WO2010045509A2 - Modulation of factor 11 expression - Google Patents

Modulation of factor 11 expression Download PDF

Info

Publication number
WO2010045509A2
WO2010045509A2 PCT/US2009/060922 US2009060922W WO2010045509A2 WO 2010045509 A2 WO2010045509 A2 WO 2010045509A2 US 2009060922 W US2009060922 W US 2009060922W WO 2010045509 A2 WO2010045509 A2 WO 2010045509A2
Authority
WO
WIPO (PCT)
Prior art keywords
factor
compound
isis
modified oligonucleotide
antisense
Prior art date
Application number
PCT/US2009/060922
Other languages
English (en)
French (fr)
Other versions
WO2010045509A3 (en
Inventor
Susan M. Freier
Brett P. Monia
Hong Zhang
Chenguang Zhao
Jeffrey R. Crosby
Andrew M. Siwkowski
Original Assignee
Isis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020177023938A priority Critical patent/KR101979134B1/ko
Priority to SI200931777T priority patent/SI2379084T1/en
Priority to ES09821293.9T priority patent/ES2657679T3/es
Priority to LTEP09821293.9T priority patent/LT2379084T/lt
Priority to PL09821293T priority patent/PL2379084T3/pl
Priority to DK09821293.9T priority patent/DK2379084T3/en
Priority to KR1020117010915A priority patent/KR101773551B1/ko
Priority to CN200980150276.5A priority patent/CN102245186B/zh
Application filed by Isis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Priority to AU2009305636A priority patent/AU2009305636A1/en
Priority to RU2011119479/10A priority patent/RU2535964C2/ru
Priority to JP2011532267A priority patent/JP5809058B2/ja
Priority to EP09821293.9A priority patent/EP2379084B1/en
Priority to MX2011004097A priority patent/MX2011004097A/es
Priority to NZ592203A priority patent/NZ592203A/xx
Priority to EP17201814.5A priority patent/EP3335715A3/en
Priority to NO09821293A priority patent/NO2379084T3/no
Priority to BRPI0920263-3A priority patent/BRPI0920263B1/pt
Priority to CA2740785A priority patent/CA2740785C/en
Priority to CA2758927A priority patent/CA2758927A1/en
Priority to JP2012505942A priority patent/JP2012524068A/ja
Priority to NZ595891A priority patent/NZ595891A/xx
Priority to RU2011146158/15A priority patent/RU2011146158A/ru
Priority to CN2010800267898A priority patent/CN102458480A/zh
Priority to PCT/US2010/031311 priority patent/WO2010121074A1/en
Priority to AU2010236286A priority patent/AU2010236286B2/en
Priority to BRPI1015236A priority patent/BRPI1015236A2/pt
Priority to MX2011010930A priority patent/MX2011010930A/es
Priority to EP10765215.8A priority patent/EP2419146A4/en
Priority to US13/262,904 priority patent/US20120083522A1/en
Publication of WO2010045509A2 publication Critical patent/WO2010045509A2/en
Publication of WO2010045509A3 publication Critical patent/WO2010045509A3/en
Priority to IL212267A priority patent/IL212267A/en
Priority to IL215678A priority patent/IL215678A0/en
Priority to IL244116A priority patent/IL244116B/en
Priority to AU2017202862A priority patent/AU2017202862B2/en
Priority to HRP20171969TT priority patent/HRP20171969T1/hr
Priority to CY20181100176T priority patent/CY1119909T1/el

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A61K31/366—Lactones having six-membered rings, e.g. delta-lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/726—Glycosaminoglycans, i.e. mucopolysaccharides
    • A61K31/727—Heparin; Heparan
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/737—Sulfated polysaccharides, e.g. chondroitin sulfate, dermatan sulfate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21027—Coagulation factor XIa (3.4.21.27)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • coagulation comprises a cascade of reactions culminating in the conversion of soluble fibrinogen to an insoluble fibrin gel.
  • the steps of the cascade involve the conversion of an inactive zymogen to an activated enzyme.
  • the active enzyme then catalyzes the next step in the cascade.
  • the coagulation cascade may be initiated through two branches, the tissue factor pathway (also “extrinsic pathway”), which is the primary pathway, and the contact activation pathway (also “intrinsic pathway”).
  • the tissue factor pathway is initiated by the cell surface receptor tissue factor (TF, also referred to as factor III), which is expressed constitutively by extravascular cells (pericytes, cardiomyocytes, smooth muscle cells, and keratinocytes) and expressed by vascular monocytes and endothelial cells upon induction by inflammatory cytokines or endotoxin. (Drake et al., Am J Pathol 1989, 134:1087-1097).
  • TF is the high affinity cellular receptor for coagulation factor Vila, a serine protease.
  • Activated protein C is a serine protease that degrades cofactors Va and Villa. Protein C is activated by thrombin with thrombomodulin, and requires coenzyme Protein S to function.
  • Antithrombin is a serine protease inhibitor (serpin) that inhibits serine proteases: thrombin, Xa, XIIa, XIa and IXa. Tissue factor pathway inhibitor inhibits the action of Xa and the TF-VIIa complex. (Schwartz AL et al., Trends Cardiovasc Med. 1997; 7:234 -239.)
  • Thrombosis is the pathological development of blood clots, and an embolism occurs when a blood clot migrates to another part of the body and interferes with organ function. Thromboembolism may cause conditions such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Significantly, thromboembolism is a major cause of morbidity affecting over 2 million Americans every year. (Adcock et al. American Journal of Clinical Pathology. 1997; 108:434-49).
  • Warfarin is typically used to treat patients suffering from atrial fibrillation.
  • the drug interacts with vitamin K -dependent coagulation factors which include factors II, VII, IX and X.
  • Anticoagulant proteins C and S are also inhibited by warfarin.
  • Drug therapy using warfarin is further complicated by the fact that warfarin interacts with other medications, including drugs used to treat atrial fibrillation, such as amiodarone. Because therapy with warfarin is difficult to predict, patients must be carefully monitored in order to detect any signs of anomalous bleeding.
  • heparin-induced thrombocytopenia HIT
  • UHF unfractioned heparin
  • Factor 11 mRNA and protein modulate expression of Factor 11 mRNA and protein.
  • Factor 11 specific inhibitors are nucleic acids, proteins, or small molecules.
  • modulation can occur in a cell or tissue.
  • the cell or tissue is in an animal.
  • the animal is a human.
  • Factor 11 mRNA levels are reduced, hi certain embodiments, Factor 11 protein levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.
  • Such diseases, disorders, and conditions are thromboembolic complications.
  • Such thromboembolic complications include the categories of thrombosis, embolism, and thromboembolism.
  • such thromboembolic complications include deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common.
  • Certain risk factors and causes for development of a thromboembolic complication include immobility, surgery (particularly orthopedic surgery), malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic complication, chronic inflammatory disease, and inherited or acquired prothrombotic clotting disorders.
  • Certain outcomes associated with development of a thromboembolic complication include decreased blood flow through an affected vessel, death of tissue, and death.
  • methods of treatment include administering a Factor 11 specific inhibitor to an individual in need thereof.
  • 2'-O-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-O-methoxyethyl modified sugar is a modified sugar.
  • 2'-O-methoxyethyl nucleotide means a nucleotide comprising a 2'-O-methoxyethyl modified sugar moiety.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to Factor 11 is an active pharmaceutical agent.
  • a Factor 11 nucleic acid or “Factor XI nucleic acid” or “F 11 nucleic acid” or “F XI nucleic acid” means any nucleic acid encoding Factor 11.
  • a Factor 11 nucleic acid includes a DNA sequence encoding Factor 11, an RNA sequence transcribed from DNA encoding Factor 11 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding Factor 11.
  • “Factor 11 mRNA” means an mRNA encoding a Factor 11 protein.
  • Factor 11 specific inhibitor refers to any agent capable of specifically inhibiting the expression of Factor 11 mRNA and/or Factor 11 protein at the molecular level.
  • Factor 11 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of Factor 11 mRNA and/or Factor 11 protein.
  • Factor 11 specific inhibitors may affect other components of the coagulation cascade including downstream components.
  • Factor 11 specific inhibitors may affect other molecular processes in an animal.
  • Factor 11 specific inhibitor antidote means a compound capable of decreasing the effect of a Factor 11 specific inhibitor.
  • a Factor 11 specific inhibitor antidote is selected from a Factor 11 peptide; a Factor 11 antidote oligonucleotide, including a Factor 11 antidote compound complementary to a Factor 11 antisense compound; and any compound or protein that affects the intrinsic or extrinsic coagulation pathway.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap segment” and the external regions may be referred to as "wing segments.”
  • Gap- widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • Identifying an animal at risk for thromboembolic complications means identifying an animal having been diagnosed with a thromboembolic complication or identifying an animal predisposed to develop a thromboembolic complication.
  • Individuals predisposed to develop a thromboembolic complication include those having one or more risk factors for thromboembolic complications including immobility, surgery (particularly orthopedic surgery), malignancy, pregnancy, older age, use of oral contraceptives, and inherited or acquired prothrombotic clotting disorders.
  • identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.
  • Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • Segment effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Target nucleic acid “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Thromboembolic complication means any disease, disorder, or condition involving an embolism caused by a thrombus.
  • diseases, disorders, and conditions include the categories of thrombosis, embolism, and thromboembolism.
  • diseases, disorders, and conditions include deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • “Treat” refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.
  • "Unmodified nucleotide” means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Embodiments of the present invention provide methods, compounds, and compositions for decreasing Factor 11 mRNA and protein expression. Embodiments of the present invention provide methods, compounds, and compositions for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with Factor 11 in an individual in need thereof. Also contemplated are methods and compounds for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with Factor 11.
  • Factor 11 associated diseases, disorders, and conditions include thromboembolic complications such as thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • Factor 11 specific inhibitors are peptides or proteins, such as, but not limited to, alpha 1 protease inhibitors, antithrombin III, Cl inhibitors, and alpha 2 plasmin inhibitors as described in J Clin Invest 1982, 69:844-852; alpha 1 antitrypsin (alpha IAT) as described in Thromb Res 1987, 48:145-151; Factor 11 peptide inhibitors as described in USPPN 2008/021998 and Blood 1998, 92:4198-206; MAP4-RGKWC as described in Thromb Res 2001, 104:451-465; beta 2 GPI as described in Proc Natl Acad Sci 2004, 101:3939-44; Lentinus proteinase inhibitor as described in EurJBiochem 1999, 262:915-923; protease nexin-2/amyloid beta protein precursor Kunitz domain inhibitor (APPI) and antithrombin (AT) as described in J Biol Chem 2004, 279:29
  • Factor 11 specific inhibitors are small molecules, such as, but not limited to, diisopropyl fluorophosphates (DFP); the small molecule inhibitors as described in Examples 1-7 of USPPN 2004/0180855; and p-aminobenzamidine (pAB) as described in J Biol Chem 2005, 280:23523-30.
  • DFP diisopropyl fluorophosphates
  • pAB p-aminobenzamidine
  • Embodiments of the present invention provide a Factor 11 specific inhibitor, as described herein, for use in treating, preventing, or ameliorating thromboembolic complications such as thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • Embodiments of the present invention provide the use of Factor 11 specific inhibitors as described herein in the manufacture of a medicament for treating, ameliorating, or preventing a thromboembolic complication such as thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • a thromboembolic complication such as thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • Embodiments of the present invention provide a Factor 11 specific inhibitor as described herein for use in treating, preventing, or ameliorating a thromboembolic complication as described herein by combination therapy with an additional agent or therapy as described herein.
  • Agents or therapies can be co-administered or administered concomitantly.
  • Embodiments of the present invention provide the use of a Factor 11 specific inhibitor as described herein in the manufacture of a medicament for treating, preventing, or ameliorating a thromboembolic complication as described herein in a patient who is subsequently administered an additional agent or therapy as described herein.
  • NM_000128.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT_022792.17, truncated from 19598000 to 19624000, (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_028066.1 (incorporated herein as SEQ ID NO: 6), exons 1-15 GENBANK Accession No. NWJ)Ol 118167.1 (incorporated herein as SEQ ID NO: 274).
  • the invention provides a compound comprising a modified oligonucleotide.
  • the compound of the invention comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides.
  • the compound of the invention may comprise a modified oligonucleotide comprising a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • the compound of the invention may comprise a modified oligonucleotide comprising a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 656 to 676 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 656 to 676 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 80% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 665 to 687 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 665 to 687 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 50% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 675 to 704 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 675 to 704 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 50% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 677 to 704 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 677 to 704 of SEQ ID NO: 1.
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 678 to 697 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 678 to 697 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 80% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3 and Example 30).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 738 to 759 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 738 to 759 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 60% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 80% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 1062 to 1089 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1062 to 1089 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 70% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 1062 to 1090 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1062 to 1090 of SEQ ID NO : 1.
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 1062 to 1091 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1062 to 1091 of SEQ ID NO: 1.
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 1275 to 1301 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1062 to 1091 of SEQ ID NO: 1.
  • the invention provides a compound comprising a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of nucleobases 1276 to 1301 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise at least 8, at least 10, at least 12, at least 14, at least 16, at least 18 or 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1062 to 1091 of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 80% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • Said modified oligonucleotide may comprise a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may comprise a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NO: 1.
  • Said modified oligonucleotide may achieve at least 70% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • Embodiments of the present invention provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, or 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 242 to 269.
  • the modified oligonucleotide comprises at least 8, at least 10, at least 12, at least 14, at least 16, or at least 18 nucleobases of a nucleobase sequence selected from ISIS Nos: 22, 31, 32, 34, 36 to 38, 40, 41, 43, 51to 53, 55, 56, 59, 60, 64, 66, 71, 73, 75, 96, 98 to 103, 105 to 109, 113 to 117, 119, 124, 127, 129, 171, 172, 174, 176, 178, 179, 181 to 197, 199 to 211, and 213 to 232.
  • the modified oligonucleotide comprises a nucleobase sequence selected from SEQ ID NOs: 22, 31, 32, 34, 36 to 38, 40, 41, 43, 51to 53, 55, 56, 59, 60, 64, 66, 71, 73, 75, 96, 98 to 103, 105 to 109, 113 to 117, 119, 124, 127, 129, 171, 172, 174, 176, 178, 179, 181 to 197, 199 to 211, and 213 to 232.
  • the modified oligonucleotide comprises at least 8, at least 10, at least 12, at least 14, at least 16, or at least 18 nucleobases of a nucleobase sequence selected from ISIS Nos: 22, 31, 34, 37, 40, 43, 51 to 53, 60, 98, 100 to 102, 105 to 109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188 to 193, 195, 196, 199 to 210, and 213 to 232.
  • the modified oligonucleotide comprises a nucleobase sequence selected from SEQ ID NOs: 22, 31, 34, 37, 40, 43, 51 to 53, 60, 98, 100 to 102, 105 to 109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188 to 193, 195, 196, 199 to 210, and 213 to 232.
  • the modified oligonucleotide consists of a nucleobase sequence selected from SEQ ID NOs: 22, 31, 34, 37, 40, 43, 51 to 53, 60, 98, 100 to 102, 105 to 109, 114, 115, 119, 171, 174, 176, 179, 181, 186, 188 to 193, 195, 196, 199 to 210, and 213 to 232.
  • Said modified oligonucleotide may achieve at least 80% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the modified oligonucleotide comprises at least 8, at least 10, at least 12, at least 14, at least 16, or at least 18 nucleobases of a nucleobase sequence selected from ISIS Nos: 31, 37, 100, 105, 179, 190 to 193, 196, 202 to 207, 209, 210, 214 to 219, 221 to 224, 226, 227, 229, and 231.
  • the modified oligonucleotide comprises a nucleobase sequence selected from SEQ ID NOs: 31, 37, 100, 105, 179, 190 to 193, 196, 202 to 207, 209, 210, 214 to 219, 221 to 224, 226, 227, 229, and 231.
  • the modified oligonucleotide consists of a nucleobase sequence selected from SEQ ID NOs: 31, 37, 100, 105, 179, 190 to 193, 196, 202 to 207, 209, 210, 214 to 219, 221 to 224, 226, 227, 229, and 231.
  • Said modified oligonucleotide may achieve at least 90% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 3).
  • the modified oligonucleotide consists of a nucleobase sequence selected from SEQ ID NOs: 34, 52, 53, 114, 115, 190, 213 to 232, 242 to 260, and 262 to 266.
  • Said modified oligonucleotides may achieve at least 70% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 30).
  • the modified oligonucleotide comprises at least 8, at least 10, at least 12, at least 14, at least 16, or at least 18 nucleobases of a nucleobase sequence selected from SEQ ID NOs: 34, 52, 53, 114, 115, 190, 213 to 216, 218 to 226, 243 to 246, 248, 249, 252 to 259, 264, and 265.
  • the modified oligonucleotide comprises a nucleobase sequence selected from SEQ ID NOs: 34, 52, 53, 114, 115, 190, 213 to 216, 218 to 226, 243 to 246, 248, 249, 252 to 259, 264, and 265.
  • the modified oligonucleotide comprises at least 8, at least 10, at least 12, at least 14, at least 16, or at least 18 nucleobases of a nucleobase sequence selected from SEQ ID NOs: 34, 190, 215, 222, 223, 226, 246, and 254. In certain embodiments, the modified oligonucleotide comprises a nucleobase sequence selected from SEQ ID NOs: 34, 190, 215, 222, 223, 226, 246, and 254. In certain embodiments, the modified oligonucleotide consists of a nucleobase sequence selected from SEQ ID NOs: 34, 190, 215, 222, 223, 226, 246, and 254.
  • Said modified oligonucleotides may achieve at least 90% inhibition of human mRNA levels as determined using an RT-PCR assay method, optionally in HepG2 cells (e.g. as described in Example 30).
  • the compound consists of a single-stranded modified oligonucleotide.
  • the modified oligonucleotide consists of 20 linked nucleosides.
  • the nucleobase sequence of the modified oligonucleotide is 100% complementary to a nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 6 or SEQ ID NO: 274.
  • the compound has at least one modified internucleoside linkage.
  • the internucleoside linkage is a phosphorothioate internucleoside linkage.
  • the compound has at least one nucleoside comprising a modified sugar.
  • the at least one modified sugar is a bicyclic sugar.
  • the at least one modified sugar comprises a 2'-O-methoxyethyl.
  • Embodiments of the present invention provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, or 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 241 , SEQ ID NOs: 15 to 269, or SEQ ID NOs: 242 to 269, wherein at least one nucleoside comprises a modified sugar.
  • said at least one at least one modified sugar is a bicyclic sugar.
  • said at least one modified sugar comprises a 2'-O-methoxyethyl group.
  • Embodiments of the present invention provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, or 20 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 241, SEQ ID NOs: 15 to 269, or SEQ ID NOs: 242 to 269, comprising at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces the furanose ring.
  • said at least one tetrahydropyran modified nucleoside has the structure:
  • the compound has at least one nucleoside comprising a modified nucleobase.
  • the modified nucleobase is a 5-methylcytosine.
  • the modified oligonucleotide of the compound comprises:
  • each cytosine in the modified oligonucleotide is a 5-methylcytosine.
  • the modified oligonucleotide of the compound comprises: (i) a gap segment consisting often linked deoxynucleosides; (ii) a 5' wing segment consisting of five linked nucleosides;
  • each cytosine in the modified oligonucleotide is a 5-methylcytosine.
  • Embodiments of the present invention provide a composition comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 241 or a salt thereof and a pharmaceutically acceptable carrier or diluent.
  • Embodiments of the present invention provide a composition comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 269 or a salt thereof and a pharmaceutically acceptable carrier or diluent.
  • Embodiments of the present invention provide a composition comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 241 to 269 or a salt thereof and a pharmaceutically acceptable carrier or diluent.
  • Embodiments of the present invention provide methods comprising administering to an animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 241.
  • Embodiments of the present invention provide methods comprising administering to an animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 15 to 269.
  • Embodiments of the present invention provide methods comprising administering to an animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence selected from among the nucleobase sequences recited in SEQ ID NOs: 241 to 269.
  • the animal is a human.
  • the administering prevents deep vein thrombosis or pulmonary embolism.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • Li a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region, hi the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides, hi certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • the wing-gap- wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides.
  • gapmers of the present invention include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 5-8-5, or 6-8-6.
  • the antisense compound has a "wingmer" motif, having a wing- gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations of the present invention include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • antisense compounds targeted to a Factor 11 nucleic acid possess a 5-10-5 gapmer motif.
  • antisense compounds targeted to a Factor 11 nucleic acid possess a 3-14-3 gapmer motif.
  • antisense compounds targeted to a Factor 11 nucleic acid possess a 2-13-5 gapmer motif.
  • antisense compounds targeted to a Factor 11 nucleic acid possess a 5-8-5 gapmer motif. In certain embodiments, antisense compounds targeted to a Factor 11 nucleic acid possess a
  • a gap-widened antisense oligonucleotide targeted to a Factor 11 nucleic acid has a gap segment of fourteen 2'-deoxyribonucleotides positioned immediately adjacent to and between wing segments of three chemically modified nucleosides.
  • the chemical modification comprises a 2 '-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • a gap-widened antisense oligonucleotide targeted to a Factor 11 nucleic acid has a gap segment of thirteen 2'-deoxyribonucleotides positioned immediately adjacent to and between a 5' wing segment of two chemically modified nucleosides and a 3' wing segment of five chemically modified nucleosides.
  • the chemical modification comprises a 2'-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • Nucleotide sequences that encode Factor 11 include, without limitation, the following: GENBANK Accession No. NM_000128.3, first deposited with GENBANK on March 24, 1999 incorporated herein as SEQ ID NO: 1; NT_022792.17, truncated from 19598000 to 19624000, first deposited with GENBANK on November 29, 2000, and incorporated herein as SEQ ID NO: 2; GENBANK Accession No. NM_028066.1, first deposited with GENBANK on June 2, 2002, incorporated herein as SEQ ID NO: 6; and exons 1-15 GENBANK Accession No.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number indicate a combination of nucleobase sequence and motif.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
  • a prolonged aPTT time can be indicative of inhibition of Factor 11 expression.
  • prolonged aPTT time in conjunction with a normal PT time can be indicative of inhibition of Factor 11 expression.
  • a decreased quantity of Platelet Factor 4 (PF-4) can be indicative of inhibition of Factor 11 expression.
  • reduced formation of thrombus or increased time for thrombus formation can be indicative of inhibition of Factor 11 expression.
  • hybridization occurs between an antisense compound disclosed herein and a Factor 11 nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a Factor 11 nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a Factor 11 nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a Factor 11 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a Factor 11 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a Factor 11 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. MoI. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • antisense compound may be fully complementary to a Factor 11 nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a Factor 11 nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a Factor 11 nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment.
  • antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • Modified Internucleoside Linkages The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to a Factor 11 nucleic acid comprise one or more modified intemucleoside linkages.
  • the modified intemucleoside linkages are phosphorothioate linkages.
  • each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise a chemically modified ribofuranose ring moieties.
  • Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5 '-vinyl group).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to a Factor 11 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • Cell types used for such analyses are available from commerical vendors ⁇ e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA).
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA).
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
  • Antisense inhibition of Factor 11 nucleic acids can be assessed by measuring Factor 11 protein levels. Protein levels of Factor 11 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence- activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human Factor 11 are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of Factor 11 and produce phenotypic changes, such as, prolonged aPTT, prolonged aPTT time in conjunction with a normal PT, decreased quantity of Platelet Factor 4 (PF-4), and reduced formation of thrombus or increased time for thrombus formation. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous.
  • the compounds provided herein demonstrate minimal effect on organ weight. In certain embodiments, the compounds demonstrate less than a 7-fold, 6-fold, 5- fold, 4-fold, 3 -fold, 2-fold or no significant increase in spleen and/or liver weight. In certain embodiments, the compounds provided herein demonstrate minimal effect on liver function. Factors for the evaluation of liver function include ALT levels, AST levels, plasma bilirubin levels and plasma albumin levels. In certain embodiments the compounds provided herein demonstrate less than a 7-fold, less than a 6-fold, less than a 5-fold, less than a 4-fold, less than a 3- fold or less than a 2-fold or no significant increase in ALT or AST. In certain embodiments the compounds provided herein demonstrate less than a 3-fold, less than a 2-fold or no significant increase in plasma bilirubin levels.
  • the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
  • the individual has a thromboembolic complication.
  • the individual is at risk for a blood clotting disorder, including, but not limited to, infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke.
  • the individual has been identified as in need of anticoagulation therapy. Examples of such individuals include, but are not limited to, those undergoing major orthopedic surgery (e.g., hip/knee replacement or hip fracture surgery) and patients in need of chronic treatment, such as those suffering from arterial fibrillation to prevent stroke.
  • the invention provides methods for prophylactically reducing Factor 11 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a Factor 11 nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a Factor 11 nucleic acid is accompanied by monitoring of Factor 11 levels in the serum of an individual, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of a Factor 11 antisense compound increases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In some embodiments, administration of a Factor 11 antisense compound decreases the measure by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to Factor 11 are used for the preparation of a medicament for treating a patient suffering or susceptible to a thromboembolic complication.
  • one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are co- administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a synergistic effect. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation, hi certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include anticoagulant or antiplatelet agents.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include NSAID/Cyclooxygenase inhibitors, such as, aspirin.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include adenosine diphosphate (ADP) receptor inhibitors, such as, clopidogrel (PLAVIX) and ticlopidine (TICLID).
  • ADP adenosine diphosphate
  • PLAVIX clopidogrel
  • TICLID ticlopidine
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include phosphodiesterase inhibitors, such as, cilostazol (PLETAL).
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, glycoprotein IIB/IIIA inhibitors, such as, abciximab (REOPRO), eptifibatide (INTEGRILIN), tirofiban (AGGRASTAT), and defibrotide.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, adenosine reuptake inhibitors, such as, to dipyridamole (PERSANTINE).
  • pharmaceutical agents that may be co-administered with a Factor 11 specific inhibitor of the present invention include, but are not limited to, an additional Factor 11 inhibitor, hi certain embodiments, the anticoagulant or antiplatelet agent is administered prior to administration of a pharmaceutical composition of the present invention. Ln certain embodiments, the anticoagulant or antiplatelet agent is administered following administration of a pharmaceutical composition of the present invention. In certain embodiments the anticoagulant or antiplatelet agent is administered at the same time as a pharmaceutical composition of the present invention. In certain embodiments the dose of a co-administered anticoagulant or antiplatelet agent is the same as the dose that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • the dose of a co-administered anticoagulant or antiplatelet agent is lower than the dose that would be administered if the anticoagulant or antiplatelet agent was administered alone. In certain embodiments the dose of a co-administered anticoagulant or antiplatelet agent is greater than the dose that would be administered if the anticoagulant or antiplatelet agent was administered alone.
  • the co-administration of a second compound enhances the anticoagulant effect of a first compound, such that co-administration of the compounds results in an anticoagulant effect that is greater than the effect of administering the first compound alone.
  • the co-administration results in anticoagulant effects that are additive of the effects of the compounds when administered alone.
  • the co-administration results in anticoagulant effects that are supra-additive of the effects of the compounds when administered alone.
  • the co-administration of a second compound increases antithrombotic activity without increased bleeding risk, hi certain embodiments, the first compound is an antisense compound, hi certain embodiments, the second compound is an antisense compound.
  • an antidote is administered anytime after the administration of a Factor 11 specific inhibitor. In certain embodiments, an antidote is administered anytime after the administration of an antisense oligonucleotide targeting Factor 11. In certain embodiments, the antidote is administered minutes, hours, days, weeks, or months after the administration of an antisense compound targeting Factor 11. In certain embodiments, the antidote is a complementary (e.g. the sense strand) to the antisense compound targeting Factor 11. In certain embodiments, the antidote is a Factor 7, Factor 7a, Factor 11, or Factor 1 Ia protein.
  • the Factor 7, Factor 7a, Factor 11, or Factor 1 Ia protein is a human Factor 7, human Factor 7a, human Factor 11, or human Factor 1 Ia protein.
  • the Factor 7 protein is NOVOSEVEN.
  • the combination of antiplatelet and anticoagulant therapy is used in clinical practice most frequently in patients diagnosed with, for example, thromboembolism, atrial fibrillation, a heart valve disorder, valvular heart disease, stroke, CAD, and in patients having a mechanical valve.
  • the benefit of dual therapy relates to the probable additive effect of suppressing both platelet and coagulation factor activities.
  • the risk of dual therapy is the potential for increased bleeding (Dowd, M. Plenary Sessions/Thrombosis Research 123 (2008)).
  • FXa inhibitors e.g., apixiban and rivaroxaban
  • ADP receptor/P2Y12 inhibitors Thienopyridines such as clopidogrel - also known as PLAVIX
  • NSAIDs e.g., aspirin and naproxen
  • the 3-14-3 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of 14 2'-deoxynucleotides and is flanked on both sides (in the 5' and 3' directions) by wings comprising 3 nucleotides each.
  • the 2-13-5 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of 13 2'-deoxynucleotides.
  • the central gap is flanked on the 5' end with a wing comprising 2 nucleotides and on the 3 ' end with a wing comprising 5 nucleotides.
  • each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2'-MOE modification.
  • All cytidine residues throughout each gapmer are 5-methylcytidines.
  • “Target start site” indicates the 5 '-most nucleotide to which the gapmer is targeted.
  • “Target stop site” indicates the 3 '-most nucleotide to which the gapmer is targeted.
  • Each gapmer listed in Table 5 is targeted to SEQ ID NO: 1 (GENBANK Accession No. NM_000128.3).
  • the 3-14-3 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of 14 2'-deoxynucleotides and is flanked on both sides (in the 5' and 3' directions) by wings comprising 3 nucleotides each.
  • the 2-13-5 gapmers are 20 nucleotides in length, wherein the central gap segment is comprised of 13 2'-deoxynucleotides.
  • the central gap is flanked on the 5' end with a wing comprising 2 nucleotides and on the 3' end with a wing comprising 5 nucleotides.
  • Example 11 In vivo effect of antisense inhibition of murine Factor 11 in the FeCI 3 induced venous thrombosis (VT) model as compared to warfarin
  • mice An additional 6 groups of BALB/c mice were treated with 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, and 5 mg/kg of warfarin, administered intraperioneally daily for 6 days.
  • mice Four hours after the last dose of warfarin, mice were anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine administered by intraperitoneal injection.
  • Two control groups of BALB/c mice were treated with PBS, administered subcutaneously twice a week for 3 weeks.
  • mice in both groups were anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine administered by intraperitoneal injection.
  • Thrombus formation was induced with FeCl 3 in all groups of mice except the first control group.
  • thrombus formation was induced by applying a piece of filter paper (2 x 4 mm) pre-saturated with 10 % FeCl 3 solution directly on the vena cava. After 3 minutes of exposure, the filter paper was removed. Thirty minutes after the filter paper application, a fixed length of the vein containing the thrombus was dissected out for platelet analysis. Liver was collected for RNA analysis.
  • ISIS 404071 and warfarin were evaluated in the tail bleeding assay.
  • Six groups of BALB/c mice were treated with 1.25 mg/kg, 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 mg/kg of ISIS 404071, administered subcutaneously twice a week for 3 weeks.
  • An additional 6 groups of BALB/c mice were treated with 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, and 5 mg/kg of warfarin, administered intraperioneally daily for 6 days.
  • a separate control group of BALB/c mice was treated with PBS, administered subcutaneously twice a week for 3 weeks.
  • mice Two days after the final treatment of ISIS 404071, warfarin, or PBS, mice were placed in a tail bleeding chamber. Mice were anesthetized in the chamber with isoflurane and a small piece of tail (approximately 4mm from the tip) was cut with sterile scissors. The tail cut was immediately placed in a 15 mL Falcon tube filled with approximately 10 mL of 0.9% NaCl buffer solution warmed to 37 0 C. The blood was collected over the course of 40 minutes. The saline filled tubes were weighed both before and after bleeding. The results are provided in Table 22.
  • Treatment PT and aPTT were measured using PPP from mice treated with ISIS 404071 or warfarin.
  • mice Six groups of BALB/c mice were treated with 1.25 mg/kg, 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 mg/kg of ISIS 404071, administered subcutaneously twice a week for 3 weeks.
  • An additional 6 groups of BALB/c mice were treated with 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, and 5 mg/kg of warfarin, administered intraperioneally daily for 6 days.
  • BALB/c mice were treated with PBS, administered subcutaneously mice twice a week for 3 weeks. Two days after the final dose was administered, PPP was collected and PT and aPTT assays were performed.
  • INR values for PT and aPTT are reported as International Normalized Ratio (INR) values.
  • INR values for PT and aPTT were determined by dividing the PT or aPTT value for each experimental group (i.e. 5 mg/kg, 10 mg/kg, 25 mg/kg, and 50 mg/kg treatment with ISIS 404071) by the PT or aPTT for the PBS treated group. This ratio was then raised to the power of the International Sensitivity Index (ISI) of the tissue factor used.
  • ISI International Sensitivity Index
  • PT in warfarin treated mice is significantly prolonged at every dosage.
  • aPTT in warfarin treated mice was prolonged, particularly at dosages of 1 mg/kg and higher.
  • Example 14 In vivo effect of antisense inhibition of murine Factor 11 in the FeCb induced venous thrombosis (VT) model as compared to Apixaban
  • ISIS 404071 and Apixaban were evaluated in the FeCl 3 induced VT mouse model.
  • Six groups of BALB/c mice were treated with 1.25 mg/kg, 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 mg/kg of ISIS 404071 , administered subcutaneously twice a week for 3 weeks.
  • Two days after receiving the last dose of ISIS 404071 mice were anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine administered by intraperitoneal injection.
  • BALB/c mice were treated with 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, and 5 mg/kg of Apixaban, administered subcutaneously one time. Twenty minutes after receiving Apixaban, mice were anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine administered by intraperitoneal injection. Two control groups of BALB/c mice were treated with PBS, administered subcutaneously twice a week for 3 weeks. Two days after the last dose of PBS, mice in both groups were anesthetized with 150 mg/kg ketamine mixed with 10 mg/kg xylazine administered by intraperitoneal injection. Thrombus formation was induced with FeCl 3 in all of the mice except the first control group.
  • thrombus formation was induced by applying a piece of filter paper (2 x 4 mm) pre-saturated with 10 % FeCl 3 solution directly on the vena cava. After 3 minutes of exposure, the filter paper was removed. Thirty minutes after the filter paper application, a fixed length of the vein containing the thrombus was dissected out for platelet analysis. Liver was collected for RNA analysis.
  • PF-4 platelet factor-4
  • Table 25 Treatment with ISIS 404071 resulted in reduction of PF-4 in comparison to the PBS control. Treatment with Apixaban also resulted in reduction of PF-4, in comparison to the PBS control. Results are presented as a percentage of PF-4 in ISIS 404071 or Apixaban treated mice, as compared to the two PBS-treated control groups.
  • Example 15 In vivo effect of antisense inhibition of murine Factor 11 compared to Apixaban in the tail bleeding assay
  • ISIS 404071 and Apixaban were evaluated in the tail bleeding model.
  • Six groups of BALB/c mice were treated with 1.25 mg/kg, 2.5 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, or 40 mg/kg of ISIS 404071, administered subcutaneously twice a week for 3 weeks.
  • An additional 6 groups of BALB/c mice were treated with 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, and 5 mg/kg of Apixaban, administered in a single subcutaneous dose.
  • a separate control group of BALB/c mice was treated with PBS, administered subcutaneously twice a week for 3 weeks.
  • mice Two days after the final treatment of ISIS 404071, Apixaban, or PBS, mice were placed in a tail bleeding chamber. Mice were anesthetized in the chamber and a small piece of tail (approximately 4 mm from the tip) was cut with sterile scissors. The cut tail was immediately placed in a 15 mL Falcon tube filled with approximately 10 mL of 0.9% NaCl buffer solution warmed to 37 C. The blood was collected over the course of 40 minutes. The saline filled tubes were weighed before and after bleeding.
  • Example 16 Ex vivo effect of antisense inhibition of murine Factor 11 in combination with LOVENOX
  • mice Three groups of BALB/c mice were treated with 10 mg/kg, 20 mg/kg, or 40 mg/kg of ISIS 404071, administered subcutaneously twice a week for 3 weeks.
  • a control mouse group was treated with PBS, administered twice a week for 3 weeks.
  • Five days after the last dose the mice were sacrificed and plasma was collected.
  • the low-molecular-weight (LMW) heparin, LOVENOX was administered to the plasma ex vivo at varying concentrations of O ⁇ g/ml, 2.5 ⁇ g/ml, 5.0 ⁇ g/ml, and 7.5 ⁇ g/ml.
  • PT and aPTT were measured 20 minutes after LOVENOX was administered.
  • treatment with LOVENOX increases PT in a dose-dependent manner.
  • Treatment with ISIS 404071 does not significantly increase PT.
  • PT is not significantly affected by treatment with ISIS 404071.
  • treatment with LOVENOX increases aPTT in a dose-dependent manner.
  • treatment with ISIS 404071 also increases aPTT in a dose-dependent manner.
  • mice The combination of ISIS 404071 and LOVENOX were evaluated in the FeCl 3 induced VT mouse model.
  • Four groups of BALB/c mice were treated with 15 mg/kg, 30 mg/kg, 45 mg/kg, or 60 mg/kg of LOVENOX, administered subcutaneously once daily for 3 days.
  • An additional 4 groups of BALB/c mice were treated with 20 mg/kg of ISIS 404071, administered subcutaneously twice weekly for 3 weeks.
  • mice were treated with 15 mg/kg, 30 mg/kg, 45 mg/kg, or 60 mg/kg of LOVENOX, administered subcutaneously once daily for 3 days.
  • Two control groups of BALB/c mice were treated with PBS, administered subcutaneously twice a week for 3 weeks. Thrombus formation was induced with FeCl 3 in all of the mice except the first control group. All mice were anesthetized with 150 mg/kg of ketamine mixed with 10 mg/kg of xylazine administered by intraperitoneal injection.
  • thrombus formation was induced by applying a piece of filter paper (2 x 4 mm) pre-saturated with 10 % FeCl 3 solution directly on the vena cava. After 3 minutes of exposure, the filter paper was removed. Thirty minutes after the filter paper application, a fixed length of the vein containing the thrombus was dissected out for platelet analysis. Quantification of Platelet Composition
  • Example 18 In vivo effect of antisense inhibition of murine Factor 11 in combination with LOVENOX on bleeding
  • ISIS 404071 was administered subcutaneously at a dosage of 20 mg/kg twice a week for 3 weeks to 4 groups of BALB/c mice, and LOVENOX was administered subcutaneously at varying dosages of 15 mg/kg, 30 mg/kg, 45 mg/kg, and 60 mg/kg once daily on the last three days of ISIS 404071 treatment.
  • ISIS 404071 was administered subcutaneously to BALB/c mice at a dosage of 20 mg/kg twice a week for 3 weeks.
  • PBS was administered subcutaneously twice a week for three weeks to BALB/c mice, as a control.
  • mice Two days after receiving their final treatment, mice were placed in a tail bleeding chamber. Mice were anesthetized in the chamber with isoflurane and a small piece of tail (approximately 4 mm from the tip) was cut with sterile scissors. The cut tail was immediately placed in a 15 mL Falcon tube filled with approximately 10 mL of 0.9% NaCl buffer solution warmed to 37 °C. The blood was collected over the course of 40 minutes. The saline filled tubes were weighed both before and after bleeding.
  • Example 19 In vivo effect of antisense inhibition of murine Factor 11 in combination with LOVENOX on PT and aPTT
  • PT and aPTT were measured using PPP from mice treated with ISIS 404071 in combination with LOVENOX.
  • ISIS 404071 was administered subcutaneously to BALB/c mice at a dosage of 25 mg/kg twice a week for 3 weeks. Plasma was collected from these mice 5 days after receiving the last dose of ISIS 404071.
  • LOVENOX was administered subcutaneously to BALB/c mice at a dosage of 20 mg/kg once daily for three days. Plasma was collected from these mice 4 hours after receiving the last dose of LOVENOX.
  • ISIS 404071 was administered subcutaneously to BALB/c mice at a dosage of 20 mg/kg twice a week for 3 weeks, and 2 days after receiving the last dose of ISIS 404071, LOVENOX was administered subcutaneously at a dosage of 20 mg/kg once daily. Plasma was collected from these mice 4 hours after the last dose of LOVENOX.
  • PBS was administered subcutaneously twice a week for three weeks, as a control. Plasma was collected from these mice 5 days after the last dose.
  • PT and aPTT values provided in Table 31 are reported as International Normalized Ratio (INR) values.
  • INR International Normalized Ratio
  • Example 20 In vivo effect of antisense inhibition of murine Factor 11 in combination with Apixaban on PT and aPTT
  • PT and aPTT were measured using PPP from mice treated with ISIS 404071 in combination with Apixaban.
  • ISIS 404071 was administered subcutaneously to BALB/c mice at a dosage of 25 mg/kg twice a week for 3 weeks. Plasma was collected from these mice 5 days after receiving the last dose of ISIS 404071.
  • Apixaban was administered subcutaneously to BALB/c mice at a dosage of 6 mg/kg twice daily for three days. Plasma was collected from these mice 20 minutes after receiving the last dose of Apixaban.
  • ISIS 404071 was administered subcutaneously to BALB/c mice at a dosage of 20 mg/kg twice a week for 3 weeks, and Apixaban was administered subcutaneously at a dosage of 6 mg/kg twice daily on the last three days of ISIS 404071 treatment. Plasma was collected from these mice 20 minutes after receiving the last dose of Apixaban.
  • PBS was administered subcutaneously twice a week for three weeks, as a control. Plasma was collected 5 days after the last dose of PBS.
  • PT and aPTT values provided in Table 32 are reported as International Normalized Ratio (INR) values. As shown in Table 32, PT is not significantly affected by treatment with ISIS 404071. However, Apixaban and Apixaban combined with ISIS 404071 increased PT. Also shown in Table 32, Apixaban, ISIS 404071 , and ISIS 404071 combined with Apixaban increase aPTT.
  • Example 21 In vivo effect of antisense inhibition of murine Factor 11 in combination with warfarin on PT and aPTT
  • PT and aPTT were measured using PPP from mice treated with ISIS 404071 in combination with warfarin.
  • Two groups of BALB/c mice were treated with either 25 mg/kg or 50 mg/kg of ISIS 404071 , administered subcutaneously twice a week for 3 weeks. Plasma was collected from each group 5 days after the last dose was administered.
  • BALB/c mice were treated with 2 mg/kg of warfarin once daily for 5 days. Plasma was collected 6 hours after the last dose of warfarin was administered.
  • PT and aPTT values provided in Table 33 are reported as International Normalized Ratio (INR) values.
  • INR International Normalized Ratio
  • PT is not affected by treatment with PBS or ISIS 404071 at either dosage.
  • treatment with 2 mg/kg warfarin, 25 mg/kg ISIS 404071 in combination with 2 mg/kg warfarin, and 50 mg/kg ISIS 404071 in combination with 2 mg/kg warfarin increase PT.
  • aPTT is affected by treatment with ISIS 404071 and warfarin. The combination of ISIS 404071 and warfarin show an increase in aPTT greater than either drug alone.
  • Example 22 In vivo antithrombotic effect of antisense inhibition of murine Factor 11 on mesenteric vein thrombosis in mice
  • ISIS 404071 was administered subcutaneously to C57BL/6 mice twice a week for three weeks at a dose of 50 mg/kg.
  • a control oligonucleotide, ISIS 405277 (AAGGACCTACACTATGGAAT; antisense oligonucleotide for Factor T), incorporated herein as SEQ ID NO: 12 was administered subcutaneously to C57B1/6 mice twice a week for three weeks at a dose of 50 mg/kg.
  • ISIS 405277 AAGGACCTACACTATGGAAT; antisense oligonucleotide for Factor T
  • PRP Platelet rich plasma
  • pellets were resuspended in 1 ml modified Tyrode's-HEPES buffer (137 mM NaCl, 0.3 mM Na 2 HPO 4 , 2 mM KCl, 12 mM NaHCO 3 , 5 mM HEPES, 5 mM glucose, 0.35% BSA, pH 7.2) containing 2 ⁇ l of PGI 2 and incubated at 37°C for 5 min.
  • the suspended pellet was centrifuged at 2600 rpm for 5 min. To remove PGI 2 , the washing step was repeated twice and platelets were fluorescently labeled with calcein AM 2.5 ⁇ g/mL (Molecular Probes, Eugene, OR) for 10 min at room temperature.
  • Fluorescently-labeled platelets were injected intravenously in ISIS 404071 treated and control oligonucleotide treated C57BL/6 mice.
  • the mice were anaesthetized with 2.5% avertin, and an incision was made through the abdominal wall to expose mesenteric veins 250-300- ⁇ m in diameter and having a shear rate of approximately 150 s "1 .
  • the exposed mesentery was kept moist throughout the experiment by periodic superfusion with warmed (37° C) PBS.
  • the mesentery was transluminated with a 12V, 10OW, DC stabilized source.
  • Veins were visualized using a Zeiss (Germany) Axiovert 135 inverted microscope (Objective 32X) connected to an SVHS video recorder (AG-6730; Panasonic, Tokyo, Japan) using a CCD video camera (Hamamatsu Photonic Systems, Hamamatsu City, Japan). Centerline erythrocyte velocity (V rbC ) was measured using an optical Doppler velocimeter (Microcirculation Research Institute, Texas A&M College of Medicine, College Station, TX).
  • Thrombosis was performed two days after the last antisense oligonucleotide injection. Thrombosis was induced by applying Whatman paper soaked in a 10 % FeCl 3 solution for 5 minutes on the mesenteric vein. The vein was monitored for 40 minutes, or until occlusion. The elapsed time before the first thrombus 30-50 ⁇ m in diameter and the elapsed time before blood stopped flowing for 30 seconds were observed.
  • Thrombus formation (30 ⁇ m in diameter) occurred in mice treated with ISIS 404071 at 14.8 ⁇ 1.7 minutes. Thrombus formation (30 ⁇ m in diameter) occurred in control mice at 8.9 ⁇ 0.6 minutes. Occlusive thrombi formed in control mice at 19.3 ⁇ 0.8 min and all injured venules occluded. In contrast, the majority of the veins in ISIS 404071 treated mice did not occlude when observation was terminated 40 minutes after injury and those veins showing occlusion. The only vein showing occlusion in the ISIS 404071 treated mice occluded at 29.5 minutes and reopened after 5 minutes, prior to the end of the study.
  • Example 23 In vivo sense-oligonucleotide-antidote for antisense inhibition of murine Factor ll in BALB/c mice
  • ISIS 404071 The effect of the specific sense oligonucleotide to ISIS 404071 as an antidote was tested in BALB/c mice.
  • ISIS 404071 was administered subcutaneously to BALB/c mice twice a week for three weeks at a dose of 40 mg/kg.
  • ISIS 404057 was administered subcutaneously to BALB/c mice twice a week for three weeks at a dose of 40 mg/kg.
  • ISIS 404071 specific antidote ISIS 418026 (CCTCTGAAAGTGGATTACCA; complementary to ISIS 404071), incorporated herein as SEQ ID NO: 13, was administered to both cohorts subcutaneously in a single injection of 90 mg/kg 48 hours after the final treatment of ISIS 404071 or 404057.
  • ISIS 404071 was administered subcutaneously to BALB/c mice twice a week for three weeks at a dose of 40 mg/kg.
  • mice were injected subcutaneously injected with PBS.
  • ISIS 404057 was administered subcutaneously to BALB/c mice twice a week for three weeks at a dose of 40 mg/kg.
  • mice were injected subcutaneously injected with PBS. Following antidote administration, a set of 4 mice from each cohort were sacrificed at 12 hours, 1 day, 2 days, 3 days, 7 days, and 14 days. Whole liver was collected for RNA analysis and PPP was collected for aPTT analysis.
  • RNA analysis RNA was extracted from liver tissue for real-time PCR analysis of Factor 11. Results are presented as percent inhibition of Factor 11, relative to PBS control. As shown in Table 34, mice treated with ISIS 404071 without antidote showed progressive decrease in inhibition over the 14 day observation period. However, mice treated with ISIS 404071 and antidote showed an accelerated decrease in inhibition over the 14 day observation period in comparison to mice which did not receive antidote. Also shown in Table 34, treatment with ISIS 418026 had no effect on inhibition of Factor 11 mRNA expression in ISIS 404057 treated mice.
  • mice treated with ISIS 404071 and antidote showed progressive decrease of aPTT over the 14 day observation period compared to mice treated with ISIS 404071 without antidote.
  • Example 24 In vivo Factor 7a protein-antidote for antisense inhibition of murine Factor 11 in BALB/c mice
  • human Factor 7a (Factor Vila) protein as an antidote for ISIS 404071 was tested in BALB/c mice.
  • Two experimental groups of BALB/c mice were treated with 20 mg/kg of ISIS 404071, administered subcutaneously twice a week for 3 weeks.
  • Two control groups of BALB/c mice were treated with PBS, administered subcutaneously twice a week for 3 weeks.
  • Thrombus formation was induced with FeCl 3 in all of the mice except the first control group. Fifteen minutes before FeCl 3 treatment, the first experimental group was treated with 5 ⁇ g/kg of human Factor 7a protein antidote (product no. 407act, American Diagnostica Inc.).
  • mice Two days after their last dose, all mice were anesthetized with 150 mg/kg of ketamine mixed with 10 mg/kg of xylazine administered by intraperitoneal injection.
  • thrombus formation was induced by applying a piece of filter paper (2 x 4 mm) pre-saturated with 10 % FeCl 3 solution directly on the vena cava. After 3 minutes of exposure, the filter paper was removed. Thirty minutes after the filter paper application, a fixed length of the vein containing the thrombus was dissected out for platelet analysis.
  • Example 25 In vivo antisense inhibition of murine Factor 11 in the collagenase-induced intracerebral hemorrhage model
  • ISIS 404071 and warfarin were examined in the collegenase-induced intracerebral hemorrhage model.
  • ISIS 404071 was administered subcutaneously to B ALB/c mice twice a week for two weeks at a dose 40 mg/kg.
  • warfarin was administered intraperioneally to mice twice a week for two weeks at a dose of 2 mg/kg.
  • ISIS 421208 TCGGAAGCGACTCTTATATG, 8 mismatches to murine Factor 11, incorporated herein as SEQ ID NO: 14
  • PBS was administered to BALB/c mice twice a week for two weeks.
  • Table 37 presents the hemorrhage volume detected in mice after collagenase treatment
  • Table 38 presents the neurologic deficit score of the mice
  • Table 39 presents the mortality rate of the mice.
  • Neurological deficit is measured by a standard scoring system where no deficiency is zero and severe deficit is five.
  • mice Two control groups of eight BALB/c mice, weighing approximately 25 g each, were not treated with ISIS 404071 or PLAVIX.
  • Thrombus formation was induced with FeCl 3 in all of the mice except the first and third control groups. All mice were anesthetized with 150 mg/kg of ketamine mixed with 10 mg/kg of xylazine administered by intraperitoneal injection.
  • HCT hematocrit
  • MCV mean corpuscular volume
  • MH mean corpuscular hemoglobin
  • MCHC mean corpuscular hemoglobin concentration
  • Example 34 Measurement of half-life of antisense oligonucleotide in CDl mice liver
  • CDl mice were treated with ISIS antisense oligonucleotides targeting human Factor 11 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver was evaluated.
  • mice Groups of fifteen CDl mice each were injected subcutaneously twice per week for 2 weeks with 50 mg/kg of ISIS 416825, ISIS 416826, ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864, ISIS 416892, ISIS 416925, ISIS 416999, ISIS 417002, or ISIS 417003. Five mice from each group were sacrificed 3 days, 28 days and 56 days following the final dose. Livers were harvested for analysis.
  • the concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol- chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 270
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • Half-lives were then calculated using WinNonlin software (PHARSIGHT).
  • Example 35 Tolerability of antisense oligonucleotides targeting human Factor 11 in Sprague- Dawley rats
  • Sprague-Dawley rats were treated with ISIS antisense oligonucleotides targeting human Factor 11 and evaluated for changes in the levels of various metabolic markers.
  • a control group of four Sprague Dawley rats was injected subcutaneously with PBS twice per week for 6 weeks. Body weight measurements were taken before and throughout the treatment period. Urine samples were taken before the start of treatment. Three days after the last dose, urine samples were taken and the rats were sacrificed. Organ weights were measured and blood was collected for further analysis. Body weight and organ weight
  • Body weights of the rats were measured at the onset of the study and subsequently twice per week. The body weights are presented in Table 71 and are expressed as a percent change over the weights taken at the start of the study. Liver, spleen, and kidney weights were measured at the end of the study and are presented in Table 71 as a percent of the saline control normalized to body weight. Those antisense oligonucleotides which did not affect more than a six-fold increase in liver and spleen weight above the PBS control were selected for further studies.
  • ALT and AST alanine transaminase
  • AST aspartate transaminase
  • Table 72 Plasma levels of bilirubin and albumin were also measured with the same clinical analyzer and the results are also presented in Table 72, expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • kidney function plasma concentrations of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in Table 73, expressed in mg/dL. Those antisense oligonucleotides which did not affect more than a two-fold increase in BUN levels compared to the PBS control were selected for further studies. The ratio of urine protein to creatinine in total urine samples was also calculated before and after antisense oligonucleotide treatment and is presented in Table 74. Those antisense oligonucleotides which did not affect more than a five-fold increase in urine protein/creatinine ratios compared to the PBS control were selected for further studies.
  • HCT hematocrit
  • MCV mean corpuscular volume
  • MCV mean corpuscular hemoglobin
  • MCHC mean corpuscular hemoglobin concentration
  • Example 36 Measurement of half-life of antisense oligonucleotide in Sprague-Dawley rat liver and kidney
  • Sprague Dawley rats were treated with ISIS antisense oligonucleotides targeting human Factor 11 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver and kidney was evaluated.
  • the concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al, 1999) which consist of a phenol- chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 270 was added prior to extraction.
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • LLOQ lower limit of quantitation
  • the results are presented in Tables 77 and 78, expressed as ⁇ g/g liver or kidney tissue.
  • Half-lives were then calculated using WinNonlin software (PHARSIGHT).
  • oligonucleotide concentration ( ⁇ g/g) in the liver and kidney of Sprague-Dawley rats
  • Example 37 Tolerability of antisense oligonucleotides targeting human Factor 11 in CDl mice
  • CDl mice were treated with ISIS antisense oligonucleotides targeting human Factor 11 and evaluated for changes in the levels of various metabolic markers.
  • CDl mice Treatment Groups of five CDl mice each were injected subcutaneously twice per week for 6 weeks with 50 mg/kg of ISIS 412223, ISIS 412224, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416848, ISIS 416849, ISIS 416850, ISIS 416851, ISIS 416852, ISIS 416853, ISIS 416854, ISIS 416855, ISIS 416856, ISIS 416857, ISIS 416858, ISIS 416859, ISIS 416860, ISIS 416861, ISIS 416862, ISIS 416863, ISIS 416864, ISIS 416865, ISIS 416866, or ISIS 416867, or.
  • a control group often CDl mice was injected subcutaneously with PBS twice per week for 6 weeks. Body weight measurements were taken before and throughout the treatment period. Three days after the last dose, the mice were sacrificed, organ weights were measured, and blood was collected for further analysis.
  • Body weight and organ weights Body weight was measured at the onset of the study and subsequently twice per week.
  • the body weights of the mice are presented in Table 80 and are expressed increase in grams over the PBS control weight taken before the start of treatment.
  • Liver, spleen, and kidney weights were measured at the end of the study, and are also presented in Table 80 as percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies.
  • ALT and AST alanine transaminase
  • AST aspartate transaminase
  • Plasma levels of bilirubin, cholesterol and albumin were also measured using the same clinical chemistry analyzer and are presented in Table 81 expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • HCT hematocrit
  • Example 38 Measurement of half-life of antisense oligonucleotide in CDl mouse liver
  • CDl mice Fifteen antisense oligonucleotides which had been evaluated in CDl mice (Example 37) were further evaluated. CDl mice were treated with ISIS antisense oligonucleotides and the oligonucleotide half-life as well the elapsed time for oligonucleotide degradation and elimination in the liver was evaluated.
  • mice Groups of fifteen CDl mice each were injected subcutaneously twice per week for 2 weeks with 50 mg/kg of ISIS 412223, ISIS 412225, ISIS 413481, ISIS 413482, ISIS 416851, ISIS 416852, ISIS 416856, ISIS 416860, ISIS 416861, ISIS 416863, ISIS 416866, ISIS 416867, ISIS 412224, ISIS 416848 or ISIS 416859. Five mice from each group were sacrificed 3 days, 28 days, and 56 days after the last dose, livers were collected for analysis.
  • the concentration of the full-length oligonucleotide was measured.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 270
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • LLOQ lower limit of quantitation
  • Example 39 Tolerability of antisense oligonucleotides targeting human Factor 11 in Sprague- Dawley rats
  • the body weights of the rats were measured at the onset of the study and subsequently twice per week.
  • the body weights are presented in Table 86 and are expressed as increase in grams over the PBS control weight taken before the start of treatment.
  • Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 86 as a percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies.
  • ALT and AST alanine transaminase
  • AST aspartate transaminase
  • Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and results are presented in Table 87 and expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • HCT hematocrit
  • Example 40 Measurement of half-life of antisense oligonucleotide in the liver and kidney of Sprague-Dawley rats
  • Sprague Dawley rats were treated with ISIS antisense oligonucleotides targeting human Factor 11 and the oligonucleotide half-life as well as the elapsed time for oligonucleotide degradation and elimination from the liver and kidney was evaluated.
  • the concentration of the full-length oligonucleotide as well as the total oligonucleotide concentration (including the degraded form) was measured.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol- chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 270 was added prior to extraction.
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • LLOQ lower limit of quantitation
  • the results are presented in Tables 91 and 92, expressed as ⁇ g/g liver or kidney tissue. Half-lives were then calculated using WinNonlin software (PHARSIGHT).
  • oligonucleotide concentration ( ⁇ g/g) in the liver and kidney of Sprague-Dawley rats
  • Example 41 Tolerability of antisense oligonucleotides targeting human Factor 11 in CDl mice
  • ISIS oligonucleotides with 6-8-6 MOE and 5-8-5 MOE motifs targeting human Factor 11 were administered in CDl mice evaluated for changes in the levels of various metabolic markers.
  • mice The body weight changes in the mice are presented in Table 94 and are expressed increase in grams over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 94 as percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies. Table 94
  • ALT and AST alanine transaminase
  • AST aspartate transaminase
  • Table 95 Plasma levels of bilirubin and albumin were also measured and results are also presented in Table 95 and expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • HCT hematocrit
  • Example 42 Tolerability of antisense oligonucleotides targeting human Factor 11 in Sprague- Dawley rats
  • Body weight and organ weight The body weights of the rats were measured at the onset of the study and subsequently twice per week. The body weights are presented in Table 99 and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 99 as a percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 100 expressed in IU/L. Those antisense oligonucleotides which did not affect an increase in ALT/AST levels above seven-fold of control levels were selected for further studies. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer; results are presented in Table 100 and expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • BUN levels compared to the PBS control were selected for further studies.
  • the total urine protein and ratio of urine protein to creatinine in total urine samples after antisense oligonucleotide treatment was calculated and is also presented in Table 101. Those antisense oligonucleotides which did not affect more than a five-fold increase in urine protein/creatinine ratios compared to the PBS control were selected for further studies.
  • HCT hematocrit
  • Example 43 Tolerability of antisense oligonucleotides targeting human Factor 11 in CDl mice
  • ISIS oligonucleotides with 4-8-4 MOE, 3-8-3 MOE, 2-10-2 MOE, 3-10-3 MOE, and 4-10-4 MOE motifs targeting human Factor 11 were administered in CDl mice evaluated for changes in the levels of various metabolic markers.
  • CDl mice Treatment Groups of five CDl mice each were injected subcutaneously twice per week for 6 weeks with 50 mg/kg of ISIS 449707, ISIS 449708, ISIS 449409, ISIS 449710, or ISIS 449711.
  • a control group of five CDl mice was injected subcutaneously with PBS twice per week for 6 weeks. Body weight measurements were taken before and at the end of the treatment period. Three days after the last dose, the mice were sacrificed, organ weights were measured, and blood was collected for further analysis.
  • mice taken at the end of the study are presented in Table 104 and are expressed in grams. Liver, spleen and kidney weights were also measured at the end of the study and are also presented in Table 104 as percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies. Table 104
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 105 expressed in ILVL. Those antisense oligonucleotides which did not affect an increase in ALT/AST levels above seven-fold of control levels were selected for further studies. Plasma levels of bilirubin and albumin were also measured using the same clinical chemistry analyzer and results are presented in Table 105 and expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • HCT hematocrit
  • Example 44 Tolerability of antisense oligonucleotides targeting human Factor 11 in Sprague- Dawley rats
  • the body weights of the rats were measured at the onset of the study and at the end of the study.
  • the body weight changes are presented in Table 109 and are expressed as increase in grams over the PBS control weight taken before the start of treatment.
  • Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 109 as a percentage of the body weight. Those antisense oligonucleotides which did not affect more than six-fold increases in liver and spleen weight above the PBS control were selected for further studies.
  • ALT and AST plasma concentrations of ALT and AST were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma concentrations of alanine transaminase (ALT) and aspartate transaminase (AST) were measured and the results are presented in Table 110 expressed in IU/L. Those antisense oligonucleotides which did not affect an increase in ALT/AST levels above sevenfold of control levels were selected for further studies. Plasma levels of bilirubin and albumin were also measured and results are presented in Table 110 and expressed in mg/dL. Those antisense oligonucleotides which did not affect an increase in levels of bilirubin more than two-fold of the control levels by antisense oligonucleotide treatment were selected for further studies.
  • HCT hematocrit
  • Example 45 Dose-dependent pharmacologic effect of antisense oligonucleotides targeting human Factor 11 in cynomolgus monkeys
  • Several antisense oligonucleotides were tested in cynomolgus monkeys to determine the pharmacologic effects of the oligonucleotides on Factor 11 activity, anticoagulation and bleeding times, liver and kidney distributions, and tolerability. All the ISIS oligonucleotides used in this study target human Factor 11 mRNA and are also fully cross-reactive with the rhesus monkey gene sequence (see Table 44). It is expected that the rhesus monkey ISIS oligonucleotides are fully cross- reactive with the cynomolgus monkey gene sequence as well. At the time the study was undertaken, the cynomolgus monkey genomic sequence was not available in the National Center for Biotechnology Information (NCBI) database; therefore, cross-reactivity with the cynomolgus monkey gene sequence could not be confirmed.
  • NCBI National Center for Biotechnology Information
  • Groups each consisting of two male and three female monkeys, were injected subcutaneously with ISIS 416838, ISIS 416850, ISIS 416858, ISIS 416864, or ISIS 417002 in escalating doses.
  • Antisense oligonucleotide was administered to the monkeys at 5 mg/kg three times per a week for week 1; 5 mg/kg twice per week for weeks 2 and 3; 10 mg/kg three times per week for week 4; 10 mg/kg twice per week for weeks 5 and 6; 25 mg/kg three times per week for week 7; and 25 mg/kg twice per week for weeks 8, 9, 10, 11, and 12.
  • One control group consisting of two male and three female monkeys, was injected subcutaneously with PBS according to the same dosing regimen.
  • RNA analysis An additional experimental group, consisting of two male and three female monkeys, was injected subcutaneously with ISIS 416850 in a chronic, lower dose regimen.
  • Antisense oligonucleotide was administered to the monkeys at 5 mg/kg three times per week for week 1 ; 5 mg/kg twice per week for week 2 and 3; 10 mg/kg three times per week for week 4; and 10 mg/kg twice per week for weeks 5 to 12.
  • Body weights were measured weekly. Blood samples were collected 14 days and 5 days before the start of treatment and subsequently once per week for Factor 11 protein activity analysis in plasma, fibrinogen measurement, PT and aPTT measurements, bleeding times, and measurement of various hematologic factors.
  • the monkeys were euthanized by exsanguination while under deep anesthesia, and organs harvested for further analysis.
  • Table 115 The results are presented in Table 115, expressed as percentage reduction relative to that of the PBS control. Treatment with ISIS 416850 and ISIS 416858 resulted in a time-dependent decrease in protein levels. Table 115
  • PT and aPTT assay Blood samples were collected in tubes containing sodium citrate. PT and aPTT were determined in duplicate with an ACL 9000 coagulation instrument (Instrumentation Laboratory, Italy). The results were interpolated on a standard curve of serial dilutions citrated control monkey plasma tested to give a reported result in percent normal.
  • Prothrombin Time (PT) and Activated Partial Thromboplastin Time (aPTT) were measured using platelet poor plasma (PPP) from monkeys treated with ISIS oligonucleotides.
  • PPP platelet poor plasma
  • PT and aPTT values are provided in Tables 116 and 117 and are reported as International Normalized Ratio (INR) values.
  • INR values for PT and aPTT were determined by dividing the PT or aPTT value for each experimental group by the PT or aPTT for the PBS treated group. This ratio was then raised to the power of the International Sensitivity Index (ISI) of the tissue factor used.
  • ISI International Sensitivity Index
  • the ISIS oligonucleotide, ISIS 416850, given with the chronic dose regimen is distinguished from the other oligonucleotides with an asterisk (*).
  • PT was not significantly prolonged in monkeys treated with ISIS oligonucleotides either in the escalating dose regimen or the chronic dose regimen.
  • aPTT was prolonged in a dose-dependent manner, as presented in Table 117.
  • Results are presented in Table 118 as percent inhibition of Factor 11 activity, relative to PBS control.
  • the ISIS oligonucleotide, ISIS 416850, given with the chronic dose regimen is distinguished from the other oligonucleotides with an asterisk (*).
  • Table 118
  • Platelet aggregation was initiated by adding 1 mmol/L ADP and/or 3 ⁇ g collagen (depending on the collection day, as outlined in Table 121) to plasma samples, and was allowed to proceed for 10 minutes. Aggregation was characterized by recording the change in the electrical resistance or impedance and the change in the initial slope of aggregation after platelet shape change. The aggregation test was performed twice per sample on each collection day and the average value was taken. The ISIS oligonucleotide, ISIS 416850, given with the chronic dose regimen is distinguished from the other oligonucleotides with an asterisk (*). Table 121
  • Body weights were taken once weekly throughout the dosing regimen. The measurements of each group are given in Table 122 expressed in grams. The results indicate that treatment with the antisense oligonucleotides did not cause any adverse changes in the health of the animals, which may have resulted in a significant alteration in weight compared to the PBS control. Organ weights were taken after the animals were euthanized and livers, kidneys and spleens were harvested and weighed. The results are presented in Table 123 and also show no significant alteration in weights compared to the PBS control, except for ISIS 416858, which shows increase in spleen weight. The ISIS oligonucleotide, ISIS 416850, given with the chronic dose regimen is distinguished from the other oligonucleotides with an asterisk (*).
  • the concentration of the full-length oligonucleotide as well as the elapsed time oligonucleotide degradation and elimination from the liver and kidney were evaluated.
  • the method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction.
  • An internal standard (ISIS 355868, a 27-mer 2'-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 270) was added prior to extraction.
  • Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 ⁇ g/g.
  • LLOQ lower limit of quantitation
  • Half-lives were then calculated using WinNonlin software (PHARSIGHT). The results are presented in Tables 128 and 129, expressed as ⁇ g/g liver or kidney tissue.
  • oligonucleotide concentration ( ⁇ g/g) in the liver and kidney of cynomolgus monkeys

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cardiology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Dermatology (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pulmonology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
PCT/US2009/060922 2008-10-15 2009-10-15 Modulation of factor 11 expression WO2010045509A2 (en)

Priority Applications (35)

Application Number Priority Date Filing Date Title
SI200931777T SI2379084T1 (en) 2008-10-15 2009-10-15 Modulation of factor expression 11
ES09821293.9T ES2657679T3 (es) 2008-10-15 2009-10-15 Modulación del factor de expresión 11
LTEP09821293.9T LT2379084T (lt) 2008-10-15 2009-10-15 Faktoriaus 11 raiškos moduliavimas
PL09821293T PL2379084T3 (pl) 2008-10-15 2009-10-15 Modulowanie ekspresji czynnika XI
DK09821293.9T DK2379084T3 (en) 2008-10-15 2009-10-15 MODULATION OF FACTOR 11 EXPRESSION
KR1020117010915A KR101773551B1 (ko) 2008-10-15 2009-10-15 인자 １１ 발현의 조정
CN200980150276.5A CN102245186B (zh) 2008-10-15 2009-10-15 因子11表达的调节
CA2740785A CA2740785C (en) 2008-10-15 2009-10-15 Modulation of factor 11 expression
AU2009305636A AU2009305636A1 (en) 2008-10-15 2009-10-15 Modulation of Factor 11 expression
RU2011119479/10A RU2535964C2 (ru) 2008-10-15 2009-10-15 Модуляция экспрессии фактора 11
JP2011532267A JP5809058B2 (ja) 2008-10-15 2009-10-15 第１１因子発現の調節
EP09821293.9A EP2379084B1 (en) 2008-10-15 2009-10-15 Modulation of factor 11 expression
MX2011004097A MX2011004097A (es) 2008-10-15 2009-10-15 Modulacion de la expresion del factor 11.
NZ592203A NZ592203A (en) 2008-10-15 2009-10-15 Modulation of factor 11 expression
EP17201814.5A EP3335715A3 (en) 2008-10-15 2009-10-15 Modulation of factor 11 expression
NO09821293A NO2379084T3 (zh) 2008-10-15 2009-10-15
BRPI0920263-3A BRPI0920263B1 (pt) 2008-10-15 2009-10-15 Compostos compreendendo um oligonucleotídeo modificado, composição e uso dos mesmos
KR1020177023938A KR101979134B1 (ko) 2008-10-15 2009-10-15 인자 １１ 발현의 조정
JP2012505942A JP2012524068A (ja) 2009-04-15 2010-04-15 第ｘｉ因子による炎症反応のモジュレーション
AU2010236286A AU2010236286B2 (en) 2009-04-15 2010-04-15 Modulation of inflammatory responses by Factor XI
NZ595891A NZ595891A (en) 2009-04-15 2010-04-15 Modulation of inflammatory responses by factor xi
RU2011146158/15A RU2011146158A (ru) 2009-04-15 2010-04-15 Модуляция воспалительных реакций фактором хi
CN2010800267898A CN102458480A (zh) 2009-04-15 2010-04-15 因子xi对炎症反应的调节
PCT/US2010/031311 WO2010121074A1 (en) 2009-04-15 2010-04-15 Modulation of inflammatory responses by factor xi
EP10765215.8A EP2419146A4 (en) 2009-04-15 2010-04-15 MODULATION OF INFLAMMATORY RESPONSES BY FACTOR XI
BRPI1015236A BRPI1015236A2 (pt) 2009-04-15 2010-04-15 métodos para modular uma resposta inflamatória, apra melhorar uma doença, distúrbio ou condição inflamatórios em um animal, para tratar um animal em risco para uma doença, distúrbio ou condição inflamatórios, para inibir a expressão de fator xi em um animal, para reduzir o risco de doença, distúrbio ou condição inflamatórios, em um animal, para tratar um animal em risco para uma doença inflamatória, e para tratar um animal tendo uma doença inflamatória, e, uso de um composto marcado para fator xi
MX2011010930A MX2011010930A (es) 2009-04-15 2010-04-15 Modulacion de respuestas inflamatorias a través de factor xi.
CA2758927A CA2758927A1 (en) 2009-04-15 2010-04-15 Modulation of inflammatory responses by factor xi
US13/262,904 US20120083522A1 (en) 2009-04-15 2010-04-15 Modulation of inflammatory responses by factor xi
IL212267A IL212267A (en) 2008-10-15 2011-04-11 Factor 11 expression modulation
IL215678A IL215678A0 (en) 2009-04-15 2011-10-10 Modulation of inflammatory responses by factor xi
IL244116A IL244116B (en) 2008-10-15 2016-02-14 Modulation of the expression of factor 11
AU2017202862A AU2017202862B2 (en) 2008-10-15 2017-05-01 Modulation of factor 11 expression
HRP20171969TT HRP20171969T1 (hr) 2008-10-15 2017-12-19 Modulacija ekspresije faktora 11
CY20181100176T CY1119909T1 (el) 2008-10-15 2018-02-14 Διαμορφωση της εκφρασης του παραγοντα 11

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US10577208P 2008-10-15 2008-10-15
US61/105,772 2008-10-15
US17446109P 2009-04-30 2009-04-30
US61/174,461 2009-04-30

Publications (2)

Publication Number Publication Date
WO2010045509A2 true WO2010045509A2 (en) 2010-04-22
WO2010045509A3 WO2010045509A3 (en) 2010-07-15

Family

ID=42107256

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/060922 WO2010045509A2 (en) 2008-10-15 2009-10-15 Modulation of factor 11 expression

Country Status (23)

Country Link
US (7) US8334372B2 (zh)
EP (2) EP3335715A3 (zh)
JP (4) JP5809058B2 (zh)
KR (2) KR101773551B1 (zh)
CN (4) CN104212799B (zh)
AU (2) AU2009305636A1 (zh)
BR (1) BRPI0920263B1 (zh)
CA (2) CA2740785C (zh)
CY (1) CY1119909T1 (zh)
DK (1) DK2379084T3 (zh)
ES (1) ES2657679T3 (zh)
HR (1) HRP20171969T1 (zh)
HU (1) HUE035888T2 (zh)
IL (2) IL212267A (zh)
LT (1) LT2379084T (zh)
MX (1) MX2011004097A (zh)
NO (1) NO2379084T3 (zh)
NZ (2) NZ592203A (zh)
PL (1) PL2379084T3 (zh)
PT (1) PT2379084T (zh)
RU (2) RU2535964C2 (zh)
SI (1) SI2379084T1 (zh)
WO (1) WO2010045509A2 (zh)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735370B2 (en) 2008-10-15 2014-05-27 Isis Pharmaceuticals, Inc. Modulation of factor 11 expression
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9994855B2 (en) 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10465011B2 (en) 2015-06-26 2019-11-05 Novartis Ag Factor XI antibodies and methods of use
WO2019217527A1 (en) 2018-05-09 2019-11-14 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing fxi expression
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US10647780B2 (en) 2016-05-25 2020-05-12 Novartis Ag Reversal binding agents for anti-factor XI/XIa antibodies and uses thereof
US11168147B2 (en) 2016-12-23 2021-11-09 Novartis Ag Factor XI antibodies and methods of use
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
WO2022221441A2 (en) 2021-04-13 2022-10-20 Sirnaomics, Inc. Products and compositions
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12084661B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010121074A1 (en) * 2009-04-15 2010-10-21 Isis Pharmaceuticals, Inc. Modulation of inflammatory responses by factor xi
WO2012064758A2 (en) * 2010-11-08 2012-05-18 Isis Pharmaceuticals, Inc. Methods for modulating factor 12 expression
WO2012145674A1 (en) * 2011-04-21 2012-10-26 Isis Pharmaceuticals, Inc. Modulation of hepatitis b virus (hbv) expression
EP3505528B1 (en) 2011-04-21 2020-11-25 Ionis Pharmaceuticals, Inc. Modulation of hepatitis b virus (hbv) expression
US9187749B2 (en) 2011-06-10 2015-11-17 Isis Pharmaceuticals, Inc. Methods for modulating factor 12 expression
AU2012327227A1 (en) * 2011-11-07 2013-05-23 Isis Pharmaceuticals, Inc. Administration of Factor XI antisense oligonucleotides
US10502737B2 (en) 2012-05-25 2019-12-10 The University Of Vermont And State Agriculture College Anti-thrombotic compositions and methods for assaying platelet reactivity and treatment selection
SG10201805646WA (en) 2014-08-07 2018-08-30 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
US9988443B2 (en) 2014-08-07 2018-06-05 Novartis Ag Angiopoetin-like 4 (ANGPTL4) antibodies and methods of use
CA3043768A1 (en) 2016-11-29 2018-06-07 PureTech Health LLC Exosomes for delivery of therapeutic agents
KR20210005100A (ko) * 2018-04-20 2021-01-13 더 유니버시티 오브 버몬트 앤드 스테이트 애그리컬쳐 칼리지 선택된 환자에서 심혈관 질환을 치료하기 위한 조성물 및 방법
JP2022533722A (ja) * 2019-05-22 2022-07-25 スーチョウ リボ ライフ サイエンス カンパニー、リミテッド 核酸、薬物組成物及び複合体ならびに調製方法と使用
TW202229549A (zh) * 2020-08-04 2022-08-01 大陸商上海拓界生物醫藥科技有限公司 抑制凝血因子ｘｉ表達的ｓｉｒｎａ、組成物及其醫藥用途
JP2023554346A (ja) 2020-12-18 2023-12-27 アイオーニス ファーマシューティカルズ， インコーポレーテッド 第ｘｉｉ因子を調節するための化合物及び方法
WO2023109935A1 (zh) * 2021-12-16 2023-06-22 上海拓界生物医药科技有限公司 一种dsRNA、其制备方法及应用
WO2023109938A1 (zh) * 2021-12-16 2023-06-22 上海拓界生物医药科技有限公司 一种dsRNA、其制备方法及应用

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US6566140B2 (en) 1998-06-08 2003-05-20 University Of Vermont And State Agriculture College Inhibition of coagulation in blood and blood products
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040180855A1 (en) 2003-02-19 2004-09-16 Schumacher William A. Methods of treating thrombosis with reduced risk of increased bleeding times
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20080021998A1 (en) 2006-07-20 2008-01-24 Rachel Wentink Presence-based resource locator
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type

Family Cites Families (182)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
EP0260032B1 (en) 1986-09-08 1994-01-26 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
ATE113059T1 (de) 1987-06-24 1994-11-15 Florey Howard Inst Nukleosid-derivate.
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
EP0406309A4 (en) 1988-03-25 1992-08-19 The University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
AU658562B2 (en) 1989-10-24 1995-04-27 Isis Pharmaceuticals, Inc. 2' modified oligonucleotides
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
DE69032425T2 (de) 1990-05-11 1998-11-26 Microprobe Corp., Bothell, Wash. Teststreifen zum Eintauchen für Nukleinsäure-Hybridisierungsassays und Verfahren zur kovalenten Immobilisierung von Oligonucleotiden
DE69126530T2 (de) 1990-07-27 1998-02-05 Isis Pharmaceutical, Inc., Carlsbad, Calif. Nuklease resistente, pyrimidin modifizierte oligonukleotide, die die gen-expression detektieren und modulieren
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
NZ239247A (en) 1990-08-03 1993-11-25 Sterling Drug Inc Oligonucleosides containing a non-phosphate inter nucleoside linkage
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
EP0549686A4 (en) 1990-09-20 1995-01-18 Gilead Sciences Inc Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
FR2676231A1 (fr) 1991-05-07 1992-11-13 Aetsrn Concentre de facteur xi de la coagulation sanguine a haute activite specifique, approprie a usage therapeutique et son procede de preparation.
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
DE59208572D1 (de) 1991-10-17 1997-07-10 Ciba Geigy Ag Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
JP3739785B2 (ja) 1991-11-26 2006-01-25 アイシス ファーマシューティカルズ，インコーポレイティド 修飾されたピリミジンを含有するオリゴマーを使用する増強された三重らせんおよび二重らせんの成形
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
ES2107205T3 (es) 1993-03-30 1997-11-16 Sanofi Sa Analogos de nucleosidos aciclicos y secuencias oligonucleotidas que los contienen.
DE69407032T2 (de) 1993-03-31 1998-07-02 Sanofi Sa Oligonucleotide mit amidverkettungen die phosphoesterverkettungen einsetzen
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
CN1048254C (zh) 1993-12-09 2000-01-12 托马斯杰弗逊大学 用于将预定的改变引入靶基因中的化合物
AU1397895A (en) * 1993-12-22 1995-07-10 Temple University - Of The Commonwealth System Of Higher Education Peptide analogs of the activated platelet binding site on factor xi
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
CN1120707C (zh) 1995-11-22 2003-09-10 约翰斯·霍普金斯大学 增强生物分子的细胞摄取的配体
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
ES2240067T3 (es) * 1999-03-18 2005-10-16 Merck Patent Gmbh Proteina que permite bloquear la adhesion de plaquetas.
CA2372085C (en) 1999-05-04 2009-10-27 Exiqon A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
CN100406065C (zh) 2000-12-01 2008-07-30 细胞工厂治疗公司 糖基化/半乳糖基化肽、双官能接头和核苷酸单体/多聚体的缀合物以及相关的组合物和使用方法
DE10111925A1 (de) 2001-03-13 2002-10-02 Ogham Gmbh Herzchip
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20030040480A1 (en) 2001-07-20 2003-02-27 Rasmus Rojkjaer Pharmaceutical composition comprising factor VII polypeptides and factor XI polypeptides
US20040142325A1 (en) 2001-09-14 2004-07-22 Liat Mintz Methods and systems for annotating biomolecular sequences
US20080219998A1 (en) * 2001-12-07 2008-09-11 Andras Gruber Anti-Thrombotic Agents
US7176303B2 (en) 2003-11-06 2007-02-13 Isis Pharmaceuticals, Inc. Modulation of STAT5 expression
AU2003290597A1 (en) 2002-11-05 2004-06-03 Isis Pharmaceuticals, Inc. Modified oligonucleotides for use in rna interference
EP1560931B1 (en) 2002-11-14 2011-07-27 Dharmacon, Inc. Functional and hyperfunctional sirna
US7144999B2 (en) * 2002-11-23 2006-12-05 Isis Pharmaceuticals, Inc. Modulation of hypoxia-inducible factor 1 alpha expression
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
US20050181978A1 (en) 2003-11-20 2005-08-18 Rasmus Rojkjaer Therapeutic use of factor XI
JP4718541B2 (ja) 2004-04-22 2011-07-06 リガド・バイオサイエンシーズ・インコーポレーテツド 改良された凝固因子調節剤
WO2005116204A1 (ja) * 2004-05-11 2005-12-08 Rnai Co., Ltd. Ｒｎａ干渉を生じさせるポリヌクレオチド、および、これを用いた遺伝子発現抑制方法
US8394947B2 (en) * 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
CA2580504C (en) * 2004-09-17 2013-10-29 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
WO2006048291A2 (en) 2004-11-03 2006-05-11 Almac Diagnostics Limited Transcriptome microarray technology and methods of using the same
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20090203893A1 (en) 2005-08-29 2009-08-13 Regulus Therapeutics, Llc Antisense compounds having enhanced anti-microrna activity
US7512842B2 (en) * 2005-08-29 2009-03-31 Searete Llc Multi-voltage synchronous systems
EP1954822A1 (en) * 2005-11-23 2008-08-13 Georg Dewald Detection and treatment of drug associated angioedema
PL2161038T3 (pl) * 2006-01-26 2014-06-30 Ionis Pharmaceuticals Inc Kompozycje i ich zastosowanie ukierunkowane na huntingtynę
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
ATE513912T1 (de) * 2006-05-05 2011-07-15 Isis Pharmaceuticals Inc Verbindungen und verfahren zur modulation der expression von sglt2
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
US20080021999A1 (en) * 2006-07-18 2008-01-24 Aspect Software, Inc. Remote expert screen pop via data message
EP2410053B2 (en) 2006-10-18 2020-07-15 Ionis Pharmaceuticals, Inc. Antisense compounds
AU2007325767A1 (en) * 2006-11-27 2008-06-05 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
US7521213B2 (en) 2006-12-01 2009-04-21 Quest Diagnostics Investments Incorporated Sample processing for nucleic acid amplification
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
EP2176280B2 (en) 2007-07-05 2015-06-24 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
JP5572090B2 (ja) 2007-08-15 2014-08-13 アイシス ファーマシューティカルズ， インコーポレーテッド テトラヒドロピラン核酸類似体
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
EP3002298B1 (en) 2007-11-21 2019-08-28 Oregon Health & Science University Anti-factor xi monoclonal antibodies and methods of use thereof
CA2708173C (en) 2007-12-04 2016-02-02 Alnylam Pharmaceuticals, Inc. Targeting lipids
EP2265627A2 (en) 2008-02-07 2010-12-29 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
EP3335715A3 (en) 2008-10-15 2018-08-08 Ionis Pharmaceuticals, Inc. Modulation of factor 11 expression
WO2010121074A1 (en) 2009-04-15 2010-10-21 Isis Pharmaceuticals, Inc. Modulation of inflammatory responses by factor xi
US9012421B2 (en) 2009-08-06 2015-04-21 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011133876A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
EP2616543A1 (en) 2010-09-15 2013-07-24 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
WO2012109395A1 (en) 2011-02-08 2012-08-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
DK2751270T3 (en) 2011-08-29 2018-10-29 Ionis Pharmaceuticals Inc OLIGOMER-CONJUGATE COMPLEXES AND THEIR USE
AU2012327227A1 (en) 2011-11-07 2013-05-23 Isis Pharmaceuticals, Inc. Administration of Factor XI antisense oligonucleotides
US9914922B2 (en) 2012-04-20 2018-03-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
US20150291958A1 (en) 2012-11-15 2015-10-15 Roche Innovation Center Copenhagen A/S Anti apob antisense conjugate compounds
PL2992098T3 (pl) 2013-05-01 2019-09-30 Ionis Pharmaceuticals, Inc. Kompozycje i sposoby modulowania ekspresji hbv i ttr
EP3151839A4 (en) 2014-06-06 2018-02-28 Ionis Pharmaceuticals, Inc. Compositions and methods for enhanced intestinal absorption of conjugated oligomeric compounds
MX2020011913A (es) 2018-05-09 2021-01-29 Ionis Pharmaceuticals Inc Compuestos y metodos para la reduccion de la expresion de fxi.

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6566140B2 (en) 1998-06-08 2003-05-20 University Of Vermont And State Agriculture College Inhibition of coagulation in blood and blood products
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040180855A1 (en) 2003-02-19 2004-09-16 Schumacher William A. Methods of treating thrombosis with reduced risk of increased bleeding times
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US20050130923A1 (en) 2003-09-18 2005-06-16 Balkrishen Bhat 4'-thionucleosides and oligomeric compounds
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20080021998A1 (en) 2006-07-20 2008-01-24 Rachel Wentink Presence-based resource locator
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
"Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278
ADCOCK ET AL., AMERICAN JOURNAL OF CLINICAL PATHOLOGY, vol. 108, 1997, pages 434 - 49
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
BERTINA RM ET AL., NATURE, vol. 369, 1994, pages 64 - 67
BJORK I; LINDAHL U, MOL CELL BIOCHEM., vol. 48, 1982, pages 161 - 182
BLOOD, vol. 72, 1988, pages 1748 - 54
BLOOD, vol. 92, 1998, pages 4198 - 206
DOWD, M., PLENARY SESSIONS/THROMBOSIS RESEARCH, 2008, pages 123
DRAKE ET AL., AM J PATHOL, vol. 134, 1989, pages 1087 - 1097
EUR J BIOCHEM, vol. 262, 1999, pages 915 - 923
FDA ADVISORY COMMITTEE BRIEFING DOCUMENT FOR NEW DRUG APPLICATION, 2009, pages 22 - 406
GAUTSCHI ET AL., J. NATL. CANCER INST., vol. 93, March 2001 (2001-03-01), pages 463 - 471
J BIOL CHEM, vol. 280, 2005, pages 23523 - 30
J CLIN INVEST, vol. 69, 1982, pages 844 - 852
J THROMB HAEM, vol. 4, 2006, pages 1496 - 1501
JBIOL CHEM, vol. 260, 1985, pages 10714 - 719
JBIOL CHEM, vol. 279, 2004, pages 29485 - 29492
JBIOL CHEM, vol. 280, 2005, pages 23523 - 30
JONES, L.J. ET AL., ANALYTICAL BIOCHEMISTRY, vol. 265, 1998, pages 368 - 374
KUBITZA, D. ET AL., BR. J. CLIN. PHARMACOL., vol. 63, 2006, pages 4
LEUMANN, J. C, BIOORGANIC & MEDICINAL CHEMISTRY, vol. 10, 2002, pages 841 - 854
MAHER; DOLNICK, NUC. ACID. RES., vol. 16, 1988, pages 3341 - 3358
PROC NATL ACAD SCI, vol. 101, 2004, pages 3939 - 44
SCHWARTZ AL ET AL., TRENDS CARDIOVASC MED., vol. 7, 1997, pages 234 - 239
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489
THROM HAEMOST, vol. 63, 1990, pages 417 - 23
THROMB RES, vol. 104, 2001, pages 451 - 465
THROMB RES, vol. 42, 1986, pages 225 - 34
THROMB RES, vol. 48, 1987, pages 145 - 151
WONG, P.C. ET AL., JOURNAL OF THROMBOSIS AND HAEMOSTASIS, 2008, pages 6
WOOLF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 7305 - 7309
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735370B2 (en) 2008-10-15 2014-05-27 Isis Pharmaceuticals, Inc. Modulation of factor 11 expression
US11376273B2 (en) 2008-10-15 2022-07-05 Ionis Pharmaceuticals, Inc. Modulation of factor 11 expression
US10883104B2 (en) 2013-05-01 2021-01-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9127276B2 (en) 2013-05-01 2015-09-08 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9181549B2 (en) 2013-05-01 2015-11-10 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9714421B2 (en) 2013-05-01 2017-07-25 Ionis Pharmaceuticals, Inc. Compositions and methods
US11851655B2 (en) 2013-05-01 2023-12-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
US11299736B1 (en) 2013-05-01 2022-04-12 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
EP3633039A1 (en) 2013-05-01 2020-04-08 Ionis Pharmaceuticals, Inc. Compositions and methods
US9994855B2 (en) 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10793862B2 (en) 2014-05-01 2020-10-06 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US11312964B2 (en) 2014-05-01 2022-04-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US10465011B2 (en) 2015-06-26 2019-11-05 Novartis Ag Factor XI antibodies and methods of use
US10647780B2 (en) 2016-05-25 2020-05-12 Novartis Ag Reversal binding agents for anti-factor XI/XIa antibodies and uses thereof
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
US11168147B2 (en) 2016-12-23 2021-11-09 Novartis Ag Factor XI antibodies and methods of use
US12012464B2 (en) 2016-12-23 2024-06-18 Novartis Ag Factor XI antibodies and methods of use
US12083142B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US12084661B2 (en) 2017-12-01 2024-09-10 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate comprising the same, and preparation method and use thereof
US11492620B2 (en) 2017-12-01 2022-11-08 Suzhou Ribo Life Science Co., Ltd. Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method thereof and use thereof
US11660347B2 (en) 2017-12-01 2023-05-30 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, composition and conjugate containing same, preparation method, and use thereof
US11633482B2 (en) 2017-12-29 2023-04-25 Suzhou Ribo Life Science Co., Ltd. Conjugates and preparation and use thereof
US11021710B2 (en) 2018-05-09 2021-06-01 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing FXI expression
WO2019217527A1 (en) 2018-05-09 2019-11-14 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing fxi expression
US11918600B2 (en) 2018-08-21 2024-03-05 Suzhou Ribo Life Science Co., Ltd. Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof
US11896674B2 (en) 2018-09-30 2024-02-13 Suzhou Ribo Life Science Co., Ltd. SiRNA conjugate, preparation method therefor and use thereof
WO2022221441A2 (en) 2021-04-13 2022-10-20 Sirnaomics, Inc. Products and compositions

Also Published As

Publication number Publication date
US8735370B2 (en) 2014-05-27
KR101979134B1 (ko) 2019-05-15
CY1119909T1 (el) 2018-06-27
US11376273B2 (en) 2022-07-05
LT2379084T (lt) 2018-03-26
EP3335715A2 (en) 2018-06-20
JP6084255B2 (ja) 2017-02-22
CN102245186B (zh) 2014-08-27
NZ603603A (en) 2014-06-27
US20200000839A1 (en) 2020-01-02
EP2379084B1 (en) 2017-11-22
JP6633155B2 (ja) 2020-01-22
JP6397517B2 (ja) 2018-09-26
JP2018199700A (ja) 2018-12-20
SI2379084T1 (en) 2018-04-30
JP2017099395A (ja) 2017-06-08
IL244116A0 (en) 2016-04-21
CA2966011A1 (en) 2010-04-22
RU2739594C2 (ru) 2020-12-28
RU2535964C2 (ru) 2014-12-20
AU2009305636A1 (en) 2010-04-22
PL2379084T3 (pl) 2018-04-30
EP2379084A2 (en) 2011-10-26
HUE035888T2 (en) 2018-05-28
IL212267A (en) 2016-02-29
US8334372B2 (en) 2012-12-18
US20130274308A1 (en) 2013-10-17
CN102245186A (zh) 2011-11-16
BRPI0920263A2 (pt) 2016-07-12
AU2017202862B2 (en) 2018-09-20
RU2011119479A (ru) 2012-11-27
MX2011004097A (es) 2011-07-28
AU2017202862A1 (en) 2017-05-18
CN104212799B (zh) 2018-11-23
CN103820450A (zh) 2014-05-28
US20210169921A1 (en) 2021-06-10
IL244116B (en) 2019-03-31
US20230263822A1 (en) 2023-08-24
KR101773551B1 (ko) 2017-08-31
CA2740785A1 (en) 2010-04-22
JP2012505660A (ja) 2012-03-08
CA2966011C (en) 2021-10-19
JP2015211685A (ja) 2015-11-26
US20130190384A1 (en) 2013-07-25
HRP20171969T1 (hr) 2018-04-06
PT2379084T (pt) 2018-02-19
BRPI0920263B1 (pt) 2021-09-21
KR20170101324A (ko) 2017-09-05
US20170035798A1 (en) 2017-02-09
CN103820450B (zh) 2018-08-21
CA2740785C (en) 2017-06-20
JP5809058B2 (ja) 2015-11-10
WO2010045509A3 (en) 2010-07-15
RU2014134408A (ru) 2016-03-20
DK2379084T3 (en) 2018-01-22
US10772906B2 (en) 2020-09-15
NO2379084T3 (zh) 2018-04-21
CN104212799A (zh) 2014-12-17
NZ592203A (en) 2013-01-25
CN109797150A (zh) 2019-05-24
KR20110081294A (ko) 2011-07-13
US20100137414A1 (en) 2010-06-03
ES2657679T3 (es) 2018-03-06
EP2379084A4 (en) 2012-06-06
EP3335715A3 (en) 2018-08-08
IL212267A0 (en) 2011-06-30

Similar Documents

Publication Publication Date Title
US11376273B2 (en) Modulation of factor 11 expression
US20100298417A1 (en) Modulation of factor 7 expression
US9322021B2 (en) Methods for modulating kallikrein (KLKB1) expression
US20120214862A1 (en) Modulation of factor 7 expression
US9150864B2 (en) Methods for modulating factor 12 expression
US20110059895A1 (en) Modulation of factor 9 expression

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980150276.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09821293

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 592203

Country of ref document: NZ

Ref document number: 212267

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2009305636

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2740785

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011532267

Country of ref document: JP

Ref document number: MX/A/2011/004097

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 3219/CHENP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2009305636

Country of ref document: AU

Date of ref document: 20091015

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20117010915

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2009821293

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011119479

Country of ref document: RU

Ref document number: 2009821293

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 244116

Country of ref document: IL

ENP Entry into the national phase

Ref document number: PI0920263

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110415