WO2011020783A2 - Targeted immunoconjugates - Google Patents

Targeted immunoconjugates Download PDF

Info

Publication number
WO2011020783A2
WO2011020783A2 PCT/EP2010/061810 EP2010061810W WO2011020783A2 WO 2011020783 A2 WO2011020783 A2 WO 2011020783A2 EP 2010061810 W EP2010061810 W EP 2010061810W WO 2011020783 A2 WO2011020783 A2 WO 2011020783A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
immunoconjugate
sequence
antigen binding
immuno conjugate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/061810
Other languages
English (en)
French (fr)
Other versions
WO2011020783A3 (en
Inventor
Ralf Hosse
Ekkehard Moessner
Michela Silacci-Melkko
Pablo Umana
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Roche Glycart AG
Original Assignee
Roche Glycart AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43033282&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011020783(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CN201080046453.8A priority Critical patent/CN102573922B/zh
Priority to AU2010285071A priority patent/AU2010285071A1/en
Priority to MX2012002014A priority patent/MX2012002014A/es
Application filed by Roche Glycart AG filed Critical Roche Glycart AG
Priority to ES10744911.8T priority patent/ES2534085T3/es
Priority to BR112012003739-0A priority patent/BR112012003739A2/pt
Priority to EP10744911.8A priority patent/EP2467165B1/en
Priority to JP2012525147A priority patent/JP5764127B2/ja
Priority to SG2012010690A priority patent/SG178443A1/en
Priority to CA2769619A priority patent/CA2769619C/en
Priority to RU2012110127/10A priority patent/RU2583876C2/ru
Priority to HK12110035.2A priority patent/HK1169318B/xx
Publication of WO2011020783A2 publication Critical patent/WO2011020783A2/en
Publication of WO2011020783A3 publication Critical patent/WO2011020783A3/en
Priority to MA34588A priority patent/MA33717B1/fr
Priority to IL217844A priority patent/IL217844A0/en
Priority to ZA2012/00767A priority patent/ZA201200767B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6813Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin the drug being a peptidic cytokine, e.g. an interleukin or interferon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6843Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6871Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting an enzyme
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/74Inducing cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention generally relates to antigen-specific immunoconjugates for selectively delivering effector moieties that influence cellular activity.
  • the present invention relates to nucleic acid molecules encoding such immunoconjugates, and vectors and host cells comprising such nucleic acid molecules.
  • the invention further relates to methods for producing the immunoconjugates of the invention, and to methods of using these immunoconjugates in the treatment of disease.
  • the selective destruction of an individual cell or a specific cell type is often desirable in a variety of clinical settings. For example, it is a primary goal of cancer therapy to specifically destroy tumor cells, while leaving healthy cells and tissues intact and undamaged. A multitude of signal transduction pathways in the cell are linked to the cell's survival and/or death. Accordingly, the direct delivery of a pathway factor involved in cell survival or death can be used to contribute to the cell's maintenance or destruction.
  • Cytokines are cell signaling molecules that participate in regulation of the immune system. When used in cancer therapy, cytokines can act as immunomodulatory agents that have antitumor effects and which can increase the immunogenicity of some types of tumors.
  • cytokines can act as immunomodulatory agents that have antitumor effects and which can increase the immunogenicity of some types of tumors.
  • rapid blood clearance and lack of tumor specificity require systemic administration of high doses of the cytokine in order to achieve a concentration of the cytokine at the tumor site sufficient to activate an immune response or have an anti-tumor effect. These high levels of systemic cytokine can lead to severe toxicity and adverse reactions.
  • a signal transduction pathway factor such as a cytokine
  • a specific site in vivo e.g., a tumor or tumor micro environment
  • conjugate the factor to an immunoglobulin specific for the site.
  • immunoglobulin heavy chains conjugated to various cytokines including lymphotoxin, tumor necrosis factor- ⁇ (TNF- ⁇ ), interleukin-2 (IL-2), and granulocyte macrophage-colony stimulating factor (GM-CSF).
  • TNF- ⁇ tumor necrosis factor- ⁇
  • IL-2 interleukin-2
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • the immunoglobulin heavy chains were either chemically conjugated to a cytokine or the immunogobulin-cytokine conjugate was expressed as a fusion protein. See Nakamura K. and Kubo, A. Cancer Supplement 80:2650-2655 (1997); Jun, L. et al, Chin. Med. J. 775:151-153 (2000); and Becker J.C., et al, Proc. Natl. Acad. ScL USA £5:7826-7831 (1996).
  • immunoglobulin-cytokine immuno conjugates can activate complement and interact with Fc receptors. This inherent immunoglobulin feature has been viewed unfavorably because therapeutic immuno conjugates may be targeted to cells expressing Fc receptors rather than the preferred antigen-bearing cells.
  • One approach to overcoming these problems is the use of engineered immunoglobulin fragments. Numerous studies have detailed the characteristics of immunoglobulin fragment- cytokine immunoconjugates. See Savage, P. et al, Br. J. Cancer (57:304-310 (1993); Harvill, E. T. and Morrison S. L., Immunotechnol 7:95-105 (1995); and Yang J. et al, MoI Immunol.
  • immunoglobulin fragment-cytokine immunoconjugates include the scFv-IL-2 immuno conjugate as set forth in PCT publication WO 2001/062298 A2; the immunoglobulin heavy chain fragment-GM-CSF immuno conjugate as set forth in U.S. Pat. No. 5,650,150; the immuno conjugate as set forth in PCT publication WO 2006/119897 A2, wherein scFv-IL-12 first subunit shares only disulfide bond(s) with IL- 12 second subunit-scFv, and the immuno conjugate as described in PCT publication WO 99/29732 A2, wherein Ig heavy chain fragment-IL-12 first subunit shares only disulfide bond(s) with Ig heavy chain fragment-IL-12 second subunit.
  • the present invention provides immuno conjugates that exhibit improved efficacy, high specificity of action, reduced toxicity, and improved stability in blood relative to known immuno conjugates .
  • One aspect of the present invention is directed to immuno conjugates that exhibit improved efficacy, high specificity of action, reduced toxicity and improved stability as compared to known immuno conjugates.
  • the immunoconjugates of the present invention can be used to selectively deliver effector moieties to a target site in vivo.
  • the immuno conjugate delivers a cytokine to a target site, wherein the cytokine can exert a localized biological effect, such as a local inflammatory response, stimulation of T cell growth and activation, and/or activation of B and/or NK cells.
  • One aspect of the present invention relates to an immuno conjugate that comprises at least a first effector moiety and at least a first and a second antigen binding moiety independently selected from the group consisting of an Fv and an Fab, wherein a first effector moiety shares an amino- or carboxy-terminal peptide bond with a first antigen binding moiety and a second antigen binding moiety shares an amino- or carboxy-terminal peptide bond with either i) the first effector moiety or ii) the first antigen binding moiety.
  • Another aspect of the present invention is an immuno conjugate that comprises at least a first single-chain effector moiety joined at its amino -terminal amino acid to one or more scFv molecules and wherein the first-single-chain effector moiety is joined at its carboxy-terminal amino acids to one or more scFv molecules.
  • Another aspect of the present invention is an immuno conjugate that comprises at least a first single-chain effector moiety and first and second antigen binding moieties, wherein each of the first and second antigen binding moieties comprises an scFv molecule joined at its carboxy- terminal amino acid to a constant region comprising a immunoglobulin constant domain independently selected from the group consisting of: IgG CHl, IgG Ck apP a, and IgE CH4, and wherein the first antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • Another aspect of the present invention is an immuno conjugate that comprises at least a first single-chain effector moiety and first and second antigen binding moieties, wherein each of the first and second antigen binding moieties comprises an scFv molecule joined at its carboxy- terminal amino acid to an IgGl CH3 domain, and wherein the first antigen binding moiety is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • Another aspect of the present invention is directed to an immuno conjugate that comprises first and second single-chain effector moieties and first and second antigen binding moieties, wherein each of the antigen binding moieties comprises an Fab molecule joined at its heavy or light chain carboxy-terminal amino acid to an IgGl CH3 domain, and wherein each of the IgGl CH3 domains is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 95. In another embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 104. In another embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 105. In another embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 106. In another embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 107. In another embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 96. In a further embodiment, the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 96 and a polypeptide sequence selected from the group consisting of SEQ ID NOs: 95 and 104-107.
  • the immuno conjugate comprises a polypeptide having a sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 95, 96, and 104-107.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 108.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 108.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 117.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 117. In one embodiment, the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 118. In another embodiment, the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 118.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 119. In another embodiment, the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 119. In one embodiment, the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 120.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 120. In one embodiment, the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 109. In another embodiment, the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 109.
  • the immunoconjugate comprises a heavy chain variable region that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 13 or SEQ ID NO: 15.
  • the immunoconjugate comprises a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 9 or SEQ ID NO: 11.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 13 or SEQ ID NO: 15, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 9 or SEQ ID NO: 11.
  • the immuno conjugate comprises a heavy chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 14 or SEQ ID NO: 16. In another embodiment, the immuno conjugate comprises a heavy chain variable region sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 14 or SEQ ID NO: 16. In one embodiment, the immuno conjugate comprises a light chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 10 or SEQ ID NO: 12. In another embodiment, the immunoconjugate comprises a light chain variable region sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 10 or SEQ ID NO: 12.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 99. In another embodiment, the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 100 or SEQ ID NO: 215. In another embodiment, the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 101 or SEQ ID NO: 235.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 100, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 101.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 215, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 235.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 112. In another embodiment, the immunoconjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of SEQ ID NO: 112. In one embodiment, the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 113 or SEQ ID NO: 216.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 113 or SEQ ID NO: 216. In one embodiment, the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 114 or SEQ ID NO: 236. In another embodiment, the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 114 or SEQ ID NO: 236.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO:195, SEQ ID NO: 199, SEQ ID NO: 203 and SEQ ID NO: 207.
  • the immunoconjugate comprises a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:185, SEQ ID NO: 189, SEQ ID NO: 193, SEQ ID NO: 197, SEQ ID NO: 201 and SEQ ID NO: 205.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO:195, SEQ ID NO: 199, SEQ ID NO: 203 and SEQ ID NO: 207 and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:185, SEQ ID NO: 189, SEQ ID NO: 193, SEQ ID NO: 197, SEQ ID NO: 201 and SEQ ID NO: 205.
  • the immunoconjugate comprises a heavy chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 8, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204 and SEQ ID NO: 208.
  • the immunoconjugate comprises a heavy chain variable region sequence that is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 8, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204 and SEQ ID NO:
  • the immuno conjugate comprises a light chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 178, SEQ ID NO: 182, SEQ ID NO: 186, SEQ ID NO: 190, SEQ ID NO: 194, SEQ ID NO: 198, SEQ ID NO: 202 and SEQ ID NO: 206.
  • the immuno conjugate comprises a light chain variable region sequence that is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 178, SEQ ID NO: 182, SEQ ID NO: 186, SEQ ID NO: 190, SEQ ID NO: 194, SEQ ID NO: 198, SEQ ID NO: 202 and SEQ ID NO: 206.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 239, SEQ ID NO: 241 and SEQ ID NO: 243.
  • the conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 245, SEQ ID NO: 247 and SEQ ID NO:249.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 239, SEQ ID NO: 241 and SEQ ID NO: 243, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 245, SEQ ID NO: 247 and SEQ ID NO:249.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 240, SEQ ID NO: 242 and SEQ ID NO: 244.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 240, SEQ ID NO: 242 and SEQ ID NO: 244.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 246, SEQ ID NO: 248 and SEQ ID NO: 250.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence selected from the group of SEQ ID NO: 246, SEQ ID NO: 248 and SEQ ID NO: 250.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group consisting of: SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 69, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 93, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO:
  • the immunoconjugate comprises a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group consisting of: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 121, SEQ ID NO: 125, SEQ ID NO: 129, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 141, SEQ ID NO: 145, SEQ ID NO: 149, SEQ ID NO: 153, SEQ ID NO: 157, S
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group consisting of: SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 69, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 93, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159,
  • the immunoconjugate comprises a heavy chain variable region sequence that is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group consisting of: SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 78, SEQ ID NO: 82, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO:
  • the immunoconjugate comprises a heavy chain variable region sequence that is encoded by a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 78, SEQ ID NO: 82, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172 and
  • the immunoconjugate comprises a light chain variable region sequence that is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 122, SEQ ID NO: 126, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 142, SEQ ID NO: 146, SEQ ID NO: 150, SEQ ID NO: 154
  • the immunoconjugate comprises a light chain variable region sequence that is encoded by a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 122, SEQ ID NO: 126, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 142, SEQ ID NO: 146, SEQ ID NO: 150, SEQ ID NO: 154, SEQ ID NO: 158, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 170 and S
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225 and SEQ ID NO: 227.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233 and SEQ ID NO: 237.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 211, SEQ ID NO: 219, and SEQ ID NO: 221, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 231.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from the group of SEQ ID NO: 209, SEQ ID NO: 223, SEQ ID NO: 225 and SEQ ID NO: 227, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 229.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 213, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 233.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 217, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 237.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226 and SEQ ID NO: 228.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226 and SEQ ID NO: 228.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234 and SEQ ID NO: 238.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234 and SEQ ID NO: 238.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 257 or SEQ ID NO: 261.
  • the immunoconjugate comprises a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 259 or SEQ ID NO: 271.
  • the immunoconjugate comprises a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to to the sequence of either SEQ ID NO: 257 or SEQ ID NO: 261, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 259 or SEQ ID NO: 271.
  • the immunoconjugate comprises a heavy chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 258 or SEQ ID NO: 262.
  • the immunoconjugate comprises a heavy chain variable region sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 258 or SEQ ID NO: 262.
  • the immunoconjugate comprises a light chain variable region sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 260 or SEQ ID NO: 272.
  • the immunoconjugate comprises a light chain variable region sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 260 or SEQ ID NO: 272.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 251 or SEQ ID NO: 255. In another embodiment, the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 253 or SEQ ID NO: 265.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 251 or SEQ ID NO: 255, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of either SEQ ID NO: 253 or SEQ ID NO: 265.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 252 or SEQ ID NO: 256.
  • the immuno conjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 252 or SEQ ID NO: 256.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 254 or SEQ ID NO: 266.
  • the immunoconjugate comprises a polypeptide sequence that is encoded by the polynucleotide sequence of either SEQ ID NO: 254 or SEQ ID NO: 266.
  • the immunoconjugate comprises at least one effector moiety, wherein the effector moiety is a cytokine.
  • the effector moiety is a cytokine selected from the group consisting of: interleukin-2 (IL-2), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon- ⁇ (INF- ⁇ ), interleukin-12 (IL- 12), interleukin-8 (IL-8), macrophage inflammatory protein- l ⁇ (MIP- l ⁇ ), macrophage inflammatory protein- l ⁇ (MIP- l ⁇ ), and transforming growth factor- ⁇ (TGF- ⁇ ).
  • IL-2 interleukin-2
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • INF- ⁇ interferon- ⁇
  • IL-12 interleukin-12
  • IL-8 interleukin-8
  • MIP- l ⁇ macrophage inflammatory protein- l ⁇
  • MIP- l ⁇ macrophage inflammatory protein- l
  • At least one antigen binding moiety is specific for one of the following antigenic determinants: the Extra Domain B of fibronectin (EDB), the Al domain of tenascin (TNC-Al), the A2 domain of tenascin (TNC-A2), the Fibroblast Activated Protein (FAP); and the Melanoma Chondroitin Sulfate Proteoglycan (MCSP).
  • EDB Extra Domain B of fibronectin
  • TMCSP Melanoma Chondroitin Sulfate Proteoglycan
  • the immunoconjugate of the invention binds to an effector moiety receptor with a dissociation constant (K D ) that is at least about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 or 10 times greater than that for a control effector moiety.
  • the immunoconjugate inhibits an increase in tumor volume in vivo by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more at the end of an administration period.
  • the immunoconjugate prolongs the survival of mammals with malignant tumors by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% when administered to a mammal in need thereof, relative to a control effector moiety or an effector moiety in a "diabody" immunoconjugate molecule.
  • Another aspect of the present invention is directed to isolated polynucleotides encoding immuno conjugates of the invention or fragments thereof.
  • Another aspect of the present invention is directed to an expression vector comprising an expression cassette comprising the polynucleotide sequences of the invention.
  • Another aspect of the present invention is directed to host cells that express the immuno conjugates of the invention or fragments thereof.
  • Another aspect of the present invention is directed to methods for producing the immuno conjugates of the invention or fragments thereof, wherein the method comprises culturing host cells transformed with expression vectors encoding for the immuno conjugates of the invention or fragments thereof under conditions suitable for the expression of the same.
  • Another aspect of the present invention is directed to methods for promoting proliferation and differentiation in an activated T lymphocyte cell, comprising contacting an activated T lymphocyte cell with an effective amount of the immuno conjugates of the invention.
  • Another aspect of the present invention is directed to methods for promoting proliferation and differentiation in an activated B lymphocyte cell, comprising contacting an activated B lymphocyte cell with an effective amount of the immuno conjugates of the invention.
  • Another aspect of the present invention is directed to methods for promoting proliferation and differentiation in a natural killer (NK) cell, comprising contacting a NK cell with an effective amount of the immuno conjugates of the invention.
  • NK natural killer
  • Another aspect of the present invention is directed to methods for promoting proliferation and differentiation in a granulocyte, a monocyte or a dendritic cell, comprising contacting a granulocyte, a monocyte or a dendritic cell with an effective amount of the immuno conjugates of the invention.
  • Another aspect of the present invention is directed to methods for promoting cytotoxic T lymphocyte (CTL) differentiation, comprising contacting a T lymphocyte cell with an effective amount of the immuno conjugates of the invention.
  • CTL cytotoxic T lymphocyte
  • Another aspect of the present invention is directed to methods for inhibiting viral replication, comprising contacting a virus-infected cell with an effective amount of the immuno conjugates of the invention.
  • Another aspect of the present invention is directed to methods for upregulating the expression of major histocompatibility complex I (MHC I), comprising contacting a target cell with an effective amount of the immuno conjugates of the invention.
  • MHC I major histocompatibility complex I
  • Another aspect of the present invention is directed to methods for inducing cell death, comprising administering to a target cell an effective amount of the immuno conjugates of the invention.
  • Another aspect of the present invention is directed to methods for inducing chemotaxis in a target cell, comprising administering to a target cell an effective amount of the immuno conjugate of the invention.
  • Another aspect of the present invention is directed to a method of treating a disease in an individual, comprising the steps of administering to an individual a therapeutically effective amount of a composition comprising the immuno conjugate of the invention and a pharmaceutical carrier.
  • FIGURE 1 Schematic overview of the various immuno conjugate fusion formats. All constructs in FIGURE 1 comprise two antibody scFv fragments (in the antigen binding moiety), and one or two cytokine molecules (as the effector moieties) connected to it. Panels A to E show different connectivities and stoichiometries of the antigen binding moieties and effector moieties. Panel A) depicts a "diabody”-IL-2 fusion. The "diabody” assembles non-covalently from two identical polypeptide chains.
  • Panel B shows an immuno conjugate comprising a heavy chain of an Fab molecule fused at its carboxy-terminus to a cytokine which, in turn, is fused at its carboxy- terminus to a second Fab heavy chain.
  • a light chain is co expressed with the heavy chain Fab- cytokine-heavy chain Fab polypeptide to form the immuno conjugate.
  • the two light chains can be fused to the cytokine, and the heavy chains are coexpressed.
  • the two Fab heavy chains are fused directly to each other.
  • the cytokine shares an amino -terminal peptide bond with the second antigen binding moiety heavy chain.
  • the two molecular formats of panels B and C can be varied such that the Fab chain is replaced by an scFv fragment, as in panels D and E.
  • FIGURE 2 Schematic overview of additional immuno conjugates that comprise two antigen binding moieties and at least one or more effector moieties.
  • Panel A shows a Fab molecule fused through its carboxy-terminus to an IgG CH3 domain.
  • an artificial disulfide bond can be introduced at the carboxy- terminus of the IgG CH3 domain (immunoconjugate on the right within panel A.
  • the IgGl CH3 domain shown in panel A can be substituted with an IgE CH4 domain.
  • the Fab moieties in panel A are replaced by scFv fragments in panel B.
  • the natural IgG hinge was fused C-terminal to the Fab molecules. Since the carboxy-terminus region of the hinge could impose some geometric constraints on the assembly of constant domains that are fused C-terminal to the IgG hinge region, an artificial linker can be introduced between the carboxy-terminal region of the hinge and the amino -terminus of the IgG CH3 domain.
  • the hinge region can also be introduced between a scFv fragment and an immunoglobulin constant domain, as shown in panel D.
  • an IgGl CH3 or IgE CH4 domain is used to homodimerize the constructs.
  • Panel E depicts an immuno conjugate in which dimerization is achieved via a CHl/Ck apP a hetero dimerization interaction.
  • the immunoconjugate of panel D can have one or two cytokines per immunoconjugate.
  • FIGURE 3 presents the results of an efficacy experiment with two different interleukin-2 immunoconjugate molecular formats specific for tumor stroma.
  • the F9 teratocarcinoma was subcutaneously injected into 129SvEv mice, and tumor size was measured using a caliper.
  • the "diabody"-IL-2 molecule was compared at two different concentrations to the Fab-interleukin-2- Fab (Fab-IL2-Fab) immunoconjugate, wherein the concentrations reflected similar numbers of immunoconjugate molecules.
  • the Fab-IL2-Fab immunoconjugate is labeled as "Fab-L19"
  • the unconjugated interleukin-2 control is labeled as "Unconj rIL-2”
  • the "diabody”-IL-2 molecule is labeled as “diabody” in FIGURE 3.
  • the Ll 9 antibody, directed against Extra Domain B of fibronectin (EDB) was used to generate the antigen binding moieties in both the diabody and the Fab-L19 immuno conjugates.
  • the amount of immunoconjugate injected per mouse is indicated in the figure legend.
  • FIGURE 4 presents the results of a survival experiment with two different interleukin-2 immunoconjugate molecular formats specific for tumor stroma.
  • Human gastric tumor cell-line LS174T was intrasplenically injected into SCID-beige mice.
  • the Fab-IL2-Fab immunoconjugate is labeled as "Fab-L19”
  • the unconjugated interleukin-2 control is labeled as "Unconj rIL-2”
  • the "diabody”-IL-2 molecule is labeled as "diabody” in FIGURE 4.
  • the anti-EDB antibody, L19 was used to generate the antigen binding moieties in both the diabody and the Fab-L19 immuno conjugates.
  • the amount of immunoconjugate injected per mouse is indicated in the figure legend, and reflects same numbers of immunoconjugate molecules.
  • FIGURE 5 shows immuno histochemical images of human uterus tissue at IOOX and 400X magnification.
  • the 2B10 variable region generated by the methods described in Example 3 binds to the A2 domain of human tenascin (TNC-A2).
  • the 2B10 variable region in a Fab fragment was fused to a FLAG fragment (SHD2B10-FLAG).
  • Healthy and cancerous human uterine tissue samples were prepared for immunohistochemical staining. Subsequently, the samples were incubated with the SHD2B10-FLAG Fab fragment. The samples were then washed and incubated with a fluorescent antibody specific for the FLAG epitope. Cancerous tissue samples exhibited higher expression levels of TNC-A2 as compared to the healthy tissue samples.
  • FIGURE 6 shows the expression levels of TNC-A2 in various human tissue samples in terms of % of immunofluorescence surface area.
  • Various human tissue samples from healthy individuals and cancer patients were incubated with the SHD2B10-FLAG Fab fragment as described in FIGURE 5.
  • FIGURE 7 shows the expression levels of Fibroblast Activated Protein (FAP) in various human tissue samples in terms of % of immunofluorescence surface area.
  • FAP Fibroblast Activated Protein
  • FIGURE 8 presents BIACORE data showing the affinity of a known IgG antibody, L 19, for EDB.
  • FIGURE 9 presents BIACORE data showing the affinity of an Fab-IL-2-Fab immuno conjugate specific for EDB.
  • the Fab fragments in the immuno conjugate were derived from the L19 antibody.
  • FIGURE 10 presents BIACORE data showing the affinity of a "diabody”-IL2 fusion protein specific for EDB.
  • the diabody scFv fragment was derived from the L19 antibody.
  • the "diabody”-IL2 fusion protein includes an 8 amino acid linker located between the scFv fragment and the IL-2 molecule.
  • FIGURE 11 presents BIACORE data showing the affinity of a "diabody”-IL2 fusion protein specific for EDB.
  • the diabody scFv fragment was derived from the L19 antibody.
  • the "diabody”-IL2 fusion protein includes a 12 amino acid linker between the scFv fragment and the IL-2 molecule
  • FIGURE 12 presents BIACORE data showing the affinity of a known IgG antibody, F 16, for immobilized domain Al of tenascin (TNC-Al).
  • FIGURE 12 also presents BIACORE data showing the affinity of an Fab fragment of the Fl 6 antibody for TNC-Al. Dissociation constants (K D ) calculated for the F16 IgG and Fab molecules are indicated in the figure.
  • FIGURE 13 presents BIACORE data showing the affinity of IL-2 for immobilized IL-2 receptor.
  • Heterodimerization of the ⁇ and ⁇ chains of IL-2R was achieved by fusing the respective chains to the "knob-into-holes" variants of the Fc portion of a human IgGl as described in Merchant, A.M. et ah, Nat. Biotech. 16:677-681 (1998).
  • the K D value calculated from the BIACORE data is indicated in the figure.
  • FIGURE 14 presents BIACORE data showing the affinity of a "diabody"-IL-2 fusion protein for TNC-Al and IL-2 receptor.
  • the scFv molecule in the diabody is derived from the F16 antibody.
  • the K D values calculated from the BIACORE data are indicated in the figure.
  • FIGURE 15 presents BIACORE data showing the affinity of an Fab-IL-2-Fab immuno conjugate for TNC-Al and IL-2 receptor.
  • the Fab molecules in the immunoconjugate were derived from the Fl 6 antibody.
  • the K D values calculated from the BIACORE data are indicated in the figure.
  • FIGURE 16 presents BIACORE data showing the affinity of an scFv-IL-2-scFv immunoconjugate for TNC-Al and IL-2 receptor.
  • the scFv molecules in the immunoconjugate were derived from the Fl 6 antibody.
  • the K D values calculated from the BIACORE data are indicated in the figure.
  • FIGURE 17 is a summary table of the K D values obtained from the BIACORE studies presented in Figures 12-16.
  • FIGURE 18 presents the results of an efficacy experiment comparing the "diabody” -IL-2 molecule targeting the EDB domain of fibronectin to the Fab-inter leukin-2-Fab immunoconjugate (labeled as "Fab-SH2B10", comprising the heavy and light chain variable regions of SEQ ID NOs: 3 and 7, respectively) targeting the A2 domain of tenascin C.
  • the unconjugated interleukin-2 control is labeled as "Unconj rIL-2”
  • the "diabody” -IL-2 molecule is labeled as "L 19 diabody” in FIGURE 18.
  • the anti-EDB antibody, L 19, was used to generate the antigen binding moiety in the diabody immunoconjugate.
  • the terato carcinoma cell-line F9 was subcutaneously injected into immunocompetent mice of the 129 strain.
  • the amount of immunoconjugate injected per mouse (in ⁇ g) is indicated in the figure legend. Treatment was started at day 6 and 5 injections were performed in total until day 11 of the experiment.
  • FIGURE 19 shows the induction of proliferation of NK-92 cells by anti-FAP, or anti-tenascin C, Fab-IL2-Fab immuno conjugates (generated using the V H and V L sequences of the 3F2, 3D9, 4B3 (anti-FAP), 2Fl 1, and 2B10 constructs (anti-tenascin C)) compared to unconjugated human IL-2.
  • Cell proliferation was measured using the CeIlT iter GIo system after two days of incubation.
  • FIGURE 20 presents the results of an ELISA assay measuring induction of IFN- ⁇ production by various interleukin-12 containing immuno conjugates compared either to unconjugated cytokines, or to immunoconjugates that contain the p35 and p40 domains of IL-12 in separate molecules.
  • Panel A shows the results on fibronectin coated plates.
  • Panel B shows the results in solution.
  • FIGURE 21 shows Surface Plasmon Resonance (SPR)-based kinetic analyses of affinity- matured anti-FAP Fab fragments.
  • SPR Surface Plasmon Resonance
  • FIGURE 22 shows SPR-based kinetic analyses of affinity-matured anti-FAP Fab fragments.
  • Processed kinetic data sets are presented for clone 5B8 binding to hu FAP (A) and mu FAP (B), for clone 5Fl binding to hu FAP (C), mu FAP (D) and for clone 14B3 binding to hu FAP (E) and mu FAP (F).
  • Smooth lines represent a global fit of the data to a 1 : 1 interaction model.
  • FIGURE 23 shows SPR-based kinetic analyses of affinity-matured anti-FAP Fab fragments.
  • Processed kinetic data sets are presented for clone 16Fl binding to hu FAP (A) and mu FAP (B), for clone 16F8 binding to hu FAP (C), mu FAP (D) and for clone O3C9 binding to hu FAP (E) and mu FAP (F).
  • Smooth lines represent a global fit of the data to a 1 : 1 interaction model.
  • FIGURE 24 shows SPR-based kinetic analyses of affinity-matured anti-FAP Fab fragments.
  • Processed kinetic data sets are presented for clone O2D7 binding to hu FAP (A) and mu FAP (B), for clone 28Hl binding to hu FAP (C), mu FAP (D), cyno FAP (E) and for clone 22 A3 binding to hu FAP (F), mu FAP (G) and Cynomolgus (cyno) FAP (H). Smooth lines represent a global fit of the data to a 1 : 1 interaction model.
  • FIGURE 25 shows SPR-based kinetic analyses of affinity-matured anti-FAP Fab fragments.
  • Processed kinetic data sets are presented for clone 29Bl 1 binding to hu FAP (A), mu FAP (B), cyno FAP (C) and for clone 23C10 binding to hu FAP (D), mu FAP (E) and cyno FAP (F).
  • Smooth lines represent a global fit of the data to a 1 : 1 interaction model.
  • FIGURE 26 shows SPR-based kinetic analyses of affinity-matured anti-TNC A2 Fab fragments binding to human (hu) TNC A2.
  • Processed kinetic data sets are presented for clone 2B10 C3B6 (A), clone 2Bl 0 6Al 2 (B), clone 2B10 C3A6 (C), clone 2B10 O7D8 (D), clone 2B10 O1F7 (E) and clone 2B10 6H10 (F).
  • Smooth lines represent a global fit of the data to a 1 :1 interaction model.
  • FIGURE 27 gives an overview of the three purification steps performed for the purification of 3F2-based Fab-IL2-Fab.
  • FIGURE 28 shows results from the purification of 3F2 -based Fab-IL2-Fab (A and B) and results from the purification of 4G8-based Fab-IL2-Fab (C and D).
  • A, C 4-12% Bis-Tris and 3-8% Tris Acetate SDS-PAGE with fractions during the purification procedure and the end product.
  • B, D Analytical size exclusion chromatography after the three applied purification steps.
  • FIGURE 29 shows results from the purification of the 2B10 Fab-IL2-Fab immunoconjugate.
  • FIGURE 30 shows the stability assessment of anti-fibronectin EDB L19-based Fab-IL2-Fab.
  • L19 Fab-IL2-Fab was formulated in 20 mM histidine HCl, 140 mM NaCl, pH 6.0 at a concentration of 6.3 mg/ml and stored for 4 weeks at room temperature and at 4°C. Samples were analyzed every week for (A) concentration by UV spectroscopy (after centrifugation to pellet potential precipitated material) and (B) aggregate content by analytical size exclusion chromatography.
  • FIGURE 31 shows SPR-based kinetic analyses of FAP-targeted 3F2 Fab-IL2-Fab immuno conjugates for human, murine and Cynomolgus (cyno) FAP and human IL-2 receptor- ⁇ / ⁇ (IL2R bg) as determined by Surface Plasmon Resonance. Smooth lines represent a global fit of the data to a 1:1 interaction model.
  • FIGURE 32 shows SPR-based kinetic analyses of FAP-targeted 4G8 Fab-IL2-Fab immuno conjugates for human, murine and Cynomolgus (cyno) FAP as determined by Surface
  • FIGURE 33 shows SPR-based kinetic analyses of FAP-targeted 4G8 Fab-IL2-Fab constructs for human and murine IL-2 receptor ⁇ / ⁇ and ⁇ chains, as determined by Surface Plasmon Resonance.
  • FIGURE 34 shows SPR-based kinetic analyses of FAP-targeted 3D9 Fab-IL2-Fab constructs for human, murine and Cynomolgus (cyno) FAP and human IL-2 receptor- ⁇ / ⁇ (IL2R bg) as determined by Surface Plasmon Resonance. Smooth lines represent a global fit of the data to a
  • FIGURE 35 shows SPR-based kinetic analyses of TNC A2-targeted 2B10 Fab-IL2-Fab constructs for human, murine and Cynomolgus (cyno) chimeric TNC A2 fusion proteins and human IL-2 receptor- ⁇ / ⁇ (IL2R bg) as determined by Surface Plasmon Resonance. Smooth lines represent a global fit of the data to a 1 : 1 interaction model.
  • FIGURE 36 illustrates the efficacy of targeted IL-2 Fab-IL2-Fab immuno conjugates recognizing
  • TNC A2 (2B10) or FAP (3F2 and 4G8) in inducing proliferation of NK92 cells in comparison to IL-2 (Proleukin) and the L19 diabody recognizing fibronectin-EDB.
  • IL-2 Proleukin
  • the x-axis is normalized to the number of IL-2 molecules, as the diabody has two IL-2 effector moieties while the Fab-IL2-
  • Fab constructs contain only one IL-2 effector moiety. Cell proliferation was measured using the
  • FIGURE 37 shows the induction of STAT 5 phosphorylation as a consequence of IL-2 mediated IL-2 receptor signaling following incubation with a FAP -targeted 4G8-based IL-2 Fab-IL2-Fab immuno conjugate recognizing FAP on different effector cell populations including (A) CD56 + NK cells, (B) CD4 + CD25 CD127 + helper T cells, (C) CD3 + , CD8 + cytotoxic T cells and (D) CD4 + CD25 + FOXP3 + regulatory T cells (Tregs) from human PBMCs in solution.
  • FIGURE 38 illustrates the efficacy of targeted IL-2 Fab-IL2-Fab immuno conjugates recognizing TNC Al (2Fl 1), TNC A2 (2B10) or FAP (3F2, 4B3 and 3D9) in inducing IFN- ⁇ release and proliferation of NK92 cells in comparison to IL-2, when the immunoconjugates are either present in solution or immobilized via FAP or TNC A2 coated on microtiter plates.
  • FIGURE 39 presents the results of a survival experiment with two different IL-2 immuno conjugate molecular formats specific for tumor stroma.
  • Human colon tumor cell line LS174T was intrasplenically injected into SCID mice.
  • the TNC A2-targeted 2B10 Fab-IL2-Fab immuno conjugate is labeled as "SH2B10”
  • the unconjugated IL-2 control is labeled as "proleukin”
  • the fibronectin EDB-targeted diabody-IL-2 molecule is labeled as "diabody”.
  • the amount of immuno conjugate injected per mouse (in ⁇ g) is indicated in the figure legend, and reflects same numbers of immunoconjugate molecules.
  • FIGURE 40 presents the results of a survival experiment with two different IL-2 immunoconjugate molecular formats specific for tumor stroma.
  • Human renal cell line ACHN was intrarenally injected into SCID mice.
  • the FAP -targeted 3F2 or 4G8 Fab-IL2-Fab immunoconjugates are labeled as "FAP-3F2" and "FAP-4G8", the unconjugated IL-2 control is labeled as "proleukin”, the fibronectin EDB-targeted diabody-IL-2 molecule is labeled as "diabody”.
  • the amount of immunoconjugates injected per mouse is indicated in the figure legend, and reflects same numbers of immunoconjugate molecules.
  • FIGURE 41 presents the results of a survival experiment with two different IL-2 immunoconjugate molecular formats specific for tumor stroma.
  • Human NSCLC cell line A549 was injected i.v. into SCID mice.
  • the TNC A2 -targeted 2B10 Fab-IL2-Fab immunoconjugate is labeled as "2B10”
  • the fibronectin EDB-targeted diabody-IL-2 molecule is labeled as "diabody”.
  • the amount of immunoconjugate injected per mouse (in ⁇ g) is indicated in the figure legend, and reflects same numbers of immunoconjugate molecules.
  • FIGURE 42 presents (A) an overview of the purification procedure of the Fab-GM-CSF-Fab immunoconjugate with Ll 9 (Fibronectin Ectodomain-B binder) as Fab, and (B) an SDS-PAGE (reduced, non-reduced) of the purified Fab-GM-CSF-Fab immunoconjugate.
  • FIGURE 43 presents the results of a GM-CSF-dependent proliferation assay comparing the effect of GM-CSF and the purified Fab-GM-CSF-Fab immuno conjugate with Ll 9 (Fibronectin Ectodomain-B binder) as Fab on TF-I cells.
  • FIGURE 44 presents (A) an overview of the purification procedure of the Fab-IL12-Fab immuno conjugate with 4G8 (FAP binder) as Fab, and (B) an SDS-PAGE (reduced, non-reduced) of the purified Fab-IL12-Fab immuno conjugate.
  • FIGURE 45 presents the results of an assay testing IL- 12 induced IFN- ⁇ release, comparing the effect of IL- 12 and the purified Fab-IL12-Fab immuno conjugate with 4G8 (FAP binder) as Fab, using PBMCs isolated from fresh human blood of a healthy donor.
  • FIGURE 46 presents (A) an overview of the purification procedure of the Fab-IFN ⁇ 2-Fab immuno conjugate with Ll 9 (Fibronectin Ectodomain-B binder) as Fab, and (B) an SDS-PAGE (reduced, non-reduced) of the purified Fab-IFN ⁇ 2-Fab immuno conjugate.
  • FIGURE 47 presents the results of an assay testing IFN- ⁇ - induced proliferation inhibition of (A) Jurkat T cells and (B) A549 tumor cells comparing the effect of IFN- ⁇ (Roferon A, Roche) and the purified Fab-IFN ⁇ 2-Fab immuno conjugate with Ll 9 (Fibronectin Ectodomain-B binder) as Fab.
  • FIGURE 48 shows (A) the elution profiles from the purification of the MCSP-targeted MHLG based Fab-IL2-Fab and (B) the results from the analytical characterization of the same Fab-IL2- Fab by SDS-PAGE (NuPAGE Novex Bis-Tris Mini Gel, Invitrogen, MOPS running buffer, reduced and non-reduced).
  • FIGURE 49 shows (A) the elution profiles from the purification of the MCSP-targeted MHLGl based Fab-IL2-Fab and (B) the results from the analytical characterization of the same Fab-IL2- Fab by SDS-PAGE (NuPAGE Novex Bis-Tris Mini Gel, Invitrogen, MOPS running buffer, reduced and non-reduced).
  • FIGURE 50 presents the results of an assay testing IL-2 induced IFN- ⁇ release comparing the effect of the purified Fab-IL2-Fab immuno conjugate with 4G8 (FAP binder) as Fab, and the purified Fab-IL2-Fab immunoconjugate with MHLG KV9 (MCSP binder) as Fab, using IL-2 starved NK92 cells.
  • FIGURE 51 presents the results of an assay testing IL-2 induced IFN- ⁇ release comparing the effect of the purified Fab-IL2-Fab immunoconjugate with 4G8 (FAP binder) as Fab, and the purified Fab-IL12-Fab immunoconjugate with MHLGl KV9 (MCSP binder) as Fab, using IL-2 starved NK92 cells.
  • FIGURE 52 shows the binding of MCSP-targeted MHLGl KV9 Fab-IL2-Fab immuno conjugate to Colo38 cells, as determined by flow cytometry. Secondary antibody alone or cells only are shown as negative controls.
  • FIGURE 53 presents (A) an overview of the purification procedure of the 2B10 Fab-IL2-Fab immuno conjugate with 2B10 (TNC A2 binder) as Fab, and (B) an SDS-PAGE (reduced, non- reduced) of the purified 2B10 Fab-IL2-Fab immuno conjugate.
  • the term "immunoconjugate” refers to a polypeptide molecule that includes at least one effector moiety and at least one antigen binding moiety.
  • the immunoconjugate comprises at least one single-chain effector moiety, and at least two antigen binding moieties.
  • the antigen binding molecule can be joined to the effector moiety by a variety of interactions and in a variety of configurations as described herein.
  • effector moiety refers to a polypeptide, e.g., a protein or glycoprotein, that influences cellular activity, for example, through signal transduction or other cellular pathways. Accordingly, the effector moiety of the invention can be associated with receptor- mediated signaling that transmits a signal from outside the cell membrane to modulate a response in a cell bearing one or more receptors for the effector moiety. In one embodiment, an effector moiety can elicit a cytotoxic response in cells bearing one or more receptors for the effector moiety. In another embodiment, an effector moiety can elicit a proliferative response in cells bearing one or more receptors for the effector moiety.
  • an effector moiety can elicit differentiation in cells bearing receptors for the effector moiety.
  • an effector moiety can alter expression (i.e., upregulate or downregulate) of an endogenous cellular protein in cells bearing receptors for the effector moiety.
  • effector moieties include cytokines, growth factors, hormones, enzymes, substrates, and cofactors.
  • the effector moiety can be associated with an antigen binding moiety in a variety of configurations to form an immuno conjugate.
  • cytokine refers to a molecule that mediates and/or regulates a biological or cellular function or process (e.g., immunity, inflammation, and hematopoiesis).
  • the term “cytokine” as used herein includes “lymphokines,” “chemokines,” “monokines,” and “ inter leukins.” Examples of useful cytokines include, but are not limited to, GM-CSF, IL-l ⁇ , IL- l ⁇ , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-IO, IL-12, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , MIP-Ia, MlP-l ⁇ , TGF- ⁇ , TNF- ⁇ , and TNF- ⁇ .
  • the term "single-chain” refers to a molecule comprising amino acid monomers linearly linked by peptide bonds.
  • the effector moiety is a single-chain effector moiety.
  • Non-limiting examples of single-chain effector moieties include cytokines, growth factors, hormones, enzymes, substrates, and cofactors.
  • the effector moiety is a cytokine and the cytokine of interest is normally found as a multimer in nature, each subunit of the multimeric cytokine is sequentially encoded by the single-chain of the effector moiety.
  • non-limiting examples of useful single-chain effector moieties include GM-CSF, IL-l ⁇ , IL-l ⁇ , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-IO, IL-12, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , MIP- 1 ⁇ , MIP- 1 ⁇ , TGF- ⁇ , TNF- ⁇ , and TNF- ⁇ .
  • control effector moiety refers to an unconjugated effector moiety.
  • control effector moiety when comparing an IL-2 immuno conjugate of the present invention with a control effector moiety, the control effector moiety is free, unconjugated IL-2.
  • control effector moiety when comparing an IL-12 immuno conjugate of the present invention with a control effector moiety, the control effector moiety is free, unconjugated IL-12 (e.g., existing as a heterodimeric protein wherein the p40 and p35 subunits share only disulfide bond(s)).
  • effector moiety receptor refers to a polypeptide molecule capable of binding specifically to an effector moiety.
  • IL-2 is the effector moiety
  • the effector moiety receptor that binds to a IL-2 is the IL-2 receptor.
  • IL-12 is the effector moiety of an immunoconjugate
  • the effector moiety receptor is the IL-12 receptor.
  • all receptors that specifically bind to the effector moiety are "effector moiety receptors" for that effector moiety.
  • an antigen binding moiety refers to a polypeptide molecule that specifically binds to an antigenic determinant.
  • an antigen binding moiety is able to direct the entity to which it is attached (e.g., an effector moiety or a second antigen binding moiety) to a target site, for example to a specific type of tumor cell or tumor stroma bearing the antigenic determinant.
  • Antigen binding moieties include antibodies and fragments thereof as further defined herein. By “specifically binds” is meant that the binding is selective for the antigen and can be discriminated from unwanted or non-specific interactions.
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties with constant regions as further defined herein and known in the art.
  • Useful heavy chain constant regions include any of the five isotypes: ⁇ , ⁇ , ⁇ , ⁇ , or ⁇ .
  • Useful light chain constant regions include any of the two isotypes: K and ⁇ .
  • antigenic determinant is synonymous with “antigen” and “epitope,” and refers to a site (e.g., a contiguous stretch of amino acids or a conformational configuration made up of different regions of non-contiguous amino acids) on a polypeptide macromolecule to which an antigen binding moiety binds, forming an antigen binding moiety-antigen complex.
  • control antigen binding moiety refers to an antigen binding moiety as it would exist free of other antigen binding moieties and effector moieties.
  • control antigen binding moiety is free Fab, wherein the Fab-IL2-Fab immuno conjugate and the free Fab molecule can both specifically bind to the same antigen determinant.
  • first and second with respect to antigen binding moieties, effector moieties, etc., are used for convenience of distinguishing when there is more than one of each type of moiety. Use of these terms is not intended to confer a specific order or orientation of the immuno conjugate unless explicitly so stated.
  • CDR complementarity determining region
  • Kabat et al. also defined a numbering system for variable domain sequences that is applicable to any antibody.
  • One of ordinary skill in the art can unambiguously assign this system of "Kabat numbering" to any variable domain sequence, without reliance on any experimental data beyond the sequence itself.
  • Kabat numbering refers to the numbering system set forth by Kabat et al., U.S. Dept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983). Unless otherwise specified, references to the numbering of specific amino acid residue positions in an antigen binding moiety of the invention are according to the Kabat numbering system.
  • polypeptide sequences of the sequence listing are not numbered according to the Kabat numbering system. However, it is well within the ordinary skill of one in the art to convert the numbering of the sequences of the Sequence Listing to Kabat numbering.
  • Immunoconjugates are polypeptide molecules that comprise at least one effector moiety and at least one antigen binding moiety.
  • the effector moiety is a single-chain effector moiety.
  • the immuno conjugate comprises at least two antigen binding moieties.
  • the antigen binding moieties and effector moieties of the immunoconjugate include those that are described in detail herein above and below and in the accompanying figures.
  • the antigen binding moiety of the immunoconjugate can be directed againt a variety of target molecules (e.g., an antigenic determinant on a protein molecule expressed on a tumor cell or tumor stroma). Non-limiting examples of antigen binding moieties are described herein.
  • the at least one antigen binding moiety is directed to an antigenic determinant of one or more of the polypeptides represented in Table 5, herein below.
  • Immuno conjugates of the invention typically exhibit one or more of the following properties: high specificity of action, reduced toxicity and/or improved stability, particularly as compared to known immuno conjugates of different configurations targeting the same antigenic determinants and carrying the same effector moities.
  • the immunoconjugate comprises at least a first effector moiety and at least a first and a second antigen binding moiety.
  • the first effector moiety is a single chain effector moiety.
  • the first and second antigen binding moeity are independently selected from the group consisting of an Fv and an Fab.
  • the first effector moiety shares an amino- or carboxy-terminal peptide bond with a first antigen binding moiety and a second antigen binding moiety shares an amino- or carboxy- terminal peptide bond with either i) the first effector moiety or ii) the first antigen binding moiety.
  • the immunoconjugate consists essentially of a first single-chain effector moiety and first and second antigen binding moieties.
  • a first effector moiety shares a carboxy-terminal peptide bond with a first antigen binding moiety and further shares an amino -terminal peptide bond with a second antigen binding moiety.
  • a first antigen binding moiety shares a carboxy- terminal peptide bond with a first effector moiety, preferably a single chain effector moiety, and further shares an amino -terminal peptide bond with a second antigen binding moiety.
  • a first antigen binding moiety shares an amino -terminal peptide bond with a first effector moiety, preferably a single chain effector moiety, and further shares a carboxy-terminal peptide with a second antigen binding moiety.
  • an effector moiety preferably a single chain effector moiety, shares a carboxy-terminal peptide bond with a first heavy chain variable region and further shares an amino -terminal peptide bond with a second heavy chain variable region.
  • an effector moiety preferably a single chain effector moiety, shares a carboxy- terminal peptide bond with a first light chain variable region and further shares an amino- terminal peptide with a second light chain variable region.
  • a first heavy or light chain variable region is joined by a carboxy-terminal peptide bond to a first effector moiety, preferably a single chain effector moiety, and is further joined by an amino-terminal peptide bond to a second heavy or light chain variable region.
  • a first heavy or light chain variable region is joined by an amino-terminal peptide bond to a first effector moiety preferably a single chain effector moiety, and is further joined by a carboxy- terminal peptide bond to a second heavy or light chain variable region.
  • an effector moiety preferably a single chain effector moiety, shares a carboxy-terminal peptide bond with a first Fab heavy or light chain and further shares an amino- terminal peptide bond with a second Fab heavy or light chain.
  • a first Fab heavy or light chain shares a carboxy-terminal peptide bond with a first single-chain effector moiety and further shares an amino-terminal peptide bond with a second Fab heavy or light chain.
  • a first Fab heavy or light chain shares an amino-terminal peptide bond with a first single-chain effector moiety and further shares a carboxy-terminal peptide bond with a second Fab heavy or light chain.
  • the immunoconjugate comprises at least a first effector moiety sharing an amino-terminal peptide bond to one or more scFv molecules and wherein the first effector moiety further shares a carboxy-terminal peptide bond with one or more scFv molecules.
  • the effector moiety is a single chain effector moiety.
  • the immunoconjugate comprises at least a first effector moiety, preferably a single chain effector moiety, and first and second antigen binding moieties, wherein each of the antigen binding moieties includes an scFv molecule joined at its carboxy-terminal amino acid to a constant region that includes an immunoglobulin constant domain, and wherein the first antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino-terminal amino acid of the first effector moiety, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the constant region is independently selected from the group consisting of IgG CHl, IgG CH2, IgG CH3, IgG Ck apP a, IgG Ci am bda and IgE CH 4 domains.
  • the immunoglobulin domain of the first antigen binding moiety is covalently linked to the immunoglobulin domain of the second antigen binding moiety through a disulfide bond.
  • at least one disulfide bond is located carboxy-terminal of the immunoglobulin domains of the first and second antigen binding moieties.
  • at least one disulf ⁇ de bond is located amino -terminal of the immunoglobulin domains of the first and second antigen binding moieties.
  • the immunoconjugate comprises first and second antigen binding moieties, each comprising an scFv molecule joined at its carboxy-terminal amino acid to a constant region that comprises an IgG CHl domain, wherein the first antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino -terminal amino acid of the first effector moiety, preferably a single chain effector moiety, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the second antigen binding moiety of the immunoconjugate can be further joined at its carboxy- terminal amino acid to the amino -terminal amino acid of a second effector moiety.
  • the second effector moiety is a single chain effector moiety.
  • the immunoconjugate comprises first and second antigen binding moieties each comprising an scFv molecule joined at its carboxy-terminal amino acid to a constant region that comprises an IgG Ck apP a domain, wherein the first antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino -terminal amino acid of the first effector moiety, preferably a single chain effector moiety, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the second antigen binding moiety of the immunoconjugate can be further joined at its carboxy- terminal amino acid to the amino -terminal amino acid of a second effector moiety.
  • the second effector moiety is a single chain effector moiety.
  • the immunoconjugate comprises first and second antigen binding moieties, each comprising an scFv molecule joined at its carboxy-terminal amino acid to a constant region that comprises an IgE CH4 domain, wherein the first antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino -terminal amino acid of the first effector moiety, preferably a single chain effector moiety, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the second antigen binding moiety of the immunoconjugate can be further joined at its carboxy- terminal amino acid to the amino -terminal amino acid of a second effector moiety.
  • the second effector moiety is a single chain effector moiety.
  • the immunoconjugate comprises first and second antigen binding moieties each, comprising an scFv molecule joined at its carboxy-terminal amino acid to an IgE CH3 domain, wherein the first antigen binding moiety is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of the first effector moiety, preferably a single chain effector moiety, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the second antigen binding moiety of the immuno conjugate can be further joined at its carboxy-terminal amino acid to the amino-terminal amino acid of a second effector moiety.
  • the second effector moiety is a single chain effector moiety.
  • the immuno conjugate comprises first and second effector moieties, and first and second antigen binding moieties, wherein each of the antigen binding moieties comprises an Fab molecule joined at its heavy or light chain carboxy-terminal amino acid to an IgGl CH3 domain, and wherein each of the IgGl CH3 domains is joined at its respective carboxy-terminal amino acid to the amino-terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through at least one disulfide bond.
  • the first and/or second effector moiety is a single chain effector moiety.
  • the IgGl CH3 domains of the antigen binding moieties may be joined by disulfide bond.
  • at least one disulfide bond is located carboxy-terminal of the IgGl CH3 domains of the first and second antigen binding moieties.
  • at least one disulfide bond is located amino-terminal of the IgGl CH3 domains of the first and second antigen binding moieties.
  • at least two disulfide bonds are located amino-terminal of the IgGl CH3 domains of the first and second antigen binding moieties.
  • the immuno conjugate comprises one or more proteolytic cleavage sites located between effector moieties and antigen binding moieties.
  • Components of the immuno conjugate may be linked directly or through various linkers (e.g., peptide linkers comprising one or more amino acids, typically about 2-10 amino acids) that are described herein or are known in the art.
  • the immuno conjugate has improved stability in solution, particularly compared to known immuno conjugate preparations.
  • the immuno conjugate binds to an antigenic determinant with a dissociation constant (K D ) that is at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 times lower than that for a control antigen binding moiety.
  • K D dissociation constant
  • the immuno conjugate binds to an antigenic determinant with a K D that is about 10 times lower than that for a control antigen binding moiety. In one embodiment the immuno conjugate binds to an antigenic determinant with a K D that is lower than about 10 nM, lower than about 1 nM, or lower than about 0.1 nM. In another embodiment, the immuno conjugate has a superior safety profile compared to known immuno conjugate preparations. The immuno conjugate preferably elicits fewer and less severe side effects, such as toxicity, destruction of non-tumor cells, etc. The decrease in side effects may be attributed to the reduced binding affinity of the immuno conjugates of the invention towards effector moiety receptors.
  • the immunoconjugate binds to an effector moiety receptor with a K D that is at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 times greater than that for a control effector moiety.
  • the immuonconjugate binds to an effector moiety receptor with a K D that is about 2 times greater than that for a control effector moiety.
  • the immuonconjugate binds to an effector moiety receptor with a K D that is about 10 times greater than that for a control effector moiety.
  • the immunoconjugate binds to an effector moiety receptor with a K D that is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times greater than that for a corresponding effector moiety in a "diabody” immunoconjugate molecule. In another embodiment, the immunoconjugate binds to an effector moiety receptor with a dissociation constant K D that is about 10 times greater than that for a corresponding effector moiety in a "diabody” immunoconjugate.
  • the immunoconjugate has superior efficacy, particularly compared to known immunoconjugate preparations.
  • the immunoconjugate is better able to inhibit increases in tumor volume in vivo and/or better able to prolong survival in mammals with malignant tumors.
  • the immunoconjugate inhibits an increase in tumor volume in vivo by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% by the end of an administration period of about at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days.
  • the immunoconjugate inhibits an increase in tumor volume in vivo by at least 50%, 55%, 60%, 65%, 70%, or 75% by the end of a 13 day administration period. In another embodiment, the immunoconjugate prolongs the survival of mammals with malignant tumors by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% when administered to a mammal in need thereof, relative to a control effector moiety. In another embodiment, the immunoconjugate prolongs the survival of mammals with malignant tumors by at least 30%, 32% or 35% when administered to a mammal in need thereof, relative to a control effector moiety.
  • the immunoconjugate prolongs the survival of mammals with malignant tumors by about 30% when administered to a mammal in need thereof, relative to a control effector moiety. In another embodiment, the immuno conjugate prolongs the survival of mammals with malignant tumors by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% when administered to a mammal in need thereof, relative to an effector moiety in a "diabody" immunoconjugate molecule.
  • the immunoconjugate prolongs the survival of mammals with malignant tumors by at least 30%, 32%, or 35% when administered to a mammal in need thereof, relative to an effector moiety in a "diabody” immunoconjugate molecule. In another embodiment, the immunoconjugate prolongs the survival of mammals with malignant tumors by about 30% when administered to a mammal in need thereof, relative to an effector moiety in a "diabody” immunoconjugate molecule. In another embodiment, the immunoconjugate prolongs the survival of mammals with malignant tumors by at least 5%, 10% or 15%, relative to a control effector moiety or an effector moiety in a "diabody” immunoconjugate molecule.
  • the antigen binding moiety of the immunoconjugate of the invention is generally a polypeptide molecule that binds to a specific antigenic determinant and is able to direct the entity to which it is attached (e.g., an effector moiety or a second antigen binding moiety) to a target site, for example to a specific type of tumor cell or tumor stroma that bears the antigenic determinant.
  • the immunoconjugate can bind to antigenic determinants found, for example, on the surfaces of tumor cells, on the surfaces of virus-infected cells, on the surfaces of other diseased cells, free in blood serum, and/or in the extracellular matrix (ECM).
  • Non-limiting examples of tumor antigens include MAGE, MART-1/Melan-A, gplOO, Dipeptidyl peptidase IV (DPPIV), adenosine deaminase-binding protein (AD Abp), cyclophilin b, Colorectal associated antigen (CRC)-CO 17- 1A/GA733, Carcinoembryonic Antigen (CEA) and its immunogenic epitopes CAP-I and CAP-2, etv6, amll, Prostate Specific Antigen (PSA) and its immunogenic epitopes PSA-I, PSA-2, and PSA-3, prostate-specific membrane antigen (PSMA), T-cell receptor/CD3-zeta chain, MAGE-family of tumor antigens (e.g., MAGE-Al, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE- AlO, M
  • Non-limiting examples of viral antigens include influenza virus hemagglutinin, Epstein-Barr virus LMP-I, hepatitis C virus E2 glycoprotein, HIV gpl60, and HIV gpl20.
  • ECM antigens include syndecan, heparanase, integrins, osteopontin, link, cadherins, laminin, laminin type EGF, lectin, fibronectin, notch, tenascin, and matrixin.
  • the immuno conjugates of the invention can bind to the following specific non- limiting examples of cell surface antigens: FAP, Her2, EGFR, CD2 (T-cell surface antigen), CD3 (heteromultimer associated with the TCR), CD22 (B-cell receptor), CD23 (low affinity IgE receptor), CD25 (IL-2 receptor ⁇ chain), CD30 (cytokine receptor), CD33 (myeloid cell surface antigen), CD40 (tumor necrosis factor receptor), IL-6R (IL6 receptor), CD20, MCSP, and PDGF ⁇ R ( ⁇ platelet-derived growth factor receptor).
  • FAP FAP
  • Her2, EGFR CD2 (T-cell surface antigen)
  • CD3 heteromultimer associated with the TCR
  • CD22 B-cell receptor
  • CD23 low affinity IgE receptor
  • CD25 IL-2 receptor ⁇ chain
  • CD30 cytokine receptor
  • CD33 myeloid cell surface antigen
  • CD40 tumor necrosis factor receptor
  • IL-6R IL-6 receptor
  • the immuno conjugate of the invention comprises two or more antigen binding moieties, wherein each of these antigen binding moieties specifically bind to the same antigenic determinant. In another embodiment, the immuno conjugate of the invention comprises two or more antigen binding moieties, wherein each of these antigen binding moieties specifically bind to different antigenic determinants.
  • the antigen binding moiety can be any type of antibody or fragment thereof that retains specific binding to an antigenic determinant.
  • Antibody fragments include, but are not limited to, V H fragments, V L fragments, Fab fragments, F(ab') 2 fragments, scFv fragments, Fv fragments, minibodies, diabodies, triabodies, and tetrabodies (see, e.g., Hudson and Souriau, Nature Med. 9: 129-134 (2003)).
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties that are specific for the Extra Domain B of fibronectin (EDB). In another embodiment, the immuno conjugate comprises at least one, typically two or more antigen binding moieties that can compete with monoclonal antibody L19 for binding to an epitope of EDB. See, e.g., PCT publication WO 2007/128563 Al (incorporated herein by reference in its entirety).
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain derived from the Ll 9 monoclonal antibody shares a carboxy-terminal peptide bond with an IL-2 molecule which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain derived from the Ll 9 monoclonal antibody shares a carboxy-terminal peptide bond with an IL- 12 molecule which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain derived from the Ll 9 monoclonal antibody shares a carboxy-terminal peptide bond with an IFN ⁇ molecule which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain derived from the Ll 9 monoclonal antibody shares a carboxy-terminal peptide bond with a GM-CSF molecule which in turn shares a carboxy- terminal peptide bond with a second Fab heavy chain derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises a polypeptide sequence wherein a first scFv derived from the Ll 9 monoclonal antibody shares a carboxy-terminal peptide bond with an IL-2 molecule which in turn shares a carboxy-terminal peptide bond with a second scFv derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises the polypeptide sequence of SEQ ID NO: 95 or a variant thereof that retains functionality.
  • the immuno conjugate comprises an Fab light chain derived from the Ll 9 monoclonal antibody.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 96 or a variant thereof that retains functionality.
  • the immuno conjugate comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 95 and SEQ ID NO: 96 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 104 or a variant thereof that retains functionality.
  • the immuno conjugate comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 104 and SEQ ID NO: 96 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 105 or a variant thereof that retains functionality.
  • the immuno conjugate comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 105 and SEQ ID NO: 96 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 106 or a variant thereof that retains functionality.
  • the immuno conjugate comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 106 and SEQ ID NO: 96 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 107 or a variant thereof that retains functionality.
  • the immuno conjugate comprises a polypeptide sequences that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 107 and SEQ ID NO: 96 or variants thereof that retain functionality.
  • the polypeptides are covalently linked, e.g., by a disulfide bond.
  • the immuno conjugate of the invention comprises at least one, typically two or more antigen binding moieties that are specific for the Al domain of Tenascin (TNC-Al).
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties that can compete with monoclonal antibody Fl 6 for binding to an epitope of TNC-Al. See, e.g., PCT Publication WO 2007/128563 Al (incorporated herein by reference in its entirety).
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties that are specific for the Al and/or the A4 domain of Tenascin (TNC-Al or TNC-A4 or TNC-A1/A4).
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for the Al domain of Tenascin shares a carboxy-terminal peptide bond with an IL-2 molecule, an IL- 12 molecule, an IFN ⁇ molecule or a GM-CSF molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for the Al domain of Tenascin.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for the Al domain of Tenascin shares a carboxy-terminal peptide bond with an IL-2 molecule which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for the Al domain of Tenascin.
  • the immuno conjugate comprises a polypeptide sequence wherein a first scFv specific for the Al domain of Tenascin shares a carboxy-terminal peptide bond with an IL-2 molecule which in turn shares a carboxy-terminal peptide bond with a second scFv specific for the Al domain of Tenascin.
  • the antigen binding moieties of the immuno conjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 13 or SEQ ID NO: 15, or variants thereof that retain functionality.
  • the antigen binding moieties of the immuno conjugate comprise a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 9 or SEQ ID NO: 11, or variants thereof that retain functionality.
  • the antigen binding moieties of the immuno conjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 13 or SEQ ID NO: 15 or variants thereof that retain functionality, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 9 or SEQ ID NO: 11 or variants thereof that retain functionality.
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 14 or SEQ ID NO: 16.
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by the polynucleotide sequence of either SEQ ID NO: 14 or SEQ ID NO: 16.
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 10 or SEQ ID NO: 12.
  • the light chain variable region sequence of the antigen binding moieties of the immunoconjugate is encoded by the polynucleotide sequence of either SEQ ID NO: 10 or SEQ ID NO: 12.
  • the immunoconjugate comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 99 or variants thereof that retain functionality.
  • the immunoconjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 100 or SEQ ID NO: 215, or variants thereof that retain functionality.
  • the immunoconjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 101 or SEQ ID NO: 235 or variants thereof that retain functionality.
  • the immunoconjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 100 and SEQ ID NO: 101 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 215 and SEQ ID NO: 235 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 112.
  • the immuno conjugate comprises a polypeptide sequence encoded by the polynucleotide sequence of SEQ ID NO: 112.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 113 or SEQ ID NO: 216.
  • the immuno conjugate comprises a polypeptide sequence encoded by the polynucleotide sequence of either SEQ ID NO: 113 or SEQ ID NO: 216.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to either SEQ ID NO: 114 or SEQ ID NO: 236.
  • the immunoconjugate comprises a polypeptide sequence encoded by the polynucleotide sequence of either SEQ ID NO: 114 or SEQ ID NO: 236.
  • the immunoconjugate comprises at least one, typically two or more antigen binding moieties that are specific for the A2 domain of Tenascin (TNC-A2).
  • the immunoconjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for the A2 domain of Tenascin shares a carboxy-terminal peptide bond with an IL- 2 molecule, an IL-12 molecule, an IFN ⁇ molecule or a GM-CSF molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for the A2 domain of Tenascin.
  • the immunoconjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for the A2 domain of Tenascin shares a carboxy- terminal peptide bond with an IL-2 molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for the A2 domain of Tenascin.
  • the antigen binding moieties of the immunoconjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO:195, SEQ ID NO: 199, SEQ ID NO: 203 and SEQ ID NO: 207, or variants thereof that retain functionality.
  • the antigen binding moieties of the immuno conjugate comprise a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 3, SEQ ID NO: 5; SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:185, SEQ ID NO: 189, SEQ ID NO: 193, SEQ ID NO: 197, SEQ ID NO: 201 and SEQ ID NO: 205, or variants thereof that retain functionality.
  • the antigen binding moieties of the immuno conjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO:195, SEQ ID NO: 199, SEQ ID NO: 203 and SEQ ID NO: 207, or variants thereof that retain functionality, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 3, SEQ ID NO: 5; SEQ ID NO: 177, SEQ ID NO: 181, SEQ ID NO:185, SEQ ID NO: 189, SEQ ID NO: 193, SEQ ID NO: 197, SEQ ID NO: 201 and
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 8, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204 and SEQ ID NO: 208.
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 8, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204 and SEQ ID NO: 208.
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 178, SEQ ID NO: 182, SEQ ID NO: 186, SEQ ID NO: 190, SEQ ID NO: 194, SEQ ID NO: 198, SEQ ID NO: 202 and SEQ ID NO: 206.
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence selected from the group of of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 178, SEQ ID NO: 182, SEQ ID NO: 186, SEQ ID NO: 190, SEQ ID NO: 194, SEQ ID NO: 198, SEQ ID NO: 202 and SEQ ID NO: 206.
  • the immuno conjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 239, SEQ ID NO: 241 and SEQ ID NO: 243, or variants thereof that retain functionality.
  • the immuno conjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 245, SEQ ID NO: 247 and SEQ ID NO:249, or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 239, SEQ ID NO: 241, and SEQ ID NO: 243 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 245, SEQ ID NO: 247 and SEQ ID NO:249 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 239 and either SEQ ID NO: 247 or SEQ ID NO: 249, or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 241 and either SEQ ID NO: 245 or SEQ ID NO: 247, or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 243 and SEQ ID NO: 245, or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 240, SEQ ID NO: 242 and SEQ ID NO: 244.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence selected from the group of of SEQ ID NO: 240, SEQ ID NO: 242 and SEQ ID NO: 244.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 246, SEQ ID NO: 248 and SEQ ID NO: 250.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence selected from the group of of SEQ ID NO: 246, SEQ ID NO: 248 and SEQ ID NO: 250.
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties that are specific for the Fibroblast Activated Protein (FAP).
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for FAP shares a carboxy-terminal peptide bond with an IL-2 molecule, an IL- 12 molecule, an IFN ⁇ molecule or a GM-CSF molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for FAP.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for FAP shares a carboxy-terminal peptide bond with an IL-2 molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for FAP.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for FAP shares a carboxy-terminal peptide bond with an IL- 12 molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for FAP.
  • the antigen binding moieties of the immuno conjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 69, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 93, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID
  • the antigen binding moieties of the immuno conjugate comprise a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group consisting of: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 121, SEQ ID NO: 125, SEQ ID NO: 129, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 141, SEQ ID NO: 145, SEQ ID NO: 149, SEQ ID NO: 153, SEQ
  • the antigen binding moieties of the immunoconjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 69, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 81, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 93, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, S
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group consisting of: SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 78, SEQ ID NO: 82, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152,
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 70, SEQ ID NO: 74, SEQ ID NO: 78, SEQ ID NO: 82, SEQ ID NO: 86, SEQ ID NO: 90, SEQ ID NO: 94, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, S
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 122, SEQ ID NO: 126, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 142, SEQ ID NO: 146, SEQ ID NO: 150, SEQ ID NO: 18, S
  • the light chain variable region sequence of the antigen binding moieties of the immunoconjugate is encoded by a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38, SEQ ID NO: 42, SEQ ID NO: 46, SEQ ID NO: 50, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 122, SEQ ID NO: 126, SEQ ID NO: 130, SEQ ID NO: 134, SEQ ID NO: 138, SEQ ID NO: 142, SEQ ID NO: 146, SEQ ID NO: 150, SEQ ID NO: 154, SEQ ID NO: 158, SEQ ID NO: 162, SEQ ID NO: 166, SEQ ID NO: 18
  • the immunoconjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225 and SEQ ID NO: 227, or variants thereof that retain functionality.
  • the immunoconjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233 and SEQ ID NO: 237 or variants thereof that retain functionality.
  • the immunoconjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 211, SEQ ID NO: 219 and SEQ ID NO: 221 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 231 or variants thereof that retain functionality.
  • the immunoconjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from the group of SEQ ID NO: 209, SEQ ID NO: 223, SEQ ID NO: 225 and SEQ ID NO: 227 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 229 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 213 and SEQ ID NO: 233 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 217 and SEQ ID NO: 237 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 221 and SEQ ID NO: 231 or variants thereof that retain functionality. In yet another specific embodiment, the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 223 and SEQ ID NO: 229 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 225 and SEQ ID NO: 229 or variants thereof that retain functionality.
  • the immunoconjugate of the present invention comprises two polypeptide sequences that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 227 and SEQ ID NO: 229 or variants thereof that retain functionality.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, and SEQ ID NO: 228.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, and SEQ ID NO: 228.
  • the immunoconjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a sequence selected from the group of SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 238.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence selected from the group of SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 238.
  • the immuno conjugate comprises at least one, typically two or more antigen binding moieties that are specific for the Melanoma Chondroitin Sulfate Proteoglycan (MCSP).
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for MCSP shares a carboxy-terminal peptide bond with an IL-2 molecule, an IL-12 molecule, an IFN ⁇ molecule or a GM-CSF molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for MCSP.
  • the immuno conjugate comprises a polypeptide sequence wherein a first Fab heavy chain specific for MCSP shares a carboxy-terminal peptide bond with an IL-2 molecule, which in turn shares a carboxy-terminal peptide bond with a second Fab heavy chain specific for MCSP.
  • the antigen binding moieties of the immuno conjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of either SEQ ID NO: 257 or SEQ ID NO: 261 or variants thereof that retain functionality.
  • the antigen binding moieties of the immunoconjugate comprise a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of either SEQ ID NO: 259 or SEQ ID NO: 271 or variants thereof that retain functionality.
  • the antigen binding moieties of the immunoconjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of either SEQ ID NO: 257 or SEQ ID NO: 261, or variants thereof that retain functionality, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of either SEQ ID NO: 259 or SEQ ID NO: 271, or variants thereof that retain functionality.
  • the antigen binding moieties of the immunoconjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 257, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 259.
  • the antigen binding moieties of the immunoconjugate comprise a heavy chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 261, and a light chain variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 259.
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 258 or SEQ ID NO: 262.
  • the heavy chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by the polynucleotide sequence of either SEQ ID NO: 258 or SEQ ID NO: 262.
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 260 or SEQ ID NO: 272.
  • the light chain variable region sequence of the antigen binding moieties of the immuno conjugate is encoded by the polynucleotide sequence of either SEQ ID NO: 260 or SEQ ID NO: 272.
  • the immuno conjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 251 or SEQ ID NO: 255, or variants thereof that retain functionality.
  • the immuno conjugate of the invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 253 or SEQ ID NO: 265, or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 251 or SEQ ID NO: 255 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to either SEQ ID NO: 253 or SEQ ID NO: 265, or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 251 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 253 or variants thereof that retain functionality.
  • the immuno conjugate of the present invention comprises a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 255 or variants thereof that retain functionality, and a polypeptide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 253 or variants thereof that retain functionality.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 252 or SEQ ID NO: 256.
  • the immuno conjugate comprises a polypeptide sequence encoded by the polynucleotide sequence of either SEQ ID NO: 252 or SEQ ID NO: 256.
  • the immuno conjugate comprises a polypeptide sequence encoded by a polynucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of either SEQ ID NO: 254 or SEQ ID NO: 266.
  • the immuno conjugate comprises a polypeptide sequence encoded by the polynucleotide sequence of either SEQ ID NO: 254 or SEQ ID NO: 266.
  • the antigen binding moieties comprise at least a variable region capable of binding an antigenic determinant.
  • variable regions useful in the present invention can be of murine, primate, or human origin.
  • Human variable regions can be derived from human monoclonal antibodies made by the hybridoma method. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described, for example, by Kozbor et al., J Immunol. 755:3001-3005 (1984) and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987).
  • Human variable regions may also be produced by transgenic animals ⁇ e.g. mice) that are capable, upon immunization, of producing a repertoire of human antibodies in the absence of endogenous immunoglobulin production.
  • transgenic animals ⁇ e.g. mice
  • J H antibody heavy chain joining region
  • phage display can be used to produce human antibodies and human variable regions in vitro from immunoglobulin variable (V) domain gene repertoires e.g., from unimmunized donors.
  • V domain gene repertoires e.g., from unimmunized donors.
  • McCafferty et al Nature 545:552-554 (1990).
  • antibody V domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as Ml 3 or fd, and displayed as functional antibody fragments on the surface of the phage particle.
  • the filamentous particle contains a single-stranded DNA copy of the phage genome
  • selections based on the functional properties of the antibody/antibody fragments also result in selection of the gene encoding the antibody/antibody fragments exhibiting those properties.
  • the phage mimics some of the properties of the B-cell.
  • Phage display can be performed in a variety of formats. For a review of phage display formats, see Hoogenboom et al, Nucleic Acids Res. iP:4133-4137 (1991). Several sources of V-gene segments can be used for phage display.
  • Clackson et al isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. See Clackson et al, Nature 552:624-628 (1991). A repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al, J. MoI. Bio. 222:581-597 (1991). In a natural immune response, antibody genes accumulate mutations at a high rate (somatic hypermutation).
  • Variable regions that can be used also include murine variable region sequences that have either been primatized or humanized or primate variable region sequences that have been humanized.
  • the term "humanized” refers to an antigen-binding moiety variable region sequence derived from a non-human antibody, for example, a murine antibody, that retains or substantially retains the antigen-binding properties of the parent molecule but which is less immunogenic in humans.
  • critical framework residues e.g., those that are important for retaining good antigen binding affinity or antibody functions
  • CDRs complementarity determining regions
  • FRl complementarity determining regions
  • FR2 complementarity determining regions
  • FR3 complementarity determining regions
  • the term “primatized” is used to refer to an antigen-binding moiety variable region derived from a non-primate antibody, for example, a murine antibody, that retains or substantially retains the antigen-binding properties of the parent molecule but which is less immunogenic in primates.
  • variable domains both heavy and light
  • humanized antigen binding moieties are very important to reduce antigenicity.
  • sequence of the variable region of a rodent antigen binding moiety is screened against the entire library of known human variable-region sequences.
  • the human sequence which is closest to that of the rodent is then accepted as the human framework region (FR) for the humanized antigen binding moiety (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. MoI. Biol., 196:901 (1987)).
  • Another method of selecting the human framework sequence is to compare the sequence of each individual subregion of the full rodent framework (i.e., FRl, FR2, FR3, and FR4) or some combination of the individual subregions (e.g., FRl and FR2) against a library of known human variable region sequences that correspond to that framework subregion (e.g., as determined by Kabat numbering), and choose the human sequence for each subregion or combination that is the closest to that of the rodent (U.S. Patent Application Publication No. 2003/0040606A1).
  • Another method uses a particular framework region derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
  • the same framework may be used for several different humanized antigen binding moieties (Carter et al., Proc. Natl. Acad. Sci. USA, SP:4285 (1992); Presta et al, J. Immunol, 151:2623 (1993)).
  • humanized variable regions are prepared by analyzing the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformation structures of selected candidate immunoglobulin variable region sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin variable region sequence, i.e., the analysis of residues that influence the ability of the candidate variable region sequence to bind its antigen.
  • FR residues can be selected and combined from the recipient and import sequences so that the desired antigen binding moiety characteristic, such as increased affinity for the target antigen(s), is achieved.
  • the hypervariable region residues are directly and most substantially involved in influencing antigen binding.
  • the antigen binding molecules of the present invention are engineered to have enhanced binding affinity according to, for example, the methods disclosed in U.S. Pat. Appl. Publ. No. 2004/0132066, the entire contents of which are hereby incorporated by reference.
  • the ability of the immuno conjugate of the invention to bind to either an effector moiety receptor or to a specific antigenic determinant can be measured either through an enzyme linked immunosorbent assay (ELISA) or other techniques familiar to one of skill in the art, e.g., surface plasmon resonance technique (analyzed on a BIACORE TlOO system) (Liljeblad, et al., Glyco. J. 77:323-329 (2000)), and traditional binding assays (Heeley, R. P., Endocr. Res. 28:211-229 (2002)). Effector Moieties
  • the effector moieties for use in the invention are generally polypeptides that influence cellular activity, for example, through signal transduction pathways. Accordingly, the effector moiety of the immuno conjugate of the invention can be associated with receptor-mediated signaling that transmits a signal from outside the cell membrane to modulate a response within the cell.
  • an effector moiety of the immuno conjugate can be a cytokine.
  • the effector moiety is a single-chain effector moiety as defined herein.
  • one or more effector moieties, typically single-chain effector moieties, of the immuno conjugates of the invention are cytokines selected from the group consisting of: IL-2, GM-CSF, IFN- ⁇ , and IL-12.
  • one or more single-chain effector moieties of the immuno conjugates are cytokines selected from the group consisting of: IL-8, MIP- l ⁇ , MIP- l ⁇ , and TGF- ⁇ .
  • the effector moiety, preferably a single-chain effector moiety, of the immuno conjugate is IL-2.
  • the IL-2 effector moiety can elicit one or more of the cellular responses selected from the group consisting of: proliferation in an activated T lymphocyte cell, differentiation in an activated T lymphocyte cell, cytotoxic T cell (CTL) activity, proliferation in an activated B cell, differentiation in an activated B cell, proliferation in a natural killer (NK) cell, differentiation in a NK cell, and NK/lymphocyte activated killer (LAK) antitumor cytotoxicity.
  • the effector moiety, preferably a single-chain effector moiety, of the immuno conjugate is GM-CSF.
  • the GM-CSF effector moiety can elicit proliferation and/or differentiation in a granulocyte, a monocyte or a dendritic cell.
  • the effector moiety, preferably a single-chain effector moiety, of the immuno conjugate is IFN- ⁇ .
  • the IFN- ⁇ effector moiety can elicit one or more of the cellular responses selected from the group consisting of: inhibiting viral replication in a virus-infected cell, and upregulating the expression of major histocompatibility complex I (MHC I).
  • MHC I major histocompatibility complex I
  • the IFN ⁇ effector moiety can inhibit proliferation in a tumor cell.
  • the effector moiety, preferably a single-chain effector moiety, of the immuno conjugate is IL-12.
  • the IL-12 effector moiety can elicit one or more of the cellular responses selected from the group consisting of: proliferation in a NK cell, differentiation in a NK cell, proliferation in a T cell, and differentiation in a T cell.
  • the effector moiety, preferably a single-chain effector moiety, of the immunoconjugate is IL-8.
  • the IL-8 effector moiety can elicit chemotaxis in neutrophils.
  • the effector moiety, preferably a single-chain effector moiety, of the immunoconjugate is MIP- l ⁇ .
  • the MIP- l ⁇ effector moiety can elicit chemotaxis in monocytes and T lymphocyte cells.
  • the effector moiety, preferably a single-chain effector moiety, of the immunoconjugate is MIP- l ⁇ .
  • the MIP- l ⁇ effector moiety can elicit chemotaxis in monocytes and T lymphocyte cells.
  • the effector moiety, preferably a single-chain effector moiety, of the immunoconjugate is TGF- ⁇ .
  • the TGF- ⁇ effector moiety can elicit one or more of the cellular responses selected from the group consisting of: chemotaxis in monocytes, chemotaxis in macrophages, upregulating the expression of IL-I in activated macrophages, and upregulating the expression of IgA in activated B cells.
  • the immuno conjugates of the invention comprise polypeptides and fragments thereof.
  • term “polypeptide” is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds).
  • polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product.
  • polypeptides dipeptides, tripeptides, oligopeptides, "protein,” “amino acid chain,” or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of "polypeptide,” and the term “polypeptide” may be used instead of, or interchangeably with any of these terms.
  • polypeptide is also intended to refer to the products of post- expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids.
  • a polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.
  • a polypeptide of the invention may be of a size of about 3 or more, 5 or more, 10 or more, 20 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more, 500 or more, 1,000 or more, or 2,000 or more amino acids.
  • Polypeptides may have a defined three-dimensional structure, although they do not necessarily have such structure. Polypeptides with a defined three-dimensional structure are referred to as folded, and polypeptides which do not possess a def ⁇ ned three-dimensional structure, but rather can adopt a large number of different conformations, and are referred to as unfolded.
  • an “isolated” polypeptide or a variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required.
  • an isolated polypeptide can be removed from its native or natural environment.
  • Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
  • polypeptides of the present invention are derivatives, analogs, or variants of the foregoing polypeptides, and any combination thereof.
  • variants include any polypeptides that retain at least some of the biological, antigenic, or immunogenic properties of the corresponding native polypeptide.
  • variants of polypeptides of the present invention include polypeptides with altered amino acid sequences due to amino acid substitutions, deletions, or insertions. Variants may occur naturally or be non-naturally occurring. Non-naturally occurring variants may be produced using art-known mutagenesis techniques. Variant polypeptides may comprise conservative or non-conservative amino acid substitutions, deletions or additions.
  • polypeptides of the present invention are polypeptides which have been altered so as to exhibit additional features not found on the native polypeptide. Examples include fusion proteins. Variant polypeptides may also be referred to herein as "polypeptide analogs.” As used herein a “derivative" of a polypeptide refers to a subject polypeptide having one or more residues chemically derivatized by reaction of a functional side group. Also included as “derivatives" are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids.
  • 4-hydroxyproline may be substituted for proline; 5- hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.
  • recombinant variants encoding these same or similar polypeptides can be synthesized or selected by making use of the "redundancy" in the genetic code.
  • Various codon substitutions such as the silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system.
  • Mutations in the polynucleotide sequence may be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide, to change characteristics such as ligand-binding affinities, interchain affinities, or degradation/turnover rate.
  • amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements.
  • conservative amino acid replacements may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
  • nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • “Insertions” or “deletions” are preferably in the range of about 1 to about 20 amino acids, more preferably 1 to 10 amino acids. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the references sequence.
  • any particular polypeptide is at least 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% identical to a reference polypeptide can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et ah, Comp. Appl. Biosci. 6:237-245 (1990).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C- terminal residues of the subject sequence.
  • a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
  • the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence.
  • deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.
  • Polypeptides of the invention include those that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequences set forth in Tables 3 and 4, below, including functional fragments or variants thereof.
  • the invention also encompasses polypeptides comprising sequences of Tables 3 or 4 with conservative amino acid substitutions.
  • polypeptides of the invention may be encoded by a single polynucleotide. Alternatively, the may be encoded by multiple (e.g., two or more) polynucleotides, so that the polypeptides are co- expressed. Polypeptides that are co-expressed from multiple polynucleotides may associate through, e.g., disulfide bonds or other means to form a functional immuno conjugate.
  • the heavy chain portion of an antigen binding moiety may be encoded by a separate polynucleotide from the portion of the immuno conjugate comprising the light chain portion of the antigen binding moiety and the effector moiety.
  • the heavy chain polypeptides When co-expressed, the heavy chain polypeptides will associate with the light chain polypeptides to form the antigen binding moiety.
  • the light chain portion of the antigen binding moiety could be encoded by a separate polynucleotide from the portion of the immuno conjugate comprising the heavy chain portion of the antigen binding moiety and the effector moiety.
  • Immunoconjugates of the present invention and fragments thereof are generally encoded by polynucleotides.
  • polynucleotide is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to an isolated nucleic acid molecule or construct, e.g., messenger RNA (mRNA), virally-derived RNA, or plasmid DNA (pDNA).
  • mRNA messenger RNA
  • pDNA virally-derived RNA
  • pDNA plasmid DNA
  • a polynucleotide may comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)).
  • PNA peptide nucleic acids
  • nucleic acid refers to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide.
  • isolated nucleic acid or polynucleotide is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment.
  • a recombinant polynucleotide encoding a therapeutic polypeptide contained in a vector is considered isolated for the purposes of the present invention.
  • Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the present invention, as well as positive and negative strand forms, and double-stranded forms, of pestivirus vectors disclosed herein.
  • Isolated polynucleotides or nucleic acids according to the present invention further include such molecules produced synthetically.
  • a polynucleotide or a nucleic acid may be or may include a regulatory element such as a promoter, ribosome binding site, or a transcription terminator.
  • a "coding region” is a portion of nucleic acid which consists of codons translated into amino acids. Although a “stop codon” (TAG, TGA, or TAA) is not translated into an amino acid, it may be considered to be part of a coding region, if present, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, 5' and 3' non- translated regions, and the like, are not part of a coding region.
  • Two or more coding regions of the present invention can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors.
  • any vector may contain a single coding region, or may comprise two or more coding regions, e.g., a vector of the present invention may encode one or more polyproteins, which are post- or co- translationally separated into the final proteins via proteolytic cleavage.
  • a vector, polynucleotide, or nucleic acid of the invention may encode heterologous coding regions, either fused or unfused to a first or second nucleic acid encoding the immunoconjugate of the invention, or variant or derivative thereof.
  • Heterologous coding regions include without limitation specialized elements or motifs, such as a secretory signal peptide or a heterologous functional domain.
  • the polynucleotide or nucleic acid is DNA.
  • a polynucleotide comprising a nucleic acid, which encodes a polypeptide normally may include a promoter and/or other transcription or translation control elements operably associated with one or more coding regions.
  • An operable association is when a coding region for a gene product, e.g., a polypeptide, is associated with one or more regulatory sequences in such a way as to place expression of the gene product under the influence or control of the regulatory sequence(s).
  • Two DNA fragments are "operably associated" if induction of promoter function results in the transcription of mRNA encoding the desired gene product and if the nature of the linkage between the two DNA fragments does not interfere with the ability of the expression regulatory sequences to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed.
  • a promoter region would be operably associated with a nucleic acid encoding a polypeptide if the promoter was capable of effecting transcription of that nucleic acid.
  • the promoter may be a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells.
  • transcription control elements besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can be operably associated with the polynucleotide to direct cell-specific transcription.
  • Suitable promoters and other transcription control regions are disclosed herein.
  • transcription control regions are known to those skilled in the art. These include, without limitation, transcription control regions, which function in vertebrate cells, such as, but not limited to, promoter and enhancer segments from cytomegaloviruses (e.g., the immediate early promoter, in conjunction with intron-A), simian virus 40 (e.g., the early promoter), and retroviruses (such as, e.g., Rous sarcoma virus).
  • Other transcription control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone and rabbit ⁇ -globin, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcription control regions include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or inter leukins).
  • translation control elements include, but are not limited to ribosome binding sites, translation initiation and termination codons, and elements derived from viral systems (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
  • a polynucleotide of the present invention is RNA, for example, in the form of messenger RNA (mRNA).
  • RNA of the present invention may be single stranded or double stranded.
  • Polynucleotide and nucleic acid coding regions of the present invention may be associated with additional coding regions which encode secretory or signal peptides, which direct the secretion of a polypeptide encoded by a polynucleotide of the present invention.
  • proteins secreted by mammalian cells have a signal peptide or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • polypeptides secreted by vertebrate cells generally have a signal peptide fused to the N-terminus of the polypeptide, which is cleaved from the complete or "full length" polypeptide to produce a secreted or "mature” form of the polypeptide.
  • the native signal peptide e.g., an immunoglobulin heavy chain or light chain signal peptide is used, or a functional derivative of that sequence that retains the ability to direct the secretion of the polypeptide that is operably associated with it.
  • a heterologous mammalian signal peptide, or a functional derivative thereof may be used.
  • the wild-type leader sequence may be substituted with the leader sequence of human tissue plasminogen activator (TPA) or mouse ⁇ -glucuronidase.
  • expression cassette refers to a polynucleotide generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell.
  • the recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment.
  • the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter.
  • the expression cassette of the invention comprises polynucleotide sequences that encode immuno conjugates of the invention or fragments thereof.
  • expression vector is synonymous with "expression contsruct” and refers to a DNA molecule that is used to introduce and direct the expression of a specific gene to which it is operably associated into a target cell.
  • the expression vector of the present invention comprises an expression cassette. Expression vectors allow transcription of large amounts of stable mRNA. Once the expression vector is inside the target cell, the ribonucleic acid molecule or protein that is encoded by the gene is produced by the cellular transcription and/or translation machinery.
  • the expression vector of the invention comprises an expression cassette comprises polynucleotide sequences that encode immuno conjugates of the invention or fragments thereof.
  • artificial refers to a synthetic, or non-host cell derived composition, e.g., a chemically-synthesized oligonucleotide.
  • nucleic acid or polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence.
  • nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence or polypeptide sequence of the present invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al, Comp. Appl. Biosci. 6:237-245 (1990). In a sequence alignment the query and subject sequences are both DNA sequences.
  • RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matached/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.
  • Polynucleotides of the invention include those that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequences set forth in Tables 6 and 8, below, including functional fragments or variants thereof.
  • the polynucleotides may be expressed as a single polynucleotide that encodes the entire immuno conjugate or as multiple (e.g., two or more) polynucleotides that are coexpressed.
  • Polypeptides encoded by polynucleotides that are co- expressed may associate through, e.g., disulfide bonds or other means to form a functional immuno conjugate.
  • the heavy chain portion of an antigen binding moiety may be encoded by a separate polynucleotide from the portion of the immuno conjugate comprising the light chain portion of the antigen binding moiety and the effector moiety. When coexpressed, the heavy chain polypeptides will associate with the light chain polypeptides to form the antigen binding moiety.
  • the light chain portion of the antigen binding moiety could be encoded by a separate polynucleotide from the portion of the immuno conjugate comprising the heavy chain portion of the antigen binding moiety and the effector moiety.
  • an isolated polynucleotide of the invention encodes a fragment of an immuno conjugate comprising at least one effector moiety, preferably a single-chain effector moiety, and at least one, preferably two or more antigen binding moieties, wherein a first effector moiety shares an amino- or carboxy-terminal peptide bond with a first antigen binding moiety and a second antigen binding moiety shares an amino- or carboxy-terminal peptide bond with either the first effector moiety or the first antigen binding moiety.
  • the antigen binding moieties are independently selected from the group consisting of Fv and Fab.
  • the polynucleotide encodes the heavy chains of two of the antigen binding moieties and one of the effector moieties. In another specific embodiment, the polynucleotide encodes the light chains of two of the antigen binding moieties and one of the effector moieties. In another specific embodiment, the polynucleotide encodes one light chain from one of the antigen binding moieties, one heavy chain from a second antigen binding moiety and one of the effector moieties.
  • an isolated polynucleotide of the invention encodes a fragment of an immunoconjugate, wherein the polynucleotide encodes the heavy chains of two Fab molecules and an effector moiety, preferably a single-chain effector moiety.
  • an isolated polynucleotide of the invention encodes a fragment of an immunoconjugate, wherein the polynucleotide encodes the light chains of two Fab molecules and an effector moiety, preferably a single-chain effector moiety.
  • an isolated polynucleotide of the invention encodes a fragment of an immunoconjugate, wherein the polynucleotide encodes the heavy chain of one Fab molecule, the light chain of second Fab molecule and an effector moiety, preferably a single-chain effector moiety.
  • an isolated polynucleotide of the invention encodes an immunoconjugate comprising at least one effector moiety, preferably a single-chain effector moiety, joined at its amino- and carboxy-terminal amino acids to one or more scFv molecules.
  • an isolated polynucleotide of the invention encodes an immunoconjugate fragment comprising at least one effector moiety, preferably a single-chain effector moiety and at least first and second antigen binding moieties, wherein each of the antigen binding moieties comprises an scFv molecule joined at its carboxy-terminal amino acid to a constant region comprising an immunoglobulin constant domain independently selected from the group consisting of IgGl CHl, IgG Ck apP a, and IgE CH4, and wherein one of the antigen binding moieties is joined at its constant region carboxy-terminal amino acid to the amino-terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through a disulfide bond.
  • the polynucleotide of the invention encodes one of the antigen binding moieties and an effector moiety, preferably a single-chain effector moiety.
  • an isolated polynucleotide of the invention encodes an immunoconjugate fragment comprising first and second effector moieties and two antigen binding moieties, wherein each of the antigen binding moieties comprises an scFv molecule joined at its carboxy- terminal amino acid to a constant region comprising an immunoglobulin constant domain, and wherein one of the antigen binding moieties is joined at its constant region carboxy-terminal amino acid to the amino-terminal amino acid of one of the effector moieties, and wherein the second antigen binding moiety is joined at its constant region carboxy-terminal amino acid to the amino-terminal amino acid of the second effector moiety, and wherein the first and second antigen binding moieties are covalently linked through a disulfide bond.
  • the first and/or second effector moieties are single chain effector moieties.
  • the constant domain is independently selected from the group consisting of IgGl CHl, IgG Ckappa, and IgE CH4.
  • the polynucleotide of the invention encodes one of the antigen binding moieties and one of the effector moieties.
  • an isolated polynucleotide of the invention encodes an immuno conjugate fragment comprising at least one effector moiety, preferably a single-chain effector moiety, and at least first and second antigen binding moieties, wherein each of the antigen binding moieties comprises an scFv molecule joined at its carboxy-terminal amino acid to an IgG CH3 domain, and wherein one of the antigen binding moieties is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through a disulfide bond.
  • the polynucleotide of the invention encodes one of the antigen binding moieties and an effector moiety, preferably a single chain effector moiety.
  • an isolated polynucleotide of the invention encodes an immuno conjugate fragment comprising two effector moieties and two antigen binding moieties, wherein each of the antigen binding moieties comprises an scFv molecule joined at its carboxy-terminal amino acid to an IgG CH3 domain, and wherein one of the antigen binding moieties is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the second antigen binding moiety is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of the second effector moiety, and wherein the first and second antigen binding moieties are covalently linked through a disulfide bond.
  • the first and/or second effector moieties are single chain effector moieties.
  • the polynucleotide of the invention encodes one of the antigen binding moieties and one of the effector moieties, preferably a single chain effector moiety.
  • an isolated polynucleotide of the invention encodes an immuno conugate fragment comprising two effector moieties and two antigen binding moieties, wherein each of the antigen binding moieties comprises an Fab molecule joined at its heavy or light chain carboxy-terminal amino acid to an IgGl CH3 domain, and wherein each of the IgGl CH3 domains is joined at its carboxy-terminal amino acid to the amino -terminal amino acid of one of the effector moieties, and wherein the first and second antigen binding moieties are covalently linked through a disulfide bond.
  • the first and/or second effector moieties are single chain effector moieties.
  • the polynucleotide of the invention comprises a sequence encoding the heavy chain variable region of one of the antigen binding moieties and one of said effector moieties, preferably a single chain moiety.
  • the polynucleotide of the invention comprises a sequence encoding the light chain variable region of one of the antigen binding moieties and one of the effector moieties, preferably a single chain effector moiety.
  • the present invention is directed to an isolated polynucleotide encoding an immuno conjugate or fragment thereof, wherein the polynucleotide comprises a sequence that encodes a variable region sequence as shown in Table 3 below.
  • the present invention is directed to an isolated polynucleotide encoding an immunoconjugate or fragment thereof, wherein the polynucleotide comprises a sequence that encodes a polypeptide sequence as shown in Table 4.
  • the invention is further directed to an isolated nucleic acid encoding an immunoconjugate or fragment thereof, wherein the nucleic acid comprises a sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence shown in Tables 6 and 8 below.
  • the invention is directed to an isolated nucleic acid encoding an immunoconjugate or fragment thereof, wherein the nucleic acid comprises a nucleic acid sequence shown in Tables 6 and 8.
  • the invention is directed to an isolated nucleic acid encoding an immunoconjugate or fragment thereof, wherein the nucleic acid comprises a sequence that encodes a variable region sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to an amino acid sequence in Table 3.
  • the invention is directed to an isolated nucleic acid encoding an immunoconjugate or fragment thereof, wherein the nucleic acid comprises a sequence that encodes a polypeptide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to an amino acid sequence in Table 4.
  • the invention encompasses an isolated nucleic acid encoding an immunoconjugate or fragment thereof, wherein the nucleic acid comprises a sequence that encodes the variable region sequences of Table 3 with conservative amino acid substitutions.
  • the invention also encompasses an isolated nucleic acid encoding an immunoconjugate of the invention or fragment thereof, wherein the nucleic acid comprises a sequence that encodes the polypeptide sequences of Table 4 with conservative amino acid substitutions.
  • NUCLEOTIDE SEQUENCE SEQ ID NO domain + CL TTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTG
  • Murine FAP CGTCCCTCAAGAGTTTACAAACCTGAAGGAAACACAAAG 56 ectodomain+poly- AGAGCTCTTACCTTGAAGGATATTTTAAATGGAACATTCT
  • cytokine fusion TCACCTTTAGCAGTTATGCCATGAGCTGGGTCCGCCAGGC
  • cytokine fusion TCACCTTTAGCAGTTATGCCATGAGCTGGGTCCGCCAGGC
  • cytokine fusion TCACCTTTAGCAGTTATGCCATGAGCTGGGTCCGCCAGGC
  • cytokine fusion TCACCTTTAGCAGTTATGCCATGAGCTGGGTCCGCCAGGC
  • G8 Fab-IL12-Fab GAGGTGCAATTGCTGGAAAGCGGCGGAGGACTGGTGCAG 220 (murine IL- 12; CCTGGCGGCAGCCTGAGACTGAGCTGCGCCGCCAGCGGC

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2010/061810 2009-08-17 2010-08-13 Targeted immunoconjugates Ceased WO2011020783A2 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
HK12110035.2A HK1169318B (en) 2009-08-17 2010-08-13 Targeted immunoconjugates
SG2012010690A SG178443A1 (en) 2009-08-17 2010-08-13 Targeted immunoconjugates
MX2012002014A MX2012002014A (es) 2009-08-17 2010-08-13 Inmunoconjugados dirigidos.
RU2012110127/10A RU2583876C2 (ru) 2009-08-17 2010-08-13 Иммуноконъюгаты направленного действия
ES10744911.8T ES2534085T3 (es) 2009-08-17 2010-08-13 Inmunoconjugados dirigidos
BR112012003739-0A BR112012003739A2 (pt) 2009-08-17 2010-08-13 imunoconjugados, polinucleotídeo, microorganismo transgênico, método para produzir o imunoconjugado, composição e usos do imunoconjugado e da composição
EP10744911.8A EP2467165B1 (en) 2009-08-17 2010-08-13 Targeted immunoconjugates
JP2012525147A JP5764127B2 (ja) 2009-08-17 2010-08-13 標的化イムノコンジュゲート
CA2769619A CA2769619C (en) 2009-08-17 2010-08-13 Targeted immunoconjugates
CN201080046453.8A CN102573922B (zh) 2009-08-17 2010-08-13 靶向性免疫缀合物
AU2010285071A AU2010285071A1 (en) 2009-08-17 2010-08-13 Targeted immunoconjugates
IL217844A IL217844A0 (en) 2009-08-17 2012-01-30 Targeted immunoconjugates
MA34588A MA33717B1 (fr) 2009-08-17 2012-01-30 Immunoconjugués ciblés
ZA2012/00767A ZA201200767B (en) 2009-08-17 2012-01-31 Targeted immunoconjugates

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US23458409P 2009-08-17 2009-08-17
US61/234,584 2009-08-17
EP10162410.4 2010-05-10
EP10162410 2010-05-10

Publications (2)

Publication Number Publication Date
WO2011020783A2 true WO2011020783A2 (en) 2011-02-24
WO2011020783A3 WO2011020783A3 (en) 2011-04-28

Family

ID=43033282

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/061810 Ceased WO2011020783A2 (en) 2009-08-17 2010-08-13 Targeted immunoconjugates

Country Status (21)

Country Link
US (1) US8945571B2 (enExample)
EP (1) EP2467165B1 (enExample)
JP (1) JP5764127B2 (enExample)
KR (2) KR101588598B1 (enExample)
CN (1) CN102573922B (enExample)
AR (1) AR077879A1 (enExample)
AU (1) AU2010285071A1 (enExample)
CA (1) CA2769619C (enExample)
CO (1) CO6430436A2 (enExample)
CR (1) CR20120042A (enExample)
EC (1) ECSP12011685A (enExample)
ES (1) ES2534085T3 (enExample)
IL (1) IL217844A0 (enExample)
MA (1) MA33717B1 (enExample)
MX (1) MX2012002014A (enExample)
PE (1) PE20120630A1 (enExample)
RU (1) RU2583876C2 (enExample)
SG (1) SG178443A1 (enExample)
TW (1) TW201119672A (enExample)
WO (1) WO2011020783A2 (enExample)
ZA (1) ZA201200767B (enExample)

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5992710A (ja) * 1982-11-16 1984-05-29 関西電力株式会社 直接水冷線路の立坑部の布設方法
WO2011040973A3 (en) * 2009-10-02 2011-11-24 Ludwig Institute For Cancer Research Ltd. Tnf-immunoconjugates with fibroblast activation protein antibodies and methods and uses thereof
WO2012020038A1 (en) * 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
WO2012020006A3 (en) * 2010-08-13 2012-04-12 Roche Glycart Ag Anti-fap antibodies and methods of use
WO2012107416A2 (en) 2011-02-10 2012-08-16 Roche Glycart Ag Improved immunotherapy
WO2012107417A1 (en) 2011-02-10 2012-08-16 Roche Glycart Ag Mutant interleukin-2 polypeptides
WO2012146628A1 (en) 2011-04-29 2012-11-01 Roche Glycart Ag Novel immunoconjugates
WO2014023709A1 (en) 2012-08-09 2014-02-13 Roche Glycart Ag Asgpr antibodies and uses thereof
WO2014043523A1 (en) * 2012-09-14 2014-03-20 The Johns Hopkins University Compositions and methods for rendering tumor cells susceptible to cd8+ t cell-mediated killing
WO2015007542A1 (en) * 2013-07-19 2015-01-22 Vib Vzw Targeted modified il-1 family members
JP2015525791A (ja) * 2012-08-07 2015-09-07 ロシュ グリクアート アーゲー 低下した及び増加したエフェクター機能を有するように操作された2つの抗体を含む組成物。
WO2015168474A1 (en) * 2014-04-30 2015-11-05 President And Fellows Of Harvard College Fusion proteins for treating cancer and related methods
US9346872B2 (en) 2012-08-08 2016-05-24 Roche Glycart Ag Interleukin-10 fusion proteins
WO2016116399A1 (en) * 2015-01-19 2016-07-28 Philogen S.P.A. Anti-fibroblast activation protein (fap) antibodies for treatment and diagnosis
WO2016156291A1 (en) * 2015-03-31 2016-10-06 F. Hoffmann-La Roche Ag Antigen binding molecules comprising a trimeric tnf family ligand
US9492562B2 (en) 2012-01-20 2016-11-15 Vib Vzw Targeted human-interferon fusion proteins
AU2015213405B2 (en) * 2010-08-13 2017-08-03 Roche Glycart Ag Anti-FAP antibodies and methods of use
US9732135B2 (en) 2013-07-19 2017-08-15 Vib Vzw Targeting of human interferon antagonists
WO2017194782A3 (en) * 2016-05-13 2017-12-21 Orionis Biosciences Nv Therapeutic targeting of non-cellular structures
US9914759B2 (en) 2013-07-19 2018-03-13 Vib Vzw Targeted modified TNF family members
US9926379B2 (en) 2013-04-03 2018-03-27 Roche Glycart Ag Bispecific antibodies specific for FAP and DR5, antibodies specific for DR5
EP3356403A2 (en) * 2015-10-02 2018-08-08 H. Hoffnabb-La Roche Ag Bispecific antibodies specific for a costimulatory tnf receptor
WO2018146074A1 (en) * 2017-02-07 2018-08-16 Vib Vzw Immune-cell targeted bispecific chimeric proteins and uses thereof
WO2018184965A1 (en) 2017-04-03 2018-10-11 F. Hoffmann-La Roche Ag Immunoconjugates of il-2 with an anti-pd-1 and tim-3 bispecific antibody
WO2018184964A1 (en) 2017-04-03 2018-10-11 F. Hoffmann-La Roche Ag Immunoconjugates of an anti-pd-1 antibody with a mutant il-2 or with il-15
WO2018189220A1 (en) 2017-04-13 2018-10-18 F. Hoffmann-La Roche Ag An interleukin-2 immunoconjugate, a cd40 agonist, and optionally a pd-1 axis binding antagonist for use in methods of treating cancer
US10144768B2 (en) 2015-12-04 2018-12-04 Novartis Ag Antibody cytokine engrafted compositions and methods of use for immunoregulation
WO2019154986A1 (en) * 2018-02-09 2019-08-15 Philogen S.P.A. Edb targeting il-12 compositions
US10392445B2 (en) 2014-11-14 2019-08-27 Hoffmann-La Roche Inc. Tumor necrosis factor (TNF) family ligand trimer-containing antigen-binding molecules
RU2708558C1 (ru) * 2018-12-13 2019-12-09 Российская Федерация, от имени которой выступает ФОНД ПЕРСПЕКТИВНЫХ ИССЛЕДОВАНИЙ Способ создания противоопухолевой иммунологической защиты к клеткам лимфомы EL-4
US10604576B2 (en) 2016-06-20 2020-03-31 Kymab Limited Antibodies and immunocytokines
US10640542B2 (en) 2013-07-18 2020-05-05 Vib Vzw Fusokines involving cytokines with strongly reduced receptor binding affinities
WO2021001289A1 (en) 2019-07-02 2021-01-07 F. Hoffmann-La Roche Ag Immunoconjugates comprising a mutant interleukin-2 and an anti-cd8 antibody
US10906985B2 (en) 2017-02-06 2021-02-02 Orionis Biosciences, Inc. Targeted engineered interferon and uses thereof
WO2021030657A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Materials and methods for improved single chain variable fragments
US10988538B2 (en) 2016-02-05 2021-04-27 Orionis Biosciences BV Bispecific signaling agents and uses thereof
US11084859B2 (en) 2016-10-24 2021-08-10 Orionis Biosciences BV Targeted mutant interferon-gamma and uses thereof
WO2021209402A2 (en) 2020-04-15 2021-10-21 F. Hoffmann-La Roche Ag Immunoconjugates
US11168139B2 (en) 2016-11-28 2021-11-09 Chugai Seiyaku Kabushiki Kaisha Antigen-binding domain, and polypeptide including conveying section
US20210363261A1 (en) * 2018-05-16 2021-11-25 Dragonfly Therapeutics, Inc. Protein binding nkg2d, cd16 and a fibroblast activation protein
US11236141B2 (en) 2016-05-13 2022-02-01 Orionis Biosciences BV Targeted mutant interferon-beta and uses thereof
US11248057B2 (en) 2016-03-07 2022-02-15 Vib Vzw CD20 binding single domain antibodies
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
WO2022117692A2 (en) 2020-12-04 2022-06-09 F. Hoffmann-La Roche Ag Ph-dependent mutant interleukin-2 polypeptides
US11384154B2 (en) 2017-02-06 2022-07-12 Orionis Biosciences BV Targeted chimeric proteins and uses thereof
WO2022148853A1 (en) 2021-01-11 2022-07-14 F. Hoffmann-La Roche Ag Immunoconjugates
US11440943B2 (en) 2019-03-28 2022-09-13 Orionis Biosciences, Inc. Therapeutic interferon alpha 1 proteins
WO2022189377A1 (en) 2021-03-09 2022-09-15 F. Hoffmann-La Roche Ag Combination therapy of pd-1-targeted il-2 variant immunoconjugates and fap/4-1bb binding molecules
WO2022189380A1 (en) 2021-03-09 2022-09-15 F. Hoffmann-La Roche Ag Combination therapy of pd-1-targeted il-2 variant immunoconjugate and anti-tyrp1/anti-cd3 bispecific antibodies
US11498966B2 (en) 2017-08-09 2022-11-15 Orionis Biosciences Inc. PD-1 and PD-L1 binding agents
US11518808B2 (en) 2018-01-12 2022-12-06 Amgen Inc. Anti-PD-1 antibodies and methods of treatment
US11541103B2 (en) 2017-08-03 2023-01-03 Amgen Inc. Interleukin-21 mutein/ anti-PD-1 antibody conjugates
US11566072B2 (en) 2017-08-09 2023-01-31 Orionis Biosciences, Inc. CD8 binding agents
WO2023062050A1 (en) 2021-10-14 2023-04-20 F. Hoffmann-La Roche Ag New interleukin-7 immunoconjugates
WO2023062048A1 (en) 2021-10-14 2023-04-20 F. Hoffmann-La Roche Ag Alternative pd1-il7v immunoconjugates for the treatment of cancer
US11661455B2 (en) 2016-02-05 2023-05-30 Orionis Biosciences BV Chimeric protein comprising an interferon alpha 2mutant and a PD-L1 binding moiety
WO2023094569A1 (en) 2021-11-26 2023-06-01 F. Hoffmann-La Roche Ag Combination therapy of anti-tyrp1/anti-cd3 bispecific antibodies and tyrp1-specific antibodies
US11702477B2 (en) 2015-11-06 2023-07-18 Orionis Biosciences BV Bi-functional chimeric proteins and uses thereof
EP3976638A4 (en) * 2019-05-24 2023-08-23 Proviva Therapeutics (Hong Kong) Limited Il-2 compositions and methods of use thereof
US11753479B2 (en) 2014-03-04 2023-09-12 Kymab Limited Nucleic acids encoding anti-OX40L antibodies
US11779604B2 (en) 2016-11-03 2023-10-10 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses and methods
US11930837B2 (en) 2017-05-24 2024-03-19 Novartis Ag Antibody-cytokine engrafted proteins and methods of use for immune related disorders
US12006354B2 (en) 2017-05-24 2024-06-11 Novartis Ag Antibody-IL2 engrafted proteins and methods of use in the treatment of cancer
US12030955B2 (en) 2017-11-28 2024-07-09 Chugai Seiyaku Kabushiki Kaisha Polypeptide including antigen-binding domain and carrying section
WO2024153725A1 (en) 2023-01-20 2024-07-25 F. Hoffmann-La Roche Ag Recombinant fc domain - il2 variant polypeptides and combination therapy with membrane-anchored antigen binding polypeptides
US12060654B2 (en) 2016-11-28 2024-08-13 Chugai Seiyaku Kabushiki Kaisha Ligand-binding molecule having adjustable ligand binding activity
US12077577B2 (en) 2018-05-30 2024-09-03 Chugai Seiyaku Kabushiki Kaisha Polypeptide comprising aggrecan binding domain and carrying moiety
US12084497B2 (en) 2018-08-08 2024-09-10 Orionis Biosciences, Inc. SIRP1α targeted chimeric proteins and uses thereof
US12091463B2 (en) 2017-08-09 2024-09-17 Orionis Biosciences, Inc. Clec9A binding agents comprising a recombinant heavy-chain only antibody (VHH)
US12195528B2 (en) 2017-11-28 2025-01-14 Chugai Seiyaku Kabushiki Kaisha Ligand-binding molecule having adjustable ligand-binding activity
US12209128B2 (en) 2016-06-20 2025-01-28 Kymab Limited Anti-PD-L1 antibodies
US12275796B2 (en) 2019-12-03 2025-04-15 Evotec International Gmbh Interferon-associated antigen binding proteins and uses thereof
US12351614B2 (en) 2019-03-28 2025-07-08 Orionis Biosciences, Inc. CLEC9A-based chimeric protein complexes
US12410225B2 (en) 2018-11-08 2025-09-09 Orionis Biosciences, Inc Modulation of dendritic cell lineages
WO2025202147A1 (en) 2024-03-27 2025-10-02 F. Hoffmann-La Roche Ag Interleukin-7 immunoconjugates
WO2025233304A1 (en) 2024-05-08 2025-11-13 F. Hoffmann-La Roche Ag Recombinant fc domain – il7 variant polypeptides and combination therapy with membrane-anchored antigen binding polypeptides
US12544426B2 (en) 2019-06-19 2026-02-10 Orionis Biosciences, Inc. Combination therapy with CD13-targeted chimeric proteins or chimeric protein complexes

Families Citing this family (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2014109038A (ru) 2011-08-23 2015-09-27 Рош Гликарт Аг Антитела к хондроитинсульфат протеогликану меланомы
CA2849033C (en) * 2011-09-26 2020-05-05 Philogen S.P.A. Immunocytokine combination therapy
US20140079636A1 (en) * 2012-04-16 2014-03-20 Dinesh U. Chimmanamada Targeted therapeutics
WO2014172448A2 (en) * 2013-04-17 2014-10-23 Anaptysbio, Inc. Antibodies directed against activin receptor type ii (actrii)
EP3738594A1 (en) 2013-09-10 2020-11-18 Madrigal Pharmaceuticals, Inc. Targeted therapeutics having an hsp90 ligand as binding moiety
WO2015066053A2 (en) 2013-10-28 2015-05-07 Synta Pharmaceuticals Corp. Targeted therapeutics
EP3099332A4 (en) 2014-01-29 2017-06-21 Madrigal Pharmaceuticals, Inc. Targeted therapeutics
JP6576942B6 (ja) 2014-03-03 2019-11-27 マドリガル ファーマシューティカルズ インコーポレイテッド 標的治療薬
MA39483A (fr) 2014-03-18 2015-09-24 Synta Pharmaceuticals Corp Agents thérapeutiques cibles
US11319344B2 (en) * 2015-02-13 2022-05-03 Agency For Science, Technology And Research Non-membrane disruptive P53 activating stapled peptides
CN106349393B (zh) * 2015-12-21 2020-10-30 合肥立方制药股份有限公司 一种增强抗体药物稳定性的结构
US10696722B2 (en) 2016-08-10 2020-06-30 Ajou University Industry-Academic Cooperation Foundation Heterodimeric Fc-fused cytokine and pharmaceutical composition comprising the same
KR20190092371A (ko) * 2016-09-21 2019-08-07 더 위스타 인스티튜트 오브 아나토미 앤드 바이올로지 섬유아세포 활성화 단백질을 표적화하는 최적화된 합성 컨센서스 면역원성 조성물
ES3007557T3 (en) 2016-10-17 2025-03-20 Pfizer Anti-edb antibodies and antibody-drug conjugates
AU2017380981B2 (en) * 2016-12-19 2025-01-30 F. Hoffmann-La Roche Ag Combination therapy with targeted 4-1BB (CD137) agonists
CN108250302A (zh) * 2016-12-29 2018-07-06 天津天锐生物科技有限公司 一种多功能蛋白质
CA3067572A1 (en) 2017-06-20 2018-12-27 Madrigal Pharmaceuticals, Inc. Targeted therapeutics
KR20200016874A (ko) 2017-06-20 2020-02-17 마드리갈 파마슈티칼스 인코포레이티드 표적화 치료제를 포함하는 병용 요법
US12247060B2 (en) 2018-01-09 2025-03-11 Marengo Therapeutics, Inc. Calreticulin binding constructs and engineered T cells for the treatment of diseases
EP3765517A1 (en) 2018-03-14 2021-01-20 Elstar Therapeutics, Inc. Multifunctional molecules that bind to calreticulin and uses thereof
CA3105448A1 (en) 2018-07-03 2020-01-09 Elstar Therapeutics, Inc. Anti-tcr antibody molecules and uses thereof
CN112513276B (zh) * 2018-07-30 2024-03-15 张晋宇 蛋白质异二聚体及其用途
EP3847242A4 (en) * 2018-09-07 2022-06-08 NantBio, Inc. TARGETED IL-12 TREATMENTS AND METHODS TO STIMULATE HANK AND NK92MI CELLS
SG11202104136YA (en) 2018-10-23 2021-05-28 Dragonfly Therapeutics Inc Heterodimeric fc-fused proteins
CN119039441A (zh) 2019-02-21 2024-11-29 马伦戈治疗公司 与nkp30结合的抗体分子及其用途
GB2599228B (en) 2019-02-21 2024-02-07 Marengo Therapeutics Inc Multifunctional molecules that bind to T cell related cancer cells and uses thereof
EP3980051A4 (en) * 2019-06-05 2023-09-13 Asher Biotherapeutics, Inc. FUSIONS OF MUTANT INTERLEUKIN-2 POLYPEPTIDES WITH ANTIGEN-BINDING MOLECULES TO MODULATE THE FUNCTION OF IMMUNE CELLS
WO2021127487A2 (en) 2019-12-20 2021-06-24 Regeneron Pharmaceuticals, Inc. Novel il2 agonists and methods of use thereof
AU2020416273A1 (en) 2020-01-03 2022-07-28 Marengo Therapeutics, Inc. Anti-TCR antibody molecules and uses thereof
AU2021252514B2 (en) * 2020-04-06 2025-06-26 Lung Biotechnology Pbc Modular synthetic receptors and methods of use
IL298136A (en) 2020-05-13 2023-01-01 Bonum Therapeutics Inc Preparations of protein complexes and methods of using them
IL300534A (en) * 2020-08-11 2023-04-01 Kanaph Therapeutics Inc A fusion protein containing 12-il and an anti-fap antibody, and its use
EP4297785A4 (en) 2021-02-26 2025-01-22 New York University COMPOSITIONS AND METHODS USING ANTIBODIES FOR BINDING TO COVALENT PEPTIDE CONJUGATES
TW202317623A (zh) 2021-06-14 2023-05-01 美商再生元醫藥公司 基於il2之治療劑及其使用方法
JP7690131B2 (ja) * 2022-01-04 2025-06-09 フィロジェン ソチエタ ペル アツィオーニ Il-12を含むイムノサイトカインとキナーゼ阻害剤の組合せ

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006213A1 (en) 1991-09-23 1993-04-01 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5650150A (en) 1990-11-09 1997-07-22 Gillies; Stephen D. Recombinant antibody cytokine fusion proteins
WO1999029732A2 (en) 1997-12-08 1999-06-17 Lexigen Pharmaceuticals Corporation Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
WO2001062298A2 (en) 2000-02-24 2001-08-30 Philogen S.R.L. Compositions and methods for treatment of angiogenesis in pathological lesions
US20030040606A1 (en) 2001-06-27 2003-02-27 Leung Shawn Shui-On Reducing immunogenicities of immunoglobulins by framework-patching
US6632927B2 (en) 1989-12-21 2003-10-14 Celltech Therapeutics Limited Humanized antibodies
US20040132066A1 (en) 2002-02-14 2004-07-08 Kalobios, Inc. Methods for affinity maturation
WO2006100582A1 (en) 2005-03-25 2006-09-28 Glycart Biotechnology Ag Antigen binding molecules directed to mcsp and having increased fc receptor binding affinity and effector function
WO2006119897A2 (en) 2005-05-11 2006-11-16 Philogen S.P.A Fusion protein of antibody l19 against fibronectin ed-b and interleukin 12
WO2007128563A1 (en) 2006-05-08 2007-11-15 Philogen Spa Antibody-targeted cytokines for therapy

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001358A (en) 1995-11-07 1999-12-14 Idec Pharmaceuticals Corporation Humanized antibodies to human gp39, compositions containing thereof
JP2002501484A (ja) * 1997-03-05 2002-01-15 アメリカ合衆国 免疫毒素および免疫寛容を誘導する方法
WO2001075110A2 (en) * 2000-03-30 2001-10-11 Dyax Corp. Mucin-1 specific binding members and methods of use thereof
KR20030064275A (ko) * 2000-06-29 2003-07-31 메르크 파텐트 게엠베하 면역싸이토카인 흡수 증강제와의 조합 치료에 의한항체-싸이토카인 융합 단백질 매개 면역 반응 증강
US8491896B2 (en) * 2002-06-14 2013-07-23 Immunomedics, Inc. Anti-pancreatic cancer antibodies
US8744844B2 (en) * 2007-07-06 2014-06-03 Audience, Inc. System and method for adaptive intelligent noise suppression
EP2187971A2 (en) * 2007-08-01 2010-05-26 The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services A fold-back diabody diphtheria toxin immunotoxin and methods of use
WO2010059315A1 (en) 2008-11-18 2010-05-27 Merrimack Pharmaceuticals, Inc. Human serum albumin linkers and conjugates thereof

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6632927B2 (en) 1989-12-21 2003-10-14 Celltech Therapeutics Limited Humanized antibodies
US5650150A (en) 1990-11-09 1997-07-22 Gillies; Stephen D. Recombinant antibody cytokine fusion proteins
WO1993006213A1 (en) 1991-09-23 1993-04-01 Medical Research Council Production of chimeric antibodies - a combinatorial approach
WO1999029732A2 (en) 1997-12-08 1999-06-17 Lexigen Pharmaceuticals Corporation Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
WO2001062298A2 (en) 2000-02-24 2001-08-30 Philogen S.R.L. Compositions and methods for treatment of angiogenesis in pathological lesions
US20030040606A1 (en) 2001-06-27 2003-02-27 Leung Shawn Shui-On Reducing immunogenicities of immunoglobulins by framework-patching
US20040132066A1 (en) 2002-02-14 2004-07-08 Kalobios, Inc. Methods for affinity maturation
WO2006100582A1 (en) 2005-03-25 2006-09-28 Glycart Biotechnology Ag Antigen binding molecules directed to mcsp and having increased fc receptor binding affinity and effector function
WO2006119897A2 (en) 2005-05-11 2006-11-16 Philogen S.P.A Fusion protein of antibody l19 against fibronectin ed-b and interleukin 12
WO2007128563A1 (en) 2006-05-08 2007-11-15 Philogen Spa Antibody-targeted cytokines for therapy

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
BECKER J.C. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 7826 - 7831
BRACK, S.S. ET AL., CLIN. CANC. RES., vol. 12, no. 10, 2006, pages 3200 - 3208
BRUTLAG ET AL., COMP. APPL. BIOSCI., vol. 6, 1990, pages 237 - 245
CARTER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4285
CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901
CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
GRIFFITH ET AL., J. CELL. BIO., vol. 120, 1993, pages 885 - 896
HARVILL E.T.; MORRISON S.L., IMMUNOTECH., vol. I, no. 2, 1995, pages 95 - 105
HARVILL, E.T.; MORRISON S.L., IMMUNOTECHNOL, vol. 1, 1995, pages 95 - 105
HEELEY, R. P., ENDOCR. RES., vol. 28, 2002, pages 217 - 229
HOOGENBOOM ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 4133 - 4137
HUDSON; SOURIAU, NATURE MED., vol. 9, 2003, pages 129 - 134
JAKOBOVITS ET AL., NATURE, vol. 362, 1993, pages 255 - 258
JUN, L. ET AL., CHIN. MED. J., vol. 113, 2000, pages 151 - 153
KOZBOR ET AL., J IMMUNOL., vol. 133, 1984, pages 3001 - 3005
LILJEBLAD ET AL., GLYCO. J., vol. 17, 2000, pages 323 - 329
MARKS ET AL., BIOTECH, vol. 10, 1992, pages 779 - 783
MARKS ET AL., J. MOL. BIO., vol. 222, 1991, pages 581 - 597
MCCAFFERTY ET AL., NATURE, vol. 348, 1990, pages 552 - 554
MERCHANT, A.M. ET AL., NAT. BIOTECH., vol. 16, 1998, pages 677 - 681
MORRISON ET AL., PROC. NATL. ACAD. SCI., vol. 81, 1984, pages 6851 - 6855
MORRISON, ADV. IMMUNOL., vol. 44, 1988, pages 65 - 92
NAKAMURA K.; KUBO, A, ANCER SUPPLEMENT, vol. 80, 1997, pages 2650 - 2655
PADLAN, MOLEC. IMMUN., vol. 28, 1991, pages 489 - 498
PADLAN, MOLEC. IMMUN., vol. 31, no. 3, 1994, pages 169 - 217
PRESTA ET AL., J. IMMUNOL., vol. 151, 1993, pages 2623
SAVAGE, P. ET AL., BR. J. CANCER, vol. 67, 1993, pages 304 - 310
SIMS ET AL., J. IMMUNOL., vol. 151, 1993, pages 2296
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536
WATERHOUSE ET AL., NUCL. ACIDS RES, vol. 21, 1993, pages 2265 - 2266
XIANG, J ET AL., IMMUNOL. CELL BIOL., vol. 72, 1994, pages 275 - 285
XIANG, J, HUM. ANTIBODIES, vol. 9, 1999, pages 23 - 36
YANG J ET AL., MOL. IMMUNOL., vol. 32, 1995, pages 873 - 881

Cited By (173)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5992710A (ja) * 1982-11-16 1984-05-29 関西電力株式会社 直接水冷線路の立坑部の布設方法
WO2011040973A3 (en) * 2009-10-02 2011-11-24 Ludwig Institute For Cancer Research Ltd. Tnf-immunoconjugates with fibroblast activation protein antibodies and methods and uses thereof
CN103168049A (zh) * 2010-08-13 2013-06-19 罗切格利卡特公司 抗生腱蛋白-c a2抗体及使用方法
EP3333194A1 (en) * 2010-08-13 2018-06-13 Roche Glycart AG Anti-fap antibodies and methods of use
US20120128591A1 (en) * 2010-08-13 2012-05-24 Marina Bacac Anti-fap antibodies and methods of use
EA037977B1 (ru) * 2010-08-13 2021-06-18 Роше Гликарт Аг Антитела к fap, способы их получения и применения
US10253110B2 (en) 2010-08-13 2019-04-09 Roche Glycart Ag Anti-FAP antibodies and methods of use
WO2012020038A1 (en) * 2010-08-13 2012-02-16 Roche Glycart Ag Anti-tenascin-c a2 antibodies and methods of use
AU2015213405B2 (en) * 2010-08-13 2017-08-03 Roche Glycart Ag Anti-FAP antibodies and methods of use
US12286486B2 (en) 2010-08-13 2025-04-29 Roche Glycart Ag Anti-FAP antibodies and methods of use
US11332545B2 (en) 2010-08-13 2022-05-17 Roche Glycart Ag Anti-FAP antibodies and methods of use
JP2013542714A (ja) * 2010-08-13 2013-11-28 ロシュ グリクアート アーゲー 抗fap抗体及び使用の方法
AU2020201916B2 (en) * 2010-08-13 2022-02-03 Roche Glycart Ag Anti-FAP antibodies and methods of use
WO2012020006A3 (en) * 2010-08-13 2012-04-12 Roche Glycart Ag Anti-fap antibodies and methods of use
US20160060356A1 (en) * 2010-08-13 2016-03-03 Roche Glycart Ag Anti-fap antibodies and methods of use
AU2017251851B2 (en) * 2010-08-13 2019-12-19 Roche Glycart Ag Anti-FAP antibodies and methods of use
US10577429B2 (en) 2010-08-13 2020-03-03 Roche Glycart Ag Anti-FAP antibodies and methods of use
US9011847B2 (en) 2010-08-13 2015-04-21 Roche Glycart, AG Anti-FAP antibodies and methods of use
EA034742B1 (ru) * 2010-08-13 2020-03-16 Роше Гликарт Аг Антитела к fap, полинуклеотид, вектор и клетка для их получения и их применения
AU2011288487B2 (en) * 2010-08-13 2015-10-01 Roche Glycart Ag Anti-FAP antibodies and methods of use
CN103168049B (zh) * 2010-08-13 2015-10-07 罗切格利卡特公司 抗生腱蛋白-c a2抗体及使用方法
US9156913B2 (en) 2010-08-13 2015-10-13 Roche Glycart Ag Anti-tenascin-C A2 antibodies and methods of use
JP2015180632A (ja) * 2010-08-13 2015-10-15 ロシュ グリクアート アーゲー 抗fap抗体及び使用の方法
US20120258073A1 (en) * 2011-02-10 2012-10-11 Christian Gerdes Immunotherapy
US9266938B2 (en) 2011-02-10 2016-02-23 Roche Glycart Ag Mutant interleukin-2 polypeptides
US10323098B2 (en) 2011-02-10 2019-06-18 Roche Glycart Ag Mutant interleukin-2 polypeptides
US20140065097A1 (en) * 2011-02-10 2014-03-06 Roche Glycart Ag Immunotherapy
EP3971206A1 (en) 2011-02-10 2022-03-23 Roche Glycart AG Mutant interleukin-2 polypeptides
US10184009B2 (en) 2011-02-10 2019-01-22 Roche Glycart Ag Mutant interleukin-2 polypeptides
EP3489255A1 (en) 2011-02-10 2019-05-29 Roche Glycart AG Mutant interleukin-2 polypeptides
WO2012107416A3 (en) * 2011-02-10 2012-10-04 Roche Glycart Ag Improved immunotherapy
WO2012107417A1 (en) 2011-02-10 2012-08-16 Roche Glycart Ag Mutant interleukin-2 polypeptides
WO2012107416A2 (en) 2011-02-10 2012-08-16 Roche Glycart Ag Improved immunotherapy
US11111312B2 (en) 2011-02-10 2021-09-07 Roche Glycart Ag Mutant interleukin-2 polypeptides
US11130822B2 (en) 2011-04-29 2021-09-28 Roche Glycart Ag Immunoconjugates
EA025851B1 (ru) * 2011-04-29 2017-02-28 Роше Гликарт Аг Новые иммуноконъюгаты
AU2012247548B2 (en) * 2011-04-29 2017-05-11 Roche Glycart Ag Novel immunoconjugates
WO2012146628A1 (en) 2011-04-29 2012-11-01 Roche Glycart Ag Novel immunoconjugates
US10202464B2 (en) 2011-04-29 2019-02-12 Roche Glycart Ag Immunoconjugates
JP2016175916A (ja) * 2011-04-29 2016-10-06 ロシュ グリクアート アーゲー 新規なイムノコンジュゲート
US10316104B2 (en) 2011-04-29 2019-06-11 Roche Glycart Ag Immunoconjugates
JP2014519807A (ja) * 2011-04-29 2014-08-21 ロシュ グリクアート アーゲー 新規なイムノコンジュゲート
EA034251B1 (ru) * 2011-04-29 2020-01-22 Роше Гликарт Аг Новые иммуноконъюгаты
US9447159B2 (en) 2011-04-29 2016-09-20 Roche Glycart Ag Immunoconjugates
US10034919B2 (en) 2012-01-20 2018-07-31 Vib Vzw Targeted human-interferon fusion proteins
US10946070B2 (en) 2012-01-20 2021-03-16 Vib Vzw Targeted and mutated human-interferon fusion proteins
US9492562B2 (en) 2012-01-20 2016-11-15 Vib Vzw Targeted human-interferon fusion proteins
US9878014B2 (en) 2012-01-20 2018-01-30 Vib Vzw Targeted human-interferon fusion proteins
JP2015525791A (ja) * 2012-08-07 2015-09-07 ロシュ グリクアート アーゲー 低下した及び増加したエフェクター機能を有するように操作された2つの抗体を含む組成物。
US10040843B2 (en) 2012-08-08 2018-08-07 Roche Glycart Ag Interleukin-10 fusion proteins and uses thereof
US9346872B2 (en) 2012-08-08 2016-05-24 Roche Glycart Ag Interleukin-10 fusion proteins
WO2014023709A1 (en) 2012-08-09 2014-02-13 Roche Glycart Ag Asgpr antibodies and uses thereof
WO2014043523A1 (en) * 2012-09-14 2014-03-20 The Johns Hopkins University Compositions and methods for rendering tumor cells susceptible to cd8+ t cell-mediated killing
US10183985B2 (en) 2012-09-14 2019-01-22 The Johns Hopkins University Compositions and methods for rendering tumor cells susceptible to CD8+ T cell-mediated killing
US9561275B2 (en) 2012-09-14 2017-02-07 The Johns Hopkins University Compositions and methods for rendering tumor cells susceptible to CD8+ T cell-mediated killing
US9926379B2 (en) 2013-04-03 2018-03-27 Roche Glycart Ag Bispecific antibodies specific for FAP and DR5, antibodies specific for DR5
US11214622B2 (en) 2013-04-03 2022-01-04 Roche Glycart Ag Antibodies specific for DR5 and methods of use
US12410222B2 (en) 2013-07-18 2025-09-09 Vib Vzw Fusokines involving cytokines with strongly reduced receptor binding affinities
US11358997B2 (en) 2013-07-18 2022-06-14 Vib Vzw Fusokines involving cytokines with strongly reduced receptor binding affinities
US10640542B2 (en) 2013-07-18 2020-05-05 Vib Vzw Fusokines involving cytokines with strongly reduced receptor binding affinities
KR20160108293A (ko) * 2013-07-19 2016-09-19 브이아이비 브이지더블유 표적화된 변형된 il-1 패밀리 구성원
US9932409B2 (en) 2013-07-19 2018-04-03 Vib Vzw Targeted modified IL-1 family members
US9732135B2 (en) 2013-07-19 2017-08-15 Vib Vzw Targeting of human interferon antagonists
CN105612180A (zh) * 2013-07-19 2016-05-25 弗拉芒区生物技术研究所 经靶向修饰的il-1家族成员
US10947288B2 (en) 2013-07-19 2021-03-16 Vib Vzw Targeting of human interferon antagonists
AU2014292377B2 (en) * 2013-07-19 2019-08-01 Centre Hospitalier Regional Universitaire De Montpellier Targeted modified IL-1 family members
US9914759B2 (en) 2013-07-19 2018-03-13 Vib Vzw Targeted modified TNF family members
US12227550B2 (en) 2013-07-19 2025-02-18 Vib Vzw Targeted modified TNF family members
US10407480B2 (en) 2013-07-19 2019-09-10 Vib Vzw Targeted modified TNF family members
US10072059B2 (en) 2013-07-19 2018-09-11 Vib Vzw Targeting of human interferon antagonists
CN105612180B (zh) * 2013-07-19 2019-11-12 弗拉芒区生物技术研究所 经靶向修饰的il-1家族成员
US11396532B2 (en) 2013-07-19 2022-07-26 Vib Vzw Targeted modified TNF family members
WO2015007542A1 (en) * 2013-07-19 2015-01-22 Vib Vzw Targeted modified il-1 family members
US10787493B2 (en) 2013-07-19 2020-09-29 Vib Vzw Targeted modified TNF family members
US10035835B2 (en) 2013-07-19 2018-07-31 Vib Vzw Targeted modified TNF family members
US11753479B2 (en) 2014-03-04 2023-09-12 Kymab Limited Nucleic acids encoding anti-OX40L antibodies
US11773175B2 (en) 2014-03-04 2023-10-03 Kymab Limited Antibodies, uses and methods
WO2015168474A1 (en) * 2014-04-30 2015-11-05 President And Fellows Of Harvard College Fusion proteins for treating cancer and related methods
US10538566B2 (en) 2014-04-30 2020-01-21 President And Fellows Of Harvard College Fusion proteins for treating cancer and related methods
US10308697B2 (en) 2014-04-30 2019-06-04 President And Fellows Of Harvard College Fusion proteins for treating cancer and related methods
US11014973B2 (en) 2014-04-30 2021-05-25 President And Fellows Of Harvard College Fusion proteins for treating cancer and related methods
US10392445B2 (en) 2014-11-14 2019-08-27 Hoffmann-La Roche Inc. Tumor necrosis factor (TNF) family ligand trimer-containing antigen-binding molecules
US11267903B2 (en) 2014-11-14 2022-03-08 Hofmann-La Roche Inc. Antigen-binding molecules comprising a tumor necrosis factor (TNF) family ligand trimer
US11306154B2 (en) 2014-11-14 2022-04-19 Hoffmann-La Roche Inc. Methods of treating cancer by administering antigen-binding molecules comprising a TNF family ligand trimer
US12441812B2 (en) 2014-11-14 2025-10-14 Hoffmann-La Roche Inc. Methods of treating cancer by administering tumor necrosis factor (TNF) family ligand trimer-containing antigen-binding molecules
WO2016116399A1 (en) * 2015-01-19 2016-07-28 Philogen S.P.A. Anti-fibroblast activation protein (fap) antibodies for treatment and diagnosis
US10519246B2 (en) 2015-01-19 2019-12-31 Philogen Spa Anti-fibroblast activation protein (FAP) antibodies for treatment and diagnosis
US10464981B2 (en) 2015-03-31 2019-11-05 Hoffmann-La Roche, Inc. Tumor necrosis factor (TNF) family ligand trimer-containing antigen binding molecules
EP3973980A1 (en) * 2015-03-31 2022-03-30 F. Hoffmann-La Roche AG Antigen binding molecules comprising a trimeric tnf family ligand
JP2018512137A (ja) * 2015-03-31 2018-05-17 エフ・ホフマン−ラ・ロシュ・アクチェンゲゼルシャフト 三量体tnfファミリーリガンドを含む抗原結合分子
US12202870B2 (en) 2015-03-31 2025-01-21 Hoffmann-La Roche Inc. Antigen binding molecules comprising a trimeric TNF family ligand and encoding polynucleotides thereof
WO2016156291A1 (en) * 2015-03-31 2016-10-06 F. Hoffmann-La Roche Ag Antigen binding molecules comprising a trimeric tnf family ligand
JP6996979B2 (ja) 2015-03-31 2022-02-04 エフ・ホフマン-ラ・ロシュ・アクチェンゲゼルシャフト 三量体tnfファミリーリガンドを含む抗原結合分子
US11286300B2 (en) 2015-10-01 2022-03-29 Hoffmann-La Roche Inc. Humanized anti-human CD19 antibodies and methods of use
US12240911B2 (en) 2015-10-02 2025-03-04 Hoffmann-La Roche Inc. Bispecific antibodies specific for OX40
EP3356403A2 (en) * 2015-10-02 2018-08-08 H. Hoffnabb-La Roche Ag Bispecific antibodies specific for a costimulatory tnf receptor
AU2016329120B2 (en) * 2015-10-02 2023-04-13 F. Hoffmann-La Roche Ag Bispecific antibodies specific for a costimulatory TNF receptor
US10526413B2 (en) 2015-10-02 2020-01-07 Hoffmann-La Roche Inc. Bispecific antibodies specific for OX40
US11702477B2 (en) 2015-11-06 2023-07-18 Orionis Biosciences BV Bi-functional chimeric proteins and uses thereof
US11136366B2 (en) 2015-12-04 2021-10-05 Novartis Ag Methods of treating immune related disorders using antibody-cytokine engrafted compositions
US10144768B2 (en) 2015-12-04 2018-12-04 Novartis Ag Antibody cytokine engrafted compositions and methods of use for immunoregulation
US11001631B2 (en) 2016-02-05 2021-05-11 Orionis Biosciences BV Clec9A binding agents
US10988538B2 (en) 2016-02-05 2021-04-27 Orionis Biosciences BV Bispecific signaling agents and uses thereof
US11236166B2 (en) 2016-02-05 2022-02-01 Orionis Biosciences BV CD8 binding agents
US11661455B2 (en) 2016-02-05 2023-05-30 Orionis Biosciences BV Chimeric protein comprising an interferon alpha 2mutant and a PD-L1 binding moiety
US12453770B2 (en) 2016-02-05 2025-10-28 Orionis Biosciences BV CLEC9A binding agents
US12364753B2 (en) 2016-02-05 2025-07-22 Orionis Biosciences BV CD8 binding agents
US11248057B2 (en) 2016-03-07 2022-02-15 Vib Vzw CD20 binding single domain antibodies
US12540192B2 (en) 2016-03-07 2026-02-03 Vib Vzw CD20 binding single domain antibodies
US12497436B2 (en) 2016-05-13 2025-12-16 Orionis Biosciences BV Chimeric protein, and encoding nucleic acid thereof, comprising interferon-β and a targeting moiety comprising a single-domain antibody or single-chain antibody
CN109563141A (zh) * 2016-05-13 2019-04-02 奥里尼斯生物科学公司 对非细胞结构的治疗性靶向
WO2017194782A3 (en) * 2016-05-13 2017-12-21 Orionis Biosciences Nv Therapeutic targeting of non-cellular structures
US11753463B2 (en) 2016-05-13 2023-09-12 Orionis Biosciences BV Therapeutic targeting of non-cellular structures
US11236141B2 (en) 2016-05-13 2022-02-01 Orionis Biosciences BV Targeted mutant interferon-beta and uses thereof
US12209128B2 (en) 2016-06-20 2025-01-28 Kymab Limited Anti-PD-L1 antibodies
US10604576B2 (en) 2016-06-20 2020-03-31 Kymab Limited Antibodies and immunocytokines
US12522641B2 (en) 2016-10-24 2026-01-13 Orionis Biosciences BV Targeted mutant interferon-gamma and uses thereof
US11084859B2 (en) 2016-10-24 2021-08-10 Orionis Biosciences BV Targeted mutant interferon-gamma and uses thereof
US11779604B2 (en) 2016-11-03 2023-10-10 Kymab Limited Antibodies, combinations comprising antibodies, biomarkers, uses and methods
US11932697B2 (en) 2016-11-28 2024-03-19 Chugai Seiyaku Kabushiki Kaisha Antigen-binding domain, and polypeptide including conveying section
US11168139B2 (en) 2016-11-28 2021-11-09 Chugai Seiyaku Kabushiki Kaisha Antigen-binding domain, and polypeptide including conveying section
US12060654B2 (en) 2016-11-28 2024-08-13 Chugai Seiyaku Kabushiki Kaisha Ligand-binding molecule having adjustable ligand binding activity
US10906985B2 (en) 2017-02-06 2021-02-02 Orionis Biosciences, Inc. Targeted engineered interferon and uses thereof
US11384154B2 (en) 2017-02-06 2022-07-12 Orionis Biosciences BV Targeted chimeric proteins and uses thereof
US12473338B2 (en) 2017-02-06 2025-11-18 Orionis Biosciences, Inc. Targeted engineered interferon and uses thereof
US12527843B2 (en) 2017-02-07 2026-01-20 Vib Vzw Immune-cell targeted bispecific chimeric proteins and uses thereof
US11246911B2 (en) 2017-02-07 2022-02-15 Vib Vzw Immune-cell targeted bispecific chimeric proteins and uses thereof
WO2018146074A1 (en) * 2017-02-07 2018-08-16 Vib Vzw Immune-cell targeted bispecific chimeric proteins and uses thereof
WO2018184965A1 (en) 2017-04-03 2018-10-11 F. Hoffmann-La Roche Ag Immunoconjugates of il-2 with an anti-pd-1 and tim-3 bispecific antibody
WO2018184964A1 (en) 2017-04-03 2018-10-11 F. Hoffmann-La Roche Ag Immunoconjugates of an anti-pd-1 antibody with a mutant il-2 or with il-15
WO2018189220A1 (en) 2017-04-13 2018-10-18 F. Hoffmann-La Roche Ag An interleukin-2 immunoconjugate, a cd40 agonist, and optionally a pd-1 axis binding antagonist for use in methods of treating cancer
US11930837B2 (en) 2017-05-24 2024-03-19 Novartis Ag Antibody-cytokine engrafted proteins and methods of use for immune related disorders
US12006354B2 (en) 2017-05-24 2024-06-11 Novartis Ag Antibody-IL2 engrafted proteins and methods of use in the treatment of cancer
US11541103B2 (en) 2017-08-03 2023-01-03 Amgen Inc. Interleukin-21 mutein/ anti-PD-1 antibody conjugates
US11566072B2 (en) 2017-08-09 2023-01-31 Orionis Biosciences, Inc. CD8 binding agents
US12091463B2 (en) 2017-08-09 2024-09-17 Orionis Biosciences, Inc. Clec9A binding agents comprising a recombinant heavy-chain only antibody (VHH)
US12351633B2 (en) 2017-08-09 2025-07-08 Orionis Biosciences, Inc. PD-1 and PD-L1 binding agents
US12448447B2 (en) 2017-08-09 2025-10-21 Orionis Biosciences, Inc. CD8 binding agents
US11498966B2 (en) 2017-08-09 2022-11-15 Orionis Biosciences Inc. PD-1 and PD-L1 binding agents
US12195528B2 (en) 2017-11-28 2025-01-14 Chugai Seiyaku Kabushiki Kaisha Ligand-binding molecule having adjustable ligand-binding activity
US12030955B2 (en) 2017-11-28 2024-07-09 Chugai Seiyaku Kabushiki Kaisha Polypeptide including antigen-binding domain and carrying section
US11518808B2 (en) 2018-01-12 2022-12-06 Amgen Inc. Anti-PD-1 antibodies and methods of treatment
WO2019154986A1 (en) * 2018-02-09 2019-08-15 Philogen S.P.A. Edb targeting il-12 compositions
KR20200109380A (ko) * 2018-02-09 2020-09-22 필로겐 에스.피.에이. Edb 표적화 il-12 조성물
CN111683687A (zh) * 2018-02-09 2020-09-18 菲洛根股份公司 靶向edb的il-12组合物
US12173044B2 (en) 2018-02-09 2024-12-24 Philogen S.P.A. EDB targeting IL-12 compositions
KR102259085B1 (ko) 2018-02-09 2021-06-03 필로겐 에스.피.에이. Edb 표적화 il-12 조성물
US20210363261A1 (en) * 2018-05-16 2021-11-25 Dragonfly Therapeutics, Inc. Protein binding nkg2d, cd16 and a fibroblast activation protein
US12077577B2 (en) 2018-05-30 2024-09-03 Chugai Seiyaku Kabushiki Kaisha Polypeptide comprising aggrecan binding domain and carrying moiety
US12084497B2 (en) 2018-08-08 2024-09-10 Orionis Biosciences, Inc. SIRP1α targeted chimeric proteins and uses thereof
US12410225B2 (en) 2018-11-08 2025-09-09 Orionis Biosciences, Inc Modulation of dendritic cell lineages
RU2708558C1 (ru) * 2018-12-13 2019-12-09 Российская Федерация, от имени которой выступает ФОНД ПЕРСПЕКТИВНЫХ ИССЛЕДОВАНИЙ Способ создания противоопухолевой иммунологической защиты к клеткам лимфомы EL-4
US12583898B2 (en) 2019-03-28 2026-03-24 Orionis Biosciences, Inc. Therapeutic interferon alpha 1 proteins
US12351614B2 (en) 2019-03-28 2025-07-08 Orionis Biosciences, Inc. CLEC9A-based chimeric protein complexes
US11440943B2 (en) 2019-03-28 2022-09-13 Orionis Biosciences, Inc. Therapeutic interferon alpha 1 proteins
EP3976638A4 (en) * 2019-05-24 2023-08-23 Proviva Therapeutics (Hong Kong) Limited Il-2 compositions and methods of use thereof
US12544426B2 (en) 2019-06-19 2026-02-10 Orionis Biosciences, Inc. Combination therapy with CD13-targeted chimeric proteins or chimeric protein complexes
WO2021001289A1 (en) 2019-07-02 2021-01-07 F. Hoffmann-La Roche Ag Immunoconjugates comprising a mutant interleukin-2 and an anti-cd8 antibody
US11787875B2 (en) 2019-08-15 2023-10-17 Janssen Biotech, Inc. Materials and methods for improved single chain variable fragments
WO2021030657A1 (en) 2019-08-15 2021-02-18 Janssen Biotech, Inc. Materials and methods for improved single chain variable fragments
US12275796B2 (en) 2019-12-03 2025-04-15 Evotec International Gmbh Interferon-associated antigen binding proteins and uses thereof
WO2021209402A2 (en) 2020-04-15 2021-10-21 F. Hoffmann-La Roche Ag Immunoconjugates
WO2022117692A2 (en) 2020-12-04 2022-06-09 F. Hoffmann-La Roche Ag Ph-dependent mutant interleukin-2 polypeptides
WO2022148853A1 (en) 2021-01-11 2022-07-14 F. Hoffmann-La Roche Ag Immunoconjugates
WO2022189377A1 (en) 2021-03-09 2022-09-15 F. Hoffmann-La Roche Ag Combination therapy of pd-1-targeted il-2 variant immunoconjugates and fap/4-1bb binding molecules
WO2022189380A1 (en) 2021-03-09 2022-09-15 F. Hoffmann-La Roche Ag Combination therapy of pd-1-targeted il-2 variant immunoconjugate and anti-tyrp1/anti-cd3 bispecific antibodies
WO2023062048A1 (en) 2021-10-14 2023-04-20 F. Hoffmann-La Roche Ag Alternative pd1-il7v immunoconjugates for the treatment of cancer
WO2023062050A1 (en) 2021-10-14 2023-04-20 F. Hoffmann-La Roche Ag New interleukin-7 immunoconjugates
WO2023094569A1 (en) 2021-11-26 2023-06-01 F. Hoffmann-La Roche Ag Combination therapy of anti-tyrp1/anti-cd3 bispecific antibodies and tyrp1-specific antibodies
WO2024153725A1 (en) 2023-01-20 2024-07-25 F. Hoffmann-La Roche Ag Recombinant fc domain - il2 variant polypeptides and combination therapy with membrane-anchored antigen binding polypeptides
WO2024153722A1 (en) 2023-01-20 2024-07-25 F. Hoffmann-La Roche Ag Immunoconjugates
WO2025202147A1 (en) 2024-03-27 2025-10-02 F. Hoffmann-La Roche Ag Interleukin-7 immunoconjugates
WO2025233304A1 (en) 2024-05-08 2025-11-13 F. Hoffmann-La Roche Ag Recombinant fc domain – il7 variant polypeptides and combination therapy with membrane-anchored antigen binding polypeptides

Also Published As

Publication number Publication date
JP2013502209A (ja) 2013-01-24
AU2010285071A1 (en) 2012-02-02
ES2534085T3 (es) 2015-04-17
JP5764127B2 (ja) 2015-08-12
ZA201200767B (en) 2014-07-30
KR20150088328A (ko) 2015-07-31
WO2011020783A3 (en) 2011-04-28
MX2012002014A (es) 2012-06-13
CN102573922B (zh) 2015-08-05
TW201119672A (en) 2011-06-16
EP2467165B1 (en) 2015-01-07
HK1169318A1 (zh) 2013-01-25
RU2583876C2 (ru) 2016-05-10
CR20120042A (es) 2012-03-22
US8945571B2 (en) 2015-02-03
RU2012110127A (ru) 2013-09-27
CN102573922A (zh) 2012-07-11
CA2769619A1 (en) 2011-02-24
US20110064751A1 (en) 2011-03-17
MA33717B1 (fr) 2012-11-01
ECSP12011685A (es) 2012-03-30
KR20120053042A (ko) 2012-05-24
IL217844A0 (en) 2012-03-29
CA2769619C (en) 2019-04-30
EP2467165A2 (en) 2012-06-27
KR101588598B1 (ko) 2016-01-29
CO6430436A2 (es) 2012-04-30
PE20120630A1 (es) 2012-05-26
SG178443A1 (en) 2012-04-27
AR077879A1 (es) 2011-09-28

Similar Documents

Publication Publication Date Title
EP2467165B1 (en) Targeted immunoconjugates
JP2013502209A5 (enExample)
AU2015249085B2 (en) Mutant interleukin-2 polypeptides
CN110337448B (zh) 使用与程序性死亡配体1(pd-l1)结合的抗体的免疫疗法
CN113164558A (zh) 用于治疗癌症的新型免疫细胞因子
US20160060347A1 (en) Antibodies targeting specifically human cxcr2
AU2017260684B2 (en) HER-2 binding antibodies
WO2023016348A1 (en) Cldn18.2-targeting antibody, bispecific antibody and use thereof
JP2023534738A (ja) TGF-β RII突然変異体及びその融合タンパク質
US20260109770A1 (en) C-c chemokine receptor type 8 (ccr8) antagonist antibodies
JP2023551563A (ja) pH依存性変異体インターロイキン-2ポリペプチド
KR20200120541A (ko) 프로그램화된 세포 사멸 단백질 리간드-1 (pd-l1)에 대한 항체 및 이의 용도
HK1169318B (en) Targeted immunoconjugates
HK40099163A (zh) Ph依赖性突变型白细胞介素-2多肽
BR112012003739A2 (pt) imunoconjugados, polinucleotídeo, microorganismo transgênico, método para produzir o imunoconjugado, composição e usos do imunoconjugado e da composição
NZ611749B2 (en) Mutant interleukin-2 polypeptides
NZ710742B2 (en) Mutant interleukin-2 polypeptides

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080046453.8

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10744911

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 11181029

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 2010744911

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010285071

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 12012500124

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: CR2012-000042

Country of ref document: CR

WWE Wipo information: entry into national phase

Ref document number: 217844

Country of ref document: IL

Ref document number: 2769619

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2010285071

Country of ref document: AU

Date of ref document: 20100813

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 000192-2012

Country of ref document: PE

WWE Wipo information: entry into national phase

Ref document number: 2012525147

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/002014

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012000430

Country of ref document: CL

Ref document number: 1201000629

Country of ref document: TH

Ref document number: 1492/CHENP/2012

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: A201202885

Country of ref document: UA

ENP Entry into the national phase

Ref document number: 20127006987

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012110127

Country of ref document: RU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012003739

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012003739

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120217