WO2000077262A1 - Synthetic ligation reassembly in directed evolution - Google Patents
Synthetic ligation reassembly in directed evolution Download PDFInfo
- Publication number
- WO2000077262A1 WO2000077262A1 PCT/US2000/016838 US0016838W WO0077262A1 WO 2000077262 A1 WO2000077262 A1 WO 2000077262A1 US 0016838 W US0016838 W US 0016838W WO 0077262 A1 WO0077262 A1 WO 0077262A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ofthe
- sequence
- nucleic acid
- sequences
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1058—Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/445—Plasmodium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1027—Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y308/00—Hydrolases acting on halide bonds (3.8)
- C12Y308/01—Hydrolases acting on halide bonds (3.8) in C-halide substances (3.8.1)
- C12Y308/01002—(S)-2-Haloacid dehalogenase (3.8.1.2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Definitions
- This invention relates to the field of protein engineering. Specifically, this invention relates to a directed evolution method for preparing a polynucleotide encoding a polypeptide. More specifically, this invention relates to a method of using mutagenesis to generate a novel polynucleotide encoding a novel polypeptide, which novel polypeptide is itself an improved biological molecule &/or contributes to the generation of another improved biological molecule. More specifically still, this invention relates to a method of performing both non-stochastic polynucleotide chimerization and non-stochastic site-directed point mutagenesis.
- this invention relates to a method of generating a progeny set of chimeric polynucleotide(s) by means that are synthetic and non-stochastic, and where the design ofthe progeny polynucleotide(s) is derived by analysis of a parental set of polynucleotides &/or ofthe polypeptides correspondingly encoded by the parental polynucleotides.
- this invention relates to a method of performing site-directed mutagenesis using means that are exhaustive, systematic, and non-stochastic.
- this invention relates to a step of selecting from among a generated set of progeny molecules a subset comprised of particularly desirable species, including by a process termed end-selection, which subset may then be screened further.
- This invention also relates to the step of screening a set of polynucleotides for the production of a polypeptide &/or of another expressed biological molecule having a useful property.
- Novel biological molecules whose manufacture is taught by this invention include genes, gene pathways, and any molecules whose expression is affected thereby, including directly encoded polypetides &/or any molecules affected by such polypeptides.
- Said novel biological molecules include those that contain a carbohydrate, a lipid, a nucleic acid, &/or a protein component, and specific but non- limiting examples of these include antibiotics, antibodies, enzymes, and steroidal and non-steroidal hormones.
- the present invention relates to enzymes, particularly to thermostable enzymes, and to their generation by directed evolution. More particularly, the present invention relates to thermostable enzymes which are stable at high temperatures and which have improved activity at lower temperatures.
- harvesting the full potential of nature's diversity can include both the step of discovery and the step of optimizing what is discovered.
- the step of discovery allows one to mine biological molecules that have commercial utility.
- the ability to harvest the full richness of biodiversity i.e. to mine biological molecules from a wide range of environmental conditions, is critical to the ability to discover novel molecules adapted to funtion under a wide variety of conditions, including extremes of conditions, such as may be found in a commercial application.
- directed evolution of experimentally modifying a biological molecule towards a desirable property, can be achieved by mutagenizing one or more parental molecular templates and by idendifying any desirable molecules among the progeny molecules.
- technologies in directed evolution include methods for achieving stochastic (i.e. random) mutagenesis and methods for achieving non-stochastic (non-random) mutagenesis.
- critical shortfalls in both types of methods are identified in the instant disclosure.
- stochastic or random mutagenesis is exemplified by a situation in which a progenitor molecular template is mutated (modified or changed) to yield a set of progeny molecules having mutation(s) that are not predetermined.
- a progenitor molecular template is mutated (modified or changed) to yield a set of progeny molecules having mutation(s) that are not predetermined.
- stochastic mutagenesis reaction for example, there is not a particular predetermined product whose production is intended; rather there is an uncertainty - hence randomness - regarding the exact nature ofthe mutations achieved, and thus also regarding the products generated.
- non-stochastic or non-random mutagenesis is exemplified by a situation in which a progenitor molecular template is mutated (modified or changed) to yield a progeny molecule having one or more predetermined mutations. It is appreciated that the presence of background products in some quantity is a reality in many reactions where molecular processing occurs, and the presence of these background products does not detract from the non-stochastic nature of a mutagenesis process having a predetermined product.
- stochastic mutagenesis is manifested in processes such as error-prone PCR and stochastic shuffling, where the mutation(s) achieved are random or not predetermined.
- non-stochastic mutagenesis is manifested in instantly disclosed processes such as gene site-saturation mutagenesis and synthetic ligation reassembly, where the exact chemical structure(s) ofthe intended product(s) are predetermined.
- the instant invention satisfies all of these needs.
- Natural evolution has been a springboard for directed or experimental evolution, serving both as a reservoir of methods to be mimicked and of molecular templates to be mutagenized. It is appreciated that, despite its intrinsic process-related limitations (in the types of favored &/or allowed mutagenesis processes) and in its speed, natural evolution has had the advantage of having been in process for millions of years & and throughout a wide diversity of environments. Accordingly, natural evolution (molecular mutagenesis and selection in nature) has resulted in the generation of a wealth of biological compounds that have shown usefulness in certain commercial applications.
- nucleic acids do not reach close enough proximity to each other in a operative environment to undergo chimerization or incorporation or other types of transfers from one species to another.
- the chimerization of nucleic acids from these 2 species is likewise unlikely, with parasites common to the two species serving as an example of a very slow passageway for inter-molecular encounters and exchanges of DNA.
- the generation of a molecule causing self-toxicity or self- lethality or sexual sterility is avoided in nature.
- the propagation of a molecule having no particular immediate benefit to an organism is prone to vanish in subsequent generations ofthe organism. Furthermore, e.g., there is no selection pressure for improving the performance of molecule under conditions other than those to which it is exposed in its endogenous environment; e.g. a cytoplasmic molecule is not likely to acquire functional features extending beyond what is required of it in the cytoplasm. Furthermore still, the propagation of a biological molecule is susceptible to any global detrimental effects - whether caused by itself or not - on its ecosystem. These and other characteristics greatly limit the types of mutations that can be propagated in nature.
- directed (or experimental) evolution - particularly as provided herein - can be performed much more rapidly and can be directed in a more streamlined manner at evolving a predetermined molecular property that is commercially desirable where nature does not provide one &/or is not likely to provide.
- the directed evolution invention provided herein can provide more wide-ranging possibilities in the types of steps that can be used in mutagenesis and selection processes. Accordingly, using templates harvested from nature, the instant directed evolution invention provides more wide-ranging possibilities in the types of progeny molecules that can be generated and in the speed at which they can be generated than often nature itself might be expected to in the same length of time.
- the instantly disclosed directed evolution methods can be applied iteratively to produce a lineage of progeny molecules (e.g. comprising successive sets of progeny molecules) that would not likely be propagated (i.e., generated &/or selected for) in nature, but that could lead to the generation of a desirable downstream mutagenesis product that is not achievable by natural evolution.
- progeny molecules e.g. comprising successive sets of progeny molecules
- Mutagenesis has been attempted in the past on many occasions, but by methods that are inadequate for the purpose of this invention.
- previously described non-stochastic methods have been serviceable in the generation of only very small sets of progeny molecules (comprised often of merely a solitary progeny molecule).
- a chimeric gene has been made by joining 2 polynucleotide fragments using compatible sticky ends generated by restriction enzyme(s), where each fragment is derived from a separate progenitor (or parental) molecule.
- Another example might be the mutagenesis of a single codon position (i.e. to achieve a codon substitution, addition, or deletion) in a parental polynucleotide to generate a single progeny polynucleotide encoding for a single site-mutagenized polypeptide.
- stochastic methods have been used to achieve larger numbers of point mutations and/or chimerizations than non-stochastic methods; for this reason, stochastic methods have comprised the predominant approach for generating a set of progeny molecules that can be subjected to screening, and amongst which a desirable molecular species might hopefully be found.
- a major drawback of these approaches is that - because of their stochastic nature - there is a randomness to the exact components in each set of progeny molecules that is produced. Accordingly, the experimentalist typically has little or no idea what exact progeny molecular species are represented in a particular reaction vessel prior to their generation. Thus, when a stochastic procedure is repeated (e.g.
- the instant invention addresses these problems by providing non-stochastic means for comprehensively and exhaustively generating all possible point mutations in a parental template.
- the instant invention further provides means for exhaustively generating all possible chimerizations within a group of chimerizations.
- Site-directed mutagenesis technologies such as sloppy or low- fidelity PCR, are ineffective for systematically achieving at each position (site) along a polypeptide sequence the full (saturated) range of possible mutations (i.e. all possible amino acid substitutions).
- the complexity of an active sequence of a biological macromolecule e.g., polynucleotides, polypeptides, and molecules that are comprised of both polynucleotide WO 00/77262 PCT/USOO/l 6838
- IC information content
- Information density is the IC per unit length of a sequence. Active sites of enzymes tend to have a high information density. By contrast, flexible linkers of information in enzymes have a low information density.
- Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. In a mixture of fragments of unknown sequence, error-prone PCR can be used to mutagenize the mixture.
- the published error-prone PCR protocols suffer from a low processivity of the polymerase. Therefore, the protocol is unable to result in the random mutagenesis of an average-sized gene. This inability limits the practical application of error-prone PCR.
- Some computer simulations have suggested that point mutagenesis alone may often be too gradual to allow the large-scale block changes that are required for continued and dramatic sequence evolution. Further, the published error-prone PCR protocols do not allow for amplification of DNA fragments greater than 0.5 to 1.0 kb, limiting their practical application.
- repeated cycles of error-prone PCR can lead to an accumulation of neutral mutations with undesired results, such as affecting a protein's immunogenicity but not its binding affinity.
- oligonucleotide-directed mutagenesis a short sequence is replaced with a synthetically mutagenized oligonucleotide. This approach does not generate combinations of distant mutations and is thus not combinatorial.
- the limited library size relative to the vast sequence length means that many rounds of selection are unavoidable for protein optimization.
- Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round followed by grouping them into families, arbitrarily choosing a single family, and reducing it to a consensus motif. Such motif is re-synthesized and reinserted into a single gene followed by additional selection. This step process constitutes a statistical bottleneck, is labor intensive, and is not practical for many rounds of mutagenesis.
- Error-prone PCR and oligonucleotide-directed mutagenesis are thus useful for single cycles of sequence fine tuning, but rapidly become too limiting when they are applied for multiple cycles.
- cassette mutagenesis a sequence block of a single template is typically replaced by a (partially) randomized sequence. Therefore, the maximum information content that can be obtained is statistically limited by the number of random sequences (i.e., library size). This eliminates other sequence families which are not currently best, but which may have greater long term potential.
- mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round. Thus, such an approach is tedious and impractical for many rounds of mutagenesis.
- RNA ligase ribozyme from a random library using many rounds of amplification by error-prone PCR and selection.
- This invention relates generally to the field of nucleic acid engineering and correspondingly encoded recombinant protein engineering. More particularly, the invention relates to the directed evolution of nucleic acids and screening of clones containing the evolved nucleic acids for resultant activity(ies) of interest, such nucleic acid activity(ies) &/or specified protein, particularly enzyme, activity(ies) of interest.
- -14- Mutagenized molecules may have chimeric molecules and molecules with point mutations, including biological molecules that contain a carbohydrate, a lipid, a nucleic acid, &/or a protein component, and specific but non- limiting examples of these include antibiotics, antibodies, enzymes, and steroidal and non- steroidal hormones.
- This invention relates generally to a method of: 1) preparing a progeny generation of molecule(s) (including a molecule that is comprised of a polynucleotide sequence, a molecule that is comprised of a polypeptide sequence, and a molecules that is comprised in part of a polynucleotide sequence and in part of a polypeptide sequence), that is mutagenized to achieve at least one point mutation, addition, deletion, &/or chimerization, from one or more ancestral or parental generation template(s); 2) screening the progeny generation molecule(s) - preferably using a high throughput method - for at least one property of interest (such as an improvement in an enzyme activity or an increase in stability or a novel chemotherapeutic effect); 3) optionally obtaining &/or cataloguing structural &/or and functional information regarding the parental &/or progeny generation molecules; and 4) optionally repeating any of steps 1) to 3).
- a progeny generation of molecule(s) including
- this progeny generation of polynucleotides there is also generated a set of progeny polypeptides, each having at least one single amino acid point mutation.
- amino acid site-saturation mutagenesis one such mutant polypeptide for each ofthe 19 naturally encoded polypeptide-forming alpha- amino acid substitutions at each and every amino acid position along the polypeptide.
- amino acid site-saturation mutagenesis one such mutant polypeptide for each ofthe 19 naturally encoded polypeptide-forming alpha- amino acid substitutions at each and every amino acid position along the polypeptide.
- this approach is also serviceable for generating mutants containing - in addition to &/or in combination with the 20 naturally encoded polypeptide-forming alpha-amino acids - other rare &/or not naturally-encoded amino acids and amino acid derivatives.
- this approach is also serviceable for generating mutants by the use of - in addition to &/or in combination with natural or unaltered codon recognition systems of suitable hosts - altered, mutagenized, &/or designer codon recognition systems (such as in a host cell with one or more altered tRNA molecules).
- this invention relates to recombination and more specifically to a method for preparing polynucleotides encoding a polypeptide by a method of in vivo re-assortment of polynucleotide sequences containing regions of partial homology, assembling the polynucleotides to form at least one polynucleotide and screening the polynucleotides for the production of polypeptide(s) having a useful property.
- this invention is serviceable for analyzing and cataloguing - with respect to any molecular property (e.g. an enzymatic activity) or combination of properties allowed by current technology - the effects of any mutational change achieved (including particularly saturation mutagenesis).
- a comprehensive method is provided for determining the effect of changing each amino acid in a parental polypeptide into each of at least 19 possible substitutions. This allows each amino acid in a parental polypeptide to be characterized and catalogued according to its spectrum of potential effects on a measurable property ofthe polypeptide.
- the method ofthe present invention utilizes the natural property of cells to recombine molecules and/or to mediate reductive processes that reduce the complexity of sequences and extent of repeated or consecutive sequences possessing regions of homology.
- a method for introducing polynucleotides into a suitable host cell and growing the host cell under conditions that produce a hybrid polynucleotide is provided, in accordance with one aspect ofthe invention.
- the invention provides a method for screening for biologically active hybrid polypeptides encoded by hybrid polynucleotides.
- the present method allows for the identification of biologically active hybrid polypeptides with enhanced biological activities.
- an important advantage ofthe synthetic ligation reassembly methods provided herein is that the starting templates that can be aligned and subjected to ligation reassembly are not limited to full length genes. In fact when working with genomic sequences it is often the case that partial gene sequences are obtained, and these can be subjected to ligation reassembly according to this invention.
- nucleic acid building blocks that are serviceable for this invention can be generated by synthetic means or alternatively by polymerase-based methods either in vivo or in vitro or alternatively by a combination of synthetic means and polymerase-based means.
- the likelihood of nucleotide inco ⁇ oration errors is different for each method. Among such errors some may be undesirable at times. For example the presence of a single nucleotide mistake in the generation of up a nucleic acid building block can lead to the undesirable introduction of a stop codon. It is appreciated that several prescreening methods can be used to filter out to undesirable nucleotide incorporation errors.
- the finalized construct can be a fusion product that includes a reporter sequence, such as GFP or a 6xHis tag, that is only generated in the absence of unwanted internal stop codons. It is also appreciated that the selection all ofthe method by which nucleic acid building blocks are generated can be based upon consideration ofthe error rates of each method considered.
- nucleic acid building blocks may be single-stranded or double-stranded polynucleotides.
- ligation reassembly according to this invention may be performed using synthetic as well as non-synthetic nucleic acid building blocks up, or a combination thereof.
- both single-stranded and double-stranded polynucleotides may be used in ligation reassembly, either mutually exclusively or in combination.
- blunt ended acid building blocks may be used without alteration ofthe blunt ends or alternatively may be subjected to treatment with an exonuclease, such as Exonuclease III, to create serviceable overhangs up for synthetic ligation couplings of.
- an exonuclease such as Exonuclease III
- Such a treatment may be brief and controlled, e.g., by subjecting the working sample of to a temperature at which the Exonuclease III is operable, and then quickly chilling.
- treatment with a ligase such as T4 DNA Ligase is an optional step.
- the invention provides a method of non- stochastically producing a library of chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of (a) generating by design a plurality of specific synthetic nucleic acid building blocks having serviceable mutually compatible ligatable ends, and (b) assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved; whereby a set of progemtor templates, such as genes (e.g. a family of esterase genes) or genes pathways (e.g. encoding antibiotics) can be shuffled to generate a sizable library of progeny polynucleotide molecules (e.g.
- the expression screening ofthe progeny polynucleotide library provides a means to identify a desirable species that has a desirable property, such as a specific enzymatic activity serviceable for a commercial application.
- a method of non-stochastically producing a library comprised of a defined number of groupings comprised of one or more groupings of chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of (a) generating by design for each grouping a set of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and (b) assembling these nucleic acid building blocks according to said groupings, such that a designed overall assembly order is achieved; whereby a set of progenitor templates, such as genes (e.g. a family of esterase genes) or genes pathways (e.g.
- encoding antibiotics can be shuffled to generate a sizable library of progeny polynucleotide molecules (e.g. l ⁇ l ⁇ ) and correspondingly encoded polypeptides, and whereby the expression screening ofthe progeny polynucleotide library provides a means to identify a desirable species that has a desirable property, such as a specific enzymatic activity serviceable for a commercial application.
- progeny polynucleotide molecules e.g. l ⁇ l ⁇
- polypeptides e.g. l ⁇ l ⁇
- the expression screening ofthe progeny polynucleotide library provides a means to identify a desirable species that has a desirable property, such as a specific enzymatic activity serviceable for a commercial application.
- FIGURE 1 Exonuclease Activity.
- Figure 1 shows the activity ofthe enzyme exonuclease III. This is an exemplary enzyme that can be used to shuffle, assemble, reassemble, recombine, and/or concatenate polynucleotide building blocks. The asterisk indicates that the enzyme acts from the 3' direction towards the 5' direction ofthe polynucleotide substrate.
- FIGURE 2 Generation of A Nucleic Acid Building Block by Polymerase-Based Amplification.
- Figure 2 illustrates a method of generating a double-stranded nucleic acid building block with two overhangs using a polymerase-based amplification reaction (e.g., PCR).
- a polymerase-based amplification reaction e.g., PCR
- F 2 and Ri a first polymerase-based amplification reaction using a first set of primers, F 2 and Ri
- F 2 and Ri is used to generate a blunt-ended product
- Fi and R 2 is used to generate a blunt-ended product
- Product 2 is essentially identical to Product B.
- the product with the 3' overhangs is selected for by nuclease-based degradation ofthe other 3 products using a 3' acting exonuclease, such as exonuclease III.
- Alternate primers are shown in parenthesis to illustrate serviceable primers may overlap, and additionally that serviceable primers may be of different lengths, as shown.
- FIGURE 3 Unique Overhangs And Unique Couplings.
- Figure 3 illustrates the point that the number of unique overhangs of each size (e.g. the total number of unique overhangs composed of 1 or 2 or 3, etc. nucleotides) exceeds the number of unique couplings that can result from the use of all the unique overhangs of that size. For example, there are 4 unique 3' overhangs composed of a single nucleotide, and 4 unique 5' overhangs composed of a single nucleotide. Yet the total number of unique coup lings that can be made using all the 8 unique single-nucleotide 3' overhangs and single-nucleotide 5' overhangs is 4.
- FIGURE 4 Unique Overall Assembly Order Achieved by Sequentially Coupling the Building Blocks
- Figure 4 illustrates the fact that in order to assemble a total of "n" nucleic acid building blocks, "n-1" couplings are needed. Yet it is sometimes the case that the number of unique couplings available for use is fewer that the "n-1" value. Under these, and other, circumstances a stringent non-stochastic overall assembly order can still be achieved by performing the assembly process in sequential steps. In this example, 2 sequential steps are used to achieve a designed overall assembly order for five nucleic acid building blocks. In this illustration the designed overall assembly order for the five nucleic acid building blocks is: 5'-(#l-#2-#3-#4-#5)-3', where #1 represents building block number 1 , etc.
- FIGURE 5 Unique Couplings Available Using a Two-Nucleotide 3' Overhang.
- Figure 5 further illustrates the point that the number of unique overhangs of each size (here, e.g. the total number of unique overhangs composed of 2 nucleotides) exceeds the number of unique couplings that can result from the use of all the unique overhangs of that size. For example, there are 16 unique 3' overhangs composed of two nucleotides, and another 16 unique 5' overhangs composed of two nucleotides, for a total of 32 as shown. Yet the total number of couplings that are unique and not self-binding that can be made using all the 32 unique double-nucleotide 3' overhangs and double-nucleotide 5' overhangs is 12.
- FIGURE 6 Generation of an Exhaustive Set of Chimeric Combinations by Synthetic Ligation Reassembly.
- Figure 6 showcases the power of this invention in its ability to generate exhaustively and systematically all possible combinations ofthe nucleic acid building blocks designed in this example. Particularly large sets (or libraries) of progeny chimeric molecules can be generated. Because this method can be performed exhaustively and systematically, the method application can be repeated by choosing new demarcation points and with correspondingly newly designed nucleic acid building blocks, bypassing the burden of re-generating and re-screening previously examined and rejected molecular species. It is appreciated that, codon wobble can be used to advantage to increase the frequency of a demarcation point.
- a particular base can often be substituted into a nucleic acid building block without altering the amino acid encoded by progenitor codon (that is now altered codon) because of codon degeneracy.
- demarcation points are chosen upon alignment of 8 progenitor templates.
- Nucleic acid building blocks including their overhangs are then designed and synthesized.
- 18 nucleic acid building blocks are generated based on the sequence of each ofthe 8 progenitor templates, for a total of 144 nucleic acid building blocks (or double-stranded oligos). Performing the ligation synthesis procedure will then produce a library of progeny molecules comprised of yield of 8 18 (or over 1.8 x 10 16 ) chimeras.
- FIGURE 7 Synthetic genes from oligos:.
- double-stranded nucleic acid building blocks are designed by aligning a plurality of progenitor nucleic acid templates. Preferably these templates contain some homology and some heterology.
- the nucleic acids may encode related proteins, such as related enzymes, which relationship may be based on function or structure or both.
- Figure 7 shows the alignment of three polynucleotide progenitor templates and the selection of demarcation points (boxed) shared by all the progenitor molecules.
- the nucleic acid building blocks derived from each ofthe progenitor templates were chosen to be approximately 30 to 50 nucleotides in length.
- FIGURE 8 Nucleic acid building blocks for synthetic ligation gene reassembly.
- Figure 8 shows the nucleic acid building blocks from the example in Figure 7.
- the nucleic acid building blocks are shown here in generic cartoon form, with their compatible overhangs, including both 5' and 3' overhangs.
- the ligation synthesis procedure can produce a library of progeny molecules comprised of yield of 3 22 (or over 3.1 x 10 10 ) chimeras.
- FIGURE 9 Addition of Introns by Synthetic Ligation Reassembly.
- Figure 9 shows in generic cartoon form that an intron may be introduced into a chimeric progeny molecule by way of a nucleic acid building block. It is appreciated that introns often have consensus sequences at both termini in order to render them operational. It is also appreciated that, in addition to enabling gene splicing, introns may serve an additional pu ⁇ ose by providing sites of homology to other nucleic acids to enable homologous recombination. For this pu ⁇ ose, and potentially others, it may be sometimes desirable to generate a large nucleic acid building block for introducing an intron.
- such a specialized nucleic acid building block may also be generated by direct chemical synthesis of more than two single stranded oligos or by using a polymerase-based amplification reaction as shown in Figure 2.
- FIGURE 10 Ligation Reassembly Using Fewer Than All The Nucleotides Of An Overhang.
- Figure 10 shows that coupling can occur in a manner that does not make use of every nucleotide in a participating overhang. The coupling is particularly lively to survive (e.g. in a transformed host) if the coupling reinforced by treatment with a ligase enzyme to form what may be referred to as a "gap ligation" or a "gapped ligation". It is appreciated that, as shown, this type of coupling can contribute to generation of unwanted background product(s), but it can also be used advantageously increase the diversity ofthe progeny library generated by the designed ligation reassembly.
- FIGURE 11 Avoidance of unwanted self-ligation in palindromic couplings.
- certain overhangs are able to undergo self- coupling to form a palindromic coupling.
- a coupling is strengthened substantially if it is reinforced by treatment with a ligase enzyme.
- this invention provides that nucleic acid building blocks can be chemically made (or ordered) that lack a 5' phosphate group (or alternatively they can be remove - e.g. by treatment with a phosphatase enzyme such as a calf intestinal alkaline phosphatase (CIAP) - in order to prevent palindromic self-ligations in ligation reassembly processes.
- a phosphatase enzyme such as a calf intestinal alkaline phosphatase (CIAP)
- FIGURE 12 Pathway Engineering. It is a goal of this invention to provide ways of making new gene pathways using ligation reassembly, optionally with other directed evolution methods such as saturation mutagenesis.
- Figure 12 illustrates a preferred approach that may be taken to achieve this goal.
- naturally- occurring microbial gene pathways are linked more often than naturally-occurring eukaryotic (e.g. plant) gene pathways, which are sometime only partially linked.
- this invention provides that regulatory gene sequences (including promoters) can be introduced in the form of nucleic acid building blocks into progeny gene pathways generated by ligation reassembly processes.
- originally linked microbial gene pathways, as well as originally unlinked genes and gene pathways can be thus converted to acquire operability in plants and other eukaryotes.
- FIGURE 13 Avoidance of unwanted self-ligation in palindromic couplings.
- Figure 13 illustrates that another goal of this invention, in addition to the generation of novel gene pathways, is the subjection of gene pathways - both naturally occurring and man-made - to mutagenesis and selection in order to achieve improved progeny molecules using the instantly disclosed methods of directed evolution (including saturation mutagenesis and synthetic ligation reassembly).
- both microbial and plant pathways can be improved by directed evolution, and as shown, the directed evolution process can be performed both on genes prior to linking them into pathways, and on gene pathways themselves.
- FIGURE 14 Conversion of Microbial Pathways to Eukaryotic Pathways.
- this invention provides that microbial pathways can be converted to pathways operable in plants and other eukaryotic species by the introduction of regulatory sequences that function in those species.
- Preferred regulatory sequences include promoters, operators, and activator binding sites.
- a preferred method of achieving the introduction of such serviceable regulatory sequences is in the form of nucleic acid building blocks, particularly through the use of couplings in ligation reassembly processes. These couplings in Fig. 14 are marked with the letters A, B, C, D and F.
- FIGURE 15 Evolution of polypeptides by synthesizing (in vivo or in vitro) corresponding deduced polynucleotides and subjecting the deduced polynucleotides to directed evolution and expression screening subsequently expressed polypeptides.
- This invention provides that ligation reassembly and site saturation mutagenesis are each serviceable for introducing nucleotide substitutions as well as nucleotide deletions and nucleotide additions and combinations thereof.
- synthetic ligation reassembly can be performed on a plurality of starting templates as well as on a single template to rearrange the order ofthe nucleotide cassettes in a non-stochastic predetermined manner.
- nucleic acid building blocks when subjecting a plurality of starting templates to ligation reassembly, it is not necessary that the same number of nucleic acid building blocks be generated from each template (e.g. to participate to in each coupling). Thus for example if three templates are used, then a different number of nucleic acid building blocks may be generated corresponding to each template.
- FIGURE 16 In Silico Triage. This figure illustrates the grouping of potential products and the ranking ofthe groupings according to "structure-function" predictions, which steps are aspects of what is referred to herein as “triaging", and specifically “in silico triage” if performed using the aid of a computer.
- FIGURE 17 Solid Phase Ligation Reassembly
- FIGURE 18 Polynucleotide reassembly. Shown is an example of directed evolution, n different strains of a virus are used in this illustration, but the technique is applicable to any single nucleic acid as well as to any nucleic acid for which different strains, species, or gene families have homologous nucleic acids that have one or more nucleotide changes compared to other homologous nucleic acids.
- the different variant nucleic acids are experimentally generated, preferably non-stochastically, as described herein, and screened or selected to identify those variants that exhibit the desired property.
- the directed evolution method(s) and screening can be repeated one or more times to obtain further improvement.
- Panel B shows that successive rounds of directed evolution can produce progressively enhanced properties, and that the combination of individual beneficial mutations can lead to an enhance improvement compared to the improvement achieved by an individual beneficial mutation.
- FIGURES 19A-C An alignment of two CMV-derived nucleotide sequences from human and primate species. Shown here is an alignment of two CMN-derived nucleotide sequences of human and primate strains. This alignment is serviceable for performing non-stochastic polynucleotide reassembly. Nucleotide sequences shared by 2 sequences are in red lettering to illustrate preferred but non-limiting examples of reassembly points.
- FIGURE 20 An alignment of the IFN-gamma nucleotide sequences from human, cat, rodent species. Shown here is an alignment ofthe IFN-gama nucleotide sequences from human, cat, and rodent species. This alignment is serviceable for performing non-stochastic polynucleotide reassembly. Nucleotide sequences shared by 2 sequences are in blue lettering & nucleotide sequences shared by 3 sequences are in red lettering to illustrate preferred but non- limiting examples of reassembly points.
- agent is used herein to denote a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds (e.g., a VLSIPS peptide array, polynucleotide array, and/or combinatorial small molecule array), biological macromolecule, a bacteriophage peptide display library, a bacteriophage antibody (e.g., scFv) display library, a polysome peptide display library, or an extract made form biological materials such as bacteria, plants, fungi, or animal (particular mammalian) cells or tissues.
- a chemical compound e.g., a VLSIPS peptide array, polynucleotide array, and/or combinatorial small molecule array
- biological macromolecule e.g., a VLSIPS peptide array, polynucleotide array, and/or combinatorial small molecule array
- bacteriophage peptide display library e.g., a bacteriophage antibody (
- Agents are evaluated for potential activity as anti- neoplasties, anti-inflammatories or apoptosis modulators by inclusion in screening assays described hereinbelow.
- Agents are evaluated for potential activity as specific protein interaction inhibitors (i.e., an agent which selectively inhibits a binding interaction between two predetermined polypeptides but which doe snot substantially interfere with cell viability) by inclusion in screening assays described hereinbelow.
- An "ambiguous base requirement" in a restriction site refers to a nucleotide base requirement that is not specified to the fullest extent, i.e. that is not a specific base (such as, in a non-limiting exemplification, a specific base selected from A, C, G, and T), but rather may be any one of at least two or more bases.
- amino acid refers to any organic compound that contains an amino group (-NH 2 ) and a carboxyl group (-COOH); preferably either as free groups or alternatively after condensation as part of peptide bonds.
- the "twenty naturally encoded polypeptide-forming alpha-amino acids” are understood in the art and refer to: alanine (ala or A), arginine (arg or R), asparagine (asn or N), aspartic acid (asp or D), cysteine (cys or C), gluatamic acid (glu or E), glutamine (gin or Q), glycine (gly or G), histidine (his or H), isoleucine (ile or I), leucine (leu or L), lysine (lys or K), methionine (met or M), phenylalanine (phe or F), proline (pro or P), serine (ser or S), threonine (thr or T), tryptophan (t ⁇ or W), tyrosine (tyr or Y), and valine (val or V).
- alanine ala or A
- arginine arg or R
- asparagine asparag
- amplification means that the number of copies of a polynucleotide is increased.
- antibody refers to intact immunoglobulin molecules, as well as fragments of immunoglobulin molecules, such as Fab, Fab 1 , (Fab') 2 , Fv, and SCA fragments, that are capable of binding to an epitope of an antigen.
- Fab fragments of immunoglobulin molecules
- Fab' fragments of immunoglobulin molecules
- Fv fragments of immunoglobulin molecules
- SCA fragments of immunoglobulin molecules
- These antibody fragments which retain some ability to selectively bind to an antigen (e.g., a polypeptide antigen) ofthe antibody from which they are derived, can be made using well known methods in the art (see, e.g., Harlow and Lane, supra), and are described further, as follows.
- An Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain.
- An Fab' fragment of an antibody molecule can be obtained by treating a whole antibody molecule with pepsin, followed by reduction, to yield a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner.
- An (Fab') fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction.
- a (Fab') 2 fragment is a dimer of two Fab' fragments, held together by two disulfide bonds.
- An Fv fragment is defined as a genetically engineered fragment containing the variable region of a light chain and the variable region of a heavy chain expressed as two chains.
- SCA single chain antibody
- AME Applied Molecular Evolution
- a molecule that has a "chimeric property" is a molecule that is: 1) in part homologous and in part heterologous to a first reference molecule; while 2) at the same time being in part homologous and in part heterologous to a second reference molecule; without 3) precluding the possibility of being at the same time in part homologous and in part heterologous to still one or more additional reference molecules.
- a chimeric molecule may be prepared by assemblying a reassortment of partial molecular sequences.
- a chimeric polynucleotide molecule may be prepared by synthesizing the chimeric polynucleotide using plurality of molecular templates, such that the resultant chimeric polynucleotide has properties of a plurality of templates.
- cognate refers to a gene sequence that is evolutionarily and functionally related between species.
- human CD4 gene is the cognate gene to the mouse 3d4 gene, since the sequences and structures of these two genes indicate that they are highly homologous and both genes encode a protein which functions in signaling T cell activation through MHC class II-restricted antigen recognition.
- a “comparison window,” as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion ofthe polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith (Smith and Waterman, Adv Appl Math, 1981; Smith and Waterman, J Teor Biol, 1981; Smith and Waterman, J Mol Biol, 1981; Smith et al, JMolEvol, 1981), by the homology alignment algorithm of Needleman (Needleman and Wuncsch, 1970), by the search of similarity method of Pearson (Pearson and Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.
- Smith Smith and Waterman, Adv Appl Math, 1981; Smith and Waterman, J Teor Biol, 1981; Smith and Waterman, J Mol Biol, 1981; Smith et al,
- complementarity-determining region and "CDR” refer to the art-recognized term as exemplified by the Kabat and Chothia CDR definitions also generally known as supervariable regions or hypervariable loops (Chothia and Lesk, 1987; Clothia et al, 1989; Kabat et al, 1987; and Tramontano et al, 1990).
- Variable region domains typically comprise the amino-terminal approximately 105-115 amino acids of a naturally-occurring immunoglobulin chain (e.g., amino acids 1-110), although variable domains somewhat shorter or longer are also suitable for forming single-chain antibodies.
- Constant amino acid substitutions refer to the interchangeability of residues having similar side chains.
- a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine
- a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine
- a group of amino acids having amide-containing side chains is asparagine and glutamine
- a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan
- a group of amino acids having basic side chains is lysine, arginine, and histidine
- a group of amino acids having sulfur-containing side chains is cysteine and methionine.
- Preferred conservative amino acids substitution groups are : valine- leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.
- a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence.
- the term “complementary to” is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence.
- the nucleotide sequence "TATAC” corresponds to a reference “TATAC” and is complementary to a reference sequence “GTATA.”
- the term “degrading effective” amount refers to the amount of enzyme which is required to process at least 50% ofthe substrate, as compared to substrate not contacted with the enzyme. Preferably, at least 80% ofthe substrate is degraded.
- defined sequence framework refers to a set of defined sequences that are selected on a non-random basis, generally on the basis of experimental data or structural data; for example, a defined sequence framework may comprise a set of amino acid sequences that are predicted to form a ⁇ -sheet structure or may comprise a leucine zipper heptad repeat motif, a zinc-finger domain, among other variations.
- a “defined sequence kernal” is a set of sequences which encompass a limited scope of variability.
- a completely random 10-mer sequence of the 20 conventional amino acids can be any of (20) 10 sequences
- a pseudorandom 10-mer sequence ofthe 20 conventional amino acids can be any of (20) ' sequences but will exhibit a bias for certain residues at certain positions and/or overall
- (3) a defined sequence kernal is a subset of sequences if each residue position was allowed to be any ofthe allowable 20 conventional amino acids (and/or allowable unconventional amino/imino acids).
- a defined sequence kernal generally comprises variant and invariant residue positions and/or comprises variant residue positions which can comprise a residue selected from a defined subset of amino acid residues), and the like, either segmentally or over the entire length ofthe individual selected library member sequence.
- sequence kernels can refer to either amino acid sequences or polynucleotide sequences.
- sequences (NNK) ⁇ o and (NNM) ⁇ o wherein N represents A, T, G, or C; K represents G or T; and M represents A or C, are defined sequence kernels.
- “Digestion” of DNA refers to catalytic cleavage ofthe DNA with a restriction enzyme that acts only at certain sequences in the DNA.
- the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
- For analytical pu ⁇ oses typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
- Directional ligation refers to a ligation in which a 5' end and a 3' end of a polynuclotide are different enough to specify a preferred ligation orientation.
- an otherwise untreated and undigested PCR product that has two blunt ends will typically not have a preferred ligation orientation when ligated into a cloning vector digested to produce blunt ends in its multiple cloning site; thus, directional ligation will typically not be displayed under these circumstances.
- directional ligation will typically displayed when a digested PCR product having a 5' EcoR I-treated end and a 3' BamH I-is ligated into a cloning vector that has a multiple cloning site digested with EcoR I and BamH I.
- DNA shuffling is used herein to indicate recombination between substantially homologous but non-identical sequences, in some embodiments DNA shuffling may involve crossover via non-homologous recombination, such as via cer/lox and/or flp/frt systems and the like.
- epitope refers to an antigenic determinant on an antigen, such as a phytase polypeptide, to which the paratope of an antibody, such as an phytase-specific antibody, binds.
- Antigenic determinants usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
- epitopope refers to that portion of an antigen or other macromolecule capable of forming a binding interaction that interacts with the variable region binding body of an antibody. Typically, such binding interaction is manifested as an intermolecular contact with one or more amino acid residues of a CDR.
- fragment when referring to a reference polypeptide comprise a polypeptide which retains at least one biological function or activity that is at least essentially same as that ofthe reference polypeptide. Furthermore, the terms “fragment”, “derivative” or “analog” are exemplified by a "pro-form” molecule, such as a low activity proprotein that can be modified by cleavage to produce a mature enzyme with significantly higher activity.
- a method for producing from a template polypeptide a set of progeny polypeptides in which a "full range of single amino acid substitutions" is represented at each amino acid position.
- “full range of single amino acid substitutions” is in reference to the naturally encoded 20 naturally encoded polypeptide-forming alpha-amino acids, as described herein.
- gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
- Genetic instability refers to the natural tendency of highly repetitive sequences to be lost through a process of reductive events generally involving sequence simplification through the loss of repeated sequences. Deletions tend to involve the loss of one copy of a repeat and everything between the repeats.
- heterologous means that one single-stranded nucleic acid sequence is unable to hybridize to another single-stranded nucleic acid sequence or its complement.
- areas of hetero logy means that areas of polynucleotides or polynucleotides have areas or regions within their sequence which are unable to hybridize to another nucleic acid or polynucleotide. Such regions or areas are for example areas of mutations.
- homologous or “homeologous” means that one single-stranded nucleic acid nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence.
- the degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentrations as discussed later.
- the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp.
- An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, also called CDR's.
- the extent ofthe framework region and CDR's have been precisely defined; see “Sequences of Proteins of Immunological Interest” (Kabat et al, 1987).
- the sequences ofthe framework regions of different light or heavy chains are relatively conserved within a specie.
- a "human framework region” is a framework region that is substantially identical (about 85 or more, usually 90-95 or more) to the framework region of a naturally occurring human immunoglobulin.
- the framework region of an antibody that is the combined framework regions ofthe constituent light and heavy chains, serves to position and align the CDR's.
- the CDR's are primarily responsible for binding to an epitope of an antigen.
- identity means that two nucleic acid sequences have the same sequence or a complementary sequence.
- areas of identity means that regions or areas of a polynucleotide or the overall polynucleotide are identical or complementary to areas of another polynucleotide or the polynucleotide.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or enzyme present in a living animal is not isolated, but the same polynucleotide or enzyme, separated from some or all ofthe coexisting materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or enzymes could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
- isolated nucleic acid is meant a nucleic acid, e.g., a DNA or RNA molecule, that is not immediately contiguous with the 5' and 3' flanking sequences with which it normally is immediately contiguous when present in the naturally occurring genome ofthe organism from which it is derived.
- the term thus describes, for example, a nucleic acid that is inco ⁇ orated into a vector, such as a plasmid or viral vector; a nucleic acid that is inco ⁇ orated into the genome of a heterologous cell (or the genome of a homologous cell, but at a site different from that at which it naturally occurs); and a nucleic acid that exists as a separate molecule, e.g., a DNA fragment produced by PCR amplification or restriction enzyme digestion, or an RNA molecule produced by in vitro transcription.
- the term also describes a recombinant nucleic acid that forms part of a hybrid gene encoding additional polypeptide sequences that can be used, for example, in the production of a fusion protein.
- ligand refers to a molecule, such as a random peptide or variable segment sequence, that is recognized by a particular receptor.
- a molecule or macromolecular complex
- the binding partner having a smaller molecular weight is referred to as the ligand and the binding partner having a greater molecular weight is referred to as a receptor.
- “Ligation” refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Sambrook et al, 1982, p. 146;
- ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts ofthe DNA fragments to be ligated.
- ligase T4 DNA ligase
- linker refers to a molecule or group of molecules that connects two molecules, such as a DNA binding protein and a random peptide, and serves to place the two molecules in a preferred configuration, e.g., so that the random peptide can bind to a receptor with minimal steric hindrance from the DNA binding protein.
- a "molecular property to be evolved” includes reference to molecules comprised of a polynucleotide sequence, molecules comprised of a polypeptide sequence, and molecules comprised in part of a polynucleotide sequence and in part of a polypeptide sequence.
- Particularly relevant - but by no means limiting - examples of molecular properties to be evolved include enzymatic activities at specified conditions, such as related to temperature; salinity; pressure; pH; and concentration of glycerol, DMSO, detergent, &/or any other molecular species with which contact is made in a reaction environment.
- Additional particularly relevant - but by no means limiting - examples of molecular properties to be evolved include stabilities - e.g. the amount of a residual molecular property that is present after a specified exposure time to a specified environment, such as may be encountered during storage.
- mutants includes changes in the sequence of a wild-type or parental nucleic acid sequence or changes in the sequence of a peptide. Such mutations may be point mutations such as transitions or transversions. The mutations may be deletions, insertions or duplications. A mutation can also be a "chimerization", which is exemplified in a progeny molecule that is generated to contain part or all of a sequence of one parental molecule as well as part or all of a sequence of at least one other parental molecule. This invention provides for both chimeric polynucleotides and chimeric polypeptides.
- N,N,G/T nucleotide sequence represents 32 possible triplets, where "N” can be A, C, G or T.
- naturally-occurring refers to the fact that an object can be found in nature.
- a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
- naturally occurring refers to an object as present in a non-pathological (un-diseased) individual, such as would be typical for the species.
- nucleic acid molecule is comprised of at least one base or one base pair, depending on whether it is single-stranded or double-stranded, respectively.
- a nucleic acid molecule may belong exclusively or chimerically to any group of nucleotide-containing molecules, as exemplified by, but not limited to, the following groups of nucleic acid molecules: RNA, DNA, genomic nucleic acids, non-genomic nucleic acids, naturally occurring and not naturally occurring nucleic acids, and synthetic nucleic acids. This includes, by way of non- limiting example, nucleic acids associated with any organelle, such as the mitochondria, ribosomal RNA, and nucleic acid molecules comprised chimerically of one or more components that are not naturally occurring along with naturally occurring components.
- nucleic acid molecule may contain in part one or more non- nucleotide-based components as exemplified by, but not limited to, amino acids and sugars.
- a ribozyme that is in part nucleotide-based and in part protein-based is considered a "nucleic acid molecule”.
- nucleic acid molecule that is labeled with a detectable moiety, such as a radioactive or alternatively a non- radioactive label, is likewise considered a "nucleic acid molecule”.
- nucleic acid sequence coding for or a "DNA coding sequence of or a “nucleotide sequence encoding” a particular enzyme - as well as other synonymous terms - refer to a DNA sequence which is transcribed and translated into an enzyme when placed under the control of appropriate regulatory sequences.
- a "promotor sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The promoter is part ofthe DNA sequence. This sequence region has a start codon at its 3' terminus. The promoter sequence does include the minimum number of bases where elements necessary to initiate transcription at levels detectable above background.
- RNA polymerase binds the sequence and transcription is initiated at the start codon (3' terminus with a promoter)
- transcription proceeds downstream in the 3' direction.
- a transcription initiation site (conveniently defined by mapping with nuclease SI) as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
- nucleic acid encoding an enzyme (protein) or “DNA encoding an enzyme (protein)” or “polynucleotide encoding an enzyme (protein)” and other synonymous terms encompasses a polynucleotide which includes only coding sequence for the enzyme as well as a polynucleotide which includes additional coding and/or non-coding sequence.
- a "specific nucleic acid molecule species” is defined by its chemical structure, as exemplified by, but not limited to, its primary sequence.
- a specific "nucleic acid molecule species” is defined by a function ofthe nucleic acid species or by a function of a product derived from the nucleic acid species.
- a “specific nucleic acid molecule species” may be defined by one or more activities or properties attributable to it, including activities or properties attributable its expressed product.
- the instant definition of "assembling a working nucleic acid sample into a nucleic acid library” includes the process of inco ⁇ orating a nucleic acid sample into a vector-based collection, such as by ligation into a vector and transformation of a host. A description of relevant vectors, hosts, and other reagents as well as specific non-limiting examples thereof are provided hereinafter.
- the instant definition of "assembling a working nucleic acid sample into a nucleic acid library” also includes the process of inco ⁇ orating a nucleic acid sample into a non-vector-based collection, such as by ligation to adaptors.
- the adaptors can anneal to PCR primers to facilitate amplification by PCR.
- a "nucleic acid library” is comprised of a vector-based collection of one or more nucleic acid molecules.
- a "nucleic acid library” is comprised of a non- vector- based collection of nucleic acid molecules.
- a "nucleic acid library” is comprised of a combined collection of nucleic acid molecules that is in part vector-based and in part non-vector-based.
- the collection of molecules comprising a library is searchable and separable according to individual nucleic acid molecule species.
- the present invention provides a "nucleic acid construct" or alternatively a
- nucleotide construct or alternatively a “DNA construct”.
- construct is used herein to describe a molecule, such as a polynucleotide (e.g., a phytase polynucleotide) may optionally be chemically bonded to one or more additional molecular moieties, such as a vector, or parts of a vector.
- a nucleotide construct is exemplified by a DNA expression DNA expression constructs suitable for the transformation of a host cell.
- oligonucleotide refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides may or may not have a 5' phosphate. Those that do not will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
- a "32-fold degenerate oligonucleotide that is comprised of, in series, at least a first homologous sequence, a degenerate N,N,G/T sequence, and a second homologous sequence" is mentioned.
- homologous is in reference to homology between the oligo and the parental polynucleotide that is subjected to the polymerase- based amplification.
- operably linked refers to a linkage of polynucleotide elements in a functional relationship.
- a nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription ofthe coding sequence.
- Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
- a coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences.
- the coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
- parental polynucleotide set is a set comprised of one or more distinct polynucleotide species. Usually this term fis used in reference to a progeny polynucleotide set which is preferably obtained by mutagenization ofthe parental set, in which case the terms “parental”, “starting” and “template” are used interchangeably.
- physiological conditions refers to temperature, pH, ionic strength, viscosity, and like biochemical parameters which are compatible with a viable organism, and/or which typically exist intracellularly in a viable cultured yeast cell or mammalian cell.
- intracellular conditions in a yeast cell grown under typical laboratory culture conditions are physiological conditions.
- Suitable in vitro reaction conditions for in vitro transcription cocktails are generally physiological conditions.
- in vitro physiological conditions comprise 50- 200 mM NaCI or KCl, pH 6.5-8.5, 20-45°C and 0.001-10 mM divalent cation (e.g., Mg**, Ca**); preferably about 150 mM NaCI or KCl, pH 7.2-7.6, 5 mM divalent cation, and often include 0.01-1.0 percent nonspecific protein (e.g., BSA).
- a non- ionic detergent can often be present, usually at about 0.001 to 2%, typically 0.05-0.2% (v/v).
- Particular aqueous conditions may be selected by the practitioner according to conventional methods.
- buffered aqueous conditions may be applicable: 10-250 mM NaCI, 5- 50 mM Tris HC1, pH 5-8, with optional addition of divalent cation(s) and/or metal chelators and/or non-ionic detergents and/or membrane fractions and/or anti-foam agents and/or scintillants.
- population means a collection of components such as polynucleotides, portions or polynucleotides or proteins.
- a molecule having a "pro-form” refers to a molecule that undergoes any combination of one or more covalent and noncovalent chemical modifications (e.g. glycosylation, proteolytic cleavage, dimerization or oligomerization, temperature- induced or pH-induced conformational change, association with a co-factor, etc.) en route to attain a more mature molecular form having a property difference (e.g. an increase in activity) in comparison with the reference pro-form molecule.
- covalent and noncovalent chemical modifications e.g. glycosylation, proteolytic cleavage, dimerization or oligomerization, temperature- induced or pH-induced conformational change, association with a co-factor, etc.
- a property difference e.g. an increase in activity
- the referemce precursor molecule may be termed a "pre-pro-form" molecule.
- the term "pseudorandom” refers to a set of sequences that have limited variability, such that, for example, the degree of residue variability at another position, but any pseudorandom position is allowed some degree of residue variation, however circumscribed.
- “Quasi-repeated units”, as used herein, refers to the repeats to be re-assorted and are by definition not identical. Indeed the method is proposed not only for practically identical encoding units produced by mutagenesis ofthe identical starting sequence, but also the reassortment of similar or related sequences which may diverge significantly in some regions. Nevertheless, if the sequences contain sufficient homologies to be reassorted by this approach, they can be referred to as "quasi- repeated" units.
- random peptide library refers to a set of polynucleotide sequences that encodes a set of random peptides, and to the set of random peptides encoded by those polynucleotide sequences, as well as the fusion proteins contain those random peptides.
- random peptide sequence refers to an amino acid sequence composed of two or more amino acid monomers and constructed by a stochastic or random process.
- a random peptide can include framework or scaffolding motifs, which may comprise invariant sequences.
- receptor refers to a molecule that has an affinity for a given ligand. Receptors can be naturally occurring or synthetic molecules. Receptors can be employed in an unaltered state or as aggregates with other species. Receptors can be attached, covalently or non-covalently, to a binding member, either directly or via a specific binding substance. Examples of receptors include, but are not limited to, antibodies, including monoclonal antibodies and antisera reactive with specific antigenic determinants (such as on viruses, cells, or other materials), cell membrane receptors, complex carbohydrates and glycoproteins, enzymes, and hormone receptors.
- Recombinant enzymes refer to enzymes produced by recombinant DNA techniques, i.e., produced from cells transformed by an exogenous DNA construct encoding the desired enzyme.
- Synthetic enzymes are those prepared by chemical synthesis.
- related polynucleotides means that regions or areas ofthe polynucleotides are identical and regions or areas ofthe polynucleotides are heterologous.
- Reductive reassortment refers to the increase in molecular diversity that is accrued through deletion (and/or insertion) events that are mediated by repeated sequences.
- sequence relationships between two or more polynucleotides are used to describe the sequence relationships between two or more polynucleotides: “reference sequence,” “comparison window,” “sequence identity,” “percentage of sequence identity,” and “substantial identity.”
- a "reference sequence” is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
- two polynucleotides may each (1) comprise a sequence (i.e., a portion ofthe complete polynucleotide sequence) that is similar between the two polynucleotides and (2) may further comprise a sequence that is divergent between the two polynucleotides
- sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences ofthe two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
- Repetitive Index (RI) is the average number of copies of the quasi-repeated units contained in the cloning vector.
- restriction site refers to a recognition sequence that is necessary for the manifestation ofthe action of a restriction enzyme, and includes a site of catalytic cleavage. It is appreciated that a site of cleavage may or may not be contained within a portion of a restriction site that comprises a low ambiguity sequence (i.e. a sequence containing the principal determinant ofthe frequency of occurrence ofthe restriction site). Thus, in many cases, relevant restriction sites contain only a low ambiguity sequence with an internal cleavage site (e.g.
- relevant restriction enzymes e.g. the Eco57 I site or CTGAAG( 16/14)
- contain a low ambiguity sequence e.g. the CTGAAG sequence in the Eco57 I site
- an external cleavage site e.g. in the N ⁇ 6 portion ofthe Eco57 I site.
- a "selectable polynucleotide” is comprised of a 5' terminal region (or end region), an intermediate region (i.e. an internal or central region), and a 3' terminal region (or end region).
- a 5' terminal region is a region that is located towards a 5' polynucleotide terminus (or a 5' polynucleotide end); thus it is either partially or entirely in a 5' half of a polynucleotide.
- a 3' terminal region is a region that is located towards a 3' polynucleotide terminus (or a 3 ' polynucleotide end); thus it is either partially or entirely in a 3' half of a polynucleotide.
- sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
- percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
- substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having at least 80 percent sequence identity, preferably at least 85 percent identity, often 90 to 95 percent sequence identity, and most commonly at least 99 percent sequence identity as compared to a reference sequence of a comparison window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less ofthe reference sequence over the window of comparison.
- similarity between two enzymes is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one enzyme to the sequence of a second enzyme. Similarity may be determined by procedures which are well-known in the art, for example, a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information).
- single-chain antibody refers to a polypeptide comprising a V H domain and a V domain in polypeptide linkage, generally liked via a spacer peptide (e.g., [Gly-Gly-Gly-Gly-Ser] x ), and which may comprise additional amino acid sequences at the amino- and/or carboxy- termini.
- a single- chain antibody may comprise a tether segment for linking to the encoding polynucleotide.
- a scFv is a single-chain antibody.
- Single-chain antibodies are generally proteins consisting of one or more polypeptide segments of at least 10 contiguous amino substantially encoded by genes ofthe immunoglobulin superfamily (e.g., see Williams and Barclay, 1989, pp. 361-368, which is inco ⁇ orated herein by reference), most frequently encoded by a rodent, non-human primate, avian, porcine bovine, ovine, goat, or human heavy chain or light chain gene sequence.
- a functional single-chain antibody generally contains a sufficient portion of an immunoglobulin superfamily gene product so as to retain the property of binding to a specific target molecule, typically a receptor or antigen (epitope).
- the members of a pair of molecules are said to "specifically bind" to each other if they bind to each other with greater affinity than to other, non-specific molecules.
- an antibody raised against an antigen to which it binds more efficiently than to a nonspecific protein can be described as specifically binding to the antigen.
- a nucleic acid probe can be described as specifically binding to a nucleic acid target if it forms a specific duplex with the target by base pairing interactions (see above).)
- Specific hybridization is defined herein as the formation of hybrids between a first polynucleotide and a second polynucleotide (e.g., a polynucleotide having a distinct but substantially identical sequence to the first polynucleotide), wherein substantially unrelated polynucleotide sequences do not form hybrids in the mixture.
- polynucleotide means a polynucleotide having certain end points and having a certain nucleic acid sequence.
- Two polynucleotides wherein one polynucleotide has the identical sequence as a portion ofthe second polynucleotide but different ends comprises two different specific polynucleotides.
- “Stringent hybridization conditions” means hybridization will occur only if there is at least 90% identity, preferably at least 95% identity and most preferably at least 97% identity between the sequences. See Sambrook et al, 1989, which is hereby inco ⁇ orated by reference in its entirety. Also included in the invention are polypeptides having sequences that are
- a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence only by conservative amino acid substitutions, for example, substitutions of one amino acid for another ofthe same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine).
- substitutions of one amino acid for another ofthe same class e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine.
- substantially identical amino acid sequence is a sequence that differs from a reference sequence or by one or more non-conservative substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site the molecule, and provided that the polypeptide essentially retains its behavioural properties.
- one or more amino acids can be deleted from a phytase polypeptide, resulting in modification ofthe structure ofthe polypeptide, without significantly altering its biological activity.
- amino- or carboxyl-terminal amino acids that are not required for phytase biological activity can be removed. Such modifications can result in the development of smaller active phytase polypeptides.
- the present invention provides a "substantially pure enzyme".
- the term "substantially pure enzyme” is used herein to describe a molecule, such as a polypeptide (e.g., a phytase polypeptide, or a fragment thereof) that is substantially free of other proteins, lipids, carbohydrates, nucleic acids, and other biological materials with which it is naturally associated.
- a substantially pure molecule, such as a polypeptide can be at least 60%, by dry weight, the molecule of interest.
- the purity ofthe polypeptides can be determined using standard methods including, e.g., polyacrylamide gel electrophoresis (e.g., SDS-PAGE), column chromatography (e.g., high performance liquid chromatography (HPLC)), and amino- te ⁇ ninal amino acid sequence analysis.
- polyacrylamide gel electrophoresis e.g., SDS-PAGE
- column chromatography e.g., high performance liquid chromatography (HPLC)
- amino- te ⁇ ninal amino acid sequence analysis e.g., amino- te ⁇ ninal amino acid sequence analysis.
- substantially pure means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual macromolecular species in the composition), and preferably substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 to 90 percent of all macromolecular species present in the composition. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules ( ⁇ 500 Daltons), and elemental ion species are not considered macromolecular species.
- variable segment refers to a portion of a nascent peptide which comprises a random, pseudorandom, or defined kernal sequence.
- a variable segment refers to a portion of a nascent peptide which comprises a random pseudorandom, or defined kernal sequence.
- a variable segment can comprise both variant and invariant residue positions, and the degree of residue variation at a variant residue position may be limited: both options are selected at the discretion ofthe practitioner.
- variable segments are about 5 to 20 amino acid residues in length (e.g., 8 to 10), although variable segments may be longer and may comprise antibody portions or receptor proteins, such as an antibody fragment, a nucleic acid binding protein, a receptor protein, and the like.
- wild-type means that the polynucleotide does not comprise any mutations.
- a wild type protein means that the protein will be active at a level of activity found in nature and will comprise the amino acid sequence found in nature. -51-
- working is simply a sample with which one is working.
- a “working molecule” for example is a molecule with which one is working.
- the invention described herein is directed to the use of repeated cycles of reductive reassortment, recombination and selection which allow for the directed molecular evolution of highly complex linear sequences, such as DNA, RNA or proteins thorough recombination.
- In vivo shuffling of molecules can be performed utilizing the natural property of cells to recombine multimers. While recombination in vivo has provided the major natural route to molecular diversity, genetic recombination remains a relatively complex process that involves 1) the recognition of homologies; 2) strand cleavage, strand invasion, and metabolic steps leading to the production of recombinant chiasma; and finally 3) the resolution of chiasma into discrete recombined molecules. The formation ofthe chiasma requires the recognition of homologous sequences.
- the invention relates to a method for producing a hybrid polynucleotide from at least a first polynucleotide and a second polynucleotide.
- the present invention can be used to produce a hybrid polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell.
- the regions of partial sequence homology promote processes which result in sequence reorganization producing a hybrid polynucleotide.
- hybrid polynucleotide is any nucleotide sequence which results from the method ofthe present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes which utilize repeated sequences to alter a nucleotide sequence within a DNA molecule.
- the invention provides a means for generating hybrid polynucleotides which may encode biologically active hybrid polypeptides.
- the original polynucleotides encode biologically active polypeptides.
- the method ofthe invention produces new hybrid polypeptides by utilizing cellular processes which integrate the sequence ofthe original polynucleotides such that the resulting hybrid polynucleotide encodes a polypeptide demonstrating activities derived from the original biologically active polypeptides.
- the original polynucleotides may encode a particular enzyme from different microorganisms.
- An enzyme encoded by a first polynucleotide from one organism may, for example, function effectively under a particular environmental condition, e.g. high salinity.
- An enzyme encoded by a second polynucleotide from a different organism may function effectively under a different environmental condition, such as extremely high temperatures.
- a hybrid polynucleotide containing sequences from the first and second original polynucleotides may encode an enzyme which exhibits characteristics of both enzymes encoded by the original polynucleotides.
- the enzyme encoded by the hybrid polynucleotide may function effectively under environmental conditions shared by each ofthe enzymes encoded by the first and second polynucleotides, e.g., high salinity and extreme temperatures.
- Enzymes encoded by the original polynucleotides ofthe invention include, but are not limited to; oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.
- a hybrid polypeptide resulting from the method ofthe invention may exhibit specialized enzyme activity not displayed in the original enzymes. For example, following recombination and/or reductive reassortment of polynucleotides encoding hydrolase activities, the resulting hybrid polypeptide encoded by a hybrid polynucleotide can be screened for specialized hydrolase activities obtained from each ofthe original enzymes, i.e. the type of bond on which the hydrolase acts and the temperature at which the hydrolase functions.
- the hydrolase may be screened to ascertain those chemical functionalities which distinguish the hybrid hydrolase from the original hydrolyases, such as: (a) amide (peptide bonds), i.e. proteases; (b) ester bonds, i.e. esterases and lipases; (c) acetals, i.e., glycosidases and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions.
- amide (peptide bonds), i.e. proteases i.e. proteases
- ester bonds i.e. esterases and lipases
- acetals i.e., glycosidases and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions.
- Sources ofthe original polynucleotides may be isolated from individual organisms ("isolates”), collections of organisms that have been grown in defined media (“enrichment cultures”), or, most preferably, uncultivated organisms ("environmental samples”).
- isolated cultures collections of organisms that have been grown in defined media
- environment cultures or, most preferably, uncultivated organisms
- the use of a culture-independent approach to derive polynucleotides encoding novel bioactivities from environmental samples is most preferable since it allows one to access untapped resources of biodiversity.
- Environmental libraries are generated from environmental samples and represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA is initially extracted directly from environmental samples, the libraries are not limited to the small fraction of prokaryotes that can be grown in pure culture. Additionally, a normalization ofthe environmental DNA present in these samples could allow more equal representation ofthe DNA from all ofthe species present in the original sample. This can dramatically increase the efficiency of finding interesting genes from minor constituents ofthe sample which may be under-represented by several orders of magnitude compared to the dominant species.
- gene libraries generated from one or more uncultivated microorganisms are screened for an activity of interest.
- Potential pathways encoding bioactive molecules of interest are first captured in prokaryotic cells in the form of gene expression libraries.
- Polynucleotides encoding activities of interest are isolated from such libraries and introduced into a host cell. The host cell is grown under conditions which promote recombination and/or reductive reassortment creating potentially active biomolecules with novel or enhanced activities.
- the microorganisms from which the polynucleotide may be prepared include prokaryotic microorganisms, such as Eubacteria and Archaebacteria, and lower eukaryotic microorganisms such as fungi, some algae and protozoa.
- Polynucleotides may be isolated from environmental samples in which case the nucleic acid may be recovered without culturing of an organism or recovered from one or more cultured organisms.
- such microorganisms may be extremophiles, such as hyperthermophiles, psychrophiles, psychrotrophs, halophiles, barophiles and acidophiles.
- Polynucleotides encoding enzymes isolated from extremophilic microorganisms are particularly preferred. Such enzymes may function at temperatures above 100°C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0°C in arctic waters, in the saturated salt environment ofthe Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge. For example, several esterases and lipases cloned and expressed from extremophilic organisms show high activity throughout a wide range of temperatures and pHs.
- Polynucleotides selected and isolated as hereinabove described are introduced into a suitable host cell.
- a suitable host cell is any cell which is capable of promoting recombination and/or reductive reassortment.
- the selected polynucleotides are preferably already in a vector which includes appropriate control sequences.
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or preferably, the host cell can be a prokaryotic cell, such as a bacterial cell.
- Introduction ofthe construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis et al, 1986).
- bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium
- fungal cells such as yeast
- insect cells such as Drosophila S2 and Spodoptera Sf9
- animal cells such as CHO, COS or Bowes melanoma
- adenoviruses and plant cells.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described in "SV40- transformed simian cells support the replication of early SN40 mutants" (Gluzman, 1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. D ⁇ A sequences derived from the SN40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
- Host cells containing the polynucleotides of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes.
- the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
- the clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity.
- the method ofthe present invention can be used to generate novel polynucleotides encoding biochemical pathways from one or more operons or gene clusters or portions thereof.
- genes are clustered, in structures referred to as "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription ofthe entire cluster.
- a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function.
- An example of a biochemical pathway encoded by gene clusters are polyketides.
- Polyketides are molecules which are an extremely rich source of bioactivities, including antibiotics (such as tetracyclines and erythromycin), anti-cancer agents (daunomycin), immunosuppressants (FK506 and rapamycin), and veterinary products (monensin). Many polyketides (produced by polyketide synthases) are valuable as therapeutic agents. Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of an enormous variety of carbon chains differing in length and patterns of functionality and cyclization. Polyketide synthase genes fall into gene clusters and at least one type (designated type I) of polyketide synthases have large size genes and enzymes, complicating genetic manipulation and in vitro studies of these genes/proteins.
- the ability to select and combine desired components from a library of polyketides, or fragments thereof, and postpolyketide biosynthesis genes for generation of novel polyketides for study is appealing.
- the method ofthe present invention makes it possible to facilitate the production of novel polyketide synthases through intermolecular recombination.
- gene cluster DNA can be isolated from different organisms and ligated into vectors, particularly vectors containing expression regulatory sequences which can control and regulate the production of a detectable protein or protein- related array activity from the ligated gene clusters.
- vectors which have an exceptionally large capacity for exogenous DNA introduction are particularly appropriate for use with such gene clusters and are described by way of example herein to include the f-factor (or fertility factor) of E. coli.
- This f-factor of E. coli is a plasmid which affect high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large DNA fragments, such as gene clusters from mixed microbial samples.
- two or more vectors containing different polyketide synthase gene clusters can be introduced into a suitable host cell. Regions of partial sequence homology shared by the gene clusters will promote processes which result in sequence reorganization resulting in a hybrid gene cluster. The novel hybrid gene cluster can then be screened for enhanced activities not found in the original gene clusters.
- the present invention relates to a method for producing a biologically active hybrid polypeptide and screening such a polypeptide for enhanced activity by:
- expression vectors which may be used there may be mentioned viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g. vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), Pl -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, aspergillus and yeast).
- the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide.
- Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences.
- suitable vectors are known to those of skill in the art, and are commercially available.
- the following vectors are provided by way of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSNK3, pBPN pMSG, pSNLSN40 (Pharmacia).
- any other plasmid or other vector may be used as long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention.
- a prefe ⁇ ed type of vector for use in the present invention contains an f-factor origin replication.
- the f-factor (or fertility factor) in E. coli is a plasmid which effects high frequency transfer of itself during conjugation and less frequent transfer ofthe bacterial chromosome itself.
- a particularly preferred embodiment is to use cloning vectors, referred to as "fosmids" or bacterial artificial chromosome (BAC) vectors.
- cosmid vectors were originally designed to clone and propagate large segments of genomic DNA. Cloning into cosmid vectors is described in detail in "Molecular Cloning: A laboratory Manual” (Sambrook et al, 1989).
- the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct RNA synthesis.
- promoter particularly named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P and t ⁇ .
- Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
- the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
- the vector may also include appropriate sequences for amplifying expression. Promoter regions can be selected from any desired gene using CAT (chloramphenicol fransferase) vectors or other vectors with selectable markers.
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
- recombinant expression vectors will include origins of replication and selectable markers permitting transformation ofthe host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
- promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
- PGK 3-phosphoglycerate kinase
- the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
- the cloning strategy permits expression via both vector driven and endogenous promoters; vector promotion may be important with expression of genes whose endogenous promoter will not function in E. coli.
- the DNA isolated or derived from microorganisms can preferably be inserted into a vector or a plasmid prior to probing for selected DNA.
- vectors or plasmids are preferably those containing expression regulatory sequences, including promoters, enhancers and the like.
- polynucleotides can be part of a vector and/or a composition and still be isolated, in that such vector or composition is not part of its natural environment. Particularly preferred phage or plasmid and methods for introduction and packaging into them are described in detail in the protocol set forth herein.
- the vector can be any cloning vector with an adequate capacity for multiply repeated copies of a sequence, or multiple sequences that can be successfully transformed and selected in a host cell.
- the vector can be any cloning vector with an adequate capacity for multiply repeated copies of a sequence, or multiple sequences that can be successfully transformed and selected in a host cell.
- One example of such a vector is described in "Polycos vectors: a system for packaging filamentous phage and phagemid vectors using lambda phage packaging extracts" (Alting-Mecs and Short, 1993).
- Propagation/maintenance can be by an antibiotic resistance carried by the cloning vector. After a period of growth, the naturally abbreviated molecules are recovered and identified by size fractionation on a gel or column, or amplified directly.
- the cloning vector utilized may contain a selectable gene that is disrupted by the insertion ofthe lengthy construct. As reductive reassortment progresses, the number of repeated units is reduced and the interrupted gene is again expressed and hence selection for the processed construct can be applied.
- the vector may be an expression/selection vector which will allow for the selection of an expressed product possessing desirable biologically properties.
- the insert may be positioned downstream of a functional promotor and the desirable property screened by appropriate means.
- novel polynucleotides can be generated by the process of reductive reassortment.
- the method involves the generation of constructs containing consecutive sequences (original encoding sequences), their insertion into an appropriate vector, and their subsequent introduction into an appropriate host cell.
- the reassortment ofthe individual molecular identities occurs by combinatorial processes between the consecutive sequences in the construct possessing regions of homology, or between quasi-repeated units.
- the reassortment process recombines and/or reduces the complexity and extent ofthe repeated sequences, and results in the production of novel molecular species.
- Various treatments may be applied to enhance the rate of reassortment.
- the reassortment process may involve homologous recombination or the natural property of quasi-repeated sequences to direct their own evolution.
- Quadsi-repeats are repeats that are not restricted to their original unit structure. Quasi-repeated units can be presented as an array of sequences in a construct; consecutive units of similar sequences. Once ligated, the junctions between the consecutive sequences become essentially invisible and the quasi- repetitive nature ofthe resulting construct is now continuous at the molecular level. The deletion process the cell performs to reduce the complexity ofthe resulting construct operates between the quasi-repeated sequences.
- the quasi-repeated units provide a practically limitless repertoire of templates upon which slippage events can occur. The constructs containing the quasi-repeats thus effectively provide sufficient molecular elasticity that deletion (and potentially insertion) events can occur virtually anywhere within the quasi-repetitive units.
- the cell cannot distinguish individual units. Consequently, the reductive process can occur throughout the sequences.
- the units are presented head to head, rather than head to tail, the inversion delineates the endpoints ofthe adjacent unit so that deletion formation will favor the loss of discrete units.
- the sequences are in the same orientation. Random orientation of quasi-repeated sequences will result in the loss of reassortment efficiency, while consistent orientation ofthe sequences will offer the highest efficiency.
- having fewer ofthe contiguous sequences in the same orientation decreases the efficiency, it may still provide sufficient elasticity for the effective recovery of novel molecules. Constructs can be made with the quasi-repeated sequences in the same orientation to allow higher efficiency.
- Sequences can be assembled in a head to tail orientation using any of a variety of methods, including the following: a) Primers that include a poly-A head and poly-T tail which when made single-stranded would provide orientation can be utilized. This is accomplished by having the first few bases ofthe primers made from RNA and hence easily removed RNAseH. b) Primers that include unique restriction cleavage sites can be utilized.
- the inner few bases ofthe primer could be thiolated and an exonuclease used to produce properly tailed molecules.
- the recovery ofthe re-assorted sequences relies on the identification of cloning vectors with a reduced RI.
- the re-assorted encoding sequences can then be recovered by amplification.
- the products are re-cloned and expressed.
- the recovery of cloning vectors with reduced RI can be effected by:
- the cloning vector would be recovered using standard plasmid isolation procedures and size fractionated on either an agarose gel, or column with a low molecular weight cut off utilizing standard procedures.
- Encoding sequences for example, genes
- Encoding sequences may demonstrate a high degree of homology and encode quite diverse protein products. These types of sequences are particularly useful in the present invention as quasi- repeats. However, while the examples illustrated below demonstrate the reassortment of nearly identical original encoding sequences (quasi-repeats), this process is not limited to such nearly identical repeats.
- the following example demonstrates the method ofthe invention.
- Encoding nucleic acid sequences (quasi-repeats) derived from three (3) unique species are depicted. Each sequence encodes a protein with a distinct set of properties. Each of the sequences differs by a single or a few base pairs at a unique position in the sequence which are designated "A", "B” and "C”.
- the quasi-repeated sequences are separately or collectively amplified and ligated into random assemblies such that all possible permutations and combinations are available in the population of ligated molecules.
- the number of quasi-repeat units can be controlled by the assembly conditions. The average number of quasi-repeated units in a construct is defined as the repetitive index (RI).
- the constructs may, or may not be size fractionated on an agarose gel according to published protocols, inserted into a cloning vector, and transfected into an appropriate host cell.
- the cells are then propagated and "reductive reassortment" is effected.
- the rate ofthe reductive reassortment process may be stimulated by the introduction of DNA damage if desired.
- the reduction in RI is mediated by deletion formation between repeated sequences by an "intramolecular” mechanism, or mediated by recombination-like events through "inter- molecular” mechanisms is immaterial. The end result is a reassortment ofthe molecules into all possible combinations.
- the method comprises the additional step of screening the library members ofthe shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact (e.g., such as catalytic antibodies) with a predetermined macromolecule, such as for example a proteinaceous receptor, peptide oligosaccharide, viron, or other predetermined compound or structure.
- a predetermined macromolecule such as for example a proteinaceous receptor, peptide oligosaccharide, viron, or other predetermined compound or structure.
- the displayed polypeptides, antibodies, peptidomimetic antibodies, and variable region sequences that are identified from such libraries can be used for therapeutic, diagnostic, research and related pu ⁇ oses (e.g., catalysts, solutes for increasing osmolarity of an aqueous solution, and the like), and/or can be subjected to one or more additional cycles of shuffling and/or affinity selection.
- the method can be modified such that the step of selecting for a phenotypic characteristic can be other than of binding affinity for a predetermined molecule (e.g., for catalytic activity, stability oxidation resistance, drug resistance, or detectable phenotype confe ⁇ ed upon a host cell).
- the present invention provides a method for generating libraries of displayed antibodies suitable for affinity interactions screening.
- the method comprises (1) obtaining first a plurality of selected library members comprising a displayed antibody and an associated polynucleotide encoding said displayed antibody, and obtaining said associated polynucleotide encoding for said displayed antibody and obtaimng said associated polynucleotides or copies thereof, wherein said associated polynucleotides comprise a region of substantially identical variable region framework sequence, and (2) introducing said polynucleotides into a suitable host cell and growing the cells under conditions which promote recombination and reductive reassortment resulting in shuffled polynucleotides.
- CDR combinations comprised by the shuffled pool are not present in the first plurality of selected library members, said shuffled pool composing a library of displayed antibodies comprising CDR permutations and suitable for affinity interaction screening.
- the shuffled pool is subjected to affinity screening to select shuffled library members which bind to a predetermined epitope (antigen) and thereby selecting a plurality of selected shuffled library members.
- the plurality of selectively shuffled library members can be shuffled and screened iteratively, from 1 to about 1000 cycles or as desired until library members having a desired binding affinity are obtained.
- polynucleotides generated by the method ofthe present invention can be subjected to agents or processes which promote the introduction of mutations into the original polynucleotides.
- the introduction of such mutations would increase the diversity of resulting hybrid polynucleotides and polypeptides encoded therefrom.
- the agents or processes which promote mutagenesis can include, but are not limited to: (+)-CC-1065, or a synthetic analog such as (+)-CC-1065-(N3-Adenine, see Sun and Hurley, 1992); an N-acelylated or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis (see, for example, van de Poll et al, 1992); or a N-acetylated or deacetylated 4- aminobiphenyl adduct capable of inhibiting DNA synthesis (see also, van de Poll et al, 1992, pp.
- trivalent chromium a trivalent chromium salt, a polycyclic aromatic hydrocarbon ("PAH") DNA adduct capable of inhibiting DNA replication, such as 7-bromomemyl-be ⁇ z[ ⁇ ] anthracene (“BMA”), tris(2,3- dibromopropyl)phosphate (“Tris-BP”), l,2-dibromo-3-chloropropane (“DBCP”), 2- bromoacrolein (2BA), benzo[ ⁇ ]pyrene-7,8-dihydrodiol-9-10-epoxide (“BPDE”), a platinum(II) halogen salt, N-hydroxy-2-amino-3-methylimidazo[4,5- J-quinoline (“N- hydroxy-IQ”), and N-hydroxy-2-amino- 1 -methyl-6-phenylimidazo[4,5-/J-pyridine (“N-hydroxy-PhIP").
- PHA polycyclic aromatic hydrocarbon
- Especially prefe ⁇ ed "means for slowing or halting PCR amplification consist of UN light (+)-CC-1065 and (+)-CC-1065-( ⁇ 3-Adenine).
- Particularly encompassed means are DNA adducts or polynucleotides comprising the DNA adducts from the polynucleotides or polynucleotides pool, which can be released or removed by a process including heating the solution comprising the polynucleotides prior to further processing.
- the present invention is directed to a method of producing recombinant proteins having biological activity by treating a sample comprising double-stranded template polynucleotides encoding a wild-type protein under conditions according to the present invention which provide for the production of hybrid or re-assorted polynucleotides.
- the invention also provides the use of polynucleotide shuffling to shuffle a population of viral genes (e.g., capsid proteins, spike glycoproteins, polymerases, and proteases) or viral genomes (e.g., paramyxoviridae, orthomyxoviridae, he ⁇ esviruses, retroviruses, reo viruses and rhino viruses).
- viral genes e.g., capsid proteins, spike glycoproteins, polymerases, and proteases
- viral genomes e.g., paramyxoviridae, orthomyxoviridae, he ⁇ esviruses, retroviruses, reo viruses and rhino viruses.
- the invention provides a method for shuffling sequences encoding all or portions of immunogenic viral proteins to generate novel combinations of epitopes as well as novel epitopes created by recombination; such shuffled viral proteins may comprise epitopes or combinations of epitopes as well as novel epitopes created by recombination; such shuffled viral proteins may comprise epitopes or combinations of epitopes which are likely to arise in the natural environment as a consequence of viral evolution; (e.g., such as recombination of influenza virus strains).
- the invention also provides a method suitable for shuffling polynucleotide sequences for generating gene therapy vectors and replication-defective gene therapy constructs, such as may be used for human gene therapy, including but not limited to vaccination vectors for DNA-based vaccination, as well as anti-neoplastic gene therapy and other general therapy formats.
- the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention.
- the left-hand end of single-stranded polynucleotide sequences is the 5' end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction.
- RNA transcripts The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end ofthe RNA transcript are refe ⁇ ed to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end ofthe coding RNA transcript are referred to as "downstream sequences".
- Nucleic acid shuffling is a method for in vitro or in vivo homologous recombination of pools of shorter or smaller polynucleotides to produce a polynucleotide or polynucleotides. Mixtures of related nucleic acid sequences or polynucleotides are subjected to sexual PCR to provide random polynucleotides, and reassembled to yield a library or mixed population of recombinant hybrid nucleic acid molecules or polynucleotides.
- the advantage ofthe mutagenic shuffling of this invention over error-prone PCR alone for repeated selection can best be explained with an example from antibody engineering.
- DNA shuffling as compared with error-prone PCR (not sexual PCR).
- the initial library of selected pooled sequences can consist of related sequences of diverse origin (i.e. antibodies from naive mRNA) or can be derived by any type of mutagenesis (including shuffling) of a single antibody gene.
- a collection of selected complementarity determining regions (“CDRs”) is obtained after the first round of affinity selection. In the diagram the thick CDRs confer onto the antibody molecule increased affinity for the antigen.
- Shuffling allows the free combinatorial association of all ofthe CDR Is with all ofthe CDR2s with all ofthe CDR3s, for example.
- This method differs from error-prone PCR, in that it is an inverse chain reaction.
- error-prone PCR the number of polymerase start sites and the number of molecules grows exponentially. However, the sequence ofthe polymerase start sites and the sequence ofthe molecules remains essentially the same.
- nucleic acid reassembly or shuffling of random polynucleotides the number of start sites and the number (but not size) ofthe random polynucleotides decreases over time. For polynucleotides derived from whole plasmids the theoretical endpoint is a single, large concatemeric molecule.
- CDRs and these rare shufflants may be selected based on their superior affinity.
- CDRs from a pool of 100 different selected antibody sequences can be permutated in up to 1006 different ways. This large number of permutations cannot be represented in a single library of DNA sequences. Accordingly, it is contemplated that multiple cycles of DNA shuffling and selection may be required depending on the length ofthe sequence and the sequence diversity desired.
- E ⁇ or-prone PCR in contrast, keeps all the selected CDRs in the same relative sequence, generating a much smaller mutant cloud.
- the template polynucleotide which may be used in the methods of this invention may be DNA or RNA. It may be of various lengths depending on the size ofthe gene or shorter or smaller polynucleotide to be recombined or reassembled.
- the template polynucleotide is from 50 bp to 50 kb. It is contemplated that entire vectors containing the nucleic acid encoding the protein of interest can be used in the methods of this invention, and in fact have been successfully used.
- the template polynucleotide may be obtained by amplification using the PCR reaction (USPN 4,683,202 and USPN 4,683,195) or other amplification or cloning methods.
- the removal of free primers from the PCR products before subjecting them to pooling ofthe PCR products and sexual PCR may provide more efficient results. Failure to adequately remove the primers from the original pool before sexual PCR can lead to a low frequency of crossover clones.
- the template polynucleotide often should be double-stranded. A double-stranded nucleic acid molecule is recommended to ensure that regions ofthe resulting single-stranded polynucleotides are complementary to each other and thus can hybridize to form a double-stranded molecule.
- single-stranded or double-stranded nucleic acid polynucleotides having regions of identity to the template polynucleotide and regions of hetero logy to the template polynucleotide may be added to the template polynucleotide, at this step. It is also contemplated that two different but related polynucleotide templates can be mixed at this step.
- the double-stranded polynucleotide template and any added double-or single-stranded polynucleotides are subjected to sexual PCR which includes slowing or halting to provide a mixture of from about 5 bp to 5 kb or more.
- the size ofthe random polynucleotides is from about 10 bp to 1000 bp, more preferably the size ofthe polynucleotides is from about 20 bp to 500 bp.
- double-stranded nucleic acid having multiple nicks may be used in the methods of this invention.
- a nick is a break in one strand ofthe double-stranded nucleic acid.
- the distance between such nicks is preferably 5 bp to 5 kb, more preferably between 10 bp to 1000 bp. This can provide areas of self-priming to produce shorter or smaller polynucleotides to be included with the polynucleotides resulting from random primers, for example.
- the concentration of any one specific polynucleotide will not be greater than 1% by weight ofthe total polynucleotides, more preferably the concentration of any one specific nucleic acid sequence will not be greater than 0.1% by weight ofthe total nucleic acid.
- the number of different specific polynucleotides in the mixture will be at least about 100, preferably at least about 500, and more preferably at least about 1000.
- single-stranded or double-stranded polynucleotides may be added to the random double-stranded shorter or smaller polynucleotides in order to increase the heterogeneity ofthe mixture of polynucleotides.
- populations of double-stranded randomly broken polynucleotides may be mixed or combined at this step with the polynucleotides from the sexual PCR process and optionally subjected to one or more additional sexual PCR cycles.
- single-stranded or double-stranded polynucleotides having a region of identity to the template polynucleotide and a region of hetero logy to the template polynucleotide may be added in a 20 fold excess by weight as compared to the total nucleic acid, more preferably the single-stranded polynucleotides may be added in a 10 fold excess by weight as compared to the total nucleic acid.
- populations of polynucleotides from each ofthe templates may be combined at a ratio of less than about 1 : 100, more preferably the ratio is less than about 1 :40.
- a backcross ofthe wild-type polynucleotide with a population of mutated polynucleotide may be desired to eliminate neutral mutations (e.g., mutations yielding an insubstantial alteration in the phenotypic property being selected for).
- the ratio of randomly provided wild-type polynucleotides which may be added to the randomly provided sexual PCR cycle hybrid polynucleotides is approximately 1:1 to about 100:1, and more preferably from 1:1 to 40:1.
- the mixed population of random polynucleotides are denatured to form single-stranded polynucleotides and then re-annealed. Only those single-stranded polynucleotides having regions of homology with other single-stranded polynucleotides will re-anneal.
- the random polynucleotides may be denatured by heating.
- One skilled in the art could determine the conditions necessary to completely denature the double- stranded nucleic acid.
- the temperature is from 80 °C to 100 °C, more preferably the temperature is from 90 °C to 96 °C.
- other methods which may be used to denature the polynucleotides include pressure (36) and pH.
- the polynucleotides may be re-annealed by cooling.
- the temperature is from 20 °C to 75 °C, more preferably the temperature is from 40 °C to 65 °C. If a high frequency of crossovers is needed based on an average of only 4 consecutive bases of homology, recombination can be forced by using a low annealing temperature, although the process becomes more difficult.
- the degree of renaturation which occurs will depend on the degree of homology between the population of single-stranded polynucleotides.
- Renaturation can be accelerated by the addition of polyethylene glycol
- PEG poly(ethylene glycol) or salt.
- the salt concentration is preferably from 0 mM to 200 mM, more preferably the salt concentration is from 10 mM to 100 mm.
- the salt may be KCl or NaCI.
- the concentration of PEG is preferably from 0% to 20%, more preferably from 5% to 10%.
- the annealed polynucleotides are next incubated in the presence of a nucleic acid polymerase and dNTP's (i.e. dATP, dCTP, DGTP and dTTP).
- the nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art.
- the approach to be used for the assembly depends on the minimum degree of homology that should still yield crossovers. If the areas of identity are large, Taq polymerase can be used with an annealing temperature of between 45-65 °C. If the areas of identity are small, Klenow polymerase can be used with an annealing temperature of between 20-30 °C. One skilled in the art could vary the temperature of annealing to increase the number of cross-overs achieved.
- the polymerase may be added to the random polynucleotides prior to annealing, simultaneously with annealing or after annealing.
- the cycle of denaturation, renaturation and incubation in the presence of polymerase is referred to herein as shuffling or reassembly ofthe nucleic acid.
- This cycle is repeated for a desired number of times.
- the cycle is repeated from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 times.
- the resulting nucleic acid is a larger double-stranded polynucleotide of from about 50 bp to about 100 kb, preferably the larger polynucleotide is from 500 bp to 50 kb.
- This larger polynucleotides may contain a number of copies of a polynucleotide having the same size as the template polynucleotide in tandem.
- This concatemeric polynucleotide is then denatured into single copies ofthe template polynucleotide.
- the result will be a population of polynucleotides of approximately the same size as the template polynucleotide.
- the population will be a mixed population where single or double-stranded polynucleotides having an area of identity and an area of hetero logy have been added to the template polynucleotide prior to shuffling.
- polynucleotides are then cloned into the appropriate vector and the ligation mixture used to transform bacteria. It is contemplated that the single polynucleotides may be obtained from the larger concatemeric polynucleotide by amplification ofthe single polynucleotide prior to cloning by a variety of methods including PCR (USPN 4,683,195 and USPN 4,683,202), rather than by digestion ofthe concatemer.
- the vector used for cloning is not critical provided that it will accept a polynucleotide ofthe desired size. If expression ofthe particular polynucleotide is desired, the cloning vehicle should further comprise transcription and translation signals next to the site of insertion ofthe polynucleotide to allow expression ofthe polynucleotide in the host cell.
- Preferred vectors include the pUC series and the pBR series of plasmids.
- the resulting bacterial population will include a number of recombinant polynucleotides having random mutations. This mixed population may be tested to identify the desired recombinant polynucleotides. The method of selection will depend on the polynucleotide desired.
- the proteins expressed by each ofthe portions ofthe polynucleotides in the population or library may be tested for their ability to bind to the ligand by methods known in the art (i.e. panning, affinity chromatography). If a polynucleotide which encodes for a protein with increased drug resistance is desired, the proteins expressed by each ofthe polynucleotides in the population or library may be tested for their ability to confer drug resistance to the host organism.
- One skilled in the art given knowledge ofthe desired protein, could readily test the population to identify polynucleotides which confer the desired properties onto the protein.
- a phage display system in which fragments ofthe protein are expressed as fusion proteins on the phage surface (Pharmacia, Milwaukee WI).
- the recombinant DNA molecules are cloned into the phage DNA at a site which results in the transcription of a fusion protein a portion of which is encoded by the recombinant DNA molecule.
- the phage containing the recombinant nucleic acid molecule undergoes replication and transcription in the cell.
- the leader sequence ofthe fusion protein directs the transport ofthe fusion protein to the tip ofthe phage particle.
- the fusion protein which is partially encoded by the recombinant DNA molecule is displayed on the phage particle for detection and selection by the methods described above.
- a number of cycles of nucleic acid shuffling may be conducted with polynucleotides from a sub-population ofthe first population, which sub-population contains DNA encoding the desired recombinant protein. In this manner, proteins with even higher binding affinities or enzymatic activity could be achieved.
- a number of cycles of nucleic acid shuffling may be conducted with a mixture of wild-type polynucleotides and a sub-population of nucleic acid from the first or subsequent rounds of nucleic acid shuffling in order to remove any silent mutations from the sub-population.
- nucleic acid in purified form can be utilized as the starting nucleic acid.
- the process may employ DNA or RNA including messenger RNA, which DNA or RNA may be single or double stranded.
- a DNA-RNA hybrid which contains one strand of each may be utilized.
- the nucleic acid sequence may be of various lengths depending on the size ofthe nucleic acid sequence to be mutated. Preferably the specific nucleic acid sequence is from 50 to 50000 base pairs. It is contemplated that entire vectors containing the nucleic acid encoding the protein of interest may be used in the methods of this invention.
- the nucleic acid may be obtained from any source, for example, from plasmids such a pBR322, from cloned DNA or RNA or from natural DNA or RNA from any source including bacteria, yeast, viruses and higher organisms such as plants or animals.
- DNA or RNA may be extracted from blood or tissue material.
- the template polynucleotide may be obtained by amplification using the polynucleotide chain reaction (PCR, see USPN 4,683,202 and USPN 4,683,195).
- the polynucleotide may be present in a vector present in a cell and sufficient nucleic acid may be obtained by culturing the cell and extracting the nucleic acid from the cell by methods known in the art.
- Any specific nucleic acid sequence can be used to produce the population of hybrids by the present process. It is only necessary that a small population of hybrid sequences ofthe specific nucleic acid sequence exist or be created prior to the present process.
- the initial small population ofthe specific nucleic acid sequences having mutations may be created by a number of different methods. Mutations may be created by e ⁇ or-prone PCR. E ⁇ or-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. Alternatively, mutations can be introduced into the template polynucleotide by oligonucleotide-directed mutagenesis. In oligonucleotide-directed mutagenesis, a short sequence ofthe polynucleotide is removed from the polynucleotide using restriction enzyme digestion and is replaced with a synthetic polynucleotide in which various bases have been altered from the original sequence.
- the polynucleotide sequence can also be altered by chemical mutagenesis.
- Chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid, other agents which are analogues of nucleotide precursors include nitrosoguanidine, 5-bromouracil, 2-aminopurine, or acridine. Generally, these agents are added to the PCR reaction in place ofthe nucleotide precursor thereby mutating the sequence. Intercalating agents such as proflavine, acriflavine, quinacrine and the like can also be used.
- Random mutagenesis ofthe polynucleotide sequence can also be achieved by hradiation with X-rays or ultraviolet light.
- plasmid polynucleotides so mutagenized are introduced into E. coli and propagated as a pool or library of hybrid plasmids.
- the small mixed population of specific nucleic acids may be found in nature in that they may consist of different alleles ofthe same gene or the same gene from different related species (i.e., cognate genes). Alternatively, they may be related DNA sequences found within one species, for example, the immunoglobulin genes.
- the polynucleotides can be used directly or inserted into an appropriate cloning vector, using techniques well-known in,the art.
- the choice of vector depends on the size ofthe polynucleotide sequence and the host cell to be employed in the methods of this invention.
- the templates of this invention may be plasmids, phages, cosmids, phagemids, viruses (e.g., retroviruses, parainfluenzavirus, he ⁇ esviruses, reoviruses, paramyxoviruses, and the like), or selected portions thereof (e.g., coat protein, spike glycoprotein, capsid protein).
- cosmids and phagemids are preferred where the specific nucleic acid sequence to be mutated is larger because these vectors are able to stably propagate large polynucleotides.
- the mixed population ofthe specific nucleic acid sequence is cloned into a vector it can be clonally amplified by inserting each vector into a host cell and allowing the host cell to amplify the vector. This is referred to as clonal amplification because while the absolute number of nucleic acid sequences increases, the number of hybrids does not increase. Utility can be readily determined by screening expressed polypeptides. -78-
- the DNA shuffling method of this invention can be performed blindly on a pool of unknown sequences.
- any sequence mixture can be inco ⁇ orated at any specific position into another sequence mixture.
- mixtures of synthetic oligonucleotides, PCR polynucleotides or even whole genes can be mixed into another sequence library at defined positions.
- the insertion of one sequence (mixture) is independent from the insertion of a sequence in another part ofthe template.
- the degree of recombination, the homology required, and the diversity ofthe library can be independently and simultaneously varied along the length ofthe reassembled DNA.
- This approach of mixing two genes may be useful for the humanization of antibodies from murine hybridomas.
- the approach of mixing two genes or inserting alternative sequences into genes may be useful for any therapeutically used protein, for example, interleukin I, antibodies, tPA and growth hormone.
- the approach may also be useful in any nucleic acid for example, promoters or introns or 31 untranslated region or 51 untranslated regions of genes to increase expression or alter specificity of expression of proteins.
- the approach may also be used to mutate ribozymes or aptamers.
- Shuffling requires the presence of homologous regions separating regions of diversity. Scaffold-like protein structures may be particularly suitable for shuffling.
- the conserved scaffold determines the overall folding by self-association, while displaying relatively unrestricted loops that mediate the specific binding. Examples of such scaffolds are the immunoglobulin beta-barrel, and the four-helix bundle which are well-known in the art. This shuffling can be used to create scaffold-like proteins with various combinations of mutated sequences for binding. Saturation mutagenesis
- this invention provides for the use of proprietary codon primers (containing a degenerate N,N,G/T sequence) to introduce point mutations into a polynucleotide, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position.
- the oligos used are comprised contiguously of a first homologous sequence, a degenerate N,N,G/T sequence, and preferably but not necessarily a second homologous sequence.
- the downstream progeny translational products from the use of such oligos include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy ofthe N,N,G/T sequence includes codons for all 20 amino acids.
- one such degenerate oligo (comprised of one degenerate N,N,G/T cassette) is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions.
- at least two degenerate N,N,G/T cassettes are used - either in the same oligo or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions.
- more than one N,N,G/T sequence can be contained in one oligo to introduce amino acid mutations at more than one site.
- This plurality of N,N,G/T sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s).
- oligos serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,G/T sequence, to introduce any combination or permutation of amino acid additions, deletions, and/or substitutions.
- the present invention provides for the use of degenerate cassettes having less degeneracy than the N,N,G/T sequence.
- degenerate cassettes having less degeneracy than the N,N,G/T sequence.
- N,N,G/T or an N,N, G/C triplet sequence as disclosed in the instant invention is advantageous for several reasons.
- this invention provides a means to systematically and fairly easily generate the substitution ofthe full range of possible amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide.
- the instant invention provides a way to systematically and fairly easily generate 2000 distinct species (i.e. 20 possible amino acids per position X 100 amino acid positions). It is appreciated that there is provided, through the use of an oligo containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32 individual sequences that code for 20 possible amino acids.
- This invention also provides for the use of nondegenerate oligos, which can optionally be used in combination with degenerate primers disclosed. It is appreciated that in some situations, it is advantageous to use nondegenerate oligos to generate specific point mutations in a working polynucleotide. This provides a means to generate specific silent point mutations, point mutations leading to corresponding amino acid changes, and point mutations that cause the generation of stop codons and the corresponding expression of polypeptide fragments.
- each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide molecules such that all 20 amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the parental polynucleotide.
- the 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g. cloned into a suitable E. coli host using an expression vector) and subjected to expression screening.
- clonal amplification e.g. cloned into a suitable E. coli host using an expression vector
- an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to the parental polypeptide), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein.
- favorable amino acid changes may be identified at more than one amino acid position.
- One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions. For example, if 2 specific favorable amino acid changes are identified in each of 3 amino acid positions in a polypeptide, the permutations include 3 possibilities at each position (no change from the original amino acid, and each of two favorable changes) and 3 positions. Thus, there are 3 x 3 x 3 or 27 total possibilities, including 7 that were previously examined - 6 single point mutations (i.e. 2 at each of three positions) and no change at any position.
- site-saturation mutagenesis can be used together with shuffling, chimerization, recombination and other mutagenizing processes, along with screening.
- This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner. In one exemplification, the iterative use of any mutagenizing process(es) is used in combination with screening.
- this invention provides for the use of saturation mutagenesis in combination with additional mutagenization processes, such as process where two or more related polynucleotides are introduced into a suitable host cell such that a hybrid polynucleotide is generated by recombination and reductive reassortment.
- mutagenesis can be use to replace each of any number of bases in a polynucleotide sequence, wherein the number of bases to be mutagenized is preferably every integer from 15 to 100,000.
- the number of bases to be mutagenized is preferably every integer from 15 to 100,000.
- a separate nucleotide is used for mutagenizing each position or group of positions along a polynucleotide sequence.
- a group of 3 positions to be mutagenized may be a codon.
- the mutations are preferably introduced using a mutagenic primer, containing a heterologous cassette, also referred to as a mutagenic cassette.
- Preferred cassettes can have from 1 to 500 bases.
- Each nucleotide position in such heterologous cassettes be N, A, C, G, T, A/C, A/G, A/T, C/G, C/T, G/T, C/G/T, A/G/T, A/C T, A/C/G, or E, where E is any base that is not A, C, G, or T (E can be referred to as a designer oligo).
- the tables below show exemplary tri-nucleotide cassettes (there are over 3000 possibilities in addition to N,N,G/T and N,N,N and N,N,A/C).
- saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette is preferably 1-500 bases in length) in defined polynucleotide sequence to be mutagenized (wherein the sequence to be mutagenized is preferably from 15 to 100,000 bases in length).
- a group of mutations (ranging from 1 to 100 mutations) is introduced into each cassette to be mutagenized.
- a grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation mutagenesis.
- Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes.
- sequences to be mutagenized include preferably a whole gene, pathway, cDNA, an entire open reading frame (ORF), and intire promoter, enhancer, repressor/transactivator, origin of replication, intron, operator, or any polynucleotide functional group.
- a preferred "defined sequences" for this purpose may be any polynucleotide that a 15 base-polynucleotide sequence, and polynucleotide sequences of lengths between 15 bases and 15,000 bases (this invention specifically names every integer in between). Considerations in choosing groupings of codons include types of amino acids encoded by a degenerate mutagenic cassette.
- this invention specifically provides for degenerate codon substitutions (using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each position, and a library of polypeptides encoded thereby.
- a "molecular backcross" can be performed by repeatedly mixing the hybrid's nucleic acid with the wild-type nucleic acid while selecting for the mutations of interest.
- this approach can be used to combine phenotypes from different sources into a background of choice. It is useful, for example, for the removal of neutral mutations that affect unselected characteristics (i.e. immunogenicity).
- unselected characteristics i.e. immunogenicity
- the method of this invention can be used for the in vitro amplification of a whole genome from a single cell as is needed for a variety of research and diagnostic applications.
- DNA amplification by PCR is in practice limited to a length of about 40 kb.
- Amplification of a whole genome such as that of E. coli (5, 000 kb) by PCR would require about 250 primers yielding 125 forty kb polynucleotides. This approach is not practical due to the unavailability of sufficient sequence data.
- random production of polynucleotides ofthe genome with sexual PCR cycles, followed by gel purification of small polynucleotides will provide a multitude of possible primers. Use of this mix of random small polynucleotides as primers in a PCR reaction alone or with the whole genome as the template should result in an inverse chain reaction with the theoretical endpoint of a single concatamer containing many copies ofthe genome.
- 100 fold amplification in the copy number and an average polynucleotide size of greater than 50 kb may be obtained when only random polynucleotides are used. It is thought that the larger concatamer is generated by overlap of many smaller polynucleotides. The quality of specific PCR products obtained using synthetic primers will be indistinguishable from the product obtained from unamplified DNA. It is expected that this approach will be useful for the mapping of genomes.
- the polynucleotide to be shuffled can be produced as random or non-random polynucleotides, at the discretion ofthe practitioner.
- this invention provides a method of shuffling that is applicable to a wide range of polynucleotide sizes and types, including the step of generating polynucleotide monomers to be used as building blocks in the reassembly of a larger polynucleotide.
- the building blocks can be fragments of genes or they can be comprised of entire genes or gene pathways, or any combination thereof.
- this invention provides for a method for shuffling, assembling, reassembling, recombining, &/or concatenating at least two polynucleotides to form a progeny polynucleotide (e.g. a chimeric progeny polynucleotide that can be expressed to produce a polypeptide or a gene pathway).
- a progeny polynucleotide e.g. a chimeric progeny polynucleotide that can be expressed to produce a polypeptide or a gene pathway.
- a double stranded polynucleotide end e.g.
- a double stranded polynucleotide end (that may be part of- or connected to - a polynucleotide or a nonpolynucleotide sequence) is subjected to a source of exonuclease activity.
- Serviceable sources of exonuclease activity may be an enzyme with 3' exonuclease activity, an enzyme with 5' exonuclease activity, an enzyme with both 3' exonuclease activity and 5' exonuclease activity, and any combination thereof.
- An exonuclease can be used to liberate nucleotides from one or both ends of a linear double stranded polynucleotide, and from one to all ends of a branched polynucleotide having more than two ends.
- the mechanism of action of this liberation is believed to be comprised of an enzymatically-catalyzed hydrolysis of terminal nucleotides, and can be allowed to proceed in a time-dependent fashion, allowing experimental control ofthe progression ofthe enzymatic process.
- a non-enzymatic step may be used to shuffle, assemble, reassemble, recombine, and/or concatenate polynucleotide building blocks that is comprised of subjecting a working sample to denaturing (or "melting") conditions (for example, by changing temperature, pH, and /or salinity conditions) so as to melt a working set of double stranded polynucleotides into single polynucleotide strands.
- denaturing or "melting”
- the presence ofthe former hybridization partners in the reaction vessel does not preclude, and may sometimes even favor, reannealment of a single stranded polynucleotide with its former partner, to recreate an original double stranded polynucleotide.
- the instant invention further provides an exonuclease-based approach requiring no denaturation - rather, the avoidance of denaturing conditions and the maintenance of double stranded polynucleotide substrates in annealed (i.e. non- denatured) state are necessary conditions for the action of exonucleases (e.g., exonuclease III and red alpha gene product).
- exonucleases e.g., exonuclease III and red alpha gene product.
- the generation of single stranded polynucleotide sequences capable of hybridizing to other single stranded polynucleotide sequences is the result of covalent cleavage - and hence sequence destruction - in one ofthe hybridization partners.
- an exonuclease III enzyme may be used to enzymatically liberate 3 ' terminal nucleotides in one hybridization strand (to achieve covalent hydrolysis in that polynucleotide strand); and this favors hybridization ofthe remaining single strand to a new partner (since its former partner was subjected to covalent cleavage).
- exonuclease III a specific exonuclease, namely exonuclease III is provided herein as an example of a 3' exonuclease; however, other exonucleases may also be used, including enzymes with 5' exonuclease activity and enzymes with 3' exonuclease activity, and including enzymes not yet discovered and enzymes not yet developed. It is particularly appreciated that enzymes can be discovered, optimized (e.g. engineered by directed evolution), or both discovered and optimized specifically for the instantly disclosed approach that have more optimal rates &/or more highly specific activities &/or greater lack of unwanted activities. In fact it is expected that the instant invention may encourage the discovery &/or development of such designer enzymes. In sum, this invention may be practiced with a variety of currently available exonuclease enzymes, as well enzymes not yet discovered and enzymes not yet developed.
- exonuclease action of exonuclease III requires a working double stranded polynucleotide end that is either blunt or has a 5' overhang, and the exonuclease action is comprised of enzymatically liberating 3' terminal nucleotides, leaving a single stranded 5' end that becomes longer and longer as the exonuclease action proceeds (see Figure 1).
- any 5' overhangs produced by this approach may be used to hybridize to another single stranded polynucleotide sequence (which may also be a single stranded polynucleotide or a terminal overhang of a partially double stranded polynucleotide) that shares enough homology to allow hybridization.
- the ability of these exonuclease Ill-generated single stranded sequences (e.g. in 5' overhangs) to hybridize to other single stranded sequences allows two or more polynucleotides to be shuffled, assembled, reassembled, &/or concatenated.
- a double stranded polynucleotide end having a 3' overhang is not susceptible to the exonuclease action of exonuclease III.
- exonuclease III may be rendered susceptible to the exonuclease action of exonuclease III by a variety of means; for example, it may be blunted by treatment with a polymerase, cleaved to provide a blunt end or a 5' overhang, joined (ligated or hybridized) to another double stranded polynucleotide to provide a blunt end or a 5' overhang, hybridized to a single stranded polynucleotide to provide a blunt end or a 5' overhang, or modified by any of a variety of means).
- an exonuclease may be allowed to act on one or on both ends of a linear double stranded polynucleotide and proceed to completion, to near completion, or to partial completion.
- the exonuclease action is allowed to go to completion, the result will be that the length of each 5' overhang will be extend far towards the middle region ofthe polynucleotide in the direction of what might be considered a "rendezvous point" (which may be somewhere near the polynucleotide midpoint).
- an exonuclease-mediated reaction can be terminated before proceeding to completion.
- polynucleotide building blocks can be up to ten bases long or tens of bases long or hundreds of bases long or thousands of bases long or tens of thousands of bases long or hundreds of thousands of bases long or millions of bases long or even longer.
- exonuclease-mediated approach is based on the action of double stranded DNA specific exodeoxyribonuclease activity of E. coli exonuclease III.
- Substrates for exonuclease III may be generated by subjecting a double stranded polynucleotide to fragmentation. Fragmentation may be achieved by mechanical means (e.g., shearing, sonication, etc.), by enzymatic means (e.g. using restriction enzymes), and by any combination thereof. Fragments of a larger polynucleotide may also be generated by polymerase-mediated synthesis.
- Exonuclease III is a 28K monomeric enzyme, product ofthe xthA gene of E. coli with four known activities: exodeoxyribonuclease (alternatively referred to as exonuclease herein), RNaseH, DNA-3' -phosphatase, and AP endonuclease.
- exodeoxyribonuclease activity is specific for double stranded DNA. The mechanism of action is thought to involve enzymatic hydrolysis of DNA from a 3' end progressively towards a 5' direction, with formation of nucleoside 5 '-phosphates and a residual single strand.
- the enzyme does not display efficient hydrolysis of single stranded DNA, single-stranded RNA, or double-stranded RNA; however it degrades RNA in an DNA-RNA hybrid releasing nucleoside 5 '-phosphates.
- the enzyme also releases inorganic phosphate specifically from 3'phosphomonoester groups on DNA, but not from RNA or short oligonucleotides. Removal of these groups converts the terminus into a primer for DNA polymerase action.
- Red alpha (redd) gene product also referred to as lambda exonuclease
- red alpha gene product is of bacteriophage ⁇ origin. The redo, gene is transcribed from the leftward promoter and its product is involved (24 kD) in recombination. Red alpha gene product acts processively from 5'-phosphorylated termini to liberate mononucleotides from duplex DNA (Takahashi & Kobayashi, 1990).
- Venom phosphodiesterases (Laskowski, 1980) is capable of rapidly opening supercoiled DNA.
- the present invention provides a non-stochastic method termed synthetic ligation reassembly (SLR), that is somewhat related to stochastic shuffling, save that the nucleic acid building blocks are not shuffled or concatenated or chimerized randomly, but rather are assembled non-stochastically.
- SLR synthetic ligation reassembly
- a particularly glaring difference is that the instant SLR method does not depend on the presence of a high level of homology between polynucleotides to be shuffled.
- prior methods particularly prior stochastic shuffling methods require that presence of a high level of homology, particularly at coupling sites, between polynucleotides to be shuffled. Accordingly these prior methods favor the regeneration ofthe original progenitor molecules, and are suboptimal for generating large numbers of novel progeny chimeras, particularly full-length progenies.
- the instant invention can be used to non-stochastically generate libraries (or sets) of progeny molecules comprised of over 10 100 different chimeras. Conceivably, SLR can even be used to generate libraries comprised of over io 1000 different progeny chimeras with (no upper limit in sight).
- the present invention provides a method, which method is non-stochastic, of producing a set of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised ofthe steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible Ugatable ends, and assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved.
- the mutually compatible Ugatable ends ofthe nucleic acid building blocks to be assembled are considered to be "serviceable" for this type of ordered assembly if they enable the building blocks to be coupled in predetermined orders.
- the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design ofthe Ugatable ends and, if more than one assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order ofthe assembly step(s).
- Panel C illustrates an exemplary assembly process comprised of 2 sequential steps to achieve a designed (non-stochastic) overall assembly order for five nucleic acid building blocks.
- the annealed building pieces are treated with an enzyme, such as a ligase (e.g. T4 DNA ligase), achieve covalent bonding ofthe building pieces.
- a ligase e.g. T4 DNA ligase
- the design of nucleic acid building blocks is obtained upon analysis ofthe sequences of a set of progenitor nucleic acid templates that serve as a basis for producing a progeny set of finalized chimeric nucleic acid molecules.
- progemtor nucleic acid templates thus serve as a source of sequence information that aids in the design ofthe nucleic acid building blocks that are to be mutagenized, i.e. chimerized or shuffled.
- this invention provides for the chimerization of a family of related genes and their encoded family of related products.
- the encoded products are enzymes.
- families of enzymes which may be mutagenized in accordance with the aspects ofthe present invention, there may be mentioned, the following enzymes and their functions:
- Glycosidase/Glycosyl transferase a. Sugar/polymer synthesis b. Cleavage of glycosidic linkages to form mono, di-and oligosaccharides c. Synthesis of complex oligosaccharides d. Glycoside synthesis using UDP-galactosyl transferase e. Transglycosylation of disaccharides, glycosyl fluorides, aryl galactosides f. Glycosyl transfer in oligosaccharide synthesis g. Diastereoselective cleavage of ⁇ -glucosylsulfoxides h. Asymmetric glycosylations i. Food processing j. Paper processing
- Mono/Dioxygenase a. Direct oxyfunctionalization of unactivated organic substrates b. Hydroxylation of alkane, aromatics, steroids c. Epoxidation ofalkenes d. Enantioselective sulphoxidation e. Regio- and stereoselective Bayer-Nilliger oxidations
- Haloperoxidase a. Oxidative addition of halide ion to nucleophilic sites b. Addition of hypohalous acids to olefinic bonds c. Ring cleavage of cyclopropanes d. Activated aromatic substrates converted to ortho and para derivatives e. 1.3 diketones converted to 2-halo-derivatives f. Heteroatom oxidation of sulfur and nitrogen containing substrates g. Oxidation of enol acetates, alkynes and activated aromatic rings
- Nitrile hydratase/nitrilase a Hydrolysis of aliphatic nitriles to carboxamides b. Hydrolysis of aromatic, heterocyclic, unsaturated aliphatic nitriles to corresponding acids c. Hydrolysis of acrylonitrile d. Production of aromatic and carboxamides, carboxylic acids
- the sequences of a plurality of progenitor nucleic acid templates are aligned in order to select one or more demarcation points, which demarcation points can be located at an area of homology, and are comprised of one or more nucleotides, and which demarcation points are shared by at least two of the progenitor templates.
- the demarcation points can be used to delineate the boundaries of nucleic acid building blocks to be generated.
- the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly ofthe progeny molecules.
- a serviceable demarcation point is an area of homology (comprised of at least one homologous nucleotide base) shared by at least two progenitor templates. More preferably a serviceable demarcation point is an area of homology that is shared by at least half of the progenitor templates. More preferably still a serviceable demarcation point is an area of homology that is shared by at least two thirds ofthe progenitor templates. Even more preferably a serviceable demarcation points is an area of homology that is shared by at least three fourths ofthe progenitor templates. Even more preferably still a serviceable demarcation points is an area of homology that is shared by at almost all ofthe progenitor templates. Even more preferably still a serviceable demarcation point is an area of homology that is shared by all of the progenitor templates.
- the assembly order i.e. the order of assembly of each building block in the 5' to 3 sequence of each finalized chimeric nucleic acid
- design or non-stochastic
- this invention provides that, the ligation reassembly process is performed systematically, for example in order to generate a systematically compartmentalized library, with compartments that can be screened systematically, e.g. one by one.
- this invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, an experimental design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, it allows a potentially very large number of progeny molecules to be examined systematically in smaller groups.
- the instant invention provides for the generation of a library (or set) comprised of a large number of progeny molecules. Because of the non-stochastic nature ofthe instant ligation reassembly invention, the progeny molecules generated preferably comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design.
- such a generated library is comprised of preferably greater than 10 3 different progeny molecular species, more preferably greater than 10 5 different progeny molecular species, more preferably still greater than 10 different progeny molecular species, more preferably still greater than 10 15 different progeny molecular species, more preferably still greater than 10 20 different progeny molecular species, more preferably still greater than 10 30 different progeny molecular species, more preferably still greater than 10 40 different progeny molecular species, more preferably still greater than 10 50 different progeny molecular species, more preferably still greater than 10 60 different progeny molecular species, more preferably still greater than 10 70 different progeny molecular species, more preferably still greater than 10 80 different progeny molecular species, more preferably still greater than 10 100 different progeny molecular species, more preferably still greater than 10 ⁇ o different progeny molecular species, more preferably still greater
- a set of finalized chimeric nucleic acid molecules, produced as described is comprised of a polynucleotide encoding a polypeptide.
- this polynucleotide is a gene, which may be a man-made gene.
- this polynucleotide is a gene pathway, which may be a man-made gene pathway.
- This invention provides that one or more man-made genes generated by this invention may be inco ⁇ orated into a man-made gene pathway, such as pathway operable in a eukaryotic organism (including a plant).
- the power of this invention is exceptional, as there is much freedom of choice and control regarding the selection of demarcation points, the size and number ofthe nucleic acid building blocks, and the size and design ofthe couplings. It is appreciated, furthermore, that the requirement for intermolecular homology is highly relaxed for the operabihty of this invention. In fact, demarcation points can even be chosen in areas of little or no intermolecular homology. For example, because of codon wobble, i.e. the degeneracy of codons, nucleotide substitutions can be introduced into nucleic acid building blocks without altering the amino acid originally encoded in the corresponding progenitor template.
- a codon can be altered such that the coding for an originally amino acid is altered.
- This inventiop provides that such substitutions can be introduced into the nucleic acid building block in order to increase the incidence of intermolecularly homologous demarcation points and thus to allow an increased number of couplings to be achieved among the building blocks, which in turn allows a greater number of progeny chimeric molecules to be generated.
- the synthetic nature ofthe step in which the building blocks are generated allows the design and introduction of nucleotides (e.g. one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vitro process (e.g. by mutageneis) or in an in vivo process (e.g. by utilizing the gene splicing ability of a host organism).
- nucleotides e.g. one or more nucleotides, which may be, for example, codons or introns or regulatory sequences
- this invention provides that a nucleic acid building block can be used to introduce an intron.
- this invention provides that functional introns may be introduced into a man-made gene of this invention.
- This invention also provides that functional introns may be introduced into a man- made gene pathway of this invention. Accordingly, this invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced intron(s).
- this invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced intron(s).
- the artificially introduced intron(s) are functional in one or more host cells for gene splicing much in the way that naturally-occurring introns serve functionally in gene splicing.
- This invention provides a process of producing man-made intron-containing polynucleotides to be introduced into host organisms for recombination and/or splicing.
- This invention thus provides for the generation of novel man-made gene pathways using synthetic ligation reassembly. In a particular aspect, this is achieved by the introduction of regulatory sequences, such as promoters, that are operable in an intended host, to confer operabihty to a novel gene pathway when it is introduced into the intended host. In a particular exemplification, this invention provides for the generation of novel man- made gene pathways that is operable in a plurality of intended hosts (e.g. in a microbial organism as well as in a plant cell).
- This can be achieve, for example, by the introduction of a plurality of regulatory sequences, comprised of a regulatory sequence that is operable in a first intended host and a regulatory sequence that is operable in a second intended host.
- a similar process can be performed to achieve operabihty of a gene pathway in a third intended host species, etc.
- the number of intended host species can be each integer from 1 to 10 or alternatively over 10.
- operabihty of a gene pathway in a plurality of intended hosts can be achieved by the introduction of a regulatory sequence having intrinsic operabihty in a plurality of intended hosts.
- this invention provides that a nucleic acid building block can be used to introduce a regulatory sequence, particularly a regulatory sequence for gene expression.
- a regulatory sequence particularly a regulatory sequence for gene expression.
- Prefe ⁇ ed regulatory sequences include, but are not limited to, those that are man-made, and those found in archeal, bacterial, eukaryotic (including mitochondrial), viral, and prionic or prion- like organisms.
- Prefe ⁇ ed regulatory sequences include but are not limited to, promoters, operators, and activator binding sites.
- this invention provides that functional regulatory sequences may be introduced into a man-made gene of this invention.
- This invention also provides that functional regulatory sequences may be introduced into a man-made gene pathway of this invention.
- this invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced regulatory sequence(s). Accordingly, this invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced regulatory sequence(s). Preferably, an artificially introduced regulatory sequence(s) is operatively linked to one or more genes in the man-made polynucleotide, and are functional in one or more host cells.
- Prefe ⁇ ed bacterial promoters that are serviceable for this invention include lad, lacZ, T3, T7, gpt, lambda P R , P and t ⁇ .
- Serviceable eukaryotic promoters include CMN immediate early, HSN thymidine kinase, early and late SN40, LTRs from retrovirus, and mouse metallothionein-I.
- Particular plant regulatory sequences include promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use ofthe plant or parts thereof.
- promoters include, but are not limited to promoters showing constitutive expression, such as the 35S promoter of Cauliflower Mosaic Virus (CaMV) (Guilley et al., 1982), those for leaf-specific expression, such as the promoter ofthe ribulose bisphosphate carboxylase small subunit gene (Coruzzi et al., 1984), those for root-specific expression, such as the promoter from the glutamin synthase gene (Tingey et al., 1987), those for seed-specific expression, such as the cruciferin A promoter from
- Brassica napus (Ryan et al., 1989), those for tuber-specific expression, such as the class-I patatin promoter from potato (Rocha-Sasa et al., 1989; Wenzler et al., 1989) or those for fruit-specific expression, such as the polygalacturonase (PG) promoter from tomato (Bird et al., 1988).
- tuber-specific expression such as the class-I patatin promoter from potato (Rocha-Sasa et al., 1989; Wenzler et al., 1989) or those for fruit-specific expression, such as the polygalacturonase (PG) promoter from tomato (Bird et al., 1988).
- PG polygalacturonase
- regulatory sequences that are prefe ⁇ ed for this invention include terminator sequences and polyadenylation signals and any such sequence functioning as such in plants, the choice of which is within the level ofthe skilled artisan.
- An example of such sequences is the 3' flanking region ofthe nopahne synthase (nos) gene of Agrobacterium tumefaciens (Bevan, 1984).
- the regulatory sequences may also include enhancer sequences, such as found in the 35S promoter of CaMV, and mRNA stabilizing sequences such as the leader sequence of Alfalfa Mosaic Cirus (A1MV) RNA4 (Brederode et al., 1980) or any other sequences functioning in a like manner.
- A1MV Alfalfa Mosaic Cirus
- a man-made genes produced using this invention can also serve as a substrate for recombination with another nucleic acid.
- a man-made gene pathway produced using this invention can also serve as a substrate for recombination with another nucleic acid.
- the recombination is facilitated by, or occurs at, areas of homology between the man-made intron-containing gene and a nucleic acid with serves as a recombination partner.
- the recombination partner may also be a nucleic acid generated by this invention, including a man-made gene or a man-made gene pathway. Recombination may be facilitated by or may occur at areas of homology that exist at the one (or more) artificially introduced intron(s) in the man-made gene.
- the synthetic ligation reassembly method of this invention utilizes a plurality of nucleic acid building blocks, each of which preferably has two ligatable ends.
- the two ligatable ends on each nucleic acid building block may be two blunt ends (i.e. each having an overhang of zero nucleotides), or preferably one blunt end and one overhang, or more preferably still two overhangs.
- a serviceable overhang for this pu ⁇ ose may be a 3' overhang or a 5' overhang.
- a nucleic acid building block may have a 3' overhang or alternatively a 5' overhang or alternatively two 3' overhangs or alternatively two 5' overhangs.
- the overall order in which the nucleic acid building blocks are assembled to form a finalized chimeric nucleic acid molecule is determined by pu ⁇ oseful experimental design and is not random.
- a nucleic acid building block is generated by chemical synthesis of two single-stranded nucleic acids (also refe ⁇ ed to as single-stranded oligos) and contacting them so as to allow them to anneal to form a double-stranded nucleic acid building block.
- a double-stranded nucleic acid building block can be of variable size.
- the sizes of these building blocks can be small or large depending on the choice ofthe experimenter.
- Prefe ⁇ ed sizes for building block range from 1 base pair (not including any overhangs) to 100,000 base pairs (not including any overhangs).
- Other prefe ⁇ ed size ranges are also provided, which have lower limits of from 1 bp to 10,000 bp
- nucleic acid building block made by different methods can also be used in combination to generate a progeny molecule of this invention.
- nucleic acid building blocks are particularly prefe ⁇ ed in this invention & is advantageous for other reasons as well, including procedural safety and ease. No cloning or harvesting or actual handling of any biological samples is required.
- the design ofthe nucleic acid building blocks can be accomplished on paper. Accordingly, this invention teaches an advance in procedural safety in recombinant technologies.
- a double-stranded nucleic acid building block according to this invention may also be generated by polymerase-based amplification of a polynucleotide template.
- a first polymerase-based amplification reaction using a first set of primers, F and Ri is used to generate a blunt-ended product (labeled Reaction 1, Product 1), which is essentially identical to Product A.
- a second polymerase-based amplification reaction using a second set of primers, ⁇ ⁇ and R 2 is used to generate a blunt-ended product (labeled Reaction 2, Product 2), which is essentially identical to Product B.
- the product with the 3' overhangs is selected by nuclease-based degradation ofthe other 3 products using a 3' acting exonuclease, such as exonuclease in.
- a 3' acting exonuclease such as exonuclease in.
- a 5' acting exonuclease e.g. red alpha
- other selection means can also be used, including hybridization-based means, and that these means can inco ⁇ orate a further -104- means, such as a magnetic bead-based means, to facilitate separation ofthe desired product.
- a double-stranded nucleic acid building block that is serviceable for this invention is generated by first generating two single stranded nucleic acids and allowing them to anneal to form a double-stranded nucleic acid building block.
- the two strands of a double-stranded nucleic acid building block may be complementary at every nucleotide apart from any that form an overhang; thus containing no mismatches, apart from any overhang(s).
- the two strands of a double-stranded nucleic acid building block are complementary at fewer than every nucleotide apart from any that form an overhang.
- a double-stranded nucleic acid building block can be used to introduce codon degeneracy.
- the codon degeneracy is introduced using the site-saturation mutagenesis described herein, using one or more N,N,G/T cassettes or alternatively using one or more N,N,N cassettes.
- An overhang may be a 3' overhang or a 5' overhang.
- An overhang may also have a terminal phosphate group or alternatively may be devoid of a terminal phosphate group (having, e.g., a hydroxyl group instead).
- An overhang may be comprised of any number of nucleotides. Preferably an overhang is comprised of 0 nucleotides (as in a blunt end) to 10,000 nucleotides. Thus, a wide range of overhang sizes may be serviceable. Accordingly, the lower limit may be each integer from 1- 200 and the upper limit may be each integer from 2-10,000. According to a particular exemplification, an overhang may consist of anywhere from 1 nucleotide to 200 nucleotides (including every integer value in between).
- the final chimeric nucleic acid molecule may be generated by sequentially assembling 2 or more building blocks at a time until all the designated building blocks have been assembled.
- a working sample may optionally be subjected to a process for size selection or purification or other selection or enrichment process between the performance of two assembly steps.
- the final chimeric nucleic acid molecule may be generated by assembling all the designated building blocks at once in one step.
- groupings of these potential products can be non-stochastically determined and furthermore ranked according to the predicted the likelihood that desirable products are contained in each grouping.
- computer modeling in silico
- mental calculations or considerations in cranio
- groupings can be ranked against each other mentally or using computer modeling by predicting the number of potentially desirable or usable products in each grouping.
- the grouping of potential products and the ranking ofthe groupings are different facets of what is refe ⁇ ed to herein as “triaging”, and specifically “in silico triage” if performed using the aid of a computer.
- the mixed population ofthe specific nucleic acid sequence is introduced into bacterial or eukaryotic cells under conditions such that at least two different nucleic acid sequences are present in each host cell.
- the polynucleotides can be introduced into the host cells by a variety of different methods.
- the host cells can be transformed with the smaller polynucleotides using methods known in the art, for example treatment with calcium chloride. If the polynucleotides are inserted into a phage genome, the host cell can be transfected with the recombinant phage genome having the specific nucleic acid sequences.
- nucleic acid sequences can be introduced into the host cell using electroporation, transfection, lipofection, biolistics, conjugation, and the like.
- specific nucleic acids sequences will be present in vectors which are capable of stably replicating the sequence in the host cell.
- the vectors will encode a marker gene such that host cells having the vector can be selected. This ensures that the mutated specific nucleic acid sequence can be recovered after introduction into the host cell.
- the entire mixed population ofthe specific nucleic acid sequences need not be present on a vector sequence. Rather only a sufficient number of sequences need be cloned into vectors to ensure that after introduction ofthe polynucleotides into the host cells each host cell contains one vector having at least one specific nucleic acid sequence present therein. It is also contemplated that rather than having a subset ofthe population ofthe specific nucleic acids sequences cloned into vectors, this subset may be already stably integrated into the host cell.
- the host cell transformants are placed under selection to identify those host cell transformants which contain mutated specific nucleic acid sequences having the qualities desired. For example, if increased resistance to a particular drug is desired then the transformed host cells may be subjected to increased concentrations ofthe particular drug and those transformants producing mutated proteins able to confer increased drug resistance will be selected. If the enhanced ability of a particular protein to bind to a receptor is desired, then expression ofthe protein can be induced from the transformants and the resulting protein assayed in a ligand binding assay by methods known in the art to identify that subset ofthe mutated population which shows enhanced binding to the ligand. Alternatively, the protein can be expressed in another system to ensure proper processing.
- the recombined specific nucleic acid sequences may be mixed with the original mutated specific nucleic acid sequences (parent sequences) and the cycle repeated as described above. In this way a set of second recombined specific nucleic acids sequences can be identified which have enhanced characteristics or encode for proteins having enhanced properties. This cycle can be repeated a number of times as desired.
- a backcross can be performed in the second or subsequent recombination cycle.
- a molecular backcross can be performed by mixing the desired specific nucleic acid sequences with a large number ofthe wild-type sequence, such that at least one wild-type nucleic acid sequence and a mutated nucleic acid sequence are present in the same host cell after transformation. Recombination with the wild-type specific nucleic acid sequence will eliminate those neutral mutations that may affect unselected characteristics such as immunogenicity but not the selected characteristics.
- a subset ofthe specific nucleic acid sequences can be generated as smaller polynucleotides by slowing or halting their PCR amplification prior to introduction into the host cell.
- the size ofthe polynucleotides must be large enough to contain some regions of identity with the other sequences so as to homologously recombine with the other sequences.
- the size ofthe polynucleotides will range from 0.03 kb to
- the shorter polynucleotide sequences can be single-stranded or double-stranded. If the sequences were originally single-stranded and have become double-stranded they can be denatured with heat, chemicals or enzymes prior to insertion into the host cell.
- the reaction conditions suitable for separating the strands of nucleic acid are well known in the art.
- steps of this process can be repeated indefinitely, being limited only by the number of possible hybrids which can be achieved. After a certain number of cycles, all possible hybrids will have been achieved and further cycles are redundant.
- the same mutated template nucleic acid is repeatedly recombined and the resulting recombinants selected for the desired characteristic.
- the initial pool or population of mutated template nucleic acid is cloned into a vector capable of replicating in a bacteria such as E. coli.
- the particular vector is not essential, so long as it is capable of autonomous replication in ⁇ . coli.
- the vector is designed to allow the expression and production of any protein encoded by the mutated specific nucleic acid linked to the vector. It is also prefe ⁇ ed that the vector contain a gene encoding for a selectable marker.
- the population of vectors containing the pool of mutated nucleic acid sequences is introduced into the E. coli host cells.
- the vector nucleic acid sequences may be introduced by transformation, transfection or infection in the case of phage.
- the concentration of vectors used to transform the bacteria is such that a number of vectors is introduced into each cell. Once present in the cell, the efficiency of homologous recombination is such that homologous recombination occurs between the various vectors. This results in the generation of hybrids (daughters) having a combination of mutations which differ from the original parent mutated sequences.
- the host cells are then clonally replicated and selected for the marker gene present on the vector. Only those cells having a plasmid will grow under the selection.
- the host cells which contain a vector are then tested for the presence of favorable mutations. Such testing may consist of placing the cells under selective pressure, for example, if the gene to be selected is an improved drug resistance gene. If the vector allows expression ofthe protein encoded by the mutated nucleic acid sequence, then such selection may include allowing expression ofthe protein so encoded, isolation ofthe protein and testing ofthe protein to determine whether, for example, it binds with increased efficiency to the ligand of interest.
- nucleic acid is isolated either aheady linked to the vector or separated from the vector. This nucleic acid is then mixed with the first or parent population of nucleic acids and the cycle is repeated.
- nucleic acid sequences having enhanced desired properties can be selected.
- the first generation of hybrids are retained in the cells and the parental mutated sequences are added again to the cells. Accordingly, the first cycle of Embodiment I is conducted as described above. However, after the daughter nucleic acid sequences are identified, the host cells containing these sequences are retained. The parent mutated specific nucleic acid population, either as polynucleotides or cloned into the same vector is introduced into the host cells already containing the daughter nucleic acids. Recombination is allowed to occur in the cells and the next generation of recombinants, or granddaughters are selected by the methods described above.
- This cycle can be repeated a number of times until the nucleic acid or peptide having the desired characteristics is obtained. It is contemplated that in subsequent cycles, the population of mutated sequences which are added to the prefe ⁇ ed hybrids may come from the parental hybrids or any subsequent generation.
- the invention provides a method of conducting a "molecular" backcross ofthe obtained recombinant specific nucleic acid in order to eliminate any neutral mutations.
- Neutral mutations are those mutations which do not confer onto the nucleic acid or peptide the desired properties. Such mutations may however confer on the nucleic acid or peptide undesirable characteristics. Accordingly, it is desirable to eliminate such neutral mutations.
- the method of this invention provide a means of doing so.
- the nucleic acid after the hybrid nucleic acid, having the desired characteristics, is obtained by the methods ofthe embodiments, the nucleic acid, the vector having the nucleic acid or the host cell containing the vector and nucleic acid is isolated.
- the nucleic acid or vector is then introduced into the host cell with a large excess ofthe wild-type nucleic acid.
- the nucleic acid ofthe hybrid and the nucleic acid ofthe wild-type sequence are allowed to recombine.
- the resulting recombinants are placed under the same selection as the hybrid nucleic acid. Only those recombinants which retained the desired characteristics will be selected. Any silent mutations which do not provide the desired characteristics will be lost through recombination with the wild-type DNA. This cycle can be repeated a number of times until all ofthe silent mutations are eliminated.
- the in vivo recombination method of this invention can be performed blindly on a pool of unknown hybrids or alleles of a specific polynucleotide or sequence. However, it is not necessary to know the actual DNA or RNA sequence ofthe specific polynucleotide.
- the approach of using recombination within a mixed population of genes can be useful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA and growth hormone.
- This approach may be used to generate proteins having altered specificity or activity.
- the approach may also be useful for the generation of hybrid nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequences, 31 untranslated regions or 51 untranslated regions of genes.
- This approach may be used to generate genes having increased rates of expression.
- This approach may also be useful in the study of repetitive DNA sequences.
- this approach may be useful to mutate ribozymes or aptamers.
- Scaffold-like regions separating regions of diversity in proteins may be particularly suitable for the methods of this invention.
- the conserved scaffold determines the overall folding by self-association, while displaying relatively unrestricted loops that mediate the specific binding.
- Examples of such scaffolds are the immunoglobulin beta barrel, and the four-helix bundle.
- the methods of this invention can be used to create scaffold-like proteins with various combinations of mutated sequences for binding.
- -113- The equivalents of some standard genetic matings may also be performed by the methods of this invention. For example, a "molecular" backcross can be performed by repeated mixing ofthe hybrid's nucleic acid with the wild-type nucleic acid while selecting for the mutations of interest.
- this approach can be used to combine phenotypes from different sources into a background of choice. It is useful, for example, for the removal of neutral mutations that affect unselected characteristics (i.e. immunogenicity). Thus it can be useful to determine which mutations in a protein are involved in the enhanced biological activity and which are not.
- the present method can be used to shuffle, by in vitro and/or in vivo recombination by any ofthe disclosed methods, and in any combination, polynucleotide sequences selected by peptide display methods, wherein an associated polynucleotide encodes a displayed peptide which is screened for a phenotype (e.g., for affinity for a predetermined receptor (ligand).
- a phenotype e.g., for affinity for a predetermined receptor (ligand).
- peptide structures including the primary amino acid sequences, of peptides or peptidomimetics that interact with biological macromolecules.
- one method of identifying peptides that possess a desired structure or functional property, such as binding to a predetermined biological macromolecule (e.g., a receptor) involves the screening of a large library or peptides for individual library members which possess the desired structure or functional property confe ⁇ ed by the amino acid sequence of the peptide.
- each bacteriophage particle or cell serves as an individual library member displaying a single species of displayed peptide in addition to the natural bacteriophage or cell protein sequences.
- Each bacteriophage or cell contains the nucleotide sequence information encoding the particular displayed peptide sequence; thus, the displayed peptide sequence can be ascertained by nucleotide sequence determination of an isolated library member.
- a well-known peptide display method involves the presentation of a peptide sequence on the surface of a filamentous bacteriophage, typically as a fusion with a bacteriophage coat protein.
- the bacteriophage library can be incubated with an immobilized, predetermined macromolecule or small molecule (e.g., a receptor) so -115- that bacteriophage particles which present a peptide sequence that binds to the immobilized macromolecule can be differentially partitioned from those that do not present peptide sequences that bind to the predetermined macromolecule.
- the bacteriophage particles i.e., library members
- the bacteriophage particles which are bound to the immobilized macromolecule are then recovered and replicated to amplify the selected bacteriophage sub-population for a subsequent round of affinity enrichment and phage replication.
- the bacteriophage library members that are thus selected are isolated and the nucleotide sequence encoding the displayed peptide sequence is determined, thereby identifying the sequence(s) of peptides that bind to the predetermined macromolecule (e.g., receptor).
- the predetermined macromolecule e.g., receptor
- the fusion protein/vector DNA complexes can be screened against a predetermined macromolecule in much the same way as bacteriophage particles are screened in the phage-based display system, with the replication and sequencing ofthe DNA vectors in the selected fusion protein/vector DNA complexes serving as the basis for identification ofthe selected library peptide sequence(s).
- RNA molecules with the ability to bind a predetermined protein or a predetermined dye molecule were selected by alternate rounds of selection and PCR amplification (Tuerk and Gold, 1990; Ellington and Szostak, 1990).
- library members comprise a fusion protein having a first polypeptide portion with DNA binding activity and a second polypeptide portion having the library member unique peptide sequence; such methods are suitable for use in cell-free in vitro selection formats, among others.
- the displayed peptide sequences can be of varying lengths, typically from 3-5000 amino acids long or longer, frequently from 5-100 amino acids long, and often from about 8-15 amino acids long.
- a library can comprise library members having varying lengths of displayed peptide sequence, or may comprise library members having a fixed length of displayed peptide sequence. Portions or all ofthe displayed peptide sequence(s) can be random, pseudorandom, defined set kernal, fixed, or the like.
- the present display methods include methods for in vitro and in vivo display of single-chain antibodies, such as nascent scFv on polysomes or scfv displayed on phage, which enable large-scale screening of scfv libraries having broad diversity of variable region sequences and binding specificities.
- the present invention also provides random, pseudorandom, and defined sequence framework peptide libraries and methods for generating and screening those -117- libraries to identify useful compounds (e.g., peptides, including single-chain antibodies) that bind to receptor molecules or epitopes of interest or gene products that modify peptides or RNA in a desired fashion.
- useful compounds e.g., peptides, including single-chain antibodies
- the random, pseudorandom, and defined sequence framework peptides are produced from libraries of peptide library members that comprise displayed peptides or displayed single-chain antibodies attached to a polynucleotide template from which the displayed peptide was synthesized.
- the mode of attachment may vary according to the specific embodiment ofthe invention selected, and can include encapsulation in a phage particle or inco ⁇ oration in a cell.
- a method of affinity enrichment allows a very large library of peptides and single-chain antibodies to be screened and the polynucleotide sequence encoding the desired peptide(s) or single-chain antibodies to be selected.
- the polynucleotide can then be isolated and shuffled to recombine combinatorially the amino acid sequence of the selected peptide(s) (or predetermined portions thereof) or single-chain antibodies (or just VHI, VLI or CDR portions thereof).
- Using these methods one can identify a peptide or single-chain antibody as having a desired binding affinity for a molecule and can exploit the process of shuffling to converge rapidly to a desired high-affinity peptide or scfv.
- the peptide or antibody can then be synthesized in bulk by conventional means for any suitable use (e.g., as a therapeutic or diagnostic agent).
- a significant advantage ofthe present invention is that no prior information regarding an expected ligand structure is required to isolate peptide ligands or antibodies of interest.
- the peptide identified can have biological activity, which is meant to include at least specific binding affinity for a selected receptor molecule and, in some instances, will further include the ability to block the binding of other compounds, to stimulate or inhibit metabolic pathways, to act as a signal or messenger, to stimulate or inhibit cellular activity, and the like.
- the present invention also provides a method for shuffling a pool of polynucleotide sequences selected by affinity screening a library of polysomes displaying nascent peptides (including single-chain antibodies) for library members which bind to a predetermined receptor (e.g., a mammalian proteinaceous receptor such as, for example, a peptidergic hormone receptor, a cell surface receptor, an intracellular protein which binds to other protein(s) to form intracellular protein complexes such as hetero-dimers and the like) or epitope (e.g., an immobilized protein, glycoprotein, oligosaccharide, and the like).
- a predetermined receptor e.g., a mammalian proteinaceous receptor such as, for example, a peptidergic hormone receptor, a cell surface receptor, an intracellular protein which binds to other protein(s) to form intracellular protein complexes such as hetero-dimers and the like
- epitope e.g.,
- Polynucleotide sequences selected in a first selection round are pooled and the pool(s) is/are shuffled by in vitro and/or in vivo recombination to produce a shuffled pool comprising a population of recombined selected polynucleotide sequences.
- the recombined selected polynucleotide sequences are subjected to at least one subsequent selection round.
- the polynucleotide sequences selected in the subsequent selection round(s) can be used directly, sequenced, and/or subjected to one or more additional rounds of shuffling and subsequent selection.
- Selected sequences can also be back-crossed with polynucleotide sequences encoding neutral sequences (i.e., having insubstantial functional effect on binding), such as for example by back-crossing with a wild-type or naturally-occurring sequence substantially identical to a selected sequence to produce native-like functional peptides, which may be less immunogenic. Generally, during back-crossing subsequent selection is applied to retain the property of binding to the predetermined receptor (ligand).
- sequences Prior to or concomitant with the shuffling of selected sequences, the sequences can be mutagenized.
- selected library members are cloned in a prokaryotic vector (e.g., plasmid, phagemid, or bacteriophage) wherein a collection of individual colonies (or plaques) representing discrete library members are produced.
- a prokaryotic vector e.g., plasmid, phagemid, or bacteriophage
- Individual selected library members can then be manipulated (e.g., by site-directed WO 00/77262 PCT/USOO/l 6838
- sequence of an individual selected library member or pool can be manipulated to inco ⁇ orate random mutation, pseudorandom mutation, defined kernal mutation (i.e., comprising variant and invariant residue positions and/or comprising variant residue positions which can comprise a residue selected from a defined subset of amino acid residues), codon-based mutation, and the like, either segmentally or over the entire length ofthe individual selected library member sequence.
- the mutagenized selected library members are then shuffled by in vitro and/or in vivo recombinatorial shuffling as disclosed herein.
- the invention also provides peptide libraries comprising a plurality of individual library members ofthe invention, wherein (1) each individual library member of said plurality comprises a sequence produced by shuffling of a pool of selected sequences, and (2) each individual library member comprises a variable peptide segment sequence or single-chain antibody segment sequence which is distinct from the variable peptide segment sequences or single-chain antibody sequences of other individual library members in said plurality (although some library members may be present in more than one copy per library due to uneven amplification, stochastic probability, or the like).
- the invention also provides a product-by-process, wherein selected polynucleotide sequences having (or encoding a peptide having) a predetermined binding specificity are formed by the process of: (1) screemng a displayed peptide or displayed single-chain antibody library against a predetermined receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching library members which bind to the predetermined receptor or epitope to produce a pool of selected library members, (2) shuffling by recombination the selected library members (or amplified or cloned copies thereof) which binds the predetermined epitope and has -120- been thereby isolated and/or enriched from the library to generate a shuffled library, and (3) screening the shuffled library against the predetermined receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching shuffled library members which
- the present method can be used to shuffle, by in vitro and/or in vivo recombination by any ofthe disclosed methods, and in any combination, polynucleotide sequences selected by antibody display methods, wherein an associated polynucleotide encodes a displayed antibody which is screened for a phenotype (e.g., for affinity for binding a predetermined antigen (ligand).
- a phenotype e.g., for affinity for binding a predetermined antigen (ligand).
- the naturally-occurring germ line immunoglobulin heavy chain locus is composed of separate tandem a ⁇ ays of variable segment genes located upstream of a tandem array of diversity segment genes, which are themselves located upstream of a tandem array of joining (i) region genes, which are located upstream ofthe constant region genes.
- V-D-J rearrangement occurs wherein a heavy chain variable region gene (VH) is formed by rearrangement to form a fused D segment followed by rea ⁇ angement with a V segment to form a V-D-J joined product gene which, if productively rearranged, encodes a functional variable region (VH) of a heavy chain.
- VH heavy chain variable region gene
- light chain loci rea ⁇ ange one of several V segments with one of several J segments to form a gene encoding the variable region (NL) of a light chain.
- variable regions possible in immunoglobulins derives in part from the numerous combinatorial possibilities of joining V and i segments (and, in the case of heavy chain loci, D segments) during rearrangement in B cell development. Additional sequence diversity in the heavy chain variable regions arises from non-uniform rea ⁇ angements ofthe D segments during V-D-J joining and from
- antigen-selection of specific B cell clones selects for higher affinity variants having non-germline mutations in one or both ofthe heavy and light chain variable regions; a phenomenon refe ⁇ ed to as "affinity maturation" or
- affinity sha ⁇ ening typically, these “affinity sha ⁇ ening” mutations cluster in specific areas ofthe variable region, most commonly in the complementarity-dete ⁇ nining regions (CDRs).
- Combinatorial libraries of antibodies have been generated in bacteriophage lambda expression systems which may be screened as bacteriophage plaques or as colonies of lysogens (Huse et al, 1989); Caton and Koprowski, 1990; MuUinax et al, 1990; Persson et al, 1991).
- bacteriophage antibody display libraries and lambda phage expression libraries have been described (Kang et al, 1991; Clackson et al, 1991; McCafferty et al, 1990; Burton et al, 1991; Hoogenboom et al, 1991; Chang et al, 1991; Breitling et al, 1991; Marks et al, 1991, p.
- a bacteriophage antibody display library is screened with a receptor (e.g., polypeptide, carbohydrate, glycoprotein, nucleic acid) that is immobilized (e.g., by covalent linkage to a chromatography resin to enrich for reactive phage by affinity chromatography) and or labeled (e.g., to screen plaque or colony lifts).
- a receptor e.g., polypeptide, carbohydrate, glycoprotein, nucleic acid
- immobilized e.g., by covalent linkage to a chromatography resin to enrich for reactive phage by affinity chromatography
- labeled e.g., to screen plaque or colony lifts
- scfV single-chain fragment variable
- the first step generally involves obtaining the genes encoding VH and VL domains with desired binding properties; these V genes may be isolated from a specific hybridoma cell line, selected from a combinatorial V-gene library, or made by V gene synthesis.
- the single-chain Fv is formed by connecting the component V genes with an oligonucleotide that encodes an appropriately designed linker peptide, such as (Gly-Gly-Gly-Gly-Ser)3 or equivalent linker peptide(s).
- the linker bridges the C-terminus ofthe first V region and N-terminus ofthe second, ordered as either VH-linker-VL or VL-linker-VH'
- the scfv binding site can faithfully replicate both the affinity and specificity of its parent antibody combining site.
- scfv fragments are comprised of VH and VL domains linked into a single polypeptide chain by a flexible linker peptide.
- the scfv genes are assembled, they are cloned into a phagemid and expressed at the tip ofthe Ml 3 phage (or similar filamentous bacteriophage) as fusion proteins with the bacteriophage PIII -123- (gene 3) coat protein. Enriching for phage expressing an antibody of interest is accomplished by panning the recombinant phage displaying a population scfv for binding to a predetermined epitope (e.g., target antigen, receptor).
- a predetermined epitope e.g., target antigen, receptor
- the linked polynucleotide of a library member provides the basis for replication ofthe library member after a screening or selection procedure, and also provides the basis for the determination, by nucleotide sequencing, ofthe identity of the displayed peptide sequence or VH and VL amino acid sequence.
- the displayed peptide (s) or single-chain antibody (e. g., scfv) and/or its VH and VL domains or their CDRs can be cloned and expressed in a suitable expression system.
- polynucleotides encoding the isolated VH and VL domains will be ligated to polynucleotides encoding constant regions (CH and CL) to form polynucleotides encoding complete antibodies (e.g., chimeric or fully-human), antibody fragments, and the like.
- polynucleotides encoding the isolated CDRs will be grafted into polynucleotides encoding a suitable variable region framework (and optionally constant regions) to form polynucleotides encoding complete antibodies (e.g., humanized or fully-human), antibody fragments, and the like.
- Antibodies can be used to isolate preparative quantities ofthe antigen by immunoaffinity chromatography.
- neoplasia a disease that causes inflammation
- neoplasia a malignant neoplasia
- autoimmune disease a malignant neoplasia
- AIDS a malignant neoplasia
- cardiovascular disease a malignant neoplasia .
- infections a malignant neoplasia .
- stage disease e.g., neoplasia
- therapeutic application to treat disease such as for example: neoplasia, autoimmune disease, AIDS, cardiovascular disease, infections, and the like.
- VH and VL cassettes can themselves be diversified, such as by random, pseudorandom, or directed mutagenesis.
- VH and VL cassettes are diversified in or near the complementarity-determining regions (CDRS), -124- often the third CDR, CDR3.
- Enzymatic inverse PCR mutagenesis has been shown to be a simple and reliable method for constructing relatively large libraries of scfv site-directed hybrids (Stemmer et al, 1993), as has e ⁇ or-prone PCR and chemical mutagenesis (Deng et al, 1994).
- Riechmann Riechmann et al, 1993
- Barbas (Barbas et al, 1992) attempted to circumvent the problem of limited repertoire sizes resulting from using biased variable region sequences by randomizing the sequence in a synthetic CDR region of a human tetanus toxoid-binding Fab.
- CDR randomization has the potential to create approximately 1 x 10 CDRs for the heavy chain CDR3 alone, and a roughly similar number of variants ofthe heavy chain CDR1 and CDR2, and light chain CDR1-3 variants.
- the combination possibilities of CDR randomization of heavy and/or light chains requires generating a prohibitive number of bacteriophage clones to produce a clone library representing all possible combinations, the vast majority of which will be non-binding. Generation of such large numbers of primary transformants is not feasible with cu ⁇ ent transformation technology and bacteriophage display systems.
- Barbas Barbas et al, 1992
- 5 x 10 7 transformants which represents only a tiny fraction of the potential diversity of a library of thoroughly randomized CDRS.
- bacteriophage. display of scfv have aheady yielded a variety of useful antibodies and antibody fusion proteins.
- a bispecific single chain antibody has been shown to mediate efficient tumor cell lysis (Gruber et al, 1994).
- Intracellular expression of an anti-Rev scfv has been shown to inhibit HIN-1 virus replication in vitro (Duan et al, 1994), and intracellular expression of an anti-p21rar, scfv has been shown to inhibit meiotic maturation of Xenopus oocytes (Biocca et al, 1993).
- the in vitro and in vivo shuffling methods ofthe invention are used to recombine CDRs which have been obtained (typically via PCR amplification or cloning) from nucleic acids obtained from selected displayed antibodies.
- Such displayed antibodies can be displayed on cells, on bacteriophage particles, on polysomes, or any suitable antibody display system wherein the antibody is associated with its encoding nucleic acid(s).
- the CDRs are initially obtained from mRNA (or cDNA) from antibody-producing cells (e.g., plasma cells/splenocytes from an immunized wild-type mouse, a human, or a transgenic mouse capable of making a human antibody as in WO 92/03918, WO 93/12227, and WO 94/25585), including hybridomas derived therefrom.
- antibody-producing cells e.g., plasma cells/splenocytes from an immunized wild-type mouse, a human, or a transgenic mouse capable of making a human antibody as in WO 92/03918, WO 93/12227, and WO 94/25585
- Polynucleotide sequences selected in a first selection round are pooled and the pool(s) is/are shuffled by in vitro and/or in vivo recombination, especially shuffling of CDRs (typically shuffling heavy chain CDRs with other heavy chain CDRs and light chain CDRs with other light chain CDRs) to produce a shuffled pool comprising a population of recombined selected polynucleotide sequences.
- the recombined selected polynucleotide sequences are expressed in a selection format as a displayed antibody and subjected to at least one subsequent selection round.
- the polynucleotide sequences selected in the subsequent selection round(s) can be used directly, sequenced, and/or subjected to one or more additional rounds of shuffling and subsequent selection until an antibody ofthe desired binding affinity is obtained.
- Selected sequences can also be back-crossed with polynucleotide sequences encoding neutral antibody framework sequences (i.e., having insubstantial functional effect on antigen binding), such as for example by back-crossing with a human variable region framework to produce human-like sequence antibodies.
- neutral antibody framework sequences i.e., having insubstantial functional effect on antigen binding
- back-crossing with a human variable region framework to produce human-like sequence antibodies.
- subsequent selection is applied to retain the property of binding to the predetermined antigen.
- the valency ofthe target epitope may be varied to control the average binding affinity of selected scfv library members.
- the target epitope can be bound to a surface or substrate at varying densities, such as by including a competitor epitope, by dilution, or by other method known to those in the art.
- a high density (valency) of predetermined epitope can be used to enrich for scfV library members which have relatively low affimty, whereas a low density (valency) can preferentially enrich for higher affinity scfv library members.
- a collection of synthetic oligonucleotides encoding random, pseudorandom, or a defined sequence kernal set of peptide sequences can be inserted by ligation into a predetermined site (e.g., a CDR).
- a predetermined site e.g., a CDR
- the sequence diversity of one or more CDRs ofthe single-chain antibody cassette(s) can be expanded by mutating the CDR(s) with site-directed mutagenesis, CDR-replacement, and the like.
- the resultant DNA molecules can be propagated in a host for cloning and amplification prior to shuffling, or can be used directly (i.e., may avoid loss of diversity which may occur upon propagation in a host cell) and the selected library members subsequently shuffled.
- Displayed peptide/polynucleotide complexes which encode a variable segment peptide sequence of interest or a single-chain antibody of interest are selected from the library by an affinity enrichment technique. This is -127- accomplished by means of a immobilized macromolecule or epitope specific for the peptide sequence of interest, such as a receptor, other macromolecule, or other epitope species. Repeating the affinity selection procedure provides an enrichment of library members encoding the desired sequences, which may then be isolated for pooling and shuffling, for sequencing, and/or for further propagation and affinity enrichment.
- the library members without the desired specificity are removed by washing.
- the degree and stringency of washing required will be determined for each peptide sequence or single-chain antibody of interest and the immobilized predetermined macromolecule or epitope.
- a certain degree of control can be exerted over the binding characteristics ofthe nascent peptide/DNA complexes recovered by adjusting the conditions ofthe binding incubation and the subsequent washing.
- the temperature, pH, ionic strength, divalent cations concentration, and the volume and duration ofthe washing will select for nascent peptide/DNA complexes within particular ranges of affinity for the immobilized macromolecule. Selection based on slow dissociation rate, which is usually predictive of high affinity, is often the most practical route.
- nascent peptide/DNA or peptide/RNA complex is prevented, and with increasing time, nascent peptide/DNA or peptide/RNA complexes of higher and higher affinity are recovered.
- affinities of some peptides are dependent on ionic strength or cation concentration. This is a useful characteristic for peptides that will be used in affinity purification of various proteins when gentle conditions for removing the protein from the peptides are required.
- One variation involves the use of multiple binding targets (multiple epitope species, multiple receptor species), such that a scfv library can be simultaneously screened for a multiplicity of scfv which have different binding specificities. Given that the size of a scfv library often limits the diversity of potential scfv sequences, it is typically desirable to us scfv libraries of as large a size as possible.
- multiple predetermined epitope species can be concomitantly screened in a single library, or sequential screening against a number of epitope species can be used.
- multiple target epitope species each encoded on a separate bead (or subset of beads) can be mixed and incubated with a polysome-display scfv library under suitable binding conditions.
- the collection of beads, comprising multiple epitope species can then be used to isolate, by affinity selection, scfv library members.
- subsequent affinity screening rounds can include the same mixture of beads, subsets thereof, or beads containing only one or two individual epitope species. This approach affords efficient screening, and is compatible with laboratory automation, batch processing, and high throughput screening methods.
- a variety of techniques can be used in the present invention to diversify a peptide library or single-chain antibody library, or to diversify, prior to or concomitant with shuffling, around variable segment peptides found in early rounds of panning to have sufficient binding activity to the predetermined macromolecule or epitope.
- the positive selected peptide/polynucleotide complexes are sequenced to determine the identity ofthe active peptides.
- Oligonucleotides are then synthesized based on these active peptide sequences, employing a low level of all bases inco ⁇ orated at each step to produce slight variations ofthe primary oligonucleotide sequences.
- This mixture of (slightly) degenerate oligonucleotides is then cloned into the variable segment sequences at the appropriate locations.
- This method produces systematic, controlled variations ofthe starting peptide sequences, which can then be shuffled. It requires, however, that individual positive nascent peptide/polynucleotide complexes be sequenced before mutagenesis, and thus is useful for expanding the diversity of small numbers of recovered complexes and selecting variants having higher binding affinity and/or higher binding specificity.
- mutagenic PCR amplification of positive selected peptide/polynucleotide complexes is done prior to sequencing.
- the same general approach can be employed with single-chain antibodies in order to expand the diversity and enhance the binding affinity/specificity, typically by diversifying CDRs or adjacent framework regions prior to or concomitant with shuffling.
- shuffling reactions can be spiked with mutagenic oligonucleotides capable of in vitro recombination with the selected library members can be included.
- mixtures of synthetic oligonucleotides and PCR produced polynucleotides can be added to the in vitro shuffling mix and be inco ⁇ orated into resulting shuffled library members (shufflants).
- the present invention of shuffling enables the generation of a vast library of CDR-variant single-chain antibodies.
- One way to generate such antibodies is to insert synthetic CDRs into the single-chain antibody and/or CDR randomization prior to or concomitant with shuffling.
- the sequences ofthe synthetic CDR cassettes are selected by referring to known sequence data of human CDR and are selected in the discretion ofthe practitioner according to the following guidelines: synthetic CDRs will have at least 40 percent positional sequence identity to known CDR sequences, and preferably will have at least 50 to 70 percent positional sequence identity to known CDR sequences.
- a collection of synthetic CDR sequences can be generated by synthesizing a collection of oligonucleotide sequences on the basis of naturally-occurring human CDR sequences listed in Kabat (Kabat et al, 1991); the pool (s) of synthetic CDR sequences are calculated to encode CDR peptide sequences having at least 40 percent sequence identity to at least one known naturally-occurring human CDR sequence.
- a collection of naturally-occurring CDR sequences may be compared to generate consensus sequences so that amino acids used at a residue position frequently (i.e., in at least 5 percent of known CDR sequences) are inco ⁇ orated into the synthetic CDRs at the co ⁇ esponding position(s).
- oligonucleotides encoding CDR peptide sequences encompassing all or most permutations ofthe observed natural sequence variations is synthesized.
- a collection of human VH CDR sequences have carboxy-terminal amino acids which are either Tyr, Val, Phe, or Asp, then the pool(s) of synthetic CDR oligonucleotide sequences are designed to allow the carboxy-terminal CDR residue to be any of these amino acids.
- residues other than those which naturally-occur at a residue position in the collection of CDR sequences are inco ⁇ orated: conservative amino acid substitutions are frequently inco ⁇ orated and up to 5 residue positions may be varied to inco ⁇ orate non-conservative amino acid substitutions as compared to known naturally-occurring CDR sequences.
- Such CDR sequences can be used in primary library members (prior to first round screening) and/or can be used to spike in vitro shuffling reactions of selected library member sequences. Construction of such pools of defined and/or degenerate sequences will be readily accomplished by those of ordinary skill in the art.
- the collection of synthetic CDR sequences comprises at least one member that is not known to be a naturally-occurring CDR sequence. It is within the discretion ofthe practitioner to include or not include a portion of random or pseudorandom sequence co ⁇ esponding to N region addition in the heavy chain CDR; the N region sequence ranges from 1 nucleotide to about 4 nucleotides occurring at V-D and D-J junctions.
- a collection of synthetic heavy chain CDR sequences comprises at least about 100 unique CDR sequences, typically at least about 1,000 unique CDR sequences, preferably at least about 10,000 unique CDR sequences, frequently more than 50,000 unique CDR sequences; however, usually not more than about 1 x 10 6 unique CDR sequences are included in the collection, although occasionally 1 x 107 to 1 X 108 unique CDR sequences are present, especially if conservative amino acid substitutions are permitted at positions where the conservative amino acid substituent is not present or is rare (i.e., less than 0.1 percent) in that position in naturally-occurring human CDRS.
- the number of unique CDR sequences included in a library should not exceed the expected number of primary transformants in the library by more than a factor of 10.
- Such single-chain antibodies generally bind of about at least 1 x 10 m-, preferably with an affinity of about at least 5 x 10 7 M-1, more preferably with an affinity of at least 1 x 10 8 M-1 to 1 x 10 9 M-1 or more, sometimes up to 1 x 10 10 M-1 or more.
- the predetermined antigen is a human protein, such as for example a human cell surface antigen (e.
- CD4, CD8, IL-2 receptor, EGF receptor, PDGF receptor other human biological macromolecule (e.g., thrombomodulin, protein C, carbohydrate antigen, sialyl Lewis antigen, Lselectin), or nonhuman disease associated macromolecule (e.g., bacterial LPS, virion capsid protein or envelope glycoprotein) and the like.
- human biological macromolecule e.g., thrombomodulin, protein C, carbohydrate antigen, sialyl Lewis antigen, Lselectin
- nonhuman disease associated macromolecule e.g., bacterial LPS, virion capsid protein or envelope glycoprotein
- High affinity single-chain antibodies ofthe desired specificity can be engineered and expressed in a variety of systems.
- scfv have been produced in plants (Firek et al, 1993) and can be readily made in prokaryotic systems (Owens and Young, 1994; Johnson and Bird, 1991).
- the single-chain antibodies can be used as a basis for constructing whole antibodies or various fragments thereof (Kettleborough et al, 1994).
- the variable region encoding sequence may be isolated (e.g., by PCR amplification or subcloning) and spliced to a sequence encoding a desired human constant region to encode a human sequence antibody more suitable for human therapeutic uses where immunogenicity is preferably minimized.
- the polynucleotide(s) having the resultant fully human encoding sequence(s) can be expressed in a host cell (e.g., from an expression vector in a mammalian cell) and purified for pharmaceutical formulation.
- the DNA expression constructs will typically include an expression control DNA sequence operably linked to the coding sequences, including naturally-associated or heterologous promoter regions.
- the expression control sequences will be eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells.
- the DNA sequences will be expressed in hosts after the sequences have been operably linked to an expression control sequence (i.e., positioned to ensure the transcription and translation ofthe structural gene).
- expression vectors are typically replicable in the host organisms either as episomes or as an integral part ofthe host chromosomal DNA.
- expression vectors will contain selection markers, e.g., tefracycline or neomycin, to permit detection of those cells transformed with the desired DNA sequences (see, e.g., USPN 4,704,362, which is inco ⁇ orated herein by reference).
- mammalian tissue cell culture may also be used to produce the polypeptides ofthe present invention (see Winnacker, 1987), which is inco ⁇ orated herein by reference).
- Eukaryotic cells are actually preferred, because a number of suitable host cell lines capable of secreting intact immunoglobulins have been developed in the art, and include the CHO cell lines, various COS cell lines, HeLa cells, and myeloma cell lines, but preferably transformed Bcells or hybridomas.
- Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen et al, 1986), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
- expression control sequences such as an origin of replication, a promoter, an enhancer (Queen et al, 1986), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.
- Preferred expression control sequences are promoters derived from immunoglobulin genes, cytomegalovirus, SV40, Adenovirus, Bovine Papilloma
- Enhancers are cis-acting sequences of between 10 to 300 bp that increase transcription by a promoter. Enhancers can effectively increase transcription when either 51 or 31 to the transcription unit. They are also effective if located within an intron or within the coding sequence itself.
- viral enhancers including SV40 enhancers, cytomegalovirus enhancers, polyoma enhancers, and adenovirus enhancers. Enhancer sequences from mammalian systems are also commonly used, such as the mouse immunoglobulin heavy chain enhancer.
- Mammalian expression vector systems will also typically include a selectable marker gene.
- suitable markers include, the dihydrofolate reductase gene (DHFR), the thymidine kinase gene (TK), or prokaryotic genes conferring drug resistance.
- the first two marker genes prefer the use of mutant cell lines that lack the ability to grow without the addition of thymidine to the growth medium. Transformed cells can then be identified by their ability to grow on non-supplemented media.
- prokaryotic drug resistance genes useful as markers include genes conferring resistance to G418, mycophenolic acid and hygromycin.
- the vectors containing the DNA segments of interest can be transfe ⁇ ed into the host cell by well-known methods, depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment, lipofection, or electroporation may be used for other cellular hosts. Other methods used to transform mammalian cells include the use of Polybrene, protoplast fusion, liposomes, electroporation, and micro-injection (see, generally, Sambrook et al, 1982 and 1989).
- the antibodies, individual mutated immunoglobulin chains, mutated antibody fragments, and other immunoglobulin polypeptides ofthe invention can be purified according to standard procedures ofthe art, including ammomum sulfate precipitation, fraction column chromatography, gel electrophoresis and the like (see, generally. Scopes, 1982). Once purified, partially or to homogeneity as desired, the polypeptides may then be used therapeutically or in developing and performing assay procedures, immunofluorescent stainings, and the like (see, generally, Lefkovits and Pernis, 1979 and 1981; Lefkovits, 1997).
- the antibodies generated by the method ofthe present invention can be used for diagnosis and therapy.
- they can be used to treat cancer, autoimmune diseases, or viral infections.
- the antibodies will typically bind to an antigen expressed preferentially on cancer cells, such as erbB-2, CEA, CD33, and many other antigens and binding members well known to those skilled in the art.
- This invention provides a method for selecting a subset of polynucleotides from a starting set of polynucleotides, which method is based on the ability to discriminate one or more selectable features (or selection markers) present anywhere in a working polynucleotide, so as to allow one to perform selection for (positive selection) &/or against (negative selection) each selectable polynucleotide.
- a method is provided termed end-selection, which method is based on the use of a selection marker located in part or entirely in a terminal region of a selectable polynucleotide, and such a selection marker may be termed an "end- selection marker".
- End-selection may be based on detection of naturally occurring sequences or on detection of sequences introduced experimentally (including by any mutagenesis procedure mentioned herein and not mentioned herein) or on both, even within the same polynucleotide.
- An end-selection marker can be a structural selection marker or a functional selection marker or both a structural and a functional selection marker.
- An end-selection marker may be comprised of a polynucleotide sequence or of a polypeptide sequence or of any chemical structure or of any biological or biochemical tag, including markers that can be selected using methods based on the detection of radioactivity, of enzymatic activity, of fluorescence, of any optical feature, of a magnetic property (e.g. using magnetic beads), of immunoreactivity, and of hybridization.
- End-selection may be applied in combination with any method serviceable for performing mutagenesis.
- mutagenesis methods include, but are not limited to, methods described herein (supra and infra). Such methods include, by way of non- limiting exemplification, any method that may be refe ⁇ ed herein or by others in the art by any ofthe following terms: “saturation mutagenesis”, “shuffling”, “recombination”, “re-assembly”, “e ⁇ or-prone PCR”, “assembly PCR”, “sexual PCR”, “crossover PCR”, “oligonucleotide primer-directed mutagenesis”, “recursive (&/or exponential) ensemble mutagenesis (see Arkin and Youvan, 1992)", “cassette mutagenesis”, “in vivo mutagenesis”, and “in vitro mutagenesis”.
- end- selection may be performed on molecules produced by any mutagenesis &/or amplification method (see, e.g., Arnold, 1993; Caldwell and Joyce, 1992; Stemmer, 1994; following which method it is desirable to select for (including to screen for the presence of) desirable progeny molecules.
- end-selection may be applied to a polynucleotide apart from any mutagenesis method.
- end-selection as provided herein, can be used in order to facilitate a cloning step, such as a step of ligation to another polynucleotide (including ligation to a vector).
- This invention thus provides for end- selection as a serviceable means to facilitate library construction, selection &/or enrichment for desirable polynucleotides, and cloning in general.
- end-selection can be based on
- end-selection can be based on both (positive) selection for, and on (negative) selection against, a polynucleotide.
- End-selection, along with other methods of selection &/or screening, can be performed in an iterative fashion, with any combination of like or unlike selection &/or screening methods and serviceable mutagenesis methods, all of which can be performed in an iterative fashion and in any order, combination, and permutation.
- end- selection may also be used to select a polynucleotide is at least in part: circular (e.g. a plasmid or any other circular vector or any other polynucleotide that is partly circular), &/or branched, &/or modified or substituted with any chemical group or moiety.
- circular e.g. a plasmid or any other circular vector or any other polynucleotide that is partly circular
- &/or branched &/or modified or substituted with any chemical group or moiety.
- a polynucleotide may be a circular molecule comprised of an intermediate or central region, which region is flanked on a 5' side by a 5' flanking region (which, for the pu ⁇ ose of end-selection, serves in like manner to a 5' terminal region of a non-circular polynucleotide) and on a 3' side by a 3' terminal region (which, for the pu ⁇ ose of end-selection, serves in like manner to a 3' terminal region of a non-circular polynucleotide).
- end-selection of a linear polynucleotide is performed using a general approach based on the presence of at least one end-selection marker located at or near a polynucleotide end or terminus (that can be either a 5' end or a 3' end).
- end-selection is based on selection for a specific sequence at or near a terminus such as, but not limited to, a sequence recognized by an enzyme that recognizes a polynucleotide sequence.
- An enzyme that recognizes and catalyzes a chemical modification of a polynucleotide is refe ⁇ ed to herein as a polynucleotide- acting enzyme.
- serviceable polynucleotide-acting enzymes are exemplified non-exclusively by enzymes with polynucleotide-cleaving activity, enzymes with polynucleotide-methylating activity, enzymes with polynucleotide-ligating activity, and enzymes with a plurality of distinguishable enzymatic activities (including non-exclusively, e.g., both polynucleotide-cleaving activity and polynucleotide-ligating activity).
- polynucleotide-acting enzymes thus also include any commercially available or non-commercially available polynucleotide endonucleases and their companion methylases including those catalogued at the website http://www.neb.com/rebase, and those mentioned in the following cited reference (Roberts and Macelis, 1996).
- Prefe ⁇ ed polynucleotide endonucleases include - but are not limited to - type II restriction enzymes (including type IIS), and include enzymes that cleave both strands of a double stranded polynucleotide (e.g.
- relevant polynucleotide-acting enzymes also include any enzymes that may be developed in the future, though cu ⁇ ently unavailable, that are serviceable for generating a ligation compatible end, preferably a sticky end, in a polynucleotide.
- a serviceable selection marker is a restriction site in a polynucleotide that allows a co ⁇ esponding type II (or type IIS) restriction enzyme to cleave an end ofthe polynucleotide so as to provide a ligatable end (including a blunt end or alternatively a sticky end with at least a one base overhang) that is serviceable for a desirable ligation reaction without cleaving the polynucleotide internally in a manner that destroys a desired internal sequence in the polynucleotide.
- a co ⁇ esponding type II (or type IIS) restriction enzyme to cleave an end ofthe polynucleotide so as to provide a ligatable end (including a blunt end or alternatively a sticky end with at least a one base overhang) that is serviceable for a desirable ligation reaction without cleaving the polynucleotide internally in a manner that destroys a desired internal sequence in the polynucleotide
- restriction sites that are not contained, or alternatively that are not expected to be contained, or alternatively that unlikely to be contained (e.g. when sequence information regarding a working polynucleotide is incomplete) internally in a polynucleotide to be subjected to end-selection.
- restriction sites that occur relatively infrequently are usually prefe ⁇ ed over those that occur more frequently.
- there are occasions where internal cleavage of a polypeptide is desired, e.g. to achieve recombination or other mutagenic procedures along with end-selection.
- a partial digestion reaction i.e. a digestion reaction that proceeds to partial completion
- a digestion reaction can be used to achieve digestion at a recognition site in a terminal region while sparing a susceptible restriction site that occurs internally in a polynucleotide and that is recognized by the same enzyme.
- partial digest are useful because it is appreciated that certain enzymes show preferential cleavage ofthe same recognition sequence depending on the location and environment in which the recognition sequence occurs.
- protection methods can be used to selectively protect specified restriction sites (e.g. internal sites) against unwanted digestion by enzymes that would otherwise cut a working polypeptide in response to the presence of those sites; and that such protection methods include modifications such as methylations and base substitutions (e.g. U instead of T) that inhibit an unwanted enzyme activity.
- restriction enzymes that are rare enough (e.g. having very long recognition sequences) to create large (e.g. megabase-long) restriction fragments, and that protection approaches (e.g. by methylation) are serviceable for increasing the rarity of enzyme cleavage sites.
- M.EM « II (mCGCG) to increase the apparent rarity of Not I approximately twofold is but one example among many (Qiang et al, 1990; Nelson et al, 1984; Maxam and Gilbert, 1980; Raleigh and Wilson, 1986).
- the use of rare restriction sites is prefe ⁇ ed.
- the frequency of occurrence of a restriction site is determined by the number of nucleotides contained therein, as well as by the ambiguity ofthe base requirements contained therein.
- a restriction site composed of, for example, 8 specific nucleotides (e.g. the
- Not I site or GC/GGCCGC, with an estimated relative occu ⁇ ence of 1 in 4 8 , i.e. 1 in 65,536, random 8-mers) is relatively more infrequent than one composed of, for example, 6 nucleotides (e.g. the Sma I site or CCC/GGG, having an estimated relative occu ⁇ ence of 1 in 4 6 , i.e. 1 in 4,096, random 6-mers), which in turn is relatively more infrequent than one composed of, for example, 4 nucleotides (e.g. the Msp I site or C/CGG, having an estimated relative occurrence of 1 in 4 4 , i.e. 1 in 256, random 4- mers).
- 6 nucleotides e.g. the Sma I site or CCC/GGG, having an estimated relative occu ⁇ ence of 1 in 4 6 , i.e. 1 in 4,096, random 6-mers
- 4 nucleotides e.g. the Msp I site or C/
- a restriction site having no ambiguous (but only specific) base requirements e.g. the Fin I site or GTCCC, having an estimated relative occurrence of 1 in 4 5 , i.e. 1 in 1024, random 5-mers
- W A or T
- W A or T
- N A or C or G or T
- the Asu I site or G/GNCC having an estimated relative occu ⁇ ence of 1 in 4x4x1x4x4, i.e. 1 in 256 - random 5-mers).
- These relative occu ⁇ ences are considered general estimates for actual polynucleotides, because it is appreciated that specific nucleotide bases (not to mention specific nucleotide sequences) occur with dissimilar frequencies in specific polynucleotides, in specific species of organisms, and in specific groupings of organisms. For example, it is appreciated that the % G+C contents of different species of organisms are often very different and wide ranging.
- relatively more infrequent restriction sites include - in a non-limiting fashion - preferably those sites composed at least a 4 nucleotide sequence, more preferably those composed at least a 5 nucleotide sequence, more preferably still those composed at least a 6 nucleotide sequence (e.g. the BamH I site or G/GATCC, the Bgl II site or A/GATCT, the Pst I site or CTGCA/G, and the Xba I site or T/CTAGA), more preferably still those composed at least a 7 nucleotide sequence, more preferably still those composed of an 8 nucleotide sequence nucleotide sequence (e.g. the Asc I site or GG/CGCGCC, the Not I site or
- an 8 nucleotide sequence nucleotide sequence e.g. the Asc I site or GG/CGCGCC, the Not I site or
- GC/GGCCGC the Pac I site or TTAAT/TAA, the Eme I site or GTTT/AAAC, the Srf I site or GCCC/GGGC, the Sse838 I site or CCTGCA/GG, and the Swa I site or ATTT/AAAT), more preferably still those composed of a 9 nucleotide sequence, and even more preferably still those composed of at least a 10 nucleotide sequence (e.g. the BspG I site or CG/CGCTGGAC). It is further appreciated that some restriction sites (e.g. for class IIS enzymes) are comprised of a portion of relatively high specificity (i.e.
- relatively high specificity i.e. the CTGAAG portion
- relatively low specificity i.e. the N16 sequence
- a serviceable end-selection marker is a terminal sequence that is recognized by a polynucleotide-acting enzyme that recognizes a specific polynucleotide sequence.
- serviceable polynucleotide-acting enzymes also include other enzymes in addition to classic type II restriction enzymes.
- serviceable polynucleotide-acting enzymes also include gyrases, helicases, recombinases, relaxases, and any enzymes related thereto.
- topoisomerases which have been categorized by some as a subset ofthe gyrases
- any other enzymes that have polynucleotide- cleaving activity (including preferably polynucleotide-nicking activity) &/or polynucleotide-ligating activity.
- preferred topoisomerase enzymes are topoisomerase I enzymes, which is available from many commercial sources (Epicentre Technologies, Madison, WI; Invitrogen, Carlsbad, CA; Life Technologies, Gathesburg, MD) and conceivably even more private sources. It is appreciated that similar enzymes may be developed in the future that are serviceable for end-selection as provided herein.
- a particularly prefe ⁇ ed topoisomerase I enzyme is a topoisomerase I enzyme of vaccinia virus origin, that has a specific recognition sequence (e.g. 5' ... AAGGG...3') and has both polynucleotide-nicking activity and polynucleotide-ligating activity. Due to the specific nicking-activity of this enzyme (cleavage of one strand), internal recognition sites are not prone to polynucleotide destruction resulting from the nicking activity (but rather remain annealed) at a temperature that causes denaturation of a terminal site that has been nicked.
- a specific recognition sequence e.g. 5' ... AAGGG...3'
- Due to the specific nicking-activity of this enzyme cleavage of one strand
- internal recognition sites are not prone to polynucleotide destruction resulting from the nicking activity (but rather remain annealed) at a temperature that causes denaturation of a terminal site that has been
- a nicking site for topoisomerase-based end- selection be no more than 100 nucleotides from a terminus, more preferably no more than 50 nucleotides from a terminus, more preferably still no more than 25 nucloetides from a terminus, even more preferably still no more than 20 nucleotides from a terminus, even more preferably still no more than 15 nucleotides from a terminus, even more preferably still no more than 10 nucleotides from a terminus, even more preferably still no more than 8 nucleotides from a terminus, even more preferably still no more than 6 nucleotides from a terminus, and even more preferably still no more than 4 nucleotides from a terminus.
- nicking site for topoisomerase-based end- selection is 4 nucleotides from a terminus
- nicking produces a single stranded oligo of 4 bases (in a terminal region) that can be denatured from its complementary strand in an end-selectable polynucleotide; this provides a sticky end (comprised of 4 bases) in a polynucleotide that is serviceable for an ensuing ligation reaction.
- a cloning vector preferably an expression vector
- compatible sticky ends can be generated in a cloning vector by any means including by restriction enzyme- based means.
- terminal nucleotides (comprised of 4 terminal bases in this specific example) in an end-selectable polynucleotide terminus are thus wisely chosen to provide compatibility with a sticky end generated in a cloning vector to which the polynucleotide is to be ligated.
- internal nicking of an end-selectable polynucleotide e.g.
- 500 bases from a terminus produces a single stranded oligo of 500 bases that is not easily denatured from its complementary strand, but rather is serviceable for repair
- This invention thus provides a method - e.g. that is vaccinia topoisomerase- based &/or type II (or IIS) restriction endonuclease-based &/or type III restriction endonuclease-based &/or nicking enzyme-based (e.g. using N. 2-tetNB I) - for producing a sticky end in a working polynucleotide, which end is ligation compatible, and which end can be comprised of at least a 1 base overhang.
- vaccinia topoisomerase- based &/or type II (or IIS) restriction endonuclease-based &/or type III restriction endonuclease-based &/or nicking enzyme-based e.g. using N. 2-tetNB I
- such a sticky end is comprised of at least a 2-base overhang, more preferably such a sticky end is comprised of at least a 3-base overhang, more preferably still such a sticky end is comprised of at least a 4-base overhang, even more preferably still such a sticky end is comprised of at least a 5-base overhang, even more preferably still such a sticky end is comprised of at least a 6-base overhang.
- Such a sticky end may also be comprised of at least a 7-base overhang, or at least an 8-base overhang, or at least a 9- base overhang, or at least a 10-base overhang, or at least 15-base overhang, or at least a 20-base overhang, or at least a 25-base overhang, or at least a 30-base overhang.
- These overhangs can be comprised of any bases, including A, C, G, or T.
- sticky end overhangs introduced using topoisomerase or a nicking enzyme can be designed to be unique in a ligation environment, so as to prevent unwanted fragment reassemblies, such as self- dimerizations and other unwanted concatamerizations.
- a plurality of sequences can be introduced into a terminal region of an end- selectable polynucleotide by the use of an oligo in a polymerase-based reaction.
- an oligo can be used to provide a prefe ⁇ ed 5' terminal region that is serviceable for topoisomerase I-based end- -144- selection, which oligo is comprised of: a 1-10 base sequence that is convertible into a sticky end (preferably by a vaccinia topoisomerase I), a ribosome binding site (i.e. and
- RBS that is preferably serviceable for expression cloning
- optional linker sequence followed by an ATG start site and a template-specific sequence of 0-100 bases (to facilitate annealment to the template in the a polymerase-based reaction).
- an oligo can be used to provide a prefe ⁇ ed 3' terminal region that is serviceable for topoisomerase I- based end-selection, which oligo is comprised of: a 1-10 base sequence that is convertible into a sticky end (preferably by a vaccinia topoisomerase I), and optional linker sequence followed by a template-specific sequence of 0-100 bases (to facilitate annealment to the template in the a polymerase-based reaction).
- end-selection can be used to distinguish and separate parental template molecules (e.g. to be subjected to mutagenesis) from progeny molecules (e.g. generated by mutagenesis).
- a first set of primers lacking in a topoisomerase I recognition site, can be used to modify the terminal regions ofthe parental molecules (e.g. in polymerase-based amplification).
- a different second set of primers e.g. having a topoisomerase I recognition site
- topoisomerase I-based end-selection can then facilitate, not only discernment, but selective topoisomerase I-based ligation ofthe desired progeny molecules.
- Annealment of a second set of primers to thusly amplified parental molecules can be facilitated by including sequences in a first set of primers (i.e. primers used for amplifying a set parental molecules) that are similar to a toposiomerase I recognition site, yet different enough to prevent functional toposiomerase I enzyme recognition.
- sequences that diverge from the AAGGG site by anywhere from 1 base to all 5 10 bases can be inco ⁇ orated into a first set of primers (to be used for amplifying the parental templates prior to subjection to mutagenesis).
- a parental molecule can be amplified using the following exemplary - but by no means limiting - set of forward and reverse primers:
- (N) ⁇ o- ⁇ oo represents preferably a 10 to 100 nucleotide-long template-specific sequence, more preferably a 10 to 20 50 nucleotide-long template-specific sequence, more preferably still a 10 to 30 nucleotide- long template-specific sequence, and even more preferably still a 15 to 25 nucleotide-long template-specific sequence.
- amplified parental molecules can then be subjected to mutagenesis using one or more sets of forward and reverse primers that do have a true topoisomerase I recognition site.
- a parental molecule can be used as templates for the generation of a mutagenized progeny molecule -Housing the following exemplary - but by no means limiting - second set of forward and reverse primers:
- primers sets not specifically mentioned can be used as first, second, or subsequent sets of primers for end-selection consistent with this invention.
- type II restriction enzyme sites can be inco ⁇ orated (e.g. an Asc I site in the above example).
- the experimentalist can inco ⁇ orate one or more N,N,G/T triplets into a serviceable primer in order to subject a working polynucleotide to saturation mutagenesis.
- use of a second and/or subsequent set of primers can achieve dual goals of introducing a topoisomerase I site and of generating mutations in a progeny polynucleotide.
- a serviceable end-selection marker is an enzyme recognition site that allows an enzyme to cleave (including nick) a polynucleotide at a specified site, to produce a ligation-compatible end upon denaturation of a generated single stranded oligo. Ligation ofthe produced polynucleotide end can then be accomplished by the same enzyme (e.g. in the case of vaccinia virus topoisomerase I), or alternatively with the use of a different enzyme.
- any serviceable end-selection markers whether like (e.g. two vaccinia virus topoisomerase I recognition sites) or unlike (e.g.
- a class II restriction enzyme recognition site and a vaccinia virus topoisomerase I recognition site can be used in combination to select a polynucleotide.
- Each selectable polynucleotide can thus have one or more end-selection markers, and they can be like or unlike end-selection markers.
- a plurality of end- selection markers can be located on one end of a polynucleotide and can have overlapping sequences with each other.
- a nicking enzyme e.g. N. BstNB I, which cleaves only one strand at 5' ...GAGTCNNNN/N...3'
- a source of polynucleotide-ligating activity in order to achieve end-selection.
- a recognition site for N e.g. N. BstNB I, which cleaves only one strand at 5' ...GAGTCNNNN/N...3'
- this approach allows one to achieve direction cloning (including expression cloning). Specifically, this approach can be used for the achievement of: direct ligation (i.e. without subjection to a classic restriction- purification-ligation reaction, that is susceptible to a multitude of potential problems from an initial restriction reaction to a ligation reaction dependent on the use of T4 DNA ligase); separation of progeny molecules from original template molecules (e.g. original template molecules lack topoisomerase I sites that not introduced until after mutagenesis), obviation ofthe need for size separation steps (e.g.
- Shuffling can also be used to recombinatorially diversify a pool of selected library members obtained by screening a two-hybrid screening system to identify library members which bind a predetermined polypeptide sequence.
- the selected library members are pooled and shuffled by in vitro and/or in vivo recombination.
- the shuffled pool can then be screened in a yeast two hybrid system to select library members which bind said predetermined polypeptide sequence (e. g., and SH2 domain) or which bind an alternate predetermined polypeptide sequence (e.g., an SH2 domain from another protein species).
- Polynucleotides encoding two hybrid proteins, one consisting ofthe yeast Gal4 DNA-binding domain fused to a polypeptide sequence of a known protein and the other consisting ofthe Gal4 activation domain fused to a polypeptide sequence of a second protein, are constructed and introduced into a yeast host cell. Intermolecular binding between the two fusion proteins reconstitutes the Gal4 DNA-binding domain with the Gal4 activation domain, which leads to the transcriptional activation of a reporter gene (e.g., lacz, HIS3) which is operably linked to a Gal4 binding site.
- a reporter gene e.g., lacz, HIS3
- the two-hybrid method is used to identify novel polypeptide sequences which interact with a known protein (Silver and Hunt, 1993;
- Sequences selected by a two-hybrid system can be pooled and shuffled and introduced into a two-hybrid system for one or more subsequent rounds of screening to identify polypeptide sequences which bind to the hybrid containing the predetermined binding sequence.
- the sequences thus identified can be compared to identify consensus sequence(s) and consensus sequence kernals.
- One microgram samples of template DNA are obtained and treated with UN. light to cause the formation of dimers, including TT dimers, particularly purine dimers.
- UN. exposure is limited so that only a few photoproducts are generated per gene on the template D ⁇ A sample.
- Multiple samples are treated with UN. light for varying periods of time to obtain template D ⁇ A samples with varying numbers of dimers from UN. exposure.
- a random priming kit which utilizes a non-proofreading polymease for example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems
- a non-proofreading polymease for example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems
- the priming protocols such as described in the Prime-It II Random Primer Labeling kit may be utilized to extend the primers.
- the dimers formed by UN. exposure serve as a roadblock for the extension by the non-proofreading polymerase.
- a pool of random size polynucleotides is present after extension with the random primers is finished.
- the present invention is further directed to a method for generating a selected mutant polynucleotide sequence (or a population of selected polynucleotide sequences) typically in the form of amplified and/or cloned polynucleotides, whereby the selected polynucleotide sequences(s) possess at least one desired phenotypic characteristic (e.g., encodes a polypeptide, promotes transcription of linked polynucleotides, binds a protein, and the like) which can be selected for.
- a desired phenotypic characteristic e.g., encodes a polypeptide, promotes transcription of linked polynucleotides, binds a protein, and the like
- One method for identifying hybrid polypeptides that possess a desired structure or functional property involves the screemng of a large library of polypeptides for individual library members which possess the desired structure or functional property conferred by the amino acid sequence ofthe polypeptide.
- a predetermined biological macromolecule e.g., a receptor
- the present invention provides a method for generating libraries of displayed polypeptides or displayed antibodies suitable for affinity interaction screening or phenotypic screening.
- the method comprises (1) obtaimng a first plurality of selected library members comprising a displayed polypeptide or displayed antibody and an associated polynucleotide encoding said displayed polypeptide or displayed antibody, and obtaining said associated polynucleotides or copies thereof wherein said associated polynucleotides comprise a region of substantially identical sequences, optimally introducing mutations into said polynucleotides or copies, (2) pooling the polynucleotides or copies, (3) producing smaller or shorter polynucleotides by interrupting a random or particularized priming and synthesis process or an amplification process, and (4) performing amplification, preferably PCR amplification, and optionally mutagenesis to homologously recombine the newly synthesized polynucleotides.
- the means for blocking or interrupting the amplification or synthesis process is by utilization of uv light, DNA adducts, DNA binding proteins.
- the DNA adducts, or polynucleotides comprising the DNA adducts are removed from the polynucleotides or polynucleotide pool, such as by a process including heating the solution comprising the DNA fragments prior to further processing.
- One microgram samples of template D ⁇ A are obtained and treated with UN. light to cause the formation of dimers, including TT dimers, particularly purine dimers.
- U.N. exposure is limited so that only a few photoproducts are generated per gene on the template D ⁇ A sample.
- Multiple samples are treated with U.N. light for varying periods of time to obtain template D ⁇ A samples with varying numbers of dimers from UN. exposure.
- a random priming kit which utilizes a non-proofreading polymerase (for example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems) is utilized to generate different size polynucleotides by priming at random sites on templates which are prepared by U.N. light (as described above) and extending along the templates.
- the priming protocols such as described in the Prime-It II Random Primer Labeling kit may be utilized to extend the primers.
- the dimers formed by UN. exposure serve as a roadblock for the extension by the non-proofreading polymerase.
- a pool of random size polynucleotides is present after extension with the random primers is finished.
- Polynucleotides of interest which are generated according to Example 1 are gel isolated on a 1.5% agarose gel. Polynucleotides in the 100-300 bp range are cut out ofthe gel and 3 volumes of 6 M Nal is added to the gel slice. The mixture is incubated at 50 °C for 10 minutes and 10 ⁇ l of glass milk (Bio 101) is added. The mixture is spun for 1 minute and the supernatant is decanted. The pellet is washed with 500 ⁇ l of Column Wash (Column Wash is 50% ethanol, lOmM Tris-HCl pH 7.5, 100 mM NaCI and 2.5 mM EDTA) and spin for 1 minute, after which the supernatant is decanted. The washing, spinning and decanting steps are then repeated. The glass milk pellet is resuspended in 20 ⁇ l of H 2 O and spun for 1 minute. DNA remains in the aqueous phase.
- the 100-300 bp polynucleotides obtained in Example 2 are recombined in an annealing mixture (0.2 mM each dNTP, 2.2 mM MgCl 2 , 50 mM KCl, 10 mM Tris- HCl ph 8.8, 0.1% Triton X-100, 0.3 ⁇ ; Taq DNA polymerase, 50 ⁇ l total volume) without adding primers.
- a Robocycler by Stratagene was used for the annealing step with the following program: 95 °C for 30 seconds, 25-50 cycles of [95 °C for 30 seconds, 50 - 60 °C (preferably 58 °C) for 30 seconds, and 72 °C for 30 seconds] and 5 minutes at 72 °C.
- the 100-300 bp polynucleotides combine to yield double- stranded polynucleotides having a longer sequence.
- the cycling is optionally again repeated with some samples utilizing the single strands as template and primer DNA and other samples utilizing random primers in addition to the single strands.
- the polynucleotides of Example 3 are separated and polypeptides are expressed therefrom.
- the original template DNA is utilized as a comparative control by obtaining comparative polypeptides therefrom.
- the polypeptides obtained from the shuffled polynucleotides of Example 3 are screened for the activity ofthe polypeptides obtained from the original template and compared with the activity levels ofthe control.
- the shuffled polynucleotides coding for interesting polypeptides discovered during screening are compared further for secondary desirable traits. Some shuffled polynucleotides co ⁇ esponding to less interesting screened polypeptides are subjected to reshuffling.
- Site-Saturation Mutagenesis To accomplish site-saturation mutagenesis every residue (316) of a dehalogenase enzyme was converted into all 20 amino acids by site directed mutagenesis using 32-fold degenerate oligonucleotide primers, as follows:
- a reaction mix of 25 ul was prepared containing ⁇ 50 ng of plasmid template, 125 ng of each primer, IX native Pfu buffer, 200 uM each dNTP and 2.5 U native Pfu
- PCR reaction (10 ng template; PCR conditions: 3' 94 C; [1 ' 94 C; 1 ' 50 C; 1'30" 68 C] x 30; 10' 68 C.
- Reverse Primer 951 lTopR (AGCTAAGGGTCAAGGCCGCACCCGAGG)
- the resulting PCR product (ca.lOOO bp) was gel purified and quantified.
- pASK3 Institute fuer Bioanalytik, Goettingen, Germany
- pASK3 Institute fuer Bioanalytik, Goettingen, Germany
- Xba I and Bgl II dephosphorylated with CIP.
- 0.5 pmoles Vaccina Topoisomerase I (Invitrogen, Carlsbad, CA) was added to 60 ng (ca. 0.1 pmole) purified PCR product for 5' 37 C in buffer NEB I (New England Biolabs, Beverly, MA) in 5 ⁇ l total volume.
- NEB I New England Biolabs, Beverly, MA
- the topogated PCR product was cloned into the vector pASK3 (5 ⁇ l, ca. 200 ng in NEB I) for 5' at room temperature. This mixture was dialyzed against H 2 O for 30'. 2 ⁇ l were used for electroporation of DH10B cells (Gibco BRL, Gaithersburg, MD).
- This invention provides that a desirable property to be generated by directed evolution is exemplified in a limiting fashion by an improved residual activity (e.g. an enzymatic activity, an immunoreactivity, an antibiotic acivity, etc.) of a molecule upon subjection to altered environment, including what may be considered a harsh enviroment, for a specified time.
- an improved residual activity e.g. an enzymatic activity, an immunoreactivity, an antibiotic acivity, etc.
- Such a harsh environment may comprise any combination ofthe following (iteratively or not, and in any order or permutation): an elevated temperature (including a temperature that may cause denaturation of a working enzyme), a decreased temperature, an elevated salinity, a decreased salinity, an elevated pH, a decreased pH, an elevated pressure, a decreassed pressure, and an change in exposure to a radiation source (including uv radiation, visible light, as well as the entire electromagnetic spectrum).
- a radiation source including uv radiation, visible light, as well as the entire electromagnetic spectrum.
- the robot made 2 assay plates from each parent growth plate consisting of 0.02 mL cell suspension.
- Thermal stability was assessed by incubating the enzyme at the elevated temperature (55°C and 80°C) for some period of time and activity assay at 30°C. Initial rates were plotted vs. time at the higher temperature.
- the enzyme was in 50 mM Tris/SO 4 pH 7.8 for both the incubation and the assay.
- Product (Cf) was detected by a standard method using Fe(NO 3 ) 3 and HgSCN. Dhla 20F12 was used as the de facto wild type.
- the apparent half-life (T]/ 2 ) was calculated by fitting the data to an exponential decay function.
- ligation reassembly can be performed using a solid support.
- the following example 8 (co ⁇ esponding to Fig. 17) is illustrative but non-limiting.
- Example 8 Solid Phase Gene Family Reassembly Protocol.
- the objective can be, e.g., to reassemble/shuffle molecules of DNA to generate gene libraries of specific genes, libraries of gene families, and libraries of unrelated genes.
- the synthesis ofthe full-length molecules is carried out on a solid support.
- solid support we use paramagnetic beads coated with Streptavidin.
- the principle is based on the strong interaction between Biotin and Streptavidin and the ability to stepwise or simulataneously ligate DNA fragments generated from the annealing of nucleic acid building blocks (such as ssDNA building blocks).
- a solid support facilitates the reassembly of nucleic acid building blocks in a sequential manner and thus allows one to use not only unique couplings, but also redundant or repeated couplings throughout the length of a nucleic acid molecule that is to be generated by ligation reassembly.
- a "capture oligonucleotide” is biotinylated at the 5 'end for binding to the beads.
- the “capture oligo” is annealed to a complementary sequence (no biotinylated).
- the double stranded capture fragment contains two restriction sites at the 5 '-end which allows release ofthe assembled molecules from the solid support.
- Ligation reassembly is performed by step-wise ligation of annealed oligonucleotides of 20-100 bases.
- the first fragment ofthe assembly contains a 5 '-end compatible with the 3 '-end ofthe capture biotinylated fragment.
- Consecutive ligation of double stranded fragments containing complementary ends allows the generation of full- length molecules.
- Halfway synthesis (midpoint) molecules are released from the solid support.
- a final ligation step between molecules generated from both ends results in the generation a full-length reassembled DNA.
- Streptavidin coated magnetic beads M280 (Dynal co ⁇ .) Magnetic stand or magnetic particle concentrator (MPC stand)
- Design capture oligos to allow reassembly from both ends ofthe sequences being reassembled.
- Washing/Binding buffer IM NaCI, lOmM Tris-HCl pH 7.5, 1 mM EDTA
- Gottschalk G Bacterial Metabolism. 2 nd ed. New York: Springer- Verlag Inc., 1986. Gresshoff PM, ed.: Technology Transfer of Plant Biotechnology. Current Topics in
- Segel IH Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady- State Enzyme Systems. New York: John Wiley & Sons, Inc., 1993.
- Alting-Mecs MA and Short JM Polycos vectors: a system for packaging filamentous phage and phagemid vectors using lambda phage packaging extracts. Gene 137:1, 93-100, 1993.
- Arkin AP and Youvan DC An algorithm for protein engineering: simulations of recursive ensemble mutagenesis. Proc Natl Acad Sci USA 89(16):7811-7815, (Aug 15) 1992.
- Caldwell RC and Joyce GF Randomization of genes by PCR mutagenesis. PCR Methods Appl 2(10):28-33, 1992.
- Caton AJ and Koprowski H Influenze virus hemagglutinin-specific antibodies isolatedf froma combinatorial expression library are closely related to the immune response ofthe donor. Proc Natl Acad Sci USA 87(16):6450-6454, 1990.
- Chothia C and Lesk AM Canonical structures for the hypervariable regions of immunoglobulins. JMolBiol 196)4):901-917, 1987.
- Conrad M Topal MD: DNA and spermidine provide a switch mechanism to regulate the activity of restriction enzyme Nae I. Proc Natl Acad Sci USA 86(24): 9707-11, (Dec) 1989. Coruzzi G, Broglie R, Edwards C, Chua NH: Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5- bisphosphate carboxylase. EMBOJ 3(8): 1671-9, 1984.
- Ellington AD and Szostak JW In vitro selection of R ⁇ A molecules that bind specific ligands. Nature 346(6287):818-822, 1990. Fields S and Song 0: A novel genetic system to detect protein-protein interactions. Nature 340(6230):245-246, 1989.
- Germino FJ Wang ZX, Weissman SM: Screening for in vivo protein-protein interactions. Proc Natl Acad Sci USA 90(3):933-937, 1993.
- Gingeras TR Brooks JE: Cloned restriction/modification system from Pseudomonas aeruginosa. Proc Natl Acad Sci USA 80(2):402-6, 1983 (Jan).
- Gluzman Y SN40-transformed simian cells support the replication of early SN40 mutants. Cell 23(1):175-182, 1981.
- Cauliflower mosaic virus DNA detection of promoter sequences, and characterization of transcripts. Cell 30(3):763-73, 1982.
- Huston JS Levinson D, Mudgett-Hunter M, Tai MS, Novotney J, Margolies MN, Ridge RJ, Bruccoleri RE, Haber E, Crea R, et al: Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci USA 85(16):5879-5883, 1988.
- Li B and Fields S Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J 7(10):957-963, 1993.
- Milne GT and Weaver DT Dominant negative alleles of RAD52 reveal a DNA repair/ recombination complex including Rad51 and Rad52. Genes Dev 7(9): 1755- 1765, 1993.
- Nath K, Azzolina BA in Gene Amplification and Analysis (ed. Chirikjian JG), vol. 1, p. 113, Elsevier North Holland, Inc., New York, New York, ⁇ 1981.
- Needleman SB and Wunsch CD A general method applicable to the search for similarities in the amino acid sequence of two proteins. JMol Biol 48(3):443-453, 1970.
- Reidhaar-Olson JF and Sauer RT Combinatorial cassette mutagenesis as a probe of the informational content of protein sequences. Science 241(4861):53-57, 1988.
- Riechmann L and Weill M Phage display and selection of a site-directed randomized single-chain antibody Fv fragment for its affinity improvement. Biochemistry 32(34):8848-8855, 1993.
- Staudinger J, Perry M, Elledge SJ, Olson EN Interactions among vertebrate helix- loop-helix proteins in yeast using the two-hybrid system. JBiol Chem 268(7) :4608- 4611, 1993. Stemmer WP, Morris SK, Wilson BS: Selection of an active single chain Fv antibody from a protein linker library prepared by enzymatic inverse PCR. Biotechniques 14(2):256-265, 1993.
- Tague BW, Dickinson CD, Chrispeels MJ A short domain ofthe plant vacuolar protein phytohemagglutinin targets invertase to the yeast vacuole. Plant Cell
- Thiesen HJ and Bach C Target Detection Assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on SP1 protein. Nucleic Acids Res 18(11):3203-3209, 1990.
- Tingey SV, Walker EL, Corruzzi GM Glutamine synthetase genes of pea encode distinct polypeptides which are differentially expressed in leaves, roots and nodules.
- Framework residue 71 is a major determinant ofthe position and conformation ofthe second hypervariable region in the VH domains of immunoglobulins. JMol Biol 215(1):175-182, 1990.
- Tuerk C and Gold L Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249(4968):505-510, 1990.
- van de Poll ML Lafleur MV, van Gog F, Vrieling H, Meerman JH: N-acetylated and deacetylated 4'-fluoro-4-aminobiphenyl and 4-aminobiphenyl adducts differ in their ability to inhibit DNA replication of single-stranded Ml 3 in vitro and of single- stranded phi X174 in Escherichia coli. Carcinogenesis 13(5):751-8, (May) 1992.
- Arslan T Abraham AT, Hecht SM: Structurally altered substrates for DNA topoisomerase I. Effects of inclusion of a single 3'-deoxynucleotide within the scissile strand. Nucleosides Nucleotides 1998 Jan-Mar;17(l-3):515-30. Aupeix K, Toulme JJ: Binding of chemically-modified oligonucleotides to the double-stranded stem of an RNA hai ⁇ in. Nucleosides Nucleotides 1999 Jun- Jul;18(6-7):1647-50.
- Blackburn GM Liu X, Rosier A, Brenner C: Two hydrolase resistant analogues of diadenosine 5',5'"-Pl,P3-triphosphate for studies with Fhit, the human fragile histidine triad protein. Nucleosides Nucleotides 1998 Jan-Mar;17(l-3):301-8.
- Creighton TE Proteins Structures and Molecular Principles. New York: W H.
- Perrin DM Garestier T, Helene C: Expanding the catalytic repertoire of nucleic acid catalysts: simultaneous inco ⁇ oration of two modified deoxyribonucleoside triphosphates bearing ammonium and imidazolyl functionalities.
- Nucleosides Nucleotides 1999 Mar;18(3):377-91.
- Pfundheller HM Koshkin AA, Olsen CE, Wengel J: Evaluation of oligonucleotides containing two novel 2'-O-methyl modified nucleotide monomers: a 3'-C-allyl and a 2'-O,3'-C-linked bicyclic derivative.
- Nucleosides Nucleotides 1999 Sep;18(9):2017- 30.
- EJ Gene therapy of cancer: activation of nucleoside prodrugs with E. coli purine nucleoside phosphorylase. Nucleosides Nucleotides 1999 Apr- May; 18(4-5):745-57.
- BuPdGMPNHPP a non-substrate inhibitor of B family DNA polymerases.
- Sali A Comparative protein modeling by satisfaction of spatial restraints. Mol Med Today 1(6): 270-7, (Sep. 1995). -193- Sali A, Matsumoto R, McNeil HP, Ka ⁇ lus M, Stevens: RL Three-dimensional models of four mouse mast cell chymases. Identification of proteoglycan binding regions and protease-specific antigenic epitopes. J Biol Chem 268(12):9023-34, April 25, 1993.
- Sali A Modeling mutations and homologous proteins. Cu ⁇ Opin Biotechnol 6(4): 437-51, (Aug. 1995).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Ecology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IL14693700A IL146937A0 (en) | 1999-06-14 | 2000-06-14 | Synthetic ligation reassembly in directed evolution |
| JP2001503702A JP4699662B2 (ja) | 1999-06-14 | 2000-06-14 | 定方向進化における合成ライゲーション再集合 |
| EP00941550A EP1192280A4 (en) | 1999-06-14 | 2000-06-14 | SYNTHETIC COMBINATION THROUGH LIGATION IN THE TARGETED EVOLUTION |
| CA002374667A CA2374667C (en) | 1999-06-14 | 2000-06-14 | Synthetic ligation reassembly in directed evolution |
| HK02107285.7A HK1045858A1 (zh) | 1999-06-14 | 2000-06-14 | 指導進化的合成結扎再重合 |
| AU56246/00A AU5624600A (en) | 1999-06-14 | 2000-06-14 | Synthetic ligation reassembly in directed evolution |
| MXPA01013020A MXPA01013020A (es) | 1999-06-14 | 2000-06-14 | Re-ensamble por ligacion sintetica en evolucion dirigida. |
| IL146937A IL146937A (en) | 1999-06-14 | 2001-12-05 | Method for producing a progeny library comprised of polynucleotide sequences |
| US10/151,469 US20030219752A1 (en) | 1995-12-07 | 2002-05-17 | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/332,835 US6537776B1 (en) | 1999-06-14 | 1999-06-14 | Synthetic ligation reassembly in directed evolution |
| US09/332,835 | 1999-06-14 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1997/012239 Continuation-In-Part WO1998001581A1 (en) | 1996-07-09 | 1997-07-09 | Method of dna shuffling with polynucleotides produced by blockingor interrupting a synthesis or amplification process |
| US10/151,469 Continuation-In-Part US20030219752A1 (en) | 1995-12-07 | 2002-05-17 | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000077262A1 true WO2000077262A1 (en) | 2000-12-21 |
| WO2000077262A9 WO2000077262A9 (en) | 2002-06-13 |
Family
ID=23300064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/016838 Ceased WO2000077262A1 (en) | 1995-12-07 | 2000-06-14 | Synthetic ligation reassembly in directed evolution |
Country Status (9)
| Country | Link |
|---|---|
| US (5) | US6537776B1 (https=) |
| EP (3) | EP2397549A3 (https=) |
| JP (1) | JP4699662B2 (https=) |
| AU (1) | AU5624600A (https=) |
| CA (1) | CA2374667C (https=) |
| HK (1) | HK1045858A1 (https=) |
| IL (2) | IL146937A0 (https=) |
| MX (1) | MXPA01013020A (https=) |
| WO (1) | WO2000077262A1 (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002086121A1 (en) * | 2001-04-25 | 2002-10-31 | Proteus | Template-mediated, ligation-oriented method of nonrandomly shuffling polynucleotides |
| US6951719B1 (en) | 1999-08-11 | 2005-10-04 | Proteus S.A. | Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained |
| US6991922B2 (en) | 1998-08-12 | 2006-01-31 | Proteus S.A. | Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation |
| JP2007524662A (ja) * | 2003-12-17 | 2007-08-30 | プラエシス ファーマシューティカルズ インコーポレーテッド | コードされたライブラリーの合成のための方法 |
| EP1073710A4 (en) * | 1999-02-04 | 2007-12-19 | Verenium Corp | NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES |
| US7838287B2 (en) | 2001-01-25 | 2010-11-23 | Evolva Sa | Library of a collection of cells |
| US8008459B2 (en) | 2001-01-25 | 2011-08-30 | Evolva Sa | Concatemers of differentially expressed multiple genes |
| EP2397549A2 (en) * | 1999-02-04 | 2011-12-21 | BP Corporation North America Inc. | Non-stochastic generation of genetic vaccines and enzymes |
Families Citing this family (177)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5766891A (en) * | 1994-12-19 | 1998-06-16 | Sloan-Kettering Institute For Cancer Research | Method for molecular cloning and polynucleotide synthesis using vaccinia DNA topoisomerase |
| EP1025217B1 (en) | 1997-10-24 | 2006-10-04 | Invitrogen Corporation | Recombinational cloning using nucleic acids having recombination sites |
| US20030166169A1 (en) * | 1998-01-16 | 2003-09-04 | Padgett Hal S. | Method for constructing viral nucleic acids in a cell-free manner |
| US7153655B2 (en) | 1998-06-16 | 2006-12-26 | Alligator Bioscience Ab | Method for in vitro molecular evolution of protein function involving the use of exonuclease enzyme and two populations of parent polynucleotide sequence |
| US20040191772A1 (en) * | 1998-08-12 | 2004-09-30 | Dupret Daniel Marc | Method of shuffling polynucleotides using templates |
| US20030092023A1 (en) * | 1998-08-12 | 2003-05-15 | Daniel Dupret | Method of shuffling polynucleotides using templates |
| US20040005673A1 (en) * | 2001-06-29 | 2004-01-08 | Kevin Jarrell | System for manipulating nucleic acids |
| CA2360011A1 (en) * | 1999-01-05 | 2000-07-13 | Trustees Of Boston University | Ordered gene assembly |
| US6917882B2 (en) * | 1999-01-19 | 2005-07-12 | Maxygen, Inc. | Methods for making character strings, polynucleotides and polypeptides having desired characteristics |
| US6961664B2 (en) * | 1999-01-19 | 2005-11-01 | Maxygen | Methods of populating data structures for use in evolutionary simulations |
| ES2341217T3 (es) | 1999-01-19 | 2010-06-17 | Maxygen, Inc. | Recombinacion de acidos nucleicos mediada por oligonucleotidos. |
| US20070065838A1 (en) * | 1999-01-19 | 2007-03-22 | Maxygen, Inc. | Oligonucleotide mediated nucleic acid recombination |
| US7024312B1 (en) | 1999-01-19 | 2006-04-04 | Maxygen, Inc. | Methods for making character strings, polynucleotides and polypeptides having desired characteristics |
| US7430477B2 (en) * | 1999-10-12 | 2008-09-30 | Maxygen, Inc. | Methods of populating data structures for use in evolutionary simulations |
| WO2001062943A1 (en) | 2000-02-25 | 2001-08-30 | Invitrogen Corporation | Topoisomerase linker-mediated amplification methods |
| AU2001277014A1 (en) * | 2000-07-21 | 2002-02-05 | Trustees Of Boston University | Modular vector systems |
| US7435562B2 (en) * | 2000-07-21 | 2008-10-14 | Modular Genetics, Inc. | Modular vector systems |
| US7198924B2 (en) * | 2000-12-11 | 2007-04-03 | Invitrogen Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites |
| ATE315086T1 (de) * | 2000-08-21 | 2006-02-15 | Invitrogen Corp | Methoden und reagenzien für molekulares klonieren |
| WO2002061034A2 (en) * | 2000-12-08 | 2002-08-08 | Invitrogen Corporation | Compositions and methods for rapidly generating recombinant nucleic acid molecules |
| US20060008817A1 (en) * | 2000-12-08 | 2006-01-12 | Invitrogen Corporation | Methods and compositions for generating recombinant nucleic acid molecules |
| US6958213B2 (en) | 2000-12-12 | 2005-10-25 | Alligator Bioscience Ab | Method for in vitro molecular evolution of protein function |
| EP1401850A1 (en) | 2001-06-20 | 2004-03-31 | Nuevolution A/S | Nucleoside derivatives for library preparation |
| US6979733B2 (en) * | 2001-08-03 | 2005-12-27 | Diversa Corporation | Epoxide hydrolases, nucleic acids encoding them and methods of making and using them |
| US6943001B2 (en) * | 2001-08-03 | 2005-09-13 | Diversa Corporation | Epoxide hydrolases, nucleic acids encoding them and methods for making and using them |
| US20040009498A1 (en) * | 2002-01-14 | 2004-01-15 | Diversa Corporation | Chimeric antigen binding molecules and methods for making and using them |
| JP5319865B2 (ja) | 2002-03-01 | 2013-10-16 | コデクシス メイフラワー ホールディングス, エルエルシー | 機能的生体分子を同定する方法、システム、およびソフトウェア |
| US7747391B2 (en) * | 2002-03-01 | 2010-06-29 | Maxygen, Inc. | Methods, systems, and software for identifying functional biomolecules |
| US20050084907A1 (en) * | 2002-03-01 | 2005-04-21 | Maxygen, Inc. | Methods, systems, and software for identifying functional biomolecules |
| AU2003214031A1 (en) * | 2002-03-15 | 2003-09-29 | Nuevolution A/S | An improved method for synthesising templated molecules |
| US10731151B2 (en) | 2002-03-15 | 2020-08-04 | Nuevolution A/S | Method for synthesising templated molecules |
| JP4493347B2 (ja) * | 2002-04-17 | 2010-06-30 | ロベルト クレア | 免疫グロブリンのユニバーサルライブラリー |
| DK1504098T4 (da) | 2002-05-17 | 2011-05-23 | Alligator Bioscience Ab | Fremgangsmåde til molekyulær udvikling in vitro af proteinfunktion |
| KR20080045764A (ko) | 2002-06-14 | 2008-05-23 | 신젠타 파티서페이션즈 아게 | 자일라나제, 이를 암호화하는 핵산, 및 이의 제조 및 사용방법 |
| JP2005532829A (ja) * | 2002-07-18 | 2005-11-04 | インヴィトロジェン コーポレーション | 組換え部位を含むウイルスベクター |
| EP1539980B1 (en) * | 2002-08-01 | 2016-02-17 | Nuevolution A/S | Library of complexes comprising small non-peptide molecules and double-stranded oligonucleotides identifying the molecules |
| US7563600B2 (en) | 2002-09-12 | 2009-07-21 | Combimatrix Corporation | Microarray synthesis and assembly of gene-length polynucleotides |
| EP2348124B1 (en) * | 2002-10-30 | 2013-12-11 | Nuevolution A/S | Synthesis of a bifunctional complex |
| US7871799B2 (en) * | 2002-11-22 | 2011-01-18 | Lawrence Livermore National Security, Llc | Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions |
| WO2004056994A2 (en) | 2002-12-19 | 2004-07-08 | Nuevolution A/S | Quasirandom structure and function guided synthesis methods |
| US7429472B2 (en) * | 2003-01-31 | 2008-09-30 | Promega Corporation | Method of immobilizing a protein or molecule via a mutant dehalogenase that is bound to an immobilized dehalogenase substrate and linked directly or indirectly to the protein or molecule |
| EP2341134B1 (en) | 2003-01-31 | 2014-08-27 | Promega Corporation | Covalent tethering of functional groups to proteins |
| US20070026397A1 (en) | 2003-02-21 | 2007-02-01 | Nuevolution A/S | Method for producing second-generation library |
| HUE030493T2 (en) | 2003-04-04 | 2017-05-29 | Basf Enzymes Llc | Pectate lyases, nucleic acids and processes encoding them for their production and use |
| WO2004109540A2 (en) * | 2003-05-30 | 2004-12-16 | Case Western Reserve University | A stochastic variable selection method for model selection |
| WO2005028615A2 (en) * | 2003-06-26 | 2005-03-31 | Invitrogen Corporation | Methods and compositions for detecting promoter activity and expressing fusion proteins |
| US20050053989A1 (en) * | 2003-08-27 | 2005-03-10 | Gil Sharon | Libraries of recombinant chimeric proteins |
| US11118215B2 (en) * | 2003-09-18 | 2021-09-14 | Nuevolution A/S | Method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| WO2005054438A2 (en) | 2003-12-01 | 2005-06-16 | Invitrogen Corporation | Nucleic acid molecules containing recombination sites and methods of using the same |
| US7972994B2 (en) * | 2003-12-17 | 2011-07-05 | Glaxosmithkline Llc | Methods for synthesis of encoded libraries |
| WO2005078122A2 (en) * | 2004-02-17 | 2005-08-25 | Nuevolution A/S | Method for enrichment involving elimination by mismatch hybridisation |
| US20080070291A1 (en) | 2004-06-16 | 2008-03-20 | David Lam | Compositions and Methods for Enzymatic Decolorization of Chlorophyll |
| US7425436B2 (en) | 2004-07-30 | 2008-09-16 | Promega Corporation | Covalent tethering of functional groups to proteins and substrates therefor |
| EP2886658A1 (en) | 2005-03-10 | 2015-06-24 | BASF Enzymes LLC | Lyase enzymes, nucleic acids encoding them and methods for making and using them |
| CA2611859C (en) | 2005-03-15 | 2015-03-31 | Verenium Corporation | Cellulases, nucleic acids encoding them and methods for making and using them |
| DK1910538T3 (da) * | 2005-06-09 | 2011-08-08 | Praecis Pharm Inc | Fremgangsmåder til syntese af kodede biblioteker |
| HUE029021T2 (en) | 2005-06-21 | 2017-02-28 | Xoma (Us) Llc | IL-1beta-binding antibodies and fragments thereof |
| US7541431B2 (en) * | 2005-09-07 | 2009-06-02 | Maine Medical Center | Cristin/R-spondin ligands active in the Wnt signaling pathway and methods, compositions and kits relating thereto |
| WO2007038241A2 (en) * | 2005-09-22 | 2007-04-05 | Maine Medical Center Research | Modulation of mesenchymal and metastatic cell growth |
| JP2009513135A (ja) * | 2005-10-28 | 2009-04-02 | プリーシス・ファーマシューティカルズ・インコーポレイテッド | エンコードされたライブラリーを用いて興味のある化合物を同定する方法 |
| US8716195B2 (en) * | 2005-11-14 | 2014-05-06 | Bioren, Inc. | Antibody ultrahumanization by predicted mature CDR blasting and cohort library generation and screening |
| PT3305900T (pt) | 2005-12-01 | 2021-10-27 | Nuevolution As | Métodos de codificação enzimática para síntese eficaz de bibliotecas grandes |
| EP1987142A4 (en) | 2006-02-02 | 2009-07-15 | Verenium Corp | ESTERASES AND ASSOCIATED NUCLEIC ACIDS AND METHODS |
| NZ595497A (en) | 2006-02-10 | 2013-09-27 | Verenium Corp | Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them |
| TR201809912T4 (tr) | 2006-02-14 | 2018-07-23 | Bp Corp North America Inc | Ksilanazlar, bunları kodlayan nükleik asitler ve bunları yapmak ve kullanmak için yöntemler. |
| MX2008011477A (es) | 2006-03-07 | 2008-09-23 | Cargill Inc | Aldolasas, acidos nucleicos que las codifican y metodos para hacerlas y usarlas. |
| AU2007223086B2 (en) | 2006-03-07 | 2013-09-26 | Basf Enzymes Llc | Aldolases, nucleic acids encoding them and methods for making and using them |
| JP2009529915A (ja) | 2006-03-20 | 2009-08-27 | ゾーマ テクノロジー リミテッド | ガストリン物質に対して特異的なヒト抗体および方法 |
| US20070231805A1 (en) * | 2006-03-31 | 2007-10-04 | Baynes Brian M | Nucleic acid assembly optimization using clamped mismatch binding proteins |
| WO2007136834A2 (en) * | 2006-05-19 | 2007-11-29 | Codon Devices, Inc. | Combined extension and ligation for nucleic acid assembly |
| CA2659820A1 (en) * | 2006-08-04 | 2008-02-14 | Novartis Ag | Ephb3-specific antibody and uses thereof |
| DK2069389T3 (en) | 2006-08-04 | 2015-01-12 | Bp Corp North America Inc | Glucanases, nucleic acids encoding them, and processes for their preparation and use |
| AR064801A1 (es) | 2006-08-18 | 2009-04-29 | Xoma Technology Ltd | Anticuerpo especifico prlr (receptor de prolactina) y sus usos |
| US7968691B2 (en) * | 2006-08-23 | 2011-06-28 | Danisco Us Inc. | Pullulanase variants with increased productivity |
| US8053191B2 (en) | 2006-08-31 | 2011-11-08 | Westend Asset Clearinghouse Company, Llc | Iterative nucleic acid assembly using activation of vector-encoded traits |
| ES2531135T3 (es) | 2006-09-21 | 2015-03-11 | Basf Enzymes Llc | Fitasas, ácidos nucleicos que las codifican y métodos para su producción y uso |
| EP2078077A2 (en) * | 2006-10-04 | 2009-07-15 | Codon Devices, Inc | Nucleic acid libraries and their design and assembly |
| EP2087107A2 (en) * | 2006-10-30 | 2009-08-12 | Promega Corporation | Mutant hydrolase proteins with enhanced kinetics and functional expression |
| WO2008070780A1 (en) | 2006-12-07 | 2008-06-12 | Novartis Ag | Antagonist antibodies against ephb3 |
| EP2121756A4 (en) | 2006-12-20 | 2011-08-31 | Mmrglobal Inc | ANTIBODIES AND PROCESS FOR THEIR PREPARATION AND USE |
| PL2479267T3 (pl) | 2006-12-21 | 2017-06-30 | Basf Enzymes Llc | Amylazy i glukoamylazy, kwasy nukleinowe kodujące te związki oraz sposoby wytwarzania tych związków oraz stosowania ich |
| NZ598285A (en) | 2007-01-30 | 2013-10-25 | Syngenta Participations Ag | Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them |
| KR101621100B1 (ko) | 2007-03-30 | 2016-05-13 | 더 리서치 파운데이션 오브 스테이트 유니버시티 오브 뉴욕 | 백신에 유용한 약독화 바이러스 |
| CA2693102C (en) * | 2007-07-31 | 2020-03-10 | Verenium Corporation | Tailored multi-site combinatorial assembly |
| BRPI0817811A2 (pt) | 2007-10-03 | 2014-10-14 | Verenium Corp | Xilanases, ácidos nucleicos que codificam as mesmas e métodos para fabricação e uso das mesmas. |
| EP2612867A1 (en) | 2007-11-01 | 2013-07-10 | Perseid Therapeutics LLC | Immunosuppressive polypeptides and nucleic acids |
| AU2008347218B2 (en) * | 2007-12-31 | 2015-02-05 | Xoma Technology Ltd. | Methods and materials for targeted mutagenesis |
| CN104651381A (zh) | 2008-01-03 | 2015-05-27 | 巴斯夫酶有限责任公司 | 转移酶和氧化还原酶、编码它们的核酸以及其制备和应用方法 |
| WO2009088753A1 (en) | 2008-01-03 | 2009-07-16 | Verenium Corporation | Isomerases, nucleic acids encoding them and methods for making and using them |
| EP2098536A1 (en) | 2008-03-05 | 2009-09-09 | 4-Antibody AG | Isolation and identification of antigen- or ligand-specific binding proteins |
| EP2283038A1 (en) * | 2008-04-30 | 2011-02-16 | Dublin City University | Compositions and methods for expressing in-frame multimeric proteins |
| US8383346B2 (en) * | 2008-06-13 | 2013-02-26 | Codexis, Inc. | Combined automated parallel synthesis of polynucleotide variants |
| US20090312196A1 (en) * | 2008-06-13 | 2009-12-17 | Codexis, Inc. | Method of synthesizing polynucleotide variants |
| US8153391B2 (en) | 2008-08-29 | 2012-04-10 | Bunge Oils, Inc. | Hydrolases, nucleic acids encoding them and methods for making and using them |
| US8198062B2 (en) | 2008-08-29 | 2012-06-12 | Dsm Ip Assets B.V. | Hydrolases, nucleic acids encoding them and methods for making and using them |
| US8357503B2 (en) | 2008-08-29 | 2013-01-22 | Bunge Oils, Inc. | Hydrolases, nucleic acids encoding them and methods for making and using them |
| US9637746B2 (en) | 2008-12-15 | 2017-05-02 | Greenlight Biosciences, Inc. | Methods for control of flux in metabolic pathways |
| CN105132387A (zh) * | 2008-12-22 | 2015-12-09 | 绿光生物科学公司 | 用于制造化合物的组合物和方法 |
| ES2638324T3 (es) | 2009-02-13 | 2017-10-19 | X-Chem, Inc. | Métodos de creación y examen de bibliotecas codificadas por ADN |
| NZ596459A (en) | 2009-05-21 | 2013-11-29 | Verenium Corp | Phytases, nucleic acids encoding them and methods for making and using them |
| US8926976B2 (en) | 2009-09-25 | 2015-01-06 | Xoma Technology Ltd. | Modulators |
| EP2480888B1 (en) | 2009-09-25 | 2016-11-30 | XOMA Technology Ltd. | Screening methods |
| UA111708C2 (uk) | 2009-10-16 | 2016-06-10 | Бандж Ойлз, Інк. | Спосіб рафінування олії |
| US10207240B2 (en) | 2009-11-03 | 2019-02-19 | Gen9, Inc. | Methods and microfluidic devices for the manipulation of droplets in high fidelity polynucleotide assembly |
| WO2011066185A1 (en) | 2009-11-25 | 2011-06-03 | Gen9, Inc. | Microfluidic devices and methods for gene synthesis |
| WO2011085075A2 (en) | 2010-01-07 | 2011-07-14 | Gen9, Inc. | Assembly of high fidelity polynucleotides |
| EP3540059A1 (en) | 2010-04-16 | 2019-09-18 | Nuevolution A/S | Bi-functional complexes and methods for making and using such complexes |
| EP2566953B1 (en) | 2010-05-07 | 2019-01-02 | Greenlight Biosciences, Inc. | Methods for control of flux in metabolic pathways through enzyme relocation |
| EP2611922A1 (en) | 2010-08-31 | 2013-07-10 | Greenlight Biosciences, Inc. | Methods for control of flux in metabolic pathways through protease manipulation |
| US9487808B2 (en) | 2010-09-24 | 2016-11-08 | Massachusetts Institute Of Technology | Rapid assembly of multiple arbitrary length DNA fragments |
| US9096871B2 (en) | 2010-10-06 | 2015-08-04 | Bp Corporation North America Inc. | Variant CBH I polypeptides with reduced product inhibition |
| CN103502448B (zh) | 2010-11-12 | 2017-03-29 | Gen9股份有限公司 | 核酸合成的方法和设备 |
| WO2012064975A1 (en) | 2010-11-12 | 2012-05-18 | Gen9, Inc. | Protein arrays and methods of using and making the same |
| JP2014504503A (ja) | 2010-12-28 | 2014-02-24 | ゾーマ テクノロジー リミテッド | Pdzドメインを用いた細胞表面提示 |
| CN103620032B (zh) * | 2010-12-31 | 2016-02-24 | 生物蛋白有限公司 | 抗体的快速人源化 |
| CN103732623B (zh) | 2011-06-03 | 2017-09-29 | 佐马技术有限公司 | 对TGF‑β具有特异性的抗体 |
| LT2944693T (lt) | 2011-08-26 | 2019-08-26 | Gen9, Inc. | Kompozicijos ir būdai, skirti nukleorūgščių didelio tikslumo sąrankai |
| IN2014CN02574A (https=) | 2011-09-07 | 2015-06-26 | Chem Inc X | |
| CN104093848A (zh) | 2011-09-09 | 2014-10-08 | 绿光生物科学公司 | 碳青霉烯(carbapenem)的无细胞制备 |
| BR112014022943A2 (pt) | 2012-03-16 | 2017-07-18 | Bp Corp North America Inc | polipeptídeos que possuem atividade de endoglicanase |
| US9150853B2 (en) | 2012-03-21 | 2015-10-06 | Gen9, Inc. | Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis |
| CA2871505C (en) | 2012-04-24 | 2021-10-12 | Gen9, Inc. | Methods for sorting nucleic acids and multiplexed preparative in vitro cloning |
| IL236303B (en) | 2012-06-25 | 2022-07-01 | Gen9 Inc | Methods for high-throughput nucleic acid assembly and sequencing |
| SG10201907347YA (en) | 2012-07-13 | 2019-09-27 | X Chem Inc | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
| US9665694B2 (en) | 2013-01-31 | 2017-05-30 | Codexis, Inc. | Methods, systems, and software for identifying bio-molecules with interacting components |
| GB201308828D0 (en) | 2013-03-12 | 2013-07-03 | Verenium Corp | Phytase |
| GB201308843D0 (en) | 2013-03-14 | 2013-07-03 | Verenium Corp | Phytase formulation |
| EP3027762A4 (en) | 2013-07-25 | 2017-06-28 | BASF Enzymes LLC | Phytase |
| SG11201600853UA (en) | 2013-08-05 | 2016-03-30 | Twist Bioscience Corp | De novo synthesized gene libraries |
| AU2014306074B2 (en) | 2013-08-05 | 2018-08-30 | Greenlight Biosciences, Inc. | Engineered proteins with a protease cleavage site |
| CN103484492A (zh) * | 2013-09-30 | 2014-01-01 | 湖南农业大学 | 一种将多个dna片段同时连接至同一载体上的方法 |
| US11060139B2 (en) * | 2014-03-28 | 2021-07-13 | Centrillion Technology Holdings Corporation | Methods for sequencing nucleic acids |
| US10669304B2 (en) | 2015-02-04 | 2020-06-02 | Twist Bioscience Corporation | Methods and devices for de novo oligonucleic acid assembly |
| BR112017020690A2 (pt) | 2015-03-30 | 2018-06-26 | Greenlight Biosciences Inc | produção livre de células de ácido ribonucleico |
| US9981239B2 (en) | 2015-04-21 | 2018-05-29 | Twist Bioscience Corporation | Devices and methods for oligonucleic acid library synthesis |
| EP3350314A4 (en) | 2015-09-18 | 2019-02-06 | Twist Bioscience Corporation | OLIGONUCLEIC ACID VARIANT LIBRARIES VARIANT AND SYNTHESIS THEREOF |
| KR102794025B1 (ko) | 2015-09-22 | 2025-04-09 | 트위스트 바이오사이언스 코포레이션 | 핵산 합성을 위한 가요성 기판 |
| US11291221B2 (en) | 2015-10-30 | 2022-04-05 | Beth Israel Deaconess Medical Center, Inc. | Methods for determination of bioactivity, quantity, removal, or inactivation of cereal amylase trypsin inhibitors in cereals, flours, plants, and complex foods |
| BR112018011503A2 (pt) | 2015-12-07 | 2018-12-04 | Zymergen Inc | promotores da corynebacterium glutamicum |
| US11208649B2 (en) | 2015-12-07 | 2021-12-28 | Zymergen Inc. | HTP genomic engineering platform |
| US9988624B2 (en) | 2015-12-07 | 2018-06-05 | Zymergen Inc. | Microbial strain improvement by a HTP genomic engineering platform |
| CA3020312A1 (en) | 2016-04-06 | 2017-10-12 | Greenlight Biosciences, Inc. | Cell-free production of ribonucleic acid |
| WO2017209990A1 (en) | 2016-05-31 | 2017-12-07 | Exxonmobil Upstream Research Company | METHODS FOR lSOLATING NUCLEIC ACIDS FROM SAMPLES |
| WO2017215790A1 (en) | 2016-06-17 | 2017-12-21 | National Hellenic Research Foundation | Systems for recombinant protein production |
| US10544390B2 (en) | 2016-06-30 | 2020-01-28 | Zymergen Inc. | Methods for generating a bacterial hemoglobin library and uses thereof |
| EP3478845A4 (en) | 2016-06-30 | 2019-07-31 | Zymergen, Inc. | METHOD OF GENERATING A GLUCOSE PERMEASE LIBRARY AND USES THEREOF |
| WO2018005522A1 (en) | 2016-07-01 | 2018-01-04 | Exxonmobil Upstream Research Company | Methods for identifying hydrocarbon reservoirs |
| WO2018031950A1 (en) * | 2016-08-12 | 2018-02-15 | Caribou Biosciences, Inc. | Protein engineering methods |
| US10417457B2 (en) | 2016-09-21 | 2019-09-17 | Twist Bioscience Corporation | Nucleic acid based data storage |
| EP3565892A4 (en) | 2017-01-06 | 2020-10-07 | Greenlight Biosciences, Inc. | Cell-free production of sugars |
| EP4556433A3 (en) | 2017-02-22 | 2025-08-06 | Twist Bioscience Corporation | Nucleic acid based data storage |
| WO2018231872A1 (en) | 2017-06-12 | 2018-12-20 | Twist Bioscience Corporation | Methods for seamless nucleic acid assembly |
| WO2018231864A1 (en) | 2017-06-12 | 2018-12-20 | Twist Bioscience Corporation | Methods for seamless nucleic acid assembly |
| US11407837B2 (en) | 2017-09-11 | 2022-08-09 | Twist Bioscience Corporation | GPCR binding proteins and synthesis thereof |
| KR102894284B1 (ko) | 2017-10-11 | 2025-12-03 | 그린라이트 바이오사이언시스, 아이엔씨. | 뉴클레오시드 트리포스페이트 및 리보핵산 생산을 위한 방법 및 조성물 |
| CN111565834B (zh) | 2017-10-20 | 2022-08-26 | 特韦斯特生物科学公司 | 用于多核苷酸合成的加热的纳米孔 |
| CN108103143B (zh) * | 2017-12-15 | 2021-11-09 | 序康医疗科技(苏州)有限公司 | 一种目标区域多重pcr与快速文库构建的方法 |
| KR102804057B1 (ko) | 2018-01-04 | 2025-05-07 | 트위스트 바이오사이언스 코포레이션 | Dna 기반 디지털 정보 저장 |
| CA3100739A1 (en) | 2018-05-18 | 2019-11-21 | Twist Bioscience Corporation | Polynucleotides, reagents, and methods for nucleic acid hybridization |
| EP3613855A1 (en) * | 2018-08-23 | 2020-02-26 | Clariant Produkte (Deutschland) GmbH | Method for the production of a nucleic acid library |
| CN109023537B (zh) * | 2018-09-04 | 2021-10-08 | 上海交通大学 | 一种微量dna样品高通量测序文库的构建技术 |
| CA3110656A1 (en) | 2018-09-07 | 2020-03-12 | Basf Plant Science Company Gmbh | Improved method for the production of high levels of pufa in plants |
| EP3847264A1 (en) | 2018-09-07 | 2021-07-14 | Basf Plant Science Company GmbH | Improved method for the production of high levels of pufa in plants |
| US12460221B2 (en) | 2018-09-07 | 2025-11-04 | Basf Plant Science Company Gmbh | Method for the production of high levels of PUFA in plants |
| WO2020139871A1 (en) | 2018-12-26 | 2020-07-02 | Twist Bioscience Corporation | Highly accurate de novo polynucleotide synthesis |
| JP2022522668A (ja) | 2019-02-26 | 2022-04-20 | ツイスト バイオサイエンス コーポレーション | 抗体を最適化するための変異体核酸ライブラリ |
| CN113766930B (zh) | 2019-02-26 | 2025-07-22 | 特韦斯特生物科学公司 | Glp1受体的变异核酸文库 |
| US11332738B2 (en) | 2019-06-21 | 2022-05-17 | Twist Bioscience Corporation | Barcode-based nucleic acid sequence assembly |
| JP2022548783A (ja) | 2019-09-23 | 2022-11-21 | ツイスト バイオサイエンス コーポレーション | 単一ドメイン抗体のバリアント核酸ライブラリー |
| EP4034566A4 (en) | 2019-09-23 | 2024-01-24 | Twist Bioscience Corporation | VARIANT NUCLEIC ACID BANKS FOR CRTH2 |
| US20230041211A1 (en) | 2019-12-20 | 2023-02-09 | Basf Se | Decreasing toxicity of terpenes and increasing the production potential in micro-organisms |
| EP4125975A4 (en) * | 2020-03-27 | 2024-05-01 | Atossa Therapeutics, Inc. | Methods of treating or preventing a viral infection using bacteriophages |
| CN111474155B (zh) * | 2020-04-28 | 2023-05-12 | 广东博创佳禾科技有限公司 | 一种青枯病菌溶液导流装置 |
| BR112022024475A2 (pt) | 2020-06-04 | 2022-12-27 | Isobionics B V | Beta santaleno sintase sintética, ácido nucleico sintético, cassete de expressão, método para produzir uma composição, célula hospedeira não humana, composição, e, uso de qualquer uma das santaleno sintases sintéticas |
| EP4015626A1 (en) | 2020-12-18 | 2022-06-22 | Isobionics B.V. | Enzymes and methods for fermentative production of monoterpene esters |
| JP2024528957A (ja) | 2021-08-02 | 2024-08-01 | ビーエーエスエフ ソシエタス・ヨーロピア | イオニリデンエタンシンターゼによる新規な芳香化合物の生成 |
| WO2026019982A1 (en) * | 2024-07-17 | 2026-01-22 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and methods for high-throughput protein characterization |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5658727A (en) * | 1991-04-10 | 1997-08-19 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5824485A (en) * | 1995-04-24 | 1998-10-20 | Chromaxome Corporation | Methods for generating and screening novel metabolic pathways |
| US5866363A (en) * | 1985-08-28 | 1999-02-02 | Pieczenik; George | Method and means for sorting and identifying biological information |
Family Cites Families (138)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4704362A (en) | 1977-11-08 | 1987-11-03 | Genentech, Inc. | Recombinant cloning vehicle microbial polypeptide expression |
| US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US5049386A (en) | 1985-01-07 | 1991-09-17 | Syntex (U.S.A.) Inc. | N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4946787A (en) | 1985-01-07 | 1990-08-07 | Syntex (U.S.A.) Inc. | N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5176995A (en) | 1985-03-28 | 1993-01-05 | Hoffmann-La Roche Inc. | Detection of viruses by amplification and hybridization |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US5333675C1 (en) | 1986-02-25 | 2001-05-01 | Perkin Elmer Corp | Apparatus and method for performing automated amplification of nucleic acid sequences and assays using heating and cooling steps |
| EP0316018A3 (en) | 1985-03-29 | 1989-07-26 | Cetus Oncology Corporation | Modification of dna sequences |
| US6492107B1 (en) | 1986-11-20 | 2002-12-10 | Stuart Kauffman | Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique |
| DE229046T1 (de) | 1985-03-30 | 1987-12-17 | Marc Genf/Geneve Ballivet | Verfahren zum erhalten von dns, rns, peptiden, polypeptiden oder proteinen durch dns-rekombinant-verfahren. |
| US4959312A (en) | 1985-05-31 | 1990-09-25 | The University Of Tennessee Research Corporation | Full spectrum mutagenesis |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| SU1441787A1 (ru) | 1987-04-29 | 1990-09-23 | Институт Белка Ан Ссср | Способ получени пептидов и белков в бесклеточной системе трансл ции |
| EP0436597B1 (en) | 1988-09-02 | 1997-04-02 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| AU649217B2 (en) | 1988-11-18 | 1994-05-19 | Regents Of The University Of California, The | Method for site-specifically incorporating unnatural amino acids into proteins |
| SU1705302A1 (ru) | 1988-12-22 | 1992-01-15 | Институт Белка Ан Ссср | Способ препаративной экспрессии генов в бесклеточной системе сопр женной транскрипции/трансл ции |
| US5198346A (en) | 1989-01-06 | 1993-03-30 | Protein Engineering Corp. | Generation and selection of novel DNA-binding proteins and polypeptides |
| US5096815A (en) | 1989-01-06 | 1992-03-17 | Protein Engineering Corporation | Generation and selection of novel dna-binding proteins and polypeptides |
| ATE143696T1 (de) | 1989-02-28 | 1996-10-15 | Canon Kk | Partiell doppelsträngiges oligonukleotid und verfahren zu seiner bildung |
| US5703055A (en) | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| US5693622A (en) | 1989-03-21 | 1997-12-02 | Vical Incorporated | Expression of exogenous polynucleotide sequences cardiac muscle of a mammal |
| CA2489769A1 (en) | 1989-03-21 | 1990-10-04 | Philip L. Felgner | Expression of exogenous polynucleotide sequences in a vertebrate |
| US6291158B1 (en) | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertoire |
| ATE147787T1 (de) | 1989-07-31 | 1997-02-15 | Inst Of Protein Research Russi | Verfahren zur herstellung von polypeptiden in einem zellfreien system |
| US5023171A (en) | 1989-08-10 | 1991-06-11 | Mayo Foundation For Medical Education And Research | Method for gene splicing by overlap extension using the polymerase chain reaction |
| US5354656A (en) | 1989-10-02 | 1994-10-11 | Stratagene | Method of DNA sequencing |
| AU638762B2 (en) | 1989-10-05 | 1993-07-08 | Optein Inc | Cell-free synthesis and isolation of novel genes and polypeptides |
| CA2035010C (en) | 1990-01-26 | 1996-12-10 | Keith C. Backman | Method of amplifying target nucleic acids applicable to both polymerase and ligase chain reactions |
| US5427930A (en) | 1990-01-26 | 1995-06-27 | Abbott Laboratories | Amplification of target nucleic acids using gap filling ligase chain reaction |
| WO1991012341A1 (en) | 1990-02-12 | 1991-08-22 | Fred Hutchinson Cancer Research Center | Improved method for ordered deletions from a fixed point in a cloned insert |
| CA2079802C (en) * | 1990-04-05 | 2001-09-18 | Roberto Crea | Walk-through mutagenesis |
| US5264618A (en) | 1990-04-19 | 1993-11-23 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
| WO1991016427A1 (en) | 1990-04-24 | 1991-10-31 | Stratagene | Methods for phenotype creation from multiple gene populations |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1991017424A1 (en) | 1990-05-03 | 1991-11-14 | Vical, Inc. | Intracellular delivery of biologically active substances by means of self-assembling lipid complexes |
| GB9011861D0 (en) | 1990-05-26 | 1990-07-18 | Beecham Group Plc | Novel compounds |
| DK0600866T3 (da) | 1990-06-01 | 1998-03-09 | Chiron Corp | Præparater og fremgangsmåder til identifikation af biologisk aktive molekyler |
| US5723286A (en) | 1990-06-20 | 1998-03-03 | Affymax Technologies N.V. | Peptide library and screening systems |
| GB9015198D0 (en) | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
| AU8498091A (en) | 1990-08-02 | 1992-03-02 | Regents Of The University Of Colorado, The | Systematic polypeptide evolution by reverse translation |
| ATE158021T1 (de) | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1992005258A1 (en) | 1990-09-20 | 1992-04-02 | La Trobe University | Gene encoding barley enzyme |
| IL99552A0 (en) | 1990-09-28 | 1992-08-18 | Ixsys Inc | Compositions containing procaryotic cells,a kit for the preparation of vectors useful for the coexpression of two or more dna sequences and methods for the use thereof |
| US5858725A (en) | 1990-10-10 | 1999-01-12 | Glaxo Wellcome Inc. | Preparation of chimaeric antibodies using the recombinant PCR strategy |
| US5234824A (en) | 1990-11-13 | 1993-08-10 | Specialty Laboratories, Inc. | Rapid purification of DNA |
| US5187083A (en) | 1990-11-13 | 1993-02-16 | Specialty Laboratories, Inc. | Rapid purification of DNA |
| JPH06508022A (ja) | 1991-02-21 | 1994-09-14 | ギリアド サイエンシズ,インコーポレイテッド | 生体分子に特異的なアプタマーおよび生産方法 |
| US5645988A (en) | 1991-05-08 | 1997-07-08 | The United States Of America As Represented By The Department Of Health And Human Services | Methods of identifying drugs with selective effects against cancer cells |
| EP0596885B1 (en) | 1991-08-02 | 1997-09-03 | Transkaryotic Therapies, Inc. | Dna library screening method |
| US5279952A (en) | 1991-08-09 | 1994-01-18 | Board Of Regents, The University Of Texas System | PCR-based strategy of constructing chimeric DNA molecules |
| US5270170A (en) | 1991-10-16 | 1993-12-14 | Affymax Technologies N.V. | Peptide library and screening method |
| HU211019B (en) | 1991-12-02 | 1995-09-28 | Richter Gedeon Vegyeszet | Process for producing new 1,2,3,6-tetrahydropyridine and piperidine derivatives substituted with n-(hydroxylalkyl) group and compositions comprising such compounds |
| JPH07503372A (ja) | 1992-01-23 | 1995-04-13 | バイカル・インコーポレイテッド | 生体外遺伝子導入 |
| EP0633944B1 (en) | 1992-03-31 | 2000-11-08 | Abbott Laboratories | Method of multiplex ligase chain reaction |
| ES2156149T3 (es) | 1992-12-04 | 2001-06-16 | Medical Res Council | Proteinas de union multivalente y multiespecificas, su fabricacion y su uso. |
| EP0620277A1 (en) | 1993-03-18 | 1994-10-19 | Merck & Co. Inc. | Nucleic acid pharmaceuticals |
| JPH08509612A (ja) | 1993-04-26 | 1996-10-15 | ジェンファーム インターナショナル インコーポレイテッド | 異種抗体を産生することができるトランスジェニック非ヒト動物 |
| JP3626187B2 (ja) | 1993-06-07 | 2005-03-02 | バイカル インコーポレイテッド | 遺伝子治療に適するプラスミド |
| US5426039A (en) | 1993-09-08 | 1995-06-20 | Bio-Rad Laboratories, Inc. | Direct molecular cloning of primer extended DNA containing an alkane diol |
| US5498531A (en) | 1993-09-10 | 1996-03-12 | President And Fellows Of Harvard College | Intron-mediated recombinant techniques and reagents |
| US5712146A (en) | 1993-09-20 | 1998-01-27 | The Leland Stanford Junior University | Recombinant combinatorial genetic library for the production of novel polyketides |
| US6187579B1 (en) | 1993-10-28 | 2001-02-13 | Carlsberg A/S | Customized proteases |
| US5389537A (en) | 1994-01-21 | 1995-02-14 | Wisconsin Alumni Research Foundation | Nuclease having altered specificity |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US6165793A (en) | 1996-03-25 | 2000-12-26 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US6117679A (en) | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| US6335160B1 (en) * | 1995-02-17 | 2002-01-01 | Maxygen, Inc. | Methods and compositions for polypeptide engineering |
| US5552278A (en) * | 1994-04-04 | 1996-09-03 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
| EP0777748A1 (en) | 1994-08-18 | 1997-06-11 | Cytogen Corporation | Peptide librairies as a source of syngenes |
| JP3412657B2 (ja) | 1994-09-08 | 2003-06-03 | 三菱瓦斯化学株式会社 | ポリアミドの乾燥方法および固相重合方法 |
| DE69526665T2 (de) | 1994-09-21 | 2002-11-21 | Cytogen Corp., Princeton | Antigen bindende peptide (abtides) aus peptidbibliotheken |
| US5885577A (en) | 1994-09-21 | 1999-03-23 | Cytogen Corporation | Antigen binding peptides (abtides) from peptide libraries |
| US5641665A (en) | 1994-11-28 | 1997-06-24 | Vical Incorporated | Plasmids suitable for IL-2 expression |
| WO1996033736A1 (en) | 1995-04-27 | 1996-10-31 | Affymax Technologies N.V. | Malaria peptides and vaccines |
| WO1996041865A1 (en) | 1995-06-07 | 1996-12-27 | Ariad Gene Therapeutics, Inc. | Rapamcycin-based regulation of biological events |
| US6057103A (en) | 1995-07-18 | 2000-05-02 | Diversa Corporation | Screening for novel bioactivities |
| US6004788A (en) | 1995-07-18 | 1999-12-21 | Diversa Corporation | Enzyme kits and libraries |
| DE69620766T2 (de) | 1995-08-11 | 2004-11-18 | Novozymes A/S | Verfahren zur herstellung von polypeptidabkömmlingen |
| US5939250A (en) | 1995-12-07 | 1999-08-17 | Diversa Corporation | Production of enzymes having desired activities by mutagenesis |
| US6537776B1 (en) * | 1999-06-14 | 2003-03-25 | Diversa Corporation | Synthetic ligation reassembly in directed evolution |
| US5830696A (en) | 1996-12-05 | 1998-11-03 | Diversa Corporation | Directed evolution of thermophilic enzymes |
| US6740506B2 (en) | 1995-12-07 | 2004-05-25 | Diversa Corporation | End selection in directed evolution |
| US5965408A (en) | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
| US5789166A (en) | 1995-12-08 | 1998-08-04 | Stratagene | Circular site-directed mutagenesis |
| US5885827A (en) | 1996-01-23 | 1999-03-23 | The Regents Of The Universtiy Of California | Eukaryotic high rate mutagenesis system |
| US6096548A (en) | 1996-03-25 | 2000-08-01 | Maxygen, Inc. | Method for directing evolution of a virus |
| US5891718A (en) | 1996-03-27 | 1999-04-06 | Vical Incorporated | Tetracycline inducible/repressible systems |
| US6242211B1 (en) | 1996-04-24 | 2001-06-05 | Terragen Discovery, Inc. | Methods for generating and screening novel metabolic pathways |
| US5846946A (en) | 1996-06-14 | 1998-12-08 | Pasteur Merieux Serums Et Vaccins | Compositions and methods for administering Borrelia DNA |
| US5763239A (en) | 1996-06-18 | 1998-06-09 | Diversa Corporation | Production and use of normalized DNA libraries |
| JPH1066576A (ja) * | 1996-08-07 | 1998-03-10 | Novo Nordisk As | 突出末端を有する2本鎖dna及びこれを用いたdnaのシャフリング方法 |
| EP0963434A4 (en) | 1996-09-27 | 2000-10-25 | Maxygen Inc | METHODS TO OPTIMIZE GENE THERAPY BY RECURSIVE SEQUENCE SHUFFLING AND SELECTION |
| KR100570935B1 (ko) | 1997-01-17 | 2006-04-13 | 맥시겐, 인크. | 반복적 서열 재조합에 의한 전세포 및 유기체의 개량 방법 |
| CA2281002A1 (en) | 1997-02-19 | 1998-08-27 | Cornell Research Foundation, Inc. | Dna construct to confer multiple traits on plants |
| IL120339A0 (en) * | 1997-02-27 | 1997-06-10 | Gesher Israel Advanced Biotecs | Improved DNA assembly method |
| IL120338A0 (en) | 1997-02-27 | 1997-06-10 | Gesher Israel Advanced Biotecs | Single step DNA fragments assembly |
| US5948653A (en) | 1997-03-21 | 1999-09-07 | Pati; Sushma | Sequence alterations using homologous recombination |
| KR100816621B1 (ko) | 1997-04-07 | 2008-03-24 | 제넨테크, 인크. | 항-vegf 항체 |
| NZ500284A (en) | 1997-04-18 | 2001-09-28 | Biogen Inc | Type II TGF-beta receptor fusion proteins |
| AU7171098A (en) | 1997-05-01 | 1998-11-24 | Board Of Regents, The University Of Texas System | Directed evolution of enzymes and antibodies |
| GB9712512D0 (en) | 1997-06-16 | 1997-08-20 | Bioinvent Int Ab | A method for in vitro molecular evolution of protein function |
| ATE550042T1 (de) | 1997-11-20 | 2012-04-15 | Vical Inc | Behandlung von krebs mithilfe cytokin- exprimierender polynukleotide und zusammensetzungen dafür |
| JP2002508971A (ja) | 1998-01-15 | 2002-03-26 | アリアド・ジーン・セラピューティクス・インコーポレーテッド | 多量体キメラ蛋白質を使用する生物学的イベントの調節 |
| AU3291099A (en) | 1998-02-11 | 1999-08-30 | Maxygen, Inc. | Genetic vaccine vector engineering |
| EP1054973A1 (en) | 1998-02-11 | 2000-11-29 | Maxygen, Inc. | Antigen library immunization |
| IL140125A0 (en) | 1998-06-17 | 2002-02-10 | Maxygen Inc | Method for producing polynucleotides with desired properties |
| US6365408B1 (en) | 1998-06-19 | 2002-04-02 | Maxygen, Inc. | Methods of evolving a polynucleotides by mutagenesis and recombination |
| JP2002522072A (ja) * | 1998-08-12 | 2002-07-23 | マキシジェン, インコーポレイテッド | 工業用化学薬品の製造のためのモノオキシゲナーゼ遺伝子のdnaシャッフリング。 |
| US6368861B1 (en) | 1999-01-19 | 2002-04-09 | Maxygen, Inc. | Oligonucleotide mediated nucleic acid recombination |
| US6917882B2 (en) * | 1999-01-19 | 2005-07-12 | Maxygen, Inc. | Methods for making character strings, polynucleotides and polypeptides having desired characteristics |
| US6436675B1 (en) | 1999-09-28 | 2002-08-20 | Maxygen, Inc. | Use of codon-varied oligonucleotide synthesis for synthetic shuffling |
| US6376246B1 (en) | 1999-02-05 | 2002-04-23 | Maxygen, Inc. | Oligonucleotide mediated nucleic acid recombination |
| ES2341217T3 (es) | 1999-01-19 | 2010-06-17 | Maxygen, Inc. | Recombinacion de acidos nucleicos mediada por oligonucleotidos. |
| AU3725600A (en) | 1999-03-02 | 2000-09-21 | Maxygen, Inc. | Surrogate orphan ligands for orphan receptors |
| AU3391900A (en) | 1999-03-05 | 2000-09-21 | Maxygen, Inc. | Encryption of traits using split gene sequences |
| AU3879300A (en) * | 1999-03-09 | 2000-09-28 | Diversa Corporation | End selection in directed evolution |
| AU4039400A (en) * | 1999-03-26 | 2000-10-16 | Diversa Corporation | Exonuclease-mediated nucleic acid reassembly in directed evolution |
| AU4211600A (en) | 1999-04-10 | 2000-11-14 | Maxygen, Inc. | Modified lipid production |
| CA2377084A1 (en) | 1999-06-25 | 2001-01-04 | Doris Apt | Methods and compositions for engineering of attenuated vaccines |
| AU1456101A (en) | 1999-11-03 | 2001-05-14 | Maxygen, Inc. | Antibody diversity generation |
| EP1108791A1 (en) | 1999-12-16 | 2001-06-20 | Gromoll, Jörg | Genetic variants of the human FSH receptor and the influence thereof on gametogenesis |
| EP1108782B1 (de) | 1999-12-18 | 2005-10-19 | Gen-IAL GEN - Institut für Angewandte, Laboranalysen GmbH | Verfahren und Zusammensetzungen zur Isolierung und Reinigung von Nukleinsäuren |
| AU2594301A (en) | 1999-12-23 | 2001-07-03 | Maxygen, Inc. | Alteration of hydrolase genes and screening of the resulting libraries for the ability to catalyze specific reactions |
| IL150291A0 (en) | 2000-01-11 | 2002-12-01 | Maxygen Inc | Integrated systems and methods for diversity generation and screening |
| AU2001243670A1 (en) | 2000-03-20 | 2001-10-03 | Maxygen, Inc. | Method for generating recombinant dna molecules in complex mixtures |
| US6376191B1 (en) | 2000-03-22 | 2002-04-23 | Mergen, Ltd. | Microarray-based analysis of polynucleotide sequence variations |
| US20010049104A1 (en) | 2000-03-24 | 2001-12-06 | Stemmer Willem P.C. | Methods for modulating cellular and organismal phenotypes |
| EP1272967A2 (en) | 2000-03-30 | 2003-01-08 | Maxygen, Inc. | In silico cross-over site selection |
| FR2813314B1 (fr) | 2000-08-25 | 2004-05-07 | Biomethodes | Procede de mutagenese dirigee massive |
| US20060223066A1 (en) | 2005-03-29 | 2006-10-05 | Applera Corporation | Methods for normalizing and for identifying small nucleic acids |
| EP1907584A2 (en) | 2005-06-28 | 2008-04-09 | Agencourt Personal Genomics Corporation | Methods of producing and sequencing modified polynucleotides |
| US8938893B2 (en) | 2011-03-08 | 2015-01-27 | Athalonz, Llc | Athletic positioning apparatus and applications thereof |
| US9093064B2 (en) | 2013-03-11 | 2015-07-28 | The Nielsen Company (Us), Llc | Down-mixing compensation for audio watermarking |
-
1999
- 1999-06-14 US US09/332,835 patent/US6537776B1/en not_active Expired - Lifetime
-
2000
- 2000-02-04 EP EP11167668A patent/EP2397549A3/en not_active Ceased
- 2000-06-14 CA CA002374667A patent/CA2374667C/en not_active Expired - Fee Related
- 2000-06-14 AU AU56246/00A patent/AU5624600A/en not_active Abandoned
- 2000-06-14 MX MXPA01013020A patent/MXPA01013020A/es active IP Right Grant
- 2000-06-14 IL IL14693700A patent/IL146937A0/xx unknown
- 2000-06-14 EP EP20140195944 patent/EP2865754A1/en not_active Withdrawn
- 2000-06-14 JP JP2001503702A patent/JP4699662B2/ja not_active Expired - Fee Related
- 2000-06-14 US US09/594,459 patent/US6605449B1/en not_active Ceased
- 2000-06-14 EP EP00941550A patent/EP1192280A4/en not_active Ceased
- 2000-06-14 WO PCT/US2000/016838 patent/WO2000077262A1/en not_active Ceased
- 2000-06-14 HK HK02107285.7A patent/HK1045858A1/zh unknown
-
2001
- 2001-12-05 IL IL146937A patent/IL146937A/en not_active IP Right Cessation
-
2003
- 2003-04-24 US US10/422,523 patent/US20040002103A1/en not_active Abandoned
-
2007
- 2007-05-09 US US11/798,032 patent/USRE45349E1/en not_active Expired - Lifetime
-
2014
- 2014-12-23 US US14/581,571 patent/US20150119293A1/en not_active Abandoned
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866363A (en) * | 1985-08-28 | 1999-02-02 | Pieczenik; George | Method and means for sorting and identifying biological information |
| US5658727A (en) * | 1991-04-10 | 1997-08-19 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5759817A (en) * | 1991-04-10 | 1998-06-02 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5824485A (en) * | 1995-04-24 | 1998-10-20 | Chromaxome Corporation | Methods for generating and screening novel metabolic pathways |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP1192280A4 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6991922B2 (en) | 1998-08-12 | 2006-01-31 | Proteus S.A. | Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation |
| US7718786B2 (en) | 1998-08-12 | 2010-05-18 | Proteus Sa | Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained |
| EP1073710A4 (en) * | 1999-02-04 | 2007-12-19 | Verenium Corp | NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES |
| EP2397549A2 (en) * | 1999-02-04 | 2011-12-21 | BP Corporation North America Inc. | Non-stochastic generation of genetic vaccines and enzymes |
| US6951719B1 (en) | 1999-08-11 | 2005-10-04 | Proteus S.A. | Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained |
| US7838287B2 (en) | 2001-01-25 | 2010-11-23 | Evolva Sa | Library of a collection of cells |
| US8008459B2 (en) | 2001-01-25 | 2011-08-30 | Evolva Sa | Concatemers of differentially expressed multiple genes |
| WO2002086121A1 (en) * | 2001-04-25 | 2002-10-31 | Proteus | Template-mediated, ligation-oriented method of nonrandomly shuffling polynucleotides |
| JP2007524662A (ja) * | 2003-12-17 | 2007-08-30 | プラエシス ファーマシューティカルズ インコーポレーテッド | コードされたライブラリーの合成のための方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP4699662B2 (ja) | 2011-06-15 |
| US6537776B1 (en) | 2003-03-25 |
| EP2397549A3 (en) | 2013-02-20 |
| MXPA01013020A (es) | 2002-07-22 |
| EP2397549A2 (en) | 2011-12-21 |
| WO2000077262A9 (en) | 2002-06-13 |
| AU5624600A (en) | 2001-01-02 |
| JP2004500027A (ja) | 2004-01-08 |
| CA2374667C (en) | 2008-08-26 |
| IL146937A0 (en) | 2002-08-14 |
| US20040002103A1 (en) | 2004-01-01 |
| US20150119293A1 (en) | 2015-04-30 |
| USRE45349E1 (en) | 2015-01-20 |
| EP2865754A1 (en) | 2015-04-29 |
| EP1192280A1 (en) | 2002-04-03 |
| IL146937A (en) | 2010-11-30 |
| CA2374667A1 (en) | 2000-12-21 |
| US6605449B1 (en) | 2003-08-12 |
| EP1192280A4 (en) | 2006-04-05 |
| HK1045858A1 (zh) | 2002-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2374667C (en) | Synthetic ligation reassembly in directed evolution | |
| US6358709B1 (en) | End selection in directed evolution | |
| US6635449B2 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
| US6773900B2 (en) | End selection in directed evolution | |
| US6709841B2 (en) | Exonuclease-mediated gene assembly in directed evolution | |
| US6696275B2 (en) | End selection in directed evolution | |
| WO2000058517A1 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
| WO2000053744A2 (en) | End selection in directed evolution | |
| US6764835B2 (en) | Saturation mutageneis in directed evolution | |
| US6939689B2 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
| AU2009212959B2 (en) | Synthetic ligation reassembly in directed evolution | |
| US20040023327A1 (en) | End selection in directed evolution | |
| Class et al. | Patent application title: SYNTHETIC LIGATION REASSEMBLY IN DIRECTED EVOLUTION Inventors: Jay M. Short (Del Mar, CA, US) | |
| AU2005203018A1 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
| AU2005203719A1 (en) | End selection in directed evolution |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 56246/00 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2374667 Country of ref document: CA Ref country code: CA Ref document number: 2374667 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 503702 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/013020 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000941550 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000941550 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| AK | Designated states |
Kind code of ref document: C2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/24-24/24, DRAWINGS, REPLACED BY NEW PAGES 1/32-32/32; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |