WO2022231056A1 - L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 - Google Patents

L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 Download PDF

Info

Publication number
WO2022231056A1
WO2022231056A1 PCT/KR2021/006681 KR2021006681W WO2022231056A1 WO 2022231056 A1 WO2022231056 A1 WO 2022231056A1 KR 2021006681 W KR2021006681 W KR 2021006681W WO 2022231056 A1 WO2022231056 A1 WO 2022231056A1
Authority
WO
WIPO (PCT)
Prior art keywords
lysine
corynebacterium
corynebacterium glutamicum
mutant
strain
Prior art date
Application number
PCT/KR2021/006681
Other languages
English (en)
French (fr)
Inventor
홍인표
이선희
김하은
박석현
박준현
Original Assignee
대상 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210067391A external-priority patent/KR102682180B1/ko
Application filed by 대상 주식회사 filed Critical 대상 주식회사
Priority to EP21939438.4A priority Critical patent/EP4332230A1/en
Priority to BR112023022512A priority patent/BR112023022512A2/pt
Priority to JP2023566852A priority patent/JP2024515390A/ja
Priority to MX2023012873A priority patent/MX2023012873A/es
Priority to AU2021443607A priority patent/AU2021443607A1/en
Priority to CA3217305A priority patent/CA3217305A1/en
Publication of WO2022231056A1 publication Critical patent/WO2022231056A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01001—Transketolase (2.2.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/265—Micrococcus
    • C12R2001/28—Micrococcus glutamicus ; Corynebacterium glutamicum

Definitions

  • the present invention relates to a Corynebacterium glutamicum mutant having improved L-lysine-producing ability and a method for producing L-lysine using the same.
  • L-lysine is an essential amino acid that is not synthesized in humans or animals and must be supplied from the outside, and is generally produced by fermentation using microorganisms such as bacteria or yeast.
  • L- lysine production may use a wild-type strain obtained in the natural state or a mutant strain modified to improve its L- lysine production ability.
  • genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are often used for the production of L-amino acids and other useful substances, and has excellent L-lysine production ability.
  • Various recombinant strains or mutants and L-lysine production methods using the same are being developed.
  • Korean Patent Application Laid-Open No. 10-2020-0026881 discloses a method of changing an existing promoter of a gene to a promoter having strong activity in order to increase the expression of a gene encoding an enzyme involved in L-lysine production.
  • An object of the present invention is to provide a mutant Corynebacterium glutamicum having improved L-lysine production ability.
  • Another object of the present invention is to provide a method for producing L-lysine using the mutant.
  • the present inventors studied to develop a new mutant with improved L-lysine production ability using a Corynebacterium glutamicum strain. As a result, within the promoter of the tkt gene encoding the transketolase involved in the L-lysine biosynthesis pathway. The present invention was completed by confirming that the production of L-lysine was increased when the nucleotide sequence at a specific position was substituted.
  • One aspect of the present invention provides a Corynebacterium glutamicum mutant with enhanced L-lysine production ability by enhancing the activity of transketolase.
  • Transketolase as used in the present invention is an enzyme that catalyzes the reaction of making sedoheptulose phosphate by transferring a ketol group (HOCH 2 CO - ) from xylulose phosphate to ribose phosphate in the pentose phosphate pathway. it means. Genes encoding these transketolase are transaldolase, glucose-6-phosphate dehydrogenase, and 6-phosphogluconolactonase. constituting a gene and operon encoding
  • the transketolase may be derived from a Corynebacterium sp. strain.
  • the Corynebacterium sp. strain is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium Corynebacterium callunae , Corynebacterium suranareeae , Corynebacterium lubricantis , Corynebacterium doosanense, Corynebacterium doosanense , Corynebacterium ipish Ens ( Corynebacterium efficiens ), Corynebacterium utereki ( Corynebacterium uterequi ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium stationis ( Coryne
  • enhanced activity means that the expression of a gene encoding a protein, such as a desired enzyme, transcription factor, or transport protein, is newly introduced or increased, so that the expression level is increased compared to the wild-type strain or strain before modification.
  • the enhancement of this activity is when the activity of the protein itself is increased compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof, and the expression or translation increase of the gene encoding it For example, when the overall degree of enzymatic activity in the cell is higher than that of the wild-type strain or the strain before modification, a combination thereof is also included.
  • the enhancement of the activity of the transketolase may be to induce a site-specific mutation in the promoter of the gene encoding the transketolase.
  • the promoter of the gene encoding the transketolase may be represented by the nucleotide sequence of SEQ ID NO: 1.
  • promoter refers to a specific region of DNA that regulates transcription of a gene, including a binding site for RNA polymerase that initiates mRNA transcription of a desired gene, and generally refers to a transcription initiation point. It is located upstream based on .
  • a promoter is defined as a region around the transcriptional initiation point to which RNA polymerase binds, and is generally composed of two short nucleotide sequences -10 and -35 base pairs away from the transcription initiation point. .
  • the promoter mutation in the present invention is improved to have higher activity than the wild-type promoter, and by inducing mutation in the promoter region located above the transcription start point, it is possible to increase the expression of the gene located downstream.
  • the enhancement of the activity of the transketolase is that one or more bases in the region of -300 to -10 are substituted forward from the transcription start point in the promoter sequence of the gene encoding the transketolase.
  • the promoter mutation in the present invention is one or more bases of -300 to -10 region, preferably -250 to -50 region, -230 to -200 region, -190 to -160 region, or -90 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases in the region to -60 may be continuously or non-contiguously substituted.
  • the nucleotide sequence of the -83 to -74 region is substituted from ccaattaacc to tgtgctgtca, and the A Corynebacterium glutamicum mutant having a new promoter sequence was obtained.
  • Such a Corynebacterium glutamicum mutant may include a mutated promoter of the tkt gene represented by the nucleotide sequence of SEQ ID NO: 2.
  • the nucleotide sequence in the region of -83 to -74 in the promoter sequence of the tkt gene encoding the transketolase of the Corynebacterium glutamicum strain is substituted from ccaattaacc to tgtggtatca.
  • a Corynebacterium glutamicum mutant having a new promoter sequence was obtained.
  • Such a Corynebacterium glutamicum mutant may include a mutated promoter of the tkt gene represented by the nucleotide sequence of SEQ ID NO: 3.
  • improved productivity means that the productivity of L-lysine is increased compared to the parent strain.
  • the parent strain means a wild-type or mutant strain to be mutated, and includes a target to be directly mutated or transformed with a recombinant vector.
  • the parent strain may be a wild-type Corynebacterium glutamicum strain or a strain mutated from the wild-type.
  • the parent strain is a mutant strain induced in the sequence of a gene (eg, lysC, zwf and hom genes) involved in lysine production, and the Korean Culture Center of Microorganisms. It may be a Corynebacterium glutamicum strain deposited with accession number KCCM12969P on April 2, 2021 (hereinafter referred to as 'Corynebacterium glutamicum DS1 strain').
  • Such a Corynebacterium glutamicum mutant with improved L-lysine-producing ability of the present invention may include a mutated promoter sequence of a transketolase-encoding gene.
  • the mutant may include any one of the nucleotide sequences shown in SEQ ID NOs: 2 to 4 as the promoter sequence of the transketolase gene.
  • the mutant strain shows an increased L-lysine production capacity compared to the parent strain by including a mutation in the promoter of the tkt gene encoding the transketolase, in particular, L-lysine production compared to the parent strain
  • L-lysine production compared to the parent strain
  • This 5% or more, specifically 5 to 40%, more specifically 10 to 30% can be increased to produce 65 to 90 g of L-lysine per 1 liter of the strain culture, preferably 70 to 80 g of L - Can produce lysine.
  • the mutant can produce L-lysine in a high yield by increasing the L-lysine production by about 4% or more compared to the promoter mutant strain of the conventional tkt gene having a different mutation position.
  • Corynebacterium glutamicum mutant according to an embodiment of the present invention may be implemented through a recombinant vector including a mutant in which the promoter sequence of the transketolase-encoding gene is partially substituted in the parent strain.
  • “some” means not all of the base sequence or polynucleotide sequence, and may be 1 to 300, preferably 1 to 100, more preferably 1 to 50, but is limited thereto. it is not
  • variant refers to a promoter variant in which one or more bases in the region of -300 to -10 in the promoter sequence of the transketolase gene involved in the biosynthesis of L-lysine are substituted.
  • the mutant in which the nucleotide sequence of the -83 to -74 region in the promoter sequence of the transketolase gene is substituted with tgtgctgtca is the nucleotide sequence of SEQ ID NO: 2, and the variant substituted with tgtggtatca is SEQ ID NO: It may have a base sequence of 3.
  • the term “vector” refers to an expression vector capable of expressing a target protein in a suitable host cell, and refers to a gene preparation comprising essential regulatory elements operably linked to express a gene insert.
  • operably linked means that a gene requiring expression and its regulatory sequence are functionally linked to each other and linked in a way that enables gene expression
  • regulatory element refers to a promoter for performing transcription, regulating transcription including any operator sequences for sequencing, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation.
  • Such vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.
  • the "recombinant vector” used in the present invention can be replicated independently of the genome of the host cell after transformation into a suitable host cell, or can be sutured into the genome itself.
  • the "suitable host cell” may include a replication origin, which is a specific nucleotide sequence from which replication is initiated as a vector capable of replication.
  • an appropriate vector introduction technique is selected according to the host cell, and the desired gene can be expressed in the host cell.
  • vector introduction can be performed by electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- Dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof can be carried out.
  • the transformed gene can be expressed in the host cell, it may be included without limitation whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the host cells include cells transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro.
  • a host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell or a recombinant microorganism.
  • the recombinant vector according to the present invention may include a selection marker
  • the selection marker is for selecting transformants (host cells) transformed with the vector, in the medium treated with the selection marker. Since only cells expressing the selection marker can survive, selection of transformed cells is possible.
  • Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, chloramphenicol, and the like.
  • Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium due to homologous recombination crossover.
  • the host cell may be a Corynebacterium sp. strain, for example, Corynebacterium glutamicum ( Corynebacterium glutamicum ) It may be a strain.
  • another aspect of the present invention comprises: a) culturing the Corynebacterium glutamicum mutant in a medium; And b) provides a method for producing L- lysine comprising the step of recovering L-lysine from the culture medium of the mutant or mutant strain.
  • the culture may be performed according to an appropriate medium and culture conditions known in the art, and those skilled in the art may easily adjust the medium and culture conditions for use.
  • the medium may be a liquid medium, but is not limited thereto.
  • the culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.
  • the medium should meet the requirements of a specific strain in an appropriate manner, and may be appropriately modified by a person skilled in the art.
  • the culture medium for the Corynebacterium sp. strain may refer to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.
  • the medium may include various carbon sources, nitrogen sources and trace element components.
  • Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • the nitrogen source may also be used individually or as a mixture, but is not limited thereto.
  • Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto.
  • essential growth substances such as amino acids and vitamins may be included.
  • precursors suitable for the culture medium may be used. The medium or individual components may be added batchwise or continuously by an appropriate method to the culture medium during the culturing process, but is not limited thereto.
  • the pH of the culture medium by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microorganism culture medium in an appropriate manner during culture.
  • an antifoaming agent such as fatty acid polyglycol ester during culture can suppress the formation of bubbles.
  • oxygen or oxygen-containing gas eg, air
  • the temperature of the culture medium may be usually 20 °C to 45 °C, for example, 25 °C to 40 °C.
  • the incubation period may be continued until a useful substance is obtained in a desired production amount, for example, it may be 10 to 160 hours.
  • the step of recovering L-lysine from the cultured medium and the cultured mutant strain is L-lysine produced from the medium using a suitable method known in the art according to the culture method.
  • a suitable method known in the art according to the culture method.
  • the biomass in the step of recovering lysine, is removed by centrifuging the culture medium at low speed, and the obtained supernatant can be separated through ion exchange chromatography.
  • the step of recovering L-lysine may include a step of purifying L-lysine.
  • the Corynebacterium glutamicum mutant according to the present invention can improve the production yield of L-lysine compared to the parent strain by increasing or enhancing the expression of the transketolase-encoding gene.
  • FIG. 1 shows the structure of a pCGI (Ptkt83-1) vector including a mutation in which the base sequence of the -83 to -74 region of the transketolase promoter is substituted with tgtgctgtca according to an embodiment of the present invention.
  • FIG. 2 shows the structure of a pCGI (Ptkt83-7) vector including a mutation in which the base sequence of the -83 to -74 region of the transketolase promoter is substituted with tgtggtatca.
  • the culture solution was centrifuged at 12,000 rpm for 10 minutes to remove the supernatant, washed once with saline, and washed three more times with phosphate buffer. After suspending this in 5 ml of phosphate buffer, it was spread on a solid culture medium (CM liquid medium further containing 15 g/L of agar and 8% lysine) and cultured at 30° C. for 30 hours to form 100 colonies. separated.
  • CM liquid medium further containing 15 g/L of agar and 8% lysine
  • soluble cells were prepared. After inoculating 10 ml of the cultured Corynebacterium glutamicum ATCC13032 in 100 ml of BHIS medium and culturing at 30° C. overnight, inoculate 100 ml of CM liquid medium with an OD 600 of 0.3 to 120 at 18° C. It was cultured for about 28 hours until OD 600 reached 0.8 at rpm. The culture solution was centrifuged at 6000 rpm at 4° C. for 10 minutes to recover cells, suspended in 20 ml of a 10% glycerol solution, and then centrifuged three times.
  • the recovered cells were again suspended in 10% glycerol solution, and 100 ⁇ l of each was dispensed into an E-tube and stored in a -70°C deep freezer until used.
  • 1 ⁇ g of DNA was added to 100 ⁇ l of Corynebacterium glutamicum ATCC13032 soluble cells and added to a cooled electroporation cuvette, and electroporation was performed using a MicroPulser manufactured by Bio-Rad. .
  • 1 ml of CM broth pre-warmed at 46°C was added to recover cells, incubated on ice for 2 minutes, and then incubated at 180 rpm in an incubator at 30°C.
  • 100 ⁇ l was spread on a BHIS agar plate to which kanamycin (50 ⁇ g/ml) was added, and then cultured at 30° C. in an incubator.
  • CAT analysis of tkt promoter region variants was measured by the Shaw method (Shaw et al., 1991. Biochemistry. 30(44):10806). Briefly, the transformed Corynebacterium glutamicum strain was cultured in a CM broth containing kanamycin (50 ⁇ g/ml), and then the cells were recovered to obtain a protein lysate.
  • Ptkt83-1 and Ptkt83-7 the nucleotide sequences in the region -83 to -74 in the promoter sequence of the tkt gene encoding transketolase were substituted with tgtgctgtca and tgtggtatca, respectively. Thereafter, an experiment was performed to verify the increase in L-lysine productivity by mutation of the promoter of the tkt gene using the Corynebacterium glutamicum DS1 strain.
  • Corynebacterium glutamicum mutant with enhanced transketolase activity, Corynebacterium glutamicum DS1 strain and E. coli DH5a (HIT Competent cellsTM, Cat No. RH618) were used. .
  • the Corynebacterium glutamicum DS1 strain is a CM of 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone and 5.0 g of beef extract in 1 L of distilled water. Incubated in -broth medium (pH 6.8) at a temperature of 30 °C.
  • E. coli DH5a was cultured at a temperature of 37° C. on LB medium having a composition of 10.0 g of tryptone, 10.0 g of NaCl and 5.0 g of yeast extract in 1 L of distilled water.
  • transketolase involved in pentose metabolism in the strain to increase lysine productivity
  • enhancement of transketolase was introduced.
  • the method used in this Example induced specific mutations in the promoter of the tkt gene in order to increase the expression of the tkt gene encoding the transketolase.
  • a primer containing the mutant sequence was prepared, and tkt on the genome of the Corynebacterium glutamicum DS1 mutant strain selected in Example 1
  • the left arm 696 bp part and the right arm 697 bp part were amplified by PCR centering on the mutated part of the gene promoter, and ligated by overlap PCR (overlap PCR), and then the recombinant vector pCGI (Reference [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130]).
  • This plasmid was named pCGI (Ptkt83-1) (see FIG. 1).
  • the primers in Table 2 below were used to amplify each gene fragment.
  • PCR was performed under the following conditions using the corresponding primers from the genomic DNA of the Corynebacterium glutamicum DS1 strain.
  • a Thermocycler TP600, TAKARA BIO Inc., Japan
  • each deoxynucleotide triphosphate dATP, dCTP, dGTP, dTTP
  • 100 ⁇ M was added to a reaction solution containing oligonucleotides 1 pM
  • Corynebacterium glutamicum Using 10 ng of chromosomal DNA of the DS1 strain as a template, 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent, Korea).
  • PCR conditions were (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 1-2 at 72°C. It was carried out under the conditions of minutes (providing a polymerization time of 2 minutes per 1 kb).
  • the thus-prepared gene fragment was cloned into a pCGI vector using BamHI, EcoRI restriction enzymes and DNA Ligation kit Ver2.1 (Takara, Japan).
  • the vector was transformed into E. coli DH5a, spread on an LB-agar plate containing 50 ⁇ g/ml kanamycin, and cultured at 37° C. for 24 hours. After isolating the finally formed colony and confirming that the insert is exactly present in the vector, this vector was isolated and used for recombination of the Corynebacterium glutamicum strain.
  • a Corynebacterium glutamicum mutant was prepared in the same manner as in Example 3, except that the nucleotide sequence of the promoter -83 ⁇ -74 region of the tkt gene was substituted with tgtggtatca in ccaattaacc.
  • the primers shown in Table 3 were used to amplify each gene fragment to construct a plasmid, and a mutant strain DS1-Ptkt83-7 was prepared using the prepared plasmid pCGI (Ptkt83-7) vector. Finally, a Corynebacterium glutamicum mutant strain (DS1-Ptkt83-7) into which the mutated tkt gene was introduced was obtained.
  • Corynebacterium glutamicum mutants DS1-Ptkt83-1 and DS1-Ptkt83-7 strains were located at specific positions (-83 to -74 region) was substituted with the optimal nucleotide sequence, so that the productivity of L-lysine was increased by about 14% and 17%, respectively, compared to the parent strain Corynebacterium glutamicum DS1 strain.
  • Corynebacterium glutamicum mutant DS1-Ptkt83-1 and DS1-Ptkt83-7 strains have different mutation positions (-217 to -206 regions) and sequences (CCCTGACTACAAA) compared to the conventional mutant Ptkt217, the productivity of L-lysine It was confirmed that this increased by about 4% and 7%, respectively.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법에 관한 것으로, 상기 변이주는 트랜스케톨라아제를 암호화하는 유전자의 발현을 증가 또는 강화시킴으로써 모균주에 비해 L-라이신의 생산 수율을 향상시킬 수 있다.

Description

L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법
본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법에 관한 것이다.
L-라이신은 사람이나 동물 체내에서 합성되지 않는 필수아미노산으로서 외부에서 공급되어야 하며, 일반적으로 세균이나 효모와 같은 미생물을 이용한 발효에 의해 생산된다. L-라이신 생산은 자연상태에서 수득된 야생형 균주나 이의 L-라이신 생산능이 향상되도록 변형된 변이주를 이용할 수 있다. 최근에는 L-라이신의 생산 효율을 개선시키기 위해 L-아미노산 및 기타 유용물질 생산에 많이 이용되는 대장균, 코리네박테리움 등의 미생물을 대상으로 유전자 재조합 기술을 적용하여 우수한 L-라이신 생산능을 갖는 다양한 재조합 균주 또는 변이주 및 이를 이용한 L-라이신 생산 방법이 개발되고 있다.
한국등록특허 제10-0838038호 및 제10-2139806호에 따르면, L-라이신 생산과 관련된 효소를 포함한 단백질을 암호화하는 유전자의 염기서열 또는 아미노산 서열을 변경하여 그 유전자의 발현을 증가시키거나 불필요한 유전자를 제거함으로써 L-라이신 생산능을 향상시킬 수 있다. 또한, 한국공개특허 제10-2020-0026881호에는 L-라이신 생산에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키기 위하여 유전자의 기존 프로모터를 강한 활성을 가지는 프로모터로 변경하는 방법을 개시하고 있다.
이와 같이 L-라이신 생산능을 증가시키는 다양한 방법이 개발되고 있으나, L-라이신 생산에 직간접적으로 연관된 효소, 전사인자, 수송 단백질 등 단백질의 종류가 수십여 종에 이르기 때문에 이러한 단백질의 활성 변화에 따른 L-라이신 생산능 증가 여부에 관해 여전히 많은 연구가 필요한 실정이다.
[선행기술문헌]
[특허문헌]
한국등록특허 제10-0838038호
한국등록특허 제10-2139806호
한국공개특허 제10-2020-0026881호
본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 변이주를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 변이주를 이용한 L-라이신의 생산 방법을 제공하는 것을 목적으로 한다.
본 발명자들은 코리네박테리움 글루타미쿰 균주를 이용하여 L-라이신 생산능이 향상된 새로운 변이주를 개발하기 위해 연구한 결과, L-라이신 생합성 경로에 관여하는 트랜스케톨라아제를 암호화하는 tkt 유전자의 프로모터 내 특정 위치의 염기서열을 치환한 경우 L-라이신 생산량이 증가하는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 일 양상은 트랜스케톨라아제의 활성이 강화되어 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주를 제공한다.
본 발명에서 사용된 “트랜스케톨라아제(transketolase)”는 오탄당인산경로에서 자일룰로스 인산으로부터 리보스인산으로 케톨기(HOCH2CO-)를 전달하여 세도헵툴로스 인산을 만드는 반응을 촉매하는 효소를 의미한다. 이러한 트랜스케톨라아제를 암호화하는 유전자는 트랜스알도라아제(transaldolase), 글루코오스-6-포스페이트 디하이드로제나아제(glucose-6-phosphate dehydrogenase) 및 6-포스포글루코노락토나아제(6-phosphogluconolactonase)를 암호화하는 유전자와 오페론(operon)을 구성하고 있으며, 이러한 오페론은 하나의 프로모터에 의해 유전자 발현이 조절된다.
본 발명의 일 구체예에 따르면, 상기 트랜스케톨라아제는 코리네박테리움(Corynebacterium) 속 균주에서 유래된 것일 수 있다. 구체적으로, 상기 코리네박테리움 속 균주는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데저티(Corynebacterium deserti), 코리네박테리움 칼루나에(Corynebacterium callunae), 코리네박테리움 수라나래에(Corynebacterium suranareeae), 코리네박테리움 루브리칸티스(Corynebacterium lubricantis), 코리네박테리움 두사넨세(Corynebacterium doosanense), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 우테레키(Corynebacterium uterequi), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 파캔세(Corynebacterium pacaense), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 휴미레듀센스(Corynebacterium humireducens), 코리네박테리움 마리눔(Corynebacterium marinum), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스페니스코룸(Corynebacterium spheniscorum), 코리네박테리움 프레이부르겐세(Corynebacterium freiburgense), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 카니스(Corynebacterium canis), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 레날레(Corynebacterium renale), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 카스피움(Corynebacterium caspium), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris), 코리네박테리움 슈도펠라지(Corynebacaterium pseudopelargi) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있으며, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “활성이 강화”는 목적하는 효소, 전사 인자, 수송 단백질 등의 단백질을 암호화하는 유전자의 발현이 새로 도입되거나 증대되어 야생형 균주 또는 변형 전의 균주에 비하여 발현량이 증가되는 것을 의미한다. 이러한 활성의 강화는 유전자를 암호화하는 뉴클레오티드 치환, 삽입, 결실 또는 이들의 조합을 통하여 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 증가한 경우와, 이를 암호화하는 유전자의 발현 증가 또는 번역 증가 등으로 세포 내에서 전체적인 효소 활성 정도가 야생형 균주 또는 변형 전의 균주에 비하여 높은 경우, 이들의 조합 역시 포함한다.
본 발명의 일 구체예에 따르면, 상기 트랜스케톨라아제의 활성 강화는 트랜스케톨라아제를 암호화하는 유전자의 프로모터에 위치 특이적 변이를 유발하는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 트랜스케톨라아제를 암호화하는 유전자의 프로모터는 서열번호 1의 염기서열로 표시되는 것일 수 있다.
본 발명에서 사용된 “프로모터”는 목적하는 유전자의 mRNA 전사를 개시하는 RNA 중합효소(polymerase)에 대한 결합부위를 포함하여 유전자의 전사를 조절하는 DNA의 특정 부위를 의미하며, 일반적으로 전사 개시점을 기준으로 상위(upstream)에 위치한다. 원핵생물에서의 프로모터는 RNA 중합효소가 결합하는 전사 개시점 주변의 부위로 정의되며, 일반적으로 전사 개시점으로부터 앞쪽으로 -10 영역과 -35 영역의 염기쌍이 떨어져 있는 두 개의 짧은 염기서열로 구성된다. 본 발명에서의 프로모터 변이는 야생형 프로모터에 비해 높은 활성을 가지도록 개량하는 것으로, 전사 개시점의 상위에 위치한 프로모터 영역 안에서 변이를 유발함으로써 하위(downstream)에 위치한 유전자의 발현을 증가시킬 수 있다.
본 발명의 일 구체예에 따르면, 상기 트랜스케톨라아제의 활성 강화는 트랜스케톨라아제를 암호화하는 유전자의 프로모터 서열 내 전사 개시점으로부터 앞쪽으로 -300 내지 -10 영역 중 하나 이상의 염기가 치환된 것일 수 있다.
보다 구체적으로, 본 발명에서의 프로모터 변이는 -300 내지 -10 영역 중 1개 이상의 염기, 바람직하게는 -250 내지 -50 영역, -230 내지 -200 영역, -190 내지 -160 영역, 또는 -90 내지 -60 영역에서 1개, 2개, 3개, 4개, 5개, 6개, 7개, 8개, 9개, 또는 10개의 염기가 연속적으로 또는 비연속적으로 치환된 것일 수 있다.
본 발명의 일 실시예에 따르면, 코리네박테리움 글루타미쿰 균주의 트랜스케톨라아제를 암호화하는 tkt 유전자의 프로모터 서열에서 -83 내지 -74 영역의 염기서열을 ccaattaacc에서 tgtgctgtca로 치환하여 tkt 유전자의 새로운 프로모터 서열을 가지는 코리네박테리움 글루타미쿰 변이주를 획득하였다. 이러한 코리네박테리움 글루타미쿰 변이주는 서열번호 2의 염기서열로 표시되는 tkt 유전자의 변이된 프로모터를 포함하는 것일 수 있다.
본 발명의 일 실시예에 따르면, 코리네박테리움 글루타미쿰 균주의 트랜스케톨라아제를 암호화하는 tkt 유전자의 프로모터 서열에서 -83 내지 -74 영역의 염기서열을 ccaattaacc에서 tgtggtatca로 치환하여 tkt 유전자의 새로운 프로모터 서열을 가지는 코리네박테리움 글루타미쿰 변이주를 획득하였다. 이러한 코리네박테리움 글루타미쿰 변이주는 서열번호 3의 염기서열로 표시되는 tkt 유전자의 변이된 프로모터를 포함하는 것일 수 있다.
본 발명에서 사용된 “생산능이 향상된”은 모균주에 비해 L-라이신의 생산성이 증가된 것을 의미한다. 상기 모균주는 변이의 대상이 되는 야생형 또는 변이주를 의미하며, 직접 변이의 대상이 되거나 재조합된 벡터 등으로 형질전환되는 대상을 포함한다. 본 발명에 있어서, 모균주는 야생형 코리네박테리움 글루타미쿰 균주 또는 야생형으로부터 변이된 균주일 수 있다.
본 발명의 일 구체예에 따르면, 상기 모균주는 라이신 생산에 관여하는 유전자 (예컨대, lysC, zwf 및 hom 유전자)의 서열에 변이가 유발된 변이주로서 한국미생물보존센터(Korean Culture Center of Microorganisms)에 2021년 4월 2일자 수탁번호 KCCM12969P로 기탁된 코리네박테리움 글루타미쿰 균주 (이하 '코리네박테리움 글루타미쿰 DS1 균주'라 함)인 것일 수 있다.
이와 같은 본 발명의 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주는 트랜스케톨라아제를 암호화하는 유전자의 변이된 프로모터 서열을 포함하는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 변이주는 서열번호 2 내지 4로 표시되는 염기서열 중 어느 하나를 트랜스케톨라아제 유전자의 프로모터 서열로 포함하는 것일 수 있다.
본 발명의 일 실시예에 따르면, 상기 변이주는 트랜스케톨라아제를 암호화하는 tkt 유전자의 프로모터 변이를 포함함으로써 모균주에 비해 증가된 L-라이신 생산능을 나타내며, 특히 모균주에 비해 L-라이신 생산량이 5% 이상, 구체적으로는 5 내지 40%, 더욱 구체적으로는 10 내지 30% 증가되어 균주 배양액 1 ℓ 당 65 ~ 90 g의 L-라이신을 생산할 수 있으며, 바람직하게는 70 ~ 80 g의 L-라이신을 생산할 수 있다. 또한, 상기 변이주는 변이 위치가 상이한 종래 tkt 유전자의 프로모터 변이주에 비해 L-라이신 생산량이 약 4% 이상 증가되어, 고수율로 L-라이신을 생산할 수 있다.
본 발명의 일 구체예에 따른 코리네박테리움 글루타미쿰 변이주는 모균주에 트랜스케톨라아제를 암호화하는 유전자의 프로모터 서열이 일부 치환된 변이체를 포함하는 재조합 벡터를 통해 구현될 수 있다.
본 발명에서 사용된 “일부”는 염기서열 또는 폴리뉴클레오티드 서열의 전부가 아닌 것을 의미하며, 1 내지 300개, 바람직하게는 1 내지 100개, 보다 바람직하게는 1 내지 50개일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “변이체”는 L-라이신의 생합성에 관여하는 트랜스케톨라아제 유전자의 프로모터 서열 내 -300 내지 -10 영역 중 하나 이상의 염기가 치환된 프로모터 변이체를 의미한다.
본 발명의 일 구체예에 따르면, 트랜스케톨라아제 유전자의 프로모터 서열 내 -83 내지 -74 영역의 염기서열이 tgtgctgtca로 치환된 변이체는 서열번호 2의 염기서열을, tgtggtatca로 치환된 변이체는 서열번호 3의 염기서열을 가지는 것일 수 있다.
본 발명에서 사용된 “벡터”는 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 발현 벡터로서 유전자 삽입물이 발현되도록 작동 가능하게 연결된(operably linked) 필수적인 조절요소를 포함하는 유전자 제조물을 의미한다. 여기서, “작동 가능하게 연결된”은 발현이 필요한 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결된 것을 의미하고, “조절요소”는 전사를 수행하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 암호화하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 이러한 벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터, 바이러스 벡터 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “재조합 벡터”는 적합한 숙주세포 내로 형질전환된 후, 숙주세포의 게놈과 무관하게 복제 가능하거나 게놈 그 자체에 봉합될 수 있다. 이때, 상기 "적합한 숙주세포"는 벡터가 복제 가능한 것으로서 복제가 개시되는 특정 염기서열인 복제 원점을 포함할 수 있다.
상기 형질전환은 숙주세포에 따라 적합한 벡터 도입 기술이 선택되어 목적하는 유전자를 숙주세포 내에서 발현시킬 수 있다. 예를 들면, 벡터 도입은 전기천공법(electroporation), 열 충격(heat-shock), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 초산 리튬-DMSO법, 또는 이들의 조합에 의해 수행될 수 있다. 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함될 수 있다.
상기 숙주세포는 생체내 또는 시험관내에서 본 발명의 재조합 벡터 또는 폴리뉴클레오티드로 형질감염, 형질전환, 또는 감염된 세포를 포함한다. 본 발명의 재조합 벡터를 포함하는 숙주 세포는 재조합 숙주 세포, 재조합 세포 또는 재조합 미생물이다.
또한, 본 발명에 의한 재조합 벡터는 선택 마커(selection marker)를 포함할 수 있는데, 상기 선택 마커는 벡터로 형질전환된 형질전환체 (숙주세포)를 선별하기 위한 것으로서 상기 선택 마커가 처리된 배지에서 선택 마커를 발현하는 세포만 생존할 수 있기 때문에, 형질전환 된 세포의 선별이 가능하다. 상기 선택 마커는 대표적인 예로 카나마이신, 스트렙토마이신, 클로람페니콜 등이 있으나, 이에 한정되는 것은 아니다.
본 발명의 형질전환용 재조합 벡터 내에 삽입된 유전자들은 상동성 재조합 교차로 인하여 코리네박테리움 속 미생물과 같은 숙주세포 내로 치환될 수 있다.
본 발명의 일 구체예에 따르면, 상기 숙주세포는 코리네박테리움 속 균주일 수 있으며, 예를 들면 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주일 수 있다.
또한, 본 발명의 다른 일 양상은 a) 상기 코리네박테리움 글루타미쿰 변이주를 배지에서 배양하는 단계; 및 b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-라이신을 회수하는 단계를 포함하는 L-라이신의 생산 방법을 제공한다.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 코리네박테리움 속 균주에 대한 배양 배지는 공지된 문헌 (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981)을 참조할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배지에 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다. 사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나 이에 한정되는 것은 아니다. 사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20℃ 내지 45℃, 예를 들면 25℃ 내지 40℃일 수 있다. 배양기간은 유용물질이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 10 내지 160 시간일 수 있다.
본 발명의 일 구체예에 따르면, 상기 배양된 변이주 및 변이주가 배양된 배지에서 L-라이신을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 L-라이신을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.
본 발명의 일 구체예에 따르면, 라이신을 회수하는 단계는 배양 배지를 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-라이신을 회수하는 단계는 L-라이신을 정제하는 공정을 포함할 수 있다.
본 발명에 따른 코리네박테리움 글루타미쿰 변이주는 트랜스케톨라아제를 암호화하는 유전자의 발현을 증가 또는 강화시킴으로써 모균주에 비해 L-라이신의 생산 수율을 향상시킬 수 있다.
도 1은 본 발명의 일 실시예에 따라 트랜스케톨라아제 프로모터의 -83 내지 -74 영역의 염기서열이 tgtgctgtca로 치환된 변이를 포함하는 pCGI(Ptkt83-1) 벡터의 구조를 나타낸 것이다.
도 2는 트랜스케톨라아제 프로모터의 -83 내지 -74 영역의 염기서열이 tgtggtatca로 치환된 변이를 포함하는 pCGI(Ptkt83-7) 벡터의 구조를 나타낸 것이다.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 코리네박테리움 글루타미쿰 변이주의 제조
트랜스케톨라아제의 활성이 강화된 코리네박테리움 글루타미쿰 변이주를 제조하기 위하여, 코리네박테리움 글루타미쿰 DS1 균주를 사용하여 무작위 돌연변이를 유발하였다.
1-1. 돌연변이 유발
코리네박테리움 글루타미쿰 DS1 균주를 CM 액체배지 (글루코오스 5 g, NaCl 2.5 g, 효모 추출물 5.0 g, 유레아(urea) 1.0 g, 폴리펩톤 10.0 g 및 비프(beef) 추출물 5.0 g 함유, pH 6.8) 50 ㎖가 담긴 플라스크에 접종하고 돌연변이 유발물질인 N-메틸-N`-니트로-N-니트로소구아니딘(N-methyl-N`-nitro-N-nitrosoguanidine, NTG)을 최종농도 300 ㎍/㎖로 첨가한 후 30℃에서 200 rpm으로 20시간 동안 진탕 배양하였다. 배양을 종료한 후 배양액을 12,000 rpm에서 10분 동안 원심분리하여 상층액을 제거하고, 식염수(saline)로 1회 세척하고 인산 완충액(phosphate buffer)으로 3회 더 세척하였다. 이를 인산 완충액 5 ㎖에 현탁한 후 종배양 고체배지 (CM 액체배지에 한천 15 g/ℓ 및 라이신 8%를 더 포함함)에 도말하고 30℃에서 30시간 동안 배양하여 콜로니(colony) 100개를 분리하였다.
1-2. L-라이신 생산능이 향상된 변이주 선별 및 변이 라이브러리 제작
분리된 콜로니 100개를 하기 표 1의 라이신 생산 액체배지 10 ㎖가 담긴 플라스크에 각각 5%씩 접종하고 30℃에서 200 rpm으로 30시간 동안 진탕 배양하였다. 각 배양액을 OD 610 nm에서 흡광도를 측정하여 균체 생육정도를 확인하고, HPLC (Shimazu, Japan)로 L-라이신의 생산량을 측정하였다, 이를 통해 L-라이신 생산량을 비교하여 L-라이신을 67.0 g/ℓ 이상 생산하는 콜로니들을 선별하였고, 이들의 라이신 관련 주요 유전자 및 프로모터 영역 염기서열 분석을 수행하여 tkt 유전자 프로모터의 변이를 가지는 균주를 확인하였다.
조성 함량 (1 L 기준)
Glucose 100 g
Ammonium sulfate 55 g
KH2PO4 1.1 g
MgSO4ㆍH2O 1.2 g
MnSO4ㆍH2O 180 mg
FeSO4ㆍH2O 180 mg
ThiamineㆍHCl 9 mg
Biotin 1.8 mg
CaCO3 5%
pH 7.0
실시예 2. tkt 프로모터의 개량
2-1. 프로모터 개량: 변이 도입
실시예 1에서 선별된 tkt 프로모터 상의 위치를 포함하는 최대 15개의 염기서열의 변형을 가진 30개의 후보 서열을 [Sambrook, J. et al. (2001) "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press. volume 2. 13.36~13.39]의 방법으로 합성하고, 코리네박테리움 글루타미쿰 ATCC13032의 tkt 프로모터 서열 (서열번호 1 참고)과 합성된 tkt 프로모터 영역을 각각 CAT(chloramphenicol acetyltransferase) 리포터 벡터 pSK1-CAT 벡터내로 클로닝 하였다. DNA 클로닝 시 오리엔테이션(orientation)과 변이 발생 유무는 DNA 시퀀싱을 통해 확인하였다. 이렇게 제작된 변이 라이브러리를 pSK1-tkt1 내지 pSK1-tkt30으로 명명하였다. 최종적으로 코리네박테리움 글루타미쿰 ATCC13032에 형질전환하여 프로모터 활성을 비교 검토하였다.
2-2. 코리네박테리움 글루타미쿰 ATCC13032로의 pSK1-CAT 구조체의 형질도입
시퀀스 분석을 통해 확인된 각각의 상기 제작된 pSK-tkt 클론들을 코리네박테리움 글루타미쿰 ATCC13032에 형질전환(transformation)하기 위하여 수용성 세포를 제작하였다. 100 ml의 BHIS 배지에 10 ml의 배양된 코리네박테리움 글루타미쿰 ATCC13032을 접종하여 30℃에서 밤새 배양한 후, 다시 100 ml의 CM 액체배지에 OD 600이 0.3이 되도록 접종하여 18℃에서 120 rpm으로 OD 600이 0.8이 될 때까지 약 28시간 배양하였다. 배양액을 4℃에서 6000 rpm으로 10분간 원심분리하여 세포를 회수하고 20 ml의 10% 글리세롤 용액으로 현탁한 후 원심분리하는 과정을 3회 반복하였다. 회수된 세포는 다시 10% 글리세롤 용액으로 현탁하고 100 ㎕씩 E-튜브에 분주하여 -70℃ deep freezer에 사용하기 전까지 보관하였다. 코리네박테리움 글루타미쿰 ATCC13032 수용성 세포 100 ㎕에 DNA 1 ㎍을 첨가하고 냉각된 일렉트로포레이션 큐베트(electroporation cuvette)에 첨가하여 Bio-Rad 사의 마이크로펄서(MicroPulser)를 이용하여 전기천공을 수행하였다. 펄스(Pulse)한 직후 46℃에서 예열(pre-warming)한 CM 액체배지 1 ml을 첨가하여 세포를 회수하고 얼음(ice)에서 2분간 반응시킨 다음 30℃ 하 인큐베이터에서 180 rpm으로 배양하였다. 그리고 카나마이신 (50 ㎍/ml)이 첨가된 BHIS 아가 플레이트(agar plate)에 100 ㎕ 도말한 후 30℃ 배양기에서 배양하였다.
2-3. CAT 분석
tkt 프로모터 영역 변이체의 CAT 분석(chloramphenicol acetyltransferase assay)은 Shaw 방법으로 (Shaw et al., 1991. Biochemistry. 30(44):10806) 측정하였다. 간략히 요약하면 형질전환된 코리네박테리움 글루타미쿰 균주를 카나마이신(kanamycin) (50 ㎍/ml)이 첨가된 CM 액체배지에 배양한 후 세포를 회수하여 단백질 용리물(protein lysate)을 확보하였다. 각각의 protein 5 ㎍과 0.1M Tris-HCl buffer (pH 7.8), 0.4 mg/ml의 5,5'-dithiobis-2-nitrobenzoic acid (DTNB; Sigma D8130), 0.1 mM Acetyl CoA (Sigma A2056) 및 0.1 mM chloramphenicol을 첨가하여 RT에서 15분간 반응시킨 후, OD 412 nm에서 흡광도를 측정하였다. 이를 통해 CAT 활성이 야생형 tkt 프로모터 서열과 비교하여 향상된, Ptkt83-1 및 Ptkt83-7을 선별하였다.
Ptkt83-1 및 Ptkt83-7는 트랜스케톨라아제를 암호화하는 tkt 유전자의 프로모터 서열에서 -83 내지 -74 영역의 염기서열이 각각 tgtgctgtca, tgtggtatca로 치환되었다. 이후에서는 코리네박테리움 글루타미쿰 DS1 균주를 이용하여 tkt 유전자의 프로모터 변이에 의한 L-라이신 생산성 증가를 검증하기 위한 실험을 수행하였다.
실시예 3. 코리네박테리움 글루타미쿰 DS1의 프로모터 변이주 제조
트랜스케톨라아제의 활성이 강화된 코리네박테리움 글루타미쿰 변이주를 제조하기 위하여, 코리네박테리움 글루타미쿰 DS1 균주 및 E. coli DH5a (HIT Competent cells™, Cat No. RH618)를 사용하였다.
상기 코리네박테리움 글루타미쿰 DS1 균주는 증류수 1 L에 글루코오스 5 g, NaCl 2.5 g, 효모 추출물 5.0 g, 유레아(urea) 1.0 g, 폴리펩톤 10.0 g 및 비프(beef) 추출물 5.0 g 조성의 CM-broth 배지 (pH 6.8)에서 30℃의 온도로 배양하였다.
E. coli DH5a는 증류수 1 L에 트립톤 10.0 g, NaCl 10.0 g 및 효모 추출물 5.0 g 조성의 LB 배지 상에서 37℃의 온도로 배양하였다.
카나마이신(kanamycin) 및 스트렙토마이신(streptomycine)은 시그마(Sigma)사의 제품을 사용하였고, DNA 시퀀싱 분석은 마크로젠(주)에 의뢰하여 분석하였다.
3-1. 재조합 벡터의 제작
균주에 오탄당 대사에 관여하는 트랜스케톨라아제의 활성을 강화하여 라이신 생산성을 증가시키기 위해 트랜스케톨라아제의 강화를 도입하였다. 본 실시예에서 이용한 방법은 트랜스케톨라아제를 암호화하는 tkt 유전자의 발현을 증가하기 위하여, tkt 유전자의 프로모터에 특이적인 변이를 유발하였다. tkt 유전자의 프로모터 -83 내지 -74 영역의 염기서열을 ccaattaacc에서 tgtgctgtca로 치환하기 위해서 변이 서열을 포함하는 프라이머를 제작하여, 실시예 1에서 선별된 코리네박테리움 글루타미쿰 DS1 변이주의 게놈 상에서 tkt 유전자 프로모터의 변이 부분을 중심으로 좌측암 696 bp 부분과 우측암 697 bp 부분을 PCR로 증폭하여, 오버랩 PCR(overlap PCR) 방법으로 연결한 후 재조합 벡터인 pCGI (문헌 [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] 참조)에 클로닝하였다. 상기 플라스미드를 pCGI(Ptkt83-1)이라고 명명하였다 (도 1 참조). 상기 플라스미드를 제작하기 위하여 각각의 유전자 단편을 증폭하는데 하기 표 2의 프라이머를 사용하였다.
프라이머(primer) (5' - 3') 서열번호
Ptkt-1F ggaattcccctgggcttcgttagcgc 4
Ptkt83-1-F2 cctttgccaaatttgaatgtgctgtcataagtcgtagatctg 5
Ptkt83-1-R1 cagatctacgacttatgacagcacattcaaatttggcaaagg 6
Ptkt-R2 gggatccctcacgacgagcagccatgg 7
자세히 설명하면 아래와 같다. 코리네박테리움 글루타미쿰 DS1 균주의 genomic DNA로부터 해당 프라이머를 이용하여 아래의 조건 하에 PCR을 수행하였다. Thermocycler (TP600, TAKARA BIO Inc., 일본)를 이용하여 각각의 데옥시뉴클레오티드 트리포스페이트 (dATP, dCTP, dGTP, dTTP) 100 μM가 첨가된 반응액에 올리고뉴클레오티드 1 pM, 코리네박테리움 글루타미쿰 DS1 균주의 염색체 DNA 10 ng을 주형(template)으로 이용하여, pfu-X DNA 폴리머라제 혼합물 (Solgent, Korea) 1 유닛의 존재 하에서 25 ~ 30 주기(cycle)를 수행하였다. PCR 수행 조건은 (i) 변성(denaturation) 단계: 94℃에서 30초, (ii) 결합(annealing) 단계: 58℃에서 30초, 및 (iii) 확장(extension) 단계: 72℃에서 1 ~ 2분 (1 kb 당 2분의 중합시간 부여)의 조건에서 실시하였다.
이와 같이 제조된 유전자 단편을 BamHI, EcoRI 제한효소와 DNA Ligation kit Ver2.1 (Takara, Japan)을 이용하여, pCGI 벡터에 클로닝하였다. 상기 벡터를 대장균(E. coli) DH5a에 형질전환시키고, 50 ㎍/㎖의 카나마이신을 함유하는 LB-한천 플레이트 상에 도말하여, 37℃에서 24시간 배양하였다. 최종 형성되는 콜로니를 분리하여 삽입물(insert)이 정확히 벡터에 존재하는지 확인한 후, 이 벡터를 분리하여 코리네박테리움 글루타미쿰 균주의 재조합에 사용하였다.
3-2. 변이주의 제조
상기 pCGI(Ptkt83-1) 벡터를 이용하여 변이 균주인 DS1-Ptkt83-1 균주를 제조하였다. 상기 벡터의 최종 농도가 1 ㎍/㎕ 이상 되도록 준비하여 코리네박테리움 글루타미쿰 DS1 균주에 전기천공법 (문헌 [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347] 참조)을 사용하여 1차 재조합을 유도하였다. 이때, 전기 천공한 균주를 카나마이신이 20 ㎍/㎕ 포함되는 CM-한천 플레이트에 도말하여 콜로니를 분리한 후 게놈상의 유도한 위치에 적절히 삽입되었는지 PCR 및 염기서열 분석을 통해 확인하였다. 이렇게 분리된 균주를 다시 2차 재조합을 유도하기 위하여 스트렙토마이신을 함유한 CM-한천 액체배지에 접종하고, 하룻밤 이상 배양하여 동일 농도의 스트렙토마이신을 함유한 한천배지에 도말하여 콜로니를 분리하였다. 최종 분리한 콜로니 중에서 카나마이신에 대한 내성 여부를 확인한 후, 항생제 내성이 없는 균주들 중 tkt 유전자에 변이가 도입되었는지 염기서열 분석을 통해 확인하였다 (문헌 [Schafer et al., Gene 145 (1994) 69-73] 참조). 최종적으로 변이 tkt 유전자가 도입된 코리네박테리움 글루타미쿰 변이주 (DS1-Ptkt83-10)를 획득하였다.
실시예 4. 코리네박테리움 글루타미쿰 변이주의 제조
tkt 유전자의 프로모터 -83 ~ -74 영역의 염기서열을 ccaattaacc에서 tgtggtatca로 치환한 것을 제외하고는, 실시예 3과 동일한 방법으로 코리네박테리움 글루타미쿰 변이주를 제조하였다.
여기서 플라스미드를 제작하기 위하여 각각의 유전자 단편을 증폭하는데 하기 표 3의 프라이머를 사용하였고, 제작된 플라스미드 pCGI(Ptkt83-7) 벡터를 이용하여 변이 균주인 DS1-Ptkt83-7 균주를 제조하였다. 최종적으로 변이 tkt 유전자가 도입된 코리네박테리움 글루타미쿰 변이주 (DS1-Ptkt83-7)를 획득하였다.
프라이머(primer) (5' - 3') 서열번호
Ptkt-1F ggaattcccctgggcttcgttagcgc 4
Ptkt83-7-F2 cctttgccaaatttgaatgtggtatcataagtcgtagatctg 8
Ptkt83-7-R1 cagatctacgacttatgataccacattcaaatttggcaaagg 9
Ptkt-R2 gggatccctcacgacgagcagccatgg 7
비교예 1. 코리네박테리움 글루타미쿰 변이주
대한민국 등록특허 제10-1504900호에 개시된, 야생형 코리네박테리움 글루타미쿰 균주의 tkt 유전자 프로모터 서열 중 -217 ~ -206 영역이 ATTGATCACACC에서 CCCTGACTACAAA로 변이가 유발된 변이주 (Ptkt217)를 사용하였다.
실험예 1. 변이주의 L-라이신 생산성 비교
모균주 코리네박테리움 글루타미쿰 DS1 균주, 실시예 3 및 4에서 제조된 라이신 생산 변이주인 DS1-Ptkt83-1 및 DS1-Ptkt83-7 균주, 및 비교예 1의 종래 라이신 생산 변이주인 Ptkt217 균주의 L-라이신 생산성을 실시예 1-2와 동일한 방법으로 비교하였다. 그 결과를 하기 표 4에 나타내었다.
균주 L-라이신 (g/L)
모균주 (DS1) 64.2
변이주 (Ptkt217) 69.9
변이주 (DS1-Ptkt83-1) 73.0
변이주 (DS1-Ptkt83-7) 75.1
상기 표 4에 나타낸 바와 같이, 코리네박테리움 글루타미쿰 변이주 DS1-Ptkt83-1 및 DS1-Ptkt83-7 균주는 라이신 생합성 경로의 강화를 위해 tkt 유전자의 프로모터 서열의 특정 위치 (-83 ~ -74 영역)가 최적의 염기서열로 치환됨으로써 모균주 코리네박테리움 글루타미쿰 DS1 균주에 비해 L-라이신의 생산성이 각각 약 14%, 17%씩 증가한 것으로 확인되었다.
또한, 코리네박테리움 글루타미쿰 변이주 DS1-Ptkt83-1 및 DS1-Ptkt83-7 균주는 변이 위치 (-217 내지 -206 영역) 및 서열 (CCCTGACTACAAA)이 상이한 종래 변이주 Ptkt217에 비해 L-라이신의 생산성이 각각 약 4%, 7%씩 증가한 것으로 확인되었다.
이러한 결과를 통해, 프로모터 -83 ~ -74 영역의 변이로 인한 tkt 유전자의 발현 강화가 라이신 생합성능을 강화함으로써 균주의 L-라이신 생산능을 향상시킨다는 것을 알 수 있었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (5)

  1. 트랜스케톨라아제의 활성이 강화되어 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 변이주.
  2. 청구항 1에 있어서,
    상기 트랜스케톨라아제의 활성 강화는 트랜스케톨라아제를 암호화하는 유전자의 프로모터에 위치 특이적 변이를 유발하는 것인 코리네박테리움 글루타미쿰 변이주.
  3. 청구항 2에 있어서,
    상기 트랜스케톨라아제를 암호화하는 유전자는 서열번호 1의 염기서열로 표시되는 것인 코리네박테리움 글루타미쿰 변이주.
  4. 청구항 1에 있어서,
    상기 변이주는 서열번호 2 및 3으로 표시되는 염기서열 중 어느 하나를 포함하는 것인 코리네박테리움 글루타미쿰 변이주.
  5. a) 청구항 1의 변이주를 배지에서 배양하는 단계; 및
    b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-라이신을 회수하는 단계를 포함하는 L-라이신의 생산 방법.
PCT/KR2021/006681 2021-04-30 2021-05-28 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 WO2022231056A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP21939438.4A EP4332230A1 (en) 2021-04-30 2021-05-28 Corynebacterium glutamicum variant with improved l-lysine production ability, and method for producing l-lysine using same
BR112023022512A BR112023022512A2 (pt) 2021-04-30 2021-05-28 Promotor, variante de corynebacterium glutamicum e método para produção de l-lisina
JP2023566852A JP2024515390A (ja) 2021-04-30 2021-05-28 Ｌ－リシン生産能が向上したコリネバクテリウム・グルタミカム変異株及びそれを用いたｌ－リシン生産方法
MX2023012873A MX2023012873A (es) 2021-04-30 2021-05-28 Variante de corynebacterium glutamicum con capacidad mejorada de producción de l-lisina y procedimiento para la producción de l-lisina mediante el uso de la misma.
AU2021443607A AU2021443607A1 (en) 2021-04-30 2021-05-28 Corynebacterium glutamicum variant with improved l-lysine production ability, and method for producing l-lysine using same
CA3217305A CA3217305A1 (en) 2021-04-30 2021-05-28 Corynebacterium glutamicum variant with improved l-lysine production ability, and method for producing l-lysine using same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210056580 2021-04-30
KR10-2021-0056580 2021-04-30
KR10-2021-0067391 2021-05-26
KR1020210067391A KR102682180B1 (ko) 2021-04-30 2021-05-26 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Publications (1)

Publication Number Publication Date
WO2022231056A1 true WO2022231056A1 (ko) 2022-11-03

Family

ID=83758658

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006681 WO2022231056A1 (ko) 2021-04-30 2021-05-28 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Country Status (9)

Country Link
EP (1) EP4332230A1 (ko)
JP (1) JP2024515390A (ko)
KR (1) KR20240000419A (ko)
CN (2) CN115261294B (ko)
AU (1) AU2021443607A1 (ko)
BR (1) BR112023022512A2 (ko)
CA (1) CA3217305A1 (ko)
MX (1) MX2023012873A (ko)
WO (1) WO2022231056A1 (ko)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100838038B1 (ko) 2006-12-29 2008-06-12 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
US20100015674A1 (en) * 2003-12-18 2010-01-21 Basf Se Methods For The Preparation of Lysine By Fermentation Of Corynebacterium Glutamicum
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
KR20150075717A (ko) * 2013-12-26 2015-07-06 백광산업 주식회사 코리네형 세균 유래의 치환된 개시코돈을 포함하는 재조합 벡터, 형질전환된 숙주세포 및 이를 이용한 아미노산의 생산방법
CN105483145A (zh) * 2011-12-21 2016-04-13 Cj第一制糖株式会社 利用具有产生l-赖氨酸能力的微生物产生l-赖氨酸的方法
KR20200026881A (ko) 2017-06-07 2020-03-11 지머젠 인코포레이티드 코리네박테리움 글루타미컴으로부터의 프로모터 및 보조 유전자 발현을 조절하는 데 이의 용도
KR102139806B1 (ko) 2020-02-13 2020-07-30 씨제이제일제당 (주) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU5982200A (en) * 2000-03-17 2001-09-24 Degussa A.G. Process for the fermentative preparation of l-amino acids with amplification of the tkt gene
CN101646687A (zh) * 2007-02-19 2010-02-10 赢创德固赛有限责任公司 通过过表达戊糖磷酸途径的酶在棒状细菌中生产甲硫氨酸的方法
CN113308426B (zh) * 2021-05-27 2022-10-18 齐鲁工业大学 一种改造tk基因5′端序列的重组棒状杆菌及其应用

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100015674A1 (en) * 2003-12-18 2010-01-21 Basf Se Methods For The Preparation of Lysine By Fermentation Of Corynebacterium Glutamicum
KR100838038B1 (ko) 2006-12-29 2008-06-12 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
CN105483145A (zh) * 2011-12-21 2016-04-13 Cj第一制糖株式会社 利用具有产生l-赖氨酸能力的微生物产生l-赖氨酸的方法
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
KR101504900B1 (ko) 2013-06-27 2015-03-23 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
KR20150075717A (ko) * 2013-12-26 2015-07-06 백광산업 주식회사 코리네형 세균 유래의 치환된 개시코돈을 포함하는 재조합 벡터, 형질전환된 숙주세포 및 이를 이용한 아미노산의 생산방법
KR20200026881A (ko) 2017-06-07 2020-03-11 지머젠 인코포레이티드 코리네박테리움 글루타미컴으로부터의 프로모터 및 보조 유전자 발현을 조절하는 데 이의 용도
US20200239897A1 (en) * 2017-06-07 2020-07-30 Zymergen Inc. Promoters from corynebacterium glutamicum and uses thereof in regulating ancillary gene expression
KR102139806B1 (ko) 2020-02-13 2020-07-30 씨제이제일제당 (주) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"Corynebacterium glutamicum DS1 strain", KOREAN CULTURE CENTER OF MICROORGANISMS, 2 April 2021 (2021-04-02)
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
KIM ET AL., JOURNAL OF MICROBIOLOGICAL METHODS, vol. 84, 2011, pages 128 - 130
SAMBROOK, J. ET AL.: "Molecular Cloning: A Laboratory Manual", vol. 2, 2001, COLD SPRING HARBOR LABORATORY PRESS, pages: 36 - 13
SCHAFER ET AL., GENE, vol. 145, 1994, pages 69 - 73
SHAW ET AL., BIOCHEMISTRY, vol. 30, no. 44, 1991, pages 10806
TAUCH ET AL., FEMS MICROBIOLOGY LETTERS, vol. 123, 1994, pages 343 - 347

Also Published As

Publication number Publication date
BR112023022512A2 (pt) 2024-01-02
MX2023012873A (es) 2024-01-24
CN117511834A (zh) 2024-02-06
KR20240000419A (ko) 2024-01-02
CN115261294B (zh) 2024-03-29
CA3217305A1 (en) 2022-11-03
AU2021443607A1 (en) 2023-11-16
CN115261294A (zh) 2022-11-01
EP4332230A1 (en) 2024-03-06
JP2024515390A (ja) 2024-04-09

Similar Documents

Publication Publication Date Title
WO2021162189A1 (ko) L-글루탐산 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-글루탐산의 생산 방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2015122569A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2014126384A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022050527A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231056A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231055A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023063547A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2012008810A2 (en) Microorganism with enhanced l-lysine productivity and method for producing l-lysine using the same
WO2022050524A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220149379A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023106543A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024019215A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2024019216A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
KR20220149376A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220148694A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024090884A1 (ko) 페닐알라닌:h+ 동시수송체 phep 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2022196919A1 (ko) L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법
WO2023158176A1 (ko) 스트레스 단백질 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2024090883A1 (ko) 피루베이트 인산화효소 2 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2023136421A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21939438

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2301007063

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 12023552992

Country of ref document: PH

Ref document number: 2023566852

Country of ref document: JP

Ref document number: MX/A/2023/012873

Country of ref document: MX

Ref document number: 3217305

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2021443607

Country of ref document: AU

Ref document number: AU2021443607

Country of ref document: AU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023022512

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2021443607

Country of ref document: AU

Date of ref document: 20210528

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202317078805

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2023128587

Country of ref document: RU

Ref document number: 2021939438

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021939438

Country of ref document: EP

Effective date: 20231130

ENP Entry into the national phase

Ref document number: 112023022512

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231027