule such as HPV
- the present invention can be carried out on a number of platforms including, but not limited to, tubes, dipsticks, microarrays, microplates, 384 well plates, other microtiter plates and microfluidic systems. It will be understood to those skilled in the art that the present, can be automated .
- Another aspect of the present invention provides a collection medium into which samples containing the target nucleic acid are collected.
- the collection medium provides sample stability for several days, several weeks, or several months.
- the collection medium may provide sample stability for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, from about 1 week to about 4 weeks, from about 1 month to about 3 months, from about 3 to about 4 months, or from about 3 month to 6 months.
- the collection medium provides sample stability for at least 21 days at 33°C or at least 6 months at 20°C.
- the above sample is a cervical cell sample or a human cervical cell sample.
- the collection medium comprises, consists of, or consists essentially of NP-40, deoxycholate, Tris-HCl, EDTA, NaCl, and sodium azide. In other aspects, the collection medium comprises, consists of, or consists essentially of 1.0% NP-40, 0.25% sodium deoxycholate, 50 mM Tris-HCl, 25 mM EDTA, 150 mM NaCl, and 0.09% sodium azide.
- Another aspect is a detergent-containing wash buffer comprising, consisting of, or consisting essentially of 40 mM Tris pH 8.2, 100 mM NaCl, 0.1% to 0.5% Triton X-100, and 0.09%) sodium azide.
- a detergent-free wash buffer comprising, consisting of, or consisting essentially of 40 mM Tris pH 8.2, 100 mM NaCl, and 0.09%> sodium azide.
- An aspect relates to a high throughput assay and apparatus capable of being practiced with any of the methods or compositions described herein.
- the high throughput assay is capable of accurately and rapidly processing samples a large number of samples in a short period of time.
- the high throughput assay is capable of processing at least 300 samples in less than 3 hours, 900 samples in about 5 hours, at least 1000 samples in about 6 hours, or at least 1500 samples in about 8 hours. In another aspect, the high throughput assay is capable of processing at least 10 microtiter plates (96 well plates, for example) in about 5 hours, at least 15 microtiter plates (96 well plates, for example) in about 7 hours, or at least 20 microtiter plates (96 well plates, for example) in about 8 hours. In an aspect, the processing of samples takes place from the start of the method or assay to the completion.
- kits for the detection of a target nucleic acid molecule in a sample comprising, consisting of or, or consisting essentially of:
- a detection reagent comprising a second anti-poly hybrid antibody, wherein the second antibody is detectably labeled
- a second detection reagent comprising a substrate for the label on the second antibody.
- the kit included one or more HPV high risk probes and the deleted portion shares high sequence identity or cross reactivity to a HPV low risk type.
- the HPV high risk probe is specific for or capable of hybridizing to one or more of HPV types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 73, and 82 and the deleted portion shares cross reactivity or specificity with one or more of low risk HPV types 1, 2, 3, 4, 5, 6, 8, 11, 13, 30, 34, 40, 42, 43, 44, 53, 61, 67, 69, 70, 71, 72, 74, 81, 83, 84, and 89.
- the polynucleotide probes are nucleic acid sequences sharing 75% or more, 80% or more, 85%> or more, 90% or more, 95% or more, 98% or more, or 100% identity to SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, or SEQ ID NO: 117.
- An aspect relates to a high throughput apparatus capable of being practiced with any of the methods or compositions described herein.
- the compositions, methods, assays, and kits described herein are used together with the apparatus described in U.S. Patent Application No. 12/508,304, U.S. Patent Application No. 12/508,306, U.S. Patent Application No. 12/622,131, U.S. Patent Application No. 12/605,540, and 12/605,605, each of which are incorporated by reference in their entirety.
- ⁇ 12/605,605 can be used to detect and analyze nucleic acid molecules associated with nucleic acid molecules associated with any one of cervical samples (e.g. , a sample obtained from a cervical swab) or cervical cell samples, adenoid cells, anal epithelial cells, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, urine and semen, other viral, bacteria, mycobacteria or plasmodia, for example cytomegalovirus (CMV), herpes, HIV, H1N1, chlamydia, gonorrhea, Neisseria gonorrhoeae (GC), Chlamydia trachomatis (CT), Trichomonas vaginalis, Staphylococcus aureus, tuberculosis, SARS-associated coronavirus or influenza.
- CMV cytomegalovirus
- herpes HIV, H1N1, chlamydia, gonor
- Results of this sequence alignment are shown at Fig. 30.
- HR sequences showing the highest percentage of identity with LR types are identified for targeted deletions. Based on this, HPV 26, 33, 39, 52, 56, 58, 66, 68, and 73 are selected as candidate plasmids for sequence removal to reduce LR cross-reactivity.
- HPV68 AGCACCATATCCTGTATCAATCATATCGCCATCCTCAATAGGAGTATTTAC
- Linear probes are then generated from the plasmids. This can be accomplished in a number of ways, including but not limited to: cleaving the plasmid with, for example, a restriction endonuclease and/or amplifying a portion of the plasmid by, for example, sequence- specific polymerase chain reaction.
- the probes are generated by (1) linearizing the plasmid through the use of a restriction endonuclease, then (2) amplifying the probe portion of the plasmid using a polymerase and a polymerase specific promoter.
- linearized RNA probes can be generated from the plasmids in Figs. 22-29 by first cleaving the plasmid with Xhol restriction endonuclease, then transcribing the portion specific for HPV nucleic acids with T7 R A polymerase. This is depicted at Fig. 31.
- the total amount of deleted sequence contained in the one (X) or two (XX) deletions ranged from ⁇ 1.4 to 2.4 Kb.
- the final plasmid constructs resulted in HPV 33X, 52X, 58X with single deletions and HPV 26XX, 39XX, 56XX, 66XX, 68XX and 73XX with double deletions.
- Restriction maps of the plasmids and resultant probes are set forth in FIGS 10 through 18. Exemplary deletions are shown above at Table 2.
- FIG. 19 and 20 An example of this workflow for generating an HPV26 double strategically- truncated plasmid is depicted at FIG. 19 and 20.
- a second amplification is then performed with the following pair of deletion primers:
- This amplification deletes a 490 base pair section of the plasmid, resulting in truncation of the LI region.
- This amplicon was then transfected into a strain of DH5 TM - T1 R E. coli bearing an active form of McrBC nuclease (Invitrogen Corp., Carlsbad, California).
- the E. coli circularizes the amplicons to generate an HPV26XX strategically-truncated plasmid, while McrBC digests the methylated template.
- HPV26XX plasmid was restriction mapped to confirm the structure and size.
- the plasmid was digested with (1) Xhol only; (2) Xhol and Notl; (3) BamHI and Spel; and (4) Hindlll. The results are shown at Fig. 21.
- This plasmid has the features set forth below in Table 3:
- a 1 ml sample was vortexed to homogenize the sample and a 50 ⁇ aliquot was removed and combined with 25 ⁇ of denaturation reagent (1.75 N NaOH) in the assay microplate. This was shaken to mix and incubated at 70°C for 30 minutes to create single stranded DNA. To this, 40 ⁇ of a neutralization buffer (probe diluent - 2.2M BES, 2.6% PAA, 0.7 N NaOH and 0.09%> sodium azide) containing RNA probes for 16 HPV types was added to create a neutral pH and incubated at 68.5°C for 10 minutes.
- a neutralization buffer probe diluent - 2.2M BES, 2.6% PAA, 0.7 N NaOH and 0.09%> sodium azide
- RNA-DNA hybrids 1 ⁇ carboxylated SERADYN beads from Thermo Fisher
- the paramagnetic beads are separated from the liquid phase/supernatant by exposure to a magnetic field.
- the supernatant waste is removed by decanting and 35 ⁇ of detection reagent 1 (secondary antibody conjugated enzyme comprising a monoclonal anti-RNA-DNA hybrid antibody conjugated to alkaline phosphatase) is added and incubated at 45°C for 30 minutes.
- the secondary antibody binds the RNA-DNA hybrid- antibody-conjugated paramagnetic bead complex.
- Non-bound secondary antibody is washed away using a detergent based wash buffer (40 mM Tris, pH 8.2, 100 mM NaCl, 0.1% Triton-X 100 and 0.09% sodium azide).
- a substrate dioxetane-based substrate from ABI, called DCP Star, with Emerald
- LOD limit of detection
- C95 concentration the copy number required to identify whether virus is detected.
- C95 concentration the copy number required to identify whether the signal for the specimen is above a presumptive clinical cutoff 95% ofthe time.
- Cervical specimens were collected at an external clinic site and placed into digene collection medium (DCM) per routine clinical procedure. Specimens were tested using the hybrid capture HR HPV DNA screening assay, and the reactive specimens and a subset of the non-reactive specimens were assayed using the hybrid capture HPV 16 and HPV 18/45 genotyping assays. A subset of the reactive specimens were also evaluated using HPV genotyping by GP5+/6+ PCR followed by Luminex detection.
- DCM digene collection medium
- the media may contain 1.0% NP- 40, 0.25% sodium deoxycholate, 50 mM Tris-HCl, 25 mM EDTA, 150 mM NaCl and 0.05% sodium azide.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Nuclear Medicine (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2011258501A AU2011258501B2 (en) | 2010-05-25 | 2011-05-24 | Fast results hybrid capture assay and associated strategically-truncated probes |
| CA2799205A CA2799205A1 (en) | 2010-05-25 | 2011-05-24 | Fast results hybrid capture assay and associated strategically-truncated probes |
| JP2013512140A JP6153866B2 (ja) | 2010-05-25 | 2011-05-24 | 迅速なハイブリッド捕捉アッセイ、及び関連する戦略的に切断されたプローブ |
| EP11726003.4A EP2576840B1 (en) | 2010-05-25 | 2011-05-24 | Fast results hybrid capture assay and associated strategically-truncated probes |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US34794110P | 2010-05-25 | 2010-05-25 | |
| US61/347,941 | 2010-05-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011149897A1 true WO2011149897A1 (en) | 2011-12-01 |
Family
ID=44275651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/037684 Ceased WO2011149897A1 (en) | 2010-05-25 | 2011-05-24 | Fast results hybrid capture assay and associated strategically-truncated probes |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US9376727B2 (enExample) |
| EP (1) | EP2576840B1 (enExample) |
| JP (1) | JP6153866B2 (enExample) |
| AU (1) | AU2011258501B2 (enExample) |
| CA (1) | CA2799205A1 (enExample) |
| WO (1) | WO2011149897A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020140974A1 (en) * | 2019-01-03 | 2020-07-09 | Hangzhou New Horizon Health Technology Co. Ltd. | Compositions and methods for detecting human papillomavirus |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012506705A (ja) | 2008-10-27 | 2012-03-22 | キアジェン ゲイサーズバーグ インコーポレイテッド | 迅速に結果を得るハイブリッドキャプチャー法による分析およびシステム |
| JP6103941B2 (ja) * | 2010-01-29 | 2017-03-29 | キアジェン ゲイサーズバーグ インコーポレイテッド | 核酸の配列特異的精製および多重分析のための方法および組成物 |
| CN105368982B (zh) | 2014-08-28 | 2019-01-29 | 杭州德同生物技术有限公司 | 一种高危型人乳头瘤病毒检测及分型方法 |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4732847A (en) | 1981-06-09 | 1988-03-22 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
| US4743535A (en) | 1984-11-07 | 1988-05-10 | Miles Inc. | Hybridization assay employing labeled probe and anti-hybrid |
| US4865980A (en) | 1982-12-29 | 1989-09-12 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US20060160069A1 (en) * | 2003-10-07 | 2006-07-20 | Chau Miu F | Methods and compositions for the diagnosis of cancer |
| US20060275784A1 (en) * | 1999-10-26 | 2006-12-07 | Ventana Medical Systems, Inc. | Detection of Human Papilloma Virus in Papanicolaou (Pap) Smears |
| US20100105060A1 (en) * | 2008-10-27 | 2010-04-29 | Qiagen Gaithersburg Inc. | Fast results hybrid capture assay on an automated platform |
Family Cites Families (215)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI63596C (fi) | 1981-10-16 | 1983-07-11 | Orion Yhtymae Oy | Mikrobdiagnostiskt foerfarande som grundar sig pao skiktshybridisering av nukleinsyror och vid foerfarandet anvaenda kombinationer av reagenser |
| US4486536A (en) | 1982-05-28 | 1984-12-04 | Smithkline Diagnostics, Inc. | Specimen slide for occult blood testing |
| DE131052T1 (de) | 1983-01-10 | 1987-03-19 | Gen-Probe Partners, San Diego, Calif. | Verfahren zum aufspueren, identifizieren und quantifizieren von organismen und viren. |
| US5288611A (en) | 1983-01-10 | 1994-02-22 | Gen-Probe Incorporated | Method for detecting, identifying, and quantitating organisms and viruses |
| US5200313A (en) | 1983-08-05 | 1993-04-06 | Miles Inc. | Nucleic acid hybridization assay employing detectable anti-hybrid antibodies |
| EP0144914A3 (en) | 1983-12-12 | 1986-08-13 | Miles Inc. | Hybridization assay employing labeled pairs of hybrid binding reagents |
| US7138505B1 (en) | 1984-01-12 | 2006-11-21 | Novartis Vaccines And Diagnostics, Inc. | Factor VIII:C nucleic acid molecules |
| FI71768C (fi) | 1984-02-17 | 1987-02-09 | Orion Yhtymae Oy | Foerbaettrade nykleinsyrareagenser och foerfarande foer deras framstaellning. |
| CA1260372A (en) | 1984-04-27 | 1989-09-26 | Elazar Rabbani | Hybridization method for the detection of genetic materials |
| CA1253777A (en) | 1984-06-01 | 1989-05-09 | Robert J. Carrico | Nucleic acid hybridization assay employing immobilized rna probes |
| US4563417A (en) | 1984-08-31 | 1986-01-07 | Miles Laboratories, Inc. | Nucleic acid hybridization assay employing antibodies to intercalation complexes |
| US4689294A (en) | 1984-11-19 | 1987-08-25 | Miles Laboratories, Inc. | Enhancement of hybridization of nucleic acids by anionic polymers |
| CA1276575C (fr) | 1984-11-30 | 1990-11-20 | Sylvie Beaudenon | Sondes a papillomavirus et procede de diagnostic in vitro d'infections a papillomavirus |
| US5876922A (en) | 1985-07-31 | 1999-03-02 | Institute Pasteur | Papillomavirus probe and a process for in vitro diagnosis of papillomavirus infections |
| US5411857A (en) | 1985-07-31 | 1995-05-02 | Institut Nationale De La Sante | Probes for papillomaviruses and an in vitro diagnostic procedure for papilloma infections |
| US4751177A (en) | 1985-06-13 | 1988-06-14 | Amgen | Methods and kits for performing nucleic acid hybridization assays |
| IL79112A (en) | 1985-06-13 | 1992-01-15 | Abbott Lab | Method for the isolation of a nucleic acid sequence and kit for performing a hybridization assay |
| US4868105A (en) | 1985-12-11 | 1989-09-19 | Chiron Corporation | Solution phase nucleic acid sandwich assay |
| WO1987005630A1 (en) | 1986-03-21 | 1987-09-24 | Institut Pasteur | Determined dna sequences derived from a papillomavirus genome, their uses for in vitro diagnostic purposes and the production of antigenic compositions |
| US5750338A (en) | 1986-10-23 | 1998-05-12 | Amoco Corporation | Target and background capture methods with amplification for affinity assays |
| WO1988003957A1 (en) | 1986-11-24 | 1988-06-02 | Gen-Probe Incorporated | Nucleic acid probes for detection and/or quantitation of non-viral organisms |
| AU619170B2 (en) | 1987-01-09 | 1992-01-23 | Abbott Laboratories | Diagnostic assays using nucleic acid probes |
| JP3096704B2 (ja) | 1987-02-26 | 2000-10-10 | バイオサーチ インターナショナル ピティ リミテッド | ヒトの発癌性乳頭腫ウイルスの検出方法 |
| AU601021B2 (en) | 1987-03-11 | 1990-08-30 | Molecular Diagnostics, Inc. | Assay for necleic acid sequences in a sample |
| IL85551A0 (en) | 1987-04-01 | 1988-08-31 | Miles Inc | Rapid hybridization assay and reagent system used therein |
| DE3722968A1 (de) | 1987-07-11 | 1989-01-19 | Behringwerke Ag | Humaner papillomvirus typ 41, seine dna und die dafuer kodierenden proteine |
| US5656731A (en) | 1987-10-15 | 1997-08-12 | Chiron Corporation | Nucleic acid-amplified immunoassay probes |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| DE68916671T2 (de) | 1988-03-18 | 1995-03-02 | Baylor College Medicine | Mutationsnachweis durch kompetitiven Oligonukleotid-Priming. |
| US5374524A (en) | 1988-05-10 | 1994-12-20 | E. I. Du Pont De Nemours And Company | Solution sandwich hybridization, capture and detection of amplified nucleic acids |
| FR2632956B2 (fr) | 1988-05-13 | 1991-07-12 | Pasteur Institut | Sondes a papillomavirus hpv49, hpv50, hpv54, hpv55; produits genetiquement et immunologiquement lies a ce papillomavirus hpv49, hpv50, hpv54, hpv55; procede de diagnostic in vitro d'infections a papillomavirus et d'immunisation in vivo contre ces papillomavirus |
| NO165894C (no) | 1988-05-24 | 1991-04-24 | Gunnar Paulsen | Analysemetode for gener. |
| DE3826793A1 (de) | 1988-08-06 | 1990-03-08 | Behringwerke Ag | Humaner papillomvirus typ 57, seine dna und die davon kodierten proteine |
| US5639871A (en) | 1988-09-09 | 1997-06-17 | Roche Molecular Systems, Inc. | Detection of human papillomavirus by the polymerase chain reaction |
| US5182377A (en) | 1988-09-09 | 1993-01-26 | Hoffmann-La Roche Inc. | Probes for detection of human papillomavirus |
| US5447839A (en) | 1988-09-09 | 1995-09-05 | Hoffmann-La Roche Inc. | Detection of human papillomavirus by the polymerase chain reaction |
| ATE133714T1 (de) | 1988-09-29 | 1996-02-15 | Chiron Corp | Polynukleotid-bestimmung mit selektierbaren spaltstellen |
| US5077192A (en) | 1988-10-25 | 1991-12-31 | The General Hospital Corporation | Method of detecting antigenic, nucleic acid-containing macromolecular entities |
| CA1339729C (en) | 1988-10-26 | 1998-03-17 | Wayne D. Lancaster | Human papillomavirus type 52 dna sequences and methods for employing thesame |
| DE3838269A1 (de) | 1988-11-11 | 1990-05-17 | Behringwerke Ag | Nachweis humaner papillomavirus dna und ihrer expression in zervix-abstrichen |
| AU5269590A (en) | 1989-03-10 | 1990-10-09 | Gene-Trak Systems | Immobilized oligonucleotide probes and uses therefor |
| US5106727A (en) | 1989-04-27 | 1992-04-21 | Life Technologies, Inc. | Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers |
| US5863717A (en) | 1989-11-03 | 1999-01-26 | Abbott Laboratories | Use of conserved oligonucleotide primers to amplify human papillomavirus DNA sequences |
| US5580970A (en) | 1989-12-01 | 1996-12-03 | Amoco Corporation | Detection of HPV transcripts |
| DE69033850T2 (de) | 1989-12-01 | 2002-06-06 | Vysis, Inc. | Nukleinsäuresonden zum Nachweis von HPV-Transkripts |
| US6174870B1 (en) | 1989-12-04 | 2001-01-16 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide inhibition of papillomavirus |
| US5756282A (en) | 1989-12-04 | 1998-05-26 | Isis Pharmaceuticals, Inc. | Oligonucleotides for the diagnosis of papillomavirus |
| US5811232A (en) | 1989-12-04 | 1998-09-22 | Isis Pharmaceuticals, Inc. | Oligonucleotides for Papillomavirus |
| NL9000134A (nl) | 1990-01-19 | 1991-08-16 | Stichting Res Fonds Pathologie | Primers en werkwijze voor het detecteren van humaan papilloma virus genotypen m.b.v. pcr. |
| US5427930A (en) | 1990-01-26 | 1995-06-27 | Abbott Laboratories | Amplification of target nucleic acids using gap filling ligase chain reaction |
| CA2039517C (en) | 1990-04-03 | 2006-11-07 | David Segev | Dna probe signal amplification |
| US5695926A (en) | 1990-06-11 | 1997-12-09 | Bio Merieux | Sandwich hybridization assays using very short capture probes noncovalently bound to a hydrophobic support |
| GB9015845D0 (en) | 1990-07-19 | 1990-09-05 | Emery Vincent C | Diagnostic method |
| US5484699A (en) | 1990-09-28 | 1996-01-16 | Abbott Laboratories | Nucleotide sequences useful as type specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods |
| EP0557456A4 (en) | 1990-11-14 | 1995-11-15 | Siska Diagnostics Inc | Non-isotopic detection of nucleic acids using a polystyrene support-based sandwich hybridization assay and compositions useful therefor |
| US6582908B2 (en) * | 1990-12-06 | 2003-06-24 | Affymetrix, Inc. | Oligonucleotides |
| WO1992011390A1 (en) | 1990-12-17 | 1992-07-09 | Idexx Laboratories, Inc. | Nucleic acid sequence detection by triple helix formation |
| FR2670797A1 (fr) * | 1990-12-20 | 1992-06-26 | Pasteur Institut | Sequences d'adn determinees derivees du genome du papillomavirus hpv39, application de ces sequences au diagnostic in vitro d'infection par ce papillomavirus, et a la production de composition immunogene. |
| US5219990A (en) | 1991-01-28 | 1993-06-15 | Biogen, Inc. | Papillomavirus e2 trans-activation repressors |
| GB9105383D0 (en) | 1991-03-14 | 1991-05-01 | Immunology Ltd | An immunotherapeutic for cervical cancer |
| FR2678284B1 (fr) | 1991-06-28 | 1993-10-08 | Pasteur Institut | Sequences d'adn derivees du genome du papillomavirus hpv42, application de ces sequences au diagnostic in vitro d'infection par ce papillomavirus et a la production de compositions immunogenes. |
| DE122007000085I1 (de) | 1991-07-19 | 2008-03-27 | Univ Queensland St Lucia | Polynukleotidabschnitt des HPV16-Genoms |
| US5543294A (en) | 1991-07-19 | 1996-08-06 | The Trustees Of Columbia University In The City Of New York | Polymerase chain reaction/restriction fragment length polymorphism method for the detection and typing of myobacteria |
| US5346811A (en) | 1991-07-22 | 1994-09-13 | Cerveceria Polar | Method and products for human papillomavirus detection |
| US5556748A (en) | 1991-07-30 | 1996-09-17 | Xenopore Corporation | Methods of sandwich hybridization for the quantitative analysis of oligonucleotides |
| US5981179A (en) | 1991-11-14 | 1999-11-09 | Digene Diagnostics, Inc. | Continuous amplification reaction |
| ES2145750T3 (es) | 1991-11-14 | 2000-07-16 | Dgi Inc | Kit y dosificado que utiliza la hibridacion no radioactiva. |
| US5506105A (en) | 1991-12-10 | 1996-04-09 | Dade International Inc. | In situ assay of amplified intracellular mRNA targets |
| US5424413A (en) | 1992-01-22 | 1995-06-13 | Gen-Probe Incorporated | Branched nucleic acid probes |
| US5437951A (en) | 1992-09-03 | 1995-08-01 | The United States Of America As Represented By The Department Of Health And Human Services | Self-assembling recombinant papillomavirus capsid proteins |
| DE69322871T2 (de) | 1992-09-15 | 1999-05-12 | The Dow Chemical Co., Midland, Mich. | Schlagzähmodifizierung von thermoplastiken |
| EP0625213B1 (en) | 1992-10-09 | 1999-12-29 | VYSIS, Inc. | Assay methods |
| DE69430665T2 (de) | 1993-01-15 | 2002-11-21 | The Public Health Research Institute Of The City Of New York, Inc. | Empfindlicher nukleinsäure-sandwichhybridisierungs-assay und kits |
| US6277570B1 (en) | 1993-04-13 | 2001-08-21 | Naxcor | Nucleic acid sequence detection employing probes comprising non-nucleosidic coumarin derivatives as polynucleotide-crosslinking agents |
| US6495676B1 (en) | 1993-04-13 | 2002-12-17 | Naxcor | Nucleic acid sequence detection employing probes comprising non-nucleosidic coumarin derivatives as polynucleotide-crosslinking agents |
| KR100189229B1 (ko) | 1993-07-23 | 1999-06-01 | 다니엘 엘. 캐시앙, 헨리 엘. 노르호프 | 핵산 증폭을 강화하는 방법 |
| DE4331012A1 (de) | 1993-09-13 | 1995-03-16 | Bayer Ag | Nukleinsäuren-bindende Oligomere mit N-Verzweigung für Therapie und Diagnostik |
| US5679509A (en) | 1993-09-28 | 1997-10-21 | University Of New Mexico | Methods and a diagnostic aid for distinguishing a subset of HPV that is associated with an increased risk of developing cervical dysplasia and cervical cancer |
| US5681697A (en) | 1993-12-08 | 1997-10-28 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor |
| DK145493D0 (da) | 1993-12-23 | 1993-12-23 | Dako As | Antistof |
| AUPM358894A0 (en) | 1994-01-31 | 1994-02-24 | Csl Limited | Modified papilloma virus l2 protein and vlps formed therefrom |
| ATE362977T1 (de) | 1994-02-14 | 2007-06-15 | Macfarlane Burnet Ct For Medic | Nicht pathogene stämme des hiv-1 |
| AU685233B2 (en) | 1994-02-21 | 1998-01-15 | Stichting Researchfonds Pathologie | Human papilloma virus detection in a nucleic acid amplification process using general primers |
| DE4415743C2 (de) | 1994-05-04 | 1996-10-10 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| AUPM566794A0 (en) | 1994-05-17 | 1994-06-09 | University Of Queensland, The | Process and product |
| US6045995A (en) | 1994-08-24 | 2000-04-04 | Isis Pharmaceuticals, Inc. | Capillary electrophoretic detection of nucleic acids |
| US5622822A (en) | 1994-09-13 | 1997-04-22 | Johnson & Johnson Clinical Diagnostics, Inc. | Methods for capture and selective release of nucleic acids using polyethyleneimine and an anionic phosphate ester surfactant and amplification of same |
| US5582988A (en) | 1994-09-15 | 1996-12-10 | Johnson & Johnson Clinical Diagnostics, Inc. | Methods for capture and selective release of nucleic acids using weakly basic polymer and amplification of same |
| JPH10506014A (ja) | 1994-09-22 | 1998-06-16 | メルク エンド カンパニー インコーポレーテッド | ヒトパピローマウイルス6a型をコードするDNA |
| JP3093116B2 (ja) | 1994-09-30 | 2000-10-03 | 株式会社豊田中央研究所 | 核酸検出方法 |
| GB9420146D0 (en) | 1994-10-06 | 1994-11-23 | Cancer Res Campaign Tech | Papillomavirus vaccine |
| US6057099A (en) | 1994-12-02 | 2000-05-02 | Intelligene Ltd. | Detection of nucleic acid sequences |
| US20030104361A1 (en) | 1997-09-29 | 2003-06-05 | Susan Weininger | Method of detection of nucleic acids with a specific sequence composition |
| US5731153A (en) | 1996-08-26 | 1998-03-24 | The Regents Of The University Of California | Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions |
| US5888724A (en) | 1995-02-17 | 1999-03-30 | The Trustees Of Columbia University In The City Of New York | Detection of high oncogenic-risk papilloma virus in high grade cervical lesions and cancers by a PCR/ELISA assay |
| DE19506561C1 (de) | 1995-02-24 | 1996-10-10 | Deutsches Krebsforsch | Verfahren zur Früherkennung von HPV-assoziierten Karzinomen bzw. von hochgradigen, durch HPV-verursachten Dysplasien |
| US5820870A (en) | 1995-03-22 | 1998-10-13 | Merck & Co., Inc. | Recombinant human papillomavirus type 18 vaccine |
| US5840306A (en) | 1995-03-22 | 1998-11-24 | Merck & Co., Inc. | DNA encoding human papillomavirus type 18 |
| IL117591A0 (en) | 1995-03-30 | 1996-07-23 | Merck & Co Inc | Synthetic DNA encoding human papillomavirus type 11 L1 protein |
| US6458940B2 (en) | 1995-06-06 | 2002-10-01 | Hybridon, Inc. | HPV-specific oligonucleotides |
| US6509149B2 (en) | 1995-06-06 | 2003-01-21 | Hybridon, Inc. | HPV-specific oligonucleotides |
| CA2223050A1 (en) | 1995-06-07 | 1996-12-19 | Abbott Laboratories | Probe masking method of reducing background in an amplification reaction |
| DE19526386C1 (de) | 1995-07-19 | 1997-01-02 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| FR2737502B1 (fr) | 1995-07-31 | 1997-10-24 | Genset Sa | Procede de detection d'acides nucleiques utilisant des sondes nucleotidiques permettant a la fois une capture specifique et une detection |
| JP2000500342A (ja) | 1995-11-15 | 2000-01-18 | ジェン−プローブ・インコーポレーテッド | ヒトパピローマウイルス核酸に相補的な核酸プローブおよび関連する方法およびキット |
| US5888736A (en) | 1995-12-22 | 1999-03-30 | Visible Genetics, Inc. | Method, compositions and kit for detection and identification of microorganisms |
| US6852487B1 (en) | 1996-02-09 | 2005-02-08 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| CA2244891C (en) | 1996-02-09 | 2008-12-30 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US5981173A (en) | 1996-02-14 | 1999-11-09 | Institut Pasteur | Genital human papillomavirus type 68a (HPV-68a), related to the potentially oncogenic HPV-39 |
| US6511805B1 (en) | 1996-03-15 | 2003-01-28 | The Penn State Research Foundation | Methods for detecting papillomavirus DNA in blood plasma and serum |
| US6214555B1 (en) | 1996-05-01 | 2001-04-10 | Visible Genetics Inc. | Method compositions and kit for detection |
| WO1998001148A1 (en) | 1996-07-09 | 1998-01-15 | President And Fellows Of Harvard College | Use of papillomavirus e2 protein in treating papillomavirus-infected cells and compositions containing the protein |
| US6218105B1 (en) | 1996-07-19 | 2001-04-17 | Kathleen S. Hall | High throughput papilloma virus in vitro infectivity assay |
| US5853993A (en) | 1996-10-21 | 1998-12-29 | Hewlett-Packard Company | Signal enhancement method and kit |
| US6265154B1 (en) | 1996-10-25 | 2001-07-24 | Abbott Laboratories | Nucleic acid primers and probes for detecting oncogenic human papillomaviruses |
| US6117631A (en) | 1996-10-29 | 2000-09-12 | Polyprobe, Inc. | Detection of antigens via oligonucleotide antibody conjugates |
| GB9624165D0 (en) | 1996-11-19 | 1997-01-08 | Amdex A S | Use of nucleic acids bound to carrier macromolecules |
| DE19648962C1 (de) | 1996-11-26 | 1998-02-26 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| US6388065B1 (en) | 1996-11-27 | 2002-05-14 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | DNA for evaluating the progression potential of cervical lesions |
| US6110676A (en) | 1996-12-04 | 2000-08-29 | Boston Probes, Inc. | Methods for suppressing the binding of detectable probes to non-target sequences in hybridization assays |
| US20020034737A1 (en) | 1997-03-04 | 2002-03-21 | Hyseq, Inc. | Methods and compositions for detection or quantification of nucleic acid species |
| DE19712541C1 (de) | 1997-03-25 | 1998-11-05 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| US5843995A (en) | 1997-07-07 | 1998-12-01 | University Of Medicine And Dentistry Of New Jersey | Inhibition of HIV-1 replication using oligocarbamate derivatives |
| DE19735118C1 (de) | 1997-08-13 | 1998-08-13 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| AU9743398A (en) | 1997-09-16 | 1999-04-05 | Delfts Diagnostic Laboratory B.V. | Detection and identification of human papillomavirus by pcr and type-specific r everse hybridization |
| US6013258A (en) | 1997-10-09 | 2000-01-11 | Zycos Inc. | Immunogenic peptides from the HPV E7 protein |
| AU1232099A (en) | 1997-11-04 | 1999-05-24 | Roche Diagnostics Gmbh | Specific and sensitive method for detecting nucleic acids |
| PT1038022E (pt) | 1997-12-12 | 2005-11-30 | Digene Corp | Avaliacao de doencas relacionadas com o virus papiloma humano |
| US20030096232A1 (en) | 1997-12-19 | 2003-05-22 | Kris Richard M. | High throughput assay system |
| JP4325114B2 (ja) | 1997-12-22 | 2009-09-02 | 日立化成工業株式会社 | オリゴヌクレオチド固定化pcrマイクロプレート上での直接rt−pcr |
| WO1999036571A2 (en) | 1998-01-13 | 1999-07-22 | Biochip Technologies Gmbh | Method for the detection or nucleic acid of nucleic acid sequences |
| US6686151B1 (en) | 1998-02-06 | 2004-02-03 | Digene Corporation | Immunological detection of RNA:DNA hybrids on microarrays |
| US7399589B2 (en) | 1998-02-06 | 2008-07-15 | Digene Corporation | Immunological detection of RNA:DNA hybrids on microarrays |
| US5994079A (en) | 1998-02-06 | 1999-11-30 | Digene Corporation | Direct detection of RNA mediated by reverse transcriptase lacking RNAse H function |
| CA2229955C (en) | 1998-02-20 | 2003-12-09 | Medigene Gmbh | Papilloma virus capsomere vaccine formulations and methods of use |
| US20020039584A1 (en) | 1998-02-20 | 2002-04-04 | Medigene Ag | Papilloma virus capsomere vaccine formulations and methods of use |
| DE69820853T2 (de) | 1998-03-23 | 2004-11-18 | Spal S.R.L., Correggio | Axiallüfter |
| US6183956B1 (en) | 1998-03-31 | 2001-02-06 | Tularik, Incorporated | High throughput in vitro screening assays for transcription modulators |
| US6045993A (en) | 1998-05-30 | 2000-04-04 | Visible Genetics Inc. | Method, reagent and kit for genotyping of human papillomavirus |
| US6284532B1 (en) | 1998-08-17 | 2001-09-04 | Indiana University | Purified human papillomavirus |
| DE19840263C1 (de) | 1998-09-03 | 2000-05-25 | Deutsches Krebsforsch | Papillomviren, Mittel zu deren Nachweis sowie zur Therapie von durch sie verursachten Erkrankungen |
| EP1108035B1 (en) | 1998-09-04 | 2007-08-08 | Sanofi Pasteur Limited | Treatment of cervical cancer |
| US7569344B2 (en) | 1998-10-26 | 2009-08-04 | Ventana Medical Systems, Inc. | Detection of human papilloma virus in papanicolaou (Pap) smears |
| US6951722B2 (en) | 1999-03-19 | 2005-10-04 | Takara Bio Inc. | Method for amplifying nucleic acid sequence |
| US20010055766A1 (en) | 1999-04-02 | 2001-12-27 | Alexander Aristarkhov | Immunosorbant assay using branched bis-biotin/avidin/multiple label complex as a detection reagent |
| AU4051300A (en) | 1999-04-02 | 2000-10-23 | Tropix, Inc. | High throughput and high sensitivity detection assays |
| ID30498A (id) | 1999-04-07 | 2001-12-13 | Sankyo Co | Senyawa-senyawa turunan amina |
| US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| US6420106B1 (en) | 1999-06-09 | 2002-07-16 | Quantovir Ab | Method and kit for early cancer prediction |
| US6200746B1 (en) | 1999-08-25 | 2001-03-13 | Pharmacia & Upjohn Company | Methods of identifying anti-viral agents |
| US7001995B1 (en) | 1999-08-25 | 2006-02-21 | Merck & Co., Inc. | Synthetic human papillomavirus genes |
| US6893819B1 (en) | 2000-11-21 | 2005-05-17 | Stratagene California | Methods for detection of a nucleic acid by sequential amplification |
| DE10009143B4 (de) | 2000-02-26 | 2012-04-26 | Eberhard-Karls-Universität Tübingen Universitätsklinikum | Nachweis von Humanen Papillomviren |
| KR100382703B1 (ko) | 2000-03-15 | 2003-05-09 | 주식회사 바이오메드랩 | 인유두종바이러스의 유전형 진단키트 및 상기 진단키트의제조방법 |
| US6936443B2 (en) | 2000-04-03 | 2005-08-30 | Cytyc Corporation | Detection and typing of human papillomavirus using PNA probes |
| US7510834B2 (en) | 2000-04-13 | 2009-03-31 | Hidetoshi Inoko | Gene mapping method using microsatellite genetic polymorphism markers |
| EP1290225A4 (en) | 2000-05-20 | 2004-09-15 | Univ Michigan | METHOD FOR PRODUCING A DNA BANK BY POSITIONAL REPRODUCTION |
| US6331423B1 (en) | 2000-06-01 | 2001-12-18 | Pe Corporation (Ny) | Isolated human kinase proteins, nucleic acid molecules encoding human kinase proteins, and uses thereof |
| EP1287165B1 (en) | 2000-06-02 | 2007-06-13 | Bayer Corporation | Method for detection and localization of genes in situ using branched-DNA hybridisation |
| US7439016B1 (en) | 2000-06-15 | 2008-10-21 | Digene Corporation | Detection of nucleic acids by type-specific hybrid capture method |
| US7601497B2 (en) | 2000-06-15 | 2009-10-13 | Qiagen Gaithersburg, Inc. | Detection of nucleic acids by target-specific hybrid capture method |
| WO2002010449A2 (en) | 2000-07-28 | 2002-02-07 | Compugen Inc. | Oligonucleotide library for detecting rna transcripts and splice variants that populate a transcriptome |
| US6329152B1 (en) | 2000-11-30 | 2001-12-11 | Bruce K. Patterson | Process for detecting low abundance RNA in intact cells |
| JP2004518421A (ja) | 2000-12-12 | 2004-06-24 | インビトロジェン コーポレイション | 固体マトリックスから核酸分子を解放させるための組成物および方法 |
| EP1368629B1 (en) | 2001-02-16 | 2009-02-11 | Cortex Biochem Inc. | Magnetic isolation and purification of nucleic acids |
| US6670150B1 (en) | 2001-05-10 | 2003-12-30 | Applera Corporation | Isolated human receptor proteins, nucleic acid molecules encoding human receptor proteins, and uses thereof |
| US6884605B2 (en) | 2001-08-09 | 2005-04-26 | Board Of Trustees Of The University Of Arkansas | Compositions, methods and products comprising human papillomavirus for detecting and treating a cancer |
| SI1421200T1 (sl) | 2001-08-23 | 2007-04-30 | Merck & Co Inc | Poskusi PCR fluorescentnih multipleks HPV-jev z uporabo vec fluoroforov |
| KR100452163B1 (ko) | 2001-09-14 | 2004-10-12 | 주식회사 바이오메드랩 | 인유두종 바이러스의 감염을 진단하기 위한 유전형 분석키트 |
| US20050032105A1 (en) | 2001-10-12 | 2005-02-10 | Bair Robert Jackson | Compositions and methods for using a solid support to purify DNA |
| US6977148B2 (en) | 2001-10-15 | 2005-12-20 | Qiagen Gmbh | Multiple displacement amplification |
| EP2272988A3 (en) | 2002-01-07 | 2011-06-15 | Norchip A/S | Method for detecting human papillomavirus mRNA |
| WO2003068933A2 (en) | 2002-02-14 | 2003-08-21 | Novavax, Inc. | Optimization of gene sequences of virus-like particles for expression in insect cells |
| HUP0200981A3 (en) | 2002-03-14 | 2004-06-28 | Genoid Kft | Pcr reactions with hybridizing probes using primers with broad genotype-specificity for detection of human papilloma-viruses and typing amplificates by using specifically hybridizing oligonucleotides |
| CA2484681A1 (en) | 2002-04-16 | 2003-10-23 | Dot Diagnostics B.V. | Human papilloma virus detection with dna microarray |
| US7407807B2 (en) | 2002-05-17 | 2008-08-05 | University Of Cape Town | Chimaeric human papillomavirus 16 I1 virus like particles and a method for preparing the particles |
| WO2004002416A2 (en) | 2002-06-26 | 2004-01-08 | The Penn State Research Foundation | Methods and materials for treating human papillomavirus infections |
| EP1507148B1 (en) | 2003-08-25 | 2005-02-23 | MTM Laboratories AG | Method for detecting carcinomas in a solubilized cervical body sample |
| SE0202896D0 (sv) | 2002-10-01 | 2002-10-01 | Quantovir Ab | Method for estimating the risk of carcinoma development |
| EP1553966B1 (en) | 2002-10-03 | 2012-08-01 | Wyeth Holdings Corporation | Fusion peptides comprising the human papillomavirus e7 and e6 polypeptides and immunogenic compositions thereof |
| CA2512110A1 (en) | 2002-12-31 | 2004-07-22 | Mmi Genomics, Inc. | Compositions, methods, and systems for inferring bovine breed |
| ES2381964T3 (es) | 2003-03-24 | 2012-06-04 | Merck Sharp & Dohme Corp. | Expresión optimizada de L1 de VPH 31 en levadura |
| WO2004087950A2 (en) | 2003-04-04 | 2004-10-14 | Roche Diagnostics Gmbh | Improved system for multi color real time pcr |
| US7129260B2 (en) | 2003-06-02 | 2006-10-31 | Abbott Laboratories | Isoindolinone kinase inhibitors |
| US20040248107A1 (en) | 2003-06-09 | 2004-12-09 | Sokolova Irina A. | Detection of high grade dysplasia in cervical cells |
| JP5183063B2 (ja) | 2003-07-05 | 2013-04-17 | ザ ジョンズ ホプキンス ユニバーシティ | 遺伝的変異の検出および列挙のための方法ならびに組成物 |
| CA2539703C (en) | 2003-09-25 | 2011-06-07 | Third Wave Technologies, Inc. | Detection of human papilloma virus (hpv) utilizing invasive cleavage structure assays |
| MY140664A (en) | 2003-09-29 | 2010-01-15 | Merck Sharp & Dohme | Optimized expression of hpv 45 l1 in yeast |
| US8012944B2 (en) | 2003-10-30 | 2011-09-06 | Pharmascience Inc. | Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent |
| MY139500A (en) | 2003-11-12 | 2009-10-30 | Merck Sharp & Dohme | Optimized expression of hpv 58 l1 in yeast |
| JP2005243132A (ja) | 2004-02-26 | 2005-09-08 | Renesas Technology Corp | 半導体装置 |
| DE602005020913D1 (de) | 2004-03-24 | 2010-06-10 | Merck Sharp & Dohme | Optimierte expression von hpv-52-l1 in hefe |
| CN1690223B (zh) | 2004-04-27 | 2010-05-05 | 亚能生物技术(深圳)有限公司 | 人乳头瘤病毒分型基因芯片检测系统 |
| US7482142B1 (en) | 2004-05-07 | 2009-01-27 | Roche Molecular Systems, Inc. | High-risk human papillomavirus detection |
| ES2564659T3 (es) | 2004-09-30 | 2016-03-28 | Epigenomics Ag | Método para proveer fragmentos de ADN derivados de una muestra archivada |
| US7670774B2 (en) | 2004-10-04 | 2010-03-02 | Goodgene Inc. | Probe of human papillomavirus and DNA chip comprising the same |
| WO2006063065A2 (en) | 2004-12-08 | 2006-06-15 | Gen-Probe Incorporated | Detection of nucleic acids from multiple types of human papillomaviruses |
| WO2006075245A2 (en) | 2005-01-14 | 2006-07-20 | The Regents Of The University Of Michigan | Systems, methods, and compositions for detection of human papilloma virus in biological samples |
| US20060240449A1 (en) | 2005-01-19 | 2006-10-26 | Mcglennen Ronald C | Methods and compositions for preparation of biological samples |
| US7524631B2 (en) | 2005-02-02 | 2009-04-28 | Patterson Bruce K | HPV E6, E7 mRNA assay and methods of use thereof |
| EP1928560A2 (en) | 2005-04-06 | 2008-06-11 | Verenium Corporation | Enzymes and formulations for broad-specificity decontamination of chemical and biological warfare agents |
| WO2006124771A2 (en) | 2005-05-12 | 2006-11-23 | Panomics, Inc. | Multiplex branched-chain dna assays |
| US20080003565A1 (en) | 2006-05-02 | 2008-01-03 | Government Of The Us, As Represented By The Secretary, Department Of Health And Human Services | Viral nucleic acid microarray and method of use |
| CN101460636A (zh) | 2006-05-11 | 2009-06-17 | 伯克顿迪金森公司 | 从细胞中提取蛋白质的方法 |
| JPWO2008139938A1 (ja) | 2007-05-02 | 2010-08-05 | 国立大学法人 東京医科歯科大学 | ヒトパピローマウイルス16型遺伝子を標的とする二本鎖核酸分子及びそれを含む医薬 |
| EP2152902A2 (en) | 2007-06-08 | 2010-02-17 | Epigenomics AG | Method for methylation analysis |
| CN101177701B (zh) | 2007-09-29 | 2010-08-18 | 潮州凯普生物化学有限公司 | 人乳头状瘤病毒基因分型检测试剂盒及其基因芯片制备方法 |
| JP2009106220A (ja) | 2007-10-31 | 2009-05-21 | Genodive Pharma Kk | 基板上での等温増幅反応による標的塩基配列の捕捉及び検出方法 |
| CA2704151C (en) | 2007-11-01 | 2017-04-25 | Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patientenzorg | New detection method for cervical hpvs |
| WO2009123996A2 (en) | 2008-03-31 | 2009-10-08 | The Ohio State University Research Foundation | Hybridization quantitation method for modified micro-rna and -dna based oligonucleotides |
| WO2010004251A1 (en) | 2008-06-16 | 2010-01-14 | Oncomethylome Sciences Sa | Dna methylomes |
| US20100121046A1 (en) | 2008-09-05 | 2010-05-13 | Mayo Foundation For Medical Education And Research | Collecting and processing complex macromolecular mixtures |
| US9090948B2 (en) | 2008-09-30 | 2015-07-28 | Abbott Molecular Inc. | Primers and probes for detecting human papillomavirus and human beta globin sequences in test samples |
| EP2184368A1 (en) | 2008-11-07 | 2010-05-12 | DKFZ Deutsches Krebsforschungszentrum | Diagnostic transcript and splice patterns of HPV16 in different cervical lesions |
| CN102414327B (zh) | 2009-05-01 | 2015-04-08 | 奇亚根盖瑟斯堡股份有限公司 | 用于在样品中检测rna剪接形式的非靶向扩增方法 |
-
2011
- 2011-05-24 US US13/114,344 patent/US9376727B2/en not_active Expired - Fee Related
- 2011-05-24 JP JP2013512140A patent/JP6153866B2/ja not_active Expired - Fee Related
- 2011-05-24 CA CA2799205A patent/CA2799205A1/en not_active Abandoned
- 2011-05-24 AU AU2011258501A patent/AU2011258501B2/en not_active Ceased
- 2011-05-24 WO PCT/US2011/037684 patent/WO2011149897A1/en not_active Ceased
- 2011-05-24 EP EP11726003.4A patent/EP2576840B1/en not_active Not-in-force
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4732847A (en) | 1981-06-09 | 1988-03-22 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
| US4865980A (en) | 1982-12-29 | 1989-09-12 | University Of Hawaii | Monoclonal antibodies for DNA-RNA hybrid complexes and their uses |
| US4743535A (en) | 1984-11-07 | 1988-05-10 | Miles Inc. | Hybridization assay employing labeled probe and anti-hybrid |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US20060275784A1 (en) * | 1999-10-26 | 2006-12-07 | Ventana Medical Systems, Inc. | Detection of Human Papilloma Virus in Papanicolaou (Pap) Smears |
| US20060160069A1 (en) * | 2003-10-07 | 2006-07-20 | Chau Miu F | Methods and compositions for the diagnosis of cancer |
| US20100105060A1 (en) * | 2008-10-27 | 2010-04-29 | Qiagen Gaithersburg Inc. | Fast results hybrid capture assay on an automated platform |
Non-Patent Citations (14)
| Title |
|---|
| COUTLEE ET AL., J. CLIN. MICROBIOL., vol. 27, 1989, pages 1002 - 1007 |
| EDER P S ET AL: "The next-generation Hybrid Capture(R) High-Risk HPV DNA assay on a fully automated platform", JOURNAL OF CLINICAL VIROLOGY, ELSEVIER, AMSTERDAM, NL, vol. 45, 1 July 2009 (2009-07-01), pages S85 - S92, XP026421230, ISSN: 1386-6532, [retrieved on 20090701] * |
| ISHIKAWA ET AL., J. IMMUNOASSAY, vol. 4, 1983, pages 209 - 237 |
| JAKOBOVITS ET AL., NATURE, vol. 362, 1993, pages 255 |
| JAKOBOVITS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 2551 |
| KARLIN, ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 2264 |
| KITAWAGA ET AL., MOL. IMMUNOLOGY, vol. 19, 1982, pages 413 |
| LORINCZ: "Hybrid Capture Method for Detection of Human Papillomavirus DNA in Clinical Specimens: A Tool for Clinical Management of Equivocal Pap Smears and for Population Screening", JOURNAL OF OBSTETRICS AND GYNAECOLOGY RESEARCH, WILEY-BLACKWELL PUBLISHING ASIA, JP, vol. 22, no. 6, 1 December 1996 (1996-12-01), pages 629 - 636, XP009148904, ISSN: 1341-8076, DOI: DOI:10.1111/J.1447-0756.1996.TB01081.X * |
| LOWE BRIAN ET AL: "HPV genotype detection using hybrid capture sample preparation combined with whole genome amplification and multiplex detection with Luminex XMAP", JOURNAL OF MOLECULAR DIAGNOSTICS, AMERICAN SOCIETY FOR INVESTIGATIVE PATHOLOGY, BETHESDA, MD, US, vol. 12, no. 6, 1 November 2010 (2010-11-01), pages 847 - 853, XP008139846, ISSN: 1525-1578, [retrieved on 20100916], DOI: DOI:10.2353/JMOLDX.2010.100045 * |
| M. POLJAK ET AL: "Human Papillomavirus Genotype Specificity of Hybrid Capture 2 Low-Risk Probe Cocktail", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 47, no. 8, 1 August 2009 (2009-08-01), pages 2611 - 2615, XP055003767, ISSN: 0095-1137, DOI: 10.1128/JCM.00278-09 * |
| MEANS ET AL., CHEM., vol. 1, 1990, pages 2 - 12 |
| PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 |
| ROUILLARD ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages 3057 - 3062 |
| STOLER ET AL: "In situ hybridization detection of human papillomavirus DNAs and messenger RNAs in genital condylomas and a cervical carcinoma", HUMAN PATHOLOGY, SAUNDERS, PHILADELPHIA, PA, US, vol. 17, no. 12, 1 December 1986 (1986-12-01), pages 1250 - 1258, XP022319080, ISSN: 0046-8177, DOI: DOI:10.1016/S0046-8177(86)80569-X * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020140974A1 (en) * | 2019-01-03 | 2020-07-09 | Hangzhou New Horizon Health Technology Co. Ltd. | Compositions and methods for detecting human papillomavirus |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2799205A1 (en) | 2011-12-01 |
| JP2013534810A (ja) | 2013-09-09 |
| US20120004128A1 (en) | 2012-01-05 |
| JP6153866B2 (ja) | 2017-06-28 |
| AU2011258501B2 (en) | 2016-07-07 |
| US9376727B2 (en) | 2016-06-28 |
| AU2011258501A1 (en) | 2013-01-10 |
| EP2576840B1 (en) | 2018-10-17 |
| EP2576840A1 (en) | 2013-04-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8877436B2 (en) | Fast results hybrid capture assay on an automated platform | |
| JP6104296B2 (ja) | 標的核酸の存在を判別するための合成プローブを用いた組成物、方法、およびキット | |
| US9689047B2 (en) | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids | |
| AU2012220575A1 (en) | Materials and methods for detection of HPV nucleic acid | |
| EP2529031B1 (en) | Method of determining and confirming the presence of hpv in a sample | |
| AU2011258501B2 (en) | Fast results hybrid capture assay and associated strategically-truncated probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11726003 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2799205 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2013512140 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011726003 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2011258501 Country of ref document: AU Date of ref document: 20110524 Kind code of ref document: A |