WO2004080418A2 - Nucleic acid compounds for inhibiting angiogenesis and tumor growth - Google Patents

Nucleic acid compounds for inhibiting angiogenesis and tumor growth Download PDF

Info

Publication number
WO2004080418A2
WO2004080418A2 PCT/US2004/007491 US2004007491W WO2004080418A2 WO 2004080418 A2 WO2004080418 A2 WO 2004080418A2 US 2004007491 W US2004007491 W US 2004007491W WO 2004080418 A2 WO2004080418 A2 WO 2004080418A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid compound
ephb4
expression
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/007491
Other languages
English (en)
French (fr)
Other versions
WO2004080418A3 (en
Inventor
Ramachandra Reddy
Parkash Gill
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vasgene Therapeutics Inc
Original Assignee
Vasgene Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vasgene Therapeutics Inc filed Critical Vasgene Therapeutics Inc
Priority to JP2006507095A priority Critical patent/JP4762889B2/ja
Priority to AU2004220525A priority patent/AU2004220525B2/en
Priority to EP04720327A priority patent/EP1606305A4/en
Priority to CA002518898A priority patent/CA2518898A1/en
Publication of WO2004080418A2 publication Critical patent/WO2004080418A2/en
Publication of WO2004080418A3 publication Critical patent/WO2004080418A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates

Definitions

  • Angiogenesis the development of new blood vessels from the endothelium of a preexisting vasculature, is a critical process in the growth, progression, and metastasis of solid tumors within the host.
  • angiogenesis the autocrine, paracrine, and amphicrine interactions ofthe vascular endothelium with its surrounding stromal components are tightly regulated both spatially and temporally.
  • the levels and activities of proangiogenic and angiostatic cytokines and growth factors are maintained in balance.
  • the pathological angiogenesis necessary for active tumor growth is sustained and persistent, representing a dysregulation ofthe normal angiogenic system.
  • Solid and hematopoietic tumor types are particularly associated with a high level of abnormal angiogenesis.
  • the disclosure provides nucleic acid compounds that decrease the expression of EphB4 or EphrinB2.
  • EphB4 and EphrinB2 participate in various disease states, including cancers and diseases related to unwanted or excessive angiogenesis. Accordingly, certain nucleic acid compounds disclosed herein may be used to treat such diseases, further aspects, the disclosure relates to the discovery that EphB4 and/or EphrinB2 are expressed, often at high levels, in a variety of tumors.
  • reagents that donwregulate EphB4 or EphrinB2 may affect tumors by a direct effect on the tumor cells as well as an indirect effect on the angiogenic processes recruited by the tumor, i certain embodiments, the disclosure provides the identity of tumor types particularly suited to treatment with an agent that downregulates EphB4 or EphrinB2, including agents that inhibit expression of EphB4 or EphrinB2.
  • the disclosure provides isolated nucleic acid compounds comprising at least a portion that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell.
  • the EphB4 transcript may be any pre-splicing transcript (i.e., including introns), post-splicing transcript, as well as any splice variant.
  • the EphB4 transcript has a sequence set forth in Figure 62.
  • the disclosure provides isolated nucleic acid compounds comprising at least a portion that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • the EphrinB2 transcript may be any pre-splicing transcript (i.e., including introns), post-splicing transcript, as well as any splice variant.
  • the EphrinB2 transcript has a sequence set forth in Figure 64.
  • categories of nucleic acid compounds include antisense nucleic acids, RNAi constructs and catalytic nucleic acid constructs.
  • a nucleic acid compound may be single or double stranded.
  • a double stranded compound may also mclude regions of overhang or non-complementarity, where one or the other ofthe strands is single stranded.
  • a single stranded compound may include regions of self-complementarity, meaning that the compound forms a so-called "hairpin” or “stem-loop” structure, with a region of double helical structure.
  • a nucleic acid compound may comprise a nucleotide sequence that is complementary to a region consisting of no more than 1000, no more than 500, no more than 250, no more than 100 or no more than 50 nucleotides of the EphB4 or EphrinB2 nucleic acid sequence as designated by Figure 62 and Figure 64, respectively.
  • the region of complementarity will preferably be at least 8 nucleotides, and optionally at least 10 or at least 15 nucleotides.
  • a region of complementarity may fall within an intron, a coding sequence or a noncoding sequence of an EphB4 or EphrinB2 transcript, such as the coding sequence portion ofthe sequences set forth in Figures 62 and 64, respectively.
  • a nucleic acid compound will have a length of about 8 to about 500 nucleotides or base pairs in length, and optionally the length will be about 14 to about 50 nucleotides.
  • a nucleic acid may be a DNA (particularly for use as an antisense), RNA or RNA:DNA hybrid. Any one strand may mclude a mixture of DNA and RNA, as well as modified forms tliat cannot readily be classified as either DNA or RNA.
  • a double stranded compound may be DNA:DNA, DNA-.RNA or RNA:RNA, and any one strand may also include a mixture of DNA and RNA, as well as modified forms that cannot readily be classified as either DNA or RNA.
  • a nucleic acid compound may include any of a variety of modifications, including one or modifications to the backbone (the sugar-phosphate portion in a natural nucleic acid, including internucleotide linkages) or the base portion (the purine or pyrimidine portion of a natural nucleic acid).
  • An antisense nucleic acid compound will preferably have a length of about 15 to about 30 nucleotides and will often contain one or more modifications to improve characteristics such as stability in the serum, in a cell or in a place where the compound is likely to be delivered, such as the stomach in the case of orally delivered compounds and the lung for inhaled compounds.
  • Examples of various EphB4 and EphrinB2 antisense and RNAi constructs having differing levels of efficacy are presented in Tables 6-9.
  • the strand complementary to the target transcript will generally be RNA or modifications thereof.
  • the other strand may be RNA, DNA or any other variation.
  • duplex portion of double stranded or single stranded "hairpin" RNAi construct will preferably have a length of 18 to 25 nucleotides in length and optionally about 21 to 23 nucleotides in length.
  • Catalytic or enzymatic nucleic acids may be ribozymes or DNA enzymes and may also contain modified forms.
  • Nucleic acid compounds may inhibit expression ofthe target by about 50%, 75%, 90% or more when contacted with cells under physiological conditions and at a concentration where a nonsense or sense control has little or no effect. Preferred concentrations for testing the effect of nucleic acid compounds are 1, 5 and 10 micromolar. Nucleic acid compounds may also be tested for effects on cellular phenotypes. In the case of certain cancer cell lines, cell death or decreased rate of expansion may be measured upon administration of EphB4 or EphrinB2 -targeted nucleic acid compounds. Preferably, cell expansion will be inhibited by greater than 50% at an experimentally meaningful concentration ofthe nucleic acid.
  • the disclosure provides pharmaceutical compostions comprising any of the various EphB4 or EphrinB2-targeted nucleic acid compounds.
  • a pharmaceutical composition will generally include a pharmaceutically acceptable carrier.
  • a pharmaceutical composition may comprise a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell.
  • a pharmaceutical composition may also comprise a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • the disclosure provides methods for inhibiting EphB4 expression in a cell, comprising contacting the cell with an effective amount of a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell. Any ofthe EphB4 targeted nucleic acid compounds disclosed may be used in such a method.
  • the disclosure provides methods for inhibiting EphrinB2 expression in a cell, comprising contacting the cell with an effective amount of a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases tl e expression of EphrinB2 in a cell. Any ofthe EphrinB2 targeted nucleic acid compounds disclosed may be used in such a method.
  • the disclosure provides methods for reducing the growth rate of a tumor in a subject, comprising administering an amount of a nucleic acid compound sufficient to reduce the growth rate of the tumor.
  • the disclosure provides methods for treating a patient suffering from a cancer, comprising administering to the patient a nucleic acid moclecule.
  • the nucleic acid molecule may be, for example, selected from the group consisting of: (a) a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell; and (b) a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • the nucleic acid compound may, for example, be an antisense or an RNAi nucleic acid compound, and may be formulated with a pharmaceutically acceptable carrier.
  • the tumor will comprise one or more cancer cells expressing EphB4 and/or EphrinB2.
  • EphB4 and/or EphrinB2 may be overexpressed relative to a cell from a comparable tissue.
  • the tumor may also be a metastatic tumor, and angiogenesis-dependent tumor or an angiogenesis independent tumor.
  • the tumor is seleted from the group consisting of colon carcinoma, breast tumor, mesothelioma, prostate tumor, squamous cell carcinoma, Kaposi sarcoma, and leukemia.
  • Such treatment may be combined with at least one additional anti-cancer chemotherapeutic agent that inhibits cancer cells in an additive or synergistic manner with the nucleic acid compound.
  • the nucleic acid compound and the additional anticancer agent(s) may be formulated in advance as a combination formulation, or may be formulated independently and administered in such a manner (e.g., timing, dosage) so as to achieve the combined effect.
  • the disclosure provides methods for treating a patient suffering from an unwanted angiogenesis-associated disease or process, comprising administering to the patient an amount of a nucleic acid compound sufficient to inhibit angiogenesis.
  • the nucleic acid molecule may be, for example, selected from the group consistmg of: (a) a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell; and (b) a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • the nucleic acid compound may, for example, be an antisense or an RNAi nucleic acid compound, and may be formulated with a pharmaceutically acceptable carrier.
  • angiogenesis-associated diseases or processes are angiogenesis-dependent cancer, benign tumors, inflammatory disorders, chronic articular rheumatism and psoriasis, ocular angiogenic diseases, Osier- Webber Syndrome, myocardial angiogenesis, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma, wound granulation, wound healing, telangiectasia psoriasis scleroderma, pyogenic granuloma, cororany collaterals, ischemic limb angiogenesis, rubeosis, arthritis and diabetic neovascularization.
  • Such treatment may be combined with an additional anti-angiogenesis agent that inhibits angiogenesis in an additive or synergistic manner with the nucleic acid compound.
  • the nucleic acid compound and the additional agent(s) may he formulated in advance as a combination formulation, or may be formulated independently and administered in such a manner (e.g., timing, dosage) so as to achieve the combined effect.
  • the disclosure provides for the use of a nucleic acid compound in the manufacture of a medicament.
  • the disclosure provides for the use of an EphB4 or EphrinB2 -targeted nucleic acid compound of in the manufacture of medicament for the treatment of cancer or the treatment of angiogenesis-associated diseases or processes.
  • the disclosure provides methods for treating a patient suffering from a cancer, comprising: (a) identifying in the patient a tumor having a plurality of cancer cells that express EphB4 and/or EphrinB2; and (b) administering to the patient, as appropriate, an EphB4 or EphrinB2-targeted nucleic acid compound.
  • a nucleic acid compound may be selected from the group consisting of: (i) a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell; and (ii) a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • a method may include, as a diagnostic part, identifying in the patient a tumor having a plurality of cancer cells having a gene amplification ofthe EphB4 and/or EphrinB2 gene. Gene amplifications may be detected in a variety of ways, including, for example, fluorescent in situ hybridization (FISH).
  • FISH fluorescent in situ hybridization
  • the disclosure provides methods for identifying a tumor that is suitable for treatment with an inhibitor of EphrinB2 or EphB4 expression.
  • a method may mclude detecting in the tumor a cell having one or more ofthe following characteristics: (a) expression of EphB4 protem and/or mRNA; (b) expression of EphrinB2 protein and/or mRNA; (c) gene amplification ofthe EphB4 gene; and (d) gene amplification ofthe EphrinB2 gene.
  • a tumor comprising cells having one or more of characteristics (a)-(d) is likely to be sensitive to treatment with an inhibitor of EphrinB2 or EphB4 expression.
  • EphrinB2 or EphB4 may also be sensitive to treatments targeted at these proteins, as these proteins are known to be expressed in the vascular endothelium and to participate in the formation of new capillaries that service growing tumors.
  • An inhibitor of EphrinB2 or EphB4 expression may be, for example, (i) a nucleic acid compound that hybridizes to an EphB4 transcript under physiological conditions and decreases the expression of EphB4 in a cell; or (ii) a nucleic acid compound that hybridizes to an EphrinB2 transcript under physiological conditions and decreases the expression of EphrinB2 in a cell.
  • One aspect ofthe present disclosure provides a method for reducing the growth rate of a tumor expressing Ephrin B2 and/or EphB4. Such method comprises administering an amount of an ephrin therapeutic agent that blocks signaling through the Ephrin B2/EphB4 pathway, sufficient to reduce the growth rate ofthe tumor.
  • the ephrin therapeutic agent may exert its inhibitory effect by inhibiting the interaction between Ephrin B2 and EphB4, inhibiting gene expression of Ephrin B2 or EphB4, inhibiting activity of Ephrin B2 or EphB4, inhibiting clustering of Ephrin B2 or EphB4, inhibiting phosphorylation of Ephrin B2 or EphB4, or inhibiting any downstream signaling event upon binding of Ephrin B2 to EphB4.
  • Exemplary tumors include, but are not limited to, colon carcinoma, breast cancer, mesothelioma, prostate cancer (hormone refractory), squamous cell carcinoma, Kaposi sarcoma, and leukemia.
  • Such packaged pharmaceutical comprises: (i) a therapeutically effective amount of a nucleic acid compound disclosed herein; and (ii) instructions and/or a label for administration of compound for the treatment of patients having tumors that express Ephrin B2 and/or EphB4.
  • Another aspect ofthe present disclosure provides a method for treating a patient suffering from a cancer.
  • Such method comprises: (i) assessing the Ephrin B2 and/or ephB4 status of a sample of tumor cells from said patient; and (ii) treating the patient with an therapeutic agent targeted to EphrinB2 or EphB4 if said tumor cells express Ephrin B2 and/or ephB4.
  • Exemplary cancers include, but are not limited to, colon carcinoma, breast cancer, mesothelioma, prostate cancer (hormone refractory), squamous cell carcinoma, Kaposi sarcoma, and leukemia.
  • Figure 1 shows amino acid sequence ofthe B4ECv3 protein (predicted sequence ofthe precursor including uncleaved Eph B4 leader peptide is shown).
  • Figure 2 shows amino acid sequence ofthe B4ECv3NT protein (predicted sequence of the precursor including uncleaved Eph B4 leader peptide is shown).
  • Figure 3 shows amino acid sequence ofthe B2EC protein (predicted sequence of tl e precursor including uncleaved Ephrin B2 leader peptide is shown).
  • Figure 4 shows amino acid sequence ofthe B4ECv3-FC protein (predicted sequence of the precursor including uncleaved Eph B4 leader peptide is shown).
  • Figure 5 shows amino acid sequence ofthe B2EC-FC protein (predicted sequence ofthe precursor including uncleaved Ephrin B2 leader peptide is shown).
  • Figure 6 shows B4EC-FC binding assay (Protein A-agarose based).
  • Figure 7 shows B4EC-FC inhibition assay (Inhibition in solution).
  • Figure 8 shows B2EC-FC binding assay (Protein- A-agarose based assay).
  • Figure 9 shows chemotaxis of HUAEC in response to B4Ecv3.
  • Figure 10 shows chemotaxis of HHEC in response to B2EC-FC.
  • Figure 11 shows chemotaxis of HHAEC in response to B2EC.
  • Figure 12 shows effect of B4Ecv3 on HUAEC tubule formation.
  • Figure 13 shows effect of B2EC-FC on HUAEC tubule formation.
  • Figure 14 is a schematic representation of human Ephrin B2 constructs.
  • Figure 15 is a schematic representation of human EphB4 constructs.
  • Figure 16 shows the domain structure ofthe recombinant soluble EphB4EC proteins. Designation ofthe domains are as follows: L - leader peptide, G - globular (ligand-binding domain), C - Cys-rich domain, FI, F2 - fibronectin type III repeats, H - 6 x His-tag.
  • Figure 17 shows purification and ligand binding properties ofthe EphB4EC proteins.
  • A SDS-PAAG gel electrophoresis of purified EphB4-derived recombinant soluble proteins (Coomassie-stained).
  • B Binding of Ephrin B2-AP fusion to EphB4-derived recombinant proteins immobilized on Ni-NT A-agarose beads. Results of three independent experiments are shown for each protein. Vertical axis - optical density at 420 nm.
  • Figure 18 shows that EphB4v3 inhibits chemotaxis.
  • Figure 19 shows that EphB4v3 inhibits tubule formation on Matrigel.
  • A displays the strong inhibition of tubule formation by B4v3 in a representative experiment.
  • B shows a quantitation ofthe reduction of tube-length obtained with B4v3 at increasing concentrations as well as a reduction in the number of junctions, in comparison to cells with no protem. Results are displayed as mean values _ S.D. obtained from three independent experiments performed with duplicate wells.
  • Figure 20 shows that soluble EphB4 has no detectable cytotoxic effect as assessed by MTS assay.
  • Figure 21 shows that B4v3 inhibits invasion and tubule formation by endothelial cells in the Matrigel assay.
  • A to detect total invading cells, photographed at 20X magnification or with Masson's Trichrome
  • Top left of A B displays section of a Matrigel plug with no GF
  • top right of A displays section with B4IgG containing GF and lower left section contains GF
  • lower right shows GF in the presence of B4v3.
  • Significant invasion of endothelial cells is only seenin GF containing Matrigel.
  • Top right displays an area with a high number of invaded cells induced by B4IgG, which signifies the dimeric form of B4v3.
  • the left upper parts ofthe pictures correspond to the cell layers formed around the Matrigel plug from which cells invade toward the center ofthe plug located in the direction ofthe right lower corner.
  • Total cells in sections of the Matrigel plugs were quantitated with Scion Image software. Results obtained from two experiments with duplicate plugs are displayed as mean values _ S.D.
  • Figure 22 shows tyrosine phosphorylation of EphB4 receptor in PC3 cells in response to stimulation with EphrinB2-Fc fusion in presence or absence of EphB4-derived recombinant soluble proteins.
  • Figure 23 shows effects of soluble EphB4ECD on viability and cell cycle.
  • Figure 24 shows that B4v3 inhibitis neovascular response in a murine corneal hydron micropocket assay.
  • Figure 25 shows that that SCC15, B16, and MCF-7 co-injected with sB4v3 in the presence of matrigel and growth factors, inhibits the in vivo tumor growth of these cells.
  • FIG. 26 shows that soluble EphB4 causes apoptosis, necrosis and decreased angiogenesis in threee tumor types, B16 melanoma, SCC15, head and neck carcinoma, and MCF-7 Breast carcinoma.
  • Tumors were injected premixed with Matrigel plus growth factors and soluble EphB4 subcutaneously. After 10 to 14 days, the mice were injected intravenously with fitc-lectin (green) to assess blood vessel perfusion.
  • Tumors treated with control PBS displayed abundant tumor density and a robust angiogenic response
  • Tumors treated with sEphB4 displayed a decrease in tumor cell density and a marked inhibition of tumor angiogenesis in regions with viable tumor cells, as well as tumor necrosis and apoptosis.
  • Figure 27 shows expression of EphB4 in prostate cell lines.
  • Figure 28 shows expression of Epl B4 in prostate cancer tissue. Representative prostate cancer frozen section stained with EphB4 monoclonal antibody (top left) or isotype specific control (bottom left). Adjacent BPH tissue stained with EphB4 monoclonal antibody (top right). Positive signal is brown color in the tumor cells. Stro a and the normal epithelia are negative. Note membrane localization of stain in the tumor tissue, consistent with trans-membrane localization of EphB4. Representative QRT-PCR of RNA extracted from cancer specimens and adjacent BPH tissues (lower right).
  • Figure 29 shows downregulation of EphB4 in prostate cancer cells by tumor suppressors and RXR expression.
  • A) PC3 cells were co-transfected with truncated CD4 and p53 or PTEN or vector only. 24 h later CD4-sorted cells were collected, lysed and analyzed sequentially by Western blot for the expression of EphB4 and ⁇ -actin, as a normalizer protein.
  • LNCaP-FGF is a stable transfection clone of FGF-8, while CWR22R-RXR stably expresses the RXR receptor.
  • BPH-1 was established from benign hypertrophic prostatic epithelium.
  • Figure 30 shows downregulation of EphB4 in prostate cancer cells by EGFR and IGFR-1.
  • Figure 31 shows effect of specific EphB4 AS-ODNs and siRNA on expression and prostate cell functions.
  • Figure 32 shows effect of EphB4 siRNA 472 on cell cycle and apoptosis.
  • Figure 33 shows that EphB4 and EphrinB2 are expressed in mesothelioma cell lines as shown by RT-PCR (A) and Western Blot (B).
  • Figure 34 shows expression of ephrin B2 and EphB4 by in situ hybridization in mesothelioma cells.
  • Figure 35 shows cellular expression of EphB4 and ephrin B2 in mesothelioma cultures.
  • Figure 36 shows expression of ephrin B2 and EphB4 in mesothelioma tumor. hrrmunohistochemistry of malignant mesothelioma biopsy. H&E stained section to reveals tumor architecture; bottom left panel is background control with no primary antibody. EphB4 and ephrin B2 specific staining is brown color. Original magnification 200X.
  • Figure 37 shows effects of EPHB4 antisense probes (A) and EPHB4 siRNAs (B) on the growth of H28 cells.
  • Figure 38 shows effects of EPHB4 antisense probes (A) and EPHB4 siRNAs (B) on cell migration.
  • FIG 39 shows that EphB4 is expressed in HNSCC primary tissues and metastases.
  • the right hand column are frozen sections of lymph node metastasis stained with EphB4 polyclonal antibody (top right) and visualized with DAB. Control (middle) was incubation with goat serum and H&E (bottom) reveals the location ofthe metastatic foci surrounded by stroma which does not stain.
  • Figure 40 shows that EphB4 is expressed in HNSCC cell lines and is regulated by EGF:
  • Figure 41 shows mechanism of regulation of EphB4 by EGF: A) Schematic ofthe EGFR signaling pathways, showing in red the sites of action and names of specific kinase inhibitors used. B) SCC 15 cells were serum-starved for 24 h prior to an additional 24 incubation as indicated with or without EGF (10 ng/ml), 3 ⁇ M U73122, or 5 ⁇ M SH-5, 5 ⁇ M SP600125, 25 nM LY294002, - ⁇ M PD098095 or 5 ⁇ M SB203580. N/A indicates cultures that received equal volume of diluent (DMSO) only. Cell lysates were subjected to Western Blot with Epl B4 monoclonal antibody, ⁇ -actin signal serves as control of protein loading and transfer.
  • DMSO diluent
  • Figure 42 shows that specific EphB4 siRNAs inhibit EphB4 expression, cell viability and cause cell cycle arrest.
  • GFP green fluorescence protein
  • C) SCC15 cells transfected with siRNAs as indicated were analyzed 24 h post transfection for cell cycle status by flow cytometry as described in the Methods. Shown are the plots of cell number vs. propidium iodide fluorescence intensity. Top and middle row show plots for cells 16 h after siRNA transfection, bottom row shows plots for cells 36 h post transfection. Specific siRNA and concentration are indicated for each plot. Lipo LipofectamineTM200 mock transfection.
  • Figure 43 shows in vitro effects of specific EphB4 AS-ODNs on SCC cells.
  • the red brackets indicate the width ofthe original scrape.
  • Figure 44 shows that EphB4 AS-ODN inhibits tumor growth in vivo.
  • Figure 45 shows that Ephrin B2, but not EphB4 is expressed in KS biopsy tissue.
  • A In situ hybridization with antisense probes for ephrin B2 and EphB4 with corresponding H&E stained section to show tumor architecture. Dark blue color in the ISH indicates positive reaction for ephrin B2. No signal for EphB4 was detected in the Kaposi's sarcoma biopsy. For contrast, ISH signal for EphB4 is strong in squamous cell carcinoma tumor cells. Ephrin B2 was also detected in KS using EphB4-AP fusion protein (bottom left).
  • B Detection of ephrin B2 with EphB4/Fc fusion protein.
  • Double-label confocal immunofluorescence microscopy with antibodies to ephrin B2 (red) LANAl (green), or EphB4 (red) of frozen KS biopsy material directly demonstrates co-expression of LANAl and ephrin B2 in KS biopsy. Coexpression is seen as yellow color.
  • Figure 46 shows that HHV-8 induces arterial marker expression in venous endothelial cells.
  • A Immunofluorescence of cultures of HUVEC and HUVEC/BC-1 for artery/vein markers and viral proteins. Cultures were grown on chamber slides and processed for immunofluorescence detection of ephrin B2 (a, e, i), EphB4 (m, q, u), CD 148 (j, v), and the HHV-8 proteins LANAl (b, f, m) or ORF59 (r) as described in the Materials and Methods. Yellow color in the merged images ofthe same field demonstrate co-expression of ephrin B2 and LANA or eplirin B2 and CD 148.
  • FIG. 47 shows that HHV-8 induces arterial marker expression in Kaposi's sarcoma cells.
  • SLK-vGPCR is a stable clone of SLK expressing the HHV-8 vGPCR
  • SLK-pCEFL is control stable clone transfected with empty expression vector.
  • SLK cells transfected with LANA or LANA ⁇ 440 are SLK-LANA and SLK- ⁇ 440 respectively. Quantity of protein loading and transfer was determined by reprobing the membranes with ⁇ -actin monoclonal antibody.
  • HUVEC in 24 well plates were transfected using Superfect with 0.8 ⁇ g/well eplirin B2 promoter constructs containing sequences from -2941 to -11 with respect to the translation start site, or two 5 '-deletions as indicated, together with 80 ng/well pCEFL or pvGPCR-CEFL.
  • Luciferase was determined 48 h post transfection and induction ratios are shown to the right ofthe graph.
  • pGL3Basic is promoterless luciferase control vector. Luciferase was normalized to protein since GPCR induced expression ofthe cotransfected ⁇ -galactosidase. Graphed is mean + SEM of 6 replicates. Shown is one of three similar experiments.
  • Figure 48 shows that VEGF and VEGF-C regulate ephrin B2 expression.
  • Figure 49 shows that Ephrin B2 knock-down with specific siRNA inhibits viability in KS cells and HUVEC grown in the presence of VEGF but not IGF, EGF or bFGF.
  • KS-SLK cells were transfected with various siRNA to ephrin B2 and controls. After 48 hr the cells were harvested and crude cell lysates fractionated on 4-20% SDS-PAGE. Western blot was performed with monoclonal antibody to ephrin B2 generated in-house. The membrane was stripped and reprobed with ⁇ -actin monoclonal antibody (Sigma) to illustrate equivalent loading and transfer.
  • the cells were transfected using Lipofectamine 2000 (Invitrogen) in Opti-MEM medium containing 10 nM of siRNA to ephrin B2, Eph B4 or green fluorescence protein (GFP) as control.
  • the cells were incubated for 2 hr and then the fresh media containing growth factors or VEGF alone was added to their respective wells. After 48 hrs, the cells were stained with crystal violet and the pictures were taken immediately by digital camera at 10X magnification.
  • Figure 50 shows that soluble EphB4 inhibits KS and EC cord formation and in vivo angiogenesis.
  • Cord formation assay of HUVEC in MatrigelTM (upper row).
  • Figure 51 shows expression of EPHB4 in bladder cancer cell lines (A), and regulation of EPHB4 expression by EGFR signaling pathway (B).
  • Figure 52 shows that transfection of p53 inhibit the expression of EPHB4 in 5637 cell.
  • Figure 53 shows growth inhibition of bladder cancer cell line (5637) upon treatment with EPHB4 siRNA 472.
  • Figure 54 shows results on apoptosis study of 5637 cells transfected with EPHB4 siRNA 472.
  • Figure 55 shows effects of EPHB4 antisense probes on cell migration. 5637 cells were treated with EPHB4AS10 (10 ⁇ M).
  • Figure 56 shows effects of EPHB4 siRNA on cell invasion.
  • 5637 cells were transfected with siRNA 472 or control siRNA.
  • Figure 57 shows comparison of EphB4 monoclonal antibodies by G250 and in pull-down assay.
  • Figure 58 shows that EphB4 antibodies inhibit the growth of SCC15 xenograft tumors.
  • Figure 59 shows that EphB4 antibodies cause apoptosis, necrosis and decreased angiogenesis in SCC 15, head and neck carcinoma tumor type.
  • Figure 60 shows that systemic administration of EphB4 antibodies leads to tumor regression.
  • Figure 61 shows a genomic nucleotide sequence of human EphB4.
  • Figure 62 shows a cDNA nucleotide sequence of human EphB4.
  • Figure 63 shows a genomic nucleotide sequence of human Ephrin B2.
  • Figure 64 shows a cDNA nucleotide sequence of human Ephrin B2.
  • Figure 65 shows an amino acid sequence of human EphB4.
  • Figure 66 shows an amino acid sequence of human Ephrin B2.
  • the current disclosure is based in part on the discovery that signaling through the ephrin/ephrin receptor pathway contributes to tumorigenesis.
  • Applicants detected expression of ephrin B2 and EphB4 in tumor tissues and developed anti-tumor therapeutic agents for blocking signaling through the ephrin ephrin receptor.
  • the disclosure provides nucleic acids and methods for antisense or RNAi-based inlribition ofthe expression of EphB4 and EphrinB2. Accordingly, in certain aspects, the disclosure provides a large number of nucleic acid compounds that may be used to treat cancer as well as angiogenesis related disorders and unwanted angiogenesis related processes.
  • Ephrin and Eph are used to refer, respectively, to ligands and receptors. They can be from any of a variety of animals (e.g., mammals/non-mammals, vertebrates/non- vertebrates, including humans). The nomenclature in this area has changed rapidly and the te ⁇ ninology used herein is that proposed as a result of work by the Eph
  • Ephrin B2 and EphB4 refers to Ephrin B2 and EphB4.
  • the present invention contemplates any ephrin ligand and/or Eph receptor within their respective family, which is expressed in a tumor.
  • the ephrins (ligands) are of two structural types, which can be further subdivided on the basis of sequence relationships and, functionally, on the basis ofthe preferential binding they exhibit for two corresponding receptor subgroups. Structurally, there are two types of ephrins: those which are membrane-anchored by a glycerophosphatidylinositol (GPI) linkage and those anchored through a transmembrane domain.
  • GPI glycerophosphatidylinositol
  • the ligands are divided into the Ephrin-A subclass, which are GPI-linked proteins which bind preferentially to EphA receptors, and the Ephrin-B subclass, which are transmembrane proteins which generally bind preferentially to EphB receptors.
  • Eph family receptors are a family of receptor protein-tyrosine kinases which are related to Eph, a receptor named for its expression in an erythropoietin-producing human hepatocellular carcinoma cell line. They are divided into two subgroups on the basis ofthe relatedness of their extracellular domain sequences and their ability to bind preferentially to Ephrin-A proteins or Ephrin-B proteins. Receptors which interact preferentially with Ephrin-A proteins are EphA receptors and those which interact preferentially with Ephrin-B proteins are EphB receptors.
  • Eph receptors have an extracellular domain, composed ofthe ligand-binding globular domain, a cysteine rich region followed by a pair of fibronectin type III repeats (e.g., see Figure 16).
  • the cytoplasmic domain consists of a juxtamembrane region containing two conserved tyrosine residues; a protein tyrosine kinase domain; a sterile ⁇ -motif (SAM) and a PDZ-domain binding motif.
  • EphB4 is specific for the membrane-bound ligand Ephrin B2 (Sakano, S. et al 1996; Brambilla R. et al 1995).
  • Ephrin B2 belongs to the class of Eph ligands that have a transmembrane domain and cytoplasmic region with five conserved tyrosine residues and PDZ domain.
  • Eph receptors are activated by binding of clustered, membrane attached ephrins (Davis S et al, 1994), indicating that contact between cells expressing the receptors and cells expressing the ligands is required for Eph activation.
  • an Eph receptor dimerizes and autophosphorylate the juxtamembrane tyrosine residues to acquire full activation (Kalo MS et al, 1999, Binns KS, 2000).
  • Eph engagement of ephrins results in rapid phosphorylation of the conserved intracellular tyrosines (Bruckner K, 1997) and somewhat slower recruitment of PDZ binding proteins (Palmer A 2002).
  • Eph/ephrins may be associated with increased potentials for tumor growth, tumorigenicity, and metastasis (Easty DJ, 1999; Kiyokawa E, 1994; Tang XX, 1999; Vogt T, 1998; Liu W, 2002; Stephenson SA, 2001; Steube KG 1999; Berclaz G, 1996).
  • One aspect ofthe present disclosure provides a method for reducing the growth rate of a tumor expressing Ephrin B2 and or EphB4. Such method comprises administering an amount of a nucleic acid therapeutic agent that inhibits gene expression of Ephrin B2, EphB4, or both.
  • nucleic Acid Therapeutic Agents This disclosure relates to nucleic acid therapeutic agents and methods for inhibiting or reducing gene expression of ephrin and/or ephrin receptor (Eph).
  • inhibit or “reduce,” it is meant that the expression ofthe gene, or level of nucleic acids or equivalent nucleic acids encoding one or more proteins or protein subunits, such as Ephrin B2 and/or EphB4, is reduced below that observed in the absence ofthe nucleic acid therapeutic agents ofthe disclosure.
  • gene it is meant a nucleic acid that encodes a RNA, for example, nucleic acid sequences including but not limited to structural genes encoding a polypeptide.
  • nucleic acid therapeutic agent or “nucleic acid agent” or “nucleic acid compound” refers to any nucleic acid-based compound that contains nucleotides and has a desired effect on a target gene.
  • the nucleic acid therapeutic agents can be single-, double-, or multiple-stranded, and can comprise modified or unmodified nucleotides or non- nucleotides or various mixtures, and combinations thereof.
  • nucleic acid therapeutic agents ofthe disclosure include, but are not limited to, antisense nucleic acids, dsRNA, siRNA, and enzymatic nucleic acid compounds.
  • the disclosure features one or more nucleic acid therapeutic agents that independently or in combination modulate expression ofthe Ephrin B2 gene encoding an Ephrin B2 protein (e.g., Genbank Accession No.: NP_004084) or the EphB4 receptor gene which encodes an EphB4 protein (e.g., Genbank Accession No.: NP_004435).
  • the Ephrin B2 gene encoding an Ephrin B2 protein
  • the EphB4 receptor gene which encodes an EphB4 protein
  • the disclosure relates to antisense nucleic acids.
  • antisense nucleic acid it is meant a non-enzymatic nucleic acid compound that binds to a target nucleic acid by means of RNA-RNA, RNA-DNA or RNA-PNA (protein nucleic acid) interactions and alters the activity ofthe target nucleic acid (for a review, see Stein and Cheng, 1993 Science 261, 1004 and Woolf et al., U.S. Pat. No. 5,849,902).
  • antisense molecules are complementary to a target sequence along a single contiguous sequence ofthe antisense molecule.
  • an antisense molecule can form a loop and binds to a substrate nucleic acid which forms a loop.
  • an antisense molecule can be complementary to two (or more) non-contiguous substrate sequences, or two (or more) non-contiguous sequence portions of an antisense molecule can be complementary to a target sequence, or both.
  • antisense DNA can be used to target nucleic acid by means of DNA-RNA interactions, thereby activating RNase H, which digests the target nucleic acid in the duplex.
  • the antisense oligonucleotides can comprise one or more RNAse H activating region, which is capable of activating RNAse H to cleave a target nucleic acid.
  • Antisense DNA can be synthesized chemically or expressed via the use of a single stranded DNA expression vector or equivalent thereof.
  • RNase H activating region is meant a region (generally greater than or equal to 4-25 nucleotides in length, preferably from 5-11 nucleotides in length) of a nucleic acid compound capable of binding to a target nucleic acid to form a non-covalent complex that is recognized by cellular RNase H enzyme (see for example Arrow et al., U.S. Pat. No. 5,849,902; Arrow et al., U.S. Pat. No. 5,989,912).
  • the RNase H enzyme binds to a nucleic acid compound- target nucleic acid complex and cleaves the target nucleic acid sequence.
  • the RNase H activating region comprises, for example, phosphodiester, phosphorothioate, phosphorodithioate, 5'-thiophosphate, phosphoramidate or methylphosphonate backbone chemistry, or a combination thereof.
  • the RNase H activating region can also comprise a variety of sugar chemistries.
  • the RNase H activating region can comprise deoxyribose, arabino, fluoroarabino or a combination thereof, nucleotide sugar chemistry.
  • the antisense nucleic acids ofthe disclosure include natural-type oligonucleotides and modified oligonucleotides including phosphorothioate-type oligodeoxyribonucleotides, phosphorodithioate-type oligodeoxyribonucleotides, methylphosphonate-type oligodeoxyribonucleotides, phosphoramidate-type oligodeoxyribonucleotides, H-phosphonate- type oligodeoxyribonucleotides, triester-type oligodeoxyribonucleotides, alpha-anomer-type oligodeoxyribonucleotides, peptide nucleic acids, other artificial nucleic acids, and nucleic acid- modified compounds.
  • natural-type oligonucleotides and modified oligonucleotides including phosphorothioate-type oligodeoxyribonucleotides, phosphorodithioate
  • modifications include those which are internal or at the end(s) ofthe oligonucleotide molecule and include additions to tlie molecule ofthe internucleoside phosphate linkages, such as cholesterol, cholesteryl, or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the genome.
  • tlie molecule ofthe internucleoside phosphate linkages such as cholesterol, cholesteryl, or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the genome.
  • modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide having a sugar which, at both its 3' and 5' positions is attached to a chemical group other than a hydroxyl group (at its 3' position) and other than a phosphate group (at its 5' position).
  • modifications to sugars include modifications to the 2' position ofthe ribose moiety which include but are not limited to 2'-O-substituted with an ⁇ O— lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an —O-aryl, or allyl group having 2-6 carbon atoms wherein such --O-alkyl, aryl or allyl group may be unsubstituted or may be substituted, (e.g., with halo, hydroxy, trifluoromethyl cyano, nitro acyl acyloxy, alkoxy, carboxy, carbalkoxyl, or amino groups), or with an amino, or halo group.
  • Nonlimiting examples of particularly useful oligonucleotides ofthe disclosure have 2'-O-alkylated ribonucleotides at their 3', 5', or 31 and 5' termini, with at least four or five contiguous nucleotides being so modified.
  • Examples of 2'-O-alkylated groups include, but are not limited to, 2'-O-methyl, 2'-O- ethyl, 2'-O-propyl, and 2'-O-butyls.
  • the synthesis ofthe natural-type and modified antisense nucleic acids can be carried out with, for example, a 381A DNA synthesizer or 394 DNA/RNA synthesizer manufactured by ABI (Applied Biosystems Inc.) in accordance with the phosphoramidite method (see instructions available from ABI, or F. Eckstein, Oligonucleotides and Analogues: A Practical Approach, IRL Press (1991)).
  • a nucleic acid-related molecule is synthesized by condensation between the 3'-terminus of a modified deoxyribonucleoside or modified ribonucleoside and the 5'-terminus of another modified deoxyribonucleoside, modified ribonucleoside, oligo-modified deoxyribonucleotide or oligo- modified-ribonucleotide by use of a reagent containing phosphoramidite protected with a group such as cyanoethyl group.
  • the final cycle of this synthesis is finished to give a product with a protective group (e.g., dimethoxytrityl group) bound to a hydroxyl group at the 5'-terminus ofthe sugar moiety.
  • a protective group e.g., dimethoxytrityl group
  • the oligomer thus synthesized at room temperature is cleaved off from the support, and its nucleotide and phosphate moieties are deprotected.
  • the natural- type oligonucleic acid compound is obtained in a crude form.
  • the phosphorothioate-type nucleic acids can also be synthesized in a similar manner to the above natural type by the phosphoramidite method with the synthesizer from ABI. The procedure after the final cycle of the synthesis is also the same as with the natural type.
  • the crude nucleic acids (natural type or modified) thus obtained can be purified in a usual manner e.g., ethanol precipitation, or reverse phase cliromatography, ion-exchange chromatography and gel filtration chromatography in high performance liquid cliromatography (HPLC), supercritical fluid chromatography, and it may be further purified by electrophoresis.
  • HPLC high performance liquid cliromatography
  • a cartridge for reverse phase chromatography such as tC18-packed SepPak Plus (long body/ENV) (Waters), can also be used.
  • the purity ofthe natural-type and modified (e.g., phosphorothioate- type) nucleic acids can be analyzed by HPLC.
  • the antisense nucleic acids ofthe disclosure can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion ofthe cellular mRNA which encodes an ephrin B2 or EphB4 polypeptide.
  • the construct is an oligonucleotide wliich is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences encoding an ephrin B2 or EphB4 polypeptide.
  • oligonucleotide probes are optionally modified oligonucleotide which are resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, and are therefore stable in vivo.
  • exemplary nucleic acid compounds for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patent Nos. 5,176,996; 5,264,564; and 5,256,775).
  • dsRNA double stranded RNA
  • RNAi RNA interference
  • siRNA see for example, Bass, 2001, Nature, 411, 428-429; Elbasbir et al., 2001 , Nature, 411 , 494-498; and Kreutzer et al., PCT Publication No. WO 00/44895; Zernicka-Goetz et al., PCT Publication No. WO 01/36646; Fire, PCT Publication No. WO 99/32619; Plaetinck et al., PCT Publication No.
  • RNAi is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner. RNAi provides a useful method of inhibiting gene expression in vitro or in vivo.
  • dsRNA double-stranded RNA
  • short interfering RNA refers to any nucleic acid compound capable of mediating RNAi or gene silencing when processed appropriately be a cell.
  • the siRNA can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid compound (e.g., Ephrin B2 or EphB4).
  • the siRNA can be a single-stranded hairpin polynucleotide having self- complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid compound.
  • the siRNA can be a circular single- stranded polynucleotide having two or more loop structures and a stem comprising self- complementary sense and antisense regions, wherein the antisense region comprises complementarity to a target nucleic acid compound, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA capable of mediating RNAi.
  • the siRNA can also comprise a single stranded polynucleotide having complementarity to a target nucleic acid compound, wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5'-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574), or 5',3'-diphosphate.
  • a terminal phosphate group such as a 5'-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574), or 5',3'-diphosphate.
  • the siRNAs ofthe disclosure contain a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the mRNA transcript for the gene to be inhibited (the "target" gene).
  • the double-stranded RNA need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi.
  • the disclosure has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence.
  • the number of tolerated nucleotide mismatches between the target sequence and the siRNA sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches in the center ofthe siRNA duplex are most critical and may essentially abolish cleavage ofthe target RNA. In contrast, nucleotides at the 3' end ofthe siRNA strand that is complementary to the target RNA do not significantly contribute to specificity ofthe target recognition.
  • Sequence identity may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90% sequence identity, or even 100% sequence identity, between the siRNA and the portion ofthe target gene is preferred.
  • the duplex region ofthe RNA maybe defined functionally as a nucleotide sequence that is capable of hybridizing with a portion ofthe target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C hybridization for 12-16 hours; followed by washing).
  • a portion ofthe target gene transcript e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C hybridization for 12-16 hours; followed by washing.
  • the double-stranded structure of dsRNA may be formed by a single self-complementary
  • RNA duplex formation may be initiated either inside or outside the cell.
  • the RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of double-stranded material may yield more effective inhibition, while lower doses may also be useful for specific applications. Inhibition is sequence-specific in that nucleotide sequences corresponding to the duplex region ofthe RNA are targeted for genetic inhibition.
  • the subject siRNAs are around 19-30 nucleotides in length, and even more preferably 21-23 nucleotides in length.
  • the siRNAs are understood to recruit nuclease complexes and guide the complexes to the target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex.
  • the 21-23 nucleotides siRNA molecules comprise a 3' hydroxyl group.
  • the siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence ofthe enzyme dicer. In one embodiment, the Drosophila in vitro system is used.
  • dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination.
  • the combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides.
  • the siRNA molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify siRNAs. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to purify the siRNA. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to purify siRNAs.
  • gel electrophoresis can be used to purify siRNAs.
  • non-denaturing methods such as non-denaturing column chromatography
  • chromatography e.g., size exclusion chromatography
  • glycerol gradient centrifugation glycerol gradient
  • dsRNAs e.g., siRNAs
  • Endogenous RNA polymerase of the treated cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro.
  • dsRNA or siRNA molecules ofthe disclosure need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.
  • the dsRNAs may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties.
  • the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA.
  • bases may be modified to block the activity of adenosine deaminase.
  • the dsRNAs may be produced enzymatically or by partial/total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • Methods of chemically modifying RNA molecules can be adapted for modifying dsRNAs (see, e.g., Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J Mol Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61).
  • the backbone of an dsRNA can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing ohgomers or sugar modifications (e.g., 2 '-substituted ribonucleosides, a-configuration).
  • the dsRNAs ofthe disclosure lack 2'-hydroxy (2'-OH) containing nucleotides.
  • At least one strand ofthe siRNA molecules has a 3' overhang from about 1 to about 6 nucleotides in length, though may be from 2 to 4 nucleotides in length. More preferably, the 3' overhangs are 1-3 nucleotides in length. In certain embodiments, one strand having a 3' overhang and the other strand being blunt-ended or also having an overhang. The length ofthe overhangs may be the same or different for each strand. In order to further enhance the stability ofthe siRNA, the 3' overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotide 3' overhangs by 2'-deoxythyinidine is tolerated and does not affect the efficiency of RNAi.
  • the absence of a hydroxyl significantly enhances the nuclease resistance ofthe overhang in tissue culture medium and may be beneficial in vivo.
  • the subject dsRNA can also be in the form of a long double-stranded RNA.
  • the dsRNA is at least 25, 50, 100, 200, 300 or 400 bases. In some cases, the dsRNA is 400-800 bases in length.
  • the dsRNAs are digested intracellularly, e.g., to produce siRNA sequences in the cell.
  • use of long double- stranded RNAs in vivo is not always practical, presumably because of deleterious effects which may be caused by the sequence-independent dsRNA response. In such embodiments, the use of local delivery systems and/or agents which reduce the effects of interferon or PICR are preferred.
  • the dsRNA is in the form of a hairpin structure (named as hairpin RNA).
  • hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo. Examples of making and using such hairpin RNAs for gene silencing in mammalian cells are described in, for example, Paddison et al, Genes Dev, 2002, 16:948-58; McCaffrey et al., Nature, 2002, 418:38-9; McManus et al.,
  • hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene.
  • siRNAs can be produced by processing a hairpin RNA in the cell.
  • PCT application WO 01/77350 describes an exemplary vector for bi-directional transcription of a transgene to yield both sense and antisense RNA transcripts ofthe same transgene in a eukaryotic cell.
  • the present disclosure provides a recombinant vector having the following unique characteristics: it comprises a viral replicon having two overlapping transcription units arranged in an opposing orientation and flanking a transgene for a dsRNA of interest, wherein the two overlapping transcription units yield both sense and antisense RNA transcripts from the same transgene fragment in a host cell.
  • the disclosure relates to enzymatic nucleic acid compounds.
  • enzymatic nucleic acid compound it is meant a nucleic acid compound which has complementarity in a substrate binding region to a specified target gene, and also has an enzymatic activity which is active to specifically cleave a target nucleic acid. It is understood that the enzymatic nucleic acid compound is able to intermolecularly cleave a nucleic acid and thereby inactivate a target nucleic acid compound. These complementary regions allow sufficient hybridization ofthe enzymatic nucleic acid compound to the target nucleic acid and thus pennit cleavage.
  • complementarity is preferred, but complementarity as low as 50-75% can also be useful in this disclosure (see for example Werner andUhlenbeck, 1995, Nucleic Acids Research, 23, 2092-2096; Hammann et al., 1999, Antisense and Nucleic Acid Drug Dev., 9, 25-31).
  • the enzymatic nucleic acids can be modified at the base, sugar, and/or phosphate groups.
  • zymatic nucleic acid is used interchangeably with phrases such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, aptazyme or aptamer-binding ribozyme, regulatable ribozyme, catalytic oligonucleotides, nucleozyme, DNAzyme, RNA enzyme, endoribonuclease, endonuclease, minizyme, leadzyme, " oligozyme or DNA enzyme. All of these terminologies describe nucleic acid compounds with enzymatic activity.
  • enzymatic nucleic acid compounds described in the instant application are not limiting in the disclosure and those skilled in the art will recognize that all that is important in an enzymatic nucleic acid compound of this disclosure is that it has a specific substrate binding site which is complementary to one or more ofthe target nucleic acid regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart a nucleic acid cleaving and/or ligation activity to the molecule (Cech et al., U.S. Pat. No. 4,987,071; Cech et al., 1988, 260 JAMA 3030).
  • enzymatic nucleic acids act by first binding to a target nucleic acid. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion ofthe molecule that acts to cleave the target nucleic acid. Thus, the enzymatic nucleic acid first recognizes and then binds a target nucleic acid through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target nucleic acid.
  • the subject enzymatic nucleic acid is a ribozyme designed to catalytically cleave an mRNA transcripts to prevent translation of mRNA (see, e.g., PCT International Publication WO90/11364, published October 4, 1990; Sarver et al., 1990, Science 247:1222-1225; and U.S. Patent No. 5,093,246).
  • ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs
  • the use of hammerhead ribozymes is preferred.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNAs have the following sequence of two bases: 5'-UG-3'.
  • the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591.
  • the ribozymes ofthe present disclosure also include RNA endoribonucleases (hereinafter "Cech-type ribozymes”) such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS or L-19 IVS RNA) and which has been extensively described (see, e.g., Zaug, et al., 1984, Science, 224:574-578; Zaug and Cech, 1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published International patent application No. WO88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216).
  • Ceech-type ribozymes such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS or L-19 IVS RNA) and which has been extensively described (see, e.g., Zaug, et al., 1984, Science, 224:574-578
  • the subject enzymatic nucleic acid is a DNA enzyme.
  • DNA enzymes incorporate some of the mechanistic features of both antisense and ribozyme technologies. DNA enzymes are designed so that they recognize a particular target nucleic acid sequence, much like an antisense oligonucleotide, however much like a ribozyme they are catalytic and specifically cleave the target nucleic acid. Briefly, to design an ideal DNA enzyme that specifically recognizes and cleaves a target nucleic acid, one of skill in the art must first identify the unique target sequence. Preferably, the unique or substantially sequence is a G/C rich of approximately 18 to 22 nucleotides.
  • the nucleic acid therapeutic agents ofthe disclosure can be between 12 and 200 nucleotides in length.
  • exemplary enzymatic nucleic acid compounds ofthe disclosure are between 15 and 50 nucleotides in length, including, for example, between 25 and 40 nucleotides in length (for example see Jarvis et al., 1996, J. Biol. Chem., 271, 29107-29112).
  • exemplary antisense molecules ofthe disclosure are between 15 and 75 nucleotides in length, including, for example, between 20 and 35 nucleotides in length (see for example Woolf et al., 1992, PNAS., 89, 7305-7309; Milner et al., 1997, Nature Biotechnology, 15, 537-541).
  • exemplary siRNAs of the disclosure are between 20 and 27 nucleotides in length, including, for example, between 21 and 23 nucleotides in length.
  • Targets for useful nucleic acid compounds ofthe disclosure can be determined as disclosed in Draper et al., 30 WO 93/23569; Sullivan et al, WO 93/23057; Thompson et al., WO 94/02595; Draper et al., WO 95/04818; McSwiggen et al, U.S. Pat. No. 5,525,468.
  • Other examples include the following PCT applications inactivation of expression of disease-related genes: WO 95/23225, WO 95/13380, WO 94/02595. Rather than repeat the guidance provided in those documents here, below are provided specific examples of such methods, not limiting to those in the art.
  • Enzymatic nucleic acid compounds, siRNA and antisense to such targets are designed as described in those applications and synthesized to be tested in vitro and in vivo, as also described.
  • the sequences of human Ephrin B2 and/or EphB4 RNAs are screened for optimal nucleic acid target sites using a computer-folding algorithm. Potential nucleic acid binding/cleavage sites are identified.
  • the nucleic acid compounds are individually analyzed by computer folding (Jaeger et al., 1989 Proc. Natl Acad. Sci. USA, 86, 7706) to assess whether the sequences fold into the appropriate secondary structure. Those nucleic acid compounds with unfavorable intramolecular interactions such as between the binding arms and the catalytic core can be eliminated from consideration.
  • the subject nucleic acid (e.g., antisense, RNAi, and/or enzymatic nucleic acid compound) binding/cleavage sites are identified and are designed to anneal to various sites in the nucleic acid target (e.g., Ephrin B2 and/or EphB4).
  • the binding arms of enzymatic nucleic acid compounds ofthe disclosure are complementary to tl e target site sequences described above.
  • Antisense and RNAi sequences are designed to have partial or complete complementarity to the nucleic acid target.
  • the nucleic acid compounds can be chemically synthesized. The method of synthesis used follows the procedure for normal DNA/RNA synthesis as described below and in Usman et al., 1987 J Am. Chem. Soc, 109, 7845; Scaringe et al., 1990 Nucleic Acids Res., 18,
  • nucleic acid therapeutic agents having a CpG motif are at an increased likelihood of causing a non-specific immune response.
  • CpG motifs include a CG (Cytosine-Guanosine) sequence adjacent to one or more purines in the 5' direction and one or more pyrimidines in the 3' direction. Lists of known CpG motifs are available in the art.
  • Preferred nucleic acid therapeutics will be selected so as to have a selective effect on the target gene (possibly affecting other closely related genes) without triggering a generalized immune response. By avoiding nucleic acid therapeutics having a CpG motif, it is possible to decrease the likelihood that a particular nucleic acid will trigger an immune response.
  • small nucleic acid motifs small refers to nucleic acid motifs less than about 100 nucleotides in length, preferably less than about 80 nucleotides in length, and more preferably less than about 50 nucleotides in length (e.g., antisense oligonucleotides, enzymatic nucleic acids, and RNAi constructs) are preferably used for exogenous delivery.
  • the simple structure of these molecules increases the ability ofthe nucleic acid to invade targeted regions of RNA structure.
  • oligonucleotides e.g., DNA
  • oligonucleotides are synthesized using protocols known in the art as described in Caruthers et al., 1992, Methods in Enzymology 211, 3- 19, Thompson et al., International PCT Publication No. WO 99/54459, Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al, 1997, Methods Mol. Bio., 74, 59, Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311.
  • oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5 '-end, and phosphoramidites at the 3 '-end.
  • small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer with a 2.5 min coupling step for 2'-O-methylated nucleotides and a 45 sec coupling step for 2'-deoxy nucleotides.
  • syntheses can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, CA) with minimal modification to the cycle.
  • nucleic acid compounds ofthe present disclosure can be synthesized separately and joined together post-synthetically, for example by ligation (Moore et al., 1992, Science 256, 9923; Draper et al, International PCT publication No. WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. 8, 204).
  • nucleic acid compounds ofthe present disclosure are modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, 2'-C- allyl, 2'-flouro, 2'-O-methyl, 2'-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163).
  • Ribozymes are purified by gel electrophoresis using general methods or are purified by high pressure liquid chromatography (HPLC; See Wincott et al., Supra, the totality of which is hereby incorporated herein by reference) and are re-suspended in water
  • Nucleic acid compounds with modifications can prevent their degradation by serum ribonucleases and thereby increase their potency.
  • modifications e.g., base, sugar and/or phosphate
  • sugar, base and phosphate modifications can be introduced into nucleic acid compounds with significant enhancement in their nuclease stability and efficacy.
  • oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2 , -amino, 2'-C- allyl, 2'-flouro, 2'-O-methyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992, TIBS. 17, 34; Usman et al, 1994, Nucleic Acids Symp. Ser. 31, 163; Burgin et al., 1996, Biochemistry, 35, 14090).
  • Sugar modification of nucleic acid compounds have been extensively described in the art (see Eckstein et al., PCT Publication No. WO 92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and
  • nucleic acid compounds ofthe disclosure include one or more G- clamp nucleotides.
  • a G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example, Lin and Matteucci, 1998, J. Am. Chem. Soc, 120, 8531-8532.
  • a single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides.
  • the inclusion of such nucleotides in nucleic acid compounds ofthe disclosure results in both enhanced affinity and specificity to nucleic acid targets.
  • nucleic acid compounds ofthe disclosure include one or more LNA (locked nucleic acid) nucleotides such as a 2', 4'-C mythylene bicyclo nucleotide (see for example Wengel et al, PCT Publication Nos. WO 00/66604 and WO 99/14226).
  • LNA locked nucleic acid
  • the disclosure features conjugates and/or complexes of nucleic acid compounds targeting Ephrin B2 and/or EphB4.
  • conjugates and/or complexes can be used to facilitate delivery of nucleic acid compounds into a biological system, such as cells.
  • the conjugates and complexes provided by the instant disclosure can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid compounds ofthe disclosure.
  • the present disclosure encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes.
  • the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers.
  • Conjugates ofthe molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
  • biodegradable nucleic acid linlcer molecule refers to a nucleic acid compound that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule.
  • the stability ofthe biodegradable nucleic acid linker molecule can be modulated by using various combinations of ribonucleotides, deoxyribonucleotides, and chemically modified nucleotides, for example, 2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino, 2'-C-allyl, 2'-O-allyl, and other 2'-modified or base modified nucleotides.
  • the biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid compound, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus based linkage, for example, a phosphoramidate or phosphodiester linkage.
  • the biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
  • biodegradable refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
  • nucleic acid compounds such as the molecules described herein, delivered exogenously are optimally stable within cells until translation ofthe target RNA has been inhibited long enough to reduce the levels ofthe undesirable protein. This period of time varies between hours to days depending upon the disease state. These nucleic acid compounds should be resistant to nucleases in order to function as effective intracellular therapeutic agents. ' Improvements in the chemical synthesis of nucleic acid compounds described in the instant disclosure and in the art have expanded the ability to modify nucleic acid compounds by introducing nucleotide modifications to enhance their nuclease stability as described above.
  • the nucleic acid compounds comprise a 5' and/or a 3'-cap structure.
  • “cap structure” it is meant chemical modifications, which have been incorporated at either terminus ofthe oligonucleotide (see for example Wincott et al., WO 97/26270). These terminal modifications protect the nucleic acid compound from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5'-terminus (5'-cap) or at the 3'-terminus (3'-cap) or can be present on both terminus.
  • the 5'-cap includes inverted abasic residue (moiety), 4',5'-methylene nucleotide; l-(beta-D- erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4- dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety; 3'-3'-inverted abasic moiety; 3 '-2'-inverted nucleotide mo
  • the 3'-cap includes, for example, 4',5'-methylene nucleotide; l-(bela-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'- amino-alkyl phosphate; l,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6- aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5- anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threopentofuranosy nucleotide; acyclic 3',4'-seco nucleotide; 3,4- dihydroxybutyl nucleot
  • the present disclosure provides methods of inhibiting angiogenesis and methods of treating angiogenesis-associated diseases. In other embodiments, the present disclosure provides methods of inhibiting or reducing tumor growth and methods of treating an individual suffering from cancer. These methods involve administering to the individual a therapeutically effective amount of one or more nucleic acid therapeutic agent as described above. These methods are particularly aimed at therapeutic and prophylactic treatments of animals, and more particularly, humans.
  • angiogenesis-associated diseases include, but are not limited to, angiogenesis-dependent cancer, including, for example, solid tumors, blood born tumors such as leukemias, and tumor metastases; benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; inflammatory disorders such as immune and non-immune inflammation; chronic articular rheumatism and psoriasis; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis; Osier- Webber Syndrome; myocardial angiogenesis; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; and wound granulation and wound healing; telangiectasia ps
  • angiogenesis-independent cancer refers to a cancer (tumor) where there is no or little neovascularization in the tumor tissue.
  • the tumor includes a tumor inside an individual, a tumor xenograft, or a tumor cultured in vitro.
  • nucleic acid therapeutic agents ofthe present disclosure are useful for treating or preventing a cancer (tumor), including, but not limited to, colon carcinoma, breast cancer, mesothelioma, prostate cancer, bladder cancer, squamous cell carcinoma ofthe head and neck (HNSCC), Kaposi sarcoma, and leukemia.
  • a cancer tumor including, but not limited to, colon carcinoma, breast cancer, mesothelioma, prostate cancer, bladder cancer, squamous cell carcinoma ofthe head and neck (HNSCC), Kaposi sarcoma, and leukemia.
  • nucleic acid therapeutic agents can be administered, together (simultaneously) or at different times (sequentially).
  • nucleic acid therapeutic agents can be administered with another type of compounds for treating cancer or for inhibiting angiogenesis.
  • the subject methods ofthe disclosure can be used alone.
  • the subject methods may be used in combination with other conventional anti- cancer therapeutic approaches directed to treatment or prevention of proliferative disorders (e.g., tumor).
  • proliferative disorders e.g., tumor
  • such methods can be used in prophylactic cancer prevention, prevention of cancer recurrence and metastases after surgery, and as an adjuvant of other conventional cancer therapy.
  • conventional cancer therapies e.g., chemotherapy, radiation therapy, phototherapy, immunotherapy, and surgery
  • a wide array of conventional compounds have been shown to have anti-neoplastic activities. These compounds have been used as pharmaceuticalal agents in chemotherapy to shrink solid tumors, prevent metastases and further growth, or decrease the number of malignant cells in leukemic or bone marrow malignancies.
  • chemotherapy has been effective in treating various types of malignancies, many anti-neoplastic compounds induce undesirable side effects. It has been shown that when two or more different treatments are combined, the treatments may work synergistically and allow reduction of dosage of each ofthe treatments, thereby reducing the detrimental side effects exerted by each compound at higher dosages. In other instances, malignancies that are refractory to a treatment may respond to a combination therapy of two or more different treatments .
  • nucleic acid therapeutic agent ofthe present disclosure When a nucleic acid therapeutic agent ofthe present disclosure is administered in combination with another conventional anti-neoplastic agent, either concomitantly or sequentially, such therapeutic agent is shown to enhance the therapeutic effect ofthe antineoplastic agent or overcome cellular resistance to such anti-neoplastic agent. This allows decrease of dosage of an anti-neoplastic agent, thereby reducing the undesirable side effects, or restores the effectiveness of an anti-neoplastic agent in resistant cells.
  • Pharmaceutical compounds that may be used for combinatory anti-tumor therapy include, merely to illustrate: aminoglutethimide, amsacrine, anastrozole, asparaginase, beg, bicalutamide, bleomycin, buserelin, busulfan, campothecin, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daunorubicin, dienestrol, diethylstilbestrol, docetaxel, doxorubicin, epirubicin, estradiol, estramustine, etoposide, exemestane, filgrastim, fludarabine, fludrocortisone, fluorouracil, fluoxymesterone, flutamide, gemcitabine, geni
  • chemotherapeutic anti-tumor compounds may be categorized by their mechanism of action mto, for example, following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, teniposide), DNA damaging agents (actinomycin, amsacrine, anth
  • pharmaceuticalal compounds that may be used for combinatory anti-angiogenesis therapy include: (1) inhibitors of release of "angiogenic molecules," such as bFGF (basic fibroblast growth factor); (2) neutralizers of angiogenic molecules, such as an anti- ⁇ bFGF antibodies; and (3) inhibitors of endothelial cell response to angiogenic stimuli, including collagenase inhibitor, basement membrane turnover inhibitors, angiostatic steroids, fungal- derived angiogenesis inhibitors, platelet factor 4, thrombospondin, arthritis drugs such as D- penicillamine and gold thiomalate, vitamin D 3 analogs, alpha-interferon, and the like.
  • angiogenic molecules such as bFGF (basic fibroblast growth factor)
  • neutralizers of angiogenic molecules such as an anti- ⁇ bFGF antibodies
  • inhibitors of endothelial cell response to angiogenic stimuli including collagenase inhibitor, basement membrane turnover inhibitors, angiostatic steroids, fungal- derived angiogenesis inhibitors
  • angiogenesis there are a wide variety of compounds that can be used to inhibit angiogenesis, for example, peptides or agents that block the VEGF-mediated angiogenesis pathway, endostatin protein or derivatives, lysine binding fragments of angiostatin, melanin or melanin-promoting compounds, plasminogen fragments (e.g., Kringles 1-3 of plasminogen), tropoin subunits, antagonists of vitronectin ⁇ v ⁇ 3 , peptides derived from Saposin B, antibiotics or analogs (e.g., tetracycline, or neomycin), dienogest-containing compositions, compounds comprising a MetAP-2 inhibitory core coupled to a peptide, the compound EM-138, chalcone and its analogs, andnaaladase inhibitors.
  • plasminogen fragments e.g., Kringles 1-3 of plasminogen
  • tropoin subunits e.g., antagonists
  • nucleic acid therapeutic agents ofthe disclosure may be continued while the other therapy is being administered and/or thereafter.
  • Administration ofthe nucleic acid therapeutic agents may be made in a single dose, or in multiple doses. In some instances, administration ofthe nucleic acid therapeutic agents is commenced at least several days prior to the conventional therapy, while in other instances, administration is begun either immediately before or at the time ofthe administration ofthe conventional therapy.
  • Nucleic acid compounds can be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres.
  • the nucleic acid vehicle combination is locally delivered by direct injection or by use of an infusion pump.
  • routes of delivery include, but are not limited to, oral (tablet or pill fonn) and/or intrathecal delivery (Gold, 1997, Neuroscience, 76, 1153-1158).
  • Other approaches include the use of various transport and carrier systems, for example though the use of conjugates and biodegradable polymers.
  • nucleic acid delivery and administration More detailed descriptions of nucleic acid delivery and administration are provided in Sullivan et al., supra, Draper et al, PCT WO93/23569, Beigelman et al, PCT Publication No. WO99/05094, and Klimuk et al., PCT Publication No. WO99/04819.
  • the subject nucleic acids e.g., antisense nucleic acids, RNAi constructs, and enzymatic nucleic acids
  • a pharmaceutically acceptable carrier e.g., a pharmaceutically acceptable carrier.
  • Such therapeutic agents can be administered alone or as a component of a pharmaceuticalal formulation (composition).
  • the compounds may be formulated for administration in any convenient way for use in human or veterinary medicine.
  • Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
  • Formulations ofthe subject nucleic acids include those suitable for oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration.
  • the amount of active ingredient which can be combined with a canier material to produce a single dosage form will generally be that amount ofthe compound which produces a therapeutic effect.
  • methods of preparing these formulations or compositions include combining another type of anti-tumor or anti-angiogenesis therapeutic agent and a carrier and, optionally, one or more accessory ingredients.
  • tl e formulations can be prepared with a liquid carrier, or a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • Formulations for oral administration maybe in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in- water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a subject nucleic acid therapeutic agent as an active ingredient.
  • lozenges using a flavored basis, usually sucrose and acacia or tragacanth
  • one or more nucleic acid therapeutic agents ofthe present disclosure may be mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any ofthe following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting
  • pharmaceutically acceptable carriers such as sodium citrate or dicalcium phosphate
  • the pharmaceuticalal compositions may also comprise buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs, hi addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, oils (in particular, cottonseed, groundnut, co , genn, olive, castor, and sesame oils), glycerol, tetrahydro furyl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspend
  • Suspensions in addition to the active compounds, may contain suspending agents such as ethoxylated isostearyl alcohols, poiyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • suspending agents such as ethoxylated isostearyl alcohols, poiyoxyethylene sorbitol, and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • methods ofthe disclosure can be administered topically, either to skin or to mucosal membranes such as those on the cervix and vagina. This offers the greatest opportunity for direct delivery to tumor with the lowest chance of inducing side effects.
  • the topical formulations may further include one or more ofthe wide variety of agents known to be effective as skin or stratum corneum penetration enhancers.
  • Examples of these are 2-pyrcolidone, N- methyl-2 -pyrrolidone, dimethylacetamide, dimethylformamide, propylene glycol, methyl or isopropyl alcohol, dimethyl sulfoxide, and azone. Additional agents may further be included to make the formulation cosmetically acceptable. Examples of these are fats, waxes, oils, dyes, fragrances, preservatives, stabilizers, and surface active agents. Keratolytic agents such as those known in the art may also be included. Examples are salicylic acid and sulfur. Dosage forms for the topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants.
  • the subject nucleic acids may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • a pharmaceutically acceptable carrier such as a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • the ointments, pastes, creams and gels may contain, in addition to a subject nucleic acid molecule, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Powders and sprays can contain, in addition to a subject nucleic acid therapeutic agent, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances.
  • Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
  • compositions suitable for parenteral administration may comprise one or more nucleic acid therapeutic agents in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood ofthe intended recipient or suspending or thickening agents.
  • aqueous and nonaqueous carriers wliich may be employed in the pharmaceuticalal compositions ofthe disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance ofthe required particle size in the case of dispersions, and by the use of surfactants.
  • These compositions may also contain adjuvants, such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • Prevention ofthe action of microorganisms maybe ensured by tlie inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption ofthe injectable pharmaceuticalal form maybe brought about by the inclusion of agents which delay absorption, such as aluminum monostearate and gelatin.
  • Injectable depot forms are made by forming microencapsule matrices of one or more nucleic acid therapeutic agents in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) andpoly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
  • biodegradable polymers such as polylactide-polyglycolide.
  • Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
  • Formulations for intravaginal or rectally administration may be presented as a suppository, which may be prepared by mixing one or more compounds of the disclosure with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound.
  • the nucleic acids ofthe instant disclosure are formulated with a pharmaceutically acceptable agent that allows for the effective distribution ofthe nucleic acid compounds ofthe instant disclosure in the physical location most suitable for their desired activity.
  • Non-limiting examples of such pharmaceutically acceptable agents include: PEG, phospholipids, phosphorothioates, P-glycoprotein inhibitors (such as Pluronic P85) which can enhance entry of drugs into various tissues, biodegradable polymers, such as poly (DL-lactide- coglycolide) microspheres for sustained release delivery after implantation (Emerich, DF et al, 1999, Cell Transplant, 8, 47-58), and loaded nanoparticles such as those made of polybutylcyanoacrylate, which can deliver drugs across the blood brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
  • certain ofthe nucleic acid compounds ofthe instant disclosure can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et al, 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992, J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol, 65,
  • eukaryotic promoters e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399
  • nucleic acids can be augmented by their release from the primary transcript by an enzymatic nucleic acid (Draper et al, PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994, J. Biol. Chem., 269, 25856; all of these references are hereby incorporated in their totalities by reference herein).
  • an enzymatic nucleic acid Draper et al, PCT WO 93/23569, and Sullivan et al., PCT 94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser.
  • RNA molecules ofthe present disclosure are preferably expressed from transcription units (see for example Couture et al., 1996, TIG., 12, 510) inserted into DNA or RNA vectors.
  • the recombinant vectors are preferably DNA plasmids or viral vectors. Ribozyme expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphaviras.
  • the recombinant vectors capable of expressing the nucleic acid compounds are delivered as described above, and persist in target cells.
  • viral vectors can be used that provide for transient expression of nucleic acid compounds. Such vectors can be repeatedly administered as necessary.
  • nucleic acid compound expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., 1996, TIG., 12, 510).
  • the disclosure contemplates an expression vector comprising a nucleic acid sequence encoding at least one ofthe nucleic acid compounds ofthe instant disclosure.
  • the nucleic acid sequence is operably linked in a manner which allows expression ofthe nucleic acid compound ofthe disclosure.
  • the disclosure features an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a transcription termination region (e.g., eukaryotic pol I, II or III termination region); c) a nucleic acid sequence encoding at least one ofthe nucleic acid catalyst ofthe instant disclosure; and wherein said sequence is operably linked to said initiation region and said termination region, in a manner which allows expression and/or delivery of said nucleic acid compound.
  • the vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5' side or the 3'-side ofthe sequence encoding the nucleic acid catalyst ofthe disclosure; and/or an intron (intervening sequences).
  • ORF open reading frame
  • Soluble derivatives ofthe extracellular domains of human Ephrin B2 and EphB4 proteins represent either truncated full-length predicted extracellular domains of Ephrin B2 (B4ECv3, B2EC) or translational fusions of the domains with constant region of human immunoglobulins
  • IgGl Fc fragment such as B2EC-FC, B4ECv2-FC and B4ECv3-FC.
  • Representative human IgGl Fc fragment
  • Ephrin B2 constructs and human EphB4 constructs are shown Figures 14 and 15.
  • the cDNA fragments encoding these recombinant proteins were subcloned into mammalian expression vectors, expressed in transiently or stably transfected mammalian cell lines and purified to homogeneity as described in detail in Materials and Methods section (see below).
  • Predicted amino acid sequences ofthe proteins are shown in Figures 1-5. High purity of the isolated proteins and their recognition by the conesponding anti-Ephrin B2 and anti-EphB4 monoclonal or polyclonal antibodies were confirmed.
  • the recombinant proteins exhibit the expected high-affinity binding, binding competition and specificity properties with their conesponding binding partners as conoborated by the biochemical assays (see e.g., Figures 6-8).
  • Such soluble derivative proteins human Ephrin B2 and EphB4 exhibit potent biological activity in several cell-based assays and in vivo assays which measure angiogenesis or anti- cancer activities, and are therefore perspective drug candidates for anti-angiogenic and anti- cancer therapy.
  • B4ECv3 as well as B2EC and B2EC-FC proteins blocked chemotaxis of human endothelial cells (as tested with umbilical cord and hepatic AECs or VECs), with a decrease in degradation ofthe extracellular matrix, Matrigel, and a decrease in migration in response to growth factor stimuli (Figures 9-11).
  • B4ECv3 and B2EC-FC proteins have potent anti- angiogenic effect as demonstrated by their inhibition of endothelial cell tube formation ( Figures 12-13).
  • Plasmids vectors for expressing recombinant soluble derivatives of Ephrin B2 and EphB4 were based on pEF6/V5-His-TOPO vector (Invitrogen), pIG (Novagen) or pRK5.
  • pEF6/V5-His- TOPO contains human elongation factor la enhancer/promoter and blasticidin resistance marker.
  • pIG vector is designed for high-level expression of protein fusions with Fc portion of human IgGlunder CMV promoter control and pRK5 is a general purpose CMV promoter-containing mammalian expression vector.
  • pEF6-B4EC-NT cDNA fragment of human EphB4 was amplified by PCR using oligo primers 5 ' -GGATCCGCC ATGGAGCTC CGGGTGCTGCT-3' and 5'-TGGATCCCT GCTCCCGC CAGCCCTCG CTCTCATCCA-3', and TOPO-cloned into pEF6/V5-His-TOPO vector.
  • pEF6-hB4ECv3 was derived frompEF ⁇ - B4ECNT by digesting the plasmid DNA with EcoRV and BstBI, filling-in the ends with Klenow enzyme and religating tl e vector.
  • EphB4 derivative encoded by pEF6-B4EC-NT does not contain epitope- or purification tags, while the similar B4ECv3 protein encoded by pEF6-hB4ECv3 contains V5 epitope tag and 6xHis tag on its C-terminus to facilitate purification from conditioned media.
  • Plasmid construct pEF6-hB2EC was created by PCR amplification of Ephrin B2 cDNA using oligo primers 5'- TGGATCCAC CATGGCTGT GAGAAGGGAC-3' plus 5 '-ATTAATGGTGATGGT GAT GATGACTAC CCACTTCGG
  • Plasmid construct pIG-hB2EC-FC was created by PCR amplification of Ephrin B2 cDNA with oligo primers 5'-TAAAGCTTCCGCCATGG CTGTGAGAAGGGAC-3' and 5'- TAGGATCCACTTCGGA ACCGAGGATGTTGTT CCC-3' , followed by TOPO-cloning and sequencing the resulting PCR fragment with consecutive subcloning in pIG hlgGl Fc fusion expression vector cut with Bam HI and Hind III.
  • pIG-hB2EC and pIG-hB4ECv3 were generated by PCR amplifying portions of EphB4 ECD cDNA using oligo primers 5'- ATAAGCTTCC GCCATGGAGC TCCGGGTGCTG-3' plus 5'-TTGGATCCTGCTCCCG CCAGCCCTCGC TCTCATC-3' with consecutive subcloning into pIG hlgGl Fc fusion expression vector cut with Bam HI and Hind III.
  • Predicted sequences of the proteins encoded by the vectors described above are shown in Figures 1-5.
  • HEK293T human embryonic kidney line
  • DMEM fetal calf serum
  • penicillin/streptomycin/neomycin antibiotics 1% penicillin/streptomycin/neomycin antibiotics.
  • Cells were maintained at 37 °C in a humidified atmosphere of 5% CO 2 /95% air.
  • Transfections were performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. One day before transfections, 293T cells were seeded at a high density to reach 80% confluence at the time of transfection.
  • Plasmid DNA and Lipofectamine reagent at 1:3 ratio were diluted in Opti-MEM I reduced serum medium (Invitrogen) for 5 min and mixed together to form DNA:Lipofectamine complex.
  • Opti-MEM I reduced serum medium Invitrogen
  • 10 ⁇ g of plasmid DNA was used for each 10 cm culture dish. After 20 min, above complex was added directly to cells in culture medium. After 16 hours of transfection, medium was aspirated, washed once with serum free DMEM and replaced with serum free DMEM. Secreted proteins were harvested after 48 hours by collecting conditional medium. Conditional medium was clarified by centrifugation at 10,000 g for 20 min, filtered through 0.2 ⁇ m filter and used for purification. 3) Generating stable cell lines
  • HEK293 or HEK293T cells were transfected with either pEF6-B4ECv3 or pEF6-B4EC-NT plasmid constructs as described above and selected using antibiotic Blasticidin. After 24 hours of transfection, cells were seeded at low density. Next day, cells were freated with 10 ⁇ g/ml of Blasticidin. After two weeks of drug selection, surviving cells were pooled and selected further for single cell clone expansion. After establishing stable cells, they were maintained at 4 ⁇ g/ml Blasticidin. Conditioned media were tested to confirm expression and secretion ofthe respective recombinant proteins. Specificity of expression was confirmed by Western blot with anti-B4 mono- or polyclonal ABs and B2EC-AP reagent binding and competition assays.
  • HEK293 cells were transiently transfected with a plasmid encoding secreted form of EphB4ectodomain (B4ECv3).
  • Conditional media was harvested and supplemented with 10 mM imidazole, 0.3 M NaCl and centrifuged at 20,000g for 30 min to remove cell debris and insoluble particles. 80 ml of obtained supernatant were applied onto the pre-equilibrated column with 1 ml of Ni-NT A-agarose (Qiagen) at the flow rate of 10 ml/h.
  • B4EC-FC protein and B2EC-FC protein were similarly purified.
  • Ni-NT A- Agarose 10 ⁇ l of Ni-NT A- Agarose were incubated in microcentrifuge tubes with 50 ⁇ l of indicated amount of B4ECv3 diluted in binding buffer BB (20 mM Tris-HCl, 0.15 M NaCl, 0.1%) bovine serum albumin pH 8) After incubation for 30 min on shaking platform, Ni-NTA beads were washed twice with 1.4 ml of BB, followed by application of 50 ⁇ l of B2-AP in the final concentration of 50 nM. Binding was perfonned for 30 min on shaking platform, and then tubes were centrifuged and washed one time with 1.4 ml of BB. Amount of precipitated AP was measured colorimetrically after application of PNPP.
  • B4ECv3 was serially diluted in 20 mM Tris-HCl, 0.15 M NaCl, 0.1%) BSA, pH 8 and mixed with 5,000 HEK293 cells expressing membrane-associated full- length Ephrin B2. After incubation for 1 h, 50 ⁇ l of 5 nM B4EC-AP reagent (protein fusion of EphB4 ectodomain with placental alkaline phosphatase were added into each tube for 30 min to detect unoccupied Ephrin B2 binding sites. Binding reactions were stopped by dilution with 1.2 ml of BB and centrifugation. Colorimetric reaction of cell-precipitated AP was developed with PNPP substrate.
  • Protein A-agarose based assay 10 ⁇ l of Protein A-agarose were incubated in Eppendorf tubes with 50 ⁇ l of indicated amount of B4EC-FC diluted in binding buffer BB (20 mM Tris- HCl, 0.15 M NaCl, 0.1% BSA pH 8). After incubation for 30 min on shaking platform, Protein AAagarose beads were washed twice with 1.4 ml of BB, followed by application of 50 ⁇ l of B2ECAP reagent at the final concentration of 50 nM. Binding was performed for 30 min on shaking platform, and then tubes were centrifuged and washed once with 1.4 ml of BB. Colorimetric reaction of precipitated AP was measured after application of PNPP (Fig. 6).
  • Nitrocellulose based assay B4EC-FC was serially diluted in 20 mM Tris-HCl, 0.15 M NaCl, 50 ⁇ g/ml BSA, pH 8. 2 ⁇ l of each fraction were applied onto nitrocellulose strip and spots were dried out for 3 min. Nifrocellulose strip was blocked with 5% non-fat milk for 30 min, followed by incubation with 5 nM B2EC-AP reagent. After 45 min incubation for binding, nifrocellulose was washed twice with 20 mM Tris-HCl, 0.15 M NaCl, 50 ⁇ g/ml BSA, pH 8 and color was developed by application of alkaline phosphatase substrate Sigma Fast (Sigma).
  • Nitrocellulose based assay See above, for B4EC-FC.
  • Human umbilical cord vein endothelial cells (1.5x103) are plated in a 96-well plate in 100 ⁇ l of EBM-2 (Clonetic # CC3162). After 24 hours (day 0), the test recombinant protein (100 ⁇ l) is added to each well at 2X the desired concenfration (5-7 concenfration levels) in EBM-2 medium. On day 0, one plate is stained with 0.5% crystal violet in 20% methanol for 10 minutes, rinsed with water, and air-dried. The remaining plates are incubated for 72 h at 37 °C. After 72 h, plates are stained with 0.5% crystal violet in 20%> methanol, rinsed with water and airdried.
  • EBM-2 Human umbilical cord vein endothelial cells
  • the stain is eluted with 1:1 solution of ethanol: 0.1 M sodium citrate (including day 0 plate), and absorbance is measured at 540 nm with an ELISA reader (Dynatech Laboratories). Day 0 absorbance is subtracted from the 72 h plates and data is plotted as percentage of confrol proliferation (vehicle freated cells). IC50 (drag concentration causing 50%> inhibition) is calculated from the plotted data.
  • B. Cord Formation Assay Endothelial Cell Tube Formation Assay
  • Matrigel (60 ⁇ l of 10 mg/ml; Collaborative Lab # 35423) is placed in each well of an ice- cold 96-well plate. The plate is allowed to sit at room temperature for 15 minutes then incubated at 37 °C for 30 minutes to permit the matrigel to polymerize.
  • HUVECs are prepared in EGM-2 (Clonetic # CC3162) at a concentration of 2X10 5 cells/ml.
  • the test compound is prepared at 2X the desired concenfration (5 concentration levels) in the same medium.
  • Cells (500 ⁇ l) and 2X drug (500 ⁇ l) is mixed and 200 ⁇ l of this suspension are placed in duplicate on the polymerized matrigel. After 24 h incubation, triplicate pictures are taken for each concenfration using a Bioquant Image Analysis system. Drug effect (IC50) is assessed compared to untreated confrols by measuring the length of cords formed and number of junctions.
  • the bottom chamber wells receive 27-29 ⁇ l of DMEM medium alone (baseline) or medium containing chemo-atfractant (bFGF, VEGF or Swiss 3T3 cell conditioned medium).
  • the top chambers receive 45 ⁇ l of HUVEC cell suspension (1X10 6 cells/ml) prepared in DMEM+1% BSA with or without test compound. After 5 h incubation at 37 °C, the membrane is rinsed in PBS, fixed and stained in Diff-Quick solutions.
  • the filter is placed on a glass slide with the migrated cells facing down and cells on top are removed using a Kimwipe. The testing is performed in 4-6 replicates and five fields are counted from each well. Negative unstimulated confrol values are subtracted from stimulated control and drug freated values and data is plotted as mean migrated cell ⁇ S.D. IC50 is calculated from the plotted data.
  • Example 2 Exfracellular domain fragments of EphB4 receptor inhibit angiogenesis and tumor growth.
  • Globular domain of EphB4 is required for EphrinB2 binding and for the activity of EphB4- derived soluble proteins in endothelial tube formation assay.
  • EphB4-derived soluble proteins in endothelial tube formation assay.
  • four recombinant deletion variants of EphB4EC were produced and tested (Fig. 16).
  • Exfracellular part of EphB4 similarly to the other members of EphB and EphA receptor family, contains N-terminal ligand- binding globular domain followed by cysteine-rich domain and two fibronectin type III repeats (FNIII).
  • GCF2-F a non-tagged version of B4- GCF2, called GCF2-F, containing complete exfracellular domain of EphB4 with no additional fused amino acids was expressed, purified and used in some ofthe experiments described here. All four C-terminally 6xHis tagged recombinant proteins were preparatively expressed in transiently transfected cultured mammalian cells and affinity purified to homogeneity from the conditioned growth media using chromatography on Ni 2+ -chelate resin (Fig. 17).
  • PC3 human prostate cancer cell line is known to express elevated levels of human Eph B4. Stimulation of PC3 cells with Ephrin B2 IgG Fc fusion protein leads to a rapid induction of tyrosine phosphorylation ofthe receptor. However, preincubation ofthe ligand with GCF2, GCF1 or GC, but not CF2 proteins suppresses subsequent EphB4 autophosphorylation. Addition ofthe proteins alone to the PC3 cells or preincubation ofthe cells with the proteins followed by changing media and adding the ligand does not affect EphB4 phosphorylation status.
  • EphB4- derived soluble proteins in endothelial tube formation assay.
  • Plugs taken from mice freated with ⁇ g of soluble EphB4 had markedly reduced vascularization of plugs, comparable to plugs without growth factor (Fig. 21). Furthermore, histological examination of plugs showed decreased vessel staining (Fig. 21). Treatment at 0 ⁇ g/dose significantly inhibited the amount of infiltration in Matrigel plugs compared to control (Fig. 21).
  • EphB4 receptor phosphorylation in HUVECs by performing Western blot analyses with lysates from soluble EphB4-freated cells and antibodies against phosphor-tyrosine.
  • EphrinB4 freatment of serum-starved HUVECs stimulated a rapid and transient decrease in the level of phosphorylated EphB4, in the presence of EphrinB2Fc, EphB4 ligand dimer.
  • Ephrin B2Fc without the soluble EphB4 protein induced phosphorylation of EphB4 receptor (Fig. 22).
  • microvessel density was similar in the outer viable rim of tumor cells (the uniform layer of cells adjacent to the tumor periphery with well defined nuclei) in confrol and soluble EphB4-freated tumors. Microvessel density was significantly in the inner, less viable region of tumor cells abutting the necrotic cenfral areas in soluble EphB4-treated than confrol tumors.
  • Fibrin deposition was increased in and around blood vessels in the inner viable rim and the central necrotic core of soluble EphB4 treated than control tumors.
  • the vessel lumen remained patent and contained red blood cells, fibrin deposition was evident around many vessels. Soluble EphB4 was found to have no such effects on the endothelium in the normal tissues examined (lungs, liver and kidneys).
  • the resulting PCR fragments were TA-cloned into mammalian expression vector pEF6/V5-His-TOPO (Invitrogen) under EF-l ⁇ promoter confrol.
  • the expressed recombinant proteins encode the following fragments ofthe mature exfracellular part of human EphB4: amino acid positions 1-522 (GCF2), 1-412 (GCFl) and 1-312 (GC).
  • EphB4 cDNA was amplified by two-step overlap PCR using oligo primers TACTAGTCCGCCATGGAGCTCCGGGTGCTGCT, CAGCTGAGTTTCCAATTTTGTGTTC, GAACACAAAATTGGAAACTCAGCTGACTGTGAACCTGAC and GCGGCCGCCCTG CTCCCGCCAGCCCTCGCT.
  • Vector for producing secreted human EphrinB2-alkaline phosphatase (B2-AP) reagent was constructed by PCR amplification of human Ephrin B2 cDNA using primers TAAAGCTTCCGCCATGGCTGTGAGAAGGGAC and TAGGATCCTTCGGAACCG AGGATGTTGTTCCC and cloning the resulting fragment, digested with Hind III and Bam HI, into Hind III-Bgl II digested pAPTag2 vector (GenHunter, Inc.). In each case, inserts in expression vectors were verified by complete sequencing.
  • Anti-Eph B4 monoclonal antibodies mAB79 and mAB23 were raised in mice against the GCF2 protem containing amino acids 1-522 of mature human EphB4 and purified from hybridoma supematants by Protein A chromatography.
  • the anti-phosphotyrosine antibody 4G10 was from UBI (Lake Placid, NY). Protein G-HRP conjugate was purchased from Bio-Rad.
  • EphB4-ECD soluble proteins cultured human embryonic kidney cells HEK293T were transfected with the conesponding plasmid constructs using standard calcium phosphate or Lipofectamin 2000 reagent (Invitrogen) protocols. Twelve to sixteen hours post- transfection, the growth medium (DMEM+10%> fetal bovine serum) was aspirated, cells washed once with serum free DMEM and replaced with serum free DMEM. Conditioned media containing the secreted proteins were harvested 72-96 hours later, clarified by centrifugation and used for purification of His-tagged proteins using Ni-NTA Agarose (Qiagen).
  • DMEM+10%> fetal bovine serum was aspirated, cells washed once with serum free DMEM and replaced with serum free DMEM.
  • Conditioned media containing the secreted proteins were harvested 72-96 hours later, clarified by centrifugation and used for purification of His-tagged proteins using Ni-NTA Agarose (Qiagen).
  • the purity and quantity ofthe recombinant proteins was tested by SDS-PAAG electrophoresis with Coomassie Blue or silver staining, Western blotting and UV spectroscopy. Purified proteins were dialyzed against 20 mM Tris-HCl, 0.15 M NaCl, pH 8 and stored at -70 °C.
  • Ni-NT A- Agarose (Qiagen) were incubated in microcentrifuge tubes with 10-500 ng sample of a B4-ECD protein diluted in 0.5 ml of binding buffer BB (20 mM Tris-HCl, 0.15 M NaCl, 0.1% bovine serum albumin, pH 8). After incubation for 30 min on shaking platform, Ni-NTA beads were washed twice with 1.4 ml of BB, followed by addition of B2-AP fusion protein at concenfration of 50 nM. Binding was performed for 30 min on a shaking platform. Tubes were centrifuged and washed once with 1.4 ml of BB. Amount of precipitated AP was measured colorimetrically at 420 nm after application of p-nifrophenyl phosphate (PNPP) and incubation for 5-30 min.
  • PNPP p-nifrophenyl phosphate
  • lysates were processed at 4 °C.
  • Cells were lysed in 1 ml of buffer containing 20 mM Hepes at pH 7.4, 100 mM sodium chloride, 50 mM sodium fluoride, 2 mM EDTA, 2 mM EGTA, 1 mM sodium orthovanadate, 1%>(V/V) NP-40, 0.5% (w/v) sodium deoxycholate, 1 mM phenyl methylsulphonyl fluoride (added freshly) and 100U Trasylol. Lysates were scraped into Eppendorf tubes and 50 ⁇ l of boiled, formalin-fixed Staphylococcus aureus was added (Calbiochem, San Diego).
  • the lysates were centrifuged for 5 min at 25,000g in a minifuge and the supematants transfened to new tubes containing the appropriate antibody. Lysates were mixed with antibodies for 1 h, after which time 50 ⁇ l of protein A- Sepharose beads were added and the contents ofthe tubes mixed for 1 h to collect the immunoprecipitates. Protein A beads were collected by centrifugation at 25,000g for 30 s. The supematants were discarded and the beads washed three times with 1 ml lysis buffer minus deoxycholate.
  • the human prostate carcinoma cell line PC3 cells were maintained in RPMI medium with 10%) dialyzed fetal calf serum and 1% penicillin streptomycin/neomycin antibiotics mix. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO 2 /95% air. Typically, cells were grown in 60 mm dishes until confluency and were either freated with mouse Ephrin B2-Fc fusion at 1 ⁇ g/ml in RPMI for 10 min to activate EphB4 receptor or plain medium as a control. To study the effect of different derivatives of soluble EphB4 ECD proteins on EphB4 receptor activation, three sets of cells were used.
  • cells were treated with various proteins (5 proteins; GC, GCFl, GCF2, GCF2-F, CF2) at 5 ⁇ g/ml for 20 min.
  • proteins were premixed with ephrinB2-Fc at 1:5 (EphB4 protein: B2-Fc) molar ratio, incubated for 20 min and applied on cells for 10 min.
  • EphB4 protein: B2-Fc B2-Fc
  • the immunoprecipitated proteins were solubilized in IX SDS-PAGE sample loading buffer and separated on 10%> SDS-PAGE.
  • electroblotted membrane was probed with anti-pTyr specific antibody 4G 10 at 1 : 1000 dilution followed by Protein G- HRP conjugate at 1:5000 dilutions.
  • HUVECs Normal HUVECs were obtained from Cambrex (BioWhittaker) and maintained in EBM2 medium supplemented with 0.1 mg/ml endothelial growth supplement (crude extract from bovine brain), penicillin (50 U/ml), streptomycin (50 U/ml), 2 mmol/1 glutamine and 0.1 mg/ml sodium heparin. Aliquots of cells were preserved frozen between passages 1 and 3. For all experiments, HUVECs were used at passages 4 or below and collected from a confluent dish.
  • HUVECs Chemotaxis of HUVECs to VEGF was assessed using a modified Boyden chamber, franswell membrane filter inserts in 24 well plates, 6.5 mm diam, 8 ⁇ m pore size, 10 ⁇ m thick matrigel coated, polycarbonate membranes (BD Biosciences).
  • the cell suspensions of HUVECs (2x 10 5 cells/ml) in 200 ⁇ l of EBM were seeded in the upper chamber and the soluble EphB4 protein were added simultaneously with stimulant (VEGF or bFGF) to the lower compartment of the chamber and their migration across a polycarbonate filter in response to 10- 20 ng/ml of VEGF with or without 100 nM-1 ⁇ M test compound was investigated.
  • stimulant VEGF or bFGF
  • HUVEC Growth Inhibition Assay HUVEC (1.5xl0 3 cells) were plated in a 96-well plate in 100 ⁇ l of EBM-2 (Clonetic, Cat.
  • test recombinant protein 100 ⁇ l is added to each well at 2x the desired concentration (5-7 concentration levels) in EBM-2 medium.
  • one plate was stained with 0.5% crystal violet in 20% methanol for 10 minutes, rinsed with water, and air- dried. The remaining plates were incubated for 72 h at 37 °C. After 72 h, plates were stained with 0.5%) crystal violet in 20%> methanol, rinsed with water and air-dried. The stain was eluted with 1:1 solution of ethanol: 0.1M sodium citrate (including day 0 plate), and absorbance measured at 540 nm with an ELISA reader (Dynatech Laboratories).
  • Matrigel (0.5ml) was injected into the abdominal subcutaneous tissue of female nu/nu mice (6 wks old) along the peritoneal mid line. There were 3 mice in each group. The animals were cared for in accordance with institutional and NIH guidelines. At day 6, mice were sacrificed and plugs were recovered and processed for histology. Typically the overlying skin was removed, and gels were cut out by retaining the peritoneal lining for support, fixed in 10%> buffered fonnalin in PBS and embedded in paraffin. Sections of 3 ⁇ m were cut and stained with H&E or Masson's trichrome stain and examined under light microscope
  • the subsequent vascular response was measured extending from the limbal vasculature toward the pellet and the contiguous circumferential zone of neovascularization Data and climcal photos presented here were obtained on day 6 after pellet implantation, which was found to be the day of maximal angiogenic response.
  • the cells were incubated for 24 h, then the remaining cells in the upper layer were swabbed with cotton and penetrating cells in the lower layer were fixed with 5%> glutaraldehyde and stained with Diff Quick.
  • the total number of cells passing through the Matrigel matrix and each 8 ⁇ m pore ofthe culture insert wascounted using optical microscopy and designated as an invasion index (cell number/area).
  • Tumor volumes in the EphB4 ECD group, in the presence and absence of growth factor after implantation were three-fold smaller than those in the vehicle groups. There was no difference in body weight between the groups.
  • Immunohistochemical examination of cross-sections of resected tumors and TUNEL-positive apoptosis or necrosis, CD34 immunostaining, and BrdU proliferation rate will be performed, after deparaffinized, rehydrated, and quenched for endogenous peroxidase activity, and after 10 min permeabilization with proteinase K. Quantitative assessment of vascular densities will also be performed. Local infratumoral delivery or IV delivery of EphB4 ECD will also be performed twice a week.
  • mice 30 athymic nude mice, BALB/c (nu/nu), were each injected with 1 x 10 6 B16 melanoma cells with 0.1 ml PBS mixed with 0.1 ml matrigel or 1.5 x 10 6 SCC15 cells resuspended in 200 ⁇ l of DMEM serum-free medium and injected subcutaneously on day 0 on the right shoulder region of mice. Proteins were injected intravenously or subcutaneously, around the tumor beginning on day 1 at a loading dose of 4 ⁇ g mg, with weekly injections of 2ug/mg. (10 ⁇ g/g, 50 ⁇ g/kg/day), and at 2 weeks post-inoculation. Mice are sacrificed on Day 14. Confrol mice received PBS 50 ⁇ l each day. 14) Tumor formation in nude mice
  • Cancer cells (5x10 6 ) were subcutaneously inoculated into the dorsal skin of nude mice. When the tumor had grown to a size of about 100 mm 3 (usually it took 12 days), sEphB4 was either infraperitoneally or subcutaneously injected once/day, and tumorigenesis was monitored for 2 weeks. Tumor volume was calculated according to the formula a 2 xb, where a and b are the smallest and largest diameters, respectively. A Student's t test was used to compare tumor volumes, with P ⁇ .05 being considered significant.
  • EphB4 Is Upregulated and Imparts Growth Advantage in Prostate Cancer A. Expression of EphB4 in prostate cancer cell lines
  • EphB4 protein was expressed in a variety of prostate cancer cell lines by Western blot.
  • prostate cancer cell lines show marked variation in the abundance ofthe 120 kD EphB4.
  • the levels were relatively high in PC3 and even higher in PC3M, a metastatic clone of PC3, while normal prostate gland derived cell lines (MLC) showed low or no expression of EphB4 (Fig. 27 A).
  • MLC normal prostate gland derived cell lines
  • Fig. 27 A We next checked the activation status of EphB4 in PC3 cells by phosphorylation study.
  • EphB4 is phosphorylated though it can be further induced by its ligand, ephrin B2 (Fig. 27B).
  • EphB4 is expressed in clinical prostate samples.
  • tumor tissues and adjacent normal tissue from prostate cancer surgical specimens were examined.
  • the histological distribution of EphB4 in the prostate specimens was determined by immunohistochemistry.
  • EphB4 expression is confined to the neoplastic epithelium (Fig. 28, top left), and is absent in stromal and normal prostate epithelium (Fig. 28, top right).
  • Fig. 28, top left neoplastic epithelium
  • Fig. 28, top right normal prostate epithelium
  • 24 ofthe 32 prostate cancers examined were positive.
  • EphB4 mRNA is expressed both in the normal and tumor tissues of clinical samples by quantitative RT-PCR.
  • tumor EphB4 mRNA levels were at least 3 times higher than in the normal in this case (Fig. 28, lower right).
  • PC3 cells are known to lack PTEN expression (Davis, et al., 1994, Science. 266:816-819) and wild-type p53 function (Gale, et al., 1997, Cell Tissue Res. 290:227-241).
  • PTEN expression Diavis, et al., 1994, Science. 266:816-819
  • wild-type p53 function Gale, et al., 1997, Cell Tissue Res. 290:227-241
  • We investigated whether the relatively high expression of EphB4 is related to p53 and/or PTEN by re-introducing wild-type p53 and/or PTEN into PC3 cells. To compensate for the transfection efficiency and the dilution effect, transfected cells were sorted for the cotransfected truncated CD4 marker.
  • EphB4 in PC3 cells was reduced by the re-introduction of either wild-type p53 or PTEN.
  • the co-transfection of p53 and PTEN did not further inhibit the expression of EphB4 (Fig. 29 A).
  • Retinoid X receptor (RXR ⁇ ) regulates the expression of EphB4
  • EphB4 expression has the reverse expression pattern when we looked at "normal” prostate (MLC), prostate cancer (PC3), and metastatic prostate cancer (PC3M) (Fig. 27 A), we considered whether RXR ⁇ regulates the expression of EphB4.
  • MLC normal prostate
  • PC3M metastatic prostate cancer
  • the expression of EphB4 was compared between CWR22R and CWR22R-RXR ⁇ , which constitutively expresses RXR ⁇ .
  • FGF8 has no effect on EphB4 expression. Consistent with initial results, EphB4 was not found in "normal" benign prostate hypertrophic cell line BPH-1 (Fig. 29B).
  • EphB4 was down-regulated after blocking the EGFR signaling using EGFR kinase inhibitor AG 1478 (Fig. 30A) or upon blockade ofthe IGF-IR signaling pathway using IGF-IR neutralizing antibody (Fig. 30B).
  • EphB4 overexpression in our prostate cancer model
  • PC3 cells which have a relatively high expression of EphB4.
  • the two approaches to decreasing EphB4 expression were siRNA and AS-ODNs.
  • a number of different phosphorothioate-modified AS-ODNs complementary to different segments ofthe EphB4 coding region were tested for specificity and efficacy of EphB4 inhibition.
  • AS-10 full-length EphB4 expression vector AS-10 was found to be the most effective (Fig. 3 IB).
  • a Similar approach was applied to the selection of specific siRNA.
  • EphB4 siRNA 472 effectively knocks down EphB4 protein expression (Fig. 31 A).
  • Both siRNA 472 and antisense AS-10 ODN reduced the viability of PC3 cells in a dose dependent manner (Fig. 31C, D).
  • Unrelated siRNA or sense oligonucleotide had no effect on viability.
  • siRNA 472 resulted in an accumulation of cells in the sub GO and S phase fractions compared to cells treated with control siRNA.
  • the sub GO fraction increased from 1 %> to 7.9%, and the S phase fraction from 14.9 % to 20.8 % in siRNA 472 freated cells compared to confrol siRNA freated cells (Fig. 32 A).
  • Cell cycle anest at sub GO and G2 is indicative of apoptosis. Apoptosis as a result of EphB4 knock-down was confirmed by ELISA assay.
  • Neutralizing IGF-IR antibody was from R&D Systems (Minneapolis MN). Anti-IGF- lR( ⁇ ), -EGFR, -EphB4(C-16) were from Santa Cruz Biotech (Santa Craz, CA). ⁇ -actin monoclonal antibody was purchased from Sigma Chemical Co. (St Louis, MO). Media and fetal bovine serum (FBS) were from Invitrogen (Carlsbad, CA). AG 1478(4-(3'-Chloroanilino)-6,7- dimethoxy-quinazoline) was from Calbiochem (San Diego, CA).
  • EphB4 specific antisense phosphorothioate-modified oligodeoxynucleotide (ODN) and sense ODN were synthesized and purified by Qiagen (Alameda CA). The sequences are: Sense, 5'-TCC-TGC-AAG-GAG-ACC-TTC-AC-3'; AS1 : 5'-GTG-CAG-GGA-TAG-CAG-GGC-CAT- 3'; AS10: 5'-ATG-GAG-GCC-TCG-CTC-AGA-AA-3'. siRNAs were synthesized at the USC/Nonis Comprehensive Cancer Center Microchemical Core laboratory.
  • EphB4 siRNAs are siRNA 472 5 '-GGU-GAA-UGU-CAA-GAC-GCU-GUU-3 ' and siRNA 2303 5 '- cuc-uuc-cga-ucc-cac-cua-cuu-3'.
  • Negative confrol siRNA to scrambled GAPDH was from Ambion (Austin, TX)
  • the prostate cancer cell lines PC3, PC3M, DU145, ALVA31, LAPC-4, LNCaP, CWR22R and adult human normal prostate epithelial cell line MLC SV40, and BPH-1 were obtained and cultured as described previously (7).
  • EphB4 monoclonal antibody
  • ECD exfracellular domain
  • GST-ECD GST- fused ECD
  • EphB4ECD expressed as a GST fusion protein in BL21 E. coli was purified by affinity chromatography and the GST domain was cleaved by thrombin.
  • Monoclonal antibody was generated and the sensitivity and specificity ofthe antibody was reconfirmed by Western blot with whole cell lysate of 293 cells stably transfected with EphB4.
  • RNA STAT-60 Tel-Test, Inc. Friendswood TX
  • For quantitative RT-PCR first sfrand cDNA was synthesized from 5 ⁇ g of total RNA using Superscript III (Invitrogen, Carlsbad CA). Quantitative RT-PCR was performed on the Sfratagene MX3000P system (Sfratagene, La Jolla CA) using SYBR Green I Brilliant Mastermix (Sse) according to the manufacture's instructions.
  • Optimized reactions for EphB4 and ⁇ -actin were 150 nM each ofthe forward primer ( ⁇ -actin, 5'-GGA-CCT-GAC-TGA-CTA-CCT-A-3'; EphB4, 5'- AAG-GAG-ACC-TTC-ACC-GTC-TT-3') and reverse primer ( ⁇ -actin 5'-TTG-AAG-GTA- GTT-TCG-TGG-AT-3'; EphB4, 5'-TCG-AGT-CAG-GTT-CAC-AGT-CA-3') with DNA denaturation/activation of polymerase at 95 °C for 10 min followed by 40 cycles of 95 °C for 30s, 60 °C for lmin, 72 °C for lmin. The specificity of the gene-specific amplification was confirmed by the presence of a single dissociation peak. All reactions were performed in triplicate with RT and no template negative controls. 6) hmnunohisto
  • OCT-embedded tissues were sectioned at 5 ⁇ m and fixed in phosphate-buffered 4%> paraformaldehyde. Sections were washed for 3 x 5 min in PBS and endogenous peroxidase was blocked by incubation in 0.3% H 2 O 2 in PBS for 10 min at room temperature. Sections were incubated with Eph4 (C-l 6) antibody (1:50) for 1 h at room temperature followed by three washes in PBS and incubation with donkey anti-goat secondary antibody (Santa Craz Biotech.) for 1 h at room temperature. After three washes in PBS, peroxidase activity was localized by incubation in DAB substrate solution (Vector Laboratories, Inc.
  • Membranes were first probed with primary antibody overnight, stripped with RestoreTM Western Blot stripping buffer (Pierce, Rockford IL) and reprobed with ⁇ -actin to confirm equivalent loading and transfer of protein. Signal was detected using SuperSignal West Femto Maximum Sensitivity Substrate (Pierce).
  • EphB4 receptor Cleared cell lysates were incubated with EphB4 monoclonal antibody overnight at 4 °C.
  • Antigen-antibody complex was immunoprecipitated by the addition of 100 ⁇ l of Protein G-Sepharose in 20 mM sodium phosphate, pH 7.0 with incubation overnight at 4 °C. hnmunoprecipitates were analyzed by
  • PC3 cells were seeded into 6-well plates and cultured until 80%> confluent and freated with 2 ⁇ g ml neutralizing IGF-IR monoclonal antibody, MAB391 (Hailey, et al., 2002, Mol Cancer Ther. 1:1349-1353), or with 1 nM AG 1478, a strong EGFR inhibitor (Liu, et al., 1999, J Cell Sci. 112 (Pt 14):2409-2417) for 24 h. Crude cell lysates were analyzed by Western blot. Band density was quantified with the Bio-Rad QuantityOne System software.
  • LipofectamineTM 2000 according to the manufacturer's instructions. 4 h post-transfection the cells were returned to growth media (RPMI 1640 supplemented with 10 % FBS). Viability was assayed by MTT 48 h following transfection.
  • PC3 cells were transfected with siRNA 472 or confrol siRNA using LipofectamineTM 2000 and 6 hours later 0.5 x 105 cells were transfened into 8 ⁇ m Matrigel-precoated inserts (BD Bioscience, Palo Alto, CA).
  • the inserts were placed in companion wells containing RPMI supplemented with 5 % FBS and 5 ⁇ g/ml fibronectin as a chemoatfractant. Following 22 h incubation the inserts were removed and the noninvading cells on the upper surface were removed by with a cotton swab.
  • the cells on the lower surface ofthe membrane were fixed in 100% methanol for 15 min, air dried and stained with Giemsa stain for 2 min. The cells were counted in five individual high-powered fields for each membrane under a light microscope. Assays were performed in triplicate for each treatment group.
  • Results were expressed as percentages of elements detected in the different phases ofthe cell cycle, namely Sub GO peak (apoptosis), G0/G1 (no DNA synthesis), S (active DNA systhesis), G2 (premitosis) and M (mitosis).
  • Apoptosis was studied using the Cell Death Detection ELISAplus Kit (Roche, Piscataway, NJ) according to the manufacturer's instructions. Briefly, PC3 80%> confluent cultures in 24-well plates were transfected using LipofectamineTM 2000 with various concenfrations (0-100 nM) of siRNA 472 or 100 nM control siRNA. 16 hours later, cells were detached and 1 x 10 4 cells were incubated in 200 ⁇ l lysis buffer. Nuclei were pelleted by centrifugation and 20 ⁇ l of supernatant containing the mono- or ohgonucleosomes was taken for ELISA analysis.
  • the supernatant was incubated with anti-histone-biotin and anti-DNA- POD in streptavidin-coated 96-well plate for 2 hours at room temperature.
  • the color was developed with ABST and absorbance at 405 nm was read in a microplate reader (Molecular Devices, Sunnyvale, CA).
  • Example 4 Expression of EPHB4 in Mesothelioma: a candidate target for therapy
  • Malignant mesothelioma (MM) is a rare neoplasm that most often arises from the pleural and peritoneal cavity serous surface. The pleural cavity is by far the most frequent site affected (> 90%), followed by the peritoneum (6-10%) (Carbone et al., 2002, Semin Oncol. 29:2-17).
  • asbestos exposure about 80%> of malignant mesothelioma cases occur in individuals who have ingested or inhaled asbestos. This tumor is particularly resistant to the current therapies and, up to now, the prognosis of these patients is dramatically poor (Lee et al, 2000, Cun Opin Pulm Med. 6:267-74).
  • EPHB4 and EphrinB2 is expressed in mesothelioma cell lines
  • Ephrin B2 and EphB4 in malignant mesothelioma cell lines was determined at the RNA and protein level by a variety of methods. RT-PCR showed that all of the four cell lines express EphrinB2 and EPHB4 (fig. 33A). Protein expression was determined by Western blot in these cell lines. Specific bands for EphB4 were seen at 120 kD. In addition, Ephrin B2 was detected in all cell lines tested as a 37 kD band on Western blot (fig. 33B). No specific band for Ephrin B2 was observed in 293 human embryonic kidney cells, which were included as a negative confrol.
  • EphB4 transcription in mesothelioma cells was carried out on NCI H28 cell lines cultured on chamber slides. Specific signal for EphB4 was detected using antisense probe Ephrin B2 transcripts were also detected in the same cell line. Sense probes for both EphB4 and Ephrin B2 served as negative confrols and did not hybridize to the cells (figure 34). Expression of EphB4 and Ephrin B2 proteins was confirmed in the cell lines by immunofluorescence analysis (fig. 35). Three cell lines showed strong expression of EphB4, whereas expression of Ephrin B2 was present in H28 and H2052, and weakly detectable in H2373.
  • EPHB4 is involved in the cell growth and migration of mesothelioma
  • EphB4 The role of EphB4 in cell proliferation was tested using EPHB4 specific antisepses oligonucleotides and siRNA. The freatment of cultured H28 with EPHB4 antisense reduced cell viability.
  • EPHB4AS-10 One ofthe most active inhibitor of EphB4 expression is EPHB4AS-10 (fig. 37A). Transfection of EPHB4 siRNA 472 generated the same effect (fig. 37B).
  • MM is a locally advancing disease with frequent extension and growth into adjacent vital structures such as the chest wall, heart, and esophagus.
  • wound healing assay using previously described techniques (3:36).
  • a wound was infroduced into sub confluent H28 cells, over the course ofthe next 28 hours cells would progressively migrate into the area ofthe wound.
  • EPHB4AS-10 for 24 hours, and the wound was introduced, this migration was virtually completely prevented.
  • the migration study with Boyden Chamber assay with EPHB4 siRNA showed that cell migration was greatly inhibited with the inhibition of EPHB4 expression (Fig. 38B).
  • NCI H28, NCI H2052, NCI H2373, MSTO 21 IH mesothelioma cell lines and 293 human embryonic kidney cells were obtained from the ATCC (Manassas, VA). Cells were maintained in RPMI 1640 media supplemented with 10 % heat-inactivated fetal bovine serum (FBS; Life Technologies, Gaithersburg, MD) and antibiotics. Primary cells were obtained from pleural effusion of patients with mesothelioma. A large number of EPHB4 phosphorothioate modified antisense oligonucleotides were synthesized. Similarly a number of EphB4 specific siRNAs were generated. Monoclonal antibody produced against EPHB4 was used for western blot. Polyclonal antibody against EphrinB2 and EPHB4 (C-l 6) (for immunohistochemical staining) was from Santa Cruz.
  • Primers for EphB4 and EphrinB2 were designed with Primer 3 software. The sequences for all primers are as follows: EPHB4 forward primer and EPHB4 reverse primer (see, e.g., in Example 2); EphrinB2 forward primer and EphrinB2 reverse primer (see, e.g., in Example 6); G3PDH forward primer, 5'-GGAGCCAAAAGGGTCATCAT-3'; G3PDH reverse primer, 5'- GGCATTGCTGCAAAGAAAGAG-3'; Clonetics kit was used for PCR. PCRs were performed with the ABI PCR System 2700 (Applied Biosystem). The PCR conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for lmin.
  • Ephrin-B2 and EphB4 PCR products were cloned using the pGEM-T Easy System (Promega, Madison WI) according to the manufacturer's description.
  • the primers and PCR products were 5'-tccgtgtggaagtactgctg-3' (forward), 5'-tctggtttggcacagttgag-3' (reverse), for ephrin-B2 that yielded a 296-bp product and 5'-ctttggaagagaccctgctg-3' (forward), 5'- agacggtgaaggtctccttg-3', for EphB4 that yielded a 297-bp product.
  • the authenticity and insert orientation were confirmed by DNA sequencing.
  • pGEM-T Easy plasmids containing the PCR product ofthe human ephrin-B2 or EphB4 gene were linearized with Spe I or Nco I.
  • Antisense or sense digoxigenin (DIG)-labeled RNA probes were transcribed from T7 or SP6 promoters by run-off transcription using a DIG RNA labeling kit (Roche, Indianapolis IN). RNA probes were quantitated by spot assay as described in the DIG RNA labeling kit instructions.
  • Slides were hybridized overnight at 42 °C with 25 ng antisense or sense RNA probes in 40%> deionized formamide, 10% dexfran sulfate, IX Denhardt's solution, 4 X SSC, 10 mM DTT, 1 mg/ml yeast t-RNA and lmg/ml denatured and sheared salmon sperm DNA in a total volume of 40 ⁇ l. Slides were then washed at 37 °C as follows: 2 X 15 min with 2 X SSC, 2 X 15min with 1 X SSC, 2 X 15 min with 0.5 X SSC and 2 X 30 min with 0.2 X SSC.
  • Hybridization signal was detected using alkaline-phosphatase-conjugated anti-DIG antibodies (Roche) according to the manufacturer's instructions. Color development was stopped by two washes in 0.1 M Tris-HCl, ImM EDTA, pH 8.0 for 10 min. Cells were visualized by counterstaining of nucleic acids with Nuclear Fast Red (Vector Laboratories, Burlingame, CA) and the slides were mounted with IMMU-MOUNT (Shandon, Astmoor UK).
  • Membranes were blocked with 5 % non-fat milk prior to incubation with antibody to EphB4 (1:5000 dilution) at 4° C, for 16 h. Secondary antibody (1:100,000 dilution) conjugated with horseradish peroxidase was applied for 1 h at 25 °C. The membranes were developed using the SuperSignal West Femto Maximum sensitivity chemiluminescent substrate (Pierce, Rockford, IL) according to the manufacturer's instructions.
  • Nuclei were counterstained with 4',6-diamidino-2-phenylindole dihydrochloride hydrate (DAPI), washed extensively with ) PBS and mounted with Vectasheild antifade mounting solution (Vector Laboratories). Images were obtained using an Olympus AX70 fluorescence microscope and Spot v2.2.2 (Diagnostic Instruments Inc., Sterling Heights, MI) digital imaging system.
  • DAPI 4',6-diamidino-2-phenylindole dihydrochloride hydrate
  • EphB4 Is Expressed in Squamous Cell Carcinoma of The Head and Neck: Regulation by Epidermal Growth Factor Signaling Pathway and Growth Advantage.
  • HNSCC Squamous cell carcinoma ofthe head and neck
  • EphB4 Although high expression of EphB4 has been reported in hematologic malignancies, breast carcinoma, endometrial carcinoma, and colon carcinoma, there is limited data on the protein levels of EphB4, and complete lack of data on the biological significance of this protein in tumor biology such as HNSCC.
  • HNSCC tumors express EphB4
  • EphB4 We studied the expression of EphB4 in human tumor tissues by immunohistochemistry, in situ hybridization, and Western blot. Twenty prospectively collected tumor tissues following IRB approval have been evaluated with specific EphB4 monoclonal antibody that does not react with other members ofthe EphB and EphA family. EphB4 expression is observed in all cases, with varying intensity of staining.
  • Figure 39A (top left) illusfrates a representative case, showing that EphB4 is expressed in the tumor regions only, as revealed by the H&E tumor architecture (Fig. 39A bottom left). Note the absence of staining for EphB4 in the stroma.
  • a metastatic tumor site in the lymph node shows positive staining while the remainder ofthe lymph node is negative (Fig. 39A, top right).
  • In situ hybridization was canied out to determine the presence and location of EphB4 transcripts in the tumor tissue. Strong signal for EphB4 specific antisense probe was detected indicating the presence of transcripts ( Figure 39 B, top left). Comparison with the H&E stain (Fig. 39B, bottom left) to illustrate tumor architecture reveals that the signal was localized to the tumor cells, and was absent from the stromal areas. Ephrin B2 transcripts were also detected in tumor sample, and as with EphB4, the signal was localized to the tumor cells (Fig. 39B, top right). Neither EphB4 nor ephrin B2 sense probes hybridized to the sections, proving specificity ofthe signals.
  • EphB4 the ligand of EphB4, namely ephrin B2
  • EphB4 in some lines eplirin B2 expression appears regulated by EGFR activity, while it is independent in other cell lines.
  • EphB4 levels were induced in SCC 15 cells that had been seram starved for 24 h prior to 24 h treatment with 10 ng/ml EGF as shown in figure 41B (lanes 1 and 2).
  • the downstream signaling pathways known for EGFR activation shown in figure 41 A, were then investigated for their input into EGF mediated induction of EphB4.
  • basal levels of EphB4 were reduced when ERK1/2 phosphorylation was inhibited.
  • siRNA2302 that was not effective in reducing EphB4 levels and had only minor effects on viability did not produce any changes in the cell cycle when compared with the mock LipofectamineTM2000 transfection.
  • Eph B4 50 5 ' -GAGACCCUGCUGAACACAAUU-3 ' 3 ' -UUCUCUGGGACGACUUGUGUU-5 '
  • Eph B4472 5' -GGUGAAUGUCAAGACGCUGUU-3 ' 3 ' -UUCCACUUACAGUUCUGCGAC-5 '
  • Eph B4 1562 5 ' -CAUCACAGCCAGACCCAACUU-3 ' 3 ' -UUGUAGUGUCGGUCUGGGUUG-5 '
  • Eph B4 2302 5' -CUCUUCCGAUCCCACCUACUU-3 ' 3 ' -UUGAGAAGGCUAGGGUGGAUG-5 '
  • the IC 50 for AS-10 was approximately 1 ⁇ M, while even 10 ⁇ M AS-11 was not sufficient to attain 50 %> reduction of viability.
  • AS-10 had on the cell cycle was investigated, it was found that the sub GO fraction increased from 1.9 % to 10.5 % compared to non-treated cells, indicative of apoptosis (Fig. 43C).
  • EphB4 participates in the migration of HNSCC. Involvement in migration may have implications for growth and metastasis. Migration was assessed using the wound-healing/scrape assay. Confluent SCC15 and SCC25 cultures were wounded by a single scrape with a sterile plastic Pasteur pipette, which left a 3 mm band with clearly defined borders. Migration of cells into the cleared area in the presence of test compounds was evaluated and quantitated after 24, 48 and 72 hr. Cell migration was markedly diminished in response to AS-10 that block EphB4 expression while the inactive compounds, AS-1 and scrambled ODN had little to no effect as shown in figure 43D. Inhibition of migration with AS-10 was also shown using the Boyden double chamber assay (Fig. 43E). F. EphB4 AS-10 in vivo anti-tumor activity
  • EphB4 AS-10 which reduces cell viability and motility, was determined in SCC 15 tumor xenografts in Balb/C nude mice.
  • HNSCC-4, -9, 12, -13, -15, -25, and -71 were obtained from and 293 human embryonic kidney cells were obtained from the ATCC (Manassas, VA). Cells were maintained in RPMI 1640 media supplemented with 10% heat-inactivated fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) and antibiotics.
  • FBS heat-inactivated fetal bovine serum
  • EGFR, EphB4(C-16) polyclonal antibodies were from Santa Cruz Biotech (Santa Craz, CA). ⁇ -actin monoclonal antibody was purchased from Sigma Chemical Co. (St Louis, MO).
  • Ephrin B2 and EphB4 polyclonal antibodies and their conesponding blocking peptides were obtained from Santa Craz Biotechnology (Santa Cruz, CA).
  • AG 1478 (4- (3'-Chloroanilino)-6,7-dimethoxy-quinazoline) was from Calbiochem (San Diego, CA).
  • Kinase inhibitors SH-5 and SP 600125 were from A.G. Scientific (San Diego, CA), PD98095, U73122, SB203580, LY294002, and Wortmannin were obtained from Sigma.
  • Sections were washed for 3 x 5 min in PBS and endogenous peroxidase was blocked by incubation in 0.3%> H O 2 in PBS for 10 min at room temperature. Sections were incubated with Eph4 (C-16) antibody (1:50) for 1 h at room temperature followed by three washes in PBS and incubation with donkey anti-goat secondary antibody (Santa Cruz Biotech.) for 1 h at room temperature. After three washes in PBS, peroxidase activity was localized by incubation in DAB substrate solution (Vector Laboratories, Inc. Burlingame CA) for 10 min at room temperature. Sections were counterstained with Hematoxylin for 20 s, dehydrated and mounted.
  • Negative confrol for staining was substitution of normal goat serum for primary antibody. Immunohistochemical staining on prostate anay (BioMeda, Foster City, CA) was done using goat ABC Staining System (Santa Cruz Biotech.) according to the manufacturer's instructions. 5) Western Blot
  • the SilencerTM siRNA construction kit (Ambion, Austin TX) was used to synthesize siRNA to EphB4. Briefly, 21 bp target sequences containing 19 bp downstream of 5'-AA dinucleotides were identified that showed no significant homology to other sequences in the GenBank database. Sense and antisense siRNA 29-mer DNA oligonucleotide templates were synthesized at the USC Nonis Microchemical Core Facility. Antisense template conesponded to the target sequence followed by 8 bp addition (5'-CCTGTCTC-3') at the 3' end complementary to the T7 promoter primer provided by the SilencerTM siRNA constraction kit. Sense template comprised 5'-AA followed by the complement ofthe target 19 bp, then the T7 8 bp sequence as above.
  • the two siRNA oligonucleotide templates were hybridized to a T7 promoter primer.
  • the 3' ends ofthe hybridized oligonucleotides were extended by the Klenow fragment of DNA polymerase to create double- stranded siRNA transcription templates.
  • the sense and antisense siRNA templates were transcribed by T7 RNA polymerase and the resulting RNA transcripts were hybridized to create dsRNA.
  • the leader sequences were removed by digesting the dsRNA with a single-stranded specific ribonuclease leaving the overhanging UU dinucleotides.
  • the DNA template was removed at the same time by freatment with RNase free deoxyribonuclease.
  • the resulting siRNA was purified by glass fiber filter binding to remove excess nucleotides, short oligomers, proteins, and salts in the reaction.
  • the end products (shown in Table 3) were double-stranded 21-mer siRNAs with 3' terminal uridine that can effectively reduce the expression of target mRNA when fransfected into cells.
  • Eph B4 AS-1 (552-572) GTG CAG GGA TAG CAG GGC CAT Eph B4 AS-2 (952-972) AAG GAG GGG TGG TGC ACG GTG Eph B4 AS-3 (1007-1027) TTC CAG GTG CAG GGA GGA GCC Eph B4 AS-4 (1263-1285) GTG GTG ACA TTG ACA GGC TCA Eph B4 AS-5 (1555-1575) TCT GGC TGT GAT GTT CCT GGC Eph B4 AS-6 (123-140) GCC GCT CAG TTC CTC CCA Eph B4 AS-7 (316-333) TGA AGG TCT CCT TGC AGG Eph B4 AS-8 (408-428) CGC GGC CAC CGT GTC CAC CTT Eph B4 AS-9 (1929-1949) CTT CAG GGT CTT GAT TGC CAC Eph B4 AS-10 (1980-1999) ATG GAG GCC TCG CTC AGA AA Eph b4 AS-11 (2
  • siRNAs 10-100 nM
  • LipofectamineTM 2000 2 x 10 4 cells/well of SCC-4, -15, -25 or -71 in a 48- well plate were transfected with siRNAs (10-100 nM) using 2 ⁇ l of LipofectamineTM 2000 according to the manufacturer's instructions. 4 h post-transfection the cells were returned to growth media (RPMI 1640 supplemented with 10 % FBS). Viability was assayed by MTT 48 h following transfection.
  • Results were expressed as percentages of elements detected in the different phases ofthe cell cycle, namely Sub GO peak (apoptosis), G0/G1 (no DNA synthesis), S (active DNA systhesis), G2 (premitosis) and M (mitosis).
  • Sub GO peak apoptosis
  • G0/G1 no DNA synthesis
  • S active DNA systhesis
  • G2 premitosis
  • M mitosis
  • SCC15 cells were seeded into 6-well plates and cultured until confluent. 10 ⁇ M AS-1, AS-10, or sense ODN as control were infroduced to the wells as described for the viability assay 12 hours before wounding the monolayer by scraping it with a sterile pipette tip. Medium was changed to RPMI 1640 supplemented with 5% FBS and fresh ODNs. The healing process was examined dynamically and recorded with a Nikon Coolpix 5000 digital camera with microscope adapter.
  • Kaposi's Sarcoma manifests as a multifocal angioproliferative disease, most commonly ofthe skin and mucus membranes, with subsequent spread to visceral organs (1) Hallmarks ofthe disease are angiogenesis, edema, infiltration of lymphomononuclear cells and growth of spindle-shaped tumor cells.
  • the KS vascular network is distinct from normal vessels in the lack of basement membranes and the abnormal spindle shaped endothelial cell (tumor cell) lining these vessels. Defective vasculature results in an accumulation ofthe blood components including albumin, red and mononuclear cells in the lesions (1).
  • the KS tumor is endothelial in origin; the tumor cells express many endothelial markers, including lectin binding sites for Ulex europeaus agglutinin-1 (UEA-1), CD34, EN-4, PAL-E (2) and the endothelial cell specific tyrosine kinase receptors, VEGFR-1 (Flt-1), VEGFR-2 (Flk-1/KDR), VEGFR-3 (Flt-4), Tie-1 and Tie-2 (3, RM & PSG unpublished data).
  • KS cells co-express lymphatic endothelial cell related proteins including LYVE and podoplanin (4).
  • the herpesviras HHV-8 is considered the etiologic agent for the disease.
  • sequences of this new herpes virus were identified in KS tumor tissue (5), and subsequent molecular-epidemiology studies have shown that nearly all KS tumors contain viral genome.
  • KS tumor cells are derived from arterial or venous endothelium.
  • HHV-8 has an effect on expression of arterial or venous markers in a model of KS.
  • KS tumor cells were found to express the ephrin B2 arterial marker.
  • ephrin B2 expression was induced by HHV-8 vGPCR in KS and endothelial cell lines.
  • Ephrin B2 is a potential target for treatment of KS because inhibition of ephrin B2 expression or signaling was detrimental to KS cell viability and function.
  • KS tumors express Ephrin B2, but not EphB4
  • EphB4 and ephrin B2 are markers for venous and arterial endothelial cells, respectively.
  • Ephrin B2 but not EphB4 transcripts were detected in tumor cells of KS biopsies by in situ hybridization (figure 45 A). Comparison ofthe positive signal with eplirin B2 antisense probe and tumor cells as shown by H&E staining shows that ephrin B2 expression is limited to the areas ofthe biopsy that contain tumor cells.
  • KS with EphB4 antisense probe The lack of signal in KS with EphB4 antisense probe is not due to a defect in the probe, as it detected transcripts in squamous cell carcinoma, which we have shown expresses this protein (18). Additional evidence for the expression of eplirin B2 in KS tumor tissue is afforded by the localization of EphB4/Fc signal to tumor cells, detected by FITC conjugated anti human Fc antibody. Because ephrin B2 is the only ligand for EphB4 this reagent is specific for the expression of ephrin B2 (figure 45B, left). An adjacent section freated only with the secondary reagent shows no specific signal.
  • HHV-8 the presumed etiologic agent for KS, could itself induce expression of ephrin B2 and repress EphB4 expression in endothelial cells.
  • the attached monolayers of endothelial cells remaining after extensive washing were examined for ephrin B2 and Epl ⁇ B4 by RT-PCR and immunofluorescence.
  • HUVEC express EphB4 venous marker strongly at the RNA level, but not ephrin B2 (figure 46B).
  • HHV-8 infected cultures (HUVEC/BC-1 and HUVEC/BC-3) express eplirin B2, while EphB4 transcripts are almost absent.
  • HHV-8 infected HUVEC now express ephrin B2 but not EphB4 (Fig. 46A(e, q, u), respectively). Expression of ephrin B2 and LANAl co-cluster as shown by yellow signal in the merged image (Fig. 46A(h)). HHV-8 infected HUVEC positive for ephrin B2 and negative for Eph B4 also express the arterial marker CD148 (19) (Fig. 46A (j, v)). Expression of ephrin B2 and CD148 co-cluster as shown by yellow signal in the merged image (Fig. 46A(1)). Uninfected HUVEC expressing Eph B4 were negative for CD148 (not shown).
  • HHV-8 vGPCR induces ephrin B2 expression
  • KS-SLK cells were stably fransfected with HHV-8 LANA, or LANA ⁇ 440 or vGPCR.
  • Western Blot of stable clones revealed a five-fold induction of ephrin B2 in KS-SLK fransfected with vGPCR compared to SLK-LANA or SLK-LANA ⁇ 440 (Fig. 47A).
  • SLK fransfected with vector alone (pCEFL) was used as a confrol.
  • SLK-vGPCR and SLK-pCEFL cells were also examined for ephrin B2 and Eph B4 expression by immunofluorescence in fransiently fransfected KS-SLK cells.
  • Figure 47B shows higher expression of ephrin B2 in the SLK-vGPCR cells compared to SLK-pCEFL.
  • No changes in Eph B4 were observed in SLK- vGPCR compared to SLK-pCEFL. This clearly demonsfrates that SLK-vGPCR cells expressed high levels of ephrin B2 compared to SLK-pCEFL cells.
  • Ephrin B2 5 '-flanking DNA-luciferase reporter plasmids were constracted as described in the Materials and Methods and fransiently fransfected into HUVECs. Ephrin B2 5'-flanking DNA sequences -2491/-11 have minimal activity in HUVEC cells (figure 47C). This is consistent with ephrin B2 being an arterial, not venous marker.
  • HUVEC in culture do express some ephrin B2 at the RNA level.
  • Cotransfection of HHV-8 vGPCR induces ephrin B2 transcription approximately 10-fold compared to the control expression vector pCEFL.
  • Roughly equal induction was seen with ephrin B2 sequences -2491/-11, -1242/-11, or -5111-11, which indicates that elements between - 577 and -11 are sufficient to mediate the response to vGPCR, although maximal activity is seen with the -1242/-11 luciferase construct.
  • Ephrin B2 is regulated by VEGF and VEGF-C
  • HUVECs were grown in EBM-2 media containing 5 % FBS with two different concentration of individual growth factor (10 ng, 100 ng/ml) for 48 h. Only VEGF- A or VEGF-C induced ephrin B2 expression in a dose dependent manner ( Figure 48B). In contrast, EGF had no effect on expression of ephrin B2.
  • Ephrin B2 siRNA inhibits the expression of Ephrin B2 in KS
  • Tliree ephrin B2 siRNA were synthesized as described in the methods section.
  • KS-SLK cells were fransfected with siRNA and 48 h later ephrin B2 expression was determined by Western Blot.
  • Ephrin B2 siRNAs 137 or 254 inhibited about 70%> of ephrin B2 expression compared to control siRNA such as siRNA Eph B4 50 or siRNA GFP.
  • Ephrin B2 63 siRNA was less effective than the above two siRNA Ephrin B2 ( Figure 49 A).
  • Ephrin B2 is necessary for full KS and EC viability, cord formation and in vivo angiogenesis activities
  • eplirin B2 siRNA (254) was then used to determine whether inhibiting expression of ephrin B2 has any effect on the growth of KS-SLK or HUVEC cells.
  • the viability of KS-SLK cells was decreased by the same siRNAs that inhibited ephrin B2 protein levels (figure 49B).
  • KS-SLK express high levels of ephrin B2 and this result shows maintenance of ephrin B2 expression is integral to cell viability in this setting.
  • HUVECs do not express ephrin B2, except when stimulated by VEGF as shown in Fig. 48B.
  • Ephrin B2 siRNA 264 dramatically reduced growth of HUVECs cultured with VEGF as the sole growth factor. In contrast, no significant effect was seen when HUVECs were cultured with IGF, EGF and bFGF. As a control, EphB4 siRNA 50 had no detrimental effect on HUVECs in either culture condition (figure 49C).In addition to inhibition of viability of KS and primary endothelial cells, EphB4-ECD inhibits cord formation in HUVEC and KS-SLK and in vivo angiogenesis in the MatrigelTM plug assay (Figure 50).
  • Human vascular endothelial cells were from Clonetics (San Diego, CA) and were maintained in EGM-2 and EGM-2MV media respectively (Clonetics).
  • TI human fibroblast line was from Dr. Peter Jones, USC. BC-1 and BC-3 human pleural effusion lymphoma cell lines and monoclonal antibodies to LANAl and ORF59 were the kind gift of Dr. Dharam Ablashi (Advanced Biotechnologies Inc., Columbia, MD).
  • KS-SLK was isolated from a Classic Kaposi's sarcoma patient (15).
  • Polyclonal antibodies to EphB4, ephrin B2, CD148, PECAM-1 were obtained from Santa Craz Biotechnology (Santa Craz, CA).
  • VEGF vascular endothelial growth factor
  • VEGF-C vascular endothelial growth factor
  • IL-(IL)6 interleukin-(IL)6, IL- 8 and oncostatin-M
  • pKSvGPCR-CEFL and pCEFL were the kind gift of Dr. Enrique Mesri (Cornell University, New York, NY).
  • Expression vectors for HHV-8 latency associated nuclear antigen (LANA) were kindly provided by Dr Matthew Rettig, Veteran's Administration Greater Los Angeles Healthcare System.
  • RNAzol Tel-Test, Inc., Friendswoods, TX
  • cDNAs were synthesized by reverse transcriptase using a random hexamer primer (Superscript II; Invitrogen, Carlsbad, CA).
  • Ephrin B2 and EphB4 PCR products from the primers shown in Table 4 for in situ hybridization were cloned using the pGEM-T Easy system (Promega, Madison WI) according to the manufacturer's description using. The authenticity and insert orientation were confirmed by DNA sequencing.
  • the pGEM-T Easy plasmids containing the PCR product ofthe human ephrin- B2 or EphB4 gene were linearized with Spe I or Nco I.
  • Antisense or sense digoxigenin (DIG)- labeled RNA probes were transcribed from T7 or SP6 promoters by run-off transcription using a DIG RNA labeling kit (Roche, Indianapolis IN). RNA probes were quantitated by spot assay as described in the DIG RNA labeling kit instructions.
  • HUVEC cells were grown to 50-70%) confluence in EGM-2 on gelatin-coated Labtech II 4-well chamber slides (Nalge Nunc International, Naperville, IL). Co-culture with BC-1 or BC-3 was essentially as described by Sakurada and coworkers (16). Briefly, BC-1 or BC-3 cells were preheated with TPA (20 ng/ml) to induce virus for 48 hrs and then added to the HUVEC culture at a ratio of 10: 1 for cocultivation for two days. The HUVECs were washed extensively with PBS to remove the attached BC-1 or BC-3 cells.
  • the TITANIUMTM One-Step RT-PCR kit (Clontech, Palo Alto, CA) was used for RT- PCR from 1 x 10 5 cells.
  • Primer pairs for amplification of EphB4, ephrin B2 and ⁇ -actin are shown in Table 4.
  • Each PCR cycle consisted of denaturation at 94 °C for 30 s, primer annealing at 60 °C for 30 s and extension at 72 °C for 30 s.
  • the samples were amplified for 30 cycles. PCR products were separated on 1.5% agarose gels and stained with ethidium bromide. 7) Cell viability assay
  • KS-SLK cells were seeded at a density of 1 x 10 4 per well in 48-well plates on day 0 in appropriate growth media containing 2%> fetal calf serum (FCS). On the following day, the media was changed and cells were freated with 0, 10 or 100 nM siRNA. On day 3, viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) as previously described (17).
  • FCS fetal calf serum
  • EphrinB2 with EPHB4-Fc Iminunofluorescence detection of EphrinB2 with EPHB4-Fc was done as follows. Frozen sections fixed in 4%> paraformaldehyde and blocked with 20%o FBS were incubated with 5 ⁇ g/ml EphB4/Fc (R&D Systems) for 1 h at RT. Sections were then incubated with 10 ⁇ g/ml rabbit anti- human IgG-FITC in PBS (Jackson ImmunoResearch Laboratories West Grove, PA) at RT for 1 hour. Nuclei were counterstained with DAPI and sections mounted as above. Human Fc (Jackson ImmunoResearch) was used as the negative confrol.
  • MafrigelTM Basement Membrane Matrix (BD Biosciences Discovery Labware, Bedford, MA) was mixed with growth medium (3:1) on ice and 0.5 ml liquid placed in 24-well plates. Incubation of plates at 37 °C for 15 min caused MatrigelTM polymerization. HUVEC or KS-SLK in exponential phase growth were freated with 2 or 8 ⁇ g/ml EphB4-ECD or PBS as confrol for 16 h prior to trypsinizing and plating on the MatrigelTM. Culture on MatrigelTM was continued in the presence of recombinant fusion proteins for 6 h. Cultures were fixed in 4%> parafomialdehyde for 30 min and evaluated by inverted phase-contrast photomicroscopy.
  • the SilencerTM siRNA construction kit (Ambion, Austin TX) was used to synthesize siRNA to ephrin B2 and EphB4. Briefly, three 21 bp target sequences comprising 19 bp downstream of a 5'-AA dinucleotide were identified in the ephrin B2 cDNA (Accession number NM_004093) that showed no significant homology to other sequences in the GenBank database. Sense and antisense siRNA 29-mer DNA oligonucleotide templates were synthesized at the USC Norris Microchemical Core Facility.
  • Antisense template conesponded to the target sequence followed by 8 bp addition (5'-CCTGTCTC-3') at the 3' end complementary to the T7 promoter primer provided with the Silencer SiRNA Construction Kit.
  • Sense template comprised 5'-AA followed by the complement ofthe target 19 bp, then the T7 8 bp sequence as above.
  • the two siRNA oligonucleotide templates were hybridized to a T7 promoter primer. The 3' ends ofthe hybridized oligonucleotides were extended by the Klenow fragment of DNA polymerase to create double-stranded siRNA transcription templates.
  • the sense and antisense siRNA templates were transcribed by T7 RNA polymerase and the resulting RNA transcripts were hybridized to create dsRNA.
  • the dsRNA consisted of 5' terminal single-stranded leader sequences, a 19 nt target specific dsRNA, and 3' terminal UUs.
  • the leader sequences were removed by digesting the dsRNA with a single-stranded specific ribonuclease.
  • the DNA template was removed at the same time by treatment with RNAse free deoxyribonuclease.
  • siRNAs were purified by glass fiber filter binding to remove excess nucleotides, short ohgomers, proteins, and salts in the reaction. End product double-sfranded 21mer siRNAs are shown in Table 5. Similarly, an EphB4 and green fluorescence protein (GFP) siRNAs were synthesized.
  • GFP green fluorescence protein
  • Table 5 siRNAs of ephrin B2 and EphB4.
  • HUVEC were seeded on eight-well chamber slides coated with fibronectin and grown overnight in EGM-2 (Cambrex, WalkersviUe, MD). 16 h later media was replaced either with EBM-2 supplemented with 5% fetal calf serum (FCS) and EGM-2 BulletKit supplements bFGF, hEGF and R 3 -IGF-I at the concenfrations provided by the manufacturer, or EBM-2 supplemented with 5% FCS and 10 ng/ml rhVEGF (R&D Systems).
  • FCS fetal calf serum
  • R&D Systems EBM-2 supplemented with 5% FCS and 10 ng/ml rhVEGF
  • the conect clone was designated pEFNB2 -2491/-11 luc Digestion of this clone with either Kpnl or Sacl followed by recircularization yielded pEFNB2 -1242/-1 iluc and pEFNB2. 57 /- ⁇ iluc, respectively. Plasmid DNAs used for fransient transfections were purified using a Mega Prep kit (QIAGEN, Valencia, CA).
  • HUVEC cells (0.8 x 10 4 cells/well in 24 well plates) maintained in EGM-2 media were fransiently co-transfected with 0.5 ⁇ g/well ephrin B2 promoter-luciferase constructs together with 50 ng/well either pCEFL or pKSvGPCR-CEFL, using Superfect reagent (QIAGEN) according to the manufacturer's instructions.
  • Cells were harvested 48 h post-transfection and lysed with Luciferase cell lysis buffer (Promega). Luciferase activity was assayed using the Luciferase Assay System (Promega) according to the manufacturer's instructions. Luciferase was nonnalized to protein, because pCEFL-vGPCR induced the expression of ⁇ -galactosidase from pCMV-Sport- ⁇ gal (Invitrogen).
  • Example 7 Expression of EphB4 in Bladder cancer: a candidate target for therapy
  • Figure 51 shows expression of EPHB4 in bladder cancer cell lines (A), and regulation of EPHB4 expression by EGFR signaling pathway (B).
  • Figure 52 shows that transfection of p53 inhibit the expression of EPHB4 in 5637 cell.
  • Figure 53 shows growth inhibition of bladder cancer cell line (5637) upon treatment with EPHB4 siRNA 472.
  • Figure 54 shows results on apoptosis study of 5637 cells transfected with EPHB4 siRNA
  • Figure 55 shows effects of EPHB4 antisense probes on cell migration. 5637 cells were freated with EPHB4AS 10 (10 ⁇ M).
  • Figure 56 shows effects of EPHB4 siRNA on cell invasion.
  • 5637 cells were fransfected with siRNA 472 or confrol siRNA.
  • EphB4 were freated with the synthetic phosphorothioate modified oligonucleotides and harvested after 24 hr. Cell lysates were prepared and probed by western blot analysis for relative amounts of EphB4 compared to untreated confrol cells.
  • Eph B4 94 ACG TCT TCA GGA ACC GCA CG (1443-1462) ++++ 80
  • Eph B4 86 AGG TAC CTC TCG GTC AGT GG (1283-1302) ++ 50
  • Eph B4 82 CAG TGA CCT CAA AGG TAT AG (1203-1222) ++++ 70
  • Eph B4 78 GGG TCA AAA GTC AGG TCT CC (1123-1142) ++++ 70
  • Eph B4 76 CTC CGG GTC GGC ACT CCC GG (1083-1102) +++ 60
  • Eph B4 72 AGG TGC AGG GAG GAG CCG TT (1003-1022) ++++ 70
  • Eph B4 66 ACG GCT GAT CCA ATG GTG TT (883-902) ++ 50
  • Eph B4 65 AGA GTG GCT ATT GGC TGG GC (863-882 ( ++++ 60
  • Eph B4 45 ACA TC ACC TTC CCG GTG GC (463-482) +++ 50
  • Eph B4 39 TCC GCA TCG CTC TCA TAG TA (343-362) +++ 60
  • Eph B4 37 TGC AGG AGC GCC CAG CCC GA (303-322) +++ 50
  • Eph B4 30 CAC ACT TCG TAG GTG CGC AC (163-182) +++ 70
  • Eph B4 24 AGC AGG GTC CT CC AAA GC (43-62) ++++ 80
  • Eph B4 22 AGA GCA GCA CCC GGA GCT CC (3-22) +++ 50
  • EphB4 AS-2 AAG GAG GGG TGG TGC ACG GTG (952-972)
  • EphB4 AS-7 TGA AGG TCT CCT TGC AGG (316-333)
  • EphB4 AS-9 CTT CAG GGT CTT GAT TGC CAC (1929-1949)
  • EphB4 AS-10 ATG GAG GCC TCG CTC AGA AA (1980-1999)
  • Eph B4 1562 caucacagccagacccaacuu
  • KS SLK a cell line expressing endogenous high level of ephrin B2.
  • Cell viability was tested using fixed dose of each oligonuceotide (5UM).
  • Gene expression downregulation was done using cell line 293 engineered to stably express full-length ephrin B2.
  • KS SLK expressing EphrinB2 were also used to test the viability in response to RNAi probes tested at the fixed dose of 50 nM. Protein expression levels were measured using 293 cells stably expressing full-length EphrinB2, in cell lysates after 24 hr treatment with fixed 50 nM of RNAi probes.
  • Ephrin B2 antisense probes were summarized below in Table 8.
  • Tlie results on Ephrin B2 RNAi probes were summarized below in Table 9.
  • Ephrin AS-44 CAC TGG GCT CTG AGC CGT TG (843-862) 60 +++
  • Ephrin AS-34 AGG ATG TTG TTC CCC GAA TG (643-662) 50 +++
  • Ephrin AS-29 CAG CTT CTA GTT CTG GAC GT (543-562) 50 +++
  • Ephrin AS-19 AGG TTA GGG CTG AAT TCT TG (343-362) 75 +++
  • Ephrin AS-16 CAG TTG AGG AGA GGG GTA TT (283-302) 40 ++
  • Ephrin AS-5 TCG ATT TGG AAA TCG CAG TT (63-82) 50 +++
  • Ephrin AS-2 CGG AGT CCC TTC TCA CAG CC (3-22) 70 +++
  • Figure 57 shows results on comparison of EphB4 monoclonal antibodies by G250 and in Pull-down assay.
  • Figure 58 shows that EphB4 antibodies, in the presence of matrigel and growth factors, inhibit the in vivo tumor growth of SCCl 5 cells.
  • SCC15 is a head and neck squamous cell carcinoma line. Tumors were initiated in nu/nu mice by injecting 2.5-5xl0 6 cells premixed with matrigel and Growth factors, and Ab's subcutaneously to initiate tumor xenografts. Mice were opened 14 days after injections. SCCl 5 is a head and neck squamous cell carcinoma line, B16 is a melanoma cell line, and MCF-7 is a breast carcinoma line. The responses of tumors to these treatments were compared to control treated mice, which receive PBS injections. Animals were observed daily for tumor growth and subcutaneous tumors were measured using a caliper every 2 days. Antibodies #1 and #23 showed significant regression of SCCl 5 tumor size compared to control, especially with no additional growth factor added.
  • Figure 59 shows that EphB4 antibodies cause apoptosis, necrosis and decreased angiogenesis in SCCl 5, head and neck carcinoma tumor type.
  • Angiogenesis was assessed by CD-31 immunohistochemistry. Tumor tissue sections from treated and untreated mice were stained for CD31. Apoptosis was assessed by immunohistochemical TUNNEL, and proliferation by BrdU assay. Following surgical removal, tumors were immediately sliced into 2 mm serial sections and embedded in paraffin using standard procedures. Paraffin embedded tissue were sectioned at 5 ⁇ m, the wax removed and the tissue rehydrated. The rehydrated tissues were microwave irradiated in antigen retreival solution. .
  • the tumor gets blood support from tumor/skin, muscle boundary. As tumor grows, inner regions get depleted of nutrients. This leads to necrosis (cell death), preferably at the tumor center. After cells die, (tumor) tissue gets replaced with fibroblastic tissue. Slides were visualized under 20-fold magnification with digital images acquired. A different morphology was obtained on SCC tumors with each antibody administered. Ab #1 showed an increase in necrosis and fibrosis but not apoptosis. Ab #23 showed an increase in apoptosis, necrosis and fibrosis and a decrease in vessel infiltration. Ab #35 showed an increase in necrosis and fibrosis, and a small increase in apoptosis and a decrease in vessel infiltration.
  • Ab #79 showed a large increase in apoptosis, and necrossis and fibrosis.
  • Ab #91 showed no change in apoptosis but an increase in proliferation.
  • Ab #138 showed an increase in apoptosis, necrosis, fibrosis and a decrease in proliferation and vessel infiltration.
  • Tumors treated with control PBS displayed abundant tumor density and a robust angiogenic response.
  • Tumors treated with EphB4 antibodies displayed a decrease in tumor cell density and a marked inhibition of tumor angiogenesis in regions with viable tumor cells, as well as tumor necrosis and apoptosis.
  • Figure 60 shows that systemic administration of antibodies on xenografts leads to tumor regression in SCC 15 tumor xenografts.
  • EphB4 monoclonal antibody or an equal volume of PBS as control were initiated on day 4, after the tumors have established, and continued for 14 days. Systemic administration was administered either IP or SC with no significant difference. All the experiments were carried out in a double-blind manner to eliminate investigator bias. Mice were sacrificed at the conclusion ofthe two week treatment period. Tumors were harvested immediately postmortem and fixed and processed for irmnunohistochemistry. EphB4 antibodies 40 mg per kg body weight were administered. Treatment with EphB4 antibody significantly inhibited human SCC tumor growth compared with control-treated mice (p ⁇ 0.05). Treatment with EphB4 antibody significantly inhibited tumor weight compared with control-treated mice (p ⁇ 0.05).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Oncology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physics & Mathematics (AREA)
  • Dermatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Heart & Thoracic Surgery (AREA)
PCT/US2004/007491 2003-03-12 2004-03-12 Nucleic acid compounds for inhibiting angiogenesis and tumor growth Ceased WO2004080418A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2006507095A JP4762889B2 (ja) 2003-03-12 2004-03-12 血管形成及び腫瘍成長を阻止するための核酸化合物
AU2004220525A AU2004220525B2 (en) 2003-03-12 2004-03-12 Nucleic acid compounds for inhibiting angiogenesis and tumor growth
EP04720327A EP1606305A4 (en) 2003-03-12 2004-03-12 NUCLEIC ACID COMPOUNDS FOR THE INHIBITION OF ANGIOGENESIS AND TUMOR GROWTH
CA002518898A CA2518898A1 (en) 2003-03-12 2004-03-12 Nucleic acid compounds for inhibiting angiogenesis and tumor growth

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US45443203P 2003-03-12 2003-03-12
US45430003P 2003-03-12 2003-03-12
US60/454,432 2003-03-12
US60/454,300 2003-03-12

Publications (2)

Publication Number Publication Date
WO2004080418A2 true WO2004080418A2 (en) 2004-09-23
WO2004080418A3 WO2004080418A3 (en) 2005-05-06

Family

ID=32994555

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2004/007491 Ceased WO2004080418A2 (en) 2003-03-12 2004-03-12 Nucleic acid compounds for inhibiting angiogenesis and tumor growth
PCT/US2004/007755 Ceased WO2004080425A2 (en) 2003-03-12 2004-03-12 Polypeptide compounds for inhibiting angiogenesis and tumor growth

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2004/007755 Ceased WO2004080425A2 (en) 2003-03-12 2004-03-12 Polypeptide compounds for inhibiting angiogenesis and tumor growth

Country Status (6)

Country Link
US (5) US7585967B2 (https=)
EP (2) EP1606305A4 (https=)
JP (3) JP2006521111A (https=)
AU (3) AU2004220459B2 (https=)
CA (2) CA2518898A1 (https=)
WO (2) WO2004080418A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2109690B1 (en) * 2007-11-29 2012-04-18 MOLECULAR HEALTH GmbH Eph-b4 specific sirna for reducing epo-induced tumor cell growth during anemia treatment in cancer patients, tissue protective erythropoietin receptor (nepor) and methods of use.
US8338169B2 (en) 2005-07-27 2012-12-25 Institut Des Vaisseaux Et Du Sang Cell/ligand marking system, wherein the marker is of Eph type, cell material comprising said system, method for preparing same and proangiogenetic use
US8357501B2 (en) 2007-11-29 2013-01-22 Molecular Health Gmbh Tissue protective erythropoietin receptor (NEPOR) and methods of use
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
EP4105328A1 (en) * 2021-06-15 2022-12-21 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Antisense-oligonucleotides for prevention of kidney dysfunction promoted by endothelial dysfunction by ephrin-b2 suppression

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6887674B1 (en) 1998-04-13 2005-05-03 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
AU2002951409A0 (en) * 2002-09-16 2002-09-26 North Western Adelaide Health Services Methods for regulating cancer
AU2003268345A1 (en) 2002-09-24 2004-04-19 The Burnham Institute Novel agents that modulate eph receptor activity
EP1606305A4 (en) * 2003-03-12 2009-06-24 Vasgene Therapeutics Inc NUCLEIC ACID COMPOUNDS FOR THE INHIBITION OF ANGIOGENESIS AND TUMOR GROWTH
US7381410B2 (en) 2003-03-12 2008-06-03 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
DK1730196T3 (da) 2004-03-12 2011-03-28 Vasgene Therapeutics Inc EphB4-bindende antistoffer til inhibering af antiogenese og tumorvækst
CN101072797B (zh) * 2004-03-12 2012-05-09 瓦斯基因治疗公司 结合ephb4、抑制血管发生和肿瘤生长的抗体
JP2007320850A (ja) * 2004-08-24 2007-12-13 Kyowa Hakko Kogyo Co Ltd 抗エフリンb2抗体
AU2005286663A1 (en) * 2004-09-23 2006-03-30 Vasgene Therapeutics, Inc. Compositions and methods for detecting and treating tumors
CA2581423A1 (en) * 2004-09-23 2006-03-30 Vasgene Therapeutics, Inc. Polipeptide compounds for inhibiting angiogenesis and tumor growth
DE102004054016A1 (de) * 2004-11-09 2006-05-11 Robert Bosch Gmbh Steuergerät zum Steuern und/oder regeln mindestens einer Fahrzeugfunktion
ES2556272T3 (es) * 2004-11-18 2016-01-14 The Board Of Trustees Of The University Of Illinois Constructos de ARNsi multicistrónico para inhibir tumores
CA2593325A1 (en) * 2005-01-06 2006-07-13 Genentech, Inc. Cancer prognostic, diagnostic and treatment methods
JP2008528614A (ja) * 2005-01-27 2008-07-31 ザ・バーンハム・インスティテュート EphB受容体結合ペプチド
US20070218061A1 (en) * 2005-09-23 2007-09-20 Vasgene Therapeutics, Inc. Use of ephrinb2 directed agents for the treatment or prevention of viral infections
SI1976884T1 (sl) 2006-01-20 2013-04-30 Genetech, Inc. Anti-efrinB2 protitelesa in postopki uporabe le teh
US20110052667A1 (en) * 2007-06-28 2011-03-03 Sylgen Laboratories, Inc. Compositions and methods for inhibiting angiogenesis and tumorigenesis
CA2696164C (en) 2007-08-13 2018-06-12 Vasgene Therapeutics, Inc. Cancer treatment using humanized antibodies that bind to ephb4
WO2012112434A1 (en) * 2011-02-14 2012-08-23 Allergan, Inc. Inhibiting aberrant blood vessel formation using retargeted endopeptidases
JP2015071566A (ja) * 2013-10-03 2015-04-16 住友ベークライト株式会社 Fgf4遺伝子増幅腫瘍の医薬組成物
US20190343880A1 (en) * 2016-12-14 2019-11-14 Shinshu University Chimeric antigen receptor gene-modified lymphocyte having cytocidal effect
WO2020146723A1 (en) * 2019-01-10 2020-07-16 Massachusetts Institute Of Technology Functional analysis of cancer cells
US12560590B2 (en) 2019-01-23 2026-02-24 Massachusetts Institute Of Technology Rapid analysis of live cells
CA3181420A1 (en) * 2020-05-28 2021-12-02 Cytobay Inc. Cytopathological staining
JPWO2023224096A1 (https=) * 2022-05-18 2023-11-23

Family Cites Families (83)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
JPH04218000A (ja) 1990-02-13 1992-08-07 Kirin Amgen Inc 修飾ポリペプチド
US5674691A (en) 1991-06-21 1997-10-07 Amrad Corporation Limited Method of screening for ligands to a receptor-type tyrosine kinase
US6331302B1 (en) * 1992-01-22 2001-12-18 Genentech, Inc. Protein tyrosine kinase agonist antibodies
US5635177A (en) * 1992-01-22 1997-06-03 Genentech, Inc. Protein tyrosine kinase agonist antibodies
AU3482493A (en) 1992-01-22 1993-09-01 New England Deaconess Hospital Novel protein tyrosine kinases
AU687727B2 (en) 1992-10-28 1998-03-05 Genentech Inc. Vascular endothelial cell growth factor antagonists
US5824303A (en) 1992-11-13 1998-10-20 Amgen Inc. Eck receptor ligands
JPH08505765A (ja) 1992-11-13 1996-06-25 アムジエン・インコーポレーテツド Eck受容体リガンド
US5512591A (en) * 1993-02-18 1996-04-30 President And Fellows Of Harvard College Treatments for diseases characterized by neovascularization
ES2152753B1 (es) 1993-03-29 2001-09-01 Ct Investig Energeticas Ciemat Animales transgenicos para la determinacion de agentes que estimulan o reprimen la hiperproliferacion epidermica y el crecimiento del pelo
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6303769B1 (en) * 1994-07-08 2001-10-16 Immunex Corporation Lerk-5 dna
US5864020A (en) * 1994-07-20 1999-01-26 Genentech, Inc. HTK ligand
WO1996003043A1 (en) 1994-07-26 1996-02-08 Rutgers, The State University Of New Jersey Human brain specific kinase
US5795734A (en) 1994-09-19 1998-08-18 President And Fellows Of Harvard College EPH receptor ligands, and uses related thereto
EP0787148B1 (en) 1994-10-27 2004-04-07 Genentech, Inc. Al-1 neurotrophic factor, a ligand for an eph-related tyrosine kinase receptor
US6057124A (en) 1995-01-27 2000-05-02 Amgen Inc. Nucleic acids encoding ligands for HEK4 receptors
WO1996026958A2 (en) 1995-02-27 1996-09-06 President And Fellows Of Harvard College Eph RECEPTOR LIGAND ELF-2
GB9508538D0 (en) * 1995-04-27 1995-06-14 Zeneca Ltd Quinazoline derivatives
ES2202469T5 (es) 1995-09-08 2011-06-06 Genentech, Inc. Proteína relacionada con el vegf.
WO2002096927A2 (en) * 2001-05-29 2002-12-05 Ribozyme Pharmaceuticals, Incorporated Ribozyme based treatment of female reproductive diseases
US6346398B1 (en) * 1995-10-26 2002-02-12 Ribozyme Pharmaceuticals, Inc. Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
US5837534A (en) * 1995-11-14 1998-11-17 The Board Of Regents Of The University Of Texas System Smooth muscle 22α promoter, gene transfer vectors containing the same, and method of use of the same to target gene expression in arterial smooth muscle cells
AUPN727795A0 (en) 1995-12-22 1996-01-18 Walter And Eliza Hall Institute Of Medical Research, The A novel receptor-type tyrosine kinase and use thereof
US6696557B1 (en) * 1996-04-19 2004-02-24 Genentech, Inc. AL-2 neurotrophic factor nucleic acid
US6100071A (en) 1996-05-07 2000-08-08 Genentech, Inc. Receptors as novel inhibitors of vascular endothelial growth factor activity and processes for their production
CA2259157A1 (en) 1996-07-05 1998-01-15 Mount Sinai Hospital Corporation Oligomerized receptors which affect pathways regulated by transmembrane ligands for elk-related receptor tyrosine kinases
UA73073C2 (uk) 1997-04-03 2005-06-15 Уайт Холдінгз Корпорейшн Заміщені 3-ціанохіноліни, спосіб їх одержання та фармацевтична композиція
KR100816621B1 (ko) 1997-04-07 2008-03-24 제넨테크, 인크. 항-vegf 항체
AU6887698A (en) 1997-04-08 1998-10-30 Sugen, Inc. Study and treatment of diseases related to specific cellular functions of receptor protein tyrosine kinases
US6440954B1 (en) * 1997-04-18 2002-08-27 President And Fellows Of Harvard College Inhibition of vascular smooth muscle cell proliferation
WO1999008696A1 (en) 1997-08-19 1999-02-25 Vanderbilt University METHODS FOR DETERMINING CELL RESPONSES THROUGH EphB RECEPTORS
EP1019080A2 (en) * 1997-10-02 2000-07-19 Leukosite, Inc. Modulation of lerk-2-mediated cell adhesion
WO1999045026A1 (en) * 1998-03-05 1999-09-10 Chiron Corporation Method for increasing the serum half-life of a biologically active molecule
US6864227B1 (en) * 1998-04-13 2005-03-08 California Institute Of Technology Artery-and vein-specific proteins and uses therefor
US6887674B1 (en) * 1998-04-13 2005-05-03 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
EP0999278B1 (en) 1998-10-02 2004-03-31 Universite Paris Vii Vascular specific regulatory elements contained in the desmin 5' flanking region
AUPP674898A0 (en) 1998-10-27 1998-11-19 Walter And Eliza Hall Institute Of Medical Research, The A method of treatment
ATE293989T1 (de) * 1998-11-20 2005-05-15 Genentech Inc Verwendung von eph-rezeptor-antagonisten und agonisten zur behandlung von vaskulären krankheiten
US6150162A (en) * 1998-12-17 2000-11-21 Isis Pharmaceuticals Inc. Antisense modulation of CD44 expression
US6770633B1 (en) * 1999-10-26 2004-08-03 Immusol, Inc. Ribozyme therapy for the treatment of proliferative skin and eye diseases
CA2396114A1 (en) * 2000-01-06 2001-07-12 Andrew Freywald Methods of modulation of the immune system
JP2004509604A (ja) * 2000-03-28 2004-04-02 アイシス・ファーマシューティカルス・インコーポレーテッド mRNAプロセッシングのアンチセンスモジュレーションによる、細胞行動の改変
EP2213743A1 (en) * 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
AU2001257174A1 (en) 2000-04-21 2001-11-07 Amgen Inc. Integrin/adhesion antagonists
US6271030B1 (en) * 2000-06-14 2001-08-07 Isis Pharmaceuticals, Inc. Antisense inhibition of C/EBP beta expression
US6277640B1 (en) * 2000-07-31 2001-08-21 Isis Pharmaceuticals, Inc. Antisense modulation of Her-3 expression
EP1392333A2 (en) 2000-08-03 2004-03-03 The University of Utah Research Foundation Manipulation of arterial-venous identity
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
WO2002026827A1 (en) * 2000-09-29 2002-04-04 Novartis Ag Extracellular polypeptides of eph b receptors and ephrin b ligands and the corresponding nucleic acid molecules
US7136808B2 (en) * 2000-10-20 2006-11-14 Microsoft Corporation Detection and correction of errors in german grammatical case
IL156009A0 (en) * 2000-11-20 2003-12-23 California Inst Of Techn Artery smooth muscle and vein smooth muscle specific proteins and uses therefor
CA2429814C (en) * 2000-12-01 2014-02-18 Thomas Tuschl Rna interference mediating small rna molecules
AU2002243623A1 (en) 2001-01-26 2002-08-06 Regeneron Pharmaceuticals, Inc. Methods of imaging and targeting vasculature
US20040132634A1 (en) 2001-01-31 2004-07-08 Frank Sicheri Compositions and methods for regulating the kinase domain of receptor tyrosine kinases
AU2002249170B2 (en) 2001-02-02 2007-02-08 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V Method for identifying functional nucleic acids
EP1383782A1 (en) * 2001-03-26 2004-01-28 Sirna Therpeutics, Inc. Oligonucleotide mediated inhibition of hepatitis b virus and hepatitis c virus replication
US6919313B2 (en) 2001-03-30 2005-07-19 President & Fellows Of Harvard College Protein waving a PDZ and a RGS domain
EP1386004A4 (en) * 2001-04-05 2005-02-16 Ribozyme Pharm Inc MODULATION OF GENE EXPRESSION ASSOCIATED WITH INFLAMMATORY PROLIFERATION AND GROWTH OF NEURITIES BY METHODS INVOLVING NUCLEIC ACID
PT2000545E (pt) * 2001-06-20 2011-12-21 Genentech Inc Composições e métodos para o diagnóstico e tratamento do tumor pulmonar
CA2450793A1 (en) 2001-06-20 2002-12-27 Prochon Biotech Ltd. Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
WO2003004057A1 (en) * 2001-07-03 2003-01-16 The Hospital For Sick Children Ephrin and eph receptor mediated immune modulation
JP3876656B2 (ja) * 2001-07-13 2007-02-07 住友金属工業株式会社 管用ねじ継手
AU2002353972A1 (en) * 2001-11-02 2003-05-19 Pfizer Products Inc. Lung cancer therapeutics and diagnostics
US20060241027A1 (en) * 2002-02-07 2006-10-26 Hans-Peter Hauser Hiv inhibiting proteins
JP4585968B2 (ja) 2002-05-10 2010-11-24 パーデュー・リサーチ・ファウンデーション EphA2アゴニストモノクローナル抗体およびその使用法
ATE525398T1 (de) 2002-05-10 2011-10-15 Medimmune Inc Epha2 monoklonale antikörper und deren anwendungsverfahren
US20040110150A1 (en) * 2002-12-10 2004-06-10 Isis Pharmaceuticals Inc. Modulation of Ephrin-B2 expression
AU2003254641A1 (en) 2002-08-28 2004-03-19 Maxygen Aps Interferon beta-like molecules for treatment of cancer
AU2003260169B9 (en) * 2002-09-16 2011-06-09 The Queen Elizabeth Hospital Research Foundation Inc. Methods for regulating cancer
AU2002951409A0 (en) 2002-09-16 2002-09-26 North Western Adelaide Health Services Methods for regulating cancer
AU2003295600A1 (en) * 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US7250289B2 (en) * 2002-11-20 2007-07-31 Affymetrix, Inc. Methods of genetic analysis of mouse
EP1606305A4 (en) * 2003-03-12 2009-06-24 Vasgene Therapeutics Inc NUCLEIC ACID COMPOUNDS FOR THE INHIBITION OF ANGIOGENESIS AND TUMOR GROWTH
NZ567952A (en) * 2003-03-24 2009-12-24 Sequoia Pharmaceuticals Inc Long acting biologically active conjugates
WO2004091375A2 (en) 2003-04-11 2004-10-28 Medimmune, Inc. Epha2 and non-neoplastic hyperproliferative cell disorders
EP1618184A4 (en) * 2003-04-11 2006-06-21 Medimmune Inc EPHA2, HYPOPROLIFERATIVE CELL DISORDERS, AND EPITHELIAL AND ENDOTHELIAL RECONSTITUTION
KR20060034231A (ko) 2003-06-06 2006-04-21 메디뮨 인코포레이티드 암의 진단, 치료 및 예방에 있어서의 epha4 및epha4 조정제의 용도
WO2005037232A2 (en) * 2003-10-17 2005-04-28 Joslin Diabetes Center, Inc. Methods and compositions for modulating adipocyte function
EP1689346A4 (en) 2003-11-20 2007-11-21 Medimmune Inc EPHA2 AGONISTIC MONOCLONAL ANTIBODIES AND METHOD OF USE THEREOF
CN101072797B (zh) 2004-03-12 2012-05-09 瓦斯基因治疗公司 结合ephb4、抑制血管发生和肿瘤生长的抗体
CA2581423A1 (en) 2004-09-23 2006-03-30 Vasgene Therapeutics, Inc. Polipeptide compounds for inhibiting angiogenesis and tumor growth

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1606305A4 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8338169B2 (en) 2005-07-27 2012-12-25 Institut Des Vaisseaux Et Du Sang Cell/ligand marking system, wherein the marker is of Eph type, cell material comprising said system, method for preparing same and proangiogenetic use
US9381208B2 (en) 2006-08-08 2016-07-05 Rheinische Friedrich-Wilhelms-Universität Structure and use of 5′ phosphate oligonucleotides
US10238682B2 (en) 2006-08-08 2019-03-26 Rheinische Friedrich-Wilhelms-Universität Bonn Structure and use of 5′ phosphate oligonucleotides
EP2109690B1 (en) * 2007-11-29 2012-04-18 MOLECULAR HEALTH GmbH Eph-b4 specific sirna for reducing epo-induced tumor cell growth during anemia treatment in cancer patients, tissue protective erythropoietin receptor (nepor) and methods of use.
EP2492355A1 (en) * 2007-11-29 2012-08-29 Life Biosystems GmbH Tissue protective erythropoietin receptor (nepor) and methods of use
US8357501B2 (en) 2007-11-29 2013-01-22 Molecular Health Gmbh Tissue protective erythropoietin receptor (NEPOR) and methods of use
EP2960341A1 (en) * 2007-11-29 2015-12-30 Molecular Health GmbH Novel tissue protective erythropoietin receptor (nepor) and methods of use
US10196638B2 (en) 2008-05-21 2019-02-05 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US10036021B2 (en) 2008-05-21 2018-07-31 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9738680B2 (en) 2008-05-21 2017-08-22 Rheinische Friedrich-Wilhelms-Universität Bonn 5′ triphosphate oligonucleotide with blunt end and uses thereof
US9896689B2 (en) 2011-03-28 2018-02-20 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US9399658B2 (en) 2011-03-28 2016-07-26 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
US10059943B2 (en) 2012-09-27 2018-08-28 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US10072262B2 (en) 2012-09-27 2018-09-11 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
US11142763B2 (en) 2012-09-27 2021-10-12 Rheinische Friedrich-Wilhelms-Universität Bonn RIG-I ligands and methods for producing them
EP4105328A1 (en) * 2021-06-15 2022-12-21 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Antisense-oligonucleotides for prevention of kidney dysfunction promoted by endothelial dysfunction by ephrin-b2 suppression
WO2022263569A1 (en) 2021-06-15 2022-12-22 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Antisense-oligonucleotides for prevention of kidney dysfunction promoted by endothelial dysfunction by ephrin-b2 suppression

Also Published As

Publication number Publication date
CA2518898A1 (en) 2004-09-23
AU2010238577B2 (en) 2012-05-24
EP1606305A4 (en) 2009-06-24
AU2004220525A1 (en) 2004-09-23
US20050164965A1 (en) 2005-07-28
AU2004220459B2 (en) 2010-08-05
WO2004080425A2 (en) 2004-09-23
WO2004080418A3 (en) 2005-05-06
US8063183B2 (en) 2011-11-22
EP1605961A2 (en) 2005-12-21
JP2011256179A (ja) 2011-12-22
WO2004080425A3 (en) 2005-07-07
EP1606305A2 (en) 2005-12-21
JP4762889B2 (ja) 2011-08-31
AU2010238577A1 (en) 2010-11-18
JP2006519610A (ja) 2006-08-31
US20070031435A1 (en) 2007-02-08
US20110129482A1 (en) 2011-06-02
EP1605961A4 (en) 2009-11-11
JP2006521111A (ja) 2006-09-21
AU2004220525B2 (en) 2011-03-31
AU2004220459A1 (en) 2004-09-23
US7585967B2 (en) 2009-09-08
US20100093831A1 (en) 2010-04-15
US20050084873A1 (en) 2005-04-21
US7862816B2 (en) 2011-01-04
CA2518912A1 (en) 2004-09-23

Similar Documents

Publication Publication Date Title
US7585967B2 (en) Nucleic acid compounds for inhibiting angiogenesis and tumor growth
US8273858B2 (en) Polypeptide compounds for inhibiting angiogenesis and tumor growth
JP2006521111A5 (https=)
WO2002031141A2 (en) Antisense oligonucleotide directed toward mammalian vegf receptor genes and uses thereof
WO2003056010A2 (en) An antisense strategy to modulate estrogen receptor response (er. alpha. and/or er. beta.)
JP2001513996A (ja) Mdm2特異的アンチセンスオリゴヌクレオチド
AU2008226824A1 (en) Use of EphB4 as a diagnostic marker and a therapeutic target for ovarian cancer
JPH06209778A (ja) NF−κBアンチセンスポリヌクレオチド
EP3587577B1 (en) Asymmetric sirna for inhibiting expression of male pattern hair loss target gene
KR20010042848A (ko) 인슐린유사 성장인자 ⅱ의 안티센스 올리고뉴클레오타이드서열 및 이를 이용한 세포성장 조절방법
JP2007530431A (ja) 膵臓癌を治療するための組成物および方法
CN114174512B (zh) 抑制PD-1表达的不对称siRNA
KR101783444B1 (ko) miR-33-5p 를 이용한 뇌신경세포 보호 물질 스크리닝 방법
CN106795556A (zh) VGSC β3 蛋白质用于癌症预防、治疗及诊断检测的靶点
AU3986201A (en) Method and reagent for the inhibition of grid
CA2321189A1 (en) Antisense oligonucleotides directed toward mammalian vegf receptor genes and uses thereof
CA2471127A1 (en) An antisense strategy to modulate estrogen receptor response (er.alpha. and/or er.beta.)

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006507095

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2518898

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004220525

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004720327

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004220525

Country of ref document: AU

Date of ref document: 20040312

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004220525

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004720327

Country of ref document: EP