WO2010093182A2 - Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법 - Google Patents

Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법 Download PDF

Info

Publication number
WO2010093182A2
WO2010093182A2 PCT/KR2010/000872 KR2010000872W WO2010093182A2 WO 2010093182 A2 WO2010093182 A2 WO 2010093182A2 KR 2010000872 W KR2010000872 W KR 2010000872W WO 2010093182 A2 WO2010093182 A2 WO 2010093182A2
Authority
WO
WIPO (PCT)
Prior art keywords
sucrose
amino acid
escherichia
increased
magnetization
Prior art date
Application number
PCT/KR2010/000872
Other languages
English (en)
French (fr)
Other versions
WO2010093182A3 (ko
Inventor
주재영
이광호
배현애
김효진
이근철
황영빈
조규수
박혜민
김현아
Original Assignee
씨제이제일제당 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 주식회사 filed Critical 씨제이제일제당 주식회사
Priority to CN201080000811.1A priority Critical patent/CN102165056B/zh
Priority to DK10715651.5T priority patent/DK2239336T3/en
Priority to ES10715651.5T priority patent/ES2635312T3/es
Priority to JP2010550616A priority patent/JP5597554B2/ja
Priority to EP10715651.5A priority patent/EP2239336B1/en
Priority to US12/743,675 priority patent/US8574874B2/en
Publication of WO2010093182A2 publication Critical patent/WO2010093182A2/ko
Publication of WO2010093182A3 publication Critical patent/WO2010093182A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/2488—Mannanases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01007—Mannokinase (2.7.1.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01048—Sucrose alpha-glucosidase (3.2.1.48), i.e. sucrase

Definitions

  • the present invention relates to a transformed microorganism producing a high yield of L-amino acid using sucrose as the main carbon source and a method for producing L-amino acid using the same.
  • Starch sugar which is mainly used in the fermentation industry, is rapidly increasing in demand due to the recent accelerated development of biofuels.
  • molasses containing a large amount of sucrose or sucrose which is cheaper than starch sugar, is used as a carbon source of the fermentation industry, there is an advantage of securing a higher cost competitiveness.
  • About 50% of Escherichia coli in nature has the ability to metabolize sucrose, but E. coli K12 strains, B strains and C strains, which are mainly used in the fermentation industry, have no sucrose magnetization ability ( Mol. Microbiol (1998) 2: 1-8, Can.J. Microbiol. (1999) 45: 418-422).
  • a method capable of imparting sucrose magnetization ability to industrial E. coli a method of introducing a sucrose soluble gene or a gene group derived from a microorganism having sucrose magnetization ability is mainly used.
  • enterobacteriaceae Enterobacteriaceae
  • Salmonella in the family Salmonella
  • Bell J. Bacteriol. (1982) 151: 68-76, Mol. Microbiol. (1998) 2: 1-8, J. Bacteriol. (1991) 173: 7464-7470, US Pat. No. 7,179,623
  • Klebsiella pneumoniae Klebsiella pneumoniae
  • Streptococcus mutans a Gram-positive microorganism Streptococcus mutans
  • Streptococcus mutans J. Bacteriol. (1989) 171: 263-271
  • Bacillus subtilis Bacillus subtilis
  • J. Bactreriol. (1989) 171: 1519-1523) scr Regulolone, sac It is also known to introduce an operon.
  • L-amino acids have been produced industrially according to fermentation methods using mutant strains of microorganism strains obtained in nature or those strains modified to enhance L-amino acid productivity.
  • Many techniques have been developed to enhance the production capacity of L-amino acids, for example, the technology mainly to increase the activity of enzymes involved in amino acid biosynthesis or to inhibit the feedback action by L-amino acid production.
  • the increase in the amino acid production capacity of L-amino acid producers can be improved by enhancing the amino acid excretion activity.
  • the method of controlling the expression of a gene and increasing the production capacity of L-amino acid is also used.
  • the L-amino acid sucrose can be divided into Scr-PTS system and Scr-non PTS system.
  • Most microorganisms that can use sucrose have a phosphoenolpyruvate dependent sucrose phosphotransferase (Scr-PTS) system.
  • Scr-PTS system has the advantage that can be efficiently introduced to a low concentration of sucrose, but there is a disadvantage in reducing the PEP pool (pool) in the cell because the influx of sucrose by consuming PEP (Phosphoenolpyruvate).
  • the Scr-non PTS system uses a proton symport-type sucrose permease, and the csc gene family including cscB encoding this sucrose permease is well known.
  • the csc regulator consists of cscB ( sucrose permease or proton symport-type sucrose permease ), cscK (fructokinase), cscA (sucrose hydolase), and cscR (sucrose transcriptional regulator) and are negatively identified by two operons, cscKB and cscR . Under control (Robeis K et al., J. Bacteriol. (2002) 184: 5307-5316)
  • PEP is an important metabolite in the central metabolic pathway, which not only acts as a phosphate donor in the sugar PTS system, but also participates in ATP-producing reactions catalyzed by pyruvate kinase. It also acts as a direct precursor of several amino acids or oxaloacetate (OAA) ( Metab. Eng. (2002) 4: 124-137, Microb. Cell Fact. (2005) 4:14).
  • OAA oxaloacetate
  • OAA is used as a carbon skeleton of amino acids such as threonine, isoleucine methionine, lysine, asparagine and aspartic acid (US Patent No. 6,960,455).
  • Most of the PEP is known to be consumed most by the sugar PTS system.
  • the amount of PEP consumed by the glucose PTS system in a minimal medium containing glucose as a carbon source amounts to 50% of the total PEP ( Microb. Cell Fact. (2005) 4:14). Therefore, if the sugar non-PTS system is used instead of the sugar PTS system, the PEP pool in the cells can be increased and productivity and yield can be improved by using the increased PEP for the biosynthesis of the fermentation product.
  • Mannokinase consumes ATP and converts hexose, including mannose and fructose, into a 6-phospho-ester form.
  • Mak bacterial wild type Mak (Mak-o) gene (mak or yajF) encoding is known as a cryptic (cryptic) gene
  • DNA sequence variations in the promoter -35 region of mak of (enteric bacteria) Mak ( Mak +) is known to significantly increase activity (Kornberg HL, J. Mol. Microbiol. Biotechnol. (2001) 3: 355-359; Miller BG & Raines RT, Biochemistry (2005) 44: 10776-10783).
  • Mak can phosphorylate other substrates glucose, sorbose and glucosamine in addition to mannose and fructose.
  • the fact that Mak affects sucrose metabolism has not been revealed yet.
  • the present inventors have conducted research to search for genes that are expected to be involved in sucrose metabolism as part of the development of microorganisms using sucrose efficiently. It turns out that it will play an important role. That is, even when the intact csc regulator is introduced into the E. coli in which the mannokinase is inactivated, it was confirmed that the use rate of sucrose is reduced compared to the wild type E. coli without the mannokinase inactivated. It was completed.
  • One object of the present invention relates to an Escherichia microorganism having improved L-amino acid production ability using sucrose as a main carbon source. More specifically, sucrose non-magnetic microorganisms to give the activity of sucrose permease (sucrose permease), sucrose hydrolase and sucrose transcriptional regulator, mannokinase (mannokinase) It is to provide an Escherichia microorganism having increased L-amino acid production capacity and sucrose magnetization capacity characterized by enhanced activity of).
  • Another object of the present invention is to provide a method for producing L-amino acid using the Escherichia microorganism.
  • sucrose is used as a main carbon source in addition to starch sugar which has been mainly used in the fermentation industry. Not only can it flexibly cope with rapidly changing world grain prices, but it can also produce high yields of L-amino acids.
  • p means promoters
  • Ko1 and Yo2o3 are operators
  • t means terminators.
  • FIG. 2 is a schematic of recombinant plasmid pAcscBAR'-mak comprising cscBAR'-mak.
  • the present invention is sucrose permease (cscB), sucrose hydrolase (cscA) and sucrose transcriptional regulator (Sucrose permease; Sucrose transcriptional regulator (cscR) and the activity of the Escherichia genus having increased L-amino acid production capacity and sucrose magnetization capacity characterized by enhanced activity of mannokinase (mannokinase).
  • sucrose permease is a peptide having the activity of introducing external sucrose into the cell
  • sucrose hydrolase has the activity of hydrolyzing sucrose to glucose and fructose
  • sucrose transcription The modulator has the activity of regulating the transcription of genes encoding sucrose permease and sucrose hydrolase.
  • the activity of the sucrose permease, sucrose hydrolase and sucrose transcriptional regulator is present in microorganisms with sucrose magnetizing ability, but Escherichia microorganisms, especially industrially used industrial E. coli K12 strain, B strain and It is not present in C strain.
  • Microorganism is applicable to various methods well known in the art.
  • a preferred method of assigning activity is the Escherichia genus which has a gene encoding a sucrose permease, sucrose hydrolase and a sucrose transcriptional regulator into a vector, and the recombinant vector has the ability to produce sucrose non-magnetic L-amino acids. It is to transform microorganisms.
  • the gene encoding the sucrose permease, the gene encoding the sucrose hydrolase, the gene encoding the sucrose transcriptional regulator is preferably a microorganism having sucrose magnetizing ability, preferably an Escherichia genus having sucrose magnetizing ability Microorganisms, and more preferably, E. coli, which has sucrose magnetizing ability.
  • E. coli with sucrose magnetization include E. coli ATCC9637 (Alterthum F & Ingram LO, Appl. Environ. Microbiol. (1989) 55: 1943-1948).
  • coli ATCC9637 ( cscB ) to SEQ ID NO: 4, the gene encoding sucrose hydrolase ( cscA ) SEQ ID NO: 6, the gene encoding the sucrose transcriptional regulator ( cscR ) Is shown by SEQ ID NO: 7, respectively.
  • the cscBAR gene containing the cscR gene can be introduced into a vector, and the recombinant vector can be produced by transforming Escherichia microorganisms having the ability to produce sucrose non-magnetic L-amino acids.
  • mannokinase refers to a peptide having an activity of converting hexose such as mannose into 6-phospho-ester form using ATP.
  • the present invention is characterized in that the activity of mannokinase is enhanced (or increased) than the original activity in the sucrose non-magnetically Escherichia genus microorganism.
  • the "original activity” refers to the activity of the sucrose non-magnetizing Escherichia microorganism without any genetic manipulation or modification.
  • the term “strengthening” or “increasing” means an improvement over the original activity of the sucrose non-magnetic non-Eskeria microorganism.
  • the method of enhancing (or increasing) the mannokase activity of the present invention is applicable to various methods well known in the art.
  • Examples of the method include, but are not limited to, encoding a mannokinase by additionally inserting a polynucleotide comprising a nucleotide sequence encoding the mannokase into a chromosome or introducing the polynucleotide into a vector system.
  • There are a method of increasing the number of copies of the nucleotide sequence a method of replacing with a strong promoter, a method of introducing a mutation into a promoter, and a method by genetic variation.
  • a copy number of the gene is introduced by introducing a gene encoding a mannokase into a vector and transforming the Escherichia spp. Microorganism to enhance the activity of the mannokase of the Escherichia spp. It can be used to increase the method.
  • the gene encoding the mannokase may be a gene having a nucleotide sequence operable to the sucrose non-magnetic E. coli microorganism, preferably a gene encoding the wild type Mak (Mak-o) of enteric bacteria. It is a mak gene that is. In a specific embodiment, it is derived from E. coli, and preferably, a polynucleotide having a nucleotide sequence of SEQ ID NO: 15 (GenBank accession number AC000091) was used.
  • the nucleotide sequence encoding the mannokase can be modified to some extent as long as it maintains its activity.
  • nucleotide sequence of which at least 70% homology is maintained by such an artificial modification is equivalent to that derived from the nucleotide sequence of the present invention as long as it retains the activity of the gene of interest in the present invention. will be.
  • the gene encoding the peptide having the activity of the mannokase, sucrose permease, sucrose hydrolase and sucrose transcriptional regulator Methods of increasing copy number, improving promoters, using random mutagenesis or site-directed mutagenesis, and the like can be used.
  • a random mutation is induced by treating hydroxylamine to a gene group including a nucleotide sequence encoding mannokinase, sucrose permease, sucrose hydrolase, and a sucrose transcriptional regulator. The method (Sikorski RS & Boeke JD, Methods Enzymol. (1991) 194: 302-318) was used.
  • the present invention relates to an Escherichia microorganism having improved L-amino acid production ability and sucrose magnetization ability, wherein the nucleotide sequence or amino acid sequence by the mutation inducing method is mutated.
  • Variants are variants in which one or more variants are present in the nucleotide sequence in mannokinase, sucrose permease, sucrose hydrolase and sucrose transcriptional regulators. More preferably it is a variant in which one or more variants are present in the amino acid sequence in mannokinase, sucrose permease, sucrose hydrolase and sucrose transcriptional regulator.
  • the 130th amino acid of the sucrose transcriptional regulator is a variant substituted for histidine to tyrosine, preferably such variant has a modified sucrose transcriptional regulator encoded by the nucleotide sequence set forth in SEQ ID NO: 17.
  • the improved L-amino acid production ability and sucrose magnetization by introducing such a variant into a vector and transforming the recombinant vector into an Escherichia microorganism having the ability to produce sucrose non-magnetic L-amino acid. It is possible to provide an Escherichia microorganism having the ability.
  • the present inventors have improved L-amino acid production ability and sucrose magnetization ability of sucrose non-magnetic non- Escherichia spp. Microorganisms using pAcscBAR'-mak plasmid comprising the nucleotide sequence of SEQ ID NO: 18. Can be transformed with Escherichia microorganisms.
  • a "vector” refers to a sucrose permease, a sucrose hydrolase, a sucrose transcriptional regulator, and a gene encoding a mannokinase as a host cell, a sucrose non-magnetizing Escherichia spp.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, [lambda] EMBL3, [lambda] EMBL4, [lambda] FIXII, [lambda] DASHII, [lambda] ZAPII, [lambda] gt10, [lambda] gt11, Charon4A, and Charon21A can be used as the phage vector or cosmid vector.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • the vector which can be used is not specifically limited, A well-known expression vector can be used.
  • a well-known expression vector can be used.
  • pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322 and pMW118 vectors and the like can be used.
  • the term "transformation" in the present invention means that the gene can be introduced into the host cell to be expressed in the host cell.
  • the transformed gene includes all of them, as long as they can be expressed in the host cell, either inserted into or located outside the chromosome of the host cell.
  • the gene also includes DNA and RNA as polynucleotides capable of encoding a polypeptide.
  • the gene may be introduced in any form as long as it can be introduced into and expressed in a host cell.
  • the gene may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all the elements necessary for self expression.
  • the expression cassette typically includes a promoter, transcription termination signal, ribosomal binding site and translation termination signal operably linked to the gene.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the gene may be introduced into the host cell in its own form or in the form of a polynucleotide structure, and may be operably linked to a sequence required for expression in the host cell.
  • the microorganism of the present invention is given the activity of sucrose permease, sucrose hydrolase and sucrose transcriptional regulator to the L-amino acid-producing microorganisms having sucrose non-magnetic properties and enhanced the activity of mannokase to produce L-amino acid It refers to a microorganism having an improved ability and sucrose magnetization ability.
  • the microorganism of the present invention includes any prokaryotic and eukaryotic microorganism as long as it possesses the above characteristics, examples of which are Genus Escherichia , Erwinia , Serratia , Providen Microorganism strains belonging to the genus Providencia , Corynebacterium and Brevibacterium .
  • the microorganism of the present invention is a microorganism belonging to the genus Escherichia, more preferably E. coli.
  • L-amino acid refers to L-threonine, O-succinyl-homoserine, O-acetyl-homoserine, L-methionine, L -Lysine, L-homoserine, L-isoleucine, L-valine and L-tryptophan.
  • the L-amino acid is L-threonine, O-succinyl-homoserine, O-acetyl-homoserine and L-tryptophan.
  • the present inventors have an E. coli ABA5G strain having a L-threonine production ability, particularly a vector having a nucleotide sequence of SEQ ID NO: 18 including the cscBAR'-mak gene group.
  • Escherichia coli CA03-0308 was transformed into Escherichia coli CA03-0308, and was assigned to the Korea Microbial Conservation Center, an international depository institution located at 361-221, Hongje 1-dong, Seodaemun-gu, Seoul, Korea, on December 23, 2008. Deposited with accession number KCCM-10978P.
  • the present invention relates to a method for producing amino acids by culturing the Escherichia microorganism having the improved L-amino acid production capacity and sucrose magnetization capacity in a medium containing sucrose as a main carbon source.
  • the present invention comprises inoculating and culturing a culture medium containing all or part of sucrose as a carbon source by inoculating microorganisms having the sucrose magnetization ability and producing L-amino acids; And separating the L-amino acid from the culture, and relates to a method for producing L-amino acid using the Escherichia microorganism from a carbon source including sucrose.
  • the culturing process of the present invention can be made according to suitable media and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the strain selected. Examples of the culture method include, but are not limited to, batch, continuous and fed-batch cultivation. The medium used for cultivation should suitably meet the requirements of the particular strain.
  • the medium used in the present invention uses sucrose as the main carbon source.
  • Sucrose used as the main carbon source may be provided as a carbon source in the form of molasses containing a large amount of sucrose, and may include a variety of appropriate carbon sources in addition to sucrose or molasses without restriction. These nitrogen sources may be used alone or in combination.
  • Examples of the person included in the medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and corresponding sodium-containing salts. It may also include metal salts such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins and appropriate precursors may be included. These media or precursors may be added batchwise or continuously to the culture.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation.
  • oxygen or oxygen-containing gas is injected into the culture, or nitrogen, hydrogen or carbon dioxide gas is injected without gas injection to maintain anaerobic and unaerobic conditions.
  • the temperature of the culture is usually 27 ° C to 37 ° C, preferably 30 ° C to 35 ° C. The incubation period can continue until the desired amount of useful material is obtained, preferably 10 to 100 hours.
  • the method for collecting and recovering the amino acids produced in the culturing step of the present invention may be performed by using a suitable method known in the art according to a culture method, for example, a batch, continuous or fed-batch culture method. Can be collected.
  • Regulators containing the cscBKAR gene (GenBank accession number X81461), which encodes a Scr-non PTS system that does not consume PEP (phosphoenolpyruvate) upon sucrose influx, PCR the template with genomic DNA from E. coli W strain (ATCC9637, USA) Amplified by the method.
  • PCR the template with genomic DNA from E. coli W strain (ATCC9637, USA) Amplified by the method.
  • SEQ ID NO: 1 having the restriction enzyme EagI site
  • SEQ ID NO: 2 having the XbaI site
  • PCR conditions were modified for 3 minutes at 94 °C, 94 °C 30 seconds denaturation, 56 °C 30 seconds annealing, 72 °C 5 minutes polymerization was repeated 25 times, the polymerization reaction was carried out at 72 °C 7 minutes.
  • a polynucleotide of 5199 bp could be obtained.
  • the obtained polynucleotide was subjected to restriction enzyme treatment of EagI and XbaI and cloned into pACYC184 vector. Then, the vector was transformed into E. coli DH5 ⁇ and plated on a MacConkey agar plate containing 1% sucrose. The colonies with dark purple color among the colonies were selected and plasmids were obtained from the colonies.
  • the resulting plasmid was named pAcscBKAR, and when the DNA sequences (c SEQ ID NO: 3) of cscBKAR cloned at EagI and XbaI sites were determined, 141st to 1388th sequences were cscB (SEQ ID NO: 4), 1460 to 2374
  • the first nucleotide sequence was found to be cscK (SEQ ID NO: 5), the 2590 th to 4023 nucleotide sequences were cscA (SEQ ID NO: 6), and the 4031 th to 5026 nucleotide sequences were identified as cscR (SEQ ID NO: 7).
  • AY048746 was electroporated to competent cells of wild type Escherichia coli K12. Thereafter, PCR reaction was performed on the kanamycine-resistant cell line to confirm the deletion of the mak gene and the pCP20 plasmid was introduced to remove the antibiotic resistance marker gene.
  • a strain in which a pAcscBKAR plasmid was introduced was incubated overnight in an LB solid medium in a 33 ° C. incubator, followed by inoculation of one platinum solution in 25 mL titer medium of Table 1 containing sucrose, followed by 33 ° C. and 200 rpm. 36 hours incubation in the incubator. After that, the OD value and sugar consumption of the culture solution were measured, and the results are shown in Table 2.
  • the strain lacking mak and transfected with csc regulators used 24.9 g / L sucrose for 36 hours, and the wild type strain transfected with csc regulator without mak deficiency.
  • the mak is deficient strain as compared to mak secret hands depending on the strain of sucrose utilizing a 33.1 g / L can be confirmed that the use of cross velocity is decreased by about 1.3 times. This indicated that mak is an important gene in sucrose metabolism.
  • a vector was constructed to simultaneously overexpress mak and csc regulators. At this time, cscK was excluded from the csc regulator.
  • pAcscBAR was produced, and then a method of cloning the ma k gene into pAcscBAR was used.
  • the polynucleotide and pAcscBKAR obtained above were subjected to restriction enzyme treatment with EcoRV and EagI , respectively, to prepare a pAcscBAR plasmid.
  • colonies containing pAcscBAR were selected by PCR using colonies grown in LB medium, from which pAcscBAR plasmids were obtained.
  • the base sequence (SEQ ID NO: 12) analysis of cscBAR linked to the XbaI and EagI sites of the obtained pAcscBAR plasmid confirmed that there was no mutation.
  • PCR was performed in the same manner as in Example 1 using the genomic DNA of E. coli W3110 as a template using primer pairs of SEQ ID NOs: 13 and 14 to amplify a polynucleotide containing mak. No. 15) was obtained and pAcscBAR-mak was constructed by cloning the PCR product to the restriction enzyme sites of Pst I and Eag I of pAcscBAR .
  • the pAcscBAR-mak was transformed into Escherichia coli DH5 ⁇ , and colonies containing pAcscBAR-mak were selected by PCR using colonies grown in LB medium, from which the pAcscBAR-mak plasmid was obtained.
  • the nucleotide sequence (SEQ ID NO: 16) analysis of cscBAR-mak linked to XbaI and EagI sites of the obtained pAcscBAR-mak plasmid confirmed that there was no mutation.
  • ABA5G strain containing pAcscBKAR produced 18.7 g / L sucrose when incubated for 30 hours, and produced 6.0 g / L L-threonine, but did not contain pAcscBAR-mak.
  • the ABA5G strain used 27.7 g / L sucrose and produced 9.7 g / L L-threonine. That is, ABA5G containing pAcscBAR-mak increased sucrose utilization rate by about 1.5 times compared to ABA5G strain containing pAcscBKAR, and increased threonine productivity by 3.7 g / L.
  • fructokinase activity as a method to confirm the increase or enhancement of mannokin activity in ABA5G strains containing pAcscBAR-mak compared to the parent strain ABA5G (Copeland L et al., Plant Physiol. (1978) 62 : 291-294).
  • This enzyme activity assay is based on fructose as the first substrate, and the coupling reaction using mannokinase, phosphoglucose isomerase and glucose-6-phosphate dehydrogenase (glucose-6-phosphate dehydrogenase) It is a method that can measure the fructokinase activity of mannokinase through a (coupling reaction).
  • Enzyme solution was digested with a soyator, ABA5G strains containing pAcscBAR and pAcscBAR-mak incubated in LB for 24 hours using a sonicator, and the supernatant was centrifuged as enzyme solution. Protein concentration was measured by Bradford assay ( Bradford assay). While maintaining the enzyme reaction for 30 minutes, the amount of change in absorbance at OD 340 nm was measured. Through this, the amount of NADPH produced by the coupling reaction was measured, and the activity was measured using an absorption coefficient of 6.22 cm -1 mM -1 of NADPH. Calculated.
  • One unit of mannokinase is defined as the amount of enzyme that produces 1 nM NADPH by 1 mg of total protein per minute by the above enzyme activity assay, and the results are shown in Table 4.
  • the activity of the mannokinase of ABA5G containing pAcscBAR-mak was about 12-fold increased or enhanced compared to ABA5G containing only pAcscBAR.
  • DNA fragments containing 5887 bp cscBAR-mak obtained from the pAcscBAR-mak plasmid using restriction enzymes of EagI and XbaI were used as the target DNA.
  • DNA fragments to which the mutagenesis solution was added were purified using a purification column (500 ⁇ l) at 75 ° C. for 30 minutes, 1 hour, 2 hours, and 4 hours.
  • the DNA treated with hydroxylamine and the pACYC184 vector treated with the restriction enzymes of EagI and XbaI were linked using T4 DNA ligase and transformed into threonine producer ABA5G.
  • the transformed strains were plated for exclusion of Macconkey solids containing 0.1% low sucrose to select dark purple colonies after one day incubation at 37 ° C.
  • the selected colonies were cultured in the titer medium of Table 1 to evaluate threonine productivity and sucrose utilization rate, and finally, strains having the highest threonine productivity and sucrose availability were selected.
  • sequencing was performed.
  • the 388th base of cscR of the strain was substituted for C to T.
  • the 130th amino acid was changed from histidine to tyrosine, and the sucrose transcriptional regulator cscR having this mutation was found in the nucleotide sequence of SEQ ID NO. Is encrypted.
  • Flask titer evaluation was performed by freshly transforming the plasmid into ABA5G. Strains incubated overnight in LB solid medium in a 33 ° C. incubator were inoculated with platinum in 25 mL titer medium of Table 1, and then incubated for 30 hours in a 33 ° C., 200 rpm incubator, and the results are shown in Table 5. It was.
  • ABA5G strain containing pAcscBKAR produced 18.7 g / L sucrose and produced 6.0 g / L L-threonine when incubated for 30 hours, but ABA5G strain containing pAcscBAR'-mak. Using 33.4 g / L sucrose and producing 12.4 g / L L-threonine.
  • ABA5G containing pAcscBAR'-mak increased sucrose utilization rate by 1.8 times and threonine productivity increased by 6.4 g / L, compared to ABA5G strain containing pAcscBKAR, and sucrose compared to ABA5G containing pAcscBAR-mak.
  • the use rate was about 1.2 times and threonine productivity increased by about 2.7 g / L. Therefore, in the case of a recombinant strain containing cscBAR'-mak , it was confirmed that the sucrose availability and productivity of L-threonine was improved, and the transformed microorganism was named CA03-0308, which was dated December 23, 2008. It was deposited with the accession number KCCM-10978P at the Korea Microbiological Conservation Center, which is an international depository organization located at 361-221 Hongje 1-dong, Seodaemun-gu, Seoul, Korea.
  • PAcscBAR'-mak prepared in Example 8 was transformed into CJM-11A (KCCM-10922P), which is an O-Succinyl-homoserine producing strain described in US Patent Publication No. 2009/0253187. After conversion, smeared on a Macconkey solid medium containing 0.1% low sucrose and cultured at 37 ° C for one day, dark purple colonies were selected.
  • CJM-11A KCCM-10922P
  • the CJM-11A strain including the parent strain pAcscBKAR used 30.2 g / L sucrose and produced 12.3 g / L O-succinyl-homoserine when incubated for 48 hours.
  • CJM-11A strain containing pAcscBAR'-mak uses 50.4 g / L sucrose and produces 20.5 g / L O-succinyl-homoserine, which has higher sucrose utilization rate than CJM-11A containing pAcscBKAR. It increased 1.7 fold and showed improved O-succinyl-homoserine productivity of 8.2 g / L. That is, in the case of the recombinant strain containing cscBAR'-mak , it was confirmed that the sucrose availability and productivity of O-succinyl-homoserine is improved.
  • PAcscBAR'-mak prepared in Example 8 was transformed into CJM-X (KCCM-10921P), an O-Acetyl-homoserine producing strain described in US Patent Publication No. 2009/0253186. Smeared with McConkie solid medium containing 0.1% low sucrose, dark purple colonies were selected after 1 day incubation at 37 ° C.
  • the CJM-X strain containing the parent strain pAcscBKAR using 29.9 g / L sucrose when incubated for 48 hours, and 10.7 g / L of O-acetyl-homoserine (O-Acetyl- homoserine, OAH), but the CJM-X strain containing pAcscBAR'-mak produced 55.4 g / L sucrose and produced 15.4 g / L OAH, compared to CJM-X containing pAcscBKAR.
  • the rate of use increased 1.8-fold and improved OAH productivity of 8.8 g / L. That is, in the case of a recombinant strain containing cscBAR'-mak , it was confirmed that the sucrose availability and OAH productivity is improved.
  • PAcscBAR'-mak prepared in Example 8 was transformed into L-tryptophan producing strain CJ285 (KCCM-10534, Korea Microbiological Conservation Center November 28, 2003) Mack containing 0.1% low sucrose After spreading to Konki solid medium, dark purple colonies were selected after one day of culture.
  • sucrose is used as a main carbon source in addition to starch sugar which has been mainly used in the fermentation industry. Not only can it flexibly cope with rapidly changing world grain prices, but it can also produce high yields of L-amino acids.

Abstract

본 발명은 수크로스를 주 탄소원으로 이용할 수 있으며, L-아미노산 생산능을 가지는 형질전환된 미생물 및 당해 미생물을 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.

Description

Ｌ-아미노산 생산용 미생물 및 이를 이용하여 Ｌ-아미노산을 생산하는 방법
본 발명은 수크로스를 주 탄소원으로 이용하여 고수율의 L-아미노산을 생산하는 형질전환된 미생물 및 이를 이용한 L-아미노산 생산 방법에 관한 것이다.
발효 산업에 주로 이용되는 전분당은 최근 바이오 연료 개발이 가속화됨에 따라 수요가 급증하고, 이상 기후에 의한 작물의 흉작으로 가격이 급상승하고 있다. 이러한 전분당에 비해 값이 싼 수크로스 또는 수크로스를 다량 포함하는 당밀 (molasses)을 발효산업의 탄소원으로 이용할 경우, 보다 높은 원가 경쟁력을 확보할 수 있는 장점이 있다. 자연계에 존재하는 대장균의 약 50 % 정도는 수크로스를 대사할 수 있는 능력을 가지고 있지만, 발효 산업에 주로 이용되고 있는 대장균 K12 균주, B 균주 및 C 균주 등은 수크로스 자화능이 없다(Mol. Microbiol. (1998) 2:1-8, Can. J. Microbiol. (1999) 45:418-422). 그러므로 수크로스 자화능과 관련된 유전자들을 규명하고 이를 개량하여 강화된 수크로스 자화능 관련 유전자들을 확보하는 일과 이들을 수크로스 비자화성 산업용 대장균에 도입하여 목적하는 대사산물을 생산하는 것은 발효산업의 가장 중요한 연구주제 중 하나이다.
산업용 대장균에 수크로스 자화능을 부여할 수 있는 방법으로서, 수크로스 자화능이 있는 미생물 유래의 수크로스 이용성 유전자 또는 유전자군을 도입하는 방법이 주로 이용되고 있다. 그 예로, 엔테로박테리아세 (Enterobacteriaceae) 과에 속하는 살모넬라 (Salmonella) 종 (J. Bacteriol. (1982) 151:68-76, Mol. Microbiol. (1998) 2:1-8, J. Bacteriol. (1991) 173:7464-7470, 미국등록특허 제7,179,623호), 클렙시엘라 뉴모니애 (Klebsiella pneumoniae) (J. Gen. Microbiol. (1988) 134:1635-1644), 어위니아 아미노보라 (Erwinia amylovora) (J. Bacteriol. (2000) 182:5351-5358)에 존재하는 scr 레귤론(regulon)을 대장균 K12에 형질전환하여 수크로스 자화능을 부여한 것은 이미 당업계에 잘 알려져 있다. 또한 수크로스 자화능을 가지는 non-K12 대장균 또는 병원성 대장균 (Appl. Environ. Microbiol. (1992) 58:2081-2088, 미국 등록특허 제6,960,455호) 유래의 csc 레귤론을 도입한 경우, 대장균 AB1281 (미국 등록특허 제4,806,480호)의 접합 플라스미드(conjugative plasmid) scr53에 존재하는 수크로스 이용성 유전자 군을 도입한 경우 및 그람 양성 미생물인 스트렙토코코스 뮤탄스 (Streptococcus mutans) (J. Bacteriol. (1989) 171:263-271) 및 바실러스 서브틸리스 (Bacillus subtilis) (J. Bactreriol. (1989) 171:1519-1523) 유래의 scr 레귤론, sac 오페론 (operon)을 도입한 경우도 알려져 있다.
종래, L-아미노산은 자연계에서 수득된 미생물 균주 또는 L-아미노산 생산성이 증강되도록 변형된 이들 균주의 변이주를 이용한 발효방법에 따라 공업적으로 생산되어 왔다. L-아미노산의 생산능을 증강시키기 위한 많은 기술이 개발되어 있으며, 일례로 아미노산 생합성에 관여하는 효소의 활성을 증가시키거나 L-아미노산 생산에 의한 피드백 작용을 억제하는 기술이 주를 이루고있다. 한편, L-아미노산 생산주의 아미노산 생산능의 증가는 아미노산 배출활성의 증강에 따라 개량할 수 있다. 예를들면 L-라이신 배출유전자의 발현이 증강된 코리네박테리움속 세균의 라이신 생산주, L-시스테인, L-시스틴, N-아세틸세린 또는 티아졸리딘 유도체의 분비에 적합한 유출 단백질을 암호화하는 유전자의 발현을 조절하여 L-아미노산의 생산능을 증가시키는 방법도 이용되고 있다.
L-아미노산수크로스를 이용할 수 있는 시스템은 크게 Scr-PTS 시스템과 Scr-non PTS 시스템으로 나눌 수 있다. 대부분의 수크로스를 이용할 수 있는 미생물은 Scr-PTS (phosphoenolpyruvate dependent sucrose phosphotransferase) 시스템을 가진다. Scr-PTS 시스템은 낮은 농도의 수크로스까지 효율적으로 유입할 수 있다는 장점은 있으나, PEP(Phosphoenolpyruvate)를 소모하여 수크로스를 유입하므로 세포내의 PEP 풀(pool)을 감소시키는 단점이 있다. Scr-non PTS 시스템은 프로톤 심포트 타입 수크로스 퍼미아제 (proton symport-type sucrose permease)를 이용하는 시스템으로 이 수크로스 퍼미아제를 코딩하는 cscB를 포함하는 csc 유전자군이 잘 알려져 있다. csc 레귤론은 cscB(sucrose permease or proton symport-type sucrose permease), cscK(fructokinase), cscA(sucrose hydolase), cscR(sucrose transcriptional regulator)로 구성되어 있으며, 2개의 오페론, cscKB와 cscR에 의해 음성적으로 조절을 받는다(Jahreis K et al., J. Bacteriol. (2002) 184:5307-5316)
PEP는 중앙 대사경로에서 중요한 중간체(metabolite)로써, 당(sugar) PTS 시스템의 포스페이트 공여자(phosphate donor)의 역할 뿐만이 아니라, 피루베이트 키나아제(pyruvate kinase)에 의해 촉매되는 ATP 생성 반응에 관여하기도 하며, 몇 가지 아미노산이나 옥살로아세테이트(oxaloacetate, OAA)의 직접적인 전구체로도 작용한다(Metab. Eng. (2002) 4:124-137, Microb. Cell Fact. (2005) 4:14). 특히 OAA는 쓰레오닌, 이소로이신 메티오닌, 라이신, 아스파라진 및 아스파틱산 등의 아미노산의 탄소골격(carbon skeleton)으로 이용된다 (미국 등록특허 제6,960,455호). PEP의 대부분은 당 PTS 시스템에 의해 가장 많이 소모되는 것으로 알려져 있다. 탄소원으로서 글루코스가 포함된 최소배지에서 글루코스 PTS 시스템에 소모되는 PEP의 양은 전체 PEP의 50 %에 이른다고 한다(Microb. Cell Fact. (2005) 4:14). 따라서 당 PTS 시스템 대신 당 non-PTS 시스템을 이용한다면, 세포 내의 PEP 풀을 증가시킬 수 있으며 증가된 PEP를 발효산물의 생합성에 이용함으로써 생산성 및 수율을 향상시킬 수 있다.
따라서 수크로스 이용에 있어서도 Scr-PTS 시스템보다는 수크로스 유입시 PEP를 소모하지 않는 Scr-non PTS 시스템을 이용하는 것이 더 바람직할 것이다. 실제로, 아지노모토(Ajinomoto)사의 경우 EC3132 유래의 cscBKA를 대장균에 도입하여 쓰레오닌, 이소루이신 및 트립토판 등의 생산에 이용하였다 (미국 등록특허 제6,960,455호). 또한 듀퐁 (DuPont)사는 대장균 ATCC13281 유래 cscBKAR을 대장균 K12에 도입하고 수크로스를 사용하여 타이로신 (tyrosine)을 생산하기도 하였다(Appl. Microbiol. Biotechol. (2007) 74:1031-1040).
한편, 만노키나아제(Mannokinase; Mak)는 ATP를 소모하며 만노오스, 프락토오즈를 포함한 헥소스(hexose)를 6-포스포-에스터(6-phospho-ester)형태로 전환해주는 키나아제(kinase) 활성을 가진다. 특히 엔테릭 박테리아(enteric bacteria)의 야생형 Mak(Mak-o)를 코딩하는 유전자(mak 또는 yajF)는 크립틱(cryptic) 유전자로 알려져 있으며, mak의 프로모터 -35 부위의 염기서열 변이에 의한 Mak(Mak+)는 활성이 크게 증가한다고 알려져 있다(Kornberg HL, J.Mol. Microbiol. Biotechnol. (2001) 3:355-359; Miller BG & Raines RT, Biochemistry (2005) 44:10776-10783). Mak는 만노오스, 프락토오즈 이외에도 또 다른 기질 글루코스, 소오보오스 및 글루코사민을 인산화시킬 수 있다. 그러나 상기 Mak가 수크로스 대사에 영향을 준다는 사실은 아직까지 밝혀진 바 없다.
상기와 같은 배경하에서 본 발명자들은 수크로스를 고효율적으로 이용하는 미생물을 개발하기 위한 일환으로써, 수크로스 대사에 관여할 것으로 예상되는 유전자들을 탐색하는 연구를 수행하던 중, 수크로스 대사에 있어서 만노키나아제가 중요한 역할을 할 것이라는 사실을 밝혀내었다. 즉, 만노키나아제가 불활성화된 대장균에 온전한 csc 레귤론을 도입하더라도, 만노키나아제가 불활성화되지 않는 야생형 대장균에 비해 수크로스 이용속도가 감소되는 사실을 확인하게 되었으며, 이러한 사실에 근거하여 본 발명을 완성하기에 이르렀다.
본 발명의 하나의 목적은 수크로스를 주 탄소원으로 이용하는 L-아미노산 생산능이 향상된 에스케리키아속 미생물에 관한 것이다. 보다 구체적으로, 수크로스 비자화성 미생물에 수크로스 퍼미아제(sucrose permease), 수크로스 하이드롤라제(sucrose hydrolase) 및 수크로스 전사 조절자(sucrose transcriptional regulator)의 활성을 부여하고, 만노키나아제(mannokinase)의 활성이 강화된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 에스케리키아속 미생물을 이용하여 L-아미노산을 제조하는 방법을 제공하는 것이다.
본 발명은 따른 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물을 사용하여 L-아미노산을 생산하는 경우, 발효산업에 주로 이용되었던 전분당 이외에 수크로스를 주탄소원으로 이용함으로써 급변하는 세계 곡물가에 유연하게 대처할 수 있을 뿐만 아니라 고수율의 L-아미노산을 생산할 수 있다.
도 1은 scr 레귤론의 개요를 나타낸 도면이다. p는 프로모터 (promoters), Ko1 및 Yo2o3는 작동자 (operators), 및 t는 종결자 (terminators)를 의미한다.
도 2는 cscBAR'-mak을 포함하는 재조합 플라스미드 pAcscBAR'-mak의 작제도이다.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 수크로스 비자화성 미생물에 수크로스 퍼미아제(sucrose permease; cscB), 수크로스 하이드롤라제(sucrose hydrolase; cscA) 및 수크로스 전사 조절자(sucrose transcriptional regulator; cscR)의 활성을 부여하고, 만노키나아제(mannokinase)의 활성이 강화된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물에 관한 것이다.
본 발명에 있어서, 수크로스 퍼미아제는 외부의 수크로스를 세포 내로 유입하는 활성을 가지는 펩타이드이며, 수크로스 하이드롤라제는 수크로스를 글루코스와 프락토스로 가수분해하는 활성을 가지며, 수크로스 전사 조절자는 수크로스 퍼미아제 및 수크로스 하이드롤라제를 코딩하는 유전자들의 전사를 조절하는 활성을 가진다. 상기 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성은 수크로스 자화능이 존재하는 미생물에 존재하지만, 에스케리키아속 미생물, 특히 산업적으로 이용되는 산업용 대장균 K12 균주, B 균주 및 C 균주에는 존재하지 않는다.
상기 수크로스 비자화성 에스케리키아 속 미생물에 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성을 부여하도록 하는 방법은 당해 분야에서 잘 알려진 다양한 방법의 적용이 가능하다. 바람직한 활성 부여 방법은 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자를 암호화하는 유전자를 벡터에 도입하고, 그 재조합 벡터로 수크로스 비자화성 L- 아미노산 생산능을 가지는 에스케리키아속 미생물을 형질전환시키는 것이다. 상기 수크로스 퍼미아제를 코딩하는 유전자, 수크로스 하이드롤라제를 코딩하는 유전자, 수크로스 전사 조절자를 코딩하는 유전자는 바람직하게 수크로스 자화능이 있는 미생물, 바람직하게는 수크로스 자화능이 있는 에스케리아속 미생물, 보다 바람직하게는 수크로스 자화능이 있는 대장균으로부터 유래할 수 있다. 수크로스 자화능이 있는 대장균의 예로는 대장균 ATCC9637 (Alterthum F & Ingram LO, Appl. Environ. Microbiol. (1989) 55:1943-1948) 등이 있다. 상기 대장균 ATCC9637로부터 얻어지는 수크로스 퍼미아제를 코딩하는 유전자 (cscB)를 서열번호 4로, 수크로스 하이드롤라제를 코딩하는 유전자(cscA) 서열번호 6으로, 수크로스 전사 조절자를 코딩하는 유전자(cscR)를 서열번호 7로 각각 나타내었다.
하나의 구체적인 실시에서, 본 발명자는 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자를 암호화하는 유전자로서, csc 레귤론으로부터 유래된 서열번호 4, 6 및 7의 cscB, cscA, 및 cscR 유전자를 포함하는 cscBAR 유전자를 벡터에 도입하고, 그 재조합 벡터로 수크로스 비자화성 L- 아미노산 생산능을 가지는 에스케리키아속 미생물을 형질전환시켜 제조할 수 있다.
본 발명에 있어서, 만노키나아제(mannokinase)는 ATP를 이용하여 만노오스 등의 헥소스(hexose)를 6-포스포-에스터 형태로 전환해 주는 활성을 가지는 펩티드를 말한다. 본 발명은 수크로스 비자화성 에스케리키아속 미생물에서 만노키나아제의 활성이 본래의 활성보다 강화(또는 증가)된 것을 특징으로 한다. 상기"본래의 활성"이란 어떠한 유전적 조작이나 변형이 없는 수크로스 비자화성 에스케리키아속 미생물이 가지고 있는 활성을 의미한다. 또한, 상기 "강화" 또는 "증가"는 수크로스 비자화성 에스케리키아속 미생물의 본래의 활성보다 향상된 것을 의미한다.
본 발명의 만노키나아제 활성을 강화(또는 증가)시키는 방법은 당해 분야에서 잘 알려진 다양한 방법의 적용이 가능하다. 그 방법의 예는, 이로 제한되는 것은 아니지만, 만노키나아제를 코딩하는 염기서열을 포함하는 폴리뉴클레오타이드를 추가로 염색체에 삽입하는 방법 또는 상기 폴리뉴클레오타이드를 벡터 시스템에 도입하는 방법 등에 의하여 만노키나아제를 코딩하는 염기서열의 카피수를 증가시키는 방법, 강한 프로모터로 교체하는 방법, 프로모터에 변이를 도입하는 방법, 및 유전자 변이에 의한 방법 등이 있다. 하나의 구체적 실시에서, 아미노산 생산능을 가지는 에스케리키아속 미생물의 만노키나아제의 활성을 강화시키기 위해 만노키나아제를 암호화하는 유전자를 벡터에 도입하고 에스케리키아속 미생물을 형질전환시킴으로써 상기 유전자의 카피수를 증가시키는 방법을 사용할 수 있다.
만노키나아제를 암호화하는 유전자는 수크로스 비자화성 에스케리키아속 미생물에 작동 가능한 염기서열을 가지는 유전자이면 족하며, 바람직하게는 엔테릭 박테리아 (enteric bacteria)의 야생형 Mak (Mak-o)를 코딩하는 유전자인 mak 유전자이다. 구체적인 일 실시예에서는 대장균에서 유래하였으며, 바람직하게는 서열번호 15의 염기서열 (GenBank accession number AC000091)을 가지는 폴리뉴클레오타이드를 사용하였다. 한편, 상기 만노키나아제를 코딩하는 염기서열은 그 활성을 유지하는 한 일정 정도 변형이 가능한 것은 당업자에게 자명할 것이다. 본 기술 분야의 당업자라면 이러한 인위적인 변형에 의해 70 % 이상의 상동성이 유지되는 염기서열이 본 발명에서 목적하는 유전자의 활성을 보유하는 한, 본 발명의 상기 염기서열로부터 유래된 것과 균등한 것임을 쉽게 이해할 것이다.
본 발명에 있어서 L-아미노산 생산능 및 수크로스 자화능을 추가적으로 향상시키기 위하여, 상기 만노키나아제, 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성을 보유한 펩티드를 코딩하는 유전자의 카피수를 증가시키는 방법, 프로모터를 개량하는 방법, 무작위 돌연변이법 (random mutagenesis) 또는 부위 특이적 돌연변이법 (site-directed mutagenesis)을 이용하는 방법 등을 사용할 수 있다. 본 발명의 구체적 실시에서는 만노키나아제, 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자를 코딩하는 염기서열을 포함하는 유전자군에 하이드록실아민 (hydroxylamine)을 처리하여 무작위 변이를 유발하는 방법 (Sikorski RS & Boeke JD, Methods Enzymol. (1991) 194:302-318)을 이용하였다.
따라서, 바람직한 일 양태로서 본 발명은 상기 변이 유발 방법에 의한 염기서열 또는 아미노산 서열에 변이가 있는, 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물에 관한 것이며, 바람직하게 상기 변이체는 만노키나아제, 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자 중의 염기서열에 변이가 하나 또는 그 이상의 변이가 존재하는 변이체이다. 보다 바람직하게는 만노키나아제, 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자 중의 아미노산 서열에 하나 또는 그 이상의 변이가 존재하는 변이체이다. 가장 바람직하게는 수크로스 전사 조절자의 130번째 아미노산이 히스티딘에서 타이로신으로 치환된 변이체이고, 바람직하게 이러한 변이체는 서열번호 17로 기재되는 염기서열로 암호화되는 변이된 수크로스 전사 조절자를 갖는다.
이와 같은 변이체를 벡터에 도입하고, 그 재조합 벡터를 수크로스 비자화성 L-아미노산 생산능을 가지는 에스케리키아 속 미생물에 형질전환시키는 방법에 의해 본 발명에 따른 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물을 제공할 수 있다. 구체적인 일 실시에서, 본 발명자는 서열번호 18로 기재되는 염기서열을 포함하는 pAcscBAR'-mak 플라스미드를 사용하여 수크로스 비자화성 에스케리키아속 미생물을 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물로 형질전환시킬 수 있다.
본 발명에서 "벡터"란 수크로스 퍼미아제, 수크로스 하이드롤라제, 수크로스 전사 조절자 및 만노키나아제를 암호화하는 유전자를 숙주세포인 수크로스 비자화성 에스케리키아속 미생물로 도입하여 본 발명에 따른 에스케리키아속 미생물을 제공하는데 사용되는 핵산 화합물로서, 목적 단백질을 발현하기 위한 통상의 필수적인 발현 요소를 포함한다. 구체적으로, 프로모터, 오퍼레이터, 개시코돈, 종결코돈 및 폴리아데닐화 서열과 같은 조절서열을 가지며, 이의 다양한 변형이 가능하다. 또한, 인핸서 서열 또는 분비 서열을 포함할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 바람직하게는 pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322 및 pMW118 벡터 등을 사용할 수 있다.
본 발명에서 용어 "형질전환"은 유전자를 숙주세포 내에 도입하여 숙주세포 내에서 발현할 수 있도록 하는 것을 의미한다. 형질전환된 유전자는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하든지 이들 모두를 포함한다. 또한, 상기 유전자는 폴리펩티드를 코딩할 수 있는 폴리뉴클레오티드로 DNA 및 RNA를 포함한다. 상기 유전자는 숙주세포내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 유전자는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 폴리뉴클레오티드 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 유전자에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결 신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 유전자는 그 자체 또는 폴리뉴클레오티드 구조체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
본 발명의 미생물은 수크로스 비자화성을 갖는 L-아미노산 생산 가능 미생물에 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성이 부여되고 만노키나아제의 활성이 강화되어 L-아미노산 생산능이 향상됨과 동시에 수크로스 자화능을 갖는 미생물을 말한다. 따라서, 본 발명의 미생물은 상기 특성을 보유하는 한 원핵 미생물 및 진핵 미생물 어느 것이나 포함하며, 이의 예로는 에스케리키아 (Escherichia) 속, 어위니아 (Erwinia) 속, 세라티아 (Serratia) 속, 프로비덴시아 (Providencia) 속, 코리네박테리움 (Corynebacterium) 속 및 브레비박테리움 (Brevibacterium) 속에 속하는 미생물 균주가 있다. 바람직하게 본 발명의 미생물은 에스케리키아 속에 속하는 미생물이며, 보다 바람직하게는 대장균이다.
본 발명에 있어서 "L-아미노산"은 L-쓰레오닌, O-숙시닐-호모세린(O-succinyl-homoserine), O-아세틸-호모세린(O-Acetyl-homoserine), L-메티오닌, L-라이신, L-호모세린, L-이소루신, L-발린 및 L-트립토판 등이다. 바람직하게 상기 L-아미노산은 L-쓰레오닌, O-숙시닐-호모세린, O-아세틸-호모세린 및 L-트립토판이다.
구체적인 일 실시에서, 본 발명자는 특히 L-쓰레오닌 생산능을 가지는 대장균이 cscBAR'-mak 유전자군을 포함한 서열변호 18의 염기서열을 갖는 벡터로 L-쓰레오닌 생산능을 가지는 대장균 ABA5G 균주를 형질전환 하였으며, 제작된 균주를 대장균 CA03-0308로 명명하고, 2008년 12월 23일자로 대한민국 서울특별시 서대문구 홍제 1동 361-221 번지에 소재하는 국제기탁기관인 한국종균협회 부설 한국미생물보존센터에 수탁번호 KCCM-10978P로 기탁하였다.
다른 하나의 양태로서, 본 발명은, 상기 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아 속 미생물을 수크로스가 주 탄소원으로 포함되어 있는 배지에 배양하여 아미노산을 생산하는 방법에 관한 것이다.
구체적으로, 본 발명은 탄소원으로서 수크로스가 전체 또는 일부 포함된 배양 배지에 상기의 수크로스 자화능을 가지고 L-아미노산을 생산하는 미생물을 접종하여 배양하는 단계; 및 상기 배양물로부터 L-아미노산을 분리하는 단계를 포함하는, 수크로스를 포함한 탄소원에서 상기 에스케리키아 속 미생물을 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.
본 발명의 상기 배양과정은 당 업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 당업자라면 선택되는 균주에 따라 용이하게 조정하여 사용할 수 있다. 상기 배양방법의 예에는 회분식, 연속식 및 유가식 배양이 포함되나, 여기에 한정되는 것은 아니다. 배양에 사용되는 배지는 특정한 균주의 요구 조건을 적절하게 만족시켜야 한다.
본 발명에서 사용되는 배지는 수크로스를 주탄소원으로 사용한다. 주탄소원으로 사용되는 수크로스는 수크로스를 다량으로 포함한 당밀 등의 형태로 탄소원으로 제공될 수 있으며, 수크로스 또는 당밀 외에 적정량의 탄소원을 제한없이 다양하게 포함할 수 있다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에 포함되는 인원으로서 인산이수소칼륨, 인산수소이칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 또한, 황산마그네슘 또는 황산 철과 같은 금속염을 포함할 수 있다. 그 외에 아미노산, 비타민 및 적절한 전구체 등이 포함될 수 있다. 이들 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있다.
배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한 배양 중에는 지방산 폴리클리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입한다. 배양물의 온도는 보통 27℃ 내지 37℃, 바람직하게는 30℃ 내지 35℃이다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속 될 수 있으며, 바람직하게는 10 내지 100 시간이다.
본 발명의 상기 배양 단계에서 생산된 아미노산을 수집 및 회수하는 방법은 배양방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 아미노산을 수집할 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 수크로스 이용성 유전자 csc regulon의 획득 및 클로닝
수크로스 유입시 PEP(phosphoenolpyruvate)를 소모하지 않는 Scr-non PTS 시스템을 암호화하는, cscBKAR 유전자(GenBank accession number X81461)를 포함하는 레귤론은 대장균 W 균주 (ATCC9637, USA)의 게놈 DNA를 주형으로 PCR법을 통하여 증폭하였다. 제한 효소 EagI 부위를 가지는 서열번호 1의 프라이머와 XbaI 부위를 가지는 서열번호 2의 프라이머를 이용하여 게놈상에 연속적으로 존재하는 4종의 유전자 전부를 단일 폴리뉴클레오티드로 증폭하였다.
서열 번호 1: 5'-CTTACGGCCGGAGTACATTTGAGCGACTGT-3'
서열 번호 2: 5'-CGACTCTAGACTCGTTGGCGAGAACAGAGG-3'
PCR 조건은 94 ℃에서 3분간 변성 후, 94℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 5분 중합을 25회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, 5199 bp의 폴리뉴클레오티드를 획득할 수 있었다. 수득한 폴리뉴클레오티드에 EagI 및 XbaI의 제한효소 처리를 한 후 pACYC184 벡터에 클로닝하였다. 이후, 상기벡터를 대장균 DH5α에 형질전환한 후 1 % 수크로스가 포함되어 있는 맥콘키 고체배지 (MacConkey agar plate)에 도말하였다. 콜로니중 진한 자주색 (purple color)을 띠는 콜로니를 선별한 후 상기 콜로니로부터 플라스미드를 수득하였다.
실시예 2. 획득된 cscBKAR 유전자의 염기서열 결정
수득한 플라스미드를 pAcscBKAR로 명명하였고, EagI 및 XbaI 자리에 클로닝된 cscBKAR의 DNA 염기서열 (서열번호 3)을 결정하였을 때, 141번째부터 1388번째 염기서열은 cscB(서열번호 4), 1460번째부터 2374번째 염기서열은 cscK(서열번호 5), 2590번째부터 4023번째 염기서열은 cscA(서열번호 6), 4031번째부터 5026번째 염기서열은 cscR(서열번호 7)로 밝혀졌다.
실시예 3. MG1655 mak 유전자 결손 균주 제작
수크로스 대사에 주요하게 영향을 주는 유전자를 탐색하기 위하여, 수크로스 대사에 관여할 것으로 예상되는 몇 가지 유전자를 선별하고, 그 유전자가 각각 결손 되어 있는 변이 대장균 K12를 제작하였다. 각 유전자가 결손된 변이체 대장균 K12는 원스탭 불화성화 방법 (Proc. Natl. Acad. Sci. (2000) 97:6640-6645) 에 의해 제작하였으며, 항생제 내성부여 표식 유전자를 제거하였다. 특히, mak 결손 균주를 제작하기 위해서, 서열번호 8 과 서열번호 9의 프라이머 쌍과 pKD4 플라스미드 (GenBank No. AY048743)를 이용하여 PCR 반응을 수행하고, 그 결과 획득한 DNA 단편을 pKD46 (GenBank No. AY048746)을 함유하는 야생형 대장균 K12의 컴피턴트 세포 (competent cell)에 일렉트로포레이션 (electroporation)하였다. 이후 카나마이신 (kanamycine) 내성을 보이는 세포주를 대상으로 PCR 반응을 수행하여, mak 유전자의 결실여부를 확인하고 pCP20 플라스미드를 도입하여 항생제 내성 표식 유전자를 제거하였다.
서열번호 8: 5'-GTGCGTATAGGTATCGATTTAGGCGGCACCAAAACTGAAGTGATTGCACTG TTGCAGCATTACACGTCTTG-3'
서열번호 9: 5'-TTACTCTTGTGGCCATAACCACGCAGCGCCGCGTACGCCGCTGGAATCACC ACTTAACGGCTGACATGGGA-3'
실시예 4. MG1655 mak 유전자 결손 균주에 pAcscBKAR 도입 및 수크로스 이용성 확인
수크로스 대사에 주요하게 영향을 줄 것으로 예상되는 mak 유전자가 결실된 변이 대장균 K12를 실시예 3의 방법으로 제작한 후, pAcscBKAR 플라스미드를 형질전환 하였다. pAcscBKAR 플라스미드가 도입된 형질전환체를 33℃ 배양기에서 LB 고체 배지에서 밤새 배양한 균주를 수크로즈가 함유된 표 1의 25 mL 역가 배지에 한 백금이 씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 36 시간 배양하였다. 이 후 상기 배양액의 OD값 및 당소모량을 측정하였고, 이의 결과를 표 2에 나타내었다.　
표 1
Figure PCTKR2010000872-appb-T000001
표 2
Figure PCTKR2010000872-appb-T000002
그 결과, 표 2에서 보는 바와 같이 mak가 결손되고 csc 레귤론이 형질도입된 균주는 36시간 동안 수크로스를 24.9 g/L 이용하고, mak가 결손되지 않고 csc 레귤론이 형질도입된 야생형 균주는 33.1 g/L의 수크로스를 이용함에 따라 mak가 결손된 균주가 mak 비결손균주에 비해 수크로스 이용속도가 약 1.3배 감소하는 것을 확인할 수 있었다. 이에, mak가 수크로스 대사에 있어서 중요한 유전자임을 지시하였다.
실시예 5. pAcscBAR-mak 제작
효율적인 수크로스 이용성 균주를 개발하기 위해, mak와 csc 레귤론을 동시에 과발현 시키기 위한 벡터를 제작하였다. 이때, csc 레귤론 중 cscK는 제외시켰다. 우선pAcscBAR을 제작한 후 pAcscBAR에 mak유전자를 클로닝하는 방법을 이용하였다.
구체적으로 서열번호 10과 11의 프라이머를 이용하여 실시예 1과 동일한 조건의 PCR 방법으로 cscK부위가 제거된 cscB부위의 폴리뉴클레오티드를 증폭하였다. 그 결과, 1521 bp의 폴리뉴클레오티드를 수득하였다.
서열번호 10: 5'-CGCGATATCTAGCATATGCCGGGTACCGCACTAGTTGAGAGTAAACGGC GAAGT-3'
서열번호 11: 5'-ATTCGGCCGGAGCCCTGCAGGTGCACGAGTACATTTGAGCGACTGT-3'
상기 수득한 폴리뉴클레오티드와 pAcscBKAR를 각각 EcoRV와 EagI으로 제한 효소 처리를 한 후 연결하여 pAcscBAR 플라스미드를 제작하였다. 상기 플라스미드를 대장균 DH5α에 형질전환 한 후, LB 배지에서 성장한 콜로니를 이용한 PCR법을 통하여 pAcscBAR이 포함된 콜로니를 선별하였으며, 이로부터 pAcscBAR 플라스미드를 획득하였다. 획득된 pAcscBAR 플라스미드의 XbaI과 EagI자리에 연결된 cscBAR의 염기서열 (서열번호 12) 분석을 통하여 변이가 없는 것을 확인하였다.
이후, 대장균 W3110의 게놈 DNA를 주형으로 서열번호 13과 14의 프라이머쌍을 이용하여 실시예 1과 동일한 방법으로 PCR을 수행함으로써 mak가 포함된 폴리뉴클레오티드를 증폭한 결과, 1388 bp의 폴리뉴클레오티드(서열번호 15)를 수득하였고, 상기 PCR 산물을 pAcscBAR의 PstⅠ과 EagⅠ의 제한 효소 자리에 클로닝함으로써 pAcscBAR-mak를 제작하였다.
서열번호 13: 5'-CACTGCAGTGGGGTAAATGCCATCG-3'
서열번호 14: 5'-AACGGCCGTCTCGGTGCTCATTACT-3'
상기 pAcscBAR-mak를 대장균 DH5α에 형질전환 한 후, LB 배지에서 성장한 콜로니를 이용한 PCR법을 통하여 pAcscBAR-mak가 포함된 콜로니를 선별하였으며, 이로부터 pAcscBAR-mak 플라스미드를 획득하였다. 획득된 pAcscBAR-mak 플라스미드의 XbaI과 EagI자리에 연결된 cscBAR-mak의 염기서열(서열번호 16)분석을 통하여 변이가 없는 것을 확인하였다.
실시예 6. 쓰레오닌 생산주에 pAcscBAR-mak 도입
pAcscBAR-mak를 쓰레오닌을 생산하는 대장균에 도입하였을 때, 수크로스를 이용하여 성장할 뿐만 아니라, 실제 효율적인 쓰레오닌 생산이 가능한지 확인하기 위하여 통상의 형질전환 방법을 통하여 쓰레오닌 생산주, ABA5G(KFCC 10718)에 도입하였다. 획득된 콜로니에 대하여 PCR 클로닝 법을 통해 수크로스 이용 관련 유전자가 포함된 플라스미드를 갖고 있는 콜로니를 획득하였다. 획득한 콜로니를 33℃ 배양기 (incubator)에서 LB 고체 배지 중에 밤새 배양한 후, 표 1의 25 mL 역가 배지에 한 백금이 씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 30시간 배양하였다.이후, 상기 배양액의 OD값 및 당소모 량을 측정하였고, 이의 결과를 표 3에 나타내었다.
표 3
Figure PCTKR2010000872-appb-T000003
그 결과, 표 3에서 나타난 바와 같이 pAcscBKAR 를 포함한 ABA5G균주는 30 시간 배양하였을 경우 18.7 g/L의 수크로스를 이용하고, 6.0 g/L의 L-쓰레오닌을 생산하였으나, pAcscBAR-mak를 포함한 ABA5G 균주는 27.7 g/L의 수크로스를 이용하고 9.7 g/L의 L-쓰레오닌을 생산하였다. 즉, pAcscBAR-mak가 포함된 ABA5G는 pAcscBKAR을 포함한 ABA5G 균주에 비해 수크로스 이용 속도가 약 1.5 배가량 증가하였으며, 쓰레오닌 생산성도 3.7 g/L 상승하였다.
실시예 7. cscBAR-mak 도입을 통한 Mak 활성 강화 확인
모균주 ABA5G와 비교하여 pAcscBAR-mak가 포함된 ABA5G 균주에서 만노키나아제의 활성의 증대 또는 강화를 확인하기 위한 하나의 방법으로 프락토키나아제 활성 측정(Copeland L et al., Plant Physiol. (1978) 62:291-294)을 수행하였다. 이 효소 활성 측정법은 프락토오즈를 최초 기질로 하여, 만노키나아제와 포스포글루코스 아이소머라제 (phosphoglucose isomerase) 및 글루코스-6-포스페이트 디하이드로게나아제 (glucose-6-phosphate dehydrogenase)를 이용한 커플링 반응(coupling reaction)을 통하여 만노키나아제의 프락토키나아제 활성을 측정할 수 있는 방법이다. 효소액은 LB에서 24시간 배양한 pAcscBAR과 pAcscBAR-mak가 각각 포함된 ABA5G 균주를 소니케이터(sonicator)를 이용하여 파쇄한 후 원심 분리한 상등액을 효소액으로 이용하였으며, 단백질 농도 측정은 브래드포드 분석법 (Bradford assay)을 이용하였다. 효소 반응은 30분간 유지하면서 OD 340 nm에서 흡광도의 변화량을 측정하였고, 이를 통해 커플링 반응에 의해 생성된 NADPH의 양을 측정하였으며, NADPH의 흡광계수 6.22 cm-1 mM-1를 사용하여 활성을 계산하였다. 만노키나아제의 1 unit은 상기의 효소 활성 측정법에 의하여 1 분당 전체 단백질 1 mg에 의해 1 nM의 NADPH를 생성시키는 효소량으로 정의하며, 이의 결과는 표 4에 나타내었다.
표 4
Figure PCTKR2010000872-appb-T000004
표 4에 나타난 바와 같이 pAcscBAR-mak가 포함된 ABA5G의 만노키나아제의 활성은 pAcscBAR만 포함된 ABA5G에 비해 효소 활성이 약 12배 증가 또는 강화 된 것을 확인할 수 있었다.
실시예 8. cscBAR-mak 의 돌연변이 도입
수크로스 이용성을 향상시킬 뿐만 아니라 쓰레오닌 생산성을 향상시키기 위하여 하이드록실아민 (Hydroxylamine)을 처리하여 변이된 수크로스 이용성 유전자를 얻는 화학적 무작위 변이법 (chemical random mutagenesis)을 수행하였다 (Sikorski RS & Boeke JD, Methods Enzymol. (1991) 194:302-318). 우선 1 M 하이드록실아민, 2 mM EDTA, 100 mM 소디움 클로라이드 (sodium chloride), 50 mM 소디움 파이로포스페이트 (sodium pyrophosphate) 를 첨가하여 변이유발액 (mutagenesis solution)을 제조한 후, 1 ml 변이유발액에 목적 DNA를 0.2 mg/ml 농도로 25 μl넣었다. pAcscBAR-mak 플라스미드로부터 EagI과 XbaI의 제한 효소를 이용하여 수득한, 5887 bp의 cscBAR-mak가 포함된 DNA 조각을 목적 DNA로 이용하였다. 변이유발액을 첨가한 DNA 조각을 75℃에서 30분, 1시간, 2시간, 4시간 마다 500 μl씩 정제컬럼 (purification column)을 이용하여 정제하였다. 하이드록실아민이 처리된 DNA와 EagI과 XbaI의 제한 효소가 처리된 pACYC184 벡터를 T4 DNA 라이게이즈 (ligase)를 이용하여 연결한 후 쓰레오닌 생산주 ABA5G에 형질전환하였다. 형질전환된 균주를 0.1 %의 저농도 수크로스가 포함된 맥콘키 고체 배제에 도말하여 37℃에서 하루 배양 후 진한 자주색을 띠는 콜로니를 선별하였다.
선별된 콜로니들을 표 1의 역가 배지에서 배양하면서 쓰레오닌 생산성과 수크로스 이용속도를 평가하여, 최종적으로 쓰레오닌 생산성과 수크로스 이용성이 가장 우수한 균주를 선별하였다. 선별된 균주로부터 플라스미드를 얻은 후 염기서열 분석을 수행하였다. 그 결과, 상기 균주의 cscR의 388 번째 염기가 C에서 T로 치환되었으며, 그에 따라 130번째 아미노산이 히스티딘에서 타이로신으로 변이되었고, 이 변이를 가진 수크로스 전사 조절자 cscR은 서열번호 17의 염기서열에 의해 암호화된다.
실시예 9. pAcscBAR'-mak도입을 통한 L-쓰레오닌 생산성 향상
cscR 변이 (서열번호 17)가 포함된 pAcscBAR'-mak (서열번호 18) 플라스미드를 ABA5G에 새로 형질전환 하여 플라스크 역가 평가를 수행하였다. 33℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 균주를 표 1의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 30시간 배양하였으며, 이의 결과를 표 5에 나타내었다.
표 5
Figure PCTKR2010000872-appb-T000005
표 5에서 나타난 바와 같이 pAcscBKAR 를 포함한 ABA5G균주는 30 시간 배양하였을 경우 18.7 g/L의 수크로스를 이용하고, 6.0 g/L의 L-쓰레오닌을 생산하였으나, pAcscBAR'-mak를 포함한 ABA5G 균주는 33.4 g/L의 수크로스를 이용하고 12.4 g/L의 L-쓰레오닌을 생산하였다. 즉, pAcscBAR'-mak가 포함된 ABA5G는 pAcscBKAR을 포함한 ABA5G 균주에 비해 수크로스 이용 속도가 약 1.8 배, 쓰레오닌 생산성이 6.4 g/L 상승하였으며, pAcscBAR-mak가 포함된ABA5G에 비해서도 수크로스 이용 속도가 약 1.2 배, 쓰레오닌 생산성이 2.7 g/L 가량 증가하였다. 따라서 cscBAR'-mak을 포함한 재조합 균주의 경우, 수크로스 이용성 및 L-쓰레오닌의 생산성이 향상됨을 확인할 수 있었으며, 상기 형질전환된 미생물을 CA03-0308로 명명하였고, 이를 2008년 12월 23일자로 대한민국 서울특별시 서대문구 홍제 1동 361-221 번지에 소재하는 국제기탁기관인 한국종균협회 부설 한국미생물보존센터에 수탁번호 KCCM-10978P로 기탁하였다.
실시예 10. pAcscBAR'-mak도입을 통한 O-숙시닐-호모세린 생산성 향상
상기의 실시예 8에서 제작된 pAcscBAR'-mak를 미국공개특허 제 2009/0253187호에 기재된 O-숙시닐-호모세린(O-Succinyl-homoserine) 생산균주인 CJM-11A(KCCM-10922P)에 형질전환하여 0.1 %의 저농도 수크로스가 포함된 맥콘키 고체배지에 도말하여 37℃에서 하루 배양 후 진한 자주색을 띠는 콜로니를 선별하였다
선별된 형질전환체를 33℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 균주를 수크로즈가 함유된 표 1의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 배양하였으며, 이의 결과를 표 6에 나타내었다.
표 6
Figure PCTKR2010000872-appb-T000006
표 6에서 나타낸 바와 같이, 모 균주인 pAcscBKAR을 포함한 CJM-11A 균주는 48시간 배양하였을 경우 30.2 g/L의 수크로스를 이용하고, 12.3 g/L의 O-숙시닐-호모세린을 생산하였으나, pAcscBAR'-mak를 포함한 CJM-11A 균주는 50.4 g/L의 수크로스를 이용하고, 20.5 g/L의 O-숙시닐-호모세린을 생산하여 pAcscBKAR을 포함한 CJM-11A 에 비해 수크로스 이용 속도가 1.7배 증가하였고, 8.2 g/L의 향상된 O-숙시닐-호모세린 생산성을 나타내었다. 즉, cscBAR'-mak을 포함한 재조합 균주의 경우, 수크로스 이용성 및 O-숙시닐-호모세린의 생산성이 향상됨을 확인할 수 있었다.
실시예 11. pAcscBAR'-mak 도입을 통한 O-아세틸-호모세린 생산성 향상
상기 실시예 8에서 제작된 pAcscBAR'-mak를 미국공개특허 제2009/0253186호에 기재된 O-아세틸-호모세린(O-Acetyl-homoserine) 생산균주인 CJM-X(KCCM-10921P)에 형질전환하여 0.1 %의 저농도 수크로스가 포함된 맥콘키 고체배지에 도말하여 37℃에서 하루 배양 후 진한 자주색을 띠는 콜로니를 선별하였다
선별된 형질전환체를 33℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 균주를 수크로즈가 함유된 표 1의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 33℃, 200 rpm의 배양기에서 배양하였으며, 이의 결과를 표 7에 나타내었다.
표 7
Figure PCTKR2010000872-appb-T000007
표 7에서 나타낸 바와 같이, 모 균주인 pAcscBKAR을 포함한 CJM-X 균주는 48시간 배양하였을 경우 29.9 g/L의 수크로스를 이용하고, 10.7 g/L의 O-아세틸-호모세린(O-Acetyl-homoserine 이하, OAH)을 생산하였으나, pAcscBAR'-mak를 포함한 CJM-X 균주는 53.5 g/L의 수크로스를 이용하고, 15.4 g/L의 OAH을 생산하여 pAcscBKAR을 포함한 CJM-X 에 비해 수크로스 이용 속도가 1.8배 증가하였고, 8.8 g/L의 향상된 OAH 생산성을 나타내었다. 즉, cscBAR'-mak을 포함한 재조합 균주의 경우, 수크로스 이용성 및 OAH의 생산성이 향상됨을 확인할 수 있었다.
실시예 12. pAcscBAR'-mak도입을 통한 L-트립토판 생산성 향상
상기 실시예 8에서 제작된 pAcscBAR'-mak를 L-트립토판 생산균주인 CJ285(KCCM-10534, 한국미생물보존센터 2003년 11월 28일 기탁)에 형질전환하여 0.1%의 저농도 수크로스가 포함된 맥콘키 고체배지에 도말하여 37℃에서 배양 후 하루 배양 후 진한 자주색을 띠는 콜로니를 선별하였다.
선별된 형질전환체를 37℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 균주를 수크로즈가 함유된 표 8의 25 mL 역가 배지에 한 백금이씩 접종한 다음, 이를 37℃, 200 rpm의 배양기에서 배양하였으며, 이의 결과를 표 9에 나타내었다.
표 8
Figure PCTKR2010000872-appb-T000008
표 9
Figure PCTKR2010000872-appb-T000009
표 9에서 나타낸 바와 같이, 모 균주인 pAcscBKAR을 포함한 CJ285 균주를 60시간 배양하였을 경우, 24.7 g/L의 수크로스를 이용하고, 4.9 g/L의 L-트립토판을 생산하였으나, pAcscBAR'-mak를 포함한 CJ285균주는 37.1 g/L의 수크로스를 이용하고, 8.9 g/L의 L-트립토판을 생산하여 pAcscBKAR을 포함한 CJ285에 비해 수크로스 이용 속도가 1.5배 증가하였고, 4.0 g/L의 향상된 L-트립토판 생산성을 나타내었다. 즉, cscBAR'-mak을 포함한 재조합 균주의 경우, 수크로스 이용성 및 L-트립토판의 생산성이 향상됨을 확인할 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당 업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
본 발명은 따른 향상된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물을 사용하여 L-아미노산을 생산하는 경우, 발효산업에 주로 이용되었던 전분당 이외에 수크로스를 주탄소원으로 이용함으로써 급변하는 세계 곡물가에 유연하게 대처할 수 있을 뿐만 아니라 고수율의 L-아미노산을 생산할 수 있다.
Figure PCTKR2010000872-appb-I000001

Claims (16)

  1. 수크로스 비자화성 미생물에 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성을 부여하고, 만노키나아제의 활성을 강화시킨 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  2. 제1항에 있어서, 만노키나아제의 활성 강화는 만노키나아제 유전자의 카피수 증가, 프로모터 교체, 프로모터 변이 및 유전자 변이로 이루어진 군으로부터 하나 이상 선택되는 방법에 의한 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  3. 제2항에 있어서, 만노키나아제 유전자의 카피수 증가는 염색체 삽입 및 만노키나아제를 코딩하는 폴리뉴클레오타이드를 포함하는 벡터의 형질도입에 의한 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  4. 제3항에 있어서, 상기 벡터는 서열번호 15의 염기서열을 포함하는 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  5. 제1항에 있어서, 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자의 활성 부여가 수크로스 퍼미아제, 수크로스 하이드롤라제 및 수크로스 전사 조절자를 암호화하는 염기서열을 포함하는 벡터로 형질전환된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  6. 제5항에 있어서, 상기 염기서열은 각각 서열번호 4, 6 및 7의 염기서열인 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  7. 제6항에 있어서, 수크로스 전사 조절자의 130번째 아미노산이 타이로신으로 치환된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  8. 제7항에 있어서, 수크로스 전사 조절자가 서열번호 17의 염기서열로 암호화된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  9. 제1항에 있어서, 수크로스 퍼미아제, 수크로스 하이드로라제, 수크로스 전사 조절자 및 만노키나아제를 암호화하는 염기서열을 모두 포함하는 벡터로 형질전환한 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  10. 제9항에 있어서, 상기 벡터가 서열번호 18의 염기서열로 암호화된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  11. 제1항에 있어서, 에스케리키아속 미생물이 대장균인 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  12. 제11항에 있어서, 대장균이 대장균 CA03-0308 (수탁번호 KCCM10978P)인 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  13. 제1항에 있어서, L-아미노산이 L-쓰레오닌, O-숙시닐-호모세린, O-아세틸-호모세린, L-메티오닌, L-라이신, L-호모세린, L-이소루신, L-발린 및 L-트립토판으로 이루어진 군으로부터 선택된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  14. 제13항에 있어서, L-아미노산이 L-쓰레오닌, O-숙시닐-호모세린, O-아세틸-호모세린 및 L-트립토판으로 이루어진 군으로부터 선택된 것을 특징으로 하는 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물.
  15. 탄소원으로서 수크로스가 전체 또는 일부 포함된 배양 배지에 제1항 내지 제14항 중 어느 한 항에 따른 증가된 L-아미노산 생산능 및 수크로스 자화능을 갖는 에스케리키아속 미생물을 접종하여 배양하는 단계; 및
    상기 단계에서 수득되는 배양물로부터 L-아미노산을 분리하는 단계를 포함하는 L-아미노산의 생산 방법.
  16. 제15항에 있어서, L-아미노산이 L-쓰레오닌, O-숙시닐-호모세린, O-아세틸-호모세린, L-메티오닌, L-라이신, L-호모세린, L-이소루신, L-발린 및 L-트립토판으로 이루어진 군으로부터 선택된 것을 특징으로 하는 L-아미노산의 생산 방법.
PCT/KR2010/000872 2009-02-13 2010-02-11 Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법 WO2010093182A2 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201080000811.1A CN102165056B (zh) 2009-02-13 2010-02-11 生产l-氨基酸的微生物和使用其生产l-氨基酸的方法
DK10715651.5T DK2239336T3 (en) 2009-02-13 2010-02-11 Microorganism for Preparation of L-Amino Acids and Process for Preparation of L-Amino Acids Using the Same
ES10715651.5T ES2635312T3 (es) 2009-02-13 2010-02-11 Microorganismo para producir L-aminoácidos y método para producir L-aminoácidos utilizando el mismo
JP2010550616A JP5597554B2 (ja) 2009-02-13 2010-02-11 Ｌ−アミノ酸生産用微生物およびこれを用いてｌ−アミノ酸を生産する方法
EP10715651.5A EP2239336B1 (en) 2009-02-13 2010-02-11 Microorganism for producing l-amino acids and method for producing l-amino acids using same
US12/743,675 US8574874B2 (en) 2009-02-13 2010-02-11 Microorganisms for producing L-amino acids and process for producing L-amino acids using them

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090012048A KR101083136B1 (ko) 2009-02-13 2009-02-13 Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
KR10-2009-0012048 2009-02-13

Publications (2)

Publication Number Publication Date
WO2010093182A2 true WO2010093182A2 (ko) 2010-08-19
WO2010093182A3 WO2010093182A3 (ko) 2010-12-09

Family

ID=42562186

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/000872 WO2010093182A2 (ko) 2009-02-13 2010-02-11 Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법

Country Status (10)

Country Link
US (1) US8574874B2 (ko)
EP (1) EP2239336B1 (ko)
JP (1) JP5597554B2 (ko)
KR (1) KR101083136B1 (ko)
CN (1) CN102165056B (ko)
DK (1) DK2239336T3 (ko)
ES (1) ES2635312T3 (ko)
HU (1) HUE032951T2 (ko)
PL (1) PL2239336T3 (ko)
WO (1) WO2010093182A2 (ko)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8129170B1 (en) 2010-12-06 2012-03-06 E.I. Du Pont De Nemours And Company Recombinant bacteria having the ability to metabolize sucrose
US8222000B2 (en) 2010-12-06 2012-07-17 E I Du Pont De Nemours And Company Recombinant bacteria having the ability to metabolize sucrose
WO2012099396A3 (en) * 2011-01-18 2012-12-06 Cj Cheiljedang Corporation A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
US8686114B2 (en) 2012-03-05 2014-04-01 E I Du Pont De Nemours And Company Variant sucrose transporter polypeptides
US9267161B2 (en) 2011-04-01 2016-02-23 Cj Cheiljedang Corporation Corynebacterium sp. transformed with a fructokinase gene derived from Escherichia sp. and process for preparing L-amino acid using the same

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101145943B1 (ko) * 2010-03-11 2012-05-15 씨제이제일제당 (주) Ｌ-아미노산 생산능을 갖는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
KR20130082124A (ko) * 2012-01-10 2013-07-18 씨제이제일제당 (주) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
KR20140102393A (ko) * 2013-02-13 2014-08-22 씨제이제일제당 (주) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
KR101530817B1 (ko) * 2013-04-16 2015-06-25 씨제이제일제당 (주) L-트립토판 생산능을 갖는 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
EP3461890A1 (en) * 2014-03-31 2019-04-03 Jennewein Biotechnologie GmbH Total fermentation of oligosaccharides
WO2015197082A1 (en) 2014-06-27 2015-12-30 Glycom A/S Oligosaccharide production
US11926858B2 (en) 2014-06-27 2024-03-12 Glycom A/S Oligosaccharide production
WO2022013143A1 (en) 2020-07-13 2022-01-20 Glycom A/S Oligosaccharide production

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4806480A (en) 1984-02-16 1989-02-21 Antibioticos, S.A. Novel E. coli hybrid plasmid vector conferring sucrose fermenting capacity
US6960455B2 (en) 2000-04-26 2005-11-01 Ajinomoto Co., Inc. Methods of making amino acids using E. coli transformed with csc genes
US20090253187A1 (en) 2008-04-04 2009-10-08 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and the method of producing l-methionine precursor using the microorganism
US20090253186A1 (en) 2008-04-04 2009-10-08 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and the method of producing l-methionine precursor using the microorganism

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7524660B2 (en) * 2005-05-05 2009-04-28 E.I. Du Pont De Nemours And Company Utilization of fructose in microbial production strains
EP1928899B1 (en) * 2005-09-27 2012-10-24 Ajinomoto Co., Inc. An l-amino acid-producing bacterium and a method for producing an l-amino acid

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4806480A (en) 1984-02-16 1989-02-21 Antibioticos, S.A. Novel E. coli hybrid plasmid vector conferring sucrose fermenting capacity
US6960455B2 (en) 2000-04-26 2005-11-01 Ajinomoto Co., Inc. Methods of making amino acids using E. coli transformed with csc genes
US7179623B2 (en) 2000-04-26 2007-02-20 Ajinomoto Co., Inc. Method of producing amino acids using E. coli transformed with sucrose PTS genes
US20090253187A1 (en) 2008-04-04 2009-10-08 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and the method of producing l-methionine precursor using the microorganism
US20090253186A1 (en) 2008-04-04 2009-10-08 Cj Cheiljedang Corporation Microorganism producing l-methionine precursor and the method of producing l-methionine precursor using the microorganism

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
ALTERTHUM F; INGRAM LO, APPL. ENVIRON. MICROBIOL., vol. 55, 1989, pages 1943 - 1948
APPL. ENVIRON. MICROBIOL., vol. 58, 1992, pages 2081 - 2088
APPL. MICROBIOL. BIOTECHOL., vol. 74, 2007, pages 1031 - 1040
CAN. J. MICROBIOL., vol. 45, 1999, pages 418 - 422
COPELAND L ET AL., PLANT PHYSIOL., vol. 62, 1978, pages 291 - 294
J. BACTERIOL., vol. 151, 1982, pages 68 - 76
J. BACTERIOL., vol. 171, 1989, pages 263 - 271
J. BACTERIOL., vol. 173, 1991, pages 7464 - 7470
J. BACTERIOL., vol. 182, 2000, pages 5351 - 5358
J. BACTRERIOL., vol. 171, 1989, pages 1519 - 1523
J. GEN. MICROBIOL., vol. 134, 1988, pages 1635 - 1644
JAHREIS K ET AL., J. BACTERIOL., vol. 184, 2002, pages 5307 - 5316
KORNBERG HL, J.MOL. MICROBIOL. BIOTECHNOL., vol. 3, 2001, pages 355 - 359
METAB. ENG., vol. 4, 2002, pages 124 - 137
MICROB. CELL FACT., vol. 4, 2005, pages 14
MILLER BG; RAINES RT, BIOCHEMISTRY, vol. 44, 2005, pages 10776 - 10783
MOL. MICROBIOL., vol. 2, 1998, pages 1 - 8
PROC. NATL. ACAD. SCI., vol. 97, 2000, pages 6640 - 6645
See also references of EP2239336A4
SIKORSKI RS; BOEKE JD, METHODS ENZYMOL., vol. 194, 1991, pages 302 - 318

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8129170B1 (en) 2010-12-06 2012-03-06 E.I. Du Pont De Nemours And Company Recombinant bacteria having the ability to metabolize sucrose
US8222000B2 (en) 2010-12-06 2012-07-17 E I Du Pont De Nemours And Company Recombinant bacteria having the ability to metabolize sucrose
WO2012099396A3 (en) * 2011-01-18 2012-12-06 Cj Cheiljedang Corporation A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
KR101261147B1 (ko) 2011-01-18 2013-05-06 씨제이제일제당 (주) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
CN103443267A (zh) * 2011-01-18 2013-12-11 Cj第一制糖株式会社 L-氨基酸生产力增强的微生物及利用其产生l-氨基酸的方法
US8835154B2 (en) 2011-01-18 2014-09-16 Cj Cheiljedang Corporation Microorganism having enhanced L-amino acids productivity and process for producing L-amino acids using the same
CN103443267B (zh) * 2011-01-18 2015-11-25 Cj第一制糖株式会社 L-氨基酸生产力增强的微生物及利用其产生l-氨基酸的方法
US9267161B2 (en) 2011-04-01 2016-02-23 Cj Cheiljedang Corporation Corynebacterium sp. transformed with a fructokinase gene derived from Escherichia sp. and process for preparing L-amino acid using the same
US8686114B2 (en) 2012-03-05 2014-04-01 E I Du Pont De Nemours And Company Variant sucrose transporter polypeptides

Also Published As

Publication number Publication date
US20110111466A1 (en) 2011-05-12
CN102165056B (zh) 2014-12-17
JP5597554B2 (ja) 2014-10-01
JP2011512867A (ja) 2011-04-28
PL2239336T3 (pl) 2017-09-29
US8574874B2 (en) 2013-11-05
KR20100092765A (ko) 2010-08-23
DK2239336T3 (en) 2017-08-14
KR101083136B1 (ko) 2011-11-11
EP2239336A4 (en) 2013-08-21
CN102165056A (zh) 2011-08-24
EP2239336A2 (en) 2010-10-13
WO2010093182A3 (ko) 2010-12-09
ES2635312T3 (es) 2017-10-03
EP2239336B1 (en) 2017-05-03
HUE032951T2 (en) 2017-11-28

Similar Documents

Publication Publication Date Title
WO2010093182A2 (ko) Ｌ-아미노산 생산용 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
EP2665809B1 (en) A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
CN105452445B (zh) 利用用于糖输入的易化扩散生产琥珀酸和其它化学品的方法
RU2276688C2 (ru) БАКТЕРИЯ, ПРИНАДЛЕЖАЩАЯ К РОДУ Escherichia,- ПРОДУЦЕНТ L-ГИСТИДИНА И СПОСОБ ПОЛУЧЕНИЯ L-ГИСТИДИНА
WO2010101359A2 (ko) Ｌ-아미노산 생산 미생물 및 이를 이용한 ｌ-아미노산 생산 방법
WO2013103268A2 (ko) Ｌ-아미노산을 생산할 수 있는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2010101360A2 (ko) Ｌ-아미노산 생산 미생물 및 이를 이용한 ｌ-아미노산 생산 방법
WO2012030130A2 (ko) 수크로오즈와 글리세롤을 동시에 이용하는 신규 숙신산 생성 변이 미생물 및 이를 이용한 숙신산 제조방법
WO2016171392A1 (ko) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법
WO2017034165A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2015178586A1 (ko) 세포내 에너지 수준이 향상된 미생물 및 이를 이용하여 l-아미노산을 생산하는 방법
KR101145943B1 (ko) Ｌ-아미노산 생산능을 갖는 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
WO2015122569A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014182119A1 (en) Novel rhtb protein variants and the method of producing o-phosphoserine using the same
WO2017069567A1 (ko) Ｌ-쓰레오닌을 생산하는 재조합 미생물 및 이를 이용하여 ｌ-쓰레오닌을 생산하는 방법
EP3119875A1 (en) Microorganisms producing l-amino acids and process for producing l-amino acids using the same
WO2015199406A1 (ko) L-트립토판 생산능을 갖는 에스케리키아속 미생물 및 이를 이용한 l-트립토판의 제조 방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2017065529A1 (ko) O-아세틸호모세린 설피드릴라제 변이체 및 이를 이용한 l-메치오닌 제조 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231056A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2016036209A1 (ko) L-쓰레오닌 생산능이 향상된 미생물 및 이를 이용한 l-쓰레오닌 생산방법

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080000811.1

Country of ref document: CN

REEP Request for entry into the european phase

Ref document number: 2010715651

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010715651

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010550616

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 12743675

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE