WO2009087081A2 - Neue insulinderivate mit extrem verzögertem zeit-/wirkungsprofil - Google Patents

Neue insulinderivate mit extrem verzögertem zeit-/wirkungsprofil Download PDF

Info

Publication number
WO2009087081A2
WO2009087081A2 PCT/EP2009/000017 EP2009000017W WO2009087081A2 WO 2009087081 A2 WO2009087081 A2 WO 2009087081A2 EP 2009000017 W EP2009000017 W EP 2009000017W WO 2009087081 A2 WO2009087081 A2 WO 2009087081A2
Authority
WO
WIPO (PCT)
Prior art keywords
arg
asp
pro
glu
lys
Prior art date
Application number
PCT/EP2009/000017
Other languages
English (en)
French (fr)
Other versions
WO2009087081A3 (de
Inventor
Paul Habermann
Gerhard Seipke
Roland Kurrle
Günter Müller
Mark Sommerfeld
Norbert Tennagels
Georg Tschank
Ulrich Werner
Original Assignee
Sanofi-Aventis Deutschland Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40568276&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2009087081(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from DE200810003568 external-priority patent/DE102008003568A1/de
Priority claimed from DE200810025008 external-priority patent/DE102008025008A1/de
Priority to ES09701358.5T priority Critical patent/ES2613152T3/es
Application filed by Sanofi-Aventis Deutschland Gmbh filed Critical Sanofi-Aventis Deutschland Gmbh
Priority to BRPI0907371A priority patent/BRPI0907371A2/pt
Priority to AU2009203809A priority patent/AU2009203809B2/en
Priority to JP2010541743A priority patent/JP5694779B2/ja
Priority to CA2711749A priority patent/CA2711749A1/en
Priority to CN200980101962.3A priority patent/CN102007143B/zh
Priority to EP09701358.5A priority patent/EP2229407B1/de
Priority to UAA201009821A priority patent/UA103015C2/ru
Priority to RU2010133231/10A priority patent/RU2524423C2/ru
Priority to DK09701358.5T priority patent/DK2229407T3/en
Priority to NZ586590A priority patent/NZ586590A/en
Publication of WO2009087081A2 publication Critical patent/WO2009087081A2/de
Publication of WO2009087081A3 publication Critical patent/WO2009087081A3/de
Priority to ZA2010/03926A priority patent/ZA201003926B/en
Priority to US12/820,722 priority patent/US9644017B2/en
Priority to TN2010000298A priority patent/TN2010000298A1/fr
Priority to MA32985A priority patent/MA31998B1/fr
Priority to IL206844A priority patent/IL206844A/en
Priority to HK11104060.4A priority patent/HK1149772A1/zh

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/28—Insulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates to novel insulin analogues with a basal time / activity profile, their preparation and use.
  • insulin analogues and "insulins” are used interchangeably herein.
  • the concept of intensified insulin therapy seeks to reduce the health risk by aiming for a stable control of blood sugar levels by early administration of basal insulin.
  • An ideal basal insulin will certainly work in every patient for at least 24 hours.
  • the effect of insulin is delayed and with the shortest possible time / effect profile, so that the risk of short-term hypoglycaemia is clearly minimized and the application can even take place without prior intake of food.
  • basal insulin A good supply of basal insulin is given when the insulin effect as long as possible persists as long as possible, ie the Body is supplied with a constant amount of insulin. This minimizes the risk of hypoglycemic events and minimizes patient and tag-specific variability.
  • the pharmacokinetic profile of an ideal basal insulin should therefore be characterized by a delayed onset of action and by a delayed, ie long-lasting and uniform effect.
  • pI isoelectric point
  • the B chain end consists of an amidated basic amino acid residue such as lysine or argininamide, i. in the amidated basic amino acid residue at the B chain end, the carboxyl group of the terminal amino acid is in its amidated form, and
  • the N-terminal amino acid residue of the insulin A chain is a lysine or arginine residue
  • FIG. 1 shows the hypoglycemic effect of the compound YKL205 according to the invention compared with that of insulin glargine.
  • the invention thus relates to an insulin analog of the formula I.
  • articles of the invention are insulin analogs as set forth above in which independently of one another AO Arg corresponds, or wherein A5 corresponds to GIu, or where A15 corresponds to GIu, or where A18 corresponds to Asp, or where B-1 corresponds to an amino group, or where BO corresponds to GIu , or wherein B1 corresponds to Asp, or wherein B2 corresponds to VaI, or wherein B3 corresponds to Asp, or wherein B4 corresponds to GIu, or wherein B29 corresponds to Lys, or wherein B30 corresponds to Thr, or where B31 corresponds to Arg or Lys.
  • a particularly preferred subject of the invention is an insulin analog selected from a group comprising:
  • human insulin in the names of said insulin analogs, reference is made to the amino acid sequences of the A and B chains of human insulin, and all deviations (additions, substitutions, deletions) thereof are given in a given name of an insulin analog.
  • Another object of the invention is a method for producing an insulin analogue as mentioned above, in particular wherein a precursor of the
  • Insulin analogue is recombinantly produced, the precursor is enzymatically processed into two - chain insulin and a coupling with arginine amide in the presence of an enzyme with trypsin activity is performed and the insulin analog is isolated.
  • Another object of the invention is a use of an insulin analogue as described above for the manufacture of a medicament for the treatment of diabetes, in particular of diabetes type I or type II.
  • the invention likewise provides a use of an insulin analogue as described above for the manufacture of a medicament to support the beta cell regeneration
  • Another object of the invention is a medicament containing an insulin analog as described above and / or physiologically acceptable salts thereof.
  • Another object of the invention is a formulation of the insulin analog as described above, wherein the formulation is in aqueous form containing the dissolved insulin analog.
  • Another object of the invention is a formulation of the insulin analogue as described above, wherein the formulation is in the form of powder.
  • Another object of the invention is a formulation as described above, wherein the insulin analogue as described above in crystalline and / or amorphous form is present.
  • Another object of the invention is a formulation of the insulin analogue as described above, wherein the formulation is in the form of a suspension.
  • Another object of the invention is a formulation of the insulin analogue as described above, wherein the formulation additionally contains a chemical chaperone.
  • Another object of the invention is a DNA coding for a precursor of an insulin analogue as described above, or for the A-chain or B-chain of an insulin analogue as described above.
  • Another object of the invention is a vector containing a DNA as described above.
  • Another object of the invention is a host organism containing a DNA as described above or a vector as described above.
  • Another object of the invention is a recuperatorinanalogon, characterized in that the C-peptide carries at its N-terminus the amino acid residue arginine and at its C-terminus two arginine residues or an arginine residue and a lysine residue, in which latter case the lysine residue is the actual C - Term forms.
  • Another object of the invention is a formulation as described above, in addition to a glucagon-like peptide-1 (GLP1) or an analog or derivative thereof, or exendin-3 or -4 or an analog or derivative thereof, preferably exendin -4 is included.
  • GLP1 glucagon-like peptide-1
  • exendin-4 is included.
  • a further subject of the invention is a formulation as described above in which an analogue of exendin-4 is selected from a group comprising H-desPro 36 -exendin-4-Lys 6 -NH 2 , H-des (Pro 36 37 ) - exendin-4-Lys 4 -NH 2, and H-des (Pro 36 - 37) -Exendin-4-Lys 5 -NH 2, or a pharmacologically tolerable salt thereof.
  • Another object of the invention is a formulation as described above, wherein an analog of exendin-4 is selected from a group containing the Pro 36 [Asp 28 ] exendin-4 (1-39), the Pro 36 [isoSp 28 ] exendin-4 (1-39), Pro 36 [Met (O) 14 , Asp 28 ] Exendin-4 (1-39), Pro 36 [Met (O) 14 , IsoPs 28 ] Exendin-4 (1-39), Pro 36 [TrP (O 2 ) 25 , Asp 28 ] Exendin-2 (1-39), Pro 36 [Trp (O 2 ) 25 , IsoPs 28 ] Exendin-2 (1-39), Pro 36 [Met (O) 14 Trp (O 2 ) 25 , Asp 28 ] Exendin-4 (1-39) and desPro 36 [Met (O) 14 Trp (O 2 ) 25 , IsoSp 28 ] Exendin-4 (1-39), or a pharmacologically tolerable Salt of it.
  • Another object of the invention is a formulation as described in the previous paragraph, in which the C-termini of the analogs of exendin-4, the peptide -
  • Another object of the invention is a formulation as described above, in which an analog of exendin-4 is selected from a group containing H- (LyS) 6 - of the Pro 36 [Asp 28 ] exendin-4 (1-39) -Lys 6 -NH 2 of the Asp 28 Pro 36 , Pro 37 , Pro 38, Exendin-4 (1-39) -NH 2 , H- (LyS) 6 - of the Pro 36 , Pro 37 , Pro 38 [Asp 28 ] Exendin-4 (1-39) -NH 2 , H-Asn- (Glu) 5 of Pro 36 , Pro 37 , Pro 38 [Asp 28 ] Exendin-4 (1-39) -NH 2 , Pro 36 , Pro 37 , Pro 38 [Asp 28 ] Exendin-4 (1-39) -NH 2 , Pro 36 , Pro 37 , Pro 38 [Asp 28 ] Exendin-4 (1-39) - (Lys) 6 -NH 2 , H- (LyS
  • Another object of the invention is a formulation as described above, in which in addition Arg 34 , Lys 26 (N ⁇ ( ⁇ -glutamyl (N ⁇ -hexadecanoyl))) GLP-1 (7-37) [liraglutide] or a pharmacologically tolerable Salt thereof is included.
  • the insulins according to the invention can be the subject of a pharmaceutical formulation which has an advantageous effect after administration. It is based on aqueous solutions. Accordingly, further components must be miscible. The danger of viral animal contamination is minimized by the fact that the preparation should not contain components derived from animal sources. It is also advantageous to prevent microbial contamination by adding preservatives. By adding isotonic agents, a possible negative effect of the formulation on the physiology of the tissue cells at the site of application can be compensated. The addition of protamine can have a stabilizing effect, so that largely salt-free insulin preparation can be obtained if protamine is added to the formulation.
  • a phenolic component can lead to a stabilization of the structure of the insulin analog used and thus additionally effect, inter alia, the delay effect on onset of action.
  • Added to the formulation may also be substances which stabilize the spatial structure of the delay insulins according to the invention and lead to better thermal stability.
  • Such chemical chaperones may include, for example, short synthetic peptides, which may also contain amino acid analogs, or include, for example, peptide sequences derived from the insulin-derived C peptide.
  • the insulins according to the invention can be incorporated into nanoparticles. Also conceivable are so-called “slow-release” formulations in which the delaying insulin according to the invention is reversibly bound to polymeric carriers.
  • the insulins of the invention may parallel with rapid-acting insulins such as Apidra ®, NovoRapid ®, Humalog ® or under development insulin derivatives or formulations with appropriate time - / action profile or inhalable insulin or nasally or orally administered insulin, resulting in
  • the insulin analogs according to the invention can be used in pharmaceutical preparations which contain peptides which are described by activity comparable to GLP-1 (glucagon-like peptide-1) or exendin-4 or exendin-3.
  • GLP-1 glycol-like peptide-1
  • exendin-4 or exendin-3 examples of such peptides are GLP-1 (7-37), Exenatide (Byetta ®) or peptides, their production in the patent applications WO 2006/058620, WO 2001/04156, WO 2004/005342 and WO 98/08871 described, represents .
  • formulations which contain a depot formulation of these peptides are especially advantageous.
  • compositions according to the invention which, in parallel with the administration of the pharmaceuticals according to the invention, provide for increasing the insulin action, for example metformin.
  • Combination therapies with dipeptidyl peptidase-4 inhibitors, which increase the level of incretins, are also possible, as are combinations with sulfonylureas, which increase insulin secretion in the pancreas.
  • the delay insulins according to the invention can be used particularly advantageously if the regeneration of pancreatic beta cells from corresponding stem cells is initiated by application of differentiation factors. All of these applications are exemplary for the therapy of diabetes called and also subject of the invention.
  • Another object of the invention is thus the use of the insulins according to the invention in combination with other active ingredients for the treatment of diabetes, in particular diabetes type I or type II diabetes.
  • Another object of the invention is a pharmaceutical composition containing an insulin analog according to the invention, which is in particular an aqueous formulation or a powder.
  • the drug is a pharmaceutical preparation, which is preferably a solution or suspension for injection purposes; it is characterized by a content of at least one insulin analog according to the invention, and / or at least one of the physiologically acceptable salts thereof in dissolved, amorphous and / or crystalline - preferably in dissolved form.
  • the preparation preferably has a pH between about 2.5 and 8.5, more preferably between about 4.0 and 8.5, preferably contains a suitable isotonizing agent, a suitable preservative and optionally a suitable buffer, and preferably also a particular one Zinc ion concentration, in sterile aqueous solution.
  • Suitable isotonizing agents are, for example, glycerol, glucose, mannitol, NaCl, calcium or magnesium compounds such as CaCk, etc.
  • Suitable preservatives are e.g. Phenol, m-cresol, benzyl alcohol and / or p-hydroxybenzoic acid ester.
  • buffer substances in particular for the adjustment of a pH value between approximately 4.0 and 8.5, e.g. Sodium acetate, sodium citrate, sodium phosphate, etc. can be used. Otherwise, physiologically acceptable dilute acids (typically HCl) or alkalis (typically NaOH) are also suitable for adjusting the pH.
  • physiologically acceptable dilute acids typically HCl
  • alkalis typically NaOH
  • the preparation has a zinc content, it is preferred to be from 1 to 2 mg / ml, in particular from 1 ⁇ g / ml to 200 ⁇ g zinc / ml.
  • the addition of Zn allows the action profile of the invention
  • Insulin analogues affect surprisingly well. This allows preparations that differ in terms of total duration of action, the rate of onset of action and the profile of the effect curve and thus allow an individual adjustment of the patient. Another possibility results from the use of a "two-chamber insulin device", which allows the application of a formulation with rapid onset of action and / or slow shallow onset of action depending on the life situation.
  • Unmodified insulin preferably bovine, porcine or human insulin, in particular human insulin, or insulin analogs and derivatives thereof can also be admixed for the purpose of varying the active substance profile of the preparation according to the invention.
  • one or more exendin-4 derivatives or peptides characterized by GLP-1 (glucagon like peptide-1) -like activity, or directly corresponding to GLP-1, can be mixed.
  • Such drugs (preparations) are also the subject of the invention.
  • Preferred drug concentrations are those corresponding to about 1-1500, more preferably about 5-1000 and especially about 40-400 international units / ml.
  • the insulin analogs according to the invention are first prepared biotechnologically as a precursor which does not yet comprise the amide. It is well known to those skilled in the art that there are a variety of ways to make insulins.
  • the host cell systems used are bacteria, yeasts and plants or plant cells to be cultivated by fermentation. If cost considerations allow it, expression systems using animal cells as a host system are also conceivable. However, this requires a safe freedom from animal viruses. Thus, it is clear that the expression systems described by way of example represent only a small portion of the host / vector systems developed for the recombinant production of proteins.
  • host organisms can be selected from the plant kingdom of organisms of the first division Schizophyta containing Schizomycetes, bacteria or blue-green algae, organisms of the second division Phycophyta V. class Chlorophyceae, organisms of the second division Phycophyta VII. Class Rhodophyceae, organisms of the 3rd division Mycophyta , Organisms of the 5th division Bryophyta and organisms of the 7th division Spermatophyta.
  • European Patent Application EP-A 1 222 207 describes a plasmid pINT358d which codes for a pre-proinsulin comprising an altered C-peptide.
  • PCR polymerase chain reaction
  • Corresponding fusion proteins do not necessarily have to be produced intracellularly. It is clear to the person skilled in the art that such proteins can also be produced by bacterial expression with subsequent secretion into the periplasm and / or into the culture supernatant.
  • European Patent Application EP-A 1 364 029 describes this by way of example.
  • the proinsulin Precursors which lead to the analogs according to the invention are likewise provided by the invention.
  • the proinsulins produced in this way can in principle be converted into an insulin analogue precursor which comprises lysine or arginine in position AO and carries lysine or arginine at the C-terminal end of the B chain.
  • proinsulins according to the invention are present as inclusion bodies or soluble after intracellular expression in bacteria, these precursors must be folded into the correct conformation by in vitro folding before the processing and biochemical modification can be carried out.
  • the described fusion protein allows direct folding after denaturation by means of urea or guanidinium hydrochloride, folding intermediates are also the subject of the invention.
  • Another object of the invention is a method for producing the insulin analogs according to the invention, wherein a precursor of the insulin analog recombinant produced and enzymatically converted to a 2 - chain insulin precursor N-terminal to amino acid 1 of the A chain arginine or lysine carries and am C-terminal end of the B chain has a lysine or arginine, which is converted with arginine amide or lysine amide in the presence of an enzyme having trypsin activity in the amide and thus in the delay insulin according to the invention and highly purified by a biochemical purification process.
  • Proteins which are obtained by substitution of at least one naturally occurring amino acid residue with other amino acid residues and / or addition and / or Removing at least one amino acid residue from the corresponding otherwise identical naturally occurring protein are referred to as "analogs" of proteins, and the added and / or replaced amino acid residues may also be those that are not naturally occurring.
  • Proteins obtained by chemically modifying certain amino acid residues of parent proteins are referred to as "derivatives" of proteins
  • the chemical modification may be, for example, the addition of one or more particular chemical groups to one or more amino acids.
  • Fig. 1 Hypoglycaemic effect of new insulin analogues in rats
  • Fig. 2 Hypoglycemic effect of new insulin analogues in the dog
  • Fig. 3 Hypoglycemic effect of YKL205 in the dog
  • Fig. 4 Zinc-dependence of the hypoglycemic effect of YKL205 in the dog
  • Example 1 Preparation of vector derivative plNT3580 encoding GIy (A21) -insulin and a modified C-peptide carrying Arg Arg / C chain boundary.
  • European Patent Application EP-A 1 222 207 describes the plasmids pINT358d, pINT91d and the primer sequence Tir. DNA of these products is used in the construction of plasmid pINT3580.
  • the plasmid plNT358d is characterized by a gene sequence which codes for a modified C-peptide with special properties. Three primer sequences are synthesized:
  • This primer serves to introduce arginine instead of lysine at the insulin A / B chain boundary.
  • the codon for the arginine to be introduced is bold in both primers.
  • a PCR is carried out with the primer pairs Tir / arg_cjunc_rev and arg cjuncf / pint3580_glya21rev in accordance with European Patent Application EP-A 1 222 207. Aliquots of the products of both reactions are combined and used together with the primer pair Tir / pint3580_glya21rev in a third PCR.
  • the product of this reaction is purified by gel electrophoretic separation of the reaction mixture and digested with the restriction enzymes Sali / Nco1 according to the manufacturer in one and the same reaction, the reaction mixture gelelektrophoretisch separated and isolated the proinsulin sequence encoding DNA fragment. The fragment is then inserted via a DNA ligase reaction into the Nco1 / Sali opened plNT91d vector DNA.
  • Competent E. coli bacterial cells are transformed with the ligation mixture.
  • the transformation mixture is plated on selection plates containing 25 mg / l ampicillin. Plasmid DNA is isolated from colonies and characterized by DNA sequence analysis. Proper plasmids are named plNT3580.
  • Example 2 Construction of the plasmid pINT3581 encoding His (A8), Gly (A21) preproinsulin
  • the construction is carried out as described in Example 1 via 3 polymerase chain reactions.
  • the product of the third reaction is inserted after Nco1 / Sali digestion into the Nco1 / Sali opened plNT91d vector DNA.
  • the primers Tir and pint3580_glya21rev are used. Two more primers are synthesized:
  • PCR1 and 2 are DNA of plasmid pINT3580.
  • PCR1 is performed with the primer pair Tir / pint3580_Ha8rev and PCR2 with the primer pair pint3580_Ha8f / pint3580_glya21 rev.
  • primer pair Tir / pint3580_glya21 rev is used.
  • Template is a mixture of the reaction products of PCR1 and PCR2.
  • Proper plasmids are named plNT3581.
  • Example 3 Construction of the plasmid pINT3582 encoding His (A8), Glu (A5), Gly (A21) preproinsulin
  • the construction is carried out as described in Example 1 and 2 via 3 polymerase chain reactions.
  • the product of the third reaction is inserted after Nco1 / Sali digestion into the Nco1 / SaM opened plNT91d vector DNA.
  • the primers Tir and pint3580_glya21rev are used. Two more primers are synthesized: pint3581_Ea5f
  • Example 2 The construction is carried out deviating from Example 1 via only one polymerase chain reaction.
  • the product of this reaction is inserted after Nco1 / Sali digestion into the Nco1 / Sali opened plNT91d vector DNA.
  • the primer Tir is used.
  • Another primer is synthesized:
  • Template is DNA of plasmid pINT3581. Proper plasmids are named plNT3583.
  • Example 5 Construction of the plasmid pINT3584 encoding His (A8), Glu (A5) Asp (A18), Gly (A21) preproinsulin
  • the construction is carried out deviating from Example 1 via only one polymerase chain reaction.
  • the product of this reaction is inserted into the Nco1 / Sah opened plNT91d vector DNA after Nco1 / Saw digestion.
  • the primer Tir pint3580_Da18rev (example 4) is used.
  • Template is DNA of plasmid pINT3582.
  • Proper plasmids are named plNT3584.
  • the pre-proinsulin coded by the plasmid is precursor for the compound YKL205-1, which is formed after amidation with argininamide and describes the following structure:
  • the primer Tir is used.
  • Example 2 The construction is carried out deviating from Example 1 via only one polymerase chain reaction.
  • the product of this reaction is inserted into the Nco1 / Sah opened plNT91d vector DNA after Nco1 / Saw digestion.
  • the primer Tir is used.
  • Another primer is synthesized:
  • Plasmids plNT3581 Proper plasmids are named plNT3586.
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205, which is formed after amidation with arginine amide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205b, which, after amidation with lysineamide, forms the following structure:
  • Example 8 Construction of the plasmid pINT3587 encoding GIu (A5), His (A8), Glu (A15), Gly (A21) preproinsulin
  • the construction is carried out deviating from Example 1 via only one polymerase chain reaction.
  • the product of this reaction is inserted into the Nco1 / Sah opened plNT91d vector DNA after Nco1 / Saw digestion.
  • the primer T ⁇ r and pint3580_Ea15rev according to Example 6 are used.
  • Template is DNA of the plasmid pINT3582.
  • Proper plasmids are named plNT3587.
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-2, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-2b, which, after amidation with lysineamide, forms the following structure:
  • the construction is carried out as described in Example 1 and 2 via 3 polymerase chain reactions.
  • the product of the third reaction is inserted after Nco1 / SaM cleavage into the Nco1 / SaM opened plNT91d vector DNA.
  • the primers Tir and pint3580_glya21rev are used. Two more primers are synthesized:
  • the pre-proinsulin encoded by the plasmid is precursor to the compound
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-3b, which, after amidation with lysineamide, forms the following structure:
  • Plasmid pINT3590 Plasmid pINT3590.
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-4, which is formed after amidation with arginine amide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-4b, which, after amidation with lysineamide, forms the following structure:
  • the pre-proinsulin coded by the plasmid is precursor for the compound YKL205-5, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-5b, which is formed after amidation with lysinamide and describes the following structure:
  • the construction is carried out as described in Example 1 and 2 via 3 polymerase chain reactions.
  • the product of the third reaction is inserted after Nco1 / SaM cleavage into the Nco1 / Sah opened plNT91d vector DNA.
  • the primers Tir and pint3580_glya21rev are used. Two more primers are synthesized:
  • the codon which codes for aspartic acid in position 3 and glutamic acid in position 4 of the insulin B chain is shown in bold.
  • Template is DNA of plasmid pINT3581.
  • Proper plasmids are named plNT3592.
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-6, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin coded by the plasmid is precursor for the compound YKL205-6b, which is formed after amidation with lysinamide and describes the following structure:
  • the construction is carried out as described in Example 1 and 2 via 3 polymerase chain reactions.
  • the product of the third reaction is inserted after Nco1 / Sali digestion into the Nco1 / Sali opened plNT91d vector DNA.
  • the primers Tir and pint3580_glya21 rev are used. Two more primers are synthesized:
  • Example 15 Construction of plasmid pINT3594 encoding Glu (A5), His (A8), Gly (A21), Glu (B4) - preproinsulin.
  • the proinsulin is precursor for the compound YKL205-7, which arises after amidation with argininamide and describes the following structure:
  • the proinsulin is a precursor for the compound YKL205-7b, which is formed after amidation with lysinamide and which describes the following structure: Arg (AO), Glu (A5), His (A8), Gly (A21), Glu (B4), Arg ( B31), Lys (B32) - NH 2 - human insulin
  • the pre-proinsulin encoded by the plasmid is a precursor for the compound YKL205-8, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor to the compound
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-9, which is formed after amidation with arginine amide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-9b, which is formed after amidation with lysinamide and describes the following structure:
  • the construction takes place via 2 polymerase chain reactions.
  • the primer pint3580_glya21rev is used. Two more primers are synthesized:
  • Pint3581_Eb0f2 contains an Ncol recognition sequence. This is underlined. The codon used for Glutamic acid coded in position 0 at the beginning B chain is highlighted in bold.
  • Template for PCR1 is DNA of the plasmid plNT3581.
  • PCR1 is performed with the primer pair pint3581_Eb-1f2 / pint3580_glya21rev.
  • Template for PCR2 is the product of PCR1.
  • PCR2 is performed with the primer pair pint3581_Eb-1f2 / pint3580_glya21 rev.
  • the product from PCR2 outlines the complete preproinsulin sequence.
  • the product of the second reaction is inserted after Nco1 / SaM cleavage into the Nco1 / SaM opened plNT91d vector DNA.
  • Proper plasmids are named plNT3597. Replacing the codon for glutamic acid in position BO by the codon of aspartic acid and following the example, one arrives at plasmids carrying aspartic acid in position BO instead of glutamic acid.
  • the pre-proinsulin encoded by the plasmid is a precursor for the compound YKL205-10, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-10b, which is formed after amidation with lysinamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-11, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-11b, which, after amidation with lysineamide, forms the following structure:
  • plasmid pNT3600 is obtained.
  • the pre-proinsulin coded by the plasmid is precursor for the compound YKL205-12, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-12b, which is formed after amidation with lysinamide and describes the following structure:
  • Example 22 Construction of the plasmid pINT3601 coding for His (A8), Gly (A21), Asp (B1) - preproinsulin
  • the construction takes place via 2 polymerase chain reactions.
  • the primer pint3580_glya21rev is used. Two more primers are synthesized:
  • Pint3581_Db-1f2 contains an Ncol recognition sequence. This is underlined. The codon coding for aspartic acid in position 1 of the B chain is highlighted in bold.
  • Template for PCR1 is DNA of the plasmid plNT3581. PCR1 is performed with the primer pair pint3581_Db1f1 / pint3580_glya21rev. Template for PCR2 is the product of PCR1. PCR2 is performed with the primer pair pint3581_Db1f2 / pint3580_glya21 rev. The product from PCR2 covers the complete preproinsulin sequence.
  • the product of the second reaction is inserted after Nco1 / SaM cleavage into the Nco1 / Sah opened plNT91d vector DNA.
  • Proper plasmids are named plNT3601.
  • Example 23 Construction of the plasmid pINT3602 coding for Glu (A5), His (A8), Gly (A21), Asp (B1) preproinsulin
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-13, which is formed after amidation with arginine amide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-13b, which, after amidation with lysineamide, forms the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-14, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-14b, which is formed after amidation with lysinamide and describes the following structure:
  • Example 25 Construction of the plasmid pINT3604 encoding His (A8), Asp (A18), Gly (A21), Asp (B1) - preproinsulin
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-15, which is formed after amidation with argininamide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-15b, which, after amidation with lysineamide, forms the following structure:
  • Example 26 Construction of the plasmid pINT3605 coding for His (A8), Gly (A21), Glu (BO), Asp (B1) preproinsulin
  • the construction takes place via 2 polymerase chain reactions.
  • the primer pint3580_glya21rev and the primer pint3581_EbO1f2 described in Example 18 are used.
  • the primer pint3597_Db1f is synthesized: 5 -CAACAGGAA ATTCGGCACG AGAGGACGTG AACCAGCACC TGTGC-3 1 (SEQ ID NO: 23)
  • Template for PCR1 is DNA of plasmid pINT3597. PCR1 is performed with the primer pair pint3597_Db1f / pint3580_glya21 rev. Template for PCR2 is the product of PCR1. PCR2 is performed with the primer pair pint3581_Eb1f2 / pint3580_glya21rev. The product from PCR2 covers the complete preproinsulin sequence. The product of the second reaction is inserted into the Nco1 / Saw opened plNT91d vector DNA after Nco1 / Saw digestion. Proper plasmids are named plNT3605. The pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-16, which is formed after amidation with arginine amide and describes the following structure:
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-16b, which is formed after amidation with lysinamide and describes the following structure:
  • Example 27 Construction of the plasmid pINT3606 encoding His (A8), Glu (A15), Asp (A18), Gly (A21), of theThr (B30) preproinsulin
  • the construction is carried out as described in Example 1 and 2 via 3 polymerase chain reactions.
  • the primers Tir and pint3580_glya21rev are used. Two more primers are synthesized:
  • Template for PCR1 and PCR2 is DNA of the plasmid plNT3586.
  • PCR1 is performed with the primer pair of B30f / pint3580_glya21rev and PCR2 is performed with primer pair Tir / B30rev template.
  • the reaction is carried out with the primer pair Tir / pint3580_glya21rev.
  • the product from PCR3 covers the complete preproinsulin sequence.
  • the product of the third reaction is inserted after Nco1 / SaM cleavage into the Nco1 / SaM opened plNT91d vector DNA.
  • the pre-proinsulin encoded by the plasmid is precursor to the compound
  • the pre-proinsulin encoded by the plasmid is precursor for the compound YKL205-17b, which, after amidation with lysineamide, forms the following structure:
  • Example 30 Enzymatic processing of the folded preproinsulin to the 2-chain Arg (AO) insulin precursor whose C-terminal B chain end is characterized by lysine or arginine.
  • the enzymatic processing of the folded preproinsulin precursor is as described e.g. in Example 4 of WO91 / 03550.
  • the use of the trypsin variant described in WO 2007/031187 A1 proves to be particularly advantageous.
  • Example 31 Preparation of an Arg (AO), His (A8), Gly (A21), Arg (B31), Arg (B32) - NH 2 - human insulin
  • a standard reaction is performed as follows: 100 mg Arg (AO), Gly (A21), Arg (B31) insulin analog are dissolved in 0.95 ml arginine amide solution (446 g / L), 0.13 mL M Na acetate buffer (pH 5.8) and 2 ml of DMF were added. The reaction mixture is cooled to 12 ° C and by addition of 0.094 ml of trypsin (0.075 mg, Roche
  • the corresponding lysinamide compound is prepared analogously. However, it is based on an aqueous lysinamide stock solution containing dissolved 366g / L lysinamide.
  • Example 32 Formulation of the amidated induline derivatives
  • the compounds A solution was prepared as follows: The insulin derivative according to the invention was dissolved at a target concentration of 240 ⁇ 5 ⁇ M in 1 mM hydrochloric acid with 80 ⁇ g / ml zinc (as zinc chloride).
  • compositions were used as the solution medium: a) 1 mM hydrochloric acid b) 1 mM hydrochloric acid, 5 ⁇ g / ml zinc (added as zinc chloride or hydrochloric acid) c) 1 mM hydrochloric acid, 10 ⁇ g / ml zinc (added as zinc chloride or hydrochloric acid) d) 1 mM hydrochloric acid, 15 ⁇ g / ml zinc (added as zinc chloride or hydrochloric acid) e) 1 mM hydrochloric acid, 30 ⁇ g / ml zinc (added as zinc chloride or hydrochloric acid) f) 1 mM hydrochloric acid, 80 ⁇ g / ml zinc (as zinc chloride or hydrochloric acid g) 1 mM hydrochloric acid, 120 ⁇ g / ml zinc (added as zinc chloride or hydrochloric acid)
  • freeze-dried material was first about a 30% higher amount than due to the molecular weight and the desired
  • Target concentration of 240 ⁇ 5 ⁇ M the finished solution was transferred by means of a syringe with a 0.2 micron filter attachment in a sealed with a septum and a crimp cap sterile vial.
  • no optimization of the formulations e.g. with regard to an addition of isotonic agents, preservatives or buffer substances.
  • Example 33 Evaluation of the hypoglycemic effect of novel insulin analogues in the rat
  • the hypoglycemic effect of selected new insulin analogues is tested in male, healthy, normoglycemic Wistar rats.
  • Male rats A dose of 9 nmol / kg of an insulin analog is injected subcutaneously.
  • blood samples are taken from the animals and the blood sugar content is determined therein.
  • the experiment clearly shows (compare Fig. 1) that the insulin analog according to the invention used leads to a significantly delayed onset of action and a longer, uniform duration of action.
  • Example 34 Evaluation of the hypoglycemic effect of new insulin analogues in the dog
  • the hypoglycemic effect of selected new insulin analogues is tested in male, healthy, normoglycemic beagle dogs.
  • Male animals are injected subcutaneously with a dose of 6 nmol / kg of an insulin analogue.
  • blood samples are taken from the animals and the blood sugar content is determined therein.
  • the experiment clearly shows (compare Fig. 2) that the insulin analog according to the invention used leads to a significantly delayed onset of action and a longer, uniform duration of action.
  • Example 35 Evaluation of the hypoglycemic effect in dogs at twice the dose
  • hypoglycemic effect of selected new insulin analogues is tested in male, healthy, normoglycemic beagle dogs.
  • Male animals are injected subcutaneously with a dose of 6 nmol / kg and 12 nmol / kg of an insulin analogue.
  • blood samples are taken from the animals and the blood sugar content is determined therein.
  • Example 36 Evaluation of the hypoglycemic effect in dogs at different zinc concentrations in the formulation
  • FIG. 4 shows the result. Thereafter, the time-effect curve of the insulin analog according to the invention by the content of zinc ions in the formulation at the same concentration of insulin influence in such a way that at zero or low zinc content observed a rapid onset and the effect persists over 24 hours, while at higher zinc content low onset of action is observed and the insulin action persists well longer than 24 hours.

Abstract

Die Erfindung betrifft neue Insulinanaloga mit basalem Zeit-/Wirkungsprofil, die durch die Merkmale charakterisiert sind, dass a) das B-Kettenende aus einem amidierten basischen Aminosäurerest wie Lysin bzw. Argininamid besteht, b) zudem der N-terminale Aminosäurerest der Insulin A-Kette ein Lysin- oder Argininrest ist, c) die Aminosäureposition A8 durch einen Histidinrest besetzt wird, d) die Aminosäureposition A21 durch einen Glycinrest besetzt wird, und e) eine oder mehrere Substitutionen und/oder Additionen negativ geladener Aminosäurereste in den Positionen A5, A15, A18, B-1, B0, B1, B2, B3 und B4 erfolgt ist.

Description

Neue Insulinderivate mit extrem verzögertem Zeit- / Wirkungsprofil
Die Erfindung betrifft neue Insulinanaloga mit basalem Zeit- / Wirkungsprofil, ihre Herstellung und Verwendung.
Über die letzten Jahre hat die Zahl der Erkrankungen an Diabetes in einem geradezu epidemischen Ausmaß zugenommen. Aufgrund der Erkrankung kann es zu einer gravierenden Verkürzung der Lebenserwartung kommen. Menschen mit Diabetes müssen ihrem Körper oft Insulin von außen zuführen. Es ist sinnvoll, die Behandlung mit Insulin zu optimieren. Mittlerweile gibt es unterschiedliche Insuline mit spezifischen pharmakologischen Eigenschaften zur Behandlung. Praktischerweise werden die unterschiedlichen Insuline nach ihrer Wirkdauer unterschieden in kurzwirksame Insuline, schnellwirkende Insuline, langwirksame Insuline und Mischinsuline. Synonym verwendete Bezeichnungen für langwirksame Insuline sind Verzögerungsinsulin, Depotinsulin oder auch Basalinsulin. Die Wirkstoffe vieler dieser Insulinpräparate sind sogenannte Insulinanaloga, die vom humanen Insulin abgeleitet worden sind durch Substitution, Deletion und / oder Addition einer oder mehrerer Aminosäuren. Die Begriffe „Insulinanaloga" und „Insuline" werden hier synonym verwendet.
Das Konzept der intensivierten Insulintherapie versucht das Gesundheitsrisiko abzumindern, indem eine stabile Kontrolle des Blutzuckerspiegels durch frühe Gabe von Basalinsulinen angestrebt wird. Ein Beispiel für ein gängiges Basalinsulin ist das Medikament Lantus® (Wirkstoff: Insulin Glargin = GIy (A21), Arg (B31), Arg (B32) Humaninsulin). Generell gilt es, bei der Entwicklung neuer, verbesserter Basalinsuline die Zahl hypoglykämischer Ereignisse zu minimieren. Ein ideales Basalinsulin wirkt dabei sicher in jedem Patienten mindestens 24 Stunden. Idealerweise setzt die Insulinwirkung verzögert und mit einem möglichst flachen Zeit- / Wirkungsprofil ein, so dass die Gefahr einer kurzfristigen Unterzuckerung deutlich minimiert ist und die Applikation sogar ohne vorherige Einnahme von Nahrungsmitteln erfolgen kann. Eine gute Versorgung mit Basalinsulin ist dann gegeben, wenn die Insulinwirkung möglichst lange gleichbleibend anhält, d.h. der Körper mit einer konstanten Menge Insulin versorgt wird. Damit ist die Gefahr hypoglykämischer Ereignisse gering und eine patienten- und tagesspezifische Variabilität minimiert. Das pharmakokinetische Profil eines idealen Basalinsulins sollte also durch einen verzögerten Wirkeintritt und durch eine verzögerte, d.h. lang anhaltende und gleichmäßige Wirkung gekennzeichnet sein.
Jedoch zeigt - trotz der bereits erreichten therapeutischen Vorteile - keines der bisher beschriebenen Verzögerungsinsuline die pharmakokinetischen Eigenschaften eines idealen Basalinsulins. Wünschenswert sind Insuline, die ein solch flaches und lang andauerndes Zeit- / Wirkungsprofil haben, dass die Gefahr hypoglykämischer Ereignisse und der tagesabhängigen Varianz im Patienten weiter minimiert ist und die Wirkdauer weiter verzögert ist, so dass unter Umständen nicht mehr täglich Insulin verabreicht werden muss. Dies würde eine vereinfachte Behandlung von Diabetikern ermöglichen, insbesondere von älteren und pflegebedürftigen Diabetikern, die sich Insulin nicht mehr selber injizieren können und wäre somit auch von großem volkswirtschaftlichem Nutzen. In der frühen Phase des Diabetes Typ 2 wären solche Basalinsuline zudem nützlich. Kliniker berichten, dass die bei vielen Menschen vorhandene Phobie vor Spritzen sie davor zurückschrecken lässt, rechtzeitig mit der Insulintherapie zu beginnen. Als Konsequenz ergibt sich eine schlechte Blutzuckereinstellung, die diabetische Spätfolgen nach sich zieht. Ein Basalinsulin, das die Anzahl der durch Spritzen erfolgten Insulingaben vermindert, könnte bewirken, dass Patienten leichter die Insulintherapie annehmen.
Kohn et al. (Peptides 28 (2007) 935-948) beschreiben, dass man die Optimierung der Pharmakodynamik von Insulin dadurch erreichen kann, dass man Insulinanaloga herstellt , deren isoelektrischer Punkt (pl) durch Addition von Lysin oder Arginin an das B- Kettenende oder den N-Terminus der A und B- Kette in Richtung des alkalischen Bereichs verschoben ist, verglichen mit dem isoelektrischen Punkt von Humaninsulin (pl = 5,6), so dass die Löslichkeit unter physiologischen Bedingungen verringert ist und sich ein verlängertes Zeit- / Wirkungsprofil ergibt. Verbindung 18 aus Kohn et al. (Arg (AO), GIy (A21), Arg (B31), Arg (B32) Humaninsulin (pl experimentell bestimmt = 7,3; pl berechnet = 7,58) wird dabei als beste Verbindung im Sinne des Konzeptes dargestellt. Das hauptsächliche Ziel bei der Gestaltung neuer Insulinanaloga sehen Kohn et al. daher in der Addition von positiv geladenen Aminosäuren zur Aminosäuresequenz von Humaninsulin zwecks Erhöhung des isoelektrischen Punktes von pl = 5,6 in den neutralen Bereich.
Diesem Ziel bei der Gestaltung neuer Insulinanaloga entgegengerichtet ist die Substitution neutraler Aminosäuren in humanem Insulin durch saure Aminosäuren und / oder die Addition von sauren Aminosäuren, da solch eine Substitution und / oder Additionen den Effekt der Einführung positiv geladener Aminosäuren zumindest teilweise aufhebt. Es wurde nun aber überraschend gefunden, dass solche Insulinanaloga zu dem beschriebenen wünschenswerten basalen Zeit- / Wirkungsprofil führen, die durch die Merkmale charakterisiert sind, dass
• das B- Kettenende aus einem amidierten basischen Aminosäurerest wie Lysin bzw. Argininamid besteht, d.h. bei dem amidierten basischen Aminosäurerest am B- Kettenende liegt die Carboxylgruppe der endständigen Aminosäure in ihrer amidierten Form vor, und
• der N-terminale Aminosäurerest der Insulin A-Kette ein Lysin- oder Argininrest ist, und
• die Aminosäureposition A8 durch einen Histidinrest besetzt wird, und
• die Aminosäureposition A21 durch einen Glycinrest besetzt wird, und • zwei Substitutionen neutraler Aminosäuren durch saure Aminosäuren, zwei
Additionen negativ geladener Aminosäurereste oder je eine solche Substitution und eine solche Addition jeweils in den Positionen A5, A15, A18, B-1 , BO, B1 , B2, B3 und B4 erfolgt sind.
Während die ersten drei genannten Merkmale durch Einführen positiver Ladungen bzw. der Ausschaltung negativer Ladungen tendenziell Beiträge zu einer Erhöhung des pl - Wertes eines entsprechenden Insulinanalogs liefern, haben die letztgenannten Substitutionen und / oder Additionen negativ geladener Aminosäurereste den gegenteiligen Effekt und liefern Beiträge zu einer Erniedrigung des pl - Werts. Überraschenderweise haben gerade die oben beschriebenen
Insulinanaloga die gewünschten vorteilhaften Zeit - / Wirkungsprofile. Die pl - Werte dieser Verbindungen sind niedriger als die der Verbindung 18 aus Kohn et al. (Arg (AO), GIy (A21), Arg (B31), Arg (B32) - Humaninsulin), weisen aber nichtsdestotrotz dabei einen verzögerten Wirkeintritt und eine längere Wirkdauer, d.h. einen extrem flachen und lang andauernden, gleichmäßigen Wirkungsverlauf auf. Damit wird die Gefahr von hypoglykämischen Ereignissen deutlich minimiert. Die Verzögerung ist so deutlich, dass sich der Effekt überraschend sogar in Modellversuchen an Ratten nachweisen lässt, obwohl im Gegensatz dazu die verzögerte Wirkung von Insulin Glargin in der Ratte nicht eindeutig beobachtbar ist. In Figur 1 ist die hypoglykämische Wirkung der erfindungsgemäßen Verbindung YKL205 verglichen mit der von Insulin Glargin dargestellt. Ähnliche Ergebnisse werden im Hund erhalten (siehe Figur 2). Damit sind neue Basalinsuline bereitgestellt worden, die deutlich weniger häufig appliziert werden müssen. Neben diesen beschriebenen pharmakokinetischen Vorteilen weisen die erfindungsgemäßen Analoga gegenüber Insulin Glargin deutlich bessere Eigenschaften in pharmakologischer Hinsicht wie z.B. Rezeptorspezifität und in vitro Mitogenität auf. Ferner zeigen die beanspruchten Insuline auch in physikalisch - chemischer Hinsicht Vorteile.
Gegenstand der Erfindung ist somit ein Insulinanalogon der Formel I
1 5 I 101 15 20
AO G I V E A5 C C H S I C S L Y A15 L E Al 8 Y C G
I ( SEQ ID NO: D \ A-Kette
Figure imgf000005_0001
B-I BO Bl B2 B3 B4 H L C G S H L V E A L Y L V C G E R G F F Y 1 5 10 15 20 25
T P B29 B30 B31 B32 (SEQ ID NO: 2)
B-Kette 30
wobei
AO Lys oder Arg;
A5 Asp, GIn oder GIu;
A15 Asp, GIu oder GIn; A18 Asp, GIu oder Asn;
B-1 Asp, GIu oder eine Aminogruppe;
BO Asp, GIu oder eine chemische Bindung;
B1 Asp, GIu oder Phe;
B2 Asp, GIu oder VaI;
B3 Asp, GIu oder Asn;
B4 Asp, GIu oder GIn;
B29 Lys oder einer chemischen Bindung;
B30 Thr oder einer chemischen Bindung;
B31 Arg, Lys oder einer chemischen Bindung;
B32 Arg-Amid, Lys-Amid oder einer Aminogruppe
entspricht, wobei zwei Aminosäurereste der Gruppe enthaltend A5, A15, A18, B-1 , BO, B1 , B2, B3 und B4 gleichzeitig und unabhängig voneinander Asp oder GIu entsprechen.
Insbesondere sind Gegenstände der Erfindung Insulinanaloga wie oben ausgeführt, bei denen unabhängig voneinander AO Arg entspricht, oder wobei A5 GIu entspricht, oder wobei A15 GIu entspricht, oder wobei A18 Asp entspricht, oder wobei B-1 einer Aminogruppe entspricht, oder wobei BO GIu entspricht, oder wobei B1 Asp entspricht, oder wobei B2 VaI entspricht, oder wobei B3 Asp entspricht, oder wobei B4 GIu entspricht, oder wobei B29 Lys entspricht, oder wobei B30 Thr entspricht, oder wobei B31 Arg oder Lys entspricht. Besonders bevorzugter Gegenstand der Erfindung ist ein Insulinanalogon ausgewählt aus einer Gruppe enthaltend:
Arg (AO), His (A8), GIu (A5), Asp (A18), GIy (A21), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A5), Asp (A18), GIy (A21), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), Glu(A5), GIu (A15), GIy (A21), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIu (A15), GIy (A21), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His(A8), GIu (A5), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His(A8), GIu (A5), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His(A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO)1 His (A8), GIu (A5), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO)1 His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO)1 His (A8), GIu (A15), GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO)1 His (A8), Asp (A18), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18) ,GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Arg(B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO)1 His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO)1 His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIy (A21), GIu (BO)1 Asp (B1), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIy (A21), GIu (BO), Asp (B1), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B30), Arg (B31) - NH2 Humaninsulin, Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B30), Lys (B31) - NH2 Humaninsulin.
Durch die Angabe des Begriffs "Humaninsulin" in den Bezeichnungen der genannten Insulinanaloga wird Bezug auf die Aminosäuresequenzen der A- und B-Kette von Humaninsulin genommen und alle Abweichungen (Additionen, Substitutionen, Deletionen) davon sind in einer gegebenen Bezeichnung eines Insulinanalogons angegeben.
Ein weiterer Gegenstand der Erfindung ist ein Verfahren zur Herstellung eines Insulinanalogons wie oben genannt, insbesondere wobei ein Vorläufer des
Insulinanalogs rekombinant hergestellt wird, der Vorläufer enzymatisch zu zwei - kettigem Insulin prozessiert wird und eine Kupplung mit Argininamid in Gegenwart eines Enzyms mit Trypsinaktivität durchgeführt wird, und das Insulinanalogon isoliert wird..
Ein weiterer Gegenstand der Erfindung ist eine Verwendung eines Insulinanalogons wie oben beschrieben zur Herstellung eines Medikaments zur Behandlung von Diabetes, insbesondere von Diabetes Typ I oder Typ II. Ebenfalls ist Gegenstand der Erfindung eine Verwendung eines Insulinanalogons wie oben beschrieben zur Herstellung eines Medikaments zur Unterstützung der beta -Zellregeneration
Ein weiterer Gegenstand der Erfindung ist ein Arzneimittel enthaltend ein Insulinanalogon wie oben beschrieben und/oder physiologisch verträgliche Salze davon.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung des Insulinanalogons wie oben beschrieben, wobei die Formulierung in wässriger Form enthaltend das gelöste Insulinanalog vorliegt. Ein weiterer Gegenstand der Erfindung ist eine Formulierung des lnsulinanalogons wie oben beschrieben, wobei die Formulierung in Form von Pulver vorliegt.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, wobei das Insulinanalogon wie oben beschrieben in kristalliner und/oder amorpher Form vorhanden ist.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung des lnsulinanalogons wie oben beschrieben, wobei die Formulierung in Form einer Suspension vorliegt.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung des lnsulinanalogons wie oben beschrieben, wobei die Formulierung zusätzlich ein chemisches Chaperon enthält.
Ein weiterer Gegenstand der Erfindung ist eine DNA kodierend für einen Vorläufer eines lnsulinanalogons wie oben beschrieben, oder für die A-Kette oder B-Kette eines lnsulinanalogons wie oben beschrieben.
Ein weiterer Gegenstand der Erfindung ist ein Vektor enthaltend eine DNA wie oben beschrieben.
Ein weiterer Gegenstand der Erfindung ist ein Wirtsorganismus enthaltend eine DNA wie oben beschrieben oder einen Vektor wie oben beschrieben.
Ein weiterer Gegenstand der Erfindung ist ein Präproinsulinanalogon, dadurch gekennzeichnet, dass das C-Peptid an seinem N-Terminus den Aminosäurerest Arginin und an seinem C-Terminus zwei Argininreste oder einen Argininrest und einen Lysinrest trägt, wobei in letzterem Falle der Lysinrest den eigentlichen C- Terminus bildet.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, bei der noch zusätzlich ein Glucagon-Like Peptide-1 (GLP1) oder ein Analogon oder Derivat davon, oder Exendin-3 bzw. -4 oder ein Analogon oder Derivat davon, vorzugsweise Exendin-4 enthalten ist. Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend H-desPro36-Exendin-4-Lys6-NH2, H-des(Pro36 37)-Exendin-4-Lys4-NH2 und H-des(Pro36-37)-Exendin-4-Lys5-NH2, oder ein pharmakologisch tolerierbares Salz davon.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend desPro36 [Asp28]Exendin-4 (1-39), desPro36 [lsoAsp28]Exendin-4 (1-39), desPro36 [Met(O)14, Asp28]Exendin-4 (1-39), desPro36 [Met(O)14, lsoAsp28]Exendin-4 (1-39), desPro36 [TrP(O2)25, Asp28]Exendin-2 (1-39), desPro36 [Trp(O2)25, lsoAsp28]Exendin-2 (1-39), desPro36 [Met(O)14Trp(O2)25, Asp28]Exendin-4 (1-39) und desPro36 [Met(O)14Trp(O2)25, lsoAsp28]Exendin-4 (1-39), oder ein pharmakologisch tolerierbares Salz davon.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie im vorigen Absatz beschrieben, bei denen an die C-Termini der Analoga von Exendin-4 das Peptid -
Lys6-NH2 angefügt ist.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend H-(LyS)6- des Pro36 [Asp28]Exendin-4(1-39)-Lys6-NH2 des Asp28Pro36, Pro37, Pro38 Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39) -NH2, H-Asn-(Glu)5 des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36 [TrP(O2)25, Asp28]Exendin-4(1-39)-Lys6-NH2, H- des Asp28 Pro36, Pro37, Pro38 [Tφ(θ2)25]Exendin-4(1-39) _NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin^(1-39) -NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 P~rp(O2)25, Asp28]Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [TrP(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36, Pro37, Pro38 [TrP(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36 [Met(O)14, Asp28]Exendin-4(1-39)-Lys6-NH2, des Met(O)14 Asp28 Pro 36, Pro37, Pro38 Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36, Pro 37, Pro38 [Met(O)14, Asp28]Exendin^l(1 -39) -NH2,
H-ASn-(GIu)5- des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Met(O)14, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Met(O)14, Asp28]Exendin-4(1-39)-Lys6-NH2, H-Asn-(Glu)5 des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36 [Met(O)14, Trp(O2)25, Asp28]Exendin-4(1-39)-Lys6-NH2, des Asp28 Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25]Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36' Pro37, Pro38 [Met(O)14, Tφ(O2)25, Asp28]Exendin-4(1-39) -NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36' Pro37, Pro38 [Met(O)14, Tφ(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-
NH2,
H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25, Asp28] Exendin-4(1-39)-
(LyS)6-NH2, oder ein pharmakologisch tolerierbares Salz davon.
Ein weiterer Gegenstand der Erfindung ist eine Formulierung wie oben beschrieben, bei dem zusätzlich Arg34, Lys26 (Nε(γ-glutamyl(Nα-hexadecanoyl))) GLP-1 (7-37) [liraglutide] oder ein pharmakologisch tolerierbares Salz davon enthalten ist.
Dem Fachmann ist dabei klar, dass die erfindungsgemäßen Insuline Gegenstand einer pharmazeutischen Formulierung sein können, die nach Applikation vorteilhaft wirkt. Dabei geht man von wässrigen Lösungen aus. Entsprechend müssen weitere Komponenten mischbar sein. Die Gefahr viraler tierischer Kontamination wird dadurch minimiert, dass die Zubereitung keine Komponenten enthalten sollte, die aus tierischen Quellen stammen. Es ist weiterhin vorteilhaft, durch Zusatz von Konservierungsmitteln eine mikrobielle Verunreinigung zu verhindern. Durch den Zusatz isotoner Agentien kann eine mögliche negative Auswirkung der Formulierung auf die Physiologie der Gewebezellen an der Applikationsstelle kompensiert werden. Stabilisierend kann sich der Zusatz von Protamin auswirken, so dass man weitgehend salzfreien Insulinzubereitung gelangen kann, wenn man der Formulierung Protamin zufügt. Der Zusatz von einer phenolischen Komponente kann zu einer Stabilisierung der Struktur des verwendeten Insulinanalogons führen und so unter anderem den Verzögerungseffekt beim Wirkungseintritt zusätzlich bewirken. Der Formulierung zugesetzt können auch Substanzen sein, die die Raumstruktur der erfindungsgemäßen Verzögerungsinsuline stabilisieren und zu besserer thermischen Stabilität führen. Solche chemischen Chaperone können z.B. kurze synthetische Peptide, die auch Aminosäureanaloga enthalten können oder z.B. vom C-Peptid des Insulin abgeleitete Peptidsequenzen umfassen.
Zur Entwicklung von Depotformen können die erfindungsgemäßen Insuline in Nanopartikel eingebunden werden. Denkbar sind auch sogenannte „Slow release" Formuierungen, bei denen das erfindungsgemäße Verzögerungsinsulin reversibel an polymere Träger gebunden vorliegt.
Die erfindungsgemäßen Insuline können parallel zu schnellwirksamen Insulinen wie Apidra®, NovoRapid®, Humalog ® oder sich in Entwicklung befindlichen Insulinderivaten oder Formulierungen mit entsprechendem Zeit - / Aktionsprofil oder inhalierbarem Insulin oder nasal oder oral applizierten Insulinen, die sich in
Entwicklung befinden, verabreicht werden. Dabei ist es dem Fachmann klar, dass dazu auch entsprechend formulierte Mischungen aus schnellwirksamen und erfindungsgemäßem Verzögerungsinsulin verwendet werden können. Weiterhin können die erfindungsgemäßen Insuinanaloga in pharmazeutischen Zubereitungen verwendet werden, die Peptide, die durch eine dem GLP-1 (Glucagon like Peptide-1) oder dem Exendin-4 bzw. Exendin-3 vergleichbare Aktivität beschrieben sind, enthalten. Beispiele für solche Peptide stellen GLP-1 (7-37), Exenatide (Byetta®) oder Peptide, deren Herstellung in den Patentanmeldungen WO 2006/058620, WO 2001/04156, WO 2004/005342 und WO 98/08871 beschrieben ist, dar. Besonders vorteilhaft sind dabei Formulierungen, die eine Depotformulierung dieser Peptide enthalten. Vorteilhaft besonders in der Anfangsphase der Typll Diabetes Erkrankung sind Therapieformen, die parallel zu Verabreichung der erfindungsgemäßen Pharmazeutika vorsehen, die die Insulinwirkung erhöhen, wie z.B. Metformin. Kombinationstherapien mit Dipeptidyl Peptidase-4 Inhibitoren, die den Spiegel an Inkretinen erhöhen, sind wie Kombinationen mit Sulfonylharnstoffen, die die Insulinausschüttung im Pankreas erhöhen, ebenfalls möglich. Besonders vorteilhaft können die erfindungsgemäßen Verzögerungsinsuline dann eingesetzt werden, wenn durch Applikation von Differenzierungsfaktoren, die Regeneration von pankreatischen Betazellen aus entsprechenden Stammzellen eingeleitet wird. All diese Anwendungen sind beispielhaft für die Therapie des Diabetes genannt und ebenfalls Gegenstand der Erfindung. Ein weiterer Gegenstand der Erfindung ist somit die Verwendung der erfindungsgemäßen Insuline in Kombination mit anderen Wirkstoffen zur Behandlung von Diabetes, insbesondere Diabetes Typ I oder Typ Il Diabetes.
Ein weiterer Gegenstand der Erfindung ist ein Arzneimittel, das ein erfindungsgemäßes Insulinanalogon enthält, welches insbesondere eine wässrige Formulierung oder ein Pulver darstellt.
Das Arzneimittel ist eine pharmazeutische Zubereitung, die vorzugsweise eine Lösung oder Suspension zu Injektionszwecken ist; sie ist gekennzeichnet durch einen Gehalt an mindestens einem erfindungsgemäßen Insulinanalog, und/oder mindestens einem von deren physiologisch verträglichen Salzen in gelöster, amorpher und/oder kristalliner - vorzugsweise in gelöster -Form.
Die Zubereitung weist vorzugsweise einen pH-Wert zwischen etwa 2,5 und 8,5, insbesondere zwischen etwa 4,0 und 8,5 auf, enthält vorzugsweise ein geeignetes Isotonisierungsmittel, ein geeignetes Konservierungsmittel und gegebenenfalls einen geeigneten Puffer, sowie vorzugsweise auch eine bestimmte Zinkionen- Konzentration, in steriler wässriger Lösung. Die Gesamtheit der Zubereitungsbestandteile außer dem Wirkstoff bildet den Zubereitungs-Träger. Geeignete Isotonisierungsmittel sind z.B. Glycerin, Glukose, Mannit, NaCI, Calcium- oder Magnesium-Verbindungen wie CaCk etc. Durch die Wahl des Isotonisierungsmittels und/oder Konservierungsstoffes beeinflusst man die Löslichkeit der erfindungsgemäßen Insuline bzw. deren physiologisch verträgliche Salze bei schwach sauren pH-Werten.
Geeignete Konservierungsmittel sind z.B. Phenol, m-Cresol, Benzylalkohol und/oder p-Hydroxybenzoesäureester.
Als Puffersubstanzen, insbesondere zur Einstellung eines pH-Wertes zwischen etwa 4,0 und 8,5 können z.B. Natriumacetat, Natriumeitrat, Natriumphosphat etc. verwendet werden. Ansonsten sind zur Einstellung des pH-Wertes auch physiologisch unbedenkliche verdünnte Säuren (typischerweise HCl) bzw. Laugen (typischerweise NaOH) geeignet.
Wenn die Zubereitung einen Zinkgehalt besitzt, ist ein solcher von 1 bis 2 mg/ml, insbesondere von 1 μg/ml bis 200 μg Zink/ml bevorzugt. Über den Zusatz von Zn lässt sich das Wirkprofil der erfindungsgemäßen
Insulinanaloge überraschend gut beeinflussen. Dies erlaubt Zubereitungen, die sich in Bezug auf Gesamtwirkungsdauer, die Geschwindigkeit des Wirkungseintritts und das Profil der Wirkungskurve unterscheiden und so eine individuelle Einstellung des Patienten erlauben. Eine andere Möglichkeit ergibt sich durch den Einsatz eines „Zweikammer - Insulin - Device", das die Applikation einer Formulierung mit schnellem Wirkeintritt und / oder langsamem flachen Wirkeintritt je nach Lebenssituation erlaubt.
Zwecks Variation des Wirkstoffprofils der erfindungsgemäßen Zubereitung kann auch unmodifiziertes Insulin, vorzugsweise Rinder-, Schweine- oder Human-Insulin, insbesondere Humaninsulin, oder Insulinanaloga und Derivate davon zugemischt werden. Ebenfalls können ein oder mehrere Exendin-4 Derivate oder Peptide, die durch eine dem GLP-1 (Glucagon like peptide-1) vergleichbare Aktivität charakterisiert sind, oder direkt GLP-1 entsprechen, zugemischt werden. Solche Arzneimittel (Zubereitungen) sind ebenfalls Gegenstand der Erfindung.
Bevorzugte Wirkstoffkonzentrationen sind solche entsprechend etwa 1 - 1500, weiter bevorzugt etwa 5 - 1000 und insbesondere etwa 40 - 400 internationale Einheiten/ml. Die erfindungsgemäßen Insulinanaloga werden zunächst als Vorstufe, die noch nicht das Amid umfasst, biotechnologisch hergestellt. Dem Fachmann ist geläufig, das es eine Vielzahl von Möglichkeiten zur Herstellung von Insulinen gibt. Als Wirtszellsysteme finden dabei Bakterien, Hefen und Pflanzen bzw. fermentativ zu kultivierende Pflanzenzellen Verwendung. Falls die Kostenbetrachtung es erlaubt sind auch Expressionssysteme, die tierische Zellen als Wirtssystem nutzen, denkbar. Voraussetzung dafür ist aber eine sichere Freiheit von tierischen Viren. Somit ist klar, dass die beispielhaft beschriebenen Expressionssysteme nur einen kleinen Ausschnitt der für die rekombinante Herstellung von Proteinen entwickelten Wirts/Vektorsysteme darstellen. In der Anmeldung werden z.B. biotechnologische Verfahren, die Hefe- oder Pflanzensysteme wie Moose, Algen oder höhere Pflanzen wie Tabak, Erbse, Distel, Gerste, Mais oder Raps zur Grundlage haben nicht beschrieben. Dennoch sind Wirts/Vektor Systeme sowie kodierende DNA - Sequenzen, die die Herstellung der Zielpeptide in entsprechenden biotechnologischen Expressionssystemen erlauben, ebenfalls Bestandteil der Erfindung. Wirtsorganismen können also insbesondere ausgewählt werden aus dem Pflanzenreich aus Organismen der ersten Abteilung Schizophyta enthaltend Schizomycetes, Bakterien oder Blaualgen, Organismen der 2. Abteilung Phycophyta V. Klasse Chlorophyceae, Organismen der 2. Abteilung Phycophyta VII. Klasse Rhodophyceae, Organismen der 3. Abteilung Mycophyta, Organismen der 5. Abteilung Bryophyta und Organismen der 7. Abteilung Spermatophyta.
In der Europäischen Patentanmeldung EP-A 1 222 207 ist ein Plasmid plNT358d beschrieben, das für ein Prä - Proinsulin codiert, welches ein verändertes C-Peptid umfasst. Mit Hilfe der Polymerase Kettenreaktion (PCR) ist es nun möglich, gezielt die das Proinsulin kodierende Sequenz so zu verändern, dass Prä - Proinsuline exprimiert werden können, die als Vorstufen für die erfindungsgemäßen Insuline dienen können. Entsprechende Fusionsproteine müssen nicht notwendigerweise intrazellulär hergestellt werden. Es ist dem Fachmann klar, dass solche Proteine auch durch bakterielle Expression mit anschließender Sekretion in das Periplasma und/oder in den Kulturüberstand hergestellt werden können. Die Europäische Patentanmeldung EP-A 1 364 029 beschreibt dies beispielhaft. Die Proinsulin- Vorstufen, die zu den erfindungsgemäßen Analoga führen, sind ebenfalls Gegenstand der Erfindung.
Die so hergestellten Proinsuline können prinzipiell zu einer Insulinanalogavorstufe umgewandelt werden, die in Position AO Lysin oder Arginin umfasst und am C- terminalen Ende der B - Kette Lysin oder Arginin trägt.
Liegen die erfindungsgemäßen Proinsuline nach intrazellulärer Expression in Bakterien als Einschlusskörper oder löslich vor, müssen diese Vorstufen durch in vitro Faltung in die richtige Konformation gefaltet werden, bevor die Prozessierung und biochemische Modifikation vorgenommen werden kann. Dabei erlaubt das beschriebene Fusionsprotein eine direkte Faltung nach Denaturierung mittels Harnstoff oder Guanidinium Hydrochlorid, Faltungsintermediate sind dabei ebenfalls Gegenstand der Erfindung.
Zur Anreicherung der einzelnen Zwischenstufen finden biochemische Methoden insbesondere Trennverfahren Verwendung, deren zugrunde liegenden Prinzipien publiziert und sogar Gegenstand von Lehrbüchern sind. Dem Fachmann ist klar, dass solche Prinzipien in Folge kombiniert werden können und so zu Verfahren führen können, die in ihre Abfolge vorher nicht publiziert wurden. Verfahren, die zur Reinigung der erfindungsgemäßen Analoga führen sind somit ebenfalls Gegenstand der Erfindung.
Ein weiterer Gegenstand der Erfindung ist ein Verfahren zur Herstellung der erfindungsgemäßen Insulinanaloga, wobei ein Vorläufer des Insulinanalogons rekombinant hergestellt und enzymatisch zu einer 2 - kettigen Insulinvorstufe umgewandelt wird, die N-terminal zu Aminosäure 1 der A- Kette Arginin bzw. Lysin trägt und am C-terminalen Ende der B-Kette einen Lysin oder Argininrest aufweist, der mit Argininamid oder Lysinamid in Gegenwart eines Enzyms mit Trypsinaktivität in das Amid und somit in das erfindungsgemäße Verzögerungsinsulin überführt und über ein biochemischer Reinigungsverfahren hochrein dargestellt wird.
Proteine, welche sich durch Substitution wenigstens eines natürlich auftretenden Aminosäurerestes mit anderen Aminosäureresten und/oder Addition und/oder Entfernen wenigstens eines Aminosäurerestes von dem entsprechenden, ansonsten gleichen natürlich vorkommenden Protein unterscheiden, werden als .Analoga" von Proteinen bezeichnet. Dabei kann es sich bei den hinzugefügten und / oder ersetzten Aminosäureresten auch um solche handeln, die nicht natürlich vorkommen.
Proteine, welche durch chemische Modifizierung bestimmter Aminosäurereste von Ausgangsproteinen erhalten werden, bezeichnet man als „Derivate" von Proteinen. Die chemische Modifikation kann z.B. in der Addition einer oder mehrerer bestimmter chemischer Gruppen an eine oder mehrere Aminosäuren bestehen.
Figurenlegende:
Fig. 1 : Blutzuckersenkende Wirkung von neuen Insulinanaloga in Ratten Fig. 2: Blutzuckersenkende Wirkung von neuen Insulinanaloga im Hund Fig. 3: Blutzuckersenkende Wirkung von YKL205 im Hund Fig. 4: Zinkabhängigkeit der hypoglykämischen Wirkung von YKL205 im Hund
Die folgenden Beispiele sollen den Erfindungsgedanken illustrieren, ohne dabei beschränkend zu wirken.
Beispiel 1 : Herstellung des Vektorderivates plNT3580, das für GIy (A21) - Insulin und ein modifiziertes C-Peptid, das an der C/A- Kettengrenze Arg Arg trägt, kodiert.
Die Europäische Patentanmeldung EP-A 1 222 207 beschreibt die Plasmide plNT358d, plNT91d und die Primer - Sequenz Tir. DNA dieser Produkte findet Verwendung in der Konstruktion des Plasmides plNT3580. Das Plasmid plNT358d ist dabei durch eine Gensequenz charakterisiert, die für ein modifiziertes C-Peptid mit besonderen Eigenschaften kodiert. Drei Primersequenzen werden synthetisiert:
pint3580_glya21rev
5'- CAAAGGTCGACTATTAGCCGCAGTAGTTCTCCAGCTGG-S' (SEQ ID NO: 3) Dieser Primer dient nach Aufarbeitung dazu in Position 21 der A-Kette der von plNT358d kodierten Proinsulinsequenz Glycin (fett gedruckt, unterstrichen) anstelle von Asparagin einzuführen. arg_cjuncf
δ'-GTCCCTGCAGCGTCGCGGCATCGTGGAGCAG-S' (SEQ ID NO: 4)
Dieser Primer dient, wie der Primer arg cjunc rev, zur Einführung von Arginin anstelle von Lysin an der Insulin A-/ B- Kettengrenze.
arg_cjunc_rev
5'- CCACGATGCC GCGACGCTGC AGGGACCCCT CCAGCG-3' (SEQ ID NO: 5)
Das Codon für das einzuführende Arginin ist in beiden Primern fett gedruckt. Mit DNA des Plasmides plNT358d als Matrize wird mit den Primerpaaren Tir / arg_cjunc_rev und arg cjuncf / pint3580_glya21rev entsprechend der Europäischen Patentanmeldung EP-A 1 222 207 je eine PCR durchgeführt. Aliquots der Produkte beider Reaktionen werden kombiniert und zusammen mit dem Primerpaar Tir / pint3580_glya21rev in einer dritten PCR eingesetzt. Das Produkt dieser Reaktion wird nach gelektrophoretischer Auftrennung des Reaktionsgemisches gereinigt und mit den Restriktionsenzymen Sali / Nco1 nach Angaben des Herstellers in ein und derselben Reaktion verdaut, das Reaktionsgemisch gelelektrophoretisch aufgetrennt und das die Proinsulinsequenz kodierende DNA - Fragment isoliert. Das Fragment wird anschließend über eine DNA- Ligasereaktion in die Nco1 / Sali geöffnete plNT91d Vektor DNA insertiert.
Mit dem Ligationsgemisch werden kompetente E. coli Bakterienzellen transformiert. Das Transformationsgemisch wird auf Selektionsplatten, die 25 mg/ 1 Ampicillin enthalten, ausplattiert. Plasmid DNA wird von Kolonien isoliert und mittels DNA - Sequenzanalyse charakterisiert. Richtige Plasmide erhalten die Bezeichnung plNT3580. Beispiel 2: Konstruktion des Plasmides plNT3581 kodierend für His (A8), GIy (A21) - Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 beschrieben über 3 Polymerase Kettenreaktionen. Das Produkt der dritten Reaktion wird nach Nco1/ Sali Spaltung in die Nco1 / Sali geöffnete plNT91d Vektor DNA insertiert. Verwendet werden die Primer Tir und pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
pint3580_Ha8f
5'-AGCAGTGCTGCCACAGCATCTGCTCCCTCTAC-31 (SEQ ID NO: 6)
pint3580_Ha8rev
5'-GAG CAGATGCT GTG GCAGCACTG CTCCACGATG-3' (SEQ ID NO: 7)
Das Codon, das für Histidin in Position 8 der A- Kette kodiert ist jeweils fett herausgestellt. Die Konstruktion wird wie ins Beispiel 1 beschrieben durchgeführt. Template für PCR1 und 2 ist DNA des Plasmides plNT3580. PCR1 wird mit dem Primerpaar Tir/ pint3580_Ha8rev und PCR2 mit dem Primerpaar pint3580_Ha8f/ pint3580_glya21 rev durchgeführt. In PCR3 wird das Primerpaar Tir/ pint3580_glya21 rev eingesetzt. Template ist dabei ein Gemisch der Reaktionsprodukte von PCR1 und PCR2. Richtige Plasmide erhalten die Bezeichnung plNT3581.
Beispiel 3: Konstruktion des Plasmides plNT3582 kodierend für His (A8), GIu (A5), GIy (A21) - Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 und 2 beschrieben über 3 Polymerase Kettenreaktionen. Das Produkt der dritten Reaktion wird nach Nco1/ Sali Spaltung in die Nco1 / SaM geöffnete plNT91d Vektor DNA insertiert. Verwendet werden die Primer Tir und pint3580_glya21rev. Zwei weitere Primer werden synthetisiert: pint3581_Ea5f
5 'GCATCGTGGAGGAGTGCTGCCACAGCATCTG 3' (SEQ ID NO: 8) pint3581_Ea5rev
5'-CTGT GGCAGCACTC CTCCACGATG CCGCGACG-3' (SEQ ID NO: 9)
Das Codon, das für Glutaminsäure in Position 5 der A- Kette kodiert, ist jeweils fett herausgestellt. Die Konstruktion wird wie ins Beispiel 1 beschrieben durchgeführt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3582.
Beispiel 4: Konstruktion des Plasmides plNT3583 kodierend für His (A8), Asp (A18), Gly(A21) - Präproinsulin
Die Konstruktion erfolgt abweichend von Beispiel 1 über nur eine Polymerase Kettenreaktion. Das Produkt dieser Reaktion wird nach Nco1/ Sali Spaltung in die Nco1 / Sali geöffnete plNT91d Vektor DNA insertiert. Verwendet wird der Primer Tir. Ein weiterer Primer wird synthetisiert:
pint3580_Da18rev
5' CAAAGGTCGACTATTAGCCGCAGTAGTCCTCCAGCTGGTAGAGGGAG 3' (SEQ ID NO: 10)
Das Codon, das für Asparaginsäure in Position 18 der A- Kette kodiert, ist fett herausgestellt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3583.
Beispiel 5: Konstruktion des Plasmides plNT3584 kodierend für His (A8), GIu (A5) Asp (A18), GIy (A21) - Präproinsulin Die Konstruktion erfolgt abweichend von Beispiel 1 über nur eine Polymerase Kettenreaktion. Das Produkt dieser Reaktion wird nach Nco1/ Sah Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Verwendet wird der Primer Tir pint3580_Da18rev (Bsp.4). Template ist DNA des Plasmides plNT3582. Richtige Plasmide erhalten die Bezeichnung plNT3584. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-1 , die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), Asp(A18), Gly(A21), Arg(B31), Arg(B32)-NH2 - Humaminsulin
Entsprechende Amidierung mit Lysinamid führt zur Verbindung YKL205-1b:
Arg (AO), GIu (A5), His (A8), Asp (A18), Gly(A21), Arg (B31), Lys (B32)-NH2 - Humaninsulin
Beispiel 6: Konstruktion des Plasmides plNT3585 kodierend für His (A8), GIu (A15),
GIy (A21) - Präproinsulin
Die Konstruktion erfolgt abweichend von Beispiel 1 über nur eine Polymerase
Kettenreaktion. Das Produkt dieser Reaktion wird nach Nco1/ Sah Spaltung in die
Nco1 / Sali geöffnete plNT91d Vektor DNA insertiert. Verwendet wird der Primer Tir.
Ein weiterer Primer wird synthetisiert:
pint3580_Ea15rev
5'- CAAAGGTCGA CTATTAGCCG CAGTAGTTCTCCAGCTCGTA GAGGGAGCAG ATGCTG -3' (SEQ ID NO: 11)
Das Codon, das für Glutaminsäure in Position 15 der A- Kette kodiert, ist fett herausgestellt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3585. Beispiel 7: Konstruktion des Plasmides plNT3586 kodierend für His (A8), GIu (A15), Asp (A18), GIy (A21) - Präproinsulin
Die Konstruktion erfolgt abweichend von Beispiel 1 über nur eine Polymerase Kettenreaktion. Das Produkt dieser Reaktion wird nach Nco1/ Sah Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Verwendet wird der Primer Tir. Ein weiterer Primer wird synthetisiert:
pint3585_Ea15_Da18rev
5'- CAAAGGTCGACTATTAGCCGCAGTAGTCCTCCAGCTCGTAGAGGGAGCAG ATGCTG -3' (SEQ ID NO: 12)
Das Codon, für Glutaminsäure in Position 15 der A- Kette und Asparaginsäure in Position A18 der A- Kette ist jeweils fett herausgestellt. Template ist DNA des
Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3586. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 8: Konstruktion des Plasmides plNT3587kodierend für GIu (A5), His (A8), GIu (A15), GIy (A21) - Präproinsulin Die Konstruktion erfolgt abweichend von Beispiel 1 über nur eine Polymerase Kettenreaktion. Das Produkt dieser Reaktion wird nach Nco1/ Sah Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Verwendet wird der Primer Tϊr und pint3580_Ea15rev gemäß Beispiel 6. Template ist DNA des Plasmides plNT3582. Richtige Plasmide erhalten die Bezeichnung plNT3587. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205 -2, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIu (A15), GIy (A21), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205 -2b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIu (A15), GIy (A21), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 9: Konstruktion des Plasmides plNT3588 kodierend für His (A8), GIy (A21), Asp (B3)- Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 und 2 beschrieben über 3 Polymerase Kettenreaktionen. Das Produkt der dritten Reaktion wird nach Nco1/ SaM Spaltung in die Nco1 / SaM geöffnete plNT91d Vektor DNA insertiert. Verwendet werden die Primer Tir und pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
pint3581_Db3f
5'- GCACGATTTGTGGACCAGCACCTGTGCGGC -3' (SEQ ID NO: 13)
pint3581_Db3rev
5'- CACAGG TGCTGGTCCA CAAATCGTGC CGAATTTC -3' (SEQ ID NO: 14) Das Codon, das für Asparaginsäure in Position 3 der Insulin B- Kette kodiert ist jeweils fett herausgestellt. Die Konstruktion wird wie ins Beispiel 1 beschrieben durchgeführt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3588.
Beispiel 10: Konstruktion des Plasmides plNT3589 kodierend für GIu (A5), His (A8), GIy (A21), Asp (B3)- Präproinsulin
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2 DNA des Plasmides plNT3582 als Template, so gelangt man zu Plasmid plNT3589.
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung
YKL205-3, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-3b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 11 : Konstruktion des Plasmides plNT3590 kodierend für His (A8), GIu (A15), GIy (A21), Asp (B3) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2 DNA des Plasmides plNT3585 als Template, so gelangt man zu Plasmid plNT3590. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-4, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-4b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 12: Konstruktion des Plasmides plNT3591 kodierend für His (A8), Asp (A18), GIy (A21), Asp (B3)- Präproinsulin
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2 DNA des Plasmides plNT3586 als Template, so gelangt man zu Plasmid plNT3591. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-5, die nach Amidierung mit Argininamid entsteht und folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-5b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2 - Humaninsulin Beispiel 13: Konstruktion des Plasmides plNT3592 kodierend für His (A8), GIy (A21), Asp (B3)- GIu (B4) - Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 und 2 beschrieben über 3 Polymerase Kettenreaktionen. Das Produkt der dritten Reaktion wird nach Nco1/ SaM Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Verwendet werden die Primer Tir und pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
pint3581_Db3_Eb4f
5 - GCACGATTTGTGGACGAGCACCTGTGCGGCTC -3' (SEQ ID NO: 15)
pint3581_Db3_Eb4rev
5 - CGCACAGG TGCTCGTCCA CAAATCGTGC CGAATTTC -3' (SEQ ID NO: 16)
Das Codon, das für Asparaginsäure in Position 3 und Glutaminsäure in Position 4 der Insulin B- Kette kodiert, ist jeweils fett herausgestellt Die Konstruktion wird wie in Beispiel 1 beschrieben durchgeführt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3592. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-6, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO)1 His (A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-6b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Lys (B32) - NH2 - Humaninsulin Beispiel 14: Konstruktion des Plasmides plNT3593 kodierend für His (A8), GIy (A21), GIu (B4) - Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 und 2 beschrieben über 3 Polymerase Kettenreaktionen. Das Produkt der dritten Reaktion wird nach Nco1/ Sali Spaltung in die Nco1 / Sali geöffnete plNT91d Vektor DNA insertiert. Verwendet werden die Primer Tir und pint3580_glya21 rev. Zwei weitere Primer werden synthetisiert :
pint3581_Eb4f
5 - ACGATTTGTGAACGAGCACCTGTGCGGCTC -3' (SEQ ID NO: 17)
pint3581_Eb4rev
5'- CGCACAGG TGCTCGTTCA CAAATCGTGC CGAATTTC -3' (SEQ ID NO: 18)
Das Codon, das für Glutaminsäure in Position 4 der Insulin B- Kette kodiert, ist fett herausgestellt. Die Konstruktion wird wie ins Beispiel 1 beschrieben durchgeführt. Template ist DNA des Plasmides plNT3581. Richtige Plasmide erhalten die Bezeichnung plNT3593.
Beispiel 15: Konstruktion des Plasmides plNT3594 kodierend für GIu (A5), His (A8), GIy (A21), GIu (B4) - Präproinsulin.
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2 DNA des Plasmides plNT3582 als Template, so gelangt man zu Plasmid plNT3594.
Das Proinsulin ist Vorstufe für die Verbindung YKL205-7, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2 - Humaninsulin. Das Proinsulin ist Vorstufe für die Verbindung YKL205-7b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt: Arg (AO), GIu (A5), His (A8), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 16: Konstruktion des Plasmides plNT3595 kodierend für His (A8), GIu (A15), GIy (A21), GIu (B4) - Präproinsulin.
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2. DNA des Plasmides plNT3585 als Template, so gelangt man zu Plasmid plNT3595. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-8, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung
YKL205-8b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 17: Konstruktion des Plasmides plNT3596 kodierend für His (A8), Asp (A18), GIy (A21), GIu (B4)- Präproinsulin
Führt man die Reaktionen wie in Beispiel 9 beschrieben durch, verwendet aber in PCR1 und PCR2 DNA des Plasmides plNT3586 als Template, so gelangt man zu Plasmid plNT3596. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-9, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-9b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 18: Konstruktion des Plasmides plNT3597 kodierend für His (A8), GIy (A21), GIu (BO) -Präproinsulin
Die Konstruktion erfolgt über 2 Polymerase Kettenreaktionen. Verwendet wird der Primer pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
pint3581_Eb0f1
5 - CAACAGGAA ATTCGGCACG AG AGTTTGTG AACCAGCACC TGTG-31 (SEQ ID NO: 19)
pint3581_EbO1f2
5'- TATCGA CCAT GG CAACAACA TCAACAGGAA ATTCGGCACG AGAG-3' (SEQ ID NO: 20)
Dabei überlappen sich die beiden Primer partial. Pint3581_Eb0f2 enthält eine Ncol - Erkennungssequenz. Diese ist unterstrichen dargestellt. Das Codon, das für Glutaminsäure in Position 0 am Anfang B- Kette kodiert, ist jeweils fett herausgestellt. Template für PCR1 ist DNA des Plasmides plNT3581.
PCR1 wird mit dem Primerpaar pint3581_Eb-1f2 / pint3580_glya21rev. Template für PCR2 ist das Produkt aus PCR1. PCR2 wird mit dem Primerpaar pint3581_Eb-1f2 / pint3580_glya21 rev durchgeführt. Das Produkt aus PCR2 übereckt die vollständige Präproinsulinsequenz. Das Produkt der zweiten Reaktion wird nach Nco1/ SaM Spaltung in die Nco1 / SaM geöffnete plNT91d Vektor DNA insertiert. Richtige Plasmide erhalten die Bezeichnung plNT3597. Ersetzt man das Codon für Glutaminsäure in Position BO durch das Codon von Asparaginsäure und folgt dem Beispiel, so gelangt man zu Plasmiden, die in Position BO anstelle von Glutaminsäure Asparaginsäure tragen.
Beispiel 19: Konstruktion des Plasmides plNT3598 kodierend für GIu (A5), His (A8), GIy (A21), GIu (BO) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 18 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3582 als Template, so gelangt man zu Plasmid plNT3598. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-10, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-10b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2 - Humaninsulin Beispiel 20: Konstruktion des Plasmides plNT3599 kodierend für His (A8), GIu (A15), GIy (A21), GIu (BO) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 18 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3585 als Template, so gelangt man zu Plasmid plNT3599. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-11 , die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-11b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 21 : Konstruktion des Plasmides plNT3600 kodierend für His (A8), Asp (A18), GIy (A21), GIu (BO) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 18 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3586 als Template, so gelangt man zu Plasmid plNT3600. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-12, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2 - Humaninsulin Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-12b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (BO)1 Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 22: Konstruktion des Plasmides plNT3601 kodierend für His (A8), GIy (A21), Asp (B1) - Präproinsulin
Die Konstruktion erfolgt über 2 Polymerase Kettenreaktionen. Verwendet wird der Primer pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
pint3581_Db1f1
5'-CAACAGGAA ATTCGGCACG AGACGTG AACCAGCACC TGTGCG-3' (SEQ ID NO: 21)
pint3581_Db1f2
5'-TATCGA CCAT GG CAACAACA TCAACAGGAA ATTCGGCACG AGAC-3' (SEQ ID NO: 22)
Dabei überlappen sich die beiden Primer partial. Pint3581_Db-1f2 enthält eine Ncol - Erkennungssequenz. Diese ist unterstrichen dargestellt. Das Codon, das für Asparaginsäure in Position 1 der B- Kette kodiert, ist jeweils fett herausgestellt. Template für PCR1 ist DNA des Plasmides plNT3581. PCR1 wird mit dem Primerpaar pint3581_Db1f1 / pint3580_glya21rev durchgeführt. Template für PCR2 ist das Produkt aus PCR1. PCR2 wird mit dem Primerpaar pint3581_Db1f2 / pint3580_glya21 rev durchgeführt. Das Produkt aus PCR2 überdeckt die vollständige Präproinsulinsequenz. Das Produkt der zweiten Reaktion wird nach Nco1/ SaM Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Richtige Plasmide erhalten die Bezeichnung plNT3601. Beispiel 23: Konstruktion des Plasmides plNT3602 kodierend für GIu (A5), His (A8), GIy (A21), Asp (B1) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 22 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3582 als Template, so gelangt man zu Plasmid plNT3602. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-13, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-13b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), GIu (A5), His (A8), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 24: Konstruktion des Plasmides plNT3603 kodierend für His (A8), GIu (A15), GIy (A21), Asp (B1) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 22 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3585 als Template, so gelangt man zu Plasmid plNT3603. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-14, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2 - Humaninsulin Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-14b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 25: Konstruktion des Plasmides plNT3604 kodierend für His (A8), Asp (A18), GIy (A21), Asp (B1) - Präproinsulin
Führt man die Reaktionen wie in Beispiel 22 beschrieben durch, verwendet aber in PCR1 DNA des Plasmides plNT3586 als Template, so gelangt man zu Plasmid plNT3604. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-15, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO)1 His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-15b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 26: Konstruktion des Plasmides plNT3605 kodierend für His (A8), GIy (A21), GIu (BO), Asp (B1) - Präproinsulin
Die Konstruktion erfolgt über 2 Polymerase Kettenreaktionen. Verwendet wird der Primer pint3580_glya21rev und der in Beispiel 18 beschrieben Primer pint3581_EbO1f2. Synthetisiert wird der Primer pint3597_Db1f: 5 -CAACAGGAA ATTCGGCACG AGAGGACGTG AACCAGCACC TGTGC-31 (SEQ ID NO: 23)
Das Codon, das für Glutaminsäure in Position 0 und das für Asparaginsäure jeweils am Anfang der B- Kette kodiert, ist jeweils fett herausgestellt. Template für PCR1 ist DNA des Plasmides plNT3597. PCR1 wird mit dem Primerpaar pint3597_Db1f/ pint3580_glya21 rev. Template für PCR2 ist das Produkt aus PCR1. PCR2 wird mit dem Primerpaar pint3581_Eb1f2 / pint3580_glya21rev durchgeführt. Das Produkt aus PCR2 überdeckt die vollständige Präproinsulinsequenz. Das Produkt der zweiten Reaktion wird nach Nco1/ Sah Spaltung in die Nco1 / Sah geöffnete plNT91d Vektor DNA insertiert. Richtige Plasmide erhalten die Bezeichnung plNT3605. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-16, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIy (A21), GIu (BO), Asp (B1), Arg (B31), Arg (B32) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-16b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIy (A21), GIu (BO), Asp (B1), Arg (B31), Lys (B32) - NH2 - Humaninsulin
Beispiel 27: Konstruktion des Plasmides plNT3606 kodierend für His (A8), GIu (A15), Asp (A18), GIy (A21), desThr (B30) - Präproinsulin
Die Konstruktion erfolgt wie in Beispiel 1 und 2 beschrieben über 3 Polymerase Kettenreaktionen. Verwendet werden die Primer Tir und pint3580_glya21rev. Zwei weitere Primer werden synthetisiert:
desB30f S'-πCTACACACCCAAGCGCGATGπCCTCAGGTGG-S1 (SEQ ID NO: 24)
desB30rev
5'-AGG AACATCGCGC TTGGGTGTGT AGAAGAAGC-3' (SEQ ID NO: 25)
Template für PCR1 und PCR2 ist DNA des Plasmides plNT3586. PCR1 wird mit dem Primerpaar desB30f / pint3580_glya21rev und PCR2 wird mit dem Primerpaar Tir / desB30rev Template durchgeführt. Als Template für PCR3 wird ein äquimolares Gemisch der Produkte aus PCR1 und PCR2 verwendet. Die Reaktion wird mit dem Primerpaar Tir/ pint3580_glya21rev durchgeführt. Das Produkt aus PCR3 überdeckt die vollständige Präproinsulinsequenz. Das Produkt der dritten Reaktion wird nach Nco1/ SaM Spaltung in die Nco1 / SaM geöffnete plNT91d Vektor DNA insertiert. Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung
YKL205-17, die nach Amidierung mit Argininamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B30), Arg (B31) - NH2 - Humaninsulin
Das von dem Plasmid kodierte Prä - Proinsulin ist Vorstufe für die Verbindung YKL205-17b, die nach Amidierung mit Lysinamid entsteht und die folgende Struktur beschreibt:
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B30), Lys (B31) - NH2 - Humaninsulin
Beispiel 28: Expression der Proinsulinderivate
Die Expression wird entsprechend Beispiel 1 der Europäischen Patentanmeldung EP-A 1 222 207 durchgeführt. Beispiel 29: Faltung der Proinsulinderivate
Die Faltung erfolgt prinzipiell nach der in EP-A 0 668 282 beschriebenen Methode Beispiel 30: Enzymatische Prozessierung der gefalteten Präproinsulin zu der 2 - kettigen Arg(AO) - Insulinvorstufe, deren C - terminales B-Kettenende durch Lysin oder Arginin charakterisiert ist.
Die Enzymatische Prozessierung der gefalteten Präproinsulinvorstufe erfolgt wie z.B. in Beispiel 4 von WO91/03550 beschrieben. Als besonders vorteilhaft erweist sich dabei der Einsatz der in WO 2007/031187 A1 beschriebenen Trypsinvariante.
Beispiel 31 : Herstellung eines Arg (AO), His (A8), GIy (A21), Arg (B31), Arg (B32) - NH2- Humaninsulins
Unabhängig von der Positionierung der zusätzlichen sauren Aminosäuren wird eine Standard reaktion wie folgt durchgeführt: 100 mg Arg (AO), GIy (A21), Arg (B31) - Insulinanalog werden in 0.95 ml Argininamidlösung (446 g/L) gelöst , 0.13 mL M Na- Acetatpuffer (pH 5.8) und 2 ml DMF zugegeben. Die Reaktionsmischung wird auf 12° C gekühlt und durch Zugabe von 0.094 ml Trypsin (0.075 mg, Roche
Diagnostics) gestartet. Nach 8 h wird die Reaktion durch Zugabe von TFA bis pH 2.5 gestoppt und per HPLC analysiert. Es bildet sich >60 % . Arg (AO)1 GIy (A21), Arg (B31), Arg (B32) - NH2- Humaninsulin. Nach Zusatz von Trypsininhibitorlösung erfolgt die Reinigung des amidierten Analogs in Analogie zu US 5,656,722.
Die Herstellung der entsprechenden Lysinamid - Verbindung erfolgt analog. Allerdings geht man von einer wässrigen Lysinamid Stammlösung aus, die 366g/L Lysinamid gelöst enthält.
Beispiel 32: Formulierung der amidierten Indulinderivate
Um die erfindungsgemäßen Insulinderivate auf ihre biologisch, pharmakologischen und physikalisch chemischen Eigenschaften zu testen, wurde von den Verbindungen wie folgt eine Lösung hergestellt: Das erfindungsgemäße Insulinderivat wurde mit einer Zielkonzentration von 240 ± 5 μM in 1 mM Salzsäure mit 80 μg/mL Zink (als Zinkchlorid) aufgelöst.
Als Lösungsmedium wurden folgende Zusammensetzungen verwendet: a) 1 mM Salzsäure b) 1 mM Salzsäure, 5 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt) c) 1 mM Salzsäure, 10 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt) d) 1 mM Salzsäure, 15 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt) e) 1 mM Salzsäure, 30 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt) f) 1 mM Salzsäure, 80 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt) g) 1 mM Salzsäure, 120 μg/mL Zink (als Zinkchlorid oder Salzsäure zugesetzt)
Hierzu wurde von dem gefriergetrockneten Material zunächst eine um etwa 30% höhere Menge als aufgrund des Molekulargewichts und der angestrebten
Konzentration benötigt eingewogen. Danach wurde die vorliegende Konzentration mittels analytischer HPLC bestimmt und die Lösung anschließend auf das zur Erreichung der Zielkonzentration erforderliche Volumen mit 5 mM Salzsäure mit 80 μg/mL Zink aufgefüllt. Falls erforderlich, wurde dabei der pH-Wert auf 3,5 ± 0,1 nachjustiert. Nach der endgültigen Analyse durch HPLC zur Absicherung der
Zielkonzentration von 240 ± 5 μM wurde die fertige Lösung mittels einer Spritze mit einem 0,2 μm Filtervorsatz in ein mit einem Septum und einer Bördelkappe verschlossenes steriles Fläschchen überführt. Für die kurzfristige, einmalige Testung der erfindungsgemäßen Insulinderivate wurde keine Optimierung der Formulierungen, z.B. hinsichtlich eines Zusatzes isotonischer Agentien, Konservierungsmittel oder Puffersubstanzen, vorgenommen.
Beispiel 33: Evaluierung der blutzuckersenkenden Wirkung von neuen Insulinanaloga in der Ratte
Die blutzuckersenkende Wirkung von ausgewählten neuen Insulinanaloga wird in männlichen, gesunden, normoglykämischen Wistarratten geprüft. Männlichen Ratten wird eine Dosis von 9 nmol/kg eines Insulinanalogons subkutan injiziert. Unmittelbar vor der Injektion des Insulinanalogons und in regelmäßigen Abständen bis zu acht Stunden nach der Injektion werden den Tieren Blutproben entnommen und darin der Blutzuckergehalt bestimmt. Das Experiment zeigt deutlich (vgl. Fig. 1), dass das eingesetzte erfindungsgemäße Insulinanalogon zu einem deutlich verzögerten Wirkeintritt und einer längeren, gleichmäßigen Wirkdauer führt.
Beispiel 34: Evaluierung der blutzuckersenkenden Wirkung von neuen Insulinanaloga im Hund
Die blutzuckersenkende Wirkung von ausgewählten neuen Insulinanaloga wird in männlichen, gesunden, normoglykämischen Beaglehunden geprüft. Männlichen Tieren wird eine Dosis von 6 nmol/kg eines Insulinanalogons subkutan injiziert. Unmittelbar vor der Injektion des Insulinanalogons und in regelmäßigen Abständen bis zu achtundvierzig Stunden nach der Injektion werden den Tieren Blutproben entnommen und darin der Blutzuckergehalt bestimmt. Das Experiment zeigt deutlich (vgl. Fig. 2), dass das eingesetzte erfindungsgemäße Insulinanalogon zu einem deutlich verzögerten Wirkeintritt und einer längeren, gleichmäßigen Wirkdauer führt.
Beispiel 35: Evaluierung der blutzuckersenkenden Wirkung am Hund bei zweifach erhöhter Dosis
Die blutzuckersenkende Wirkung von ausgewählten neuen Insulinanaloga wird in männlichen, gesunden, normoglykämischen Beaglehunden geprüft. Männlichen Tieren wird eine Dosis von 6 nmol/kg und 12nmol/kg eines Insulinanalogons subkutan injiziert. Unmittelbar vor der Injektion des Insulinanalogons und in regelmäßigen Abständen bis zu achtundvierzig Stunden nach der Injektion werden den Tieren Blutproben entnommen und darin der Blutzuckergehalt bestimmt.
Das Experiment zeigt deutlich (vgl. Fig. 3), dass das eingesetzte erfindungsgemäße Insulinanalogon dosisabhängig wirkt, dass aber trotz zweifach erhöhter Dosis der Wirkungsverlauf flach verläuft, d.h. kein ausgeprägter Tiefpunkt (Nadir) beobachtet wird. Daraus lässt sich ableiten, dass die erfindungsgemäßen Insuline im Vergleich zu bekannten Verzögerungsinsulinen zu deutlich weniger hypoglykanischen Ereignissen führen.
Beispiel 36: Evaluierung der blutzuckersenkenden Wirkung am Hund bei verschiedenen Zinkkonzentrationen in der Formulierung
Die Experimente wurden, wie in Beispiel 35 beschrieben, durchgeführt. Figur 4 zeigt das Ergebnis. Danach lässt sich die Zeit - Wirkungskurve des erfindungsgemäßen Insulinanalogons durch den Gehalt an Zinkionen in der Formulierung bei gleicher Insulinkonzentration in der Weise beeinflussen, dass man bei null oder geringem Zinkgehalt einen schnellen Wirkungseintritt beobachtet und die Wirkung über 24 Stunden anhält, während bei höherem Zinkgehalt ein flacher Wirkungseintritt beobachtet wird und die Insulinwirkung deutlich länger als 24 Stunden anhält.

Claims

Patentansprüche:
1. Insulinanalogon der Formel I
s s
1 5 | 10| 15 20
A0 G I V E A5 C C H S I C S L Y A15 L E A18 Y C G I \ A-Kette
Figure imgf000042_0001
I I B-I BO Bl B2 B3 B4 H L C G S H L V E A L Y L V C G E R G F F Y 1 5 10 15 20 25
T P B29 B30 B31 B32 B-Kette
30
wobei
AO Lys oder Arg;
A5 Asp, GIn oder GIu;
A15 Asp, GIu oder GIn;
A18 Asp, GIu oder Asn;
B-1 Asp, GIu oder eine Aminogruppe;
BO Asp, GIu oder eine chemische Bindung;
B1 Asp, GIu oder Phe;
B2 Asp, GIu oder VaI;
B3 Asp, GIu oder Asn; B4 Asp, GIu oder GIn;
B29 Lys oder einer chemischen Bindung;
B30 Thr oder einer chemischen Bindung;
B31 Arg, Lys oder einer chemischen Bindung;
B32 Arg-Amid, Lys-Amid oder einer Aminogruppe
entspricht, wobei zwei Aminosäurereste der Gruppe enthaltend A5, A15, A18, B-1 , BO, B1 , B2, B3 und B4 gleichzeitig und unabhängig voneinander Asp oder GIu entsprechen.
2. Insulinanalogon gemäß Anspruch 1 , wobei AO Arg entspricht.
3. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei A5 GIu entspricht.
4. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei A15 GIu entspricht.
5. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei A18 Asp entspricht.
6. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B-1 einer Aminogruppe entspricht.
7. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei BO GIu entspricht.
8. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B1 Asp entspricht.
9. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B2 VaI entspricht.
10. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B3 Asp entspricht.
11. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B4 GIu entspricht.
12. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B29 Lys entspricht.
13. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B30 Thr entspricht.
14. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B31 Arg oder Lys entspricht.
15. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, wobei B32 Arg -NH2 oder LyS-NH2 entspricht.
16. Insulinanalogon gemäß einem oder mehreren der vorstehenden Ansprüche, ausgewählt aus einer Gruppe enthaltend:
Arg (AO), His (A8), GIu (A5), Asp (A18), GIy (A21), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), Asp (A18), GIy (A21), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A15), Asp (A18), GIy (A21), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Glu(A5), GIu (A15), GIy (A21), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A5), GIu (A15), GIy (A21), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His(A8), GIu (A5), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His(A8), GIu (A5), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His(A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIy (A21), Asp (B3), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (B4), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), GIu (BO)1 Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His (A8), Asp (A18), GIy (A21), GIu (BO), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18) ,GIy (A21), GIu (BO), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIu (A5), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Arg(B32) - NH2
Humaninsulin, Arg (AO), His (A8), GIu (A15), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B1), Arg (B31), Lys (B32) - NH2 Humaninsulin,
Arg (AO), His (A8), GIy (A21), GIu (BO), Asp (B1), Arg (B31), Arg (B32) - NH2
Humaninsulin,
Arg (AO), His (A8), GIy (A21), GIu (BO), Asp (B1), Arg (B31), Lys (B32) - NH2
Humaninsulin, Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B30), Arg (B31) - NH2
Humaninsulin,
Arg (AO), His (A8), Asp (A18), GIy (A21), Asp (B3), Arg (B30), Lys (B31) - NH2
Humaninsulin.
17. Verfahren zur Herstellung eines Insulinanalogons gemäß einem der Ansprüche 1 bis 16.
18. Verfahren gemäß Anspruch 17, wobei ein Vorläufer des Insulinanalogons rekombinant hergestellt wird, der Vorläufer enzmatisch zu zwei -kettigem Insulin prozessiert wird und eine Kupplung mit Argininamid in Gegenwart eines Enzyms mit Trypsinaktivität durchgeführt wird, und das Insulinanalogon isoliert wird.
19. Verwendung eines Insulinanalogons gemäß einem der Ansprüche 1 bis 16 zur Herstellung eines Medikaments zur Behandlung von Diabetes Mellitus.
20. Verwendung gemäß Anspruch 19 in einem Verfahren zur Herstellung eines Medikaments zur Behandlung von Diabetes MellitusTyp I oder Typ Il oder zur therapeutischen Unterstützung der beta -Zellregeneration.
21. Arzneimittel enthaltend ein Insulinanalog gemäß einem der Ansprüche 1 bis 16 und/oder physiologisch verträgliche Salze davon.
22. Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, wobei die Formulierung in wässriger Form enthaltend das gelöste Insulinanalogon vorliegt.
23. Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, wobei die Formulierung in Form von Pulver vorliegt.
24. Formulierung gemäß Anspruch 23, wobei das Insulinanalogon gemäß einem der Ansprüche 1 bis 16 in kristalliner und/oder amorpher Form vorhanden ist.
25. Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, wobei die Formulierung in Form einer Suspension vorliegt.
26. Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, wobei die Formulierung zusätzlich ein chemisches Chaperon enthält.
27. DNA kodierend für einen Vorläufer eines Insulinanalogons gemäß einem der Ansprüche 1 bis 16.
28. DNA kodierend für die A-Kette eines Insulinanalogons gemäß einem der Ansprüche 1 bis 16.
29. DNA kodierend für die B-Kette eines Insulinanalogons gemäß einem der Ansprüche 1 bis 16.
30. Vektor enthaltend eine DNA nach einem oder mehreren der Ansprüche 27 bis 29.
31. Wirtsorganismus enthaltend eine DNA nach einem oder mehreren der Ansprüche 27 bis 29 oder einen Vektor gemäß Anspruch 30.
32. Präproinsulinanalogon, dadurch gekennzeichnet, dass das C-Peptid an seinem N-Terminus den Aminosäurerest Arginin und an seinem C-Terminus zwei Argininreste oder einen Argininrest und einen Lysinrest trägt, wobei in letzterem Falle der Lysinrest den eigentlichen C-Terminus bildet.
33. Formulierung nach einem oder mehreren der Ansprüche 22 bis 26, bei der noch zusätzlich ein Glucagon-Like Peptide-1 (GLP1) oder ein Analogon oder Derivat davon, oder Exendin-3 bzw. -4 oder ein Analogon oder Derivat davon enthalten ist.
34. Formulierung nach Anspruch 33, bei dem zusätzlich Exendin-4 enthalten ist.
35. Formulierung gemäß Anspruch 33, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend H-desPro36-Exendin-4-Lys6-NH2, H-des(Pro36 37)-Exendin-4-Lys4-NH2 und H-des(Pro36 37)-Exendin-4-Lys5-NH2, oder ein pharmakologisch tolerierbares Salz davon.
36. Formulierung gemäß Anspruch 33, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend desPro36 [Asp28]Exendin-4 (1-39), desPro36 [lsoAsp28]Exendin-4 (1-39), desPro36 [Met(O)14, Asp28]Exendin-4 (1-39), desPro36 [Met(O)14, lsoAsp28]Exendin-4 (1-39), desPro36 [TrP(O2)25, Asp28]Exendin-2 (1-39), desPro36 p~rp(O2)25, lsoAsp28]Exendin-2 (1-39), desPro36 [Met(O)14Trp(O2)25, Asp28]Exendin-4 (1-39) und desPro36 [Met(O)14Trp(O2)25, lsoAsp28]Exendin-4 (1-39), oder ein pharmakologisch tolerierbares Salz davon.
37. Formulierung gemäß Anspruch 36, bei denen an die C-Termini der Analoga von Exendin-4 das Peptid -LyS6-NH2 angefügt ist.
38. Formulierung gemäß Anspruch 33, bei dem ein Analogon von Exendin-4 ausgewählt wird aus einer Gruppe enthaltend
H-(LyS)6- des Pro36 [Asp28]Exendin-4(1-39)-Lys6-NH2 des Asp28Pro36, Pro37, Pro38 Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39) -NH2, H-ASn-(GIu)5 des Pro36, Pro37, Pro38 [Asp28]Exendin^(1-39) -NH2, des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1 -39)-(Lys)6-NH2,
H-(LyS)6- des Pro36, Pro37, Pro38 [Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Asp28]Exendin^(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36 [Trp(O2)25, Asp28]Exendin-4(1-39)-Lys6-NH2, H- des Asp28 Pro36, Pro37, Pro38 [Trp(O2)25]Exendin-4(1-39) -NH2,
H-(LyS)6- des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin-4(1-39) -NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36, Pro37, Pro38 [Trp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 p~rp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36 [Met(O)14, Asp28]Exendin-4(1-39)-Lys6-NH2, des Met(O)14 Asp28 Pro 36, Pro37, Pro38 Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36, Pro 37, Pro38 [Met(O)14, Asp28]Exendin-4(1-39) -NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Met(O)14, Asp28]Exendin-4(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36, Pro37, Pro38 [Met(O)14, Asp28]Exendin-4(1-39)-Lys6-NH2, H-Asn-(Glu)5 des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39)-(Lys)6-NH2,
H-(LyS)6- des Pro36 [Met(O)14, Trp(O2)25, Asp28]Exendin-4(1-39)-Lys6-NH2, des Asp28 Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25]Exendin-4(1-39) -NH2, H-(LyS)6- des Pro36' Pro37, Pro38 [Met(O)14, Tφ(O2)25, Asp28]Exendin-4(1-39) -NH2, H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Met(O)14, Asp28] Exendin-4(1-39) -NH2, des Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25, Asp28]Exendin-4(1-39)-(Lys)6-NH2, H-(LyS)6- des Pro36' Pro37, Pro38 [Met(O)14, Tφ(O2)25, Asp28]Exendin-4(1 -39)-(Lys)6- NH2,
H-Asn-(Glu)5- des Pro36, Pro37, Pro38 [Met(O)14, Trp(O2)25, Asp28] Exendin-4(1-39)- (LyS)6-NH2, oder ein pharmakologisch tolerierbares Salz davon.
39. Formulierung nach Anspruch 33, bei dem zusätzlich Arg34, Lys26 (Nε(γ- glutamyl(Nα-hexadecanoyl))) GLP-1 (7-37) [liraglutide] oder ein pharmakologisch tolerierbares Salz davon enthalten ist.
40. Wässrige Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, die kein oder weniger als 15 μg/ml Zink enthält.
41. Wässrige Formulierung des Insulinanalogons gemäß einem der Ansprüche 1 bis 16, die kein oder weniger als 15 μg/ml bis 2 mg/ml Zink enthält.
42. Formulierung gemäß Anspruch 41 , wobei 200 μg/ml Zink enthalten sind.
PCT/EP2009/000017 2008-01-09 2009-01-06 Neue insulinderivate mit extrem verzögertem zeit-/wirkungsprofil WO2009087081A2 (de)

Priority Applications (17)

Application Number Priority Date Filing Date Title
DK09701358.5T DK2229407T3 (en) 2008-01-09 2009-01-06 NEW INSULIN DERIVATIVES WITH EXTREMELY DELAYED TIME / EFFECTS PROFILE
NZ586590A NZ586590A (en) 2008-01-09 2009-01-06 Insulin analogues or derivatives having an extremely delayed time-action profile
EP09701358.5A EP2229407B1 (de) 2008-01-09 2009-01-06 Neue insulinderivate mit extrem verzögertem zeit- / wirkungsprofil
RU2010133231/10A RU2524423C2 (ru) 2008-01-09 2009-01-06 Новые производные инсулина с чрезвычайно замедленным профилем время/действие
BRPI0907371A BRPI0907371A2 (pt) 2008-01-09 2009-01-06 derivados de insulina com um perfil de tempo-ação muito retardado
AU2009203809A AU2009203809B2 (en) 2008-01-09 2009-01-06 Novel insulin derivatives having an extremely delayed time-action profile
JP2010541743A JP5694779B2 (ja) 2008-01-09 2009-01-06 極度に遅延した時間作用プロファイルを有する新規なインスリン誘導体
CA2711749A CA2711749A1 (en) 2008-01-09 2009-01-06 Novel insulin derivatives having an extremely delayed time-action profile
CN200980101962.3A CN102007143B (zh) 2008-01-09 2009-01-06 具有超延迟时效特征的新型胰岛素衍生物
ES09701358.5T ES2613152T3 (es) 2008-01-09 2009-01-06 Nuevos derivados de insulina con perfil tiempo/acción extremadamente retardado
UAA201009821A UA103015C2 (ru) 2008-01-09 2009-01-06 Новые производные инсулина с чрезвычайно замедленным профилем время/действие
ZA2010/03926A ZA201003926B (en) 2008-01-09 2010-06-02 Novel insulin derivatives having an extremely delayed time-action profile
US12/820,722 US9644017B2 (en) 2008-01-09 2010-06-22 Insulin derivatives having an extremely delayed time-action profile
TN2010000298A TN2010000298A1 (en) 2008-01-09 2010-06-25 Novel insulin derivatives having an extremely delayed time-action profile
MA32985A MA31998B1 (fr) 2008-01-09 2010-07-05 Nouveaux derives d'insuline ayant un profil temps-action extremement retarde
IL206844A IL206844A (en) 2008-01-09 2010-07-06 Insulin derivatives with a highly delayed action profile
HK11104060.4A HK1149772A1 (zh) 2008-01-09 2011-04-21 具有超延遲時效特徵的新型胰島素衍生物

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DE200810003568 DE102008003568A1 (de) 2008-01-09 2008-01-09 Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008003568.8 2008-01-09
US4465908P 2008-04-14 2008-04-14
US61/044,659 2008-04-14
DE102008025008.2 2008-05-24
DE200810025008 DE102008025008A1 (de) 2008-05-24 2008-05-24 Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/820,722 Continuation US9644017B2 (en) 2008-01-09 2010-06-22 Insulin derivatives having an extremely delayed time-action profile

Publications (2)

Publication Number Publication Date
WO2009087081A2 true WO2009087081A2 (de) 2009-07-16
WO2009087081A3 WO2009087081A3 (de) 2009-09-17

Family

ID=40568276

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/000017 WO2009087081A2 (de) 2008-01-09 2009-01-06 Neue insulinderivate mit extrem verzögertem zeit-/wirkungsprofil

Country Status (32)

Country Link
US (1) US9644017B2 (de)
EP (1) EP2229407B1 (de)
JP (1) JP5694779B2 (de)
KR (1) KR20100111682A (de)
CN (1) CN102007143B (de)
AR (1) AR070118A1 (de)
AU (1) AU2009203809B2 (de)
BR (1) BRPI0907371A2 (de)
CA (1) CA2711749A1 (de)
CL (1) CL2009000017A1 (de)
CO (1) CO6311108A2 (de)
DK (1) DK2229407T3 (de)
DO (1) DOP2010000209A (de)
EC (1) ECSP10010333A (de)
ES (1) ES2613152T3 (de)
GT (1) GT201000199A (de)
HK (1) HK1149772A1 (de)
HU (1) HUE030537T2 (de)
IL (1) IL206844A (de)
MA (1) MA31998B1 (de)
MY (1) MY152979A (de)
NI (1) NI201000114A (de)
NZ (1) NZ586590A (de)
PA (1) PA8811601A1 (de)
PE (1) PE20091377A1 (de)
PL (1) PL2229407T3 (de)
RU (1) RU2524423C2 (de)
TN (1) TN2010000298A1 (de)
TW (1) TW200942256A (de)
UY (1) UY31596A1 (de)
WO (1) WO2009087081A2 (de)
ZA (1) ZA201003926B (de)

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011003820A1 (de) * 2009-07-06 2011-01-13 Sanofi-Aventis Deutschland Gmbh Hitze- und schüttelstabile insulinzubereitungen
WO2011003823A1 (de) * 2009-07-06 2011-01-13 Sanofi-Aventis Deutschland Gmbh Langsamwirkende insulinzubereitungen
WO2011003822A3 (de) * 2009-07-06 2011-08-25 Sanofi-Aventis Deutschland Gmbh Wässrige insulinzubereitungen enthaltend methionin
WO2011161161A1 (en) 2010-06-24 2011-12-29 Boehringer Ingelheim International Gmbh Diabetes therapy
WO2012062698A1 (en) 2010-11-08 2012-05-18 Boehringer Ingelheim International Gmbh Pharmaceutical composition, methods for treating and uses thereof
WO2012098462A1 (en) 2011-01-20 2012-07-26 Zealand Pharma A/S Combination of acylated glucagon analogues with insulin analogues
US20120295846A1 (en) * 2009-11-13 2012-11-22 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a glp-1 agonist, an insulin and methionine
US8343914B2 (en) 2006-01-06 2013-01-01 Case Western Reserve University Fibrillation resistant proteins
CN102933599A (zh) * 2010-06-23 2013-02-13 诺沃—诺迪斯克有限公司 包含额外的二硫键的人胰岛素
US8399407B2 (en) 2009-09-17 2013-03-19 Case Western Reserve University Non-standard insulin analogues
US20130096057A1 (en) * 2011-10-18 2013-04-18 AmideBio LLC Chemically and Thermodynamically Stable Insulin Analogues and Improved Methods for their Production
US8501440B2 (en) 2006-10-04 2013-08-06 Case Western Reserve University Fibrillation-resistant insulin and insulin analogues
US8633156B2 (en) 2008-01-09 2014-01-21 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US8642541B2 (en) 2008-12-15 2014-02-04 Zealand Pharma A/S Glucagon analogues
US8642540B2 (en) 2008-12-15 2014-02-04 Zealand Pharma A/S Glucagon analogues
US8680049B2 (en) 2008-12-15 2014-03-25 Zealand Pharma A/S Glucagon analogues
US8685919B2 (en) 2008-12-15 2014-04-01 Zealand Pharma A/S Glucagon analogues
US8853155B2 (en) 2010-06-23 2014-10-07 Novo Nordisk A/S Insulin derivatives containing additional disulfide bonds
US8921313B2 (en) 2008-07-31 2014-12-30 Case Western Reserve University Halogen-stabilized insulin
US8993516B2 (en) 2008-04-14 2015-03-31 Case Western Reserve University Meal-time insulin analogues of enhanced stability
US9079975B2 (en) 2009-12-11 2015-07-14 Case Western Reserve University Insulin analogues with chlorinated amino acids
US9156901B2 (en) 2009-07-13 2015-10-13 Ditte Riber Acylated glucagon analogues
US9169310B2 (en) 2010-06-24 2015-10-27 Zealand Pharma A/S Glucagon analogues
US9180169B2 (en) 2012-09-17 2015-11-10 Zealand Pharma A/S Glucagon analogues
US9200053B2 (en) 2008-07-31 2015-12-01 Case Western Reserve University Insulin analogues containing penta-fluoro-Phenylalanine at position B24
US9403894B2 (en) 2010-06-23 2016-08-02 Zealand Pharma A/S Glucagon analogues
US9408893B2 (en) 2011-08-29 2016-08-09 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for use in glycemic control in diabetes type 2 patients
US9526764B2 (en) 2008-10-17 2016-12-27 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1-agonist
US9644017B2 (en) 2008-01-09 2017-05-09 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US9707176B2 (en) 2009-11-13 2017-07-18 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist and methionine
US9821032B2 (en) 2011-05-13 2017-11-21 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for improving glycemic control as add-on therapy to basal insulin
US9839675B2 (en) 2013-02-04 2017-12-12 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US9839692B2 (en) 2014-01-09 2017-12-12 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US9896495B2 (en) 2013-10-17 2018-02-20 Zealand Pharma A/S Acylated glucagon analogues
US9895424B2 (en) 2014-01-09 2018-02-20 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US9895423B2 (en) 2014-01-09 2018-02-20 Sanofi Stabilized pharmaceutical formulations of insulin aspart
US9950039B2 (en) 2014-12-12 2018-04-24 Sanofi-Aventis Deutschland Gmbh Insulin glargine/lixisenatide fixed ratio formulation
US9981013B2 (en) 2010-08-30 2018-05-29 Sanofi-Aventis Deutschland Gmbh Use of AVE0010 for the treatment of diabetes mellitus type 2
US9988429B2 (en) 2013-10-17 2018-06-05 Zealand Pharma A/S Glucagon analogues
US9987332B2 (en) 2011-09-01 2018-06-05 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition for use in the treatment of a neurodegenerative disease
US10093713B2 (en) 2013-11-06 2018-10-09 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
US10100097B2 (en) 2012-05-03 2018-10-16 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
US10131702B2 (en) 2013-11-06 2018-11-20 Zealand Pharma A/S Glucagon-GLP-1-GIP triple agonist compounds
US10159713B2 (en) 2015-03-18 2018-12-25 Sanofi-Aventis Deutschland Gmbh Treatment of type 2 diabetes mellitus patients
US10253078B2 (en) 2014-10-29 2019-04-09 Zealand Pharma A/S GIP agonist compounds and methods
US10253079B2 (en) 2012-12-21 2019-04-09 Sanofi Functionalized Exendin-4 derivatives
US10336802B2 (en) 2015-04-16 2019-07-02 Zealand Pharma A/S Acylated glucagon analogue
CN109999180A (zh) * 2011-06-02 2019-07-12 韩美科学株式会社 用于治疗糖尿病的包括长效胰岛素缀合物和长效促胰岛素肽缀合物的组合物
US10392429B2 (en) 2014-10-06 2019-08-27 Case Western Reserve University Biphasic single-chain insulin analogues
US10434147B2 (en) 2015-03-13 2019-10-08 Sanofi-Aventis Deutschland Gmbh Treatment type 2 diabetes mellitus patients
US10442847B2 (en) 2012-07-23 2019-10-15 Zealand Pharma A/S Glucagon analogues
US10758592B2 (en) 2012-10-09 2020-09-01 Sanofi Exendin-4 derivatives as dual GLP1/glucagon agonists

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102005046113A1 (de) * 2005-09-27 2007-03-29 Sanofi-Aventis Deutschland Gmbh Verfahren zur Amidierung von Polypetiden mit C-terminalen basischen Aminosäuren unter Verwendung spezifischer Endoproteasen
RU2010147076A (ru) * 2008-04-22 2012-05-27 Кейз Вестерн Ризев Юнивесити (Us) Аналоги инсулина специфичные к изоформам
US9163073B2 (en) 2013-04-17 2015-10-20 Amidebio, Llc Chemically and thermodynamically stable insulin analogues and improved methods for their production
EP3098235A4 (de) 2014-01-20 2017-10-18 Hanmi Pharm. Co., Ltd. Langwirkendes insulin und verwendung davon
AR100639A1 (es) 2014-05-29 2016-10-19 Hanmi Pharm Ind Co Ltd Composición para tratar diabetes que comprende conjugados de análogos de insulina de acción prolongada y conjugados de péptidos insulinotrópicos de acción prolongada
TWI684458B (zh) 2014-05-30 2020-02-11 南韓商韓美藥品股份有限公司 包含胰島素及ｇｌｐ-１/昇糖素雙重促效劑之治療糖尿病之組成物
UY36870A (es) 2015-08-28 2017-03-31 Hanmi Pharm Ind Co Ltd Análogos de insulina novedosos
EP3517544A4 (de) 2016-09-23 2020-06-03 Hanmi Pharm. Co., Ltd. Insulinanalogon mit reduzierter bindungskraft an den insulinrezeptor und verwendung davon
JP2020511513A (ja) 2017-03-23 2020-04-16 ハンミ ファーマシューティカル カンパニー リミテッド インスリン受容体との結合力が減少されたインスリンアナログの結合体及びその用途

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989010937A1 (en) * 1988-05-11 1989-11-16 Novo Nordisk A/S Insulin analogues
US6100376A (en) * 1988-11-08 2000-08-08 Hoechst Aktiengesellschaft A21, B30, modified insulin derivatives having an altered action profile
WO2001025278A1 (de) * 1999-10-02 2001-04-12 Aventis Pharma Deutschland Gmbh C-peptid zur verbesserten herstellung von insulin und insulinanaloga
WO2002079250A1 (en) * 2001-04-02 2002-10-10 Novo Nordisk A/S Insulin precursors and a process for their preparation
WO2003053339A2 (en) * 2001-12-20 2003-07-03 Eli Lilly And Company Insulin molecule having protracted time action
WO2007081824A2 (en) * 2006-01-06 2007-07-19 Case Western Reserve University Fibrillation resistant proteins

Family Cites Families (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3984696A (en) 1974-12-11 1976-10-05 Medi-Ray, Inc. Radiation guard for X-ray table
JPS6033474B2 (ja) 1978-05-11 1985-08-02 藤沢薬品工業株式会社 新規なヒアルロニダ−ゼｂｍｐ−８２３１およびその製造法
DK113585D0 (da) 1985-03-12 1985-03-12 Novo Industri As Nye peptider
US5008241A (en) * 1985-03-12 1991-04-16 Novo Nordisk A/S Novel insulin peptides
DK347086D0 (da) * 1986-07-21 1986-07-21 Novo Industri As Novel peptides
PH25772A (en) 1985-08-30 1991-10-18 Novo Industri As Insulin analogues, process for their preparation
WO1988006599A1 (en) 1987-02-25 1988-09-07 Novo Industri A/S Novel insulin derivatives
US4923162A (en) 1988-09-19 1990-05-08 Fleming Matthew C Radiation shield swivel mount
US5225323A (en) * 1988-11-21 1993-07-06 Baylor College Of Medicine Human high-affinity neurotransmitter uptake system
AU641631B2 (en) 1988-12-23 1993-09-30 Novo Nordisk A/S Human insulin analogues
PT93057B (pt) 1989-02-09 1995-12-29 Lilly Co Eli Processo para a preparacao de analogos da insulina
DK134189D0 (da) 1989-03-20 1989-03-20 Nordisk Gentofte Insulinforbindelser
US5006718A (en) 1989-07-21 1991-04-09 Lenhart Mark J X-ray shield for X-ray examination table
GR1005153B (el) 1989-08-29 2006-03-13 The General Hospital Corporation Πρωτεινες συντηξεως, παρασκευη τους και χρηση τους.
DK155690D0 (da) 1990-06-28 1990-06-28 Novo Nordisk As Nye peptider
DK10191D0 (da) * 1991-01-22 1991-01-22 Novo Nordisk As Hidtil ukendte peptider
US5358708A (en) 1993-01-29 1994-10-25 Schering Corporation Stabilization of protein formulations
DE4405388A1 (de) 1994-02-19 1995-08-24 Hoechst Ag Verfahren zur Herstellung von Polyalkyl-1-oxa-diazaspirodecan-Verbindungen
YU18596A (sh) 1995-03-31 1998-07-10 Eli Lilly And Company Analogne formulacije monomernog insulina
CA2223272A1 (en) 1995-05-05 1996-11-07 Ronald Eugene Chance Single chain insulin with high bioactivity
JPH11292787A (ja) 1995-08-15 1999-10-26 Asahi Chem Ind Co Ltd 生理活性ペプチドを含有する経粘膜投与製剤
DE19637230A1 (de) 1996-09-13 1998-03-19 Boehringer Mannheim Gmbh Exendin-Analoga, Verfahren zu deren Herstellung und diese enthaltende Arzneimittel
IL127365A0 (en) 1996-06-20 1999-10-28 Novo Nordisk As Insulin preparations containing carbohydrates
DE69737479T4 (de) 1996-08-30 2010-05-06 Novo Nordisk A/S Glp-1 derivate
US7312196B2 (en) 1997-01-08 2007-12-25 Amylin Pharmaceuticals, Inc. Formulations for amylin agonist peptides
DE19726167B4 (de) 1997-06-20 2008-01-24 Sanofi-Aventis Deutschland Gmbh Insulin, Verfahren zu seiner Herstellung und es enthaltende pharmazeutische Zubereitung
DE19735711C2 (de) 1997-08-18 2001-04-26 Aventis Pharma Gmbh Verfahren zur Herstellung eines Vorläufers von Insulin oder Insulinderivaten mit korrekt verbundenen Cystinbrücken
IL134901A0 (en) * 1997-10-24 2001-05-20 Lilly Co Eli Insoluble insulin compositions
US6444641B1 (en) * 1997-10-24 2002-09-03 Eli Lilly Company Fatty acid-acylated insulin analogs
US5981964A (en) 1997-12-22 1999-11-09 Bruce J. McAuley Adjustable X-ray shield and on-line dosimetry system using same
ATE290877T1 (de) 1998-01-09 2005-04-15 Novo Nordisk As Stabilisierte insulin-zubereitungen
AU741037B2 (en) 1998-02-23 2001-11-22 Neurocrine Biosciences, Inc. Methods for treatment of diabetes using peptide analogues of insulin
EP1083930B1 (de) 1998-06-05 2008-11-12 Nutrinia Limited Insulin angereichertes säuglingsnährpräparat
JP2007204498A (ja) 1999-03-01 2007-08-16 Chugai Pharmaceut Co Ltd 長期安定化製剤
JP2000247903A (ja) 1999-03-01 2000-09-12 Chugai Pharmaceut Co Ltd 長期安定化製剤
EP1076066A1 (de) 1999-07-12 2001-02-14 Zealand Pharmaceuticals A/S Peptide zur Senkung des Blutglukosespiegels
CN100389821C (zh) 1999-10-04 2008-05-28 希龙公司 稳定化的含多肽的液体药物组合物
US7060675B2 (en) 2001-02-15 2006-06-13 Nobex Corporation Methods of treating diabetes mellitus
DE10108211A1 (de) 2001-02-20 2002-08-22 Aventis Pharma Gmbh Verwendung von Fusionsproteinen, deren N-terminaler Anteil aus einem Hirudinderivat besteht, zur Herstellung rekombinanter Proteine über Sekretion durch Hefen
DE10108212A1 (de) 2001-02-20 2002-08-22 Aventis Pharma Gmbh Fusionsprotein zur Sekretion von Wertprotein in bakterielle Überstände
US6852694B2 (en) 2001-02-21 2005-02-08 Medtronic Minimed, Inc. Stabilized insulin formulations
DE10114178A1 (de) 2001-03-23 2002-10-10 Aventis Pharma Gmbh Zinkfreie und zinkarme Insulinzubereitungen mit verbesserter Stabilität
EP1432430A4 (de) 2001-08-28 2006-05-10 Lilly Co Eli Vormischungen von glp-1 und basalinsulin
BR0215216A (pt) 2001-12-21 2004-11-16 Novo Nordisk Healthcare Ag Composição aquosa lìquida, método para preparar uma composição aquosa lìquida de um polipeptìdeo de fator vii, uso de uma composição aquosa lìquida, e, método para o tratamento de uma sìndrome de resposta ao fator vii
US8058233B2 (en) 2002-01-10 2011-11-15 Oregon Health And Science University Modification of feeding behavior using PYY and GLP-1
DE10227232A1 (de) 2002-06-18 2004-01-15 Aventis Pharma Deutschland Gmbh Saure Insulinzubereitungen mit verbesserter Stabilität
AU2003243929B2 (en) 2002-07-04 2009-06-04 Zp Holding Spv K/S GLP-1 and methods for treating diabetes
KR20050083713A (ko) 2002-10-02 2005-08-26 질랜드 파마 에이/에스 안정화된 엑센딘-4 화합물
CA2518776A1 (en) 2003-04-29 2004-11-11 Eli Lilly And Company Insulin analogs having protracted time action
DE10325567B4 (de) 2003-06-05 2008-03-13 Mavig Gmbh Strahlenschutzanordnung mit separierbarer Umhüllung
ATE525083T1 (de) 2003-11-13 2011-10-15 Novo Nordisk As Pharmazeutische zusammensetzung umfassend eine insulinotrope glp-1(7-37) analoge, asp(b28)- insulin, und eine oberflächenaktive verbindung
US20080090753A1 (en) 2004-03-12 2008-04-17 Biodel, Inc. Rapid Acting Injectable Insulin Compositions
US20080248999A1 (en) 2007-04-04 2008-10-09 Biodel Inc. Amylin formulations
BRPI0512396A (pt) 2004-07-21 2008-03-11 Ambrx Inc polipeptìdeos biossintéticos utilizando aminoácidos codificados não naturalmente
JP2008513384A (ja) 2004-09-17 2008-05-01 ノボ ノルディスク アクティーゼルスカブ インスリンおよびインスリン分泌性ペプチドを含有する医薬組成物
DE102004058306A1 (de) 2004-12-01 2006-07-27 Sanofi-Aventis Deutschland Gmbh Verfahren zur Herstellung von Carboxy-terminal amidierten Peptiden
US20090142338A1 (en) 2005-03-04 2009-06-04 Curedm, Inc. Methods and Compositions for Treating Type 1 and Type 2 Diabetes Mellitus and Related Conditions
KR101304958B1 (ko) 2005-09-14 2013-09-17 에프. 호프만-라 로슈 아게 트립신 변이체에 의한 인슐린 전구체의 절단
KR101105871B1 (ko) 2005-09-27 2012-01-16 주식회사 엘지생명과학 인 난포자극호르몬의 안정한 용액 제형
EP1972149B1 (de) 2006-01-10 2017-12-13 Thomson Licensing DTV Verfahren und anordnung zur parallel ausführung von 4:4:4 codierung
US20070191271A1 (en) 2006-02-10 2007-08-16 Dow Pharmaceutical Sciences Method for stabilizing polypeptides lacking methionine
EP1986674A4 (de) 2006-02-13 2009-11-11 Nektar Therapeutics Methioninhaltige protein- oder peptidzusammensetzungen sowie verfahren zu ihrer herstellung und verwendung
US7763582B2 (en) 2006-02-21 2010-07-27 University Of Medicine And Dentistry Of New Jersey Localized insulin delivery for bone healing
TW200806317A (en) 2006-03-20 2008-02-01 Wyeth Corp Methods for reducing protein aggregation
DE102006031962A1 (de) 2006-07-11 2008-01-17 Sanofi-Aventis Deutschland Gmbh Amidiertes Insulin Glargin
RU2524150C2 (ru) 2006-09-22 2014-07-27 Ново Нордиск А/С Аналоги инсулина, устойчивые к протеазам
MX2009011123A (es) 2007-04-23 2009-11-02 Intarcia Therapeutics Inc Formulaciones de suspensiones de peptidos insulinotropicos y sus usos.
WO2008145323A1 (en) 2007-05-31 2008-12-04 F. Hoffmann-La Roche Ag Pharmaceutical formulation for interferons
EP2173407B1 (de) 2007-07-02 2020-02-19 Roche Diabetes Care GmbH Vorrichtung zur abgabe von arzneimitteln
SI2219607T1 (sl) 2007-11-01 2012-09-28 Merck Serono Sa Tekoäśe formulacije lh
US8710000B2 (en) 2007-11-08 2014-04-29 Novo Nordisk A/S Insulin derivative
BRPI0907119A2 (pt) 2008-01-09 2015-07-14 Sanofi Aventis Deutschland Derivados de insulina tendo um perfil de ação de tempo extremamente retardado
MY152979A (en) 2008-01-09 2014-12-15 Sanofi Aventis Deutschland Novel insulin derivatives having an extremely delayed time-action profile
TWI394580B (zh) 2008-04-28 2013-05-01 Halozyme Inc 超快起作用胰島素組成物
KR101939557B1 (ko) 2008-10-17 2019-01-17 사노피-아벤티스 도이칠란트 게엠베하 인슐린과 ｇｌｐ－1 효능제의 병용물
JP2009091363A (ja) 2008-11-21 2009-04-30 Asahi Kasei Pharma Kk Ｐｔｈの安定化水溶液注射剤
JP2012532177A (ja) 2009-07-06 2012-12-13 サノフィ−アベンティス・ドイチュラント・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング 熱及び振動安定性インスリン製剤
JP5675799B2 (ja) 2009-07-06 2015-02-25 サノフィ−アベンティス・ドイチュラント・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング 遅効性インスリン製剤
BR112012000177B1 (pt) 2009-07-06 2021-06-01 Sanofi-Aventis Deutschland Gmbh Formulação farmacêutica aquosa contendo metionina, processo para sua preparação, uso da mesma e medicamento para tratar diabetes mellitus
RU2537239C2 (ru) 2009-11-13 2014-12-27 Санофи-Авентис Дойчланд Гмбх Фармацевтическая композиция, включающая агонист glp-1, инсулин и метионин
AU2010317994B2 (en) 2009-11-13 2014-03-06 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist and methionine
AU2011202239C1 (en) 2010-05-19 2017-03-16 Sanofi Long-acting formulations of insulins
GB201303771D0 (en) 2013-03-04 2013-04-17 Midatech Ltd Nanoparticles peptide compositions
AR098168A1 (es) 2013-10-25 2016-05-04 Sanofi Sa Formulación estable de insulina glulisina

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989010937A1 (en) * 1988-05-11 1989-11-16 Novo Nordisk A/S Insulin analogues
US6100376A (en) * 1988-11-08 2000-08-08 Hoechst Aktiengesellschaft A21, B30, modified insulin derivatives having an altered action profile
WO2001025278A1 (de) * 1999-10-02 2001-04-12 Aventis Pharma Deutschland Gmbh C-peptid zur verbesserten herstellung von insulin und insulinanaloga
WO2002079250A1 (en) * 2001-04-02 2002-10-10 Novo Nordisk A/S Insulin precursors and a process for their preparation
WO2003053339A2 (en) * 2001-12-20 2003-07-03 Eli Lilly And Company Insulin molecule having protracted time action
WO2007081824A2 (en) * 2006-01-06 2007-07-19 Case Western Reserve University Fibrillation resistant proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP2229407A2 *

Cited By (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8343914B2 (en) 2006-01-06 2013-01-01 Case Western Reserve University Fibrillation resistant proteins
US8501440B2 (en) 2006-10-04 2013-08-06 Case Western Reserve University Fibrillation-resistant insulin and insulin analogues
US9644017B2 (en) 2008-01-09 2017-05-09 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US8633156B2 (en) 2008-01-09 2014-01-21 Sanofi-Aventis Deutschland Gmbh Insulin derivatives having an extremely delayed time-action profile
US8993516B2 (en) 2008-04-14 2015-03-31 Case Western Reserve University Meal-time insulin analogues of enhanced stability
US9388228B2 (en) 2008-07-31 2016-07-12 Case Western Reserve University Halogen-stabilized insulin
US9200053B2 (en) 2008-07-31 2015-12-01 Case Western Reserve University Insulin analogues containing penta-fluoro-Phenylalanine at position B24
US8921313B2 (en) 2008-07-31 2014-12-30 Case Western Reserve University Halogen-stabilized insulin
US10117909B2 (en) 2008-10-17 2018-11-06 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1 agonist
EP2349324B1 (de) * 2008-10-17 2017-09-06 Sanofi-Aventis Deutschland GmbH Kombination von einem insulin und einem glp-1-agonisten
US9526764B2 (en) 2008-10-17 2016-12-27 Sanofi-Aventis Deutschland Gmbh Combination of an insulin and a GLP-1-agonist
US8680049B2 (en) 2008-12-15 2014-03-25 Zealand Pharma A/S Glucagon analogues
US8642540B2 (en) 2008-12-15 2014-02-04 Zealand Pharma A/S Glucagon analogues
US8685919B2 (en) 2008-12-15 2014-04-01 Zealand Pharma A/S Glucagon analogues
US8642541B2 (en) 2008-12-15 2014-02-04 Zealand Pharma A/S Glucagon analogues
WO2011003820A1 (de) * 2009-07-06 2011-01-13 Sanofi-Aventis Deutschland Gmbh Hitze- und schüttelstabile insulinzubereitungen
WO2011003822A3 (de) * 2009-07-06 2011-08-25 Sanofi-Aventis Deutschland Gmbh Wässrige insulinzubereitungen enthaltend methionin
WO2011003823A1 (de) * 2009-07-06 2011-01-13 Sanofi-Aventis Deutschland Gmbh Langsamwirkende insulinzubereitungen
JP2012532179A (ja) * 2009-07-06 2012-12-13 サノフィ−アベンティス・ドイチュラント・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング 遅効性インスリン製剤
US10004786B2 (en) 2009-07-13 2018-06-26 Zealand Pharma A/S Acylated glucagon analogues
US9156901B2 (en) 2009-07-13 2015-10-13 Ditte Riber Acylated glucagon analogues
US8399407B2 (en) 2009-09-17 2013-03-19 Case Western Reserve University Non-standard insulin analogues
US10028910B2 (en) 2009-11-13 2018-07-24 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1-agonist and methionine
US20120295846A1 (en) * 2009-11-13 2012-11-22 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a glp-1 agonist, an insulin and methionine
US9707176B2 (en) 2009-11-13 2017-07-18 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist and methionine
US10029011B2 (en) * 2009-11-13 2018-07-24 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition comprising a GLP-1 agonist, an insulin and methionine
US9079975B2 (en) 2009-12-11 2015-07-14 Case Western Reserve University Insulin analogues with chlorinated amino acids
US8883722B2 (en) 2010-06-23 2014-11-11 Novo Nordisk A/S Human insulin containing additional disulfide bonds
CN102933599A (zh) * 2010-06-23 2013-02-13 诺沃—诺迪斯克有限公司 包含额外的二硫键的人胰岛素
US9403894B2 (en) 2010-06-23 2016-08-02 Zealand Pharma A/S Glucagon analogues
US8853155B2 (en) 2010-06-23 2014-10-07 Novo Nordisk A/S Insulin derivatives containing additional disulfide bonds
RU2598273C2 (ru) * 2010-06-23 2016-09-20 Ново Нордиск А/С Производные инсулина, содержащие дополнительные дисульфидные связи
US9512195B2 (en) 2010-06-23 2016-12-06 Novo Nordisk A/S Insulin derivatives containing additional disulfide bonds
US9169310B2 (en) 2010-06-24 2015-10-27 Zealand Pharma A/S Glucagon analogues
WO2011161161A1 (en) 2010-06-24 2011-12-29 Boehringer Ingelheim International Gmbh Diabetes therapy
US9981013B2 (en) 2010-08-30 2018-05-29 Sanofi-Aventis Deutschland Gmbh Use of AVE0010 for the treatment of diabetes mellitus type 2
WO2012062698A1 (en) 2010-11-08 2012-05-18 Boehringer Ingelheim International Gmbh Pharmaceutical composition, methods for treating and uses thereof
EP3539540A1 (de) 2010-11-08 2019-09-18 Boehringer Ingelheim International GmbH Pharmazeutische zusammensetzung, verfahren zur behandlung und verwendung
WO2012098462A1 (en) 2011-01-20 2012-07-26 Zealand Pharma A/S Combination of acylated glucagon analogues with insulin analogues
US9821032B2 (en) 2011-05-13 2017-11-21 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for improving glycemic control as add-on therapy to basal insulin
CN109999180A (zh) * 2011-06-02 2019-07-12 韩美科学株式会社 用于治疗糖尿病的包括长效胰岛素缀合物和长效促胰岛素肽缀合物的组合物
US9408893B2 (en) 2011-08-29 2016-08-09 Sanofi-Aventis Deutschland Gmbh Pharmaceutical combination for use in glycemic control in diabetes type 2 patients
US9987332B2 (en) 2011-09-01 2018-06-05 Sanofi-Aventis Deutschland Gmbh Pharmaceutical composition for use in the treatment of a neurodegenerative disease
US9006176B2 (en) * 2011-10-18 2015-04-14 AmideBio LLC Chemically and thermodynamically stable insulin analogues and improved methods for their production
US20130096057A1 (en) * 2011-10-18 2013-04-18 AmideBio LLC Chemically and Thermodynamically Stable Insulin Analogues and Improved Methods for their Production
US10100097B2 (en) 2012-05-03 2018-10-16 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
US11795204B2 (en) 2012-07-23 2023-10-24 Zealand Pharma A/S Glucagon analogues
US10442847B2 (en) 2012-07-23 2019-10-15 Zealand Pharma A/S Glucagon analogues
US10253081B2 (en) 2012-09-17 2019-04-09 Zealand Pharma A/S Glucagon analogues
US9975939B2 (en) 2012-09-17 2018-05-22 Zealand Pharma A/S Glucagon analogues
US9180169B2 (en) 2012-09-17 2015-11-10 Zealand Pharma A/S Glucagon analogues
US10758592B2 (en) 2012-10-09 2020-09-01 Sanofi Exendin-4 derivatives as dual GLP1/glucagon agonists
US10253079B2 (en) 2012-12-21 2019-04-09 Sanofi Functionalized Exendin-4 derivatives
US9839675B2 (en) 2013-02-04 2017-12-12 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US11091528B2 (en) 2013-10-17 2021-08-17 Zealand Pharma A/S Acylated glucagon analogues
US11884713B2 (en) 2013-10-17 2024-01-30 Zealand Pharma A/S Acylated glucagon analogues
US9988429B2 (en) 2013-10-17 2018-06-05 Zealand Pharma A/S Glucagon analogues
US9896495B2 (en) 2013-10-17 2018-02-20 Zealand Pharma A/S Acylated glucagon analogues
US10457714B2 (en) 2013-10-17 2019-10-29 Zealand Pharma A/S Acylated glucagon analogues
US11034747B2 (en) 2013-10-17 2021-06-15 Zealand Pharma A/S Glucagon analogues and methods of use
US10131702B2 (en) 2013-11-06 2018-11-20 Zealand Pharma A/S Glucagon-GLP-1-GIP triple agonist compounds
US11111285B2 (en) 2013-11-06 2021-09-07 Zealand Pharma A/S Glucagon-GLP-1-GIP triple agonist compounds
US10093713B2 (en) 2013-11-06 2018-10-09 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
US11008375B2 (en) 2013-11-06 2021-05-18 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
US10610595B2 (en) 2014-01-09 2020-04-07 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US9895424B2 (en) 2014-01-09 2018-02-20 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US9895423B2 (en) 2014-01-09 2018-02-20 Sanofi Stabilized pharmaceutical formulations of insulin aspart
US9839692B2 (en) 2014-01-09 2017-12-12 Sanofi Stabilized pharmaceutical formulations of insulin analogues and/or insulin derivatives
US11142560B2 (en) 2014-10-06 2021-10-12 Case Western Reserve University Biphasic single-chain insulin analogues
US10392429B2 (en) 2014-10-06 2019-08-27 Case Western Reserve University Biphasic single-chain insulin analogues
US11001619B2 (en) 2014-10-29 2021-05-11 Zealand Pharma A/S GIP agonist compounds and methods
US11814417B2 (en) 2014-10-29 2023-11-14 Zealand Pharma A/S GIP agonist compounds and methods
US10253078B2 (en) 2014-10-29 2019-04-09 Zealand Pharma A/S GIP agonist compounds and methods
US9950039B2 (en) 2014-12-12 2018-04-24 Sanofi-Aventis Deutschland Gmbh Insulin glargine/lixisenatide fixed ratio formulation
US10434147B2 (en) 2015-03-13 2019-10-08 Sanofi-Aventis Deutschland Gmbh Treatment type 2 diabetes mellitus patients
US10159713B2 (en) 2015-03-18 2018-12-25 Sanofi-Aventis Deutschland Gmbh Treatment of type 2 diabetes mellitus patients
US10336802B2 (en) 2015-04-16 2019-07-02 Zealand Pharma A/S Acylated glucagon analogue
US11274136B2 (en) 2015-04-16 2022-03-15 Zealand Pharma A/S Acylated glucagon analogue

Also Published As

Publication number Publication date
CN102007143B (zh) 2015-08-26
JP5694779B2 (ja) 2015-04-01
MY152979A (en) 2014-12-15
BRPI0907371A2 (pt) 2015-11-24
CO6311108A2 (es) 2011-08-22
PE20091377A1 (es) 2009-09-26
IL206844A (en) 2016-02-29
CN102007143A (zh) 2011-04-06
RU2010133231A (ru) 2012-02-20
DOP2010000209A (es) 2010-08-31
US20110077197A1 (en) 2011-03-31
HK1149772A1 (zh) 2011-10-14
ZA201003926B (en) 2011-04-28
ECSP10010333A (es) 2010-08-31
IL206844A0 (en) 2010-12-30
CA2711749A1 (en) 2009-07-16
PL2229407T3 (pl) 2017-06-30
JP2011509088A (ja) 2011-03-24
MA31998B1 (fr) 2011-01-03
NZ586590A (en) 2012-06-29
NI201000114A (es) 2011-03-15
TN2010000298A1 (en) 2011-11-11
CL2009000017A1 (es) 2009-10-23
PA8811601A1 (es) 2009-08-26
GT201000199A (es) 2013-11-18
DK2229407T3 (en) 2017-02-27
UY31596A1 (es) 2009-08-31
EP2229407A2 (de) 2010-09-22
KR20100111682A (ko) 2010-10-15
HUE030537T2 (en) 2017-05-29
WO2009087081A3 (de) 2009-09-17
ES2613152T3 (es) 2017-05-22
AR070118A1 (es) 2010-03-17
EP2229407B1 (de) 2016-11-16
AU2009203809A1 (en) 2009-07-16
TW200942256A (en) 2009-10-16
RU2524423C2 (ru) 2014-07-27
AU2009203809B2 (en) 2013-07-25
US9644017B2 (en) 2017-05-09

Similar Documents

Publication Publication Date Title
EP2229407B1 (de) Neue insulinderivate mit extrem verzögertem zeit- / wirkungsprofil
EP2229406B1 (de) Neue insulinderivate mit extrem verzögertem zeit- / wirkungsprofil
DE102008003568A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
DE102008003566A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
EP2041169B1 (de) Amidiertes insulin glargin
EP0885961B1 (de) Neue Insulinderivate mit schnellem Wirkungseintritt
EP2451437B1 (de) Wässrige insulinzubereitungen enthaltend methionin
DE69629210T2 (de) Insulinabkömmlinge
WO2011003823A1 (de) Langsamwirkende insulinzubereitungen
DE102008025008A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil
EP1084248B1 (de) Neue insulinanaloga mit erhöhter zinkbindung
DE102008025007A1 (de) Neue Insulinderivate mit extrem verzögertem Zeit-/ Wirkungsprofil

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980101962.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09701358

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 12010501284

Country of ref document: PH

REEP Request for entry into the european phase

Ref document number: 2009701358

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009701358

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 201011511

Country of ref document: CR

Ref document number: CR2010-011511

Country of ref document: CR

WWE Wipo information: entry into national phase

Ref document number: 10079133

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 4072/CHENP/2010

Country of ref document: IN

Ref document number: MX/A/2010/007320

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 586590

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: DZP2010000419

Country of ref document: DZ

WWE Wipo information: entry into national phase

Ref document number: 2009203809

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 20107014961

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 206844

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 1001104

Country of ref document: KE

WWE Wipo information: entry into national phase

Ref document number: 2711749

Country of ref document: CA

Ref document number: 2010541743

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: PI 2010002683

Country of ref document: MY

ENP Entry into the national phase

Ref document number: 2009203809

Country of ref document: AU

Date of ref document: 20090106

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010133231

Country of ref document: RU

Ref document number: A201009821

Country of ref document: UA

ENP Entry into the national phase

Ref document number: PI0907371

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20100709