WO2023106543A1 - L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 - Google Patents

L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 Download PDF

Info

Publication number
WO2023106543A1
WO2023106543A1 PCT/KR2022/011180 KR2022011180W WO2023106543A1 WO 2023106543 A1 WO2023106543 A1 WO 2023106543A1 KR 2022011180 W KR2022011180 W KR 2022011180W WO 2023106543 A1 WO2023106543 A1 WO 2023106543A1
Authority
WO
WIPO (PCT)
Prior art keywords
lysine
corynebacterium
strain
amino acid
mutant
Prior art date
Application number
PCT/KR2022/011180
Other languages
English (en)
French (fr)
Inventor
김하은
이선희
이영주
김봉기
박석현
박준현
Original Assignee
대상 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대상 주식회사 filed Critical 대상 주식회사
Publication of WO2023106543A1 publication Critical patent/WO2023106543A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01009—Glyceraldehyde-3-phosphate dehydrogenase (NADP+) (1.2.1.9)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01012—Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (1.2.1.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01013—Glyceraldehyde-3-phosphate dehydrogenase (NADP+) (phosphorylating) (1.2.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01059—Glyceraldehyde-3-phosphate dehydrogenase (NAD(P)+)(phosphorylating) (1.2.1.59)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present invention relates to a Corynebacterium glutamicum mutant with improved L-lysine production ability and a method for producing L-lysine using the same.
  • L-lysine is an essential amino acid that is not synthesized in the human or animal body and must be supplied from the outside, and is generally produced by fermentation using microorganisms such as bacteria or yeast.
  • L- lysine production may use a wild-type strain obtained in nature or a mutant strain modified to improve its L- lysine production ability.
  • genetic recombination technology was applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to produce excellent L-lysine.
  • Various recombinant strains or mutant strains and L-lysine production methods using the same are being developed.
  • Korean Patent Registration Nos. 10-0838038 and 10-2139806 the expression of the gene is increased or unnecessary by changing the nucleotide sequence or amino acid sequence of a gene encoding a protein including an enzyme related to L-lysine production.
  • L-lysine production ability can be improved by deleting the gene.
  • Korean Patent Publication No. 10-2020-0026881 discloses a method of changing an existing promoter of a gene to a promoter having strong activity in order to increase the expression of a gene encoding an enzyme involved in L-lysine production.
  • Patent Document 1 Korea Patent Registration No. 10-0838038
  • Patent Document 2 Korea Patent Registration No. 10-2139806
  • Patent Document 3 Korean Patent Publication No. 10-2020-0026881
  • An object of the present invention is to provide a Corynebacterium glutamicum mutant with improved L-lysine production ability.
  • an object of the present invention is to provide a method for producing L-lysine using the mutant strain.
  • the present inventors studied to develop a new mutant strain with improved L-lysine production ability using a Corynebacterium glutamicum strain, and as a result, gapA encoding glyceraldehyde 3-phosphate dehydrogenase involved in the L-lysine biosynthetic pathway
  • the present invention was completed by confirming that L-lysine production increased when an amino acid at a specific position in the amino acid sequence of a gene was substituted.
  • One aspect of the present invention provides a Corynebacterium glutamicum mutant with improved L-lysine production ability by improving the activity of glyceraldehyde 3-phosphate dehydrogenase.
  • Glyceraldehyde 3-phosphate dehydrogenase used in the present invention is involved in glycolysis or glycosynthesis during energy metabolism, and glyceraldehyde 3-phosphate and 1 It refers to an enzyme that catalyzes the reversible reaction of ,3-bisphosphoglycerate and at the same time reduces the coenzyme NAD+ or NADP+ to NADH or NADPH or conversely oxidizes it. GAPDH is classified into three subtypes, GapA, GapB and GapN, depending on the type of coenzyme.
  • GapA uses NAD in glycolysis to produce 1,3-bisphosphoglyceric acid and NADH from glyceraldehyde 3-phosphate, as well as uses NADH in gluconeogenesis to produce 1,3-bis Catalyzing the reaction that produces glyceraldehyde 3-phosphate from phosphoglyceric acid
  • GapB is activated by both NAD and NADP and functions only in gluconeogenesis.
  • GapN is NADP dependent and catalyzes the irreversible oxidation of glyceraldehyde 3-phosphate to 1,3-bisphosphoglyceric acid without generating ATP.
  • a mutant producing NADPH was prepared by using NADP instead of NAD in the conversion of glyceraldehyde 3-phosphate by improving the activity of GapA.
  • the glyceraldehyde 3-phosphate dehydrogenase may be GapA.
  • the glyceraldehyde 3-phosphate dehydrogenase may be derived from a strain of the genus Corynebacterium .
  • the strains of the genus Corynebacterium are Corynebacterium glutamicum , Corynebacterium crudilactis , Corynebacterium deserti , Corynebacterium Callunae ( Corynebacterium callunae ), Corynebacterium suranaaeae ( Corynebacterium suranareeae ), Corynebacterium rubricantis ( Corynebacterium lubricantis ), Corynebacterium dusanense ( Corynebacterium doosanense ), Corynebacterium episi Ens ( Corynebacterium efficiens ), Corynebacterium utereki ( Corynebacterium uterequi ), Corynebacterium stationis
  • Activity improvement means that proteins such as enzymes, transcription factors, and transport proteins of interest are structurally modified to produce products or protein complexes different from those of the wild-type strain or the strain before modification, or the wild-type strain or the strain before modification. It refers to an increase in the concentration of a product or protein complex relative to a strain.
  • the structural modification refers to a physical change in a reaction site for a protein substrate or binding protein, for example, an active site of an enzyme.
  • the improvement of this activity is when the activity of the protein itself is different from or increased compared to the activity of the protein originally possessed by the microorganism through nucleotide substitution, insertion, deletion, or a combination encoding the gene, and increased expression of the gene encoding it Alternatively, when the overall degree of enzyme activity in the cell is higher than that of the wild-type strain or the strain before modification due to increased translation, a combination thereof is also included.
  • the activity improvement of the glyceraldehyde 3-phosphate dehydrogenase may be by inducing a site-specific mutation in a gene encoding glyceraldehyde 3-phosphate dehydrogenase.
  • the gene encoding the glyceraldehyde 3-phosphate dehydrogenase may be represented by the amino acid sequence of SEQ ID NO: 1.
  • the gene encoding the glyceraldehyde 3-phosphate dehydrogenase may be represented by the nucleotide sequence of SEQ ID NO: 2.
  • the improvement of the activity of the glyceraldehyde 3-phosphate dehydrogenase is achieved by substitution of one or more amino acids in the 10th to 130th amino acid region in the amino acid sequence of the gene encoding glyceraldehyde 3-phosphate dehydrogenase may have been
  • the genetic mutation in the present invention is one or more amino acids in the 10th to 130th amino acid region, preferably 1 in the 20th to 120th, 30th to 110th, 30 to 50th, or 90 to 110th amino acid region Two, two, three, four, or five amino acids may be consecutively or noncontiguously substituted.
  • the activity improvement of the glyceraldehyde 3-phosphate dehydrogenase is one of the 36th, 37th and 100th amino acids in the amino line sequence of the gene encoding glyceraldehyde 3-phosphate dehydrogenase More than one amino acid may be substituted.
  • the 36th position in the amino acid sequence of the gapA gene encoding the glyceraldehyde 3-phosphate dehydrogenase of Corynebacterium glutamicum strain is changed from leucine (Leu) to serine (serine, Ser), the 37th position was substituted from threonine (Thre) to lysine (lysine, Lys) to obtain a Corynebacterium glutamicum mutant having a new amino acid sequence of the gapA gene.
  • These Corynebacterium glutamicum mutants may contain the gapA gene represented by the amino acid sequence of SEQ ID NO: 3.
  • the 36th position in the amino acid sequence of the gapA gene encoding the glyceraldehyde 3-phosphate dehydrogenase of Corynebacterium glutamicum strain is serine (leucine, Leu) ( serine (Ser), threonine (Thr) to lysine (lys) at the 37th position, and phenylalanine (Phe) to valine (Val) at the 100th position to create new amino acids in the gapA gene.
  • a mutant strain of Corynebacterium glutamicum having the sequence was obtained.
  • These Corynebacterium glutamicum mutants may contain the gapA gene represented by the amino acid sequence of SEQ ID NO: 5.
  • Corynebacterium glutamicum mutants having mutations in the glyceraldehyde 3-phosphate dehydrogenase gene or the amino acid sequence encoding the same can have improved L-lysine production.
  • the parent strain refers to a wild-type or mutant strain subject to mutation, and includes a subject subject to direct mutation or transformed into a recombinant vector.
  • the mother strain may be a wild type Corynebacterium glutamicum strain or a strain mutated from the wild type.
  • the mother strain is a Corynebacterium glutamicum strain in which the activity of citrate synthase involved in the lysine biosynthetic pathway is attenuated (Korean Application No. 10-2021-0050318 Ho) (hereinafter referred to as 'Corynebacterium glutamicum DS2 strain').
  • the Corynebacterium glutamicum mutant with improved L-lysine production ability contains an amino acid mutation of the gapA gene encoding glyceraldehyde 3-phosphate dehydrogenase, thereby producing L-lysine biosynthesis.
  • Increased NADPH supply indicates increased L-lysine production capacity compared to the parent strain, in particular, L-lysine production increased by 5% or more, specifically 5 to 20% compared to the parent strain, to 70 g or more per 1 liter of strain culture medium , Specifically, 70 to 85 g of L-lysine can be produced.
  • Corynebacterium glutamicum mutant according to an embodiment of the present invention is implemented through a recombinant vector containing a mutant in which the amino acid sequence of the gapA gene encoding glyceraldehyde 3-phosphate dehydrogenase is partially substituted in the parent strain.
  • “Some” used in the present invention means not all of the amino acid sequence, base sequence or polynucleotide sequence, and may be 1 to 300, preferably 1 to 100, more preferably 1 to 50, It is not limited to this.
  • mutant refers to a mutant in which one or more amino acids in the 10th to 130th amino acid region in the amino acid sequence of the glyceraldehyde 3-phosphate dehydrogenase gene involved in the biosynthesis of L-lysine is substituted.
  • the variant in which the 36th and 37th amino acids in the amino acid sequence of the glyceraldehyde 3-phosphate dehydrogenase gene are substituted has the amino acid sequence of SEQ ID NO: 3 or the base sequence of SEQ ID NO: 4 can
  • the mutant in which the 36th, 37th and 100th amino acids in the amino acid sequence of the glyceraldehyde 3-phosphate dehydrogenase gene are substituted is the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 6 It may have a nucleotide sequence.
  • vector is an expression vector capable of expressing a target protein in a suitable host cell, and refers to a gene product containing essential regulatory elements operably linked to express a gene insert.
  • operably linked means that a gene requiring expression and its regulatory sequence are functionally linked to each other to enable gene expression
  • regulatory element refers to a promoter for performing transcription and regulating transcription. sequences encoding suitable mRNA ribosome binding sites, and sequences that control termination of transcription and translation.
  • vectors include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.
  • the “recombinant vector” used in the present invention can be replicated independently of the genome of the host cell or can be incorporated into the genome itself.
  • the "suitable host cell” is capable of replicating the vector and may include an origin of replication, which is a specific nucleotide sequence at which replication is initiated.
  • a suitable vector introduction technique is selected according to the host cell, and the desired gene can be expressed in the host cell.
  • vector introduction can be performed by electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- It may be performed by a dextran method, a cationic liposome method, a lithium acetate-DMSO method, or a combination thereof.
  • the transformed gene may be included without limitation, whether it is inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell.
  • the host cell includes a cell transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro.
  • a host cell containing the recombinant vector of the present invention is a recombinant host cell, recombinant cell or recombinant microorganism.
  • the recombinant vector according to the present invention may include a selection marker.
  • the selection marker is for selecting transformants (host cells) transformed with the vector in a medium treated with the selection marker. Since only cells expressing the selectable marker can survive, selection of transformed cells is possible.
  • Representative examples of the selectable marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.
  • Genes inserted into the recombinant vector for transformation of the present invention may be substituted into host cells such as microorganisms of the genus Corynebacterium due to homologous recombination crossing.
  • the host cell may be a Corynebacterium genus strain, for example, a Corynebacterium glutamicum DS2 strain.
  • another aspect of the present invention is a) culturing the Corynebacterium glutamicum mutant in a medium; And b) it provides a method for producing L- lysine comprising the step of recovering L- lysine from the medium in which the mutant or mutant is cultured.
  • the culture may be performed according to appropriate media and culture conditions known in the art, and those skilled in the art can easily adjust and use the media and culture conditions.
  • the medium may be a liquid medium, but is not limited thereto.
  • the culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.
  • the medium must meet the requirements of a particular strain in an appropriate way, and can be appropriately modified by a person skilled in the art.
  • a culture medium for a strain of the genus Corynebacterium may refer to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.
  • Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, These include fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
  • the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto.
  • essential growth substances such as amino acids and vitamins may be included. Precursors suitable for the culture medium may also be used. The medium or individual components may be added in a batchwise or continuous manner by a method suitable for the culture medium during the culture process, but is not limited thereto.
  • the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation.
  • the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation.
  • oxygen or oxygen-containing gas eg, air
  • the temperature of the culture medium may be usually 20 ° C to 45 ° C, for example, 25 ° C to 40 ° C.
  • the culturing period may be continued until useful substances are obtained in a desired yield, and may be, for example, 10 to 160 hours.
  • the step of recovering L-lysine from the cultured mutant and the medium in which the mutant is cultured is L-lysine produced from the medium using a suitable method known in the art according to the culture method.
  • a suitable method known in the art according to the culture method can be collected or retrieved.
  • centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractionation (eg ammonium sulfate precipitation), chromatography (eg ion exchange, affinity, hydrophobicity and Size exclusion) may be used, but is not limited thereto.
  • the culture medium in the step of recovering lysine, is centrifuged at low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography.
  • the recovering L-lysine may include a step of purifying L-lysine.
  • the amino acid mutation of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is induced, and the yield of L-lysine production can be improved through improvement of enzyme activity.
  • FIG. 1 shows the structure of a DS2-gapA-Pm1 vector including a gapA gene in which the 36th amino acid in the amino acid sequence is replaced from leucine to serine and the 37th amino acid is substituted from threonine to lysine according to an embodiment of the present invention.
  • Figure 2 shows DS2-gapA including the gapA gene in which the 36th amino acid in the amino acid sequence is substituted from leucine to serine, the 37th amino acid from threonine to lysine, and the 100th amino acid from phenylalanine to valine in the amino acid sequence according to an embodiment of the present invention. It shows the structure of the -Pm2 vector.
  • Corynebacterium glutamicum DS2 strain and E. coli DH5a (HIT Competent cellsTM, Cat No. RH618) was used.
  • the Corynebacterium glutamicum DS2 strain is a CM composed of 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone and 5.0 g of beef extract in 1 L of distilled water. -cultured at 30°C in broth medium (pH 6.8).
  • the E. coli DH5a was cultured at 37° C. on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.
  • Antibiotics kanamycin and streptomycin were used as products of Sigma.
  • DNA sequencing analysis was performed by requesting Macrogen Co., Ltd.
  • the activity of glyceraldehyde 3-phosphate dehydrogenase was improved to produce NADPH instead of NADH to increase L-lysine productivity by expanding the supply of NADPH required during lysine biosynthesis.
  • the method used in this example induced a specific mutation in the gapA gene encoding glyceraldehyde 3-phosphate dehydrogenase.
  • the 36th amino acid was substituted from leucine to serine, and the 37th amino acid was substituted from threonine to lysine.
  • the 442 bp portion of the arm and the 552 bp portion of the right arm were amplified by PCR, linked by an overlap PCR method, and then recombinant vector pCGI (Kim et al., Journal of Microbiological Methods 84 (2011) 128-130 ] reference).
  • the plasmid was named DS2-gapA-Pm1 (see FIG. 1).
  • the primers in Table 1 were used to amplify each gene fragment.
  • PCR was performed under the following conditions using the above primers.
  • a thermocycler TP600, TAKARA BIO Inc., Japan
  • 1 pM of oligonucleotide and Corynebacterium glutamicum were added to the reaction solution to which 100 ⁇ M of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) was added.
  • dATP deoxynucleotide triphosphate
  • dCTP deoxynucleotide triphosphate
  • dGTP deoxynucleotide triphosphate
  • dTTP deoxynucleotide triphosphate
  • the PCR performance conditions were (i) denaturation step: 30 seconds at 94 ° C, (ii) annealing step: 30 seconds at 58 ° C, and (iii) extension step: 1 to 2 at 72 ° C. min (polymerization time of 2 minutes per 1 kb).
  • the gene fragment thus prepared was cloned into a pCGI vector using self-assembly cloning.
  • the vector was transformed into E. coli DH5a, spread on LB-agar plates containing 50 ⁇ g/ml of kanamycin, and cultured at 37° C. for 24 hours. After confirming that the insert was correctly present in the vector by isolating the finally formed colony, the vector was isolated and used for recombination of the Corynebacterium glutamicum strain.
  • the amplification of the corresponding genes is amplified by PCR from genomic DNA of Corynebacterium glutamicum ATCC 13032, inserted into pCGI vector by self-assembled cloning method according to the strategy, E. coli DH5a selected from. Chromosomal base substitution (Chromosomal base substitution) individually amplified the gene of each fragment to prepare a target DNA fragment by overlap PCR. Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes for gene manipulation, and NEB products were used for various restriction enzymes and DNA modifying enzymes, and they were used according to the supplied buffers and protocols.
  • a mutant strain DS2-1 strain
  • DS2-1 strain was prepared. Prepared so that the final concentration of the vector was 1 ⁇ g / ⁇ l or more, and used electroporation (see Tauch et al., FEMS Microbiology letters 123 (1994) 343-347) on Corynebacterium glutamicum DS2 strain to induce primary recombination. At this time, the electroporated strain was plated on a CM-agar plate containing 20 ⁇ g/ ⁇ l of kanamycin to separate colonies, and then it was confirmed by PCR and sequencing whether the strain was properly inserted into the induced position on the genome.
  • the strain thus isolated was inoculated into a CM-agar liquid medium containing streptomycin, cultured overnight or longer, and then plated on an agar medium containing the same concentration of streptomycin to separate colonies. After confirming resistance to kanamycin among the finally isolated colonies, it was confirmed through sequencing whether the mutation was introduced into the gapA gene among strains without antibiotic resistance (Reference [Schafer et al., Gene 145 (1994) 69- 73]). Finally, a Corynebacterium glutamicum mutant (DS2-1) into which the mutant gapA gene was introduced was obtained.
  • the activity of glyceraldehyde 3-phosphate dehydrogenase was improved to produce NADPH instead of NADH to increase L-lysine productivity by expanding the supply of NADPH required during lysine biosynthesis.
  • the method used in this example induced a specific mutation in the gapA gene encoding glyceraldehyde 3-phosphate dehydrogenase.
  • the 36th amino acid was substituted from leucine to serine, the 37th amino acid from threonine to lysine, and the 100th amino acid from phenylalanine to valine.
  • a 442 bp portion of the left arm and a 360 bp portion of the right arm were amplified by PCR, centered on the portion containing the th and 100th amino acids, linked by overlap PCR, and then recombinant vector pCGI (document [Kim et al. , Journal of Microbiological Methods 84 (2011) 128-130).
  • the plasmid was named DS2-gapA-Pm2 (see FIG. 2).
  • the primers in Table 2 were used to amplify each gene fragment.
  • the DS2-2 strain which is a mutant strain, was prepared and obtained using the DS2-gapA-Pm2.
  • Each strain was inoculated into a 100 ml flask containing 10 ml of a lysine medium having the composition shown in Table 3, respectively, and cultured with shaking at 30° C. for 28 hours at 180 rpm. After completion of the culture, lysine analysis was performed by HPLC (Shimazu, Japan) to measure the production of L-lysine, and the results are shown in Table 4 below.
  • the Corynebacterium glutamicum mutants DS2-1 and DS2-2 have specific positions (36th and 37th amino acids, or 36th amino acids) of the amino acid sequence of the gapA gene to enhance the lysine biosynthetic pathway. , 37th and 100th amino acids) were substituted with optimal amino acid residues, thereby increasing the productivity of L-lysine by about 12.5% and 11.1%, respectively, compared to the parent strain Corynebacterium glutamicum DS2 strain.
  • the gapA gene mutation improves the L-lysine production ability of the strain by improving the activity of glyceraldehyde 3-phosphate dehydrogenase.

Abstract

본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법에 관한 것으로, 상기 코리네박테리움 글루타미쿰 변이주는 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자의 아미노산 변이가 유도되어 효소 활성의 개선을 통해 L-라이신의 생산 수율이 향상될 수 있다.

Description

L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법
본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-라이신의 생산 방법에 관한 것이다.
L-라이신은 사람이나 동물 체내에서 합성되지 않는 필수아미노산으로서 외부에서 공급되어야 하며, 일반적으로 세균이나 효모와 같은 미생물을 이용한 발효에 의해 생산된다. L-라이신 생산은 자연상태에서 수득된 야생형 균주나 이의 L-라이신 생산능이 향상되도록 변형된 변이주를 이용할 수 있다. 최근에는 L-라이신의 생산 효율을 개선시키기 위해 L-아미노산 및 기타 유용물질 생산에 많이 이용되는 대장균, 코리네박테리움 등의 미생물을 대상으로 유전자 재조합 기술을 적용하여 우수한 L-라이신 생산능을 갖는 다양한 재조합 균주 또는 변이주 및 이를 이용한 L-라이신 생산 방법이 개발되고 있다.
한국등록특허 제10-0838038호 및 제10-2139806호에 따르면, L-라이신 생산과 관련된 효소 등을 포함한 단백질을 암호화하는 유전자의 염기서열 또는 아미노산 서열을 변경하여 그 유전자의 발현을 증가시키거나 불필요한 유전자를 제거함으로써 L-라이신 생산능을 향상시킬 수 있다. 또한, 한국공개특허 제10-2020-0026881호에는 L-라이신 생산에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키기 위하여 유전자의 기존 프로모터를 강한 활성을 가지는 프로모터로 변경하는 방법을 개시하고 있다.
이와 같이 L-라이신 생산능을 증가시키는 다양한 방법이 개발되고 있으나, L-라이신 생산에 직간접적으로 연관된 효소, 전사인자, 수송 단백질 등 단백질의 종류가 수십여 종에 이르기 때문에 이러한 단백질의 활성 변화에 따른 L-라이신 생산능 증가 여부에 관해 여전히 많은 연구가 필요한 실정이다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 한국등록특허 제10-0838038호
(특허문헌 2) 한국등록특허 제10-2139806호
(특허문헌 3) 한국공개특허 제10-2020-0026881호
본 발명은 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 변이주를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 변이주를 이용한 L-라이신의 생산 방법을 제공하는 것을 목적으로 한다.
본 발명자들은 코리네박테리움 글루타미쿰 균주를 이용하여 L-라이신 생산능이 향상된 새로운 변이주를 개발하기 위해 연구한 결과, L-라이신 생합성 경로에 관여하는 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 gapA 유전자의 아미노산 서열 중 특정 위치의 아미노산을 치환한 경우 L-라이신 생산량이 증가함을 확인함으로써 본 발명을 완성하였다.
본 발명의 일 양상은 글리세르알데하이드 3-인산 탈수소효소의 활성이 개선되어 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주를 제공한다.
본 발명에서 사용된 “글리세르알데하이드 3-인산 탈수소효소(glyceraldehyde 3-phosphate dehydrogenase, GAPDH)”는 에너지 대사 중 당분해 또는 당합성에 관여하여 글리세르알데하이드 3-인산(glyceraldehyde 3-phosphate)과 1,3-비스포스포글리세르산(1,3-bisphosphoglycerate)의 가역적인 반응을 촉매하는 동시에 조효소 NAD+ 또는 NADP+를 NADH 또는 NADPH로 환원하거나 반대로 이를 산화하는 효소를 의미한다. GAPDH는 조효소의 종류에 따라 GapA, GapB 및 GapN의 세가지 아형으로 구분된다. GapA는 해당과정(glycolysis)에서 NAD를 사용하여 글리세르알데하이드 3-인산으로부터 1,3-비스포스포글리세르산과 NADH를 생산할 뿐만 아니라 포도당신생합성(gluconeogenesis)에서 NADH를 사용하여 1,3-비스포스포글리세르산으로부터 글리세르알데하이드 3-인산을 생산하는 반응을 촉매하고, GapB는 NAD와 NADP 모두에 의해 활성화되며 포도당신생합성에서만 작용한다. GapN는 NADP 의존적이며 ATP 생성 없이 글리세르알데하이드 3-인산을 1,3-비스포스포글리세르산으로 전환하는 비가역적 산화를 촉매한다.
본 발명에서는 라이신 생합성 과정에 필요한 NADPH를 다량 생산 또는 공급하기 위해 GapA의 활성을 개선하여 글리세르알데하이드 3-인산의 전환에서 NAD 대신 NADP를 사용하여 NADPH를 생산하는 변이주를 제작하였다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소는 GapA인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소는 코리네박테리움(Corynebacterium) 속 균주에서 유래된 것일 수 있다. 구체적으로, 상기 코리네박테리움속 균주는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데저티(Corynebacterium deserti), 코리네박테리움 칼루나에(Corynebacterium callunae), 코리네박테리움 수라나래에(Corynebacterium suranareeae), 코리네박테리움 루브리칸티스(Corynebacterium lubricantis), 코리네박테리움 두사넨세(Corynebacterium doosanense), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 우테레키(Corynebacterium uterequi), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 파캔세(Corynebacterium pacaense), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 휴미레듀센스(Corynebacterium humireducens), 코리네박테리움 마리눔(Corynebacterium marinum), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스페니스코룸(Corynebacterium spheniscorum), 코리네박테리움 프레이부르겐세(Corynebacterium freiburgense), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 카니스(Corynebacterium canis), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 레날레(Corynebacterium renale), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 카스피움(Corynebacterium caspium), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris), 코리네박테리움 슈도펠라지(Corynebacaterium pseudopelargi) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있으며, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “활성이 개선”은 목적하는 효소, 전사 인자, 수송 단백질 등의 단백질이 구조적으로 변형되어 야생형 균주 또는 변형 전의 균주와 다른 생산물 또는 단백질 복합체를 생산하거나, 또는 야생형 균주 또는 변형 전의 균주에 비해 생산물 또는 단백질 복합체의 농도가 증가하는 것을 의미한다. 여기서 구조적으로 변형이란 단백질의 기질 또는 결합 단백질에 대한 반응 부위, 예를 들면 효소의 활성 자리(active site)가 물리적으로 변경됨을 말한다. 이러한 활성의 개선은 유전자를 암호화하는 뉴클레오티드 치환, 삽입, 결실 또는 이들의 조합을 통하여 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성과 달라지거나 이에 비해 증가한 경우와, 이를 암호화하는 유전자의 발현 증가 또는 번역 증가 등으로 세포 내에서 전체적인 효소 활성 정도가 야생형 균주 또는 변형 전의 균주에 비하여 높은 경우, 이들의 조합 역시 포함한다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소의 활성 개선은 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자에 위치 특이적 변이를 유발하는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자는 서열번호 1의 아미노산 서열로 표시되는 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자는 서열번호 2의 염기서열로 표시되는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소의 활성 개선은 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자의 아미노산 서열 내 10 내지 130번째 아미노산 영역 중 하나 이상의 아미노산이 치환된 것일 수 있다.
보다 구체적으로, 본 발명에서의 유전자 변이는 10 내지 130번째 아미노산 영역 중 1개 이상의 아미노산, 바람직하게는 20 내지 120번째, 30 내지 110번째, 30 내지 50번째, 또는 90 내지 110번째 아미노산 영역 중 1개, 2개, 3개, 4개, 또는 5개의 아미노산이 연속적으로 또는 비연속적으로 치환된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소의 활성 개선은 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자의 아미노선 서열 내 36번째, 37번째 및 100번째 아미노산 중 하나 이상의 아미노산이 치환된 것일 수 있다.
본 발명의 일 실시예에 따르면, 코리네박테리움 글루타미쿰 균주의 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 gapA 유전자의 아미노산 서열에서 36번째 자리를 류신(leucine, Leu)에서 세린(serine, Ser)으로, 37번째 자리를 트레오닌(threonine, Thr)에서 라이신(lysine, Lys)으로 치환하여 gapA 유전자의 새로운 아미노산 서열을 가지는 코리네박테리움 글루타미쿰 변이주를 획득하였다. 이러한 코리네박테리움 글루타미쿰 변이주는 서열번호 3의 아미노산 서열로 표시되는 gapA 유전자를 포함하는 것일 수 있다.
또한, 본 발명의 일 실시예에 따르면, 코리네박테리움 글루타미쿰 균주의 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 gapA 유전자의 아미노산 서열에서 36번째 자리를 류신(leucine, Leu)에서 세린(serine, Ser)으로, 37번째 자리를 트레오닌(threonine, Thr)에서 라이신(lysine, Lys)으로, 100번째 자리를 페닐알라닌(phenylalanine, Phe)에서 발린(valine, Val)으로 치환하여 gapA 유전자의 새로운 아미노산 서열을 가지는 코리네박테리움 글루타미쿰 변이주를 획득하였다. 이러한 코리네박테리움 글루타미쿰 변이주는 서열번호 5의 아미노산 서열로 표시되는 gapA 유전자를 포함하는 것일 수 있다.
이와 같이 글리세르알데하이드 3-인산 탈수소효소 유전자 또는 이를 암호화하는 아미노산 서열에 대한 변이를 가지는 코리네박테리움 글루타미쿰 변이주는 L-라이신 생산능이 향상될 수 있다.
본 발명에서 사용된 “생산능이 향상된”은 모균주에 비해 L-라이신의 생산성이 증가된 것을 의미한다. 상기 모균주는 변이의 대상이 되는 야생형 또는 변이주를 의미하며, 직접 변이의 대상이 되거나 재조합된 벡터 등으로 형질전환되는 대상을 포함한다. 본 발명에 있어서, 모균주는 야생형 코리네박테리움 글루타미쿰 균주 또는 야생형으로부터 변이된 균주일 수 있다.
본 발명의 일 실시예에 따르면, 상기 모균주는 라이신 생합성 경로에 관여하는 시트레이트 합성효소(citrate synthase)의 활성이 약화된 코리네박테리움 글루타미쿰 균주 (국내 출원번호 제10-2021-0050318호) (이하 '코리네박테리움 글루타미쿰 DS2 균주'라 함)일 수 있다.
본 발명의 일 실시예에 따르면, 상기 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주는 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 gapA 유전자의 아미노산 변이를 포함함으로써 L-라이신 생합성에 필요한 NADPH 공급량이 증가되어 모균주에 비해 증가된 L-라이신 생산능을 나타내며, 특히 모균주에 비해 L-라이신 생산량이 5% 이상, 구체적으로는 5 내지 20% 증가되어 균주 배양액 1 ℓ 당 70 g 이상, 구체적으로는 70 ~ 85 g의 L-라이신을 생산할 수 있다.
본 발명의 일 구체예에 따른 코리네박테리움 글루타미쿰 변이주는 모균주에 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 gapA 유전자의 아미노산 서열이 일부 치환된 변이체를 포함하는 재조합 벡터를 통해 구현될 수 있다.
본 발명에서 사용된 “일부”는 아미노산 서열, 염기서열 또는 폴리뉴클레오티드 서열의 전부가 아닌 것을 의미하며, 1 내지 300개, 바람직하게는 1 내지 100개, 보다 바람직하게는 1 내지 50개일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “변이체”는 L-라이신의 생합성에 관여하는 글리세르알데하이드 3-인산 탈수소효소 유전자의 아미노산 서열 내 10 내지 130번째 아미노산 영역 중 하나 이상의 아미노산이 치환된 변이체를 의미한다.
본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소 유전자의 아미노산 서열 내 36번째 및 37번째 아미노산이 치환된 변이체는 서열번호 3의 아미노산 서열 또는 서열번호 4의 염기서열을 가지는 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 글리세르알데하이드 3-인산 탈수소효소 유전자의 아미노산 서열 내 36번째, 37번째 및 100번째 아미노산이 치환된 변이체는 서열번호 5의 아미노산 서열 또는 서열번호 6의 염기서열을 가지는 것일 수 있다.
본 발명에서 사용된 “벡터”는 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 발현 벡터로서 유전자 삽입물이 발현되도록 작동 가능하게 연결된(operably linked) 필수적인 조절요소를 포함하는 유전자 제조물을 의미한다. 여기서, “작동 가능하게 연결된”은 발현이 필요한 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결된 것을 의미하고, “조절요소”는 전사를 수행하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 암호화하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 이러한 벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터, 바이러스 벡터 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “재조합 벡터”는 적합한 숙주세포 내로 형질전환된 후, 숙주세포의 게놈과 무관하게 복제 가능하거나 게놈 그 자체에 봉합될 수 있다. 이때, 상기 "적합한 숙주세포"는 벡터가 복제 가능한 것으로서 복제가 개시되는 특정 염기서열인 복제 원점을 포함할 수 있다.
상기 형질전환은 숙주세포에 따라 적합한 벡터 도입 기술이 선택되어 목적하는 유전자를 숙주세포 내에서 발현시킬 수 있다. 예를 들면, 벡터 도입은 전기천공법(electroporation), 열 충격(heat-shock), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 초산 리튬-DMSO법, 또는 이들의 조합에 의해 수행될 수 있다. 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함될 수 있다.
상기 숙주세포는 생체내 또는 시험관내에서 본 발명의 재조합 벡터 또는 폴리뉴클레오티드로 형질감염, 형질전환, 또는 감염된 세포를 포함한다. 본 발명의 재조합 벡터를 포함하는 숙주 세포는 재조합 숙주 세포, 재조합 세포 또는 재조합 미생물이다.
또한, 본 발명에 의한 재조합 벡터는 선택 마커(selection marker)를 포함할 수 있는데, 상기 선택 마커는 벡터로 형질전환된 형질전환체 (숙주세포)를 선별하기 위한 것으로서 상기 선택 마커가 처리된 배지에서 선택 마커를 발현하는 세포만 생존할 수 있기 때문에, 형질전환 된 세포의 선별이 가능하다. 상기 선택 마커는 대표적인 예로 카나마이신, 스트렙토마이신, 클로람페니콜 등이 있으나, 이에 한정되는 것은 아니다.
본 발명의 형질전환용 재조합 벡터 내에 삽입된 유전자들은 상동성 재조합 교차로 인하여 코리네박테리움 속 미생물과 같은 숙주세포 내로 치환될 수 있다.
본 발명의 일 구체예에 따르면, 상기 숙주세포는 코리네박테리움속 균주일 수 있으며, 예를 들면 코리네박테리움 글루타미쿰 DS2 균주일 수 있다.
또한, 본 발명의 다른 일 양상은 a) 상기 코리네박테리움 글루타미쿰 변이주를 배지에서 배양하는 단계; 및 b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-라이신을 회수하는 단계를 포함하는 L-라이신의 생산 방법을 제공한다.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 코리네박테리움 속 균주에 대한 배양 배지는 공지된 문헌 (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981)을 참조할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배지에 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다. 사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나 이에 한정되는 것은 아니다. 사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20℃ 내지 45℃, 예를 들면 25℃ 내지 40℃일 수 있다. 배양기간은 유용물질이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 10 내지 160 시간일 수 있다.
본 발명의 일 구체예에 따르면, 상기 배양된 변이주 및 변이주가 배양된 배지에서 L-라이신을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 L-라이신을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.
본 발명의 일 구체예에 따르면, 라이신을 회수하는 단계는 배양 배지를 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-라이신을 회수하는 단계는 L-라이신을 정제하는 공정을 포함할 수 있다.
본 발명에 따른 코리네박테리움 글루타미쿰 변이주는 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자의 아미노산 변이가 유도되어 효소 활성의 개선을 통해 L-라이신의 생산 수율이 향상될 수 있다.
도 1은 본 발명의 일 실시예에 따라 아미노산 서열 중 36번째 아미노산을 류신에서 세린으로, 37번째 아미노산을 트레오닌에서 라이신으로 치환한 gapA 유전자를 포함하는 DS2-gapA-Pm1 벡터의 구조를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따라 아미노산 서열 중 36번째 아미노산을 류신에서 세린으로, 37번째 아미노산을 트레오닌에서 라이신으로, 100번째 아미노산을 페닐알라닌에서 발린으로 치환한 gapA 유전자를 포함하는 DS2-gapA-Pm2 벡터의 구조를 나타낸 것이다.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 코리네박테리움 글루타미쿰 변이주의 제조
글리세르알데하이드 3-인산 탈수소효소의 활성이 개선된 코리네박테리움 글루타미쿰 변이주를 제조하기 위해 모균주로서 코리네박테리움 글루타미쿰 DS2 균주 및 E. coli DH5a (HIT Competent cells™, Cat No. RH618)를 사용하였다.
상기 코리네박테리움 글루타미쿰 DS2 균주는 증류수 1 L에 글루코오스 5 g, NaCl 2.5 g, 효모 추출물 5.0 g, 유레아(urea) 1.0 g, 폴리펩톤 10.0 g 및 비프(beef) 추출물 5.0 g 조성의 CM-broth 배지 (pH 6.8)에서 30℃의 온도로 배양하였다.
상기 E. coli DH5a는 증류수 1 L에 트립톤 10.0 g, NaCl 10.0 g 및 효모 추출물 5.0 g 조성의 LB 배지 상에서 37℃의 온도로 배양하였다.
항생제 카나마이신(kanamycin) 및 스트렙토마이신(streptomycine)은 시그마(Sigma)사의 제품을 사용하였다.
DNA 시퀀싱 분석은 마크로젠(주)에 의뢰하여 분석하였다.
1-1. 재조합 벡터의 제작
라이신 생합성 과정에서 필요한 NADPH 공급을 확대하여 L-라이신 생산성을 증가시키기 위해 NADH 대신 NADPH를 생산하도록 글리세르알데하이드 3-인산 탈수소효소의 활성을 개선시켰다. 본 실시예에서 이용한 방법은 글리세르알데하이드 3-인산 탈수소효소를 암호화하고 있는 gapA 유전자에 특이적 변이를 유발하였다. gapA 유전자의 아미노산 서열 중 36번째 아미노산을 류신에서 세린으로, 37번째 아미노산을 트레오닌에서 라이신으로 치환하였고, 코리네박테리움 글루타미쿰 게놈 상에서 gapA 유전자 36번째 및 37번째 아미노산을 포함한 부분을 중심으로 좌측암 442 bp 부분과 우측암 552 bp 부분을 PCR로 증폭하여, 오버랩 PCR(overlap PCR) 방법으로 연결한 후 재조합 벡터인 pCGI (문헌 [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] 참조)에 클로닝하였다. 상기 플라스미드를 DS2-gapA-Pm1라고 명명하였다 (도 1 참조). 상기 플라스미드를 제작하기 위하여 각각의 유전자 단편을 증폭하는데 하기 표 1의 프라이머를 사용하였다.
프라이머(primer) 명칭 및 서열 (5'-3') 서열번호
gapA 좌측상동암
증폭 프라이머		 gapA_Pm1_LA_F1 agtgcgaacgatttcaggt 7
gapA_Pm1_LA_F2 gaccatgattacgccagtgcgaacgatttcaggt 8
gapA_Pm1_LA_R1 ggagtcgttgactgcaacta 9
gapA_Pm1_LA_R2 actgcaactacctcgagatc 10
gapA우측상동암
증폭 프라이머		 gapA_Pm1_RA_F1 aaggacaacaagaccctttc 11
gapA_Pm1_RA_F2 caacgactccaaggacaacaagaccctttc 12
gapA_Pm1_RA_R1 aaccagagcaacagccttag 13
gapA_Pm1_RA_R2 acagccttagctgcaccggt 14
이상의 프라이머를 이용하여 아래의 조건 하에 PCR을 수행하였다. Thermocycler (TP600, TAKARA BIO Inc., 일본)를 이용하여 각각의 데옥시뉴클레오티드 트리포스페이트 (dATP, dCTP, dGTP, dTTP) 100 μM가 첨가된 반응액에 올리고뉴클레오티드 1 pM, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA 10 ng을 주형(template)으로 이용하여, pfu-X DNA 폴리머라제 혼합물 (Solgent) 1 유닛의 존재 하에서 25 ~ 30 주기(cycle)를 수행하였다. PCR 수행 조건은 (i) 변성(denaturation) 단계: 94℃에서 30초, (ii) 결합(annealing) 단계: 58℃에서 30초, 및 (iii) 확장(extension) 단계: 72℃에서 1 ~ 2분 (1 kb 당 2분의 중합시간 부여)의 조건에서 실시하였다.
이와 같이 제조된 유전자 단편을 self-assembly cloning을 이용하여, pCGI 벡터에 클로닝하였다. 상기 벡터를 E. coli DH5a에 형질전환시키고, 50 ㎍/㎖의 카나마이신을 함유하는 LB-한천 플레이트 상에 도말하여, 37℃에서 24시간 배양하였다. 최종 형성되는 콜로니를 분리하여 삽입물(insert)이 정확히 벡터에 존재하는지 확인한 후, 이 벡터를 분리하여 코리네박테리움 글루타미쿰 균주의 재조합에 사용하였다.
상기 방법에서 공통적으로 진행된 과정으로서, 해당 유전자들의 증폭은 코리네박테리움 글루타미쿰 ATCC 13032의 genomic DNA로부터 PCR 방법으로 증폭하여 전략에 따라 self-assembled cloning 방법으로 pCGI 벡터에 삽입하여 E. coli DH5a에서 선별하였다. 염색체의 유전자 염기 치환(Chromosomal base substitution)은 각각 단편의 유전자를 개별 증폭하여 오버랩 PCR로 목적 DNA 단편을 제조하였다. 유전자 조작 시 PCR 증폭 효소로는 Ex Taq 중합효소 (Takara), Pfu 중합효소 (Solgent)를 이용하였고, 각종 제한효소 및 DNA modifying 효소는 NEB 제품을 사용하였으며, 공급된 버퍼 및 프로토콜에 따라 사용하였다.
1-2. 변이주의 제조
상기 DS2-gapA-Pm1을 이용하여 변이 균주인 DS2-1 균주를 제조하였다. 상기 벡터의 최종 농도가 1 ㎍/㎕ 이상 되도록 준비하여 코리네박테리움 글루타미쿰 DS2 균주에 전기천공법 (문헌 [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347] 참조)을 사용하여 1차 재조합을 유도하였다. 이때, 전기 천공한 균주를 카나마이신이 20 ㎍/㎕ 포함되는 CM-한천 플레이트에 도말하여 콜로니를 분리한 후 게놈상의 유도한 위치에 적절히 삽입되었는지 PCR 및 염기서열 분석을 통해 확인하였다. 이렇게 분리된 균주를 다시 2차 재조합을 유도하기 위하여 스트렙토마이신을 함유한 CM-한천 액체배지에 접종하고, 하룻밤 이상 배양하여 동일 농도의 스트렙토마이신을 함유한 한천배지에 도말하여 콜로니를 분리하였다. 최종 분리한 콜로니 중에서 카나마이신에 대한 내성 여부를 확인한 후, 항생제 내성이 없는 균주들 중 gapA 유전자에 변이가 도입되었는지 염기서열 분석을 통해 확인하였다 (문헌 [Schafer et al., Gene 145 (1994) 69-73] 참조). 최종적으로 변이 gapA 유전자가 도입된 코리네박테리움 글루타미쿰 변이주 (DS2-1)를 획득하였다.
실시예 2. 코리네박테리움 글루타미쿰 변이주의 제조
라이신 생합성 과정에서 필요한 NADPH 공급을 확대하여 L-라이신 생산성을 증가시키기 위해 NADH 대신 NADPH를 생산하도록 글리세르알데하이드 3-인산 탈수소효소의 활성을 개선시켰다. 본 실시예에서 이용한 방법은 글리세르알데하이드 3-인산 탈수소효소를 암호화하고 있는 gapA 유전자에 특이적 변이를 유발하였다. gapA 유전자의 아미노산 서열 중 36번째 아미노산을 류신에서 세린으로, 37번째 아미노산을 트레오닌에서 라이신으로, 100번째 아미노산을 페닐알라닌에서 발린으로 치환하였고, 코리네박테리움 글루타미쿰 게놈 상에서 gapA 유전자 36번째 및 37번째 및 100번째 아미노산을 포함한 부분을 중심으로 좌측암 442 bp 부분과 우측암 360 bp 부분을 PCR로 증폭하여, 오버랩 PCR(overlap PCR) 방법으로 연결한 후 재조합 벡터인 pCGI (문헌 [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] 참조)에 클로닝하였다. 상기 플라스미드를 DS2-gapA-Pm2라고 명명하였다 (도 2 참조). 상기 플라스미드를 제작하기 위하여 각각의 유전자 단편을 증폭하는데 하기 표 2의 프라이머를 사용하였다.
프라이머(primer) 명칭 및 서열 (5'-3') 서열번호
gapA 좌측상동암
증폭 프라이머		 gapA_Pm1_LA_F1 agtgcgaacgatttcaggt 7
gapA_Pm1_LA_F2 gaccatgattacgccagtgcgaacgatttcaggt 8
gapA_Pm1_LA_R1 ggagtcgttgactgcaacta 9
gapA_Pm1_LA_R2 actgcaactacctcgagatc 10
gapA우측상동암
증폭 프라이머		 gapA_Pm2_RA_F1 ttcaccgatgcaaacgcgg 15
gapA_Pm2_RA_F2 caccggcgtcttcaccgatgcaaacgcgg 16
gapA_Pm1_RA_R1 aaccagagcaacagccttag 13
gapA_Pm1_RA_R2 acagccttagctgcaccggt 14
이후에서는 실시예 1과 동일한 방법을 수행하여, 상기 DS2-gapA-Pm2를 이용하여 변이 균주인 DS2-2 균주를 제조 및 획득하였다.
실험예 1. 모균주와 변이주의 L-라이신 생산성 비교
모균주 코리네박테리움 글루타미쿰 DS2 균주와 실시예 1 및 2에서 제조된 라이신 생산 변이주인 DS2-1 및 DS2-2 균주의 L-라이신 생산성을 비교하였다.
하기 표 3과 같은 조성을 갖는 라이신 배지 10 ml를 함유한 100 ml 플라스크에 각각의 균주를 각각 접종하고, 30℃에서 28시간, 180 rpm의 조건으로 진탕 배양하였다. 배양 종료 후 라이신 분석은 HPLC (Shimazu, 일본)로 L-라이신의 생산량을 측정하였고, 그 결과를 하기 표 4에 나타내었다.
조성 함량 (증류수 1 L 기준)
Glucose 100 g
Ammonium sulfate 55 g
KH2PO4 1.1 g
MgSO4ㆍH2O 1.2 g
MnSO4ㆍH2O 180 mg
FeSO4ㆍH2O 180 mg
ThiamineㆍHCl 9 mg
Biotin 1.8 mg
CaCO3 5%
pH 7.0
균주 OD610 L-라이신 (g/L) 단위 균체 당 L-라이신 생산량 (g/gDCW)
모균주 (DS2) 23.0 69.7 7.2
변이주 (DS2-1) 22.5 76.3 8.1
변이주 (DS2-2) 22.4 75.2 8.0
상기 표 4에 나타낸 바와 같이, 코리네박테리움 글루타미쿰 변이주 DS2-1 및 DS2-2는 라이신 생합성 경로의 강화를 위해 gapA 유전자의 아미노산 서열의 특정 위치 (36번째 및 37번째 아미노산, 또는 36번째, 37번째 및 100번째 아미노산)가 최적의 아미노산 잔기로 치환됨으로써 모균주 코리네박테리움 글루타미쿰 DS2 균주에 비해 L-라이신의 생산성이 각각 약 12.5% 및 11.1% 증가한 것으로 확인되었다. 이러한 결과를 통해, gapA 유전자 변이가 글리세르알데하이드 3-인산 탈수소효소의 활성을 개선함으로써 균주의 L-라이신 생산능을 향상시킨다는 것을 알 수 있었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (5)

  1. 글리세르알데하이드 3-인산 탈수소효소(Glyceraldehyde 3-phosphate dehydrogenase)의 활성이 개선되어 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 변이주.
  2. 청구항 1에 있어서,
    상기 글리세르알데하이드 3-인산 탈수소효소의 활성 개선은 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자에 위치 특이적 변이를 유발하는 것인 코리네박테리움 글루타미쿰 변이주.
  3. 청구항 1에 있어서,
    상기 글리세르알데하이드 3-인산 탈수소효소의 활성 개선은 글리세르알데하이드 3-인산 탈수소효소를 암호화하는 유전자의 아미노선 서열 내 36번째, 37번째 및 100번째 아미노산 중 하나 이상의 아미노산이 치환된 것인 코리네박테리움 글루타미쿰 변이주.
  4. 청구항 1에 있어서,
    상기 변이주는 서열번호 3 또는 5로 표시되는 아미노산 서열을 포함하는 것인 코리네박테리움 글루타미쿰 변이주.
  5. a) 청구항 1 내지 4 중 어느 한 항의 변이주를 배지에서 배양하는 단계; 및
    b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-라이신을 회수하는 단계를 포함하는 L-라이신의 생산 방법.
PCT/KR2022/011180 2021-12-06 2022-07-29 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법 WO2023106543A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210173249A KR20230084993A (ko) 2021-12-06 2021-12-06 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR10-2021-0173249 2021-12-06

Publications (1)

Publication Number Publication Date
WO2023106543A1 true WO2023106543A1 (ko) 2023-06-15

Family

ID=86570298

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/011180 WO2023106543A1 (ko) 2021-12-06 2022-07-29 L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Country Status (3)

Country Link
KR (1) KR20230084993A (ko)
CN (1) CN116218749A (ko)
WO (1) WO2023106543A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020082403A1 (en) * 1999-10-05 2002-06-27 Bettina Mockel Nucleotide sequences which code for the eno gene
KR20060078687A (ko) * 2004-12-30 2006-07-05 씨제이 주식회사 외래의 ｎａｄｐ 의존적 글리세르알데히드-3-포스페이트디히드로게나제 유전자를 포함하는 에세리키아 종 또는코리네박리움 종 미생물 및 그를 이용하여 ｌ-라이신을생산하는 방법
KR20120130579A (ko) * 2011-05-23 2012-12-03 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 제조방법
KR101498630B1 (ko) * 2013-10-28 2015-03-04 씨제이제일제당 주식회사 Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
KR20200010285A (ko) * 2017-05-19 2020-01-30 지머젠 인코포레이티드 증가된 nadph를 유도하는 생합성 경로의 게놈 공학

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100838038B1 (ko) 2006-12-29 2008-06-12 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
US20200239897A1 (en) 2017-06-07 2020-07-30 Zymergen Inc. Promoters from corynebacterium glutamicum and uses thereof in regulating ancillary gene expression
KR102139806B1 (ko) 2020-02-13 2020-07-30 씨제이제일제당 (주) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020082403A1 (en) * 1999-10-05 2002-06-27 Bettina Mockel Nucleotide sequences which code for the eno gene
KR20060078687A (ko) * 2004-12-30 2006-07-05 씨제이 주식회사 외래의 ｎａｄｐ 의존적 글리세르알데히드-3-포스페이트디히드로게나제 유전자를 포함하는 에세리키아 종 또는코리네박리움 종 미생물 및 그를 이용하여 ｌ-라이신을생산하는 방법
KR20120130579A (ko) * 2011-05-23 2012-12-03 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 제조방법
KR101498630B1 (ko) * 2013-10-28 2015-03-04 씨제이제일제당 주식회사 Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
KR20200010285A (ko) * 2017-05-19 2020-01-30 지머젠 인코포레이티드 증가된 nadph를 유도하는 생합성 경로의 게놈 공학

Also Published As

Publication number Publication date
KR20230084993A (ko) 2023-06-13
CN116218749A (zh) 2023-06-06

Similar Documents

Publication Publication Date Title
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022050527A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023106543A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022050524A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023063547A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024019215A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024019216A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2022231055A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231056A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023136422A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
WO2022196919A1 (ko) L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법
WO2023136421A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
KR20220126610A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220148694A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220126609A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220149376A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220149379A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220030866A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22904380

Country of ref document: EP

Kind code of ref document: A1