AU4039400A - Exonuclease-mediated nucleic acid reassembly in directed evolution - Google Patents
Exonuclease-mediated nucleic acid reassembly in directed evolution Download PDFInfo
- Publication number
- AU4039400A AU4039400A AU40394/00A AU4039400A AU4039400A AU 4039400 A AU4039400 A AU 4039400A AU 40394/00 A AU40394/00 A AU 40394/00A AU 4039400 A AU4039400 A AU 4039400A AU 4039400 A AU4039400 A AU 4039400A
- Authority
- AU
- Australia
- Prior art keywords
- yes
- nucleic acid
- exonuclease
- polynucleotide
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1058—Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
Description
WO 00/58517 PCT/USOO/08245 EXONUCLEASE-MEDIATED NUCLEIC ACID REASSEMBLY IN DIRECTED EVOLUTION 5 FIELD OF THE INVENTION This invention relates to the field of protein engineering. More specifically, this relates to a directed evolution method for preparing a polynucleotides 10 encoding polypeptide, which method comprises the step of generating site-directed mutagenesis optionally in combination with the step of polynucleotide chimerization, the step of selecting for potentially desirable progeny molecules, including by a process termed end-selection (which may then be screened further), and the step of screening the polynucleotides for the production of polypeptide(s) 15 having a useful property. In a particular aspect, the present invention is relevant to enzymes, particularly to thermostable enzymes, and to their generation by directed evolution. More particularly, the present invention relates to thermostable enzymes which are 20 stable at high temperature and which have improved activity at lower temperatures. BACKGROUND 25 Harvesting the full potential of nature's diversity can include both the step of discovery and the step of optimizing what is discovered. For example, the step of discovery allows one to mine biological molecules that have industrial utility. However, for certain industrial needs, it is advantageous to further modify these enzymes experimentally to achieve properties beyond what natural evolution has 30 provided and is likely to provide in the near future. The process, termed directed evolution, of experimentally modifying a biological molecule towards a desirable property, can be achieved by mutagenizing one or more parental molecular templates and idendifying any desirable molecules 1 WO 00/58517 PCT/US00/08245 among the progeny molecules. However, currently available technologies used in directed evolution have several shortfalls. Among these shortfalls are: 1) Site-directed mutagenesis technologies, such as sloppy or low-fidelity PCR, are ineffective for systematically achieving at each position (site) 5 along a polypeptide sequence the full (saturated) range of possible mutations (i.e. all possible amino acid substitutions). 2) There is no relatively easy systematic means for rapidly analyzing the large amount of information that can be contained in a molecular sequence and in the potentially colossal number or progeny molecules that could be 10 conceivably obtained by the directed evolution of one or more molecular templates. 3) There is no relatively easy systematic means for providing comprehensive empirical information relating structure to function for molecular positions. 15 4) There is no easy systematic means for incorporating internal controls in certain mutagenesis (e.g. chimerization) procedures. 5) There is no easy systematic means to select for specific progeny molecules, such as full-length chimeras, from among smaller partial sequences. 20 Molecular mutagenesis occurs in nature and has resulted in the generation of a wealth of biological compounds that have shown utility in certain industrial applications. However, evolution in nature often selects for molecular properties that are discordant with many unmet industrial needs. Additionally, it is often the case 25 that when an industrially useful mutations would otherwise be favored at the molecular level, natural evolution often overrides the positive selection of such mutations when there is a concurrent detriment to an organism as a whole (such as when a favorable mutation is accompanied by a detrimental mutation). Additionally still, natural evolution is slow, and places high emphasis on fidelity in replication. 30 Finally, natural evolution prefers a path paved mainly by beneficial mutations while tending to avoid a plurality of successive negative mutations, even though such 2 WO 00/58517 PCT/USOO/08245 negative mutations may prove beneficial when combined, or may lead - through a circuitous route - to final state that is beneficial. Directed evolution, on the other hand, can be performed much more rapidly 5 and aimed directly at evolving a molecular property that is industrially desirable where nature does not provide one. An exceedingly large number of possibilities exist for purposeful and random combinations of amino acids within a protein to produce useful hybrid proteins and 10 their corresponding biological molecules encoding for these hybrid proteins, i.e., DNA, RNA. Accordingly, there is a need to produce and screen a wide variety of such hybrid proteins for a desirable utility, particularly widely varying random proteins. 15 The complexity of an active sequence of a biological macromolecule (e.g., polynucleotides, polypeptides, and molecules that are comprised of both polynucleotide and polypeptide sequences) has been called its information content ("IC"), which has been defined as the resistance of the active protein to amino acid sequence variation (calculated from the minimum number of invariable amino acids 20 (bits) required to describe a family of related sequences with the same function). Proteins that are more sensitive to random mutagenesis have a high information content. Molecular biology developments, such as molecular libraries, have allowed 25 the identification of quite a large number of variable bases, and even provide ways to select functional sequences from random libraries. In such libraries, most residues can be varied (although typically not all at the same time) depending on compensating changes in the context. Thus, while a 100 amino acid protein can contain only 2,000 different mutations. 20100 sequence combinations are possible. 30 3 WO 00/58517 PCT/USO0/08245 Information density is the IC per unit length of a sequence. Active sites of enzymes tend to have a high information density. By contrast, flexible linkers of information in enzymes have a low information density. 5 Current methods in widespread use for creating alternative proteins in a library format are error-prone polymerase chain reactions and cassette mutagenesis, in which the specific region to be optimized is replaced with a synthetically mutagenized oligonucleotide. In both cases, a substantial number of mutant sites are generated around certain sites in the original sequence. 10 Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. In a mixture of fragments of unknown sequence, error-prone PCR can be used to mutagenize the mixture. The published error-prone PCR protocols suffer from a low processivity 15 of the polymerase. Therefore, the protocol is unable to result in the random mutagenesis of an average-sized gene. This inability limits the practical application of error-prone PCR. Some computer simulations have suggested that point mutagenesis alone may often be too gradual to allow the large-scale block changes that are required for continued and dramatic sequence evolution. Further, 20 the published error-prone PCR protocols do not allow for amplification of DNA fragments greater than 0.5 to 1.0 kb, limiting their practical application. In addition, repeated cycles of error-prone PCR can lead to an accumulation of neutral mutations with undesired results, such as affecting a protein's immunogenicity but not its binding affinity. 25 In oligonucleotide-directed mutagenesis, a short sequence is replaced with a synthetically mutagenized oligonucleotide. This approach does not generate combinations of distant mutations and is thus not combinatorial. The limited library size relative to the vast sequence length means that many rounds of 30 selection are unavoidable for protein optimization. Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round followed by grouping them into families, arbitrarily choosing a single 4 WO 00/58517 PCT/USOO/08245 family, and reducing it to a consensus motif. Such motif is resynthesized and reinserted into a single gene followed by additional selection. This step process constitutes a statistical bottleneck, is labor intensive, and is not practical for many rounds of mutagenesis. 5 Error-prone PCR and oligonucleotide-directed mutagenesis are thus useful for single cycles of sequence fine tuning, but rapidly become too limiting when they are applied for multiple cycles. 10 Another limitation of error-prone PCR is that the rate of down-mutations grows with the information content of the sequence. As the information content, library size, and mutagenesis rate increase, the balance of down-mutations to up mutations will statistically prevent the selection of further improvements (statistical ceiling). 15 In cassette mutagenesis, a sequence block of a single template is typically replaced by a (partially) randomized sequence. Therefore, the maximum information content that can be obtained is statistically limited by the number of random sequences (i.e., library size). This eliminates other sequence families 20 which are not currently best, but which may have greater long term potential. Also, mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round. Thus, such an approach is tedious and impractical for many rounds of mutagenesis. 25 Thus, error-prone PCR and cassette mutagenesis are best suited, and have been widely used, for fine-tuning areas of comparatively low information content. One apparent exception is the selection of an RNA ligase ribozyme from a random library using many rounds of amplification by error-prone PCR and selection. 30 In nature, the evolution of most organisms occurs by natural selection and sexual reproduction. Sexual reproduction ensures mixing and combining of the 5 WO 00/58517 PCT/US00/08245 genes in the offspring of the selected individuals. During meiosis, homologous chromosomes from the parents line up with one another and cross-over part way along their length, thus randomly swapping genetic material. Such swapping or shuffling of the DNA allows organisms to evolve more rapidly. 5 In recombination, because the inserted sequences were of proven utility in a homologous environment, the inserted sequences are likely to still have substantial information content once they are inserted into the new sequence. 10 The term Applied Molecular Evolution ("AME") means the application of an evolutionary design algorithm to a specific, useful goal. While many different library formats for AME have been reported for polynucleotides, peptides and proteins (phage, lacI and polysomes), none of these formats have provided for recombination by random cross-overs to deliberately create a combinatorial library. 15 Theoretically there are 2,000 different single mutants of a 100 amino acid protein. However, a protein of 100 amino acids has 20100 possible sequence combinations, a number which is too large to exhaustively explore by conventional methods. It would be advantageous to develop a system which would allow 20 generation and screening of all of these possible combination mutations. Some workers in the art have utilized an in vivo site specific recombination system to generate hybrids of combine light chain antibody genes with heavy chain antibody genes for expression in a phage system. However, their system relies on 25 specific sites of recombination and is limited accordingly. Simultaneous mutagenesis of antibody CDR regions in single chain antibodies (scFv) by overlapping extension and PCR have been reported. Others have described a method for generating a large population of 30 multiple hybrids using random in vivo recombination. This method requires the recombination of two different libraries of plasmids, each library having a different selectable marker. The method is limited to a finite number of recombinations 6 WO 00/58517 PCT/USOO/08245 equal to the number of selectable markers existing, and produces a concomitant linear increase in the number of marker genes linked to the selected sequence(s). In vivo recombination between two homologous, but truncated, insect-toxin 5 genes on a plasmid has been reported as a method of producing a hybrid gene. The in vivo recombination of substantially mismatched DNA sequences in a host cell having defective mismatch repair enzymes, resulting in hybrid molecule formation has been reported. 7 WO 00/58517 PCT/USO0/08245 SUMMARY OF THE INVENTION This invention relates generally to the field of nucleic acid engineering and correspondingly encoded recombinant protein engineering. More particularly, the 5 invention relates to the directed evolution of nucleic acids and screening of clones containing the evolved nucleic acids for resultant activity(ies) of interest, such nucleic acid activity(ies) &/or specified protein, particularly enzyme, activity(ies) of interest. 10 This invention relates generally to a method of: 1) preparing a progeny generation molecule (including a molecule that is comprised of a polynucleotide sequence, a molecules that is comprised of a polypeptide sequence, and a molecules that is comprised in part of a polynucleotide sequence and in part of a polypeptide sequence), that is mutagenized to achieve at least one point mutation, addition, deletion, &/or 15 chimerization, from one or more ancestral or parental generation template(s); 2) screening the progeny generation molecule - preferably using a high throughput method for at least one property of interest (such as an improvement in an enzyme activity or an increase in stability or a novel chemotherapeutic effect); 3) optionally obtaining &/or cataloguing structural &/or and functional information regarding the parental &/or 20 progeny generation molecules; and 4) optionally repeating any of steps 1) to 3). In a preferred embodiment, this invention provides a method for producing a mutagenized progeny polynucleotide, comprising: (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease 25 mediated reassembly process so as to produce a progeny polynucleotide set; whereby the exonuclease-mediated reassembly process is exemplified, in a non limiting fashion, by subjection to a 3' exonuclease treatment, such as treatment with exonuclease III, which acts on 3' underhangs and blunt ends, to liberate 3'-terminal but not 5'-terminal nucleotides from a starting double stranded 30 polynucleotide, leaving a remaining strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner; 8 WO 00/58517 PCT/USOO/08245 whereby the exonuclease-mediated reassembly process is further exemplified, in a non limiting fashion, by subjection to a 5' exonuclease treatment, such as treatment with red alpha gene product, that acts on 5' underhangs to liberate 5'-terminal nucleotides from a starting double stranded polynucleotide, leaving a remaining 5 strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner; whereby the exonuclease-mediated reassembly process is further exemplified, in a non-limiting fashion, by subjection to an exonuclease treatment, such as 10 treatment with Mung Bean Nuclease or treatment with S I Nuclease or treatment with E.coli DNA Polymerase, that acts on overhanging ends, including on unhybridized ends, to liberate terminal nucleotides from an unhybridized single-stranded end of an annealed nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened but hybridized end to 15 facilitate polymerase-based extension and/or ligase-mediated ligation of the treated end; and whereby the exonuclease-mediated reassembly process is also exemplified by a dual treatment, that can be performed, for example, non-simultaneously, with both an exonuclease that liberates terminal nucleotides from underhanging 20 ends or blunt ends as well as an exonuclease that liberates terminal nucleotides from overhanging ends such as unhybridized ends. In a preferred aspect of this embodiment, this invention provides a method for producing a mutagenized progeny polynucleotide, wherein the 25 step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 3' exonuclease treatment that acts on 3' underhangs and blunt ends, to liberate 3'-terminal but not 5' 30 terminal nucleotides; whereby said 3' exonuclease is exemplified, in a non-limiting fashion, by treatment with an exonuclease, such as exonuclease III, to liberate 3'-terminal but not 5' 9 WO 00/58517 PCT/USOO/08245 terminal nucleotides from a starting double stranded polynucleotide, leaving a remaining strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner. 5 In another preferred aspect of this embodiment, this invention provides a method for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny 10 polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 5' exonuclease treatment that acts on 5' underhangs to liberate 5'-terminal nucleotides; whereby said 5' exonuclease is exemplified, in a non-limiting fashion, by treatment with an exonuclease, such as red alpha gene product, to liberate 5'-terminal 15 nucleotides from a starting double stranded polynucleotide, leaving a remaining strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner. 20 In yet another preferred aspect of this embodiment, this invention provides a method for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: 25 (i) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby said treatment is exemplified, in a non-limiting fashion, by subjection to an exonuclease treatment, such as treatment with Mung Bean Nuclease or treatment with Si Nuclease or treatment with E.coli DNA Polymerase, that 30 acts on overhanging ends, including on unhybridized ends, to liberate nucleotides from an unhybridized single-stranded end of an annealed nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened but 10 WO 00/58517 PCT/USOO/08245 hybridized end to facilitate polymerase-based extension and/or ligase mediated ligation of the treated end. In yet another preferred aspect of this embodiment, this invention provides a 5 method for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 3' exonuclease treatment 10 that acts on 3' underhangs and blunt ends, to liberate 3'-terminal but not 5' terminal nucleotides; and (ii) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby the exonuclease-mediated reassembly process is comprised of a dual 15 treatment, that can be performed, for example, non-simultaneously, with both an exonuclease that liberates terminal nucleotides from underhangs or blunt ends as well as an exonuclease that liberates terminal nucleotides from overhangs such as unhybridized ends. 20 In yet another preferred aspect of this embodiment, this invention provides a method for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: 25 (i) subjecting a starting or parental polynucleotide set to a 5' exonuclease treatment that acts on 5' underhangs to liberate 5'-terminal nucleotides; and (ii) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby the exonuclease-mediated reassembly process is comprised of a dual 30 treatment, that can be performed, for example, non-simultaneously, with both an exonuclease that liberates terminal nucleotides from underhangs or blunt 11 WO 00/58517 PCT/USOO/08245 ends as well as an exonuclease that liberates terminal nucleotides from overhangs such as unhybridized ends. In another preferred embodiment, this invention provides a method for 5 producing a mutagenized progeny polynucleotide having at least one desirable property comprised of the step of: (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease mediated reassembly process so as to produce a progeny polynucleotide set; and 10 (b) subjecting the progeny polynucleotide set to an end selection-based screening and enrichment process, so as to select for a desirable subset of the progeny polynucleotide set; whereby the above steps can be performed iteratively and in any order and in combination; 15 whereby the end selection-based process creates ligation-compatible ends; whereby the creation of ligation-compatible ends is optionally used to facilitate one or more intermolecular ligations, that are preferably directional ligations, within members of the progeny polynucleotide set so as to achieve assembly &/or reassembly mutagenesis; 20 whereby the creation of ligation-compatible ends serves to facilitate ligation of the progeny polynucleotide set into an expression vector system and expression cloning; whereby the expression cloning of the progeny polynucleotide set serves to generate a polypeptide set; 25 whereby the generated polypeptide set can be subjected to an expression screening process; and whereby expression screening of the progeny polypeptide set provides a means to identify a desirable species, e.g. a mutant polypeptide or alternatively a polypeptide fragment, that has a desirable property, such as a specific 30 enzymatic activity. 12 WO 00/58517 PCT/USOO/08245 In another preferred embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, comprising: a) annealing a poly-binding nucleic acid strand to two mono-binding nucleic acid 5 strands to generate an annealed heteromeric complex of nucleic acid strands; wherein the poly-binding nucleic acid strand and the two mono-binding nucleic acid strands are each derived from a different molecular species in said collection of progenitor polynucleotides; wherein the said collection of progenitor polynucleotides is preferably comprised of 10 nonidentical though possibly related progenitor polynucleotides, as exemplified by a collection of genes encoding dehalogenases; and wherein the poly-binding nucleic acid strand to two mono-binding nucleic acid strands each have at least a 7 nucleotide-long sequence of identity to the progenitor polynucleotides from which it is derived; and 15 b) subjecting the unhybridized single-stranded ends of the annealed mono-binding nucleic acid strands in the heteromeric complex to an exonuclease treatment that degrades said unhybridized ends; whereby the annealment of working poly-binding and mono-binding strands derived from nonidentical polynucleotides thus allows one to generate a 20 chimerization of said nonidentical polynucleotides; whereby, in a library of said annealed complexes of nucleic acid strands, many component strands have unhybridizable ends that are suboptimal or not serviceable for priming polymerase-based extension; and whereby the exonuclease treatment removes such unhybridizable ends to convert the 25 annealed complexes of nucleic acid strands into better primers for polymerase-based extension. In a preferred aspect of this embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of 30 progenitor polynucleotides, further comprising the step of: c) subjecting the annealed heteromeric complex to polymerase-based extension. 13 WO 00/58517 PCT/USO0/08245 In another preferred aspect of this embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, further comprising the step of: d) subjecting the annealed nucleic acid strands to a ligase treatment; 5 whereby subjection to ligase treatment is exemplified by subjection to T4 DNA Ligase treatment to achieve intermolecular ligation between the two annealed mono-binding strands, which thus become covalently linked forming a chimerized strand. 10 In yet another preferred aspect of this embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, further comprising the step of: e) separating the poly-binding nucleic acid strand from the ligated mono-binding 15 nucleic acid strands; whereby the separation of a poly-binding nucleic acid strand from ligated mono binding nucleic acid strands to which it is annealed can be achieved, for example, by either denaturation or by exposure to an enzymatic activity that selectively acts on the poly-binding nucleic acid strands. 20 In yet another preferred aspect of this embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, further comprising the step of: 25 f) generating a nucleic acid strand that is complementary to the ligated mono binding nucleic acid strand; whereby the resultant product is comprised of a double stranded mutagenized progeny polynucleotide. 30 In yet another preferred aspect of this embodiment, this invention provides a method for generating a mutagenized progeny polynucleotide from a collection of progenitor 14 WO 00/58517 PCT/USO0/08245 polynucleotides, further wherein the mutagenized progeny polynucleotide is a gene or gene pathway. In yet another preferred aspect of this embodiment, this invention provides a 5 method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, further comprising: expressing the generated mutagenized progeny polypeptide in a suitable host; whereby said expression leads to the generation of a product of the polypeptide that can be detected by expression screening. 10 In a preferred embodiment, there is generated (e.g. from a parent polynucleotide template) - in what is termed "codon site-saturation mutagenesis" - a progeny generation of polynucleotides, each having at least one set of up to three contiguous point mutations (i.e. different bases comprising a new codon), such that 15 every codon (or every family of degenerate codons encoding the same amino acid) is represented at each codon position. Corresponding to - and encoded by - this progeny generation of polynucleotides, there is also generated a set of progeny polypeptides, each having at least one single amino acid point mutation. In a preferred aspect, there is generated - in what is termed "amino acid site-saturation 20 mutagenesis" - one such mutant polypeptide for each of the 19 naturally encoded polypeptide-forming alpha-amino acid substitutions at each and every amino acid position along the polypeptide. This yields - for each and every amino acid position along the parental polypeptide - a total of 20 distinct progeny polypeptides including the original amino acid, or potentially more than 21 distinct progeny polypeptides if 25 additional amino acids are used either instead of or in addition to the 20 naturally encoded amino acids Thus, in another aspect, this approach is also serviceable for generating mutants containing - in addition to &/or in combination with the 20 naturally 30 encoded polypeptide-forming alpha-amino acids - other rare &/or not naturally encoded amino acids and amino acid derivatives. In yet another aspect, this approach is also serviceable for generating mutants by the use of - in addition to 15 WO 00/58517 PCT/USOO/08245 &/or in combination with natural or unaltered codon recognition systems of suitable hosts - altered, mutagenized, &/or designer codon recognition systems (such as in a host cell with one or more altered tRNA molecules). 5 In yet another aspect, this invention relates to recombination and more specifically to a method for preparing polynucleotides encoding a polypeptide by a method of in vivo re-assortment of polynucleotide sequences containing regions of partial homology, assembling the polynucleotides to form at least one polynucleotide and screening the polynucleotides for the production of polypeptide(s) having a useful 10 property. In yet another preferred embodiment, this invention is serviceable for analyzing and cataloguing - with respect to any molecular property (e.g. an enzymatic activity) or combination of properties allowed by current technology - the effects of any mutational 15 change achieved (including particularly saturation mutagenesis). Thus, a comprehensive method is provided for determining the effect of changing each amino acid in a parental polypeptide into each of at least 19 possible substitutions. This allows each amino acid in a parental polypeptide to be characterized and catalogued according to its spectrum of potential effects on a measurable property of the polypeptide. 20 In another aspect, the method of the present invention utilizes the natural property of cells to recombine molecules and/or to mediate reductive processes that reduce the complexity of sequences and extent of repeated or consecutive sequences possessing regions of homology. 25 It is an object of the present invention to provide a method for generating hybrid polynucleotides encoding biologically active hybrid polypeptides with enhanced activities. In accomplishing these and other objects, there has been provided, in accordance with one aspect of the invention, a method for introducing 30 polynucleotides into a suitable host cell and growing the host cell under conditions that produce a hybrid polynucleotide. 16 WO 00/58517 PCT/US0O/08245 In another aspect of the invention, the invention provides a method for screening for biologically active hybrid polypeptides encoded by hybrid polynucleotides. The present method allows for the identification of biologically active hybrid polypeptides with enhanced biological activities. 5 Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various 10 changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. In a specific embodiment, this invention provides method for producing and isolating a library of progeny polunucleotides having at least one desirable property 15 comprised of the steps of: (a) subjecting a starting or parental polynucleotide set to a mutagenesis process so as to produce a progeny polynucleotide set; and (b) subjecting the progeny polynucleotide set to an end selection-based screening and enrichment process, so as to select for a desirable 20 subset of the progeny polynucleotide set; whereby the above steps can be performed iteratively and in any order and in combination, whereby the end selection-based process creates ligation-compatible ends, 25 whereby the creation of ligation-compatible ends is optionally used to facilitate one or more intermolecular ligations, that are preferably directional ligations, within members of the progeny polynucleotide set so as to achieve assembly &/or reassembly mutagenesis, whereby the creation of ligation-compatible ends serves to facilitate ligation 30 of the progeny polynucleotide set into an expression vector system and expression cloning, 17 WO 00/58517 PCT/USOO/08245 whereby the end selection-based screening and enrichment process allows one to produce a library of progeny polynucleotides generated by a mutagenesis process, include non-stochastic polynucleotide site saturation mutagenesis (Gene Site Saturation MutagenesisTm) and 5 non-stochastic polynucleotide reassembly (GeneReassemblyTm), whereby the expression cloning of the progeny polynucleotide set serves to generate a full-length polypeptide set, whereby the generated polypeptide set can be subjected to an expression screening process, and 10 whereby expression screening of the progeny polypeptide set provides a means to identify a desirable species, e.g. a mutant polypeptide or alternatively a polypeptide fragment, that has a desirable property, such as a specific enzymatic activity. 15 In another specific embodiment, this invention provides a method for producing and isolating a polypeptide having at least one desirable property comprised of the steps of: (a) subjecting a starting or parental polynucleotide set to a mutagenesis 20 process so as to produce a progeny polynucleotide set; and (b) subjecting the progeny polynucleotide set to an end selection-based screening and enrichment process, so as to select for a desirable subset of the progeny polynucleotide set; 25 whereby the above steps can be performed iteratively and in any order and in combination, whereby the end selection-based process creates ligation-compatible ends, whereby the creation of ligation-compatible ends is optionally used to facilitate one or more intermolecular ligations, that are preferably 30 directional ligations, within members of the progeny polynucleotide set so as to achieve assembly &/or reassembly mutagenesis, 18 WO 00/58517 PCT/USOO/08245 whereby the end selection-based screening and enrichment process allows one to produce a library of progeny polynucleotides generated by a mutagenesis process, include non-stochastic polynucleotide site saturation mutagenesis (Gene Site Saturation MutagenesisTM) and 5 non-stochastic polynucleotide reassembly (GeneReassemblyTM), whereby the expression cloning of the progeny polynucleotide set serves to generate a full-length polypeptide set, whereby the creation of ligation-compatible ends serves to facilitate ligation of the progeny polynucleotide set into an expression vector system 10 and expression cloning, whereby the generated polypeptide set can be subjected to an expression screening process, and whereby expression screening of the progeny polypeptide set provides a means to identify a desirable species, e.g. a mutant polypeptide or 15 alternatively a polypeptide fragment, that has a desirable property, such as a specific enzymatic activity. In a specific aspect of this embodiment, this invention provides the immediately preceding methods, wherein the mutagenesis process of step (a) is 20 comprised of a process, termed saturation mutagenesis, for generating, from a codon-containing parental polypeptide template, a progeny polypeptide set in which a full range of single amino acid substitutions is represented at each amino acid position, comprising the steps of: (a) subjecting a working codon-containing template polynucleotide to 25 polymerase-based amplification using a degenerate oligonucleotide for each codon to mutagenized, where each of said degenerate oligonucleotides is comprised of a first homologous sequence and a degenerate triplet sequence, so as to generate a set of progeny polynucleotides; wherein said degenerate triplet sequence is selected from the group 30 consisting of i) N,N,N; ii) N,N,G/T; iii) N,N,G/C; iv) N,N,C/G/T; v) N,N,A/G/T; vi) N,N,A/C/T; vii) N,N,A/C/G; and viii) any degenerate codon that encodes all 20 amino acids; and 19 WO 00/58517 PCT/USOO/08245 (b) subjecting said set of progeny polynucleotides to recombinant expression such that polypeptides encoded by the progeny polynucleotides are produced; 5 whereby the above steps can be performed iteratively and in any order and in combination, and whereby, said method provides a means for generating all 20 amino acid changes at each amino acid site along a parental polypeptide template, 10 because the degeneracy of the triplet sequence includes codons for all 20 amino acids. In a specific aspect of this embodiment, this invention further provides the immediately preceding methods, wherein the mutagenesis process of step (a) is 15 comprised of a process, termed synthetic ligation gene reassembly or simply synthetic ligation gene reassembly. 20 WO 00/58517 PCT/USOO/08245 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the activity of the enzyme exonuclease III. This is an exemplary enzyme that can be used to shuffle, assemble, reassemble, recombine, and/or 5 concatenate polynucleotide building blocks. The asterisk indicates that the enzyme acts from the 3' direction towards the 5' direction of the polynucleotide substrate. Figure 2 shows an exemplary application of the enzyme exonuclease III in exonuclease-mediated polynucleotide reassembly. Shown also is the combined use 10 of in vivo "repair" by transforming a suitable host (e.g. Escherichia, Pseudomonas, Steptomyces, or Bacillus) and utilizing the host's repair mechanism to provide further diversity by generating a library of cloned mutagenized progeny nucleic acids ( and preferably polypeptides expressed by such nucleic acids) that can be analyzed by expression screening. 15 Figure 3 shows the generation of a poly-binding nucleic acid strand. In this case, the generated strand is of the same length as the parental template, but is not methylated. Dpn I treatment can thus be used to select for the generated strand. Although not shown, the template as well as the generated product can be part of a vector (linear 20 or circular). Figure 4 shows the use of exonuclease treatment as a means to liberate 3' and 5' terminal nucleotides from the unhybridized single-stranded end of an annealed nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened but 25 hybridized end to facilitate polymerase-based extension and/or ligase-mediated ligation of the treated end. Shown also is the combined use of in vivo "repair" by transforming a suitable host (e.g. Escherichia, Pseudomonas, Steptomyces, or Bacillus) and utilizing the host's repair mechanism to provide further diversity by generating a library of cloned 30 mutagenized progeny nucleic acids ( and preferably polypeptides expressed by such nucleic acids) that can be analyzed by expression screening. 21 WO 00/58517 PCT/USOO/08245 Figure 5 shows the use of exonuclease-mediated nucleic acid reassembly in an example in which one methylated poly-binding nucleic acid strand is annealed to several unmethylated mono-binding nucleic acid strands. The annealed nucleic acid strands form heteromeric nucleic acid complexes and are subjected to exonuclease 5 treatment as a means to liberate 3' and 5'-terminal nucleotides from the unhybridized single-stranded ends of a plurality of annealed nucleic acid strands in the heteromeric nucleic acid complexes, leaving shortened but hybridized ends to facilitate polymerase-based extension and/or ligase-mediated ligation of the treated ends. Treatment with DpnI is then serviceable for selecting against the generated 10 annealed mono-binding nucleic acid strands that are unmethylated and chimeric in nature. Figure 6 shows the use of exonuclease-mediated nucleic acid reassembly in an example in which a plurality of methylated poly-binding nucleic acid strand are 15 annealed to several unmethylated mono-binding nucleic acid strands. The annealed nucleic acid strands form heteromeric nucleic acid complexes that are subjected to exonuclease treatment as a means to liberate 3' and 5'-terminal nucleotides from the unhybridized single-stranded ends of a plurality of annealed nucleic acid strands in the heteromeric nucleic acid complexes, leaving shortened but hybridized ends to 20 facilitate polymerase-based extension and/or ligase-mediated ligation of the treated ends. Treatment with DpnI is then serviceable for selecting against the generated annealed mono-binding nucleic acid strands that are unmethylated and chimeric in nature. 22 WO 00/58517 PCT/USOO/08245 DEFINITIONS OF TERMS In order to facilitate understanding of the examples provided herein, certain frequently occurring methods and/or terms will be described. 5 The term "agent" is used herein to denote a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds (e.g., a VLSIPS peptide array, polynucleotide array, and/or combinatorial small molecule array), biological macromolecule, a bacteriophage peptide display library, a bacteriophage 10 antibody (e.g., scFv) display library, a polysome peptide display library, or an extract made form biological materials such as bacteria, plants, fungi, or animal (particular mammalian) cells or tissues. Agents are evaluated for potential activity as anti neoplastics, anti-inflammatories or apoptosis modulators by inclusion in screening assays described hereinbelow. Agents are evaluated for potential activity as specific 15 protein interaction inhibitors (i.e., an agent which selectively inhibits a binding interaction between two predetermined polypeptides but which doe snot substantially interfere with cell viability) by inclusion in screening assays described hereinbelow. 20 An "ambiguous base requirement" in a restriction site refers to a nucleotide base requirement that is not specified to the fullest extent, i.e. that is not a specific base (such as, in a non-limiting exemplification, a specific base selected from A, C, G, and T), but rather may be any one of at least two or more bases. Commonly accepted abbreviations that are used in the art as well as herein to 25 represent ambiguity in bases include the following: R = G or A; Y = C or T; M = A or C; K = G or T; S = G or C; W = A or T; H = A or C or T; B = G or T or C; V = G or C or A; D = G or A or T; N = A or C or G or T. The term "amino acid" as used herein refers to any organic compound that 30 contains an amino group (-NH 2 ) and a carboxyl group (-COOH); preferably either as free groups or alternatively after condensation as part of peptide bonds. The "twenty naturally encoded polypeptide-forming alpha-amino acids" are 23 WO 00/58517 PCT/USOO/08245 understood in the art and refer to: alanine (ala or A), arginine (arg or R), asparagine (asn or N), aspartic acid (asp or D), cysteine (cys or C), gluatamic acid (glu or E), glutamine (gln or Q), glycine (gly or G), histidine (his or H), isoleucine (ile or I), leucine (leu or L), lysine (lys or K), methionine (met or M), phenylalanine (phe or 5 F), proline (pro or P), serine (ser or S), threonine (thr or T), tryptophan (trp or W), tyrosine (tyr or Y), and valine (val or V). The term "amplification" means that the number of copies of a polynucleotide is increased. 10 The term "antibody", as used herein, refers to intact immunoglobulin molecules, as well as fragments of immunoglobulin molecules, such as Fab, Fab', (Fab') 2 , Fv, and SCA fragments, that are capable of binding to an epitope of an antigen. These antibody fragments, which retain some ability to selectively bind to 15 an antigen (e.g., a polypeptide antigen) of the antibody from which they are derived, can be made using well known methods in the art (see, e.g., Harlow and Lane, supra), and are described further, as follows. (1) An Fab fragment consists of a monovalent antigen-binding fragment of 20 an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain. (2) An Fab' fragment of an antibody molecule can be obtained by treating a 25 whole antibody molecule with pepsin, followed by reduction, to yield a molecule consisting of an intact light chain and a portion of a heavy chain. Two Fab' fragments are obtained per antibody molecule treated in this manner. 30 (3) An (Fab') 2 fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent 24 WO 00/58517 PCT/USOO/08245 reduction. A (Fab') 2 fragment is a dimer of two Fab' fragments, held together by two disulfide bonds. (4) An Fv fragment is defined as a genetically engineered fragment 5 containing the variable region of a light chain and the variable region of a heavy chain expressed as two chains. (5) An single chain antibody ("SCA") is a genetically engineered single chain molecule containing the variable region of a light chain and the 10 variable region of a heavy chain, linked by a suitable, flexible polypeptide linker. A molecule that has a "chimeric property" is a molecule that is: 1) in part homologous and in part heterologous to a first reference molecule; while 2) at the 15 same time being in part homologous and in part heterologous to a second reference molecule; without 3) precluding the possibility of being at the same time in part homologous and in part heterologous to still one or more additional reference molecules. In a non-limiting embodiment, a chimeric molecule may be prepared by assemblying a reassortment of partial molecular sequences. In a non-limiting aspect, 20 a chimeric polynucleotide molecule may be prepared by synthesizing the chimeric polynucleotide using plurality of molecular templates, such that the resultant chimeric polynucleotide has properties of a plurality of templates. The term "cognate" as used herein refers to a gene sequence that is 25 evolutionarily and functionally related between species. For example, but not limitation, in the human genome the human CD4 gene is the cognate gene to the mouse 3d4 gene, since the sequences and structures of these two genes indicate that they are highly homologous and both genes encode a protein which functions in signaling T cell activation through MHC class II-restricted antigen recognition. 30 A "comparison window," as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may 25 WO 00/58517 PCT/USOO/08245 be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal 5 alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith (Smith and Waterman, Adv Appl Math, 1981; Smith and Waterman, J Teor Biol, 1981; Smith and Waterman, JMol Biol, 1981; Smith et al, JMol Evol, 1981), by the homology alignment algorithm of Needleman (Needleman and Wuncsch, 10 1970), by the search of similarity method of Pearson (Pearson and Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison 15 window) generated by the various methods is selected. As used herein, the term "complementarity-determining region" and "CDR" refer to the art-recognized term as exemplified by the Kabat and Chothia CDR definitions also generally known as supervariable regions or hypervariable 20 loops (Chothia and Lesk, 1987; Clothia et al, 1989; Kabat et al, 1987; and Tramontano et al, 1990). Variable region domains typically comprise the amino terminal approximately 105-115 amino acids of a naturally-occurring immunoglobulin chain (e.g., amino acids 1-110), although variable domains somewhat shorter or longer are also suitable for forming single-chain antibodies. 25 "Conservative amino acid substitutions" refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of 30 amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and 26 WO 00/58517 PCT/USOO/08245 tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are : valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, 5 and asparagine-glutamine. The term "corresponds to" is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is 10 identical to a reference polypeptide sequence. In contradistinction, the term "complementary to" is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC" corresponds to a reference "TATAC" and is complementary to a reference sequence "GTATA." 15 The term "degrading effective" amount refers to the amount of enzyme which is required to process at least 50% of the substrate, as compared to substrate not contacted with the enzyme. Preferably, at least 80% of the substrate is degraded. 20 As used herein, the term "defined sequence framework" refers to a set of defined sequences that are selected on a non-random basis, generally on the basis of experimental data or structural data; for example, a defined sequence framework may comprise a set of amino acid sequences that are predicted to form a B-sheet structure or may comprise a leucine zipper heptad repeat motif, a zinc-finger 25 domain, among other variations. A "defined sequence kernal" is a set of sequences which encompass a limited scope of variability. Whereas (1) a completely random 10-mer sequence of the 20 conventional amino acids can be any of (20)10 sequences, and (2) a pseudorandom 10-mer sequence of the 20 conventional amino acids can be any of (20)10 sequences but will exhibit a bias for certain residues at certain 30 positions and/or overall, (3) a defined sequence kernal is a subset of sequences if each residue position was allowed to be any of the allowable 20 conventional amino acids (and/or allowable unconventional amino/imino acids). A defined sequence 27 WO 00/58517 PCT/USOO/08245 kernal generally comprises variant and invariant residue positions and/or comprises variant residue positions which can comprise a residue selected from a defined subset of amino acid residues), and the like, either segmentally or over the entire length of the individual selected library member sequence. Defined sequence 5 kernels can refer to either amino acid sequences or polynucleotide sequences. Of illustration and not limitation, the sequences (NNK)io and (NNM) 10 , wherein N represents A, T, G, or C; K represents G or T; and M represents A or C, are defined sequence kernels. 10 "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 gg of plasmid or DNA 15 fragment is used with about 2 units of enzyme in about 20 pl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 pg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about I hour at 37 0 C are 20 ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a gel to isolate the desired fragment. "Directional ligation" refers to a ligation in which a 5' end and a 3' end of a 25 polynuclotide are different enough to specify a preferred ligation orientation. For example, an otherwise untreated and undigested PCR product that has two blunt ends will typically not have a preferred ligation orientation when ligated into a cloning vector digested to produce blunt ends in its multiple cloning site; thus, directional ligation will typically not be displayed under these circumstances. In 30 contrast, directional ligation will typically displayed when a digested PCR product having a 5' EcoR I-treated end and a 3' BamH I-is ligated into a cloning vector that has a multiple cloning site digested with EcoR I and BamH I. 28 WO 00/58517 PCT/USOO/08245 The term "DNA shuffling" is used herein to indicate recombination between substantially homologous but non-identical sequences, in some embodiments DNA shuffling may involve crossover via non-homologous recombination, such as via 5 cer/lox and/or flp/frt systems and the like. As used in this invention, the term "epitope" refers to an antigenic determinant on an antigen, such as a phytase polypeptide, to which the paratope of an antibody, such as an phytase-specific antibody, binds. Antigenic determinants 10 usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three-dimensional structural characteristics, as well as specific charge characteristics. As used herein "epitope" refers to that portion of an antigen or other macromolecule capable of forming a binding interaction that interacts with the variable region binding body of an 15 antibody. Typically, such binding interaction is manifested as an intermolecular contact with one or more amino acid residues of a CDR. The terms "fragment", "derivative" and "analog" when referring to a reference polypeptide comprise a polypeptide which retains at least one biological 20 function or activity that is at least essentially same as that of the reference polypeptide. Furthermore, the terms "fragment", "derivative" or "analog" are exemplified by a "pro-form" molecule, such as a low activity proprotein that can be modified by cleavage to produce a mature enzyme with significantly higher activity. 25 A method is provided herein for producing from a template polypeptide a set of progeny polypeptides in which a "full range of single amino acid substitutions" is represented at each amino acid position. As used herein, "full range of single amino acid substitutions" is in reference to the naturally encoded 20 naturally encoded polypeptide-forming alpha-amino acids, as described herein. 30 The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region 29 WO 00/58517 PCT/USOO/08245 (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). "Genetic instability", as used herein, refers to the natural tendency of highly 5 repetitive sequences to be lost through a process of reductive events generally involving sequence simplification through the loss of repeated sequences. Deletions tend to involve the loss of one copy of a repeat and everything between the repeats. The term "heterologous" means that one single-stranded nucleic acid 10 sequence is unable to hybridize to another single-stranded nucleic acid sequence or its complement. Thus areas of heterology means that areas of polynucleotides or polynucleotides have areas or regions within their sequence which are unable to hybridize to another nucleic acid or polynucleotide. Such regions or areas are for example areas of mutations. 15 The term "homologous" or "homeologous" means that one single-stranded nucleic acid nucleic acid sequence may hybridize to a complementary single stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the 20 hybridization conditions such as temperature and salt concentrations as discussed later. Preferably the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp. An immunoglobulin light or heavy chain variable region consists of a 25 "framework" region interrupted by three hypervariable regions, also called CDR's. The extent of the framework region and CDR's have been precisely defined; see "Sequences of Proteins of Immunological Interest" (Kabat et al, 1987). The sequences of the framework regions of different light or heavy chains are relatively conserved within a specie. As used herein, a "human framework region" is a 30 framework region that is substantially identical (about 85 or more, usually 90-95 or more) to the framework region of a naturally occurring human immunoglobulin. the framework region of an antibody, that is the combined framework regions of the 30 WO 00/58517 PCT/US00/08245 constituent light and heavy chains, serves to position and align the CDR's. The CDR's are primarily responsible for binding to an epitope of an antigen. The benefits of this invention extend to "industrial applications" (or 5 industrial processes), which term is used to include applications in commercial industry proper (or simply industry) as well as non-commercial industrial applications (e.g. biomedical research at a non-profit institution). Relevant applications include those in areas of diagnosis, medicine, agriculture, manufacturing, and academia. 10 The term "identical" or "identity" means that two nucleic acid sequences have the same sequence or a complementary sequence. Thus, "areas of identity" means that regions or areas of a polynucleotide or the overall polynucleotide are identical or complementary to areas of another polynucleotide or the polynucleotide. 15 The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or enzyme present in a living animal is not isolated, but the same polynucleotide or enzyme, separated from some or all of the 20 coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or enzymes could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment. 25 By "isolated nucleic acid" is meant a nucleic acid, e.g., a DNA or RNA molecule, that is not immediately contiguous with the 5' and 3' flanking sequences with which it normally is immediately contiguous when present in the naturally occurring genome of the organism from which it is derived. The term thus describes, for example, a nucleic acid that is incorporated into a vector, such as a 30 plasmid or viral vector; a nucleic acid that is incorporated into the genome of a heterologous cell (or the genome of a homologous cell, but at a site different from that at which it naturally occurs); and a nucleic acid that exists as a separate 31 WO 00/58517 PCT/USOO/08245 molecule, e.g., a DNA fragment produced by PCR amplification or restriction enzyme digestion, or an RNA molecule produced by in vitro transcription. The term also describes a recombinant nucleic acid that forms part of a hybrid gene encoding additional polypeptide sequences that can be used, for example, in the production of 5 a fusion protein. As used herein "ligand" refers to a molecule, such as a random peptide or variable segment sequence, that is recognized by a particular receptor. As one of skill in the art will recognize, a molecule (or macromolecular complex) can be both 10 a receptor and a ligand. In general, the binding partner having a smaller molecular weight is referred to as the ligand and the binding partner having a greater molecular weight is referred to as a receptor. "Ligation" refers to the process of forming phosphodiester bonds between 15 two double stranded nucleic acid fragments (Sambrook et al, 1982, p. 146; Sambrook, 1989). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 pig of approximately equimolar amounts of the DNA fragments to be ligated. 20 As used herein, "linker" or "spacer" refers to a molecule or group of molecules that connects two molecules, such as a DNA binding protein and a random peptide, and serves to place the two molecules in a preferred configuration, e.g., so that the random peptide can bind to a receptor with minimal steric hindrance from the DNA binding protein. 25 As used herein, a "molecular property to be evolved" includes reference to molecules comprised of a polynucleotide sequence, molecules comprised of a polypeptide sequence, and molecules comprised in part of a polynucleotide sequence and in part of a polypeptide sequence. Particularly relevant - but by no means 30 limiting - examples of molecular properties to be evolved include enzymatic activities at specified conditions, such as related to temperature; salinity; pressure; pH; and concentration of glycerol, DMSO, detergent, &/or any other molecular 32 WO 00/58517 PCT/USOO/08245 species with which contact is made in a reaction environment. Additional particularly relevant - but by no means limiting - examples of molecular properties to be evolved include stabilities - e.g. the amount of a residual molecular property that is present after a specified exposure time to a specified environment, such as 5 may be encountered during storage. The term "mutations" means changes in the sequence of a wild-type nucleic acid sequence or changes in the sequence of a peptide. Such mutations may be point mutations such as transitions or transversions. The mutations may be deletions, 10 insertions or duplications. As used herein, the degenerate "N,N,G/T" nucleotide sequence represents 32 possible triplets, where "N" can be A, C, G or T. 15 The term "naturally-occurring" as used herein as applied to the object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. Generally, the term 20 naturally occurring refers to an object as present in a non-pathological (un-diseased) individual, such as would be typical for the species. As used herein, a "nucleic acid molecule" is comprised of at least one base or one base pair, depending on whether it is single-stranded or double-stranded, 25 respectively. Furthermore, a nucleic acid molecule may belong exclusively or chimerically to any group of nucleotide-containing molecules, as exemplified by, but not limited to, the following groups of nucleic acid molecules: RNA, DNA, genomic nucleic acids, non-genomic nucleic acids, naturally occurring and not naturally occurring nucleic acids, and synthetic nucleic acids. This includes, by way 30 of non-limiting example, nucleic acids associated with any organelle, such as the mitochondria, ribosomal RNA, and nucleic acid molecules comprised chimerically 33 WO 00/58517 PCT/USOO/08245 of one or more components that are not naturally occurring along with naturally occurring components. Additionally, a "nucleic acid molecule" may contain in part one or more 5 non-nucleotide-based components as exemplified by, but not limited to, amino acids and sugars. Thus, by way of example, but not limitation, a ribozyme that is in part nucleotide-based and in part protein-based is considered a "nucleic acid molecule". In addition, by way of example, but not limitation, a nucleic acid molecule 10 that is labeled with a detectable moiety, such as a radioactive or alternatively a non radioactive label, is likewise considered a "nucleic acid molecule". The terms "nucleic acid sequence coding for" or a "DNA coding sequence of' or a "nucleotide sequence encoding" a particular enzyme - as well as other 15 synonymous terms - refer to a DNA sequence which is transcribed and translated into an enzyme when placed under the control of appropriate regulatory sequences. A "promotor sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. The promoter is part of the DNA sequence. This sequence region 20 has a start codon at its 3' terminus. The promoter sequence does include the minimum number of bases where elements necessary to initiate transcription at levels detectable above background. However, after the RNA polymerase binds the sequence and transcription is initiated at the start codon (3' terminus with a promoter), transcription proceeds downstream in the 3' direction. Within the 25 promotor sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease Si) as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. The terms "nucleic acid encoding an enzyme (protein)" or "DNA encoding 30 an enzyme (protein)" or "polynucleotide encoding an enzyme (protein)" and other synonymous terms encompasses a polynucleotide which includes only coding 34 WO 00/58517 PCT/USO0/08245 sequence for the enzyme as well as a polynucleotide which includes additional coding and/or non-coding sequence. In one preferred embodiment, a "specific nucleic acid molecule species" is 5 defined by its chemical structure, as exemplified by, but not limited to, its primary sequence. In another preferred embodiment, a specific "nucleic acid molecule species" is defined by a function of the nucleic acid species or by a function of a product derived from the nucleic acid species. Thus, by way of non-limiting example, a "specific nucleic acid molecule species" may be defined by one or more 10 activities or properties attributable to it, including activities or properties attributable its expressed product. The instant definition of "assembling a working nucleic acid sample into a nucleic acid library" includes the process of incorporating a nucleic acid sample 15 into a vector-based collection, such as by ligation into a vector and transformation of a host. A description of relevant vectors, hosts, and other reagents as well as specific non-limiting examples thereof are provided hereinafter. The instant definition of "assembling a working nucleic acid sample into a nucleic acid library" also includes the process of incorporating a nucleic acid sample into a non 20 vector-based collection, such as by ligation to adaptors. Preferably the adaptors can anneal to PCR primers to facilitate amplification by PCR. Accordingly, in a non-limiting embodiment, a "nucleic acid library" is comprised of a vector-based collection of one or more nucleic acid molecules. In 25 another preferred embodiment a "nucleic acid library" is comprised of a non vector-based collection of nucleic acid molecules. In yet another preferred embodiment a "nucleic acid library" is comprised of a combined collection of nucleic acid molecules that is in part vector-based and in part non-vector-based. Preferably, the collection of molecules comprising a library is searchable and 30 separable according to individual nucleic acid molecule species. 35 WO 00/58517 PCT/USOO/08245 The present invention provides a "nucleic acid construct" or alternatively a "nucleotide construct" or alternatively a "DNA construct". The term "construct" is used herein to describe a molecule, such as a polynucleotide (e.g., a phytase polynucleotide) may optionally be chemically bonded to one or more additional 5 molecular moieties, such as a vector, or parts of a vector. In a specific - but by no means limiting - aspect, a nucleotide construct is exemplified by a DNA expression DNA expression constructs suitable for the transformation of a host cell. An "oligonucleotide" (or synonymously an "oligo") refers to either a single 10 stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides may or may not have a 5' phosphate. Those that do not will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. To 15 achieve polymerase-based amplification (such as with PCR), a "32-fold degenerate oligonucleotide that is comprised of, in series, at least a first homologous sequence, a degenerate N,N,G/T sequence, and a second homologous sequence" is mentioned. As used in this context, "homologous" is in reference to homology between the oligo and the parental polynucleotide that is subjected to the 20 polymerase-based amplification. As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid 25 sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. 30 A coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from 36 WO 00/58517 PCT/US00/08245 both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein. 5 As used herein the term "parental polynucleotide set" is a set comprised of one or more distinct polynucleotide species. Usually this term fis used in reference to a progeny polynucleotide set which is preferably obtained by mutagenization of the parental set, in which case the terms "parental", "starting" and "template" are used interchangeably. 10 As used herein the term "physiological conditions" refers to temperature, pH, ionic strength, viscosity, and like biochemical parameters which are compatible with a viable organism, and/or which typically exist intracellularly in a viable cultured yeast cell or mammalian cell. For example, the intracellular conditions in a 15 yeast cell grown under typical laboratory culture conditions are physiological conditions. Suitable in vitro reaction conditions for in vitro transcription cocktails are generally physiological conditions. In general, in vitro physiological conditions comprise 50-200 mM NaCl or KCl, pH 6.5-8.5, 20-45*C and 0.001-10 mM divalent cation (e.g., Mg", Ca"); preferably about 150 mM NaCl or KCl, pH 7.2-7.6, 5 mM 20 divalent cation, and often include 0.01-1.0 percent nonspecific protein (e.g., BSA). A non-ionic detergent (Tween, NP-40, Triton X-100) can often be present, usually at about 0.001 to 2%, typically 0.05-0.2% (v/v). Particular aqueous conditions may be selected by the practitioner according to conventional methods. For general guidance, the following buffered aqueous conditions may be applicable: 10-250 25 mM NaCl, 5-50 mM Tris HCI, pH 5-8, with optional addition of divalent cation(s) and/or metal chelators and/or non-ionic detergents and/or membrane fractions and/or anti-foam agents and/or scintillants. Standard convention (5' to 3') is used herein to describe the sequence of 30 double standed polynucleotides. 37 WO 00/58517 PCT/USOO/08245 The term "population" as used herein means a collection of components such as polynucleotides, portions or polynucleotides or proteins. A "mixed population: means a collection of components which belong to the same family of nucleic acids or proteins (i.e., are related) but which differ in their sequence (i.e., are 5 not identical) and hence in their biological activity. A molecule having a "pro-form" refers to a molecule that undergoes any combination of one or more covalent and noncovalent chemical modifications (e.g. glycosylation, proteolytic cleavage, dimerization or oligomerization, temperature 10 induced or pH-induced conformational change, association with a co-factor, etc.) en route to attain a more mature molecular form having a property difference (e.g. an increase in activity) in comparison with the reference pro-form molecule. When two or more chemical modification (e.g. two proteolytic cleavages, or a proteolytic cleavage and a deglycosylation) can be distinguished en route to the production of a 15 mature molecule, the reference precursor molecule may be termed a "pre-pro form" molecule. As used herein, the term "pseudorandom" refers to a set of sequences that have limited variability, such that, for example, the degree of residue variability at 20 another position, but any pseudorandom position is allowed some degree of residue variation, however circumscribed. "Quasi-repeated units", as used herein, refers to the repeats. to be re assorted and are by definition not identical. Indeed the method is proposed not only 25 for practically identical encoding units produced by mutagenesis of the identical starting sequence, but also the reassortment of similar or related sequences which may diverge significantly in some regions. Nevertheless, if the sequences contain sufficient homologies to be reassorted by this approach, they can be referred to as ''quasi-repeated" units. 30 As used herein "random peptide library" refers to a set of polynucleotide sequences that encodes a set of random peptides, and to the set of random peptides 38 WO 00/58517 PCT/USOO/08245 encoded by those polynucleotide sequences, as well as the fusion proteins contain those random peptides. As used herein, "random peptide sequence" refers to an amino acid 5 sequence composed of two or more amino acid monomers and constructed by a stochastic or random process. A random peptide can include framework or scaffolding motifs, which may comprise invariant sequences. As used herein, "receptor" refers to a molecule that has an affinity for a 10 given ligand. Receptors can be naturally occurring or synthetic molecules. Receptors can be employed in an unaltered state or as aggregates with other species. Receptors can be attached, covalently or non-covalently, to a binding member, either directly or via a specific binding substance. Examples of receptors include, but are not limited to, antibodies, including monoclonal antibodies and antisera reactive 15 with specific antigenic determinants (such as on viruses, cells, or other materials), cell membrane receptors, complex carbohydrates and glycoproteins, enzymes, and hormone receptors. "Recombinant" enzymes refer to enzymes produced by recombinant DNA 20 techniques, i.e., produced from cells transformed by an exogenous DNA construct encoding the desired enzyme. "Synthetic" enzymes are those prepared by chemical synthesis. The term "related polynucleotides" means that regions or areas of the 25 polynucleotides are identical and regions or areas of the polynucleotides are heterologous. "Reductive reassortment", as used herein, refers to the increase in molecular diversity that is accrued through deletion (and/or insertion) events that are 30 mediated by repeated sequences. 39 WO 00/58517 PCT/USOO/08245 The following terms are used to describe the sequence relationships between two or more polynucleotides: "reference sequence," "comparison window," "sequence identity," "percentage of sequence identity," and "substantial identity." 5 A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence 10 is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length. Since two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides and (2) may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between 15 two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. "Repetitive Index (RI)", as used herein, is the average number of copies of 20 the quasi-repeated units contained in the cloning vector. The term "restriction site" refers to a recognition sequence that is necessary for the manifestation of the action of a restriction enzyme, and includes a site of catalytic cleavage. It is appreciated that a site of cleavage may or may not be 25 contained within a portion of a restriction site that comprises a low ambiguity sequence (i.e. a sequence containing the principal determinant of the frequency of occurrence of the restriction site). Thus, in many cases, relevant restriction sites contain only a low ambiguity sequence with an internal cleavage site (e.g. G/AATTC in the EcoR I site) or an immediately adjacent cleavage site (e.g. 30 /CCWGG in the EcoR II site). In other cases, relevant restriction enzymes [e.g. the Eco57 I site or CTGAAG(16/14)] contain a low ambiguity sequence (e.g. the CTGAAG sequence in the Eco57 I site) with an external cleavage site (e.g. in the 40 WO 00/58517 PCT/US0O/08245
N
16 portion of the Eco57 I site). When an enzyme (e.g. a restriction enzyme) is said to "cleave" a polynucleotide, it is understood to mean that the restriction enzyme catalyzes or facilitates a cleavage of a polynucleotide. 5 In a non-limiting aspect, a "selectable polynucleotide" is comprised of a 5' terminal region (or end region), an intermediate region (i.e. an internal or central region), and a 3' terminal region (or end region). As used in this aspect, a 5' terminal region is a region that is located towards a 5' polynucleotide terminus (or a 5' polynucleotide end); thus it is either partially or entirely in a 5' half of a 10 polynucleotide. Likewise, a 3' terminal region is a region that is located towards a 3' polynucleotide terminus (or a 3' polynucleotide end); thus it is either partially or entirely in a 3' half of a polynucleotide. As used in this non-limiting exemplification, there may be sequence overlap between any two regions or even among all three regions. 15 The term "sequence identity" means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the 20 number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. This "substantial identity", as used herein, denotes 25 a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having at least 80 percent sequence identity, preferably at least 85 percent identity, often 90 to 95 percent sequence identity, and most commonly at least 99 percent sequence identity as compared to a reference sequence of a comparison window of at least 25-50 nucleotides, wherein the percentage of 30 sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison. 41 WO 00/58517 PCT/USOO/08245 As known in the art "similarity" between two enzymes is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one enzyme to the sequence of a second enzyme. Similarity may be determined by 5 procedures which are well-known in the art, for example, a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information). As used herein, the term "single-chain antibody" refers to a polypeptide comprising a VH domain and a VL domain in polypeptide linkage, generally liked 10 via a spacer peptide (e.g., [Gly-Gly-Gly-Gly-Ser]x), and which may comprise additional amino acid sequences at the amino- and/or carboxy- termini. For example, a single-chain antibody may comprise a tether segment for linking to the encoding polynucleotide. As an example, a scFv is a single-chain antibody. Single chain antibodies are generally proteins consisting of one or more polypeptide 15 segments of at least 10 contiguous amino substantially encoded by genes of the immunoglobulin superfamily (e.g., see Williams and Barclay, 1989, pp. 361-368, which is incorporated herein by reference), most frequently encoded by a rodent, non-human primate, avian, porcine bovine, ovine, goat, or human heavy chain or light chain gene sequence. A functional single-chain antibody generally contains a 20 sufficient portion of an immunoglobulin superfamily gene product so as to retain the property of binding to a specific target molecule, typically a receptor or antigen (epitope). The members of a pair of molecules (e.g., an antibody-antigen pair or a 25 nucleic acid pair) are said to "specifically bind" to each other if they bind to each other with greater affinity than to other, non-specific molecules. For example, an antibody raised against an antigen to which it binds more efficiently than to a non specific protein can be described as specifically binding to the antigen. (Similarly, a nucleic acid probe can be described as specifically binding to a nucleic acid target if 30 it forms a specific duplex with the target by base pairing interactions (see above).) 42 WO 00/58517 PCT/USOO/08245 "Specific hybridization" is defined herein as the formation of hybrids between a first polynucleotide and a second polynucleotide (e.g., a polynucleotide having a distinct but substantially identical sequence to the first polynucleotide), wherein substantially unrelated polynucleotide sequences do not form hybrids in the 5 mixture. The term "specific polynucleotide" means a polynucleotide having certain end points and having a certain nucleic acid sequence. Two polynucleotides wherein one polynucleotide has the identical sequence as a portion of the second 10 polynucleotide but different ends comprises two different specific polynucleotides. "Stringent hybridization conditions" means hybridization will occur only if there is at least 90% identity, preferably at least 95% identity and most preferably at least 97% identity between the sequences. See Sambrook et al, 1989, which is 15 hereby incorporated by reference in its entirety. Also included in the invention are polypeptides having sequences that are "substantially identical" to the sequence of a phytase polypeptide, such as one of SEQ ID 1. A "substantially identical" amino acid sequence is a sequence that differs 20 from a reference sequence only by conservative amino acid substitutions, for example, substitutions of one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for 25 asparagine). Additionally a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence or by one or more non-conservative substitutions, deletions, or insertions, particularly when such a substitution occurs at 30 a site that is not the active site the molecule, and provided that the polypeptide essentially retains its behavioural properties. For example, one or more amino acids can be deleted from a phytase polypeptide, resulting in modification of the structure 43 WO 00/58517 PCT/USOO/08245 of the polypeptide, without significantly altering its biological activity. For example, amino- or carboxyl-terminal amino acids that are not required for phytase biological activity can be removed. Such modifications can result in the development of smaller active phytase polypeptides. 5 The present invention provides a "substantially pure enzyme". The term "substantially pure enzyme" is used herein to describe a molecule, such as a polypeptide (e.g., a phytase polypeptide, or a fragment thereof) that is substantially free of other proteins, lipids, carbohydrates, nucleic acids, and other biological 10 materials with which it is naturally associated. For example, a substantially pure molecule, such as a polypeptide, can be at least 60%, by dry weight, the molecule of interest. The purity of the polypeptides can be determined using standard methods including, e.g., polyacrylamide gel electrophoresis (e.g., SDS-PAGE), column chromatography (e.g., high performance liquid chromatography (HPLC)), and 15 amino-terminal amino acid sequence analysis. As used herein, "substantially pure" means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual macromolecular species in the composition), and preferably 20 substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 to 90 percent of all macromolecular species present in the composition. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot 25 be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules (<500 Daltons), and elemental ion species are not considered macromolecular species. 30 As used herein, the term "variable segment" refers to a portion of a nascent peptide which comprises a random, pseudorandom, or defined kernal sequence. A variable segment" refers to a portion of a nascent peptide which comprises a random 44 WO 00/58517 PCT/USOO/08245 pseudorandom, or defined kernal sequence. A variable segment can comprise both variant and invariant residue positions, and the degree of residue variation at a variant residue position may be limited: both options are selected at the discretion of the practitioner. Typically, variable segments are about 5 to 20 amino acid 5 residues in length (e.g., 8 to 10), although variable segments may be longer and may comprise antibody portions or receptor proteins, such as an antibody fragment, a nucleic acid binding protein, a receptor protein, and the like. The term "wild-type" means that the polynucleotide does not comprise any 10 mutations. A "wild type" protein means that the protein will be active at a level of activity found in nature and will comprise the amino acid sequence found in nature. The term "working", as in "working sample", for example, is simply a sample with which one is working. Likewise, a "working molecule", for example 15 is a molecule with which one is working. 45 WO 00/58517 PCT/USOO/08245 DETAILED DESCRIPTION OF THE INVENTION The invention described herein is directed to the use of repeated cycles of reductive reassortment, recombination and selection which allow for the directed 5 molecular evolution of highly complex linear sequences, such as DNA, RNA or proteins thorough recombination. In vivo shuffling of molecules can be performed utilizing the natural property of cells to recombine multimers. While recombination in vivo has provided the 10 major natural route to molecular diversity, genetic recombination remains a relatively complex process that involves 1) the recognition of homologies; 2) strand cleavage, strand invasion, and metabolic steps leading to the production of recombinant chiasma; and finally 3) the resolution of chiasma into discrete recombined molecules. The formation of the chiasma requires the recognition of 15 homologous sequences. In a preferred embodiment, the invention relates to a method for producing a hybrid polynucleotide from at least a first polynucleotide and a second polynucleotide. The present invention can be used to produce a hybrid 20 polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell. The regions of partial sequence homology promote processes which result in sequence reorganization producing a hybrid polynucleotide. The term "hybrid polynucleotide", as used herein, is any nucleotide sequence which 25 results from the method of the present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes which utilize repeated sequences to 30 alter a nucleotide sequence within a DNA molecule. 46 WO 00/58517 PCT/US00/08245 The invention provides a means for generating hybrid polynucleotides which may encode biologically active hybrid polypeptides. In one aspect, the original polynucleotides encode biologically active polypeptides. The method of the invention produces new hybrid polypeptides by utilizing cellular processes which 5 integrate the sequence of the original polynucleotides such that the resulting hybrid polynucleotide encodes a polypeptide demonstrating activities derived from the original biologically active polypeptides. For example, the original polynucleotides may encode a particular enzyme from different microorganisms. An enzyme encoded by a first polynucleotide from one organism may, for example, function 10 effectively under a particular environmental condition, e.g. high salinity. An enzyme encoded by a second polynucleotide from a different organism may function effectively under a different environmental condition, such as extremely high temperatures. A hybrid polynucleotide containing sequences from the first and second original polynucleotides may encode an enzyme which exhibits 15 characteristics of both enzymes encoded by the original polynucleotides. Thus, the enzyme encoded by the hybrid polynucleotide may function effectively under environmental conditions shared by each of the enzymes encoded by the first and second polynucleotides, e.g., high salinity and extreme temperatures. 20 Enzymes encoded by the original polynucleotides of the invention include, but are not limited to; oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases. A hybrid polypeptide resulting from the method of the invention may exhibit specialized enzyme activity not displayed in the original enzymes. For example, following recombination and/or reductive reassortment of polynucleotides 25 encoding hydrolase activities, the resulting hybrid polypeptide encoded by a hybrid polynucleotide can be screened for specialized hydrolase activities obtained from each of the original enzymes, i.e. the type of bond on which the hydrolase acts and the temperature at which the hydrolase functions. Thus, for example, the hydrolase may be screened to ascertain those chemical functionalities which distinguish the 30 hybrid hydrolase from the original hydrolyases, such as: (a) amide (peptide bonds), i.e. proteases; (b) ester bonds, i.e. esterases and lipases; (c) acetals, i.e., glycosidases 47 WO 00/58517 PCT/USOO/08245 and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions. Sources of the original polynucleotides may be isolated from individual 5 organisms ("isolates"), collections of organisms that have been grown in defined media ("enrichment cultures"), or, most preferably, uncultivated organisms ("environmental samples"). The use of a culture-independent approach to derive polynucleotides encoding novel bioactivities from environmental samples is most preferable since it allows one to access untapped resources of biodiversity. 10 "Environmental libraries" are generated from environmental samples and represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA is initially extracted directly from environmental samples, the libraries 15 are not limited to the small fraction of prokaryotes that can be grown in pure culture. Additionally, a normalization of the environmental DNA present in these samples could allow more equal representation of the DNA from all of the species present in the original sample. This can dramatically increase the efficiency of finding interesting genes from minor constituents of the sample which may be 20 under-represented by several orders of magnitude compared to the dominant species. For example, gene libraries generated from one or more uncultivated microorganisms are screened for an activity of interest. Potential pathways encoding bioactive molecules of interest are first captured in prokaryotic cells in the 25 form of gene expression libraries. Polynucleotides encoding activities of interest are isolated from such libraries and introduced into a host cell. The host cell is grown under conditions which promote recombination and/or reductive reassortment creating potentially active biomolecules with novel or enhanced activities. 30 The microorganisms from which the polynucleotide may be prepared include prokaryotic microorganisms, such as Eubacteria and Archaebacteria, and lower eukaryotic microorganisms such as fungi, some algae and protozoa. Polynucleotides 48 WO 00/58517 PCT/USOO/08245 may be isolated from environmental samples in which case the nucleic acid may be recovered without the culturing of an organism or recovered from one or more cultured organisms. In one aspect, such microorganisms may be extremophiles, such as hyperthermophiles, psychrophiles, psychrotrophs, halophiles, barophiles and 5 acidophiles. Polynucleotides encoding enzymes isolated from extremophilic microorganisms are particularly preferred. Such enzymes may function at temperatures above 1 00"C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0"C in arctic waters, in the saturated salt environment of the Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, 10 or at pH values greater than 11 in sewage sludge. For example, several esterases and lipases cloned and expressed from extremophilic organisms show high activity throughout a wide range of temperatures and pHs. Polynucleotides selected and isolated as hereinabove described are 15 introduced into a suitable host cell. A suitable host cell is any cell which is capable of promoting recombination and/or reductive reassortment. The selected polynucleotides are preferably already in a vector which includes appropriate control sequences. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or preferably, the host cell can be a 20 prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis et al, 1986). As representative examples of appropriate hosts, there may be mentioned: 25 bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; and plant cells. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein. 30 With particular references to various mammalian cell culture systems that can be employed to express recombinant protein, examples of mammalian 49 WO 00/58517 PCT/USOO/08245 expression systems include the COS-7 lines of monkey kidney fibroblasts, described in "SV40-transformed simian cells support the replication of early SV40 mutants" (Gluzman, 1981), and other cell lines capable of expressing a compatible vector, for example, the C 127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression 5 vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements. 10 Host cells containing the polynucleotides of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected 15 for expression, and will be apparent to the ordinarily skilled artisan. The clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity. 20 In another aspect, it is envisioned the method of the present invention can be used to generate novel polynucleotides encoding biochemical pathways from one or more operons or gene clusters or portions thereof. For example, bacteria and many eukaryotes have a coordinated mechanism for regulating genes whose products are involved in related processes. The genes are clustered, in structures referred to as 25 "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription of the entire cluster. Thus, a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function. An example of a biochemical pathway encoded by gene clusters are polyketides. Polyketides are 30 molecules which are an extremely rich source of bioactivities, including antibiotics (such as tetracyclines and erythromycin), anti-cancer agents (daunomycin), immunosuppressants (FK506 and rapamycin), and veterinary products (monensin). 50 WO 00/58517 PCT/US0O/08245 Many polyketides (produced by polyketide synthases) are valuable as therapeutic agents. Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of an enormous variety of carbon chains differing in length and patterns of functionality and cyclization. Polyketide synthase genes fall into gene clusters 5 and at least one type (designated type I) of polyketide synthases have large size genes and enzymes, complicating genetic manipulation and in vitro studies of these genes/proteins. The ability to select and combine desired components from a library of 10 polyketides, or fragments thereof, and postpolyketide biosynthesis genes for generation of novel polyketides for study is appealing. The method of the present invention makes it possible to facilitate the production of novel polyketide synthases through intermolecular recombination. 15 Preferably, gene cluster DNA can be isolated from different organisms and ligated into vectors, particularly vectors containing expression regulatory sequences which can control and regulate the production of a detectable protein or protein related array activity from the ligated gene clusters. Use of vectors which have an exceptionally large capacity for exogenous DNA introduction are particularly 20 appropriate for use with such gene clusters and are described by way of example herein to include the f-factor (or fertility factor) of E. coli. This f-factor of E. coli is a plasmid which affect high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large DNA fragments, such as gene clusters from mixed microbial samples. Once ligated into an appropriate vector, two or more 25 vectors containing different polyketide synthase gene clusters can be introduced into a suitable host cell. Regions of partial sequence homology shared by the gene clusters will promote processes which result in sequence reorganization resulting in a hybrid gene cluster. The novel hybrid gene cluster can then be screened for enhanced activities not found in the original gene clusters. 30 51 WO 00/58517 PCT/USOO/08245 Therefore, in a preferred embodiment, the present invention relates to a method for producing a biologically active hybrid polypeptide and screening such a polypeptide for enhanced activity by: 1) introducing at least a first polynucleotide in operable linkage and a 5 second polynucleotide in operable linkage, said at least first polynucleotide and second polynucleotide sharing at least one region of partial sequence homology, into a suitable host cell; 2) growing the host cell under conditions which promote sequence reorganization resulting in a hybrid polynucleotide in operable linkage; 10 3) expressing a hybrid polypeptide encoded by the hybrid polynucleotide; 4) screening the hybrid polypeptide under conditions which promote identification of enhanced biological activity; and 5) isolating the a polynucleotide encoding the hybrid polypeptide. 15 Methods for screening for various enzyme activities are known to those of skill in the art and discussed throughout the present specification. Such methods may be employed when isolating the polypeptides and polynucleotides of the present invention. 20 As representative examples of expression vectors which may be used there may be mentioned viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g. vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), P1-based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other 25 vectors specific for specific hosts of interest (such as bacillus, aspergillus and yeast). Thus, for example, the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. The following 30 vectors are provided by way of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXT1, pSG5 (Stratagene), 52 WO 00/58517 PCT/USOO/08245 pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid or other vector may be used as long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention. 5 A preferred type of vector for use in the present invention contains an f-factor origin replication. The f-factor (or fertility factor) in E. coli is a plasmid which effects high frequency transfer of itself during conjugation and less frequent transfer of the bacterial chromosome itself. A particularly preferred embodiment is 10 to use cloning vectors, referred to as "fosmids" or bacterial artificial chromosome (BAC) vectors. These are derived from E. coli f-factor which is able to stably integrate large segments of genomic DNA. When integrated with DNA from a mixed uncultured environmental sample, this makes it possible to achieve large genomic fragments in the form of a stable "environmental DNA library." 15 Another preferred type of vector for use in the present invention is a cosmid vector. Cosmid vectors were originally designed to clone and propagate large segments of genomic DNA. Cloning into cosmid vectors is described in detail in "Molecular Cloning: A laboratory Manual" (Sambrook et al, 1989). 20 The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct RNA synthesis. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine 25 kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. Promoter regions can be selected 30 from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. 53 WO 00/58517 PCT/US00/08245 In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli. 5 Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP 1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. 10 Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), cc-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into 15 the periplasmic space or extracellular medium. The cloning strategy permits expression via both vector driven and endogenous promoters; vector promotion may be important with expression of genes whose endogenous promoter will not function in E. coli. 20 The DNA isolated or derived from microorganisms can preferably be inserted into a vector or a plasmid prior to probing for selected DNA. Such vectors or plasmids are preferably those containing expression regulatory sequences, including promoters, enhancers and the like. Such polynucleotides can be part of a 25 vector and/or a composition and still be isolated, in that such vector or composition is not part of its natural environment. Particularly preferred phage or plasmid and methods for introduction and packaging into them are described in detail in the protocol set forth herein. 30 The selection of the cloning vector depends upon the approach taken, for example, the vector can be any cloning vector with an adequate capacity to multiply repeated copies of a sequence, or multiple sequences that can be successfully 54 WO 00/58517 PCT/USOO/08245 transformed and selected in a host cell. One example of such a vector is described in "Polycos vectors: a system for packaging filamentous phage and phagemid vectors using lambda phage packaging extracts" (Alting-Mecs and Short, 1993). Propagation/maintenance can be by an antibiotic resistance carried by the cloning 5 vector. After a period of growth, the naturally abbreviated molecules are recovered and identified by size fractionation on a gel or column, or amplified directly. The cloning vector utilized may contain a selectable gene that is disrupted by the insertion of the lengthy construct. As reductive reassortment progresses, the number of repeated units is reduced and the interrupted gene is again expressed and hence 10 selection for the processed construct can be applied. The vector may be an expression/selection vector which will allow for the selection of an expressed product possessing desirable biologically properties. The insert may be positioned downstream of a functional promotor and the desirable property screened by appropriate means. 15 In vivo reassortment is focused on "inter-molecular" processes collectively referred to as "recombination" which in bacteria, is generally viewed as a "RecA dependent" phenomenon. The present invention can rely on recombination processes of a host cell to recombine and re-assort sequences, or the cells' ability to 20 mediate reductive processes to decrease the complexity of quasi-repeated sequences in the cell by deletion. This process of "reductive reassortment" occurs by an "intra molecular", RecA-independent process. Therefore, in another aspect of the present invention, novel polynucleotides 25 can be generated by the process of reductive reassortment. The method involves the generation of constructs containing consecutive sequences (original encoding sequences), their insertion into an appropriate vector, and their subsequent introduction into an appropriate host cell. The reassortment of the individual molecular identities occurs by combinatorial processes between the consecutive 30 sequences in the construct possessing regions of homology, or between quasi repeated units. The reassortment process recombines and/or reduces the complexity and extent of the repeated sequences, and results in the production of novel 55 WO 00/58517 PCT/USOO/08245 molecular species. Various treatments may be applied to enhance the rate of reassortment. These could include treatment with ultra-violet light, or DNA damaging chemicals, and/or the use of host cell lines displaying enhanced levels of "genetic instability". Thus the reassortment process may involve homologous 5 recombination or the natural property of quasi-repeated sequences to direct their own evolution. Repeated or "quasi-repeated" sequences play a role in genetic instability. In the present invention, "quasi-repeats" are repeats that are not restricted to their 10 original unit structure. Quasi-repeated units can be presented as an array of sequences in a construct; consecutive units of similar sequences. Once ligated, the junctions between the consecutive sequences become essentially invisible and the quasi-repetitive nature of the resulting construct is now continuous at the molecular level. The deletion process the cell performs to reduce the complexity of the 15 resulting construct operates between the quasi-repeated sequences. The quasi repeated units provide a practically limitless repertoire of templates upon which slippage events can occur. The constructs containing the quasi-repeats thus effectively provide sufficient molecular elasticity that deletion (and potentially insertion) events can occur virtually anywhere within the quasi-repetitive units. 20 When the quasi-repeated sequences are all ligated in the same orientation, for instance head to tail or vice versa, the cell cannot distinguish individual units. Consequently, the reductive process can occur throughout the sequences. In contrast, when for example, the units are presented head to head, rather than head to 25 tail, the inversion delineates the endpoints of the adjacent unit so that deletion formation will favor the loss of discrete units. Thus, it is preferable with the present method that the sequences are in the same orientation. Random orientation of quasi repeated sequences will result in the loss of reassortment efficiency, while consistent orientation of the sequences will offer the highest efficiency. However, while having 30 fewer of the contiguous sequences in the same orientation decreases the efficiency, it may still provide sufficient elasticity for the effective recovery of novel molecules. 56 WO 00/58517 PCT/USOO/08245 Constructs can be made with the quasi-repeated sequences in the same orientation to allow higher efficiency. Sequences can be assembled in a head to tail orientation using any of a 5 variety of methods, including the following: a) Primers that include a poly-A head and poly-T tail which when made single-stranded would provide orientation can be utilized. This is accomplished by having the first few bases of the primers made from RNA and hence easily removed RNAseH. 10 b) Primers that include unique restriction cleavage sites can be utilized. Multiple sites, a battery of unique sequences, and repeated synthesis and ligation steps would be required. c) The inner few bases of the primer could be thiolated and an exonuclease used to produce properly tailed molecules. 15 The recovery of the re-assorted sequences relies on the identification of cloning vectors with a reduced RI. The re-assorted encoding sequences can then be recovered by amplification. The products are re-cloned and expressed. The recovery of cloning vectors with reduced RI can be effected by: 20 1) The use of vectors only stably maintained when the construct is reduced in complexity. 2) The physical recovery of shortened vectors by physical procedures. In this case, the cloning vector would be recovered using standard plasmid isolation procedures and size fractionated on either an agarose gel, or column with a 25 low molecular weight cut off utilizing standard procedures. 3) The recovery of vectors containing interrupted genes which can be selected when insert size decreases. 4) The use of direct selection techniques with an expression vector and the appropriate selection. 30 Encoding sequences (for example, genes) from related organisms may demonstrate a high degree of homology and encode quite diverse protein products. 57 WO 00/58517 PCT/US00/08245 These types of sequences are particularly useful in the present invention as quasi repeats. However, while the examples illustrated below demonstrate the reassortment of nearly identical original encoding sequences (quasi-repeats), this process is not limited to such nearly identical repeats. 5 The following example demonstrates the method of the invention. Encoding nucleic acid sequences (quasi-repeats) derived from three (3) unique species are depicted. Each sequence encodes a protein with a distinct set of properties. Each of the sequences differs by a single or a few base pairs at a unique position in the 10 sequence which are designated "A", "B" and "C". The quasi-repeated sequences are separately or collectively amplified and ligated into random assemblies such that all possible permutations and combinations are available in the population of ligated molecules. The number of quasi-repeat units can be controlled by the assembly conditions. The average number of quasi-repeated units in a construct is defined as 15 the repetitive index (RI). Once formed, the constructs may, or may not be size fractionated on an agarose gel according to published protocols, inserted into a cloning vector, and transfected into an appropriate host cell. The cells are then propagated and 20 "reductive reassortment" is effected. The rate of the reductive reassortment process may be stimulated by the introduction of DNA damage if desired. Whether the reduction in RI is mediated by deletion formation between repeated sequences by an "intra-molecular" mechanism, or mediated by recombination-like events through "inter-molecular" mechanisms is immaterial. The end result is a reassortment of the 25 molecules into all possible combinations. Optionally, the method comprises the additional step of screening the library members of the shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact (e.g., such as catalytic antibodies) with a 30 predetermined macromolecule, such as for example a proteinaceous receptor, peptide oligosaccharide, viron, or other predetermined compound or structure. 58 WO 00/58517 PCT/USOO/08245 The displayed polypeptides, antibodies, peptidomimetic antibodies, and variable region sequences that are identified from such libraries can be used for therapeutic, diagnostic, research and related purposes (e.g., catalysts, solutes for increasing osmolarity of an aqueous solution, and the like), and/or can be subjected 5 to one or more additional cycles of shuffling and/or affinity selection. The method can be modified such that the step of selecting for a phenotypic characteristic can be other than of binding affinity for a predetermined molecule (e.g., for catalytic activity, stability oxidation resistance, drug resistance, or detectable phenotype conferred upon a host cell). 10 The present invention provides a method for generating libraries of displayed antibodies suitable for affinity interactions screening. The method comprises (1) obtaining first a plurality of selected library members comprising a displayed antibody and an associated polynucleotide encoding said displayed antibody, and 15 obtaining said associated polynucleotide encoding for said displayed antibody and obtaining said associated polynucleotides or copies thereof, wherein said associated polynucleotides comprise a region of substantially identical variable region framework sequence, and (2) introducing said polynucleotides into a suitable host cell and growing the cells under conditions which promote recombination and 20 reductive reassortment resulting in shuffled polynucleotides. CDR combinations comprised by the shuffled pool are not present in the first plurality of selected library members, said shuffled pool composing a library of displayed antibodies comprising CDR permutations and suitable for affinity interaction screening. Optionally, the shuffled pool is subjected to affinity screening to select shuffled 25 library members which bind to a predetermined epitope (antigen) and thereby selecting a plurality of selected shuffled library members. Further, the plurality of selectively shuffled library members can be shuffled and screened iteratively, from I to about 1000 cycles or as desired until library members having a desired binding affinity are obtained. 30 In another aspect of the invention, it is envisioned that prior to or during recombination or reassortment, polynucleotides generated by the method of the 59 WO 00/58517 PCT/US0O/08245 present invention can be subjected to agents or processes which promote the introduction of mutations into the original polynucleotides. The introduction of such mutations would increase the diversity of resulting hybrid polynucleotides and polypeptides encoded therefrom. The agents or processes which promote 5 mutagenesis can include, but are not limited to: (+)-CC-1065, or a synthetic analog such as (+)-CC-1065-(N3-Adenine, see Sun and Hurley, 1992); an N-acelylated or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis (see, for example, van de Poll et al, 1992); or a N-acetylated or deacetylated 4 aminobiphenyl adduct capable of inhibiting DNA synthesis (see also, van de Poll et 10 al, 1992, pp. 751-758); trivalent chromium, a trivalent chromium salt, a polycyclic aromatic hydrocarbon ("PAH") DNA adduct capable of inhibiting DNA replication, such as 7 -bromomethyl-benz[a]anthracene ("BMA"), tris(2,3 dibromopropyl)phosphate ("Tris-BP"), 1,2-dibromo-3-chloropropane ("DBCP"), 2 bromoacrolein (2BA), benzo[a]pyrene-7,8-dihydrodiol-9-10-epoxide ("BPDE"), a 15 platinum(II) halogen salt, N-hydroxy-2-amino-3-methylimidazo[4,5-J]-quinoline ("N-hydroxy-IQ"), and N-hydroxy-2-amino- I -methyl-6-phenylimidazo[4,5-] pyridine ("N-hydroxy-PhIP"). Especially preferred "means for slowing or halting PCR amplification consist of UV light (+)-CC-1065 and (+)-CC-1065-(N3 Adenine). Particularly encompassed means are DNA adducts or polynucleotides 20 comprising the DNA adducts from the polynucleotides or polynucleotides pool, which can be released or removed by a process including heating the solution comprising the polynucleotides prior to further processing. In another aspect the present invention is directed to a method of producing 25 recombinant proteins having biological activity by treating a sample comprising double-stranded template polynucleotides encoding a wild-type protein under conditions according to the present invention which provide for the production of hybrid or re-assorted polynucleotides. 30 The invention also provides the use of polynucleotide shuffling to shuffle a population of viral genes (e.g., capsid proteins, spike glycoproteins, polymerases, and proteases) or viral genomes (e.g., paramyxoviridae, orthomyxoviridae, 60 WO 00/58517 PCT/USOO/08245 herpesviruses, retroviruses, reoviruses and rhinoviruses). In an embodiment, the invention provides a method for shuffling sequences encoding all or portions of immunogenic viral proteins to generate novel combinations of epitopes as well as novel epitopes created by recombination; such shuffled viral proteins may comprise 5 epitopes or combinations of epitopes as well as novel epitopes created by recombination; such shuffled viral proteins may comprise epitopes or combinations of epitopes which are likely to arise in the natural environment as a consequence of viral evolution; (e.g., such as recombination of influenza virus strains). 10 The invention also provides a method suitable for shuffling polynucleotide sequences for generating gene therapy vectors and replication-defective gene therapy constructs, such as may be used for human gene therapy, including but not limited to vaccination vectors for DNA-based vaccination, as well as anti-neoplastic gene therapy and other general therapy formats. 15 In the polypeptide notation used herein, the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention. Similarly, unless specified otherwise, the left-hand end of single-stranded polynucleotide sequences is the 5' 20 end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA 25 strand having the same sequence as the RNA and which are 3' to the 3' end of the coding RNA transcript are referred to as "downstream sequences". Methodology Nucleic acid shuffling is a method for in vitro or in vivo homologous 30 recombination of pools of shorter or smaller polynucleotides to produce a polynucleotide or polynucleotides. Mixtures of related nucleic acid sequences or polynucleotides are subjected to sexual PCR to provide random polynucleotides, and 61 WO 00/58517 PCT/US0O/08245 reassembled to yield a library or mixed population of recombinant hybrid nucleic acid molecules or polynucleotides. In contrast to cassette mutagenesis, only shuffling and error-prone PCR 5 allow one to mutate a pool of sequences blindly (without sequence information other than primers). The advantage of the mutagenic shuffling of this invention over error-prone PCR alone for repeated selection can best be explained with an example from 10 antibody engineering. Consider DNA shuffling as compared with error-prone PCR (not sexual PCR). The initial library of selected pooled sequences can consist of related sequences of diverse origin (i.e. antibodies from naive mRNA) or can be derived by any type of mutagenesis (including shuffling) of a single antibody gene. A collection of selected complementarity determining regions ("CDRs") is obtained 15 after the first round of affinity selection. In the diagram the thick CDRs confer onto the antibody molecule increased affinity for the antigen. Shuffling allows the free combinatorial association of all of the CDRls with all of the CDR2s with all of the CDR3s, for example. 20 This method differs from error-prone PCR, in that it is an inverse chain reaction. In error-prone PCR, the number of polymerase start sites and the number of molecules grows exponentially. However, the sequence of the polymerase start sites and the sequence of the molecules remains essentially the same. In contrast, in nucleic acid reassembly or shuffling of random polynucleotides the number of start 25 sites and the number (but not size) of the random polynucleotides decreases over time. For polynucleotides derived from whole plasmids the theoretical endpoint is a single, large concatemeric molecule. Since cross-overs occur at regions of homology, recombination will 30 primarily occur between members of the same sequence family. This discourages combinations of CDRs that are grossly incompatible (e.g., directed against different epitopes of the same antigen). It is contemplated that multiple families of sequences 62 WO 00/58517 PCT/USO0/08245 can be shuffled in the same reaction. Further, shuffling generally conserves the relative order, such that, for example, CDR1 will not be found in the position of CDR2. 5 Rare shufflants will contain a large number of the best (eg. highest affinity) CDRs and these rare shufflants may be selected based on their superior affinity. CDRs from a pool of 100 different selected antibody sequences can be permutated in up to 1006 different ways. This large number of permutations cannot 10 be represented in a single library of DNA sequences. Accordingly, it is contemplated that multiple cycles of DNA shuffling and selection may be required depending on the length of the sequence and the sequence diversity desired. Error-prone PCR, in contrast, keeps all the selected CDRs in the same 15 relative sequence, generating a much smaller mutant cloud. The template polynucleotide which may be used in the methods of this invention may be DNA or RNA. It may be of various lengths depending on the size of the gene or shorter or smaller polynucleotide to be recombined or reassembled. 20 Preferably, the template polynucleotide is from 50 bp to 50 kb. It is contemplated that entire vectors containing the nucleic acid encoding the protein of interest can be used in the methods of this invention, and in fact have been successfully used. The template polynucleotide may be obtained by amplification using the 25 PCR reaction (USPN 4,683,202 and USPN 4,683,195) or other amplification or cloning methods. However, the removal of free primers from the PCR products before subjecting them to pooling of the PCR products and sexual PCR may provide more efficient results. Failure to adequately remove the primers from the original pool before sexual PCR can lead to a low frequency of crossover clones. 30 The template polynucleotide often should be double-stranded. A double-stranded nucleic acid molecule is recommended to ensure that regions of the 63 WO 00/58517 PCT/USOO/08245 resulting single-stranded polynucleotides are complementary to each other and thus can hybridize to form a double-stranded molecule. It is contemplated that single-stranded or double-stranded nucleic acid 5 polynucleotides having regions of identity to the template polynucleotide and regions of heterology to the template polynucleotide may be added to the template polynucleotide, at this step. It is also contemplated that two different but related polynucleotide templates can be mixed at this step. 10 The double-stranded polynucleotide template and any added double-or single-stranded polynucleotides are subjected to sexual PCR which includes slowing or halting to provide a mixture of from about 5 bp to 5 kb or more. Preferably the size of the random polynucleotides is from about 10 bp to 1000 bp, more preferably the size of the polynucleotides is from about 20 bp to 500 bp. 15 Alternatively, it is also contemplated that double-stranded nucleic acid having multiple nicks may be used in the methods of this invention. A nick is a break in one strand of the double-stranded nucleic acid. The distance between such nicks is preferably 5 bp to 5 kb, more preferably between 10 bp to 1000 bp. This 20 can provide areas of self-priming to produce shorter or smaller polynucleotides to be included with the polynucleotides resulting from random primers, for example. The concentration of any one specific polynucleotide will not be greater than 1% by weight of the total polynucleotides, more preferably the concentration of any 25 one specific nucleic acid sequence will not be greater than 0.1% by weight of the total nucleic acid. The number of different specific polynucletides in the mixture will be at least about 100, preferably at least about 500, and more preferably at least about 1000. 30 At this step single-stranded or double-stranded polynucleotides, either synthetic or natural, may be added to the random double-stranded shorter or smaller 64 WO 00/58517 PCT/USO0/08245 polynucleotides in order to increase the heterogeneity of the mixture of polynucleotides. It is also contemplated that populations of double-stranded randomly broken 5 polynucleotides may be mixed or combined at this step with the polynucleotides from the sexual PCR process and optionally subjected to one or more additional sexual PCR cycles. Where insertion of mutations into the template polynucleotide is desired, 10 single-stranded or double-stranded polynucleotides having a region of identity to the template polynucleotide and a region of heterology to the template polynucleotide may be added in a 20 fold excess by weight as compared to the total nucleic acid, more preferably the single-stranded polynucleotides may be added in a 10 fold excess by weight as compared to the total nucleic acid. 15 Where a mixture of different but related template polynucleotides is desired, populations of polynucleotides from each of the templates may be combined at a ratio of less than about 1:100, more preferably the ratio is less than about 1:40. For example, a backcross of the wild-type polynucleotide with a population of mutated 20 polynucleotide may be desired to eliminate neutral mutations (e.g., mutations yielding an insubstantial alteration in the phenotypic property being selected for). In such an example, the ratio of randomly provided wild-type polynucleotides which may be added to the randomly provided sexual PCR cycle hybrid polynucleotides is approximately 1:1 to about 100:1, and more preferably from 1:1 to 40:1. 25 The mixed population of random polynucleotides are denatured to form single-stranded polynucleotides and then re-annealed. Only those single-stranded polynucleotides having regions of homology with other single-stranded polynucleotides will re-anneal. 30 The random polynucleotides may be denatured by heating. One skilled in the art could determine the conditions necessary to completely denature the double 65 WO 00/58517 PCT/USOO/08245 stranded nucleic acid. Preferably the temperature is from 80 *C to 100 *C, more preferably the temperature is from 90 *C to 96 'C. other methods which may be used to denature the polynucleotides include pressure (36) and pH. 5 The polynucleotides may be re-annealed by cooling. Preferably the temperature is from 20 *C to 75 *C, more preferably the temperature is from 40 *C to 65 *C. If a high frequency of crossovers is needed based on an average of only 4 consecutive bases of homology, recombination can be forced by using a low annealing temperature, although the process becomes more difficult. The degree of 10 renaturation which occurs will depend on the degree of homology between the population of single-stranded polynucleotides. Renaturation can be accelerated by the addition of polyethylene glycol ("PEG") or salt. The salt concentration is preferably from 0 mM to 200 mM, more 15 preferably the salt concentration is from 10 mM to 100 mm. The salt may be KC or NaCl. The concentration of PEG is preferably from 0% to 20%, more preferably from 5% to 10%. The annealed polynucleotides are next incubated in the presence of a nucleic 20 acid polymerase and dNTP's (i.e. dATP, dCTP, DGTP and dTTP). The nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art. The approach to be used for the assembly depends on the minimum degree of 25 homology that should still yield crossovers. If the areas of identity are large, Taq polymerase can be used with an annealing temperature of between 45-65 'C. If the areas of identity are small, Klenow polymerase can be used with an annealing temperature of between 20-30 *C. One skilled in the art could vary the temperature of annealing to increase the number of cross-overs achieved. 30 The polymerase may be added to the random polynucleotides prior to annealing, simultaneously with annealing or after annealing. 66 WO 00/58517 PCT/USOO/08245 The cycle of denaturation, renaturation and incubation in the presence of polymerase is referred to herein as shuffling or reassembly of the nucleic acid. This cycle is repeated for a desired number of times. Preferably the cycle is repeated 5 from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 times. The resulting nucleic acid is a larger double-stranded polynucleotide of from about 50 bp to about 100 kb, preferably the larger polynucleotide is from 500 bp to 50 kb. 10 This larger polynucleotides may contain a number of copies of a polynucleotide having the same size as the template polynucleotide in tandem. This concatemeric polynucleotide is then denatured into single copies of the template polynucleotide. The result will be a population of polynucleotides of approximately 15 the same size as the template polynucleotide. The population will be a mixed population where single or double-stranded polynucleotides having an area of identity and an area of heterology have been added to the template polynucleotide prior to shuffling. 20 These polynucleotides are then cloned into the appropriate vector and the ligation mixture used to transform bacteria. It is contemplated that the single polynucleotides may be obtained from the larger concatemeric polynucleotide by amplification of the single polynucleotide prior to cloning by a variety of methods including PCR (USPN 4,683,195 and 25 USPN 4,683,202), rather than by digestion of the concatemer. The vector used for cloning is not critical provided that it will accept a polynucleotide of the desired size. If expression of the particular polynucleotide is desired, the cloning vehicle should further comprise transcription and translation 30 signals next to the site of insertion of the polynucleotide to allow expression of the polynucleotide in the host cell. Preferred vectors include the pUC series and the pBR series of plasmids. 67 WO 00/58517 PCT/USOO/08245 The resulting bacterial population will include a number of recombinant polynucleotides having random mutations. This mixed population may be tested to identify the desired recombinant polynucleotides. The method of selection will 5 depend on the polynucleotide desired. For example, if a polynucleotide which encodes a protein with increased binding efficiency to a ligand is desired, the proteins expressed by each of the portions of the polynucleotides in the population or library may be tested for their 10 ability to bind to the ligand by methods known in the art (i.e. panning, affinity chromatography). If a polynucleotide which encodes for a protein with increased drug resistance is desired, the proteins expressed by each of the polynucleotides in the population or library may be tested for their ability to confer drug resistance to the host organism. One skilled in the art, given knowledge of the desired protein, 15 could readily test the population to identify polynucleotides which confer the desired properties onto the protein. It is contemplated that one skilled in the art could use a phage display system in which fragments of the protein are expressed as fusion proteins on the phage 20 surface (Pharmacia, Milwaukee WI). The recombinant DNA molecules are cloned into the phage DNA at a site which results in the transcription of a fusion protein a portion of which is encoded by the recombinant DNA molecule. The phage containing the recombinant nucleic acid molecule undergoes replication and transcription in the cell. The leader sequence of the fusion protein directs the 25 transport of the fusion protein to the tip of the phage particle. Thus the fusion protein which is partially encoded by the recombinant DNA molecule is displayed on the phage particle for detection and selection by the methods described above. It is further contemplated that a number of cycles of nucleic acid shuffling 30 may be conducted with polynucleotides from a sub-population of the first population, which sub-population contains DNA encoding the desired recombinant 68 WO 00/58517 PCT/USOO/08245 protein. In this manner, proteins with even higher binding affinities or enzymatic activity could be achieved. It is also contemplated that a number of cycles of nucleic acid shuffling may 5 be conducted with a mixture of wild-type polynucleotides and a sub-population of nucleic acid from the first or subsequent rounds of nucleic acid shuffling in order to remove any silent mutations from the sub-population. Any source of nucleic acid, in purified form can be utilized as the starting 10 nucleic acid. Thus the process may employ DNA or RNA including messenger RNA, which DNA or RNA may be single or double stranded. In addition, a DNA-RNA hybrid which contains one strand of each may be utilized. The nucleic acid sequence may be of various lengths depending on the size of the nucleic acid sequence to be mutated. Preferably the specific nucleic acid sequence is from 50 to 15 50000 base pairs. It is contemplated that entire vectors containing the nucleic acid encoding the protein of interest may be used in the methods of this invention. The nucleic acid may be obtained from any source, for example, from plasmids such a pBR322, from cloned DNA or RNA or from natural DNA or RNA 20 from any source including bacteria, yeast, viruses and higher organisms such as plants or animals. DNA or RNA may be extracted from blood or tissue material. The template polynucleotide may be obtained by amplification using the polynucleotide chain reaction (PCR, see USPN 4,683,202 and USPN 4,683,195). Alternatively, the polynucleotide may be present in a vector present in a cell and 25 sufficient nucleic acid may be obtained by culturing the cell and extracting the nucleic acid from the cell by methods known in the art. Any specific nucleic acid sequence can be used to produce the population of hybrids by the present process. It is only necessary that a small population of hybrid 30 sequences of the specific nucleic acid sequence exist or be created prior to the present process. 69 WO 00/58517 PCT/USOO/08245 The initial small population of the specific nucleic acid sequences having mutations may be created by a number of different methods. Mutations may be created by error-prone PCR. Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long 5 sequence. Alternatively, mutations can be introduced into the template polynucleotide by oligonucleotide-directed mutagenesis. In oligonucleotide-directed mutagenesis, a short sequence of the polynucleotide is removed from the polynucleotide using restriction enzyme digestion and is replaced with a synthetic polynucleotide in which various bases have been altered from the original sequence. 10 The polynucleotide sequence can also be altered by chemical mutagenesis. Chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid. other agents which are analogues of nucleotide precursors include nitrosoguanidine, 5-bromouracil, 2-aminopurine, or acridine. Generally, these agents are added to the PCR reaction in place of the nucleotide precursor 15 thereby mutating the sequence. Intercalating agents such as proflavine, acriflavine, quinacrine and the like can also be used. Random mutagenesis of the polynucleotide sequence can also be achieved by irradiation with X-rays or ultraviolet light. Generally, plasmid polynucleotides so mutagenized are introduced into E. coli and propagated as a pool or library of hybrid plasmids. 20 Alternatively the small mixed population of specific nucleic acids may be found in nature in that they may consist of different alleles of the same gene or the same gene from different related species (i.e., cognate genes). Alternatively, they may be related DNA sequences found within one species, for example, the 25 immunoglobulin genes. Once the mixed population of the specific nucleic acid sequences is generated, the polynucleotides can be used directly or inserted into an appropriate cloning vector, using techniques well-known in,the art. 30 The choice of vector depends on the size of the polynucleotide sequence and the host cell to be employed in the methods of this invention. The templates of this 70 WO 00/58517 PCT/USOO/08245 invention may be plasmids, phages, cosmids, phagemids, viruses (e.g., retroviruses, parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like), or selected portions thereof (e.g., coat protein, spike glycoprotein, capsid protein). For example, cosmids and phagemids are preferred where the specific nucleic acid 5 sequence to be mutated is larger because these vectors are able to stably propagate large polynucleotides. If the mixed population of the specific nucleic acid sequence is cloned into a vector it can be clonally amplified by inserting each vector into a host cell and 10 allowing the host cell to amplify the vector. This is referred to as clonal amplification because while the absolute number of nucleic acid sequences increases, the number of hybrids does not increase. Utility can be readily determined by screening expressed polypeptides. 15 The DNA shuffling method of this invention can be performed blindly on a pool of unknown sequences. By adding to the reassembly mixture oligonucleotides (with ends that are homologous to the sequences being reassembled) any sequence mixture can be incorporated at any specific position into another sequence mixture. Thus, it is contemplated that mixtures of synthetic oligonucleotides, PCR 20 polynucleotides or even whole genes can be mixed into another sequence library at defined positions. The insertion of one sequence (mixture) is independent from the insertion of a sequence in another part of the template. Thus, the degree of recombination, the homology required, and the diversity of the library can be independently and simultaneously varied along the length of the reassembled DNA. 25 This approach of mixing two genes may be useful for the humanization of antibodies from murine hybridomas. The approach of mixing two genes or inserting alternative sequences into genes may be useful for any therapeutically used protein, for example, interleukin I, antibodies, tPA and growth hormone. The approach may 30 also be useful in any nucleic acid for example, promoters or introns or 31 untranslated region or 51 untranslated regions of genes to increase expression or 71 WO 00/58517 PCT/USOO/08245 alter specificity of expression of proteins. The approach may also be used to mutate ribozymes or aptamers. Shuffling requires the presence of homologous regions separating regions of 5 diversity. Scaffold-like protein structures may be particularly suitable for shuffling. The conserved scaffold determines the overall folding by self-association, while displaying relatively unrestricted loops that mediate the specific binding. Examples of such scaffolds are the immunoglobulin beta-barrel, and the four-helix bundle which are well-known in the art. This shuffling can be used to create scaffold-like 10 proteins with various combinations of mutated sequences for binding. 72 WO 00/58517 PCT/USOO/08245 Saturation mutagenesis In one aspect, this invention provides for the use of proprietary codon primers (containing a degenerate N,N,G/T sequence) to introduce point mutations 5 into a polynucleotide, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position. The oligos used are comprised contiguously of a first homologous sequence, a degenerate N,N,G/T sequence, and preferably but not necessarily a second homologous sequence. The downstream progeny translational products from the use 10 of such oligos include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy of the N,N,G/T sequence includes codons for all 20 amino acids. In one aspect, one such degenerate oligo (comprised of one degenerate 15 N,N,G/T cassette) is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions. In another aspect, at least two degenerate N,N,G/T cassettes are used - either in the same oligo or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions. Thus, more than one N,N,G/T sequence can be 20 contained in one oligo to introduce amino acid mutations at more than one site. This plurality of N,N,G/T sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s). In another aspect, oligos serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,G/T sequence, to introduce any combination or 25 permutation of amino acid additions, deletions, and/or substitutions. In a particular exemplification, it is possible to simultaneously mutagenize two or more contiguous amino acid positions using an oligo that contains contiguous N,N,G/T triplets, i.e. a degenerate (N,N,G/T), sequence. 30 In another aspect, the present invention provides for the use of degenerate cassettes having less degeneracy than the NN,G/T sequence. For example, it may 73 WO 00/58517 PCT/USOO/08245 be desirable in some instances to use (e.g. in an oligo) a degenerate triplet sequence comprised of only one N, where said N can be in the first second or third position of the triplet. Any other bases including any combinations and permutations thereof can be used in the remaining two positions of the triplet. Alternatively, it may be 5 desirable in some instances to use (e.g. in an oligo) a degenerate N,N,N triplet sequence, or an N,N, G/C triplet sequence. It is appreciated, however, that the use of a degenerate triplet (such as N,N,G/T or an N,N, G/C triplet sequence) as disclosed in the instant invention is 10 advantageous for several reasons. In one aspect, this invention provides a means to systematically and fairly easily generate the substitution of the full range of possible amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide. Thus, for a 100 amino acid polypeptide, the instant invention provides a way to systematically and fairly easily generate 2000 distinct species (i.e. 15 20 possible amino acids per position X 100 amino acid positions). It is appreciated that there is provided, through the use of an oligo containing a degenerate N,N,G/T or an N,N,G/C triplet sequence, 32 individual sequences that code for 20 possible amino acids. Thus, in a reaction vessel in which a parental polynucleotide sequence is subjected to saturation mutagenesis using one such oligo, there are generated 32 20 distinct progeny polynucleotides encoding 20 distinct polypeptides. In contrast, the use of a non-degenerate oligo in site-directed mutagenesis leads to only one progeny polypeptide product per reaction vessel. This invention also provides for the use of nondegenerate oligos, which can 25 optionally be used in combination with degenerate primers disclosed. It is appreciated that in some situations, it is advantageous to use nondegenerate oligos to generate specific point mutations in a working polynucleotide. This provides a means to generate specific silent point mutations, point mutations leading to corresponding amino acid changes, and point mutations that cause the generation of 30 stop codons and the corresponding expression of polypeptide fragments. 74 WO 00/58517 PCT/USOO/08245 Thus, in a preferred embodiment of this invention, each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide molecules such that all 20 amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the 5 parental polynucleotide. The 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g. cloned into a suitable E. coli host using an expression vector) and subjected to expression screening. When an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to 10 the parental polypeptide), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein. It is appreciated that upon mutagenizing each and every amino acid position in a parental polypeptide using saturation mutagenesis as disclosed herein, favorable 15 amino acid changes may be identified at more than one amino acid position. One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions. For example, if 2 specific favorable amino acid changes are identified in each of 3 amino acid positions in a polypeptide, the permutations include 3 possibilities at each position (no change from the original 20 amino acid, and each of two favorable changes) and 3 positions. Thus, there are 3 x 3 x 3 or 27 total possibilities, including 7 that were previously examined - 6 single point mutations (i.e. 2 at each of three positions) and no change at any position. In yet another aspect, site-saturation mutagenesis can be used together with 25 shuffling, chimerization, recombination and other mutagenizing processes, along with screening. This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner. In one exemplification, the iterative use of any mutagenizing process(es) is used in combination with screening. 30 Thus, in a non-limiting exemplification, this invention provides for the use of saturation mutagenesis in combination with additional mutagenization processes, 75 WO 00/58517 PCTUSOO/08245 such as process where two or more related polynucleotides are introduced into a suitable host cell such that a hybrid polynucleotide is generated by recombination and reductive reassortment. 5 In addition to performing mutagenesis along the entire sequence of a gene, the instant invention provides that mutagenesis can be use to replace each of any number of bases in a polynucleotide sequence, wherein the number of bases to be mutagenized is preferably every integer from 15 to 100,000. Thus, instead of mutagenizing every position along a molecule, one can subject every a discrete 10 number of bases (preferably a subset totaling from 15 to 100,000) to mutagenesis. Preferably, a separate nucleotide is used for mutagenizing each position or group of positions along a polynucleotide sequence. A group of 3 positions to be mutagenized may be a codon. The mutations are preferably introduced using a mutagenic primer, containing a heterologous cassette, also referred to as a mutagenic 15 cassette. Preferred cassettes can have from 1 to 500 bases. Each nucleotide position in such heterologous cassettes be N, A, C, G, T, A/C, A/G, A/T, C/G, C/T, G/T, C/G/T, A/G/T, A/C/T, A/C/G, or E, where E is any base that is not A, C, G, or T (E can be referred to as a designer oligo). The tables below show exemplary tri nucleotide cassettes (there are over 3000 possibilities in addition to N,N,G/T and 20 N,N,N and N,N,A/C). In a general sense, saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette is preferably 1-500 bases in length) in defined polynucleotide sequence to be mutagenized (wherein the 25 sequence to be mutagenized is preferably from 15 to 100,000 bases in length). Thusly, a group of mutations (ranging from 1 to 100 mutations) is introduced into each cassette to be mutagenized. A grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation 30 mutagenesis. Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes. 76 WO 00/58517 PCT/USOO/08245 Defined sequences to be mutagenized (see Fig. 20) include preferably a whole gene, pathway, cDNA, an entire open reading frame (ORF), and entire promoter, enhancer, repressor/transactivator, origin of replication, intron, operator, or any polynucleotide functional group. Generally, a preferred "defined sequences" 5 for this purpose may be any polynucleotide that a 15 base-polynucleotide sequence, and polynucleotide sequences of lengths between 15 bases and 15,000 bases (this invention specifically names every integer in between). Considerations in choosing groupings of codons include types of amino acids encoded by a degenerate mutagenic cassette. 10 In a particularly preferred exemplification a grouping of mutations that can be introduced into a mutagenic cassette (see Tables 1-85), this invention specifically provides for degenerate codon substitutions (using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each 15 position, and a library of polypeptides encoded thereby. 77 WO 00/58517 PCT/USOO/08245 TABLE Site I Site 2 Site 3 # of a.a.'s NPL: POL: NEG POS: STP 2. N,N,G/T N N GIG 20 15: 9: 2: 5: 1 2. N,N,G/C N N G/C | 20 15: 9: 2: 5: 1 3. N,N,G/A N N G/A 14 15: 6: 2: 6: 3 4. NN,A/C N N A/C 18 14: 9: 2: 5: 2 5. N,N,A/T N N AfT 18 14: 9: 2: 5: 2 6. N,N,C/T N N C/T 15 14: 12: 2: 4: 0 7. N,N,N N N N 20 29: 18: 4: 10: 3 8. N,N,G N N G 13 8: 3: 1: 3: 1 9. N,N,A N N A 12 7: 3: 1: 3: 2 10. N,N,C N N C 15 7: 6: 1: 2: 0 11. N,N,T N N T 15 7: 6: 1: 2: 0 12. NN.C/G/T N N C/G/T 20 22: 15: 3: 7: I 13. N,N,A/GIT N N A/G/T 20 22: 12: 3: 8: 3 14. N,N,A/C/T N N A/C/T 18 21: 15: 3: 7 2 15. N,N,A/C/G N N A/C/G 20 22: 12: 3: 8 3 16. N,AA N A A 3 0: 1: 1: 1 1 17. N,A,C N A C 4 0: 2: 1: 1: 0 18. N,A,G N A G 3 0: 1: 1: 1: 1 19. N,A.T N A T 4 0: 2: 1: 1: 0 20. N,C.A N C A 4 2: 2: 0: 0: 0 21. N,C,C N C C 4 2: 2: 0: 0: 0 22. N,C,G N C G 4 2: 2: 0: 0: 0 23. N,C,T N C T 4 2: 2: 0: 0: 0 24. N,GA N G A 2 1: 0: 0: 2: 1 25. N,G,C N G C 4 1: 2: 0: 1: 0 26. N,G,G N G G 3 2: 0: 0: 2: 0 27. N,GT N G T 4 1: 2: 0: 1: 0 28. NT,A N T A 3 4: 0: 0: 0: 0 29. N,T,C N T C 4 4: 0: 0: 0: 0 30. N,T,G N T G 3 4: 0: 0: 0: 0 31. N,T,T N T T 4 4: 0: 0: 0: 0 32. N,A/C,A N A/C A 7 2: 3: 1: 1: 1 33. N.A/GA N A/G A 5 1: 1 : : 3: 2 34. N,A/T,A N A/T A 6 4: 1: 1: 1: 1 35. N,C/G,A N C/G A 6 3: 2: 0: 2: 1 36. N,C/TA N CiT A 7 6: 2: 0: 0: 0 37. N,T/G,A N T/G A 5 5: 0: 0: 2: 1 38. N,CIGrT,A N C/G/T A 9 7: 2: 0: 2: 1 39. N,A/G/T,A N A/G/T A 8 5: 1: 1: 3: 3 40. N,A/C/T.A N A/C/T A 10 6: 3: 1: : 1 41. N,A/C/G,A N A/C/G A 9 3: 3: 1: 3: 2 42. A,N,N A N N 7 4: 8: 0: 4: 0 43. C,NN C N N 5 8: 2: 0: 6: 0 44. G,N,N G N N 5 12: 0: 4: 0: 0 45. T,N.N T N N 6 5: 8: 0: 0: 3 46. A/C.N,N A/C N N 11 12: 10: 0: 10: 0 47. A/G,N,N A/G N N 12 16: 8: 4: 4: 0 48. A/T,N.N A/T N N 12 9: 16: 0: 4: 3 49. C/G,N,N C/G N N 10 20: 2: 4: 6: 0 50. C/TN,N C/T N N 10 13: 10: 0: 6: 3 51. G/T,N.N G/T N N 11 17: 8: 4: 0: 3 52. N,A,N N A N 7 0: 6: 4: 4: 2 53. N,C.N N C N 4 8: 8: 0: 0: 0 54. NG.N N G N 5 5: 4: 0: 6: 1 55. N,T.N N T N 5 16: 0: 0: 0: 0 56. N,A/C.N N A/C N 11 8: 14: 4: 4: 2 57. N,A/G,N N A/G N 12 5: 10: 4: 10: 3 58. N,A/T,N N A/T N 12 16: 6: 4: 4: 2 59. NC/G,N N C/G N 8 13: 12: 0: 6: I 60. N,C/T,N N C/T N 9 24: 8: 0: 0: 0 61. N,G/fN N G/T N 10 21: 4: 0: 6: 1 62. N,A/C/G,N N A/C/G N 15 13: 18: 4: 10: 3 63. N,A/C/TN N A/C/T N 16 24: 14: 4: 4: 2 64. N.A/G/T.N N A/G/T N 17 21: 10: 4: 10: 3 65. N,C/G/T,N N C/GrT N 13 29: 02: 0: 6: 0 66. C,C,N C C N 1 4: 0: 0: 0: 0 67. G.G.N G G N 1 4: 0: 0: 0: 0 68. G,C,N G C N 1 4: 0: 0: 0: 0 69. G,TN G T N 4: 0: 0: 0: 0 70. C,G.N C G N 1 0: 0: 0: 4: 0 71. C.T,N C T N 4: 0: 0: 0: 0 72. TCN T C N I 0: 4: 0: 0: 0 73. A.C,N A C N 0: 4: 0: 0: 0 78 WO 00/58517 PCT/USOO/08245 TABLE Site I Site 2 Site 3 # of a.a.'s NPL: POL: NEG: POS: ST 74. G,A,N G A N 2 0: 0: 4: 0: 0 75. A,T,N A T N 2 4: 0: 0: 0: 0 76. C.A,N C A N 2 0: 2: 0: 2: 0 77. T.T,N T T N 2 4: 0: 0: 0: 0 78. A,A,N A A N 2 0: 2: 0: 2: 0 79. T,A.N T A N 0: 2: 0: 0: 2 80. T,G,N T G N 2 l: 2: 0: 0: 1 81. A,G,N A G N 2 0: 2: 0: 2: 0 82. G/C,G,N G/C G N 2 4: 0: 0: 4: 0 83. G/C,CN G/C C N 2 8: 0: 0: 0: 0 84. G/C,A,N G/C A N 4 0: 2: 4: 2: 0 85. G/C,T.N G/C T N 2 8: 0: 0: 0: 0 79 WO 00/58517 PCT/USOO/08245 TABLE 1. Mutagenic Cassette: N, N, G/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 2 NONPOLAR 15 GGC NO (NPL) GGA NO GGG YES GCT YES ALANINE 2 GCC NO GCA NO GCG YES GTf YES VALINE 2 GTC NO GTA NO GTG YES TfA NO LEUCINE 3 TTG YES CTT YES CTC NO CTA NO CTG YES ATT YES ISOLEUCINE I ATC NO ATA NO ATG YES METHIONINE I TTT YES PHENYLALANINE I TTC NO TGG YES TRYPTOPHAN I CCT YES PROLINE 2 CCC NO CCA NO CCG YES TCT YES SERINE 3 POLAR 9 TCC NO NONIONIZAB TCA NO LE TCG YES (POL) AGT YES AGC NO TGT YES CYSTEINE I TGC NO AAT YES ASPARAGINE I AAC NO CAA NO GLUTAMINE I CAG YES TAT YES TYROSINE TAC NO ACT YES THREONINE 2 ACC NO ACA NO ACG YES GAT YES ASPARTIC ACID I IONIZABLE: 2 GAC NO ACIDIC GAA NO GLLTAMIC ACID NEGATIVE GAG YES CHARGE (NEG) AAA NO LYSINE I IONIZABLE: 5 AAG YES BASIC CGT YES ARGININE 3 POSITIVE CGC NO CHARGE CGA NO (POS) CGG YES AGA NO AGG YES CAT YES HISTIDINE I CAC NO TAA NO jSTOPCODON I STOP SIGNAL I TAG YES (STP) TGA NO TOTAL 64 32 20 Amino Acids Are NPL: POL: NEG: POS: Represented STP= I __ 15: 9: 2: 5: 80 WO 00/58517 PCT/USO0/08245 TABLE 2. Mutagenic Cassette: N, N, G/C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE 2 NONPOLAR 15 GGC YES (NPL) GGA NO GGG YES GCT NO ALANINE 2 GCC YES GCA NO GCG YES GTT NO VALINE 2 GTC YES GTA NO GTG YES TTA NO LEUCINE 3 TTG YES CTT NO CTC YES CTA NO CTG YES ATT NO ISOLEUCINE I ATC YES ATA NO ATG YES METHIONINE TT NO PHENYLALANINE I TTC YES TGG YES TRYPTOPHAN CCT NO PROLINE 2 CCC YES CCA NO CCG YES TCT NO SERINE 3 POLAR 9 TCC YES NONIONIZABLE TCA NO (POL) TCG YES AGT NO AGC YES TGT NO CYSTEINE TGC YES AAT NO ASPARAGINE AAC YES CAA NO GLUTAMINE CAG YES TAT NO TYROSINE TAC YES ACT NO THREONINE 2 ACC YES ACA NO ACG YES GAT NO ASPARTIC ACID I IONIZABLE: ACIDIC 2 GAC YES NEGATIVE CHARGE GAA NO GLUTAMIC ACID I (NEG) GAG YES AAA NO LYSINE I IONIZABLE: BASIC 5 AAG YES POSITIVE CHARGE CGT NO ARGININE 3 (POS) CGC YES CGA NO CGG YES AGA NO AGG YES CAT NO HISTIDINE CAC YES FAA NO STOP CODON I STOP SIGNAL I TAG YES (STP) TGA NO TOTAL TOTAL 20 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 32 15: 9: 2: 5: 1 81 WO 00/58517 PCT/USOO/08245 TABLE 3. Mutagenic Cassette: N, N, G/A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE 2 NONPOLAR 15 GtC NO (NPL) GGA YES 000 YES OCT NO ALANINE 2 GCC NO GCA YES GCO YES _____________ 0117 NO VALINE2 GTC NO GTA YES GTG YES UTA YES LEUCINE 4 TTG YES CN NO CTC NO CTA YES CTG YES AOZ NO ISOLEUCINE 2 ATC NO ATA YES ATG YES METHIONINE UTT NO PHENYLALANINE 0 OZC NOABLE:_BASIC 6 TOO YES TRYPTOPHAN CCT NO PROLINE 2 CCC NO CCA YES CCG YES TCT NO SERINE 2 POLAR 6 TCC NO NONIONIZABLE TCA YES (POL) TCG YES AOT NO AGC NO ______________ TOT NO CYSTEINE 0 TOC NO ____________ AAT NO ASPARAGINE 0 AAC NO CAA YES GLUTAMINE 2 CAO YES TAT NO TYROSINE 0 TAC NO ACT NO THREONINE 2 ACC NO ACA YES ACO YES -8 2 OAT NO ASPARTIC ACID 0 IONIZABLE: ACIDIC 2 GAC NO 1_________ __ NEGATIVE CHARGE OAA YES GLUTAMIC ACID 2 (NEG) GAG YES 1___________________________ AAA YxES LYSINE 2 IONIZABLE: BASIC 6 AAO YES 1 _____________ POSITIVE CHARGE COT NO ARGININE 4 (POS) COC NO I COA YES COO YES AGA YES AGO YES CAT NO HISTIDINE 0 CAC NO FAA ___ES__ SIO OO 3 SiTOP SIGNAL 3 TAO YES (STP) TOA YES T OTAL TOTAL 14 Amino Acids Are Represented NPL: POL: NEG: POS: STP 64 32 15: 6: 2: 6 : 3 8 2 WO 00/58517 PCT/USOO/08245 TABLE 4. Mutagenic Cassette: N, N, A/C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO NONPOLAR 14 GOC YES (NPL) GGA [ YES GG f NO OCT NO ALANINE 2 GCC YES GCA YES GCO NO GrNO VALINE 2 GTC TAYES TSA YES LEUCINE 3 TTO NO NO CTG YES CTA YES GTG NO ATNO ISOLEUCINE 2 ATC YES ATA YES NO METHIONINE 0 NO PHENYLALANINE TG NO TRYPTOPHAN 0 CCT NO PROLINE 2 CCC YES CCA YES CG NO I TCT NO SERINE 3 POLAR 9 TCC YES NONIONIZABLE TCA YES (POL) TCG NO AGT NO AGC YES TGT NO CYSTEINEI TGC YES AAT NO ASPARAGINEI AAC YES CAA YES GLUTAMINEI CAG NO TAT NO TYROSINE TAG YES AGT NO fTH-REONINE 2 ACC YES ACA YES ACG NO _____________ iAT KfNO ASPARTIG ACID I IONIZABLE: AGIDIG 2 GAG r YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID I(NEG) GAG NO I _____________ _____________ AAA YES LYSINE I IONIZABLE: BASIC 5 AAO NO POSITIVE CHARGE GT NO ARGININE 3 (POS) CG YES CGA YES COG No AGA YES AGO NO CAT NO H-ISTIDINE rAA YE TPCDN2 STOP01 SIGNAL 2 TAG NO J(STP) TGA YES _____________ _____________ TOTAL TOTAL 18 Amino Acids Are Represented NPL: POL: NEG: POS: SUP 64 32 I14: 9: 2: 5: 2 83 WO 00/58517 PCTIUSOO/08245 TABLE 5. Mutagenic Cassette: N, N, A/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 2 NONPOLAR 14 GGC NO (NPL) GGA YES GGG NO GCT YES ALANINE 2 GCC NO GCA YES GCG NO GT YES VALINE 2 GTC NO GTA YES GTG NO TTA YES LEUCINE 3 TG NO CT YES CTC NO CTA YES CTG NO ATT YES ISOLEUCINE 2 ATC NO ATA YES ATG NO METHIONINE 0 TFT YES PHENYLALANINE I TTC NO TGG NO TRYPTOPHAN 0 CCT YES PROLINE 2 CCC NO CCA YES CCG NO TCT YES SERINE 3 POLAR 9 TCC NO NONIONIZABLE TCA YES (POL) TCG NO AGT YES AGC NO TGT YES CYSTEINE TGC NO AAT YES ASPARAGINE AAC NO CAA YES GLUTAMINE CAG NO TAT YES TYROSINE TAC NO ACT YES THREONINE 2 ACC NO ACA YES ACG NO GAT YES ASPARTIC ACID I IONIZABLE: ACIDIC 2 GAC NO NEGATIVE CHARGE GAA YES GLUTAMIC ACID I (NEG) GAG NO AAA YES LYSINE I IONIZABLE: BASIC 5 AAG NO POSITIVE CHARGE CGT YES ARGININE 3 (POS) CGC NO CGA YES CGG NO AGA YES AGG NO CAT YES HISTIDINE CAC NO TAA YES STOPCODON 2 SlOP SIGNAL 2 TAG NO (STP) TGA YES TOTAL TOTAL 18 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 64 32 14: 9: 2: 5: 2 84 WO 00/58517 PCT/USOO/08245 TABLE 6. Mutagenic Cassette: N, N, C/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 2 NONPOLAR 14 GGC YES (NPL) GGA NO GGG NO GCT YES ALANINE 2 GCC YES GCA NO GCG NO GTT YES VALINE 2 GTC YES GTA NO GTG NO TTA NO LEUCINE 2 TTG NO CTT YES CTC YES CTA NO CTG NO ATT YES ISOLEUCINE 2 ATC YES ATA NO ATG NO METHIONINE 0 TTT YES PHENYLALANINE 2 TTC YES , TGG NO | TRYPTOPHAN 0 CCT YES PROLINE 2 CCC YES CCA NO CCG NO TCT YES SERINE 4 POLAR 12 TCC YES NONIONIZABLE TCA NO (POL) TCG NO AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES AAT YES ASPARAGINE 2 AAC YES CAA NO GLUTAMINE 0 CAG NO 1 TAT YES TYROSINE 2 TAC YES 1 ACT YES T-HREONINE 2 ACC YES ACA NO ACG NO GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 2 GAC YES NEGATIVE CHARGE GAA NO GLUTAMIC ACID 0 (NEG) GAG NO AAA NO LYSINE 0 IONIZABLE: BASIC 4 AAG NO POSITIVE CHARGE CGT YES ARGININE 2 (POS) CGC YES CGA NO CGG NO AGA NO AGG NO CAT YES HISTIDINE 2 CAC YES TAA NO STOP CODON 0 STOP SIGNAL 0 TAG NO (STP) TGA NO TOTAL TOTAL 15 Amino Acids Are Represented NPL: POL: NEG: POS: STP 64 32 14: 12: 2: 4: 0 85 WO 00/58517 PCT/USOO/08245 TABLE 7. Mutagenic Cassette: N, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 29 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CIT YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE TFT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 6 POLAR 18 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE TAC YES ACT YES THREONINE 4 ACC YES ACA YES ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES 1 AAA YES LYSINE 2 IONIZABLE: BASIC 10 AAG YES 1 POSITIVE CHARGE CGT YES ARGININE 6 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE CAC YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL TOTAL 20 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 64 29: 18: 4: 10: 3 86 WO 00/58517 PCT/USOO/08245 TABLE 8. Mutagenic Cassette: N, N, G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE I NONPOLAR 8 GGC NO (NPL) GGA NO GGG YES GCT NO ALANINE GCC NO GCA NO GCG YES GTT NO VALINE GTC NO GTA NO GTG YES TTA NO LEUCINE 2 TTG YES CTT NO CTC NO CTA NO CTG YES ATT NO ISOLEUCINE 0 ATC NO ATA NO ATG YES METHIONINE TT NO PHENYLALANINE 0 TC NO TGG YES | TRYPTOPHAN CCT NO | PROLINE CCC NO CCA NO CCG YES TCT NO SHRINE POLAR 3 TCC NO NONIONIZABLE TCA NO (POL) TCG YES AGT NO AGC NO TGT NO CYSTEINE 0 TGC NO AAT NO ASPARAGINE 0 AAC NO CAA NO GLUTAMINE CAG YES TAT NO TYROSINE 0 TAC NO I ACT NO THREONINE ACC NO ACA NO ACG YES GAT NO ASPARTIC ACID 0 IONIZABLE: ACIDIC GAC NO NEGATIVE CHARGE GAA NO GLUTAMIC ACID I (NEG) GAG YES AAA NO LYSINE I IONIZABLE: BASIC 3 AAG YES POSITIVE CHARGE CGT NO ARGININE 2 (POS) CGC NO CGA NO CGG YES AGA NO AGG YES CAT NO HISTIDINE 0 CAC NO TAA NO STOP CODON I STOP SIGNAL I TAG YES (STP) TGA NO TOTAL TOTAL 13 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 16 8: 3: 1: 3: 1 87 WO 00/58517 PCT/USO0/08245 TABLE 9. Mutagenic Cassette: N, N, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE I NONPOLAR 7 GGC NO (NPL) GGA YES GGG NO GCT NO ALANINE GCC NO GCA YES GCG NO GTT NO VALINE GTC NO GTA YES GTG NO TrA YES LEUCINE 2 TTG NO CTr NO CTC NO CTA YES CTG NO ATT NO ISOLEUCINE ATC NO ATA YES ATG | NO METHIONINE 0 TTT NO PHENYLALANINE 0 TTC NO TGG NO TRYPTOPHAN 0 CCT NO PROLINE CCC NO CCA YES CCG NO TCT NO SERINE I POLAR 3 TCC NO NONIONIZABLE TCA YES (POL) TCG NO AGT NO AGC NO TOT NO CYSTEINE 0 TGC NO AAT NO ASPARAGINE 0 AAC NO CAA YES GLUTAMINE I CAG NO TAT NO TYROSINE 0 TAC NO ACT NO THREONINE I ACC NO ACA YES ACG NO GAT NO ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAC NO NEGATIVE CHARGE GAA YES GLUTAMIC ACID I (NEG) GAG NO AAA YES LYSINE I IONIZABLE: BASIC 3 AAG NO POSITIVE CHARGE CGT NO ARGININE 2 (POS) CGC NO CGA YES CGG NO AGA YES AGG NO CAT NO HISTIDINE 0 CAC NO TAA YES STOP CODON 2 STOP SIGNAL 2 TAG NO (STP) TGA YES I TOTAL TOTAL 12 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 16 7: 3: 1: 3: 2 88 WO 00/58517 PCT/USOO/08245 TABLE 10. Mutagenic Cassette: N, N, C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE NONPOLAR 7 GGC YES (NPL) GGA NO GGG NO GCT NO ALANINE GCC YES GCA NO GCG NO GTT NO VALINE GTC YES GTA NO GTG NO TTA NO LEUCINE TTG NO CTT NO CTC YES CTA NO CTG NO ATT NO ISOLEUCINEI ATC YES ATA NO ATG NO | METHIONINE 0 TTT NO PHENYLALANINE I TTC YES TGG NO TRYPTOPHAN 0 CCT NO PROLINE CCC YES CCA NO CCG NO TCT NO SERINE 2 POLAR 6 TCC YES NONIONIZABLE TCA NO (POL) TCG NO AGT NO AGC YES TGT NO CYSTEINE TGC YES AAT NO ASPARAGINE I AAC YES CAA NO GLUTAMINE 0 CAG NO TAT NO TYROSINE TAC YES ACT NO THREONINE ACC YES ACA NO ACG NO GAT NO ASPARTIC ACID I IONIZABLE: ACIDIC I GAC YES NEGATIVE CHARGE GAA NO GLUTAMIC ACID 0 (NEG) GAG NO AAA NO LYSINE 0 IONIZABLE: BASIC 2 AAG NO POSITIVE CHARGE CGT NO ARGININE I (POS) CGC YES CGA NO CGG NO AGA NO AGG NO CAT NO HISTIDINE CAC YES HI TAA NO STOP CODON 0 STOP SIGNAL 0 TAG NO (STP) TGA NO TOTAL TOTAL 15 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 16 7: 6: 1: 2: 0 89 WO 00/58517 PCT/US00/08245 TABLE 11. Mutagenic Cassette: N, N, T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE I NONPOLAR 7 GGC NO (NPL) GGA NO GGG NO GCT YES ALANINE GCC NO GCA NO GCG NO GT YES VALINE GTC NO GTA NO GTG NO TTA NO LEUCINE TTG NO CTT YES CTC NO CTA NO CTG NO ATT YES ISOLEUCINE ATC NO ATA NO ATG NO METHIONINE 0 TTT YES PHENYLALANINE TTC NO TGG NO TRYPTOPHAN 0 CCT YES PROLINE CCC NO CCA NO CCG NO TCT YES SERINE 2 POLAR 6 TCC NO NONIONIZABLE TCA NO (POL) TCG NO AGT YES AGC NO TGT YES CYSTEINE TGC NO AAT YES ASPARAGINE AAC NO CAA NO GLUTAMINE 0 CAG NO TAT YES TYROSINE I TAC NO ACT YES THREONINE ACC NO ACA NO ACG NO GAT YES ASPARTIC ACID I IONIZABLE: ACIDIC I GAC NO NEGATIVE CHARGE GAA NO GLUTAMIC ACID 0 (NEG) GAG NO AAA NO LYSINE 0 IONIZABLE: BASIC 2 AAG NO POSITIVE CHARGE CGT YES ARGININE I (POS) CGC NO CGA NO CGG NO AGA NO AGG NO CAT YES HISTIDINE CAC NO TAA NO STOP CODON 0 STOP SIGNAL U TAG NO (STP) TGA NO TOTAL TOTAL 15 Amino Acids Are Represented NPL: POL: NEG: POS: STP 64 16 7: 6: 1: 2: 0 90 WO 00/58517 PCT/USOO/08245 TABLE 12. Mutagenic Cassette: N, N, C/G/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 3 NONPOLAR 22 GGC YES (NPL) GGA NO GGG YES GCT YES ALANINE 3 GCC YES GCA NO GCG YES GTT YES VALINE 3 GTC YES GTA NO GTG YES TTA NO LEUCINE 4 TG YES CT YES CTC YES CTA NO CTG YES ATT YES ISOLEUCINE 2 ATC YES ATA NO ATG YES METHIONINE I TTT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN CCT YES PROLINE 3 CCC YES CCA NO CCG YES TCT YES SERINE 5 POLAR 15 TCC YES NONIONIZABLE TCA NO (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES AAT YES ASPARAGINE 2 AAC YES CAA NO GLUTAMINE I CAG YES TAT YES TYROSINE 2 TAC YES ACT YES THREONINE 3 ACC YES ACA NO ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 3 GAC YES NEGATIVE CHARGE GAA NO GLUTAMIC ACID I (NEG) GAG YES AAA NO LYSINE I IONIZABLE: BASIC 7 AAG YES POSITIVE CHARGE CGT YES ARGININE 4 (POS) CGC YES CGA NO CGG YES AGA NO AGG YES CAT YES HISTIDINE 2 CAC YES FAA NO STOP CODON I STOP SIGNAL TAG YES (STP) TGA NO TOTAL TOTAL 20 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 64 48 22: 15: 3: 7: 1 91 WO 00/58517 PCT/USOO/08245 TABLE 13. Mutagenic Cassette: N, N, A/G/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 3 NONPOLAR 22 GGC NO (NPL) GGA YES GGG YES GCT YES ALANINE 3 GCC NO GCA YES GCG YES GTT YES VALINE 3 GTC NO GTA YES GTG YES TTA YES LEUCINE 5 TTG YES CT7 YES CTC NO CTA YES CTG YES ATf YES ISOLEUCINE 2 ATC NO ATA YES ATG YES METHIONINE I TTT YES PHENYLALANINE I TC NO TGG YES TRYPTOPHAN I CCT YES PROLINE 3 CCC NO CCA YES CCO YES TCT YES SERINE 4 POLAR 12 TCC NO NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC NO TGT YES CYSTEINE TGC NO AAT YES ASPARAGINE AAC NO CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE TAC |No ACT YES THREONINE 3 ACC NO ACA YES ACG YES GAT YES ASPARTIC ACID I IONIZABLE: ACIDIC 3 GAC NO NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES I AAA YES LYSINE 2 IONIZABLE: BASIC 8 AAG YES POSITIVE CHARGE CGT YES ARGININE 5 (POS) CGC NO CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE CAC NO TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL TOTAL 20 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 48 22: 12: 3: 8: 3 92 WO 00/58517 PCT/USOO/08245 TABLE 14. Mutagenic Cassette: N, N, A/C/T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 3 NONPOLAR 21 GGC YES (NPL) GGA YES GGG NO GCT YES ALANINE 3 GCC YES GCA YES GCG NO GTT YES VALINE 3 GTC YES GTA YES GTG NO TTA YES LEUCINE 4 TTG NO CTT YES CTC YES CTA YES CTG NO ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG NO METHIONINE 0 TTT YES PHENYLALANINE 2 TTC YES TGG NO TRYPTOPHAN 0 CCT YES PROLINE 3 CCC YES CCA YES CCG NO TCT YES SERINE 5 POLAR 15 TCC YES NONIONIZABLE TCA YES (POL) TCG NO AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE CAG NO TAT YES TYROSINE 2 TAC YES ACT YES THREONINE 3 ACC YES ACA YES ACG NO GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 3 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID I (NEG) GAG No AAA YES LYSINE I IONIZABLE: BASIC 7 AAG NO POSITIVE CHARGE CGT YES ARGININE 4 (POS) CGC YES CGA YES CGG NO AGA YES AGG NO CAT YES HISTIDINE 2 CAC YES TAA YES STOPCODON 2 STOP SIGNAL 2 TAG NO (STP) TGA YES TOTAL TOTAL 18 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 64 48 21: 15: 3: 7: 2 93 WO 00/58517 PCT/US00/08245 TABLE 15. Mutagenic Cassette: N, N, A/C/G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT NO GLYCINE 3 NONPOLAR 22 GGC YES (NPL) GGA YES GGG YES GCT NO ALANINE 3 GCC YES GCA YES GCG YES GTr NO VALINE 3 GTC YES GTA YES GTG YES TTA YES LEUCINE 5 TTG YES CTT NO CTC YES CTA YES CTG YES ATT NO ISOLEUCINE 2 ATC YES ATA YES ATG YES METHIONINE I TTT NO PHENYLALANINE I TTC YES TGG YES TRYPTOPHAN I CCT NO PROLINE 3 CCC YES CCA YES CCG YES TCT NO SERINE 4 POLAR 12 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT NO AGC YES TGT NO CYSTEINE TGC YES AAT NO ASPARAGINE AAC YES CAA YES GLUTAMINE 2 CAG YES TAT NO TYROSINE TAC YES ACT NO THREONINE 3 ACC YES ACA YES ACG YES GAT NO ASPARTIC ACID I IONIZABLE: ACIDIC 3 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 8 AAG YES POSITIVE CHARGE CGT NO ARGININE 5 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT NO HISTIDINE CAC YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES 1 TOTAL TOTAL 20 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 64 48 22: 12: 3: 8: 3 94 WO 00/58517 PCT/US0O/08245 TABLE 16. Mutagenic Cassette: N, A, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAA YES STOP CODON I STOP SIGNAL I _______________ I(STP) TOTAL 4 3 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 0: 1: 1: 1: TABLE 17. Mutagenic Cassette: N, A, C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 T PROLINE 0 SERINE 0 POLAR 2 | CYSTEINE 0 NONIONIZABLE AAC YES | ASPARAGINE I (POL) GLUTAMINE 0 TAC YES ITYROSINE - THREONINE 0 GAC YES ASPARTIC ACID I IONIZABLE: ACIDIC I GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE CAC YES I HISTIDINE I(POS) STOP CODON 0 STOP SIGNAL 0 _ I(STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 2: 1: 1: 0 95 WO 00/58517 PCTIUSOO/08245 TABLE 18. Mutagenic Cassette: N, A, G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCfNE 0 NONPOLAR 0 ALANINE 0 (NPL) VALNE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR I CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAG YES GLUTAMINE I TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAG YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAG YES LYSINE I IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAG YES STOP CODON I STOP SIGNAL I -(STP) TOTAL 4 3 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 1: 1: 1: I TABLE 19. Mutagenic Cassette: N, A, T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE AAT YES ASPARAGINE I (POL) GLUTAMINE 0 TAT YES TYROSINE THREONINE 0 GAT YES ASPARTIC ACID I IONIZABLE: ACIDIC I GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE CAT YES HISTIDINE I (POS) STOP CODON 0 STOP SIGNAL 0 1_ (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP 0: 2: 1: 1: 0 96 WO 00/58517 PCT/USO0/08245 TABLE 20. Mutagenic Cassette: N, C, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 2 GCA YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE POLAR 2 CYSTEINE o NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACA YES THREONINE I ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 2: 2: 0: 0: 0 TABLE 21. Mutagenic Cassette: N, C, C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 2 GCC YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCC I YES PROLINE TCC YES SERINE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACC YES THREONINE I ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 2: 2: 0: 0: 0 97 WO 00/58517 PCT/USOO/08245 TABLE 22. Mutagenic Cassette: N, C, G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 2 GCG YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCG YES PROLINE TCG YES SERINE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACG YES THREONINE ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 2: 2: 0: 0: 0 TABLE 23. Mutagenic Cassette: N, C, T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) I GLYCINE 0 NONPOLAR 2 GCT YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 I TRYPTOPHAN 0 CCT YES PROLINE TCT YES I SERINE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACT YES THREONINEI ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 2: 2: 0: 0: 0 98 WO 00/58517 PCT/US0O/08245 TABLE 24. Mutagenic Cassette: N, G, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR I ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL I 7 _(STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1: 0: 0: 2: 1 TABLE 25. Mutagenic Cassette: N, G, C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGC YES GLYCINE I NONPOLAR I ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 |PROLINE 0 AGC YES SERINE I POLAR 2 TGC YES CYSTEINE I NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC I CGC YES ARGININE I POSITIVE CHARGE I HISTIDrNE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 1: 2: 0: 1: 0 99 WO 00/58517 PCT/USOO/08245 TABLE 26. Mutagenic Cassette: N, G, G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGG YES GLYCINE I NONPOLAR 2 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 CGG YES ARGININE 2 POSITIVE CHARGE AGG YES (POS) HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 3 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 2: 0: 0: 2: 0 TABLE 27. Mutagenic Cassette: N, G, T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE I NONPOLAR ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 AGT YES SERINE I POLAR 2 TGT YES CYSTEINE I NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC I CGT YES ARGININE I POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1: 2: 0: 1: 0 100 WO 00/58517 PCT/US00/08245 TABLE 28. Mutagenic Cassette: N, T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTA YES VALINE TTA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0(PO) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 3 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 __ 4: 0: 0: 0: 0 TABLE 29. Mutagenic Cassette: N, T, C CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTC YES VALINE CTC YES LEUCINE ATC YES ISOLEUCINE METHIONINE 0 TTC YES PHENYLALANINE I TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 101 WO 00/58517 PCT/USOO/08245 TABLE 30. Mutagenic Cassette: N, T, G CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTG YES VALINE TG YES LEUCINE 2 CTG YES ISOLEUCINE 0 ATG YES METHIONINE PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 3 Amino Acids Are Represented NPL: POL: NEG: POS: STP= - I _ _ _ _ _ _ _ _ _4: 0: 0: 0: 0 TABLE 31. Mutagenic Cassette: N, T, T CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTT YES VALINE CTF YES LEUCINE ATT YES ISOLEUCINE METHIONINE 0 TT YES PHENYLALANINE I TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 102 WO 00/58517 PCT/USOO/08245 TABLE 32. Mutagenic Cassette: N, A/C, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 2 GCA YES ALANINE I (NPL) VALINE 0 _LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE POLAR 3 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE TYROSINE 0 ACA YES THREONINE ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) IAA YES STOP CODON I STOP SIGNAL I (STP) TOTAL 8 7 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 2: 3: 1: 1: TABLE 33. Mutagenic Cassette: N, A/G, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR I ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 I PROLINE 0 SERINE 0 POLAR CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC 3 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TAA YES STOP CODON 2 STOP SIGNAL 2 TGA YES (STP) TOTAL 8 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1: 1: 1: 3: 2 103 WO 00/58517 PCT/USOO/08245 TABLE 34. Mutagenic Cassette: N, A/T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTA YES VALINE TTA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE I TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAA YES STOP CODON I STOP SIGNAL I (STP) TOTAL 8 6 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 1: 1: 1: TABLE 35. Mutagenic Cassette: N, C/G, A CODON Represented) AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR 3 GCA YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERENE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACA YES THREONINE I ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL I (STP) TOTAL 8 6 Amino Acids Are Represented NPL: POL: NEG: POS: STP = - 3: 2: 0: 2: 1 104 WO 00/58517 PCT/USOO/08245 TABLE 36. Mutagenic Cassette: N, C/T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 6 GCA YES ALANINE (NPL) GTA YES VALINE TTA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACA YES THREONINE ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 8 7 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 6: 2: 0: 0: 0 TABLE 37. Mutagenic Cassette: N, T/G, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR 5 ALANINE 0 (NPL) GTA YES VALINE TrA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL I (STP) TOTAL 8 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 5: 0: 0: 2: 1 105 WO 00/58517 PCT/USOO/08245 TABLE 38. Mutagenic Cassette: N, C/G/T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR 7 GCA YES ALANINE I (NPL) GTA YES VALINE TTA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE I POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACA YES THREONINE ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL I (STP) TOTAL 12 9 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 1_ 7: 2: 0: 2: 1 TABLE 39. Mutagenic Cassette: N, A/G/T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR 5 ALANINE 0 (NPL) GTA YES VALINE TTA YES LEUCINE 2 CTA YES ATA YES ISOLEUCINE METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERENE 0 POLAR CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC 3 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 TAA YES STOP CODON 2 STOP SIGNAL 2 TGA YES (STP) TOTAL 12 8 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 5: 1: 1: 3: 2 106 WO 00/58517 PCT/US0O/08245 TABLE 40. Mutagenic Cassette: N, A/C/T, A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 6 GCA YES ALANINE I (NPL) GTA YES VALINE TTA YES LEUClNE 2 CTA YES ATA YES ISOLEUCINE I METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE I POLAR 3 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE I TYROSINE 0 ACA YES | THREONINE I ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC I ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAA YES STOP CODON I STOP SIGNAL I ______________ I_________________________(STP) TOTAL 12 10 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 1_ 6: 3: 1: 1: 1 TABLE 41. Mutagenic Cassette: N, A/C/G. A CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGA YES GLYCINE I NONPOLAR 3 GCA YES ALANINE I (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCA YES PROLINE TCA YES SERINE I POLAR 3 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE I TYROSINE 0 ACA YES THREONINE ASPARTIC ACID 0 IONIZABLE: ACIDIC I GAA YES GLUTAMIC ACID I NEGATIVE CHARGE (NEG) AAA YES LYSINE I IONIZABLE: BASIC 3 CGA YES ARGININE 2 POSITIVE CHARGE AGA YES (POS) HISTIDINE 0 FAA YES STOP CODON 2 STOP SIGNAL 2 TGA YES (STP) TOTAL 12 9 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 3: 3: 1: 3: 2 107 WO 00/58517 PCT/US00/08245 TABLE 42. Mutagenic Cassette: A, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) VALINE0 LEUCINE 0 ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES PHENYLALANINE 0 RTR OPHAN 0 PON G AGT YES SEINE 2 POLAR 8 AGC YES NNIONIZABLE CYSTEINE 0 (POL) AAT YES ASPARAGINE 2 AAC YES GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTICACID 0 IONIZABLE: ACIDIC GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG { YES POSITIVE CHARGE AGA YES ARGININE 2 (POS) AGG YES HISTIDINE 0 STOPCODON 0 STOP SIGNAL 0 (STP) TOTAL 16 7 Amino Acids Are Represented NPL: POL: NEG: POS: STP 6 1 4: 8: 0: 4: 0 TABLE 43. Mutagenic Cassette: C, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 8 ALANINE 0 (NPL) VALINE 0 CTT YES LEUCINE 4 CTC YES CTA YES CTG YES ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES SERINE 0 POLAR 2 CYSTEINE 0 NIONIONEZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE 2 CAG YES TYROSINE THREONINE 0 |ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 6 CGT YES AGNNE 4 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES CAT YES HISTIDINE 2 CAC YES STOP CODON 0 STOP SIGNAL 0 S1 (STP) TOTAL 16 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 8: 2: 0: 6: 0 108 WO 00/58517 PCT/US00/08245 TABLE 44. Mutagenic Cassette: G, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 12 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 16 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 12: 0: 4: 0: 0 TABLE 45. Mutagenic Cassette: T, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR S ALANINE 0 (NPL) VALINE 0 TTA YES LEUCNE 2 TTG YES ISOLEUCINE 0 METHIONINE 0 TTT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN PROLINE 0 TCT YES SERINE 4 POLAR 8 TCC YES NNIONIZABLE TCA YES (POL) TCG YES TGT YES CYSTEINE 2 TGC YES ASPARAGINE 0 GLUTAMINE 0 TAT YES TYROSINE 2 TACYE i ITHREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 ONIZABLE: BASIC 0 AGININ9E 0 POSITIVE CHARGE HISTIDINE 0(POS) TAA YS STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 16 6 Amino Acids Are Represented NPL: POL: NEG: POS: STP= 5: 8: 0: 0: 3 109 WO 00/58517 PCTUSOO/08245 TABLE 46. Mutagenic Cassette: A/C, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 12 ALANINE 0 (NPL) VALINE 0 CTT YES LEUCINE 4 CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES AGT YES SERINE 2 POLAR 10 AGC YES NONIONIZABLE CYSTEINE 0 (POL) AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: 0 GLUTAMIC ACID 0 ACIDIC NEGATIVE CHARGE (NEG) AAA YES LYSINE 2 IONIZABLE: BASIC 10 AAG YES POSITIVE CHARGE CGT YES ARGININE 6 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE 2 CAC YES STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 32 11 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 12: 10: 0: 10: 0 110 WO 00/58517 PCT/USOO/08245 TABLE 47. Mutagenic Cassette: A/G, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 16 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES LEUCINE 0 ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 AGT YES SERINE 2 POLAR 8 AGC YES NONIONIZABLE CYSTEINE 0 (POL) AAT YES ASPARAGINE 2 AAC YES GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE AGA YES ARGININE 2 (POS) AGG YES HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 32 12 Amino Acids Are Represented NPL: POL: NEG: POS: STP 16: 8: 4: 4: 0 111 WO 00/58517 PCT/USOO/08245 TABLE 48. Mutagenic Cassette: A/T, N, N CODON I Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 9 ALANINE 0 (NPL) VALINE 0 TTA YES LEUCINE 2 TTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I ITT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN I PROLINE 0 TCT YES SERINE 6 POLAR 16 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES AAT YES ASPARAGINE 2 AAC YES GLUTAMINE 0 TAT YES TYROSINE 2 TAC YES ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE AGA YES ARGININE 2 (POS) AGG YES HISTIDINE 0 TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 32 12 Amino Acids Are NPL: POL: NEG: POS: STP = Represented 9: 16: 0: 4: 3 112 WO 00/58517 PCT/US0O/08245 TABLE 49. Mutagenic Cassette: C/G, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 20 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES CT YES LEUCINE 4 CTC YES CTA YES CTG YES ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE 2 CAG YES TYROSINE 0 THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES LYSINE 0 IONIZABLE: BASIC 6 CGT YES ARGININE 4 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES CAT YES HISTIDINE 2 CAC YES STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 32 10 Amino Acids Are NPL: POL: NEG: POS: STP = Represented 20: 2: 4: 6: 0 113 WO 00/58517 PCT/USOO/08245 TABLE 50. Mutagenic Cassette: C/T, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 13 ALANINE 0 (NPL) VALINE 0 TTA YES LEUCINE 6 TTG YES CTT YES CTC YES CTA YES CTG YES ISOLEUCINE 0 METHIONINE 0 TTT YES PHENYLALANINE 2 TC YES TGG YES TRYPTOPHAN I CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 4 POLAR 10 TCC YES NONIONIZABLE TCA YES (POL) TCG YES TGT YES CYSTEINE 2 TGC YES ASPARAGINE 0 CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 6 CGT YES ARGININE 4 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES CAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 32 10 Amino Acids Are NPL: POL: NEG: POS: STP = Represented 13: 10: 0: 6: 3 114 WO 00/58517 PCT/USOO/08245 TABLE 51. Mutagenic Cassette: G/T, N, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 17 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES TIA YES LEUCINE 2 TTG YES ISOLEUCINE 0 METHIONINE 0 TIT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN PROLINE 0 TCT YES SERINE 4 POLAR 8 TCC YES NONIONIZABLE TCA YES (POL) TCG YES TGT YES CYSTEINE 2 TGC YES ASPARAGINE 0 GLUTAMINE 0 TAT YES TYROSINE 2 TAC YES THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 32 11 Amino Acids Are NPL: POL: NEG: POS: STP = Represented 17: 8: 4: 0: 3 115 WO 00/58517 PCT/USOO/08245 TABLE 52. Mutagenic Cassette: N, A, N CODON Represented AMINOACID (Frequency) CATEGORY lFrequency) GLYCINE 0 NONPOLAR ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR CYSTEINE 0 NONIONIZABLE AAT YES ASPARAGINE 2 (POL) AAC- YE S CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG | YES AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE
-----
_ARGININE 0 (POS) CAT YES HISTIDINE 2 CAC |YES TAA YES STOP CODON 2 STOP SIGNAL TAG YES (STP) TOTAL 16 7 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 6: 4: 4: 2 TABLE 53. Mutagenic Cassette: N, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 8 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES VALINE I I LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERENE 4 POLAR 8 TCC YES NONIONIZABLE TCA YES (POL) TCG YES CYSTEINE 0 ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 16 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1 8: 8: 0: 0: 0 116 WO 00/58517 PCT/USOO/08245 TABLE 54. Mutagenic Cassette: N, G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 5 GGC YES (NPL) GGA YES GGG YES ALANINE 0 VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN PROLINE 0 AGT YES SERINE 2 POLAR 4 AGC YES NONIONIZABLE TGT YES CYSTEINE 2 (POL) TGC YES ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC CGT YES ARGININE 6 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES AGA YES AGG YES I HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL (STP) TOTAL 16 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 5: 4: 0: 6: 1 TABLE 55. Mutagenic Cassette: N, T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 16 ALANINE 0 (NPL) GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CTT YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I TTT YES PHENYLALANINE 2 TTC YES TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 16 5 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 16: 0: 0: 0: 0 117 WO 00/58517 PCTIUSOO/08245 TABLE 56. Mutagenic Cassette: N, A/C, N CODON I Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 8 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 4 POLAR 14 TCC YES NONIONIZABLE TCA YES (POL) TCG YES CYSTEINE 0 AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES ACT YES THREONINE 4 ACC YES ACA YES ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE ARGININE 0 (POS) GAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 2 STOP SIGNAL 2 TAG YES (STP) TOTAL 32 11 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 8: 14: 4: 4: 2 118 WO 00/58517 PCT/USOO/08245 TABLE 57. Mutagenic Cassette: N, A/G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 5 GGC YES (NPL) GGA YES GGG YES ALANINE 0 VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN I PROLINE 0 AGT YES SERINE 2 POLAR 10 AGC YES NONIONIZABLE TOT YES CYSTEINE 2 (POL) TGC YES AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 10 AAG YES POSITIVE CHARGE CGT YES ARGININE 6 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE CAC |YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 32 12 Amino Acids Are Represented NPL: POL: NEG: POS: STP - 5: 10: 4: 10: 3 119 WO 00/58517 PCT/USOO/08245 TABLE 58. Mutagenic Cassette: N, A/T, N CODON Represented CATEGORY (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 16 ALANINE 0 (NPL) GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CT7 YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE T-1 YES PHENYLALANINE TrC YES TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 6 CYSTEINE 0 NONIONIZABLE AAT YES ASPARAGINE 2 (POL) AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE ARGININE 0 (POS) CAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 2 STOP SIGNAL 2 TAG YES (STP) TOTAL 32 12 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 16: 6: 4: 4: 2 120 WO 00/58517 PCT/USOO/08245 TABLE 59. Mutagenic Cassette: N, C/G, N CODON I Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 13 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 6 POLAR 12 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 6 CGT YES ARGININE 6 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES AGA YES AGG YES HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL I (STP) 32 8 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 13: 12: 0: 6: 1 121 WO 00/58517 PCT/US00/08245 TABLE 60. Mutagenic Cassette: N, C/T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 24 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES GTF YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CTT YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I TT YES PHENYLALANINE 2 TTC YES TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 4 POLAR 8 TCC YES NONIONIZABLE TCA YES (POL) TCG YES CYSTEINE 0 ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 32 9 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 24: 8: 0: 0: 0 122 WO 00/58517 PCT/USOO/08245 TABLE 61. Mutagenic Cassette: N, G/T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 21 GGC YES (NPL) GGA YES GGG YES ALANINE 0 GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CTF YES CTC YES CTA YES CTG YES ATf YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I TT YES PHENYLALANINE 2 TrC YES TGG YES TRYPTOPHAN I PROLINE 0 AGT YES SERENE 2 POLAR 4 AGC YES NONIONIZABLE TGT YES CYSTEINE 2 (POL) TGC YES ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 6 CGT YES ARGININE 6 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES AGA YES AGG YES |HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL (STP) TOTAL 32 10 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 21: 4: 0: 6: 1 123 WO 00/58517 PCT/USOO/08245 TABLE 62. Mutagenic Cassette: N, A/C/G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 13 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES VALINE 0 LEUCINE 0 ISOLEUCINE 0 METIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 6 POLAR 18 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE TGC YES AAT YES ASPARAGINE AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE TAC YES ACT YES THREONINE 4 ACC YES ACA YES ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 10 AAG YES POSITIVE CHARGE CGT YES ARGININE 6 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 48 15 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 13: 18: 4: 10: 3 124 WO 00/58517 PCT/USOO/08245 TABLE 63. Mutagenic Cassette: N, A/C/T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 24 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CTT YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE TTT YES PHENYLALANINE 2 TTC YES TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 4 POLAR 14 TCC YES NONIONIZABLE TCA YES (POL) TCG YES CYSTEINE 0 AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES ACT YES THREONINE 4 ACC YES ACA YES ACG YES GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 4 AAG YES POSITIVE CHARGE ARGININE 0 (POS) CAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 2 STOP SIGNAL 2 TAG YES (STP) TOTAL 48 16 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 24: 14: 4: 4: 2 125 WO 00/58517 PCT/USOO/08245 TABLE 64. Mutagenic Cassette: N, A/G/T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 21 GGC YES (NPL) GGA YES GGG YES ALANINE 0 GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TrG YES CTT YES CTC YES CTA YES CTG YES ATl YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I T YES PHENYLALANINE 2 Trc YES TGG YES TRYPTOPHAN I PROLINE 0 AGT YES SERINE 2 POLAR 10 AGC YES NONIONIZABLE TGT YES CYSTEINE 2 (POL) TGC YES AAT YES ASPARAGINE 2 AAC YES CAA YES GLUTAMINE 2 CAG YES TAT YES TYROSINE 2 TAC YES T| THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID (NEG) GAG YES AAA YES LYSINE 2 IONIZABLE: BASIC 10 AAG YES POSITIVE CHARGE CGT YES ARGININE 6 (POS) CGC YES CGA YES CGG YES AGA YES AGG YES CAT YES HISTIDINE 2 CAC YES TAA YES STOP CODON 3 STOP SIGNAL 3 TAG YES (STP) TGA YES TOTAL 48 17 Amino Acids Are Represented NPL: POL: NEG: POS: STP 1 21: 10: 4: 10: 3 126 WO 00/58517 PCT/USOO/08245 TABLE 65. Mutagenic Cassette: N, C/G/T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 29 GGC YES (NPL) GGA YES GGG YES GCT YES ALANINE 4 GCC YES GCA YES GCG YES GTT YES VALINE 4 GTC YES GTA YES GTG YES TTA YES LEUCINE 6 TTG YES CTT YES CTC YES CTA YES CTG YES ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE TTT YES PHENYLALANINE 2 TTC YES TGG YES TRYPTOPHAN I CCT YES PROLINE 4 CCC YES CCA YES CCG YES TCT YES SERINE 6 POLAR 12 TCC YES NONIONIZABLE TCA YES (POL) TCG YES AGT YES AGC YES TGT YES CYSTEINE 2 TGC YES ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES I ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 6 CGT YES ARGININE 6 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES AGA YES AGG YES HISTIDINE 0 TGA YES STOP CODON I STOP SIGNAL (STP) TOTAL 48 13 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 29: 12: 0: 6: 1 127 WO 00/58517 PCT/USOO/08245 TABLE 66. Mutagenic Cassette: C, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 TABLE 67. Mutagenic Cassette: G, G, N CODON Represented AMINOACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 4 GGC YES (NPL) GGA YES GGG YES ALANINE 0 VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 0 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 128 WO 00/58517 PCT/USOO/08245 TABLE 68. Mutagenic Cassette: G, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP 4: 0: 0: 0: 0 TABLE 69. Mutagenic Cassette: G, T, N CODON Represented AMINO ACID (Frequency). CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) GTT YES VALINE 4 GTC YES GTA YES GTG YES I LEUCINE 0 I ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 7 " _(STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 129 WO 00/58517 PCT/US0O/08245 TABLE 70. Mutagenic Cassette: C, G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN O PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 4 CGT YES ARGININE 4 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP 0: 0: 0: 4: 0 TABLE 71. Mutagenic Cassette: C, T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) VALINE 0 CTT YES LEUCINE 4 CTC YES CTA YES CTG YES ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 130 WO 00/58517 PCT/USOO/08245 TABLE 72. Mutagenic Cassette: T, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 TCT YES SERINE 4 POLAR 4 TCC YES NONIONIZABLE TCA YES (POL) TCG YES CYSTEINE 0 ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 0: 4: 0: 0: 0 TABLE 73. Mutagenic Cassette: A, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 _______METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 4 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 ACT YES THREONINE 4 ACC YES ACA YES ACG YES ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGA TIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 A RGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 41 Amino Acid Is Represented NPL: POL: NEG: POS: STP = T L 0: 4: 0: 0 :0 131 WO 00/58517 PCT/USOO/08245 TABLE 74. Mutagenic Cassette: G, A, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG YES LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 0: 4: 0: 0 TABLE 75. Mutagenic Cassette: A, T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ATT YES ISOLEUCINE 3 ATC YES ATA YES ATG YES METHIONINE I PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 132 WO 00/58517 PCT/USOO/08245 TABLE 76. Mutagenic Cassette: C, A, N CODON Representea AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE 2 CAG YES TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE
(NEG)
LYSINE 0 IONIZABLE: BASIC 2 ARGININE 0 POSITIVE CHARGE CAT YES HISTIDINE 2 (POS) CAC YES STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 2: 0: 2: 0 TABLE 77. Mutagenic Cassette: T, T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 4 ALANINE 0 (NPL) VALINE 0 TTA YES LEUCINE 2 TTG YES ISOLEUCINE 0 METHIONINE 0 TITT YES PHENYLALANINE 2 TTC YES TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 0: 0 133 WO 00/58517 PCT/USOO/08245 TABLE 78. Mutagenic Cassette: A, A, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE AAT YES ASPARAGINE 2 (POL) AAC YES GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) AAA YES LYSINE 2 IONIZABLE: BASIC 2 AAG YES POSITIVE CHARGE I ARGININE 0 (POS) HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 NINE_ (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 2: 0: 2: 0 TABLE 79. Mutagenic Cassette: T, A, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TAT YES TYROSINE 2 TAC YES THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) . LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) TAA YES STOP CODON 2 STOP SIGNAL 2 TAG YES (STP) TOTAL 4 1 Amino Acid Is Represented NPL: POL: NEG: POS: STP = 0: 2: 0: 0: 2 134 WO 00/58517 PCT/USOO/08245 TABLE 80. Mutagenic Cassette: T, G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR I ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TGG YES TRYPTOPHAN I PROLINE 0 SERINE 0 POLAR 2 TGT YES CYSTEINE 2 NONIONIZABLE TGC YES (POL) TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE (POS) HISTIDINE 0 TGA YES STOPCODON I STOP SIGNAL I (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 1: 2: 0: 0: 1 TABLE 81. Mutagenic Cassette: A, G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 AGT YES SERINE 2 POLAR 2 AGC YES NONIONIZABLE CYSTEINE 0 (POL) ASPARAGINE 0 GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 2 AGA YES ARGININE 2 POSITIVE CHARGE AGG YES (POS) HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 4 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 2: 0: 2: 0 135 WO 00/58517 PCT/USOO/08245 TABLE 82. Mutagenic Cassette: G/C, G, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GGT YES GLYCINE 4 NONPOLAR 4 GGC YES (NPL) GGA YES GGG YES _ALANINE 0 VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 4 CGT YES ARGININE 4 POSITIVE CHARGE CGC YES (POS) CGA YES CGG YES HISTIDINE 0 STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 8 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 4: 0: 0: 4: 0 TABLE 83. Mutagenic Cassette: G/C, C, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 8 GCT YES ALANINE 4 (NPL) GCC YES GCA YES GCG YES VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 CCT YES PROLINE 4 CCC YES CCA YES CCG YES SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 8 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 8: 0: 0: 0: 0 136 WO 00/58517 PCT/USOO/08245 TABLE 84. Mutagenic Cassette: G/C, A, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 0 ALANINE 0 (NPL) VALINE 0 LEUCINE 0 ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 2 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) CAA YES GLUTAMINE 2 CAG YES TYROSINE 0 THREONINE 0 GAT YES ASPARTIC ACID 2 IONIZABLE: ACIDIC 4 GAC YES NEGATIVE CHARGE GAA YES GLUTAMIC ACID 2 (NEG) GAG |YES LYSINE 0 IONIZABLE: BASIC 2 ARGININE 0 POSITIVE CHARGE CAT YES HISTIDINE 2 (POS) CAC YES STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 8 4 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 0: 2: 4: 2: 0 TABLE 85. Mutagenic Cassette: G/C, T, N CODON Represented AMINO ACID (Frequency) CATEGORY (Frequency) GLYCINE 0 NONPOLAR 8 ALANINE 0 (NPL) GTT YES VALINE 4 GTC YES GTA YES GTG YES C1T YES LEUCINE 4 CTC YES CTA YES CTG YES ISOLEUCINE 0 METHIONINE 0 PHENYLALANINE 0 TRYPTOPHAN 0 PROLINE 0 SERINE 0 POLAR 0 CYSTEINE 0 NONIONIZABLE ASPARAGINE 0 (POL) GLUTAMINE 0 TYROSINE 0 THREONINE 0 ASPARTIC ACID 0 IONIZABLE: ACIDIC 0 GLUTAMIC ACID 0 NEGATIVE CHARGE (NEG) LYSINE 0 IONIZABLE: BASIC 0 ARGININE 0 POSITIVE CHARGE HISTIDINE 0 (POS) STOP CODON 0 STOP SIGNAL 0 (STP) TOTAL 8 2 Amino Acids Are Represented NPL: POL: NEG: POS: STP = 8: 0: 0: 0: 0 137 WO 00/58517 PCT/USOO/08245 2,11.2.3. EXONUCLEASE-MEDIATED REASSEMBLY In a particular embodiment, this invention provides for a method for 5 shuffling, assembling, reassembling, recombining, &/or concatenating at least two polynucleotides to form a progeny polynucleotide (e.g. a chimeric progeny polynucleotide that can be expressed to produce a polypeptide or a gene pathway). In a particular embodiment, a double stranded polynucleotide end (e.g. two single stranded sequences hybridized to each other as hybridization partners) is treated with 10 an exonuclease to liberate nucleotides from one of the two strands, leaving the remaining strand free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner. In a particular aspect, a double stranded polynucleotide end (that may be part 15 of - or connected to - a polynucleotide or a nonpolynucleotide sequence) is subjected to a source of exonuclease activity. Serviceable sources of exonuclease activity may be an enzyme with 3' exonuclease activity, an enzyme with 5' exonuclease activity, an enzyme with both 3' exonuclease activity and 5' exonuclease activity, and any combination thereof. An exonuclease can be used to liberate nucleotides from one 20 or both ends of a linear double stranded polynucleotide, and from one to all ends of a branched polynucleotide having more than two ends. The mechanism of action of this liberation is believed to be comprised of an enzymatically-catalyzed hydrolysis of terminal nucleotides, and can be allowed to proceed in a time-dependent fashion, allowing experimental control of the progression of the enzymatic process. 25 By contrast, a non-enzymatic step may be used to shuffle, assemble, reassemble, recombine, and/or concatenate polynucleotide building blocks that is comprised of subjecting a working sample to denaturing (or "melting") conditions (for example, by changing temperature, pH, and /or salinity conditions) so as to melt 30 a working set of double stranded polynucleotides into single polynucleotide strands. For shuffling, it is desirable that the single polynucleotide strands participate to some extent in annealment with different hybridization partners (i.e. and not merely revert to exclusive reannealment between what were former partners before the 138 WO 00/58517 PCT/USOO/08245 denaturation step). The presence of the former hybridization partners in the reaction vessel, however, does not preclude, and may sometimes even favor, reannealment of a single stranded polynucleotide with its former partner, to recreate an original double stranded polynucleotide. 5 In contrast to this non-enzymatic shuffling step comprised of subjecting double stranded polynucleotide building blocks to denaturation, followed by annealment, the instant invention further provides an exonuclease-based approach requiring no denaturation - rather, the avoidance of denaturing conditions and the 10 maintenance of double stranded polynucleotide substrates in annealed (i.e. non denatured) state are necessary conditions for the action of exonucleases (e.g., exonuclease III and red alpha gene product). Additionally in contrast, the generation of single stranded polynucleotide sequences capable of hybridizing to other single stranded polynucleotide sequences is the result of covalent cleavage - and hence 15 sequence destruction - in one of the hybridization partners. For example, an exonuclease III enzyme may be used to enzymatically liberate 3' terminal nucleotides in one hybridization strand (to achieve covalent hydrolysis in that polynucleotide strand); and this favors hybridization of the remaining single strand to a new partner (since its former partner was subjected to covalent cleavage). 20 By way of further illustration, a specific exonuclease, namely exonuclease III is provided herein as an example of a 3' exonuclease; however, other exonucleases may also be used, including enzymes with 5' exonuclease activity and enzymes with 3' exonuclease activity, and including enzymes not yet discovered and enzymes not 25 yet developed. It is particularly appreciated that enzymes can be discovered, optimized (e.g. engineered by directed evolution), or both discovered and optimized specifically for the instantly disclosed approach that have more optimal rates &/or more highly specific activities &/or greater lack of unwanted activities. In fact it is expected that the instant invention may encourage the discovery &/or development 30 of such designer enzymes. In sum, this invention may be practiced with a variety of currently available exonuclease enzymes, as well as enzymes not yet discovered and enzymes not yet developed. 139 WO 00/58517 PCT/USOO/08245 The exonuclease action of exonuclease III requires a working double stranded polynucleotide end that is either blunt or has a 5' overhang, and the exonuclease action is comprised of enzymatically liberating 3' terminal nucleotides, 5 leaving a single stranded 5' end that becomes longer and longer as the exonuclease action proceeds (see Figure 1). Any 5' overhangs produced by this approach may be used to hybridize to another single stranded polynucleotide sequence (which may also be a single stranded polynucleotide or a terminal overhang of a partially double stranded polynucleotide) that shares enough homology to allow hybridization. The 10 ability of these exonuclease III-generated single stranded sequences (e.g. in 5' overhangs) to hybridize to other single stranded sequences allows two or more polynucleotides to be shuffled, assembled, reassembled, &/or concatenated. Furthermore, it is appreciated that one can protect the end of a double 15 stranded polynucleotide or render it susceptible to a desired enzymatic action of a serviceable exonuclease as necessary. For example, a double stranded polynucleotide end having a 3' overhang is not susceptible to the exonuclease action of exonuclease III. However, it may be rendered susceptible to the exonuclease action of exonuclease III by a variety of means; for example, it may be blunted by 20 treatment with a polymerase, cleaved to provide a blunt end or a 5' overhang, joined (ligated or hybridized) to another double stranded polynucleotide to provide a blunt end or a 5' overhang, hybridized to a single stranded polynucleotide to provide a blunt end or a 5' overhang, or modified by any of a variety of means). 25 According to one aspect, an exonuclease may be allowed to act on one or on both ends of a linear double stranded polynucleotide and proceed to completion, to near completion, or to partial completion. When the exonuclease action is allowed to go to completion, the result will be that the length of each 5' overhang will extend far towards the middle region of the polynucleotide in the direction of what might be 30 considered a "rendezvous point" (which may be somewhere near the polynucleotide midpoint). Ultimately, this results in the production of single stranded polynucleotides (that can become dissociated) that are each about half the length of 140 WO 00/58517 PCT/USOO/08245 the original double stranded polynucleotide (see Figure 1). Alternatively, an exonuclease-mediated reaction can be terminated before proceeding to completion. Thus this exonuclease-mediated approach is serviceable for shuffling, 5 assembling &/or reassembling, recombining, and concatenating polynucleotide building blocks, which polynucleotide building blocks can be up to ten bases long or tens of bases long or hundreds of bases long or thousands of bases long or tens of thousands of bases long or hundreds of thousands of bases long or millions of bases long or even longer. 10 This exonuclease-mediated approach is based on the action of double stranded DNA specific exodeoxyribonuclease activity of E. coli exonuclease III. Substrates for exonuclease III may be generated by subjecting a double stranded polynucleotide to fragmentation. Fragmentation may be achieved by mechanical 15 means (e.g., shearing, sonication, etc.), by enzymatic means (e.g. using restriction enzymes), and by any combination thereof. Fragments of a larger polynucleotide may also be generated by polymerase-mediated synthesis. Exonuclease III is a 28K monomeric enzyme, product of the xthA gene of E. 20 coli with four known activities: exodeoxyribonuclease (alternatively referred to as exonuclease herein), RNaseH, DNA-3'-phosphatase, and AP endonuclease. The exodeoxyribonuclease activity is specific for double stranded DNA. The mechanism of action is thought to involve enzymatic hydrolysis of DNA from a 3' end progressively towards a 5' direction, with formation of nucleoside 5'-phosphates and 25 a residual single strand. The enzyme does not display efficient hydrolysis of single stranded DNA, single-stranded RNA, or double-stranded RNA; however it degrades RNA in an DNA-RNA hybrid releasing nucleoside 5'-phosphates. The enzyme also releases inorganic phosphate specifically from 3'phosphomonoester groups on DNA, but not from RNA or short oligonucleotides. Removal of these groups 30 converts the terminus into a primer for DNA polymerase action. Additional examples of enzymes with exonuclease activity include red-alpha and venom phosphodiesterases. Red alpha (reda) gene product (also referred to as 141 WO 00/58517 PCT/USO0/08245 lambda exonuclease) is of bacteriophage X origin. The redc gene is transcribed from the leftward promoter and its product is involved (24 kD) in recombination. Red alpha gene product acts processively from 5'-phosphorylated termini to liberate mononucleotides from duplex DNA (Takahashi & Kobayashi, 1990). Venom 5 phosphodiesterases (Laskowski, 1980) is capable of rapidly opening supercoiled DNA. It is appreciated that related but nonidentical nucleic acid strands can hybridize as a step towards the generation of chimeric molecules. However, because 10 they are non-dentical, they can form what might be termed a heteromeric complex, i.e. an annealment of non-identical nucleic acids. In this complex, it is appreciated that even though two heterologous strands may be hybridized in part, terminal sequences of sufficiently heterologous strands will not hybridize, hence they are hybridizable. This poses a problem, because unhybrizided ends are suboptimal for 15 priming extension and for serving as points of ligation. Accordingly, in another embodiment, this invention provides for the use of exonuclease treatment as a means to liberate 3' and 5'-terminal nucleotides from the unhybridized single-stranded end of an annealed nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened but hybridized end to facilitate polymerase-based extension and/or ligase 20 mediated ligation of the treated end. This procedure is nicknamed "pruning of loose ends" A variety of exonucleases are serviceable for this "pruning" purpose. Thus, particularly preferred exonuclease treatments for this "pruning" purpose according to this invention include treatment with Mung Bean Nuclease, treatment with S 1 Nuclease, and treatment with E.coli DNA. Additional preferred exonuclease 25 treatments for this "pruning" purpose according to this invention include the use of the enzymes listed below (selected enzyme properties are provided). 142 WO 00/58517 PCT/USOO/08245 Exonucleases a. Stratagene b. Promega c. Epicenter d. Roche e. Kong, H.M., Kucera, R.B., and Jack, W.E., (1993) J. Biol. Chem. 268, 1965-1975. f. McClure, W.R. and Jovin, T.M., (1975) J. Bio. Chem 250, 4073-4080. g. Polesky A.H., Steitz, T.A., Grindley, N.D.F. and Joyce, C.M., (1990) J. Bio. Chem. 265, 14579-14591. h. Gillin, F.D. and Nossal, N.G., (1975) Biochem. Biophys. Res. Commun. 64, 457-464. 1. Patel, S.S., Wong, E. and Johnson, K.A., (1991) Biochemistry 30, 511-525. k. exhibits some double-stranded exonuclease activity from both ends at higher concentrations of enzyme m. exhibits some double-stranded exonuclease activity at higher concentrations of enzyme 143 WO 00/58517 PCT/US0O/08245 In another preferred embodiment, this invention provides that nucleic acid building blocks for exonuclease-mediated reassembly include nucleic acid strands that upon hybridizing to non-identical nucleic acid strands form heteromeric complexes. Within these complexes, a strand that is annealed to 5 more than one other strand is referred to as a poly-binding strand, and a strand that is annealed to only one other strand is referred to as a mono-binding strand. Accordingly, mono-binding strands are usually, but not always shorter in length than poly-binding strands. By way of non-liming exemplification, both mono binding strands and poly-binding strands can be generated from a template 10 progenitor molecule by either synthesis, fragmentation (physical or enzyme based), isolation (e.g. by selective treatment with Dpn I) &/or by denaturation. 144 WO 00/58517 PCT/USOO/08245 2.11.2.3. NON-STOCHASTIC LIGATION REASSEMBLY In one aspect, the present invention provides a non-stochastic method termed synthetic ligation reassembly (SLR), that is somewhat related to stochastic shuffling, 5 save that the nucleic acid building blocks are not shuffled or concatenated or chimerized randomly, but rather are assembled non-stochastically. A particularly glaring difference is that the instant SLR method does not depend on the presence of a high level of homology between polynucleotides to be 10 shuffled. In contrast, prior methods, particularly prior stochastic shuffling methods require that presence of a high level of homology, particularly at coupling sites, between polynucleotides to be shuffled. Accordingly these prior methods favor the regeneration of the original progenitor molecules, and are suboptimal for generating large numbers of novel progeny chimeras, particularly full-length progenies. The 15 instant invention, on the other hand, can be used to non-stochastically generate libraries (or sets) of progeny molecules comprised of over 10100 different chimeras. Conceivably, SLR can even be used to generate libraries comprised of over 101000 different progeny chimeras with (no upper limit in sight). 20 Thus, in one aspect, the present invention provides a method, which method is non-stochastic, of producing a set of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of the steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and 25 assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved. The mutually compatible ligatable ends of the nucleic acid building blocks to be assembled are considered to be "serviceable" for this type of ordered assembly if 30 they enable the building blocks to be coupled in predetermined orders. Thus, in one aspect, the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design of the ligatable ends and, if more than one 145 WO 00/58517 PCT/USOO/08245 assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order of the assembly step(s). Figure 4, Panel C illustrates an exemplary assembly process comprised of 2 sequential steps to achieve a designed (non-stochastic) overall 5 assembly order for five nucleic acid building blocks. In a preferred embodiment of this invention, the annealed building pieces are treated with an enzyme, such as a ligase (e.g. T4 DNA ligase), achieve covalent bonding of the building pieces. In a preferred embodiment, the design of nucleic acid building blocks is 10 obtained upon analysis of the sequences of a set of progenitor nucleic acid templates that serve as a basis for producing a progeny set of finalized chimeric nucleic acid molecules. These progenitor nucleic acid templates thus serve as a source of sequence information that aids in the design of the nucleic acid building blocks that are to be mutagenized, i.e. chimerized or shuffled. 15 In one exemplification, this invention provides for the chimerization of a family of related genes and their encoded family of related products. In a particular exemplification, the encoded products are enzymes. As a representative list of families of enzymes which may be mutagenized in accordance with the aspects of 20 the present invention, there may be mentioned, the following enzymes and their functions: 1 Lipase/Esterase a. Enantioselective hydrolysis of esters (lipids)/ thioesters 25 1) Resolution of racemic mixtures 2) Synthesis of optically active acids or alcohols from meso diesters b. Selective syntheses 1) Regiospecific hydrolysis of carbohydrate esters 30 2) Selective hydrolysis of cyclic secondary alcohols c. Synthesis of optically active esters, lactones, acids, alcohols 1) Transesterification of activated/nonactivated esters 146 WO 00/58517 PCT/US00/08245 2) Interesterification 3) Optically active lactones from hydroxyesters 4) Regio- and enantioselective ring opening of anhydrides d. Detergents 5 e. Fat/Oil conversion f. Cheese ripening 2 Protease a. Ester/amide synthesis 10 b. Peptide synthesis c. Resolution of racemic mixtures of amino acid esters d. Synthesis of non-natural amino acids e. Detergents/protein hydrolysis 15 3 Glycosidase/Glycosyl transferase a. Sugar/polymer synthesis b. Cleavage of glycosidic linkages to form mono, di-and oligosaccharides c. Synthesis of complex oligosaccharides 20 d. Glycoside synthesis using UDP-galactosyl transferase e. Transglycosylation of disaccharides, glycosyl fluorides, aryl galactosides f. Glycosyl transfer in oligosaccharide synthesis g. Diastereoselective cleavage of P-glucosylsulfoxides 25 h. Asymmetric glycosylations i. Food processing j. Paper processing 4 Phosphatase/Kinase 30 a. Synthesis/hydrolysis of phosphate esters 1) Regio-, enantioselective phosphorylation 2) Introduction of phosphate esters 147 WO 00/58517 PCT/USOO/08245 3) Synthesize phospholipid precursors 4) Controlled polynucleotide synthesis b. Activate biological molecule c. Selective phosphate bond formation without protecting groups 5 5 Mono/Dioxygenase a. Direct oxyfunctionalization of unactivated organic substrates b. Hydroxylation of alkane, aromatics, steroids c. Epoxidation of alkenes 10 d. Enantioselective sulphoxidation e. Regio- and stereoselective Bayer-Villiger oxidations 6 Haloperoxidase a. Oxidative addition of halide ion to nucleophilic sites 15 b. Addition of hypohalous acids to olefinic bonds c. Ring cleavage of cyclopropanes d. Activated aromatic substrates converted to ortho and para derivatives e. 1.3 diketones converted to 2-halo-derivatives f. Heteroatom oxidation of sulfur and nitrogen containing substrates 20 g. Oxidation of enol acetates, alkynes and activated aromatic rings 7 Lignin peroxidase/Diarylpropane peroxidase a. Oxidative cleavage of C-C bonds b. Oxidation of benzylic alcohols to aldehydes 25 c. Hydroxylation of benzylic carbons d. Phenol dimerization e. Hydroxylation of double bonds to form diols f. Cleavage of lignin aldehydes 30 8 Epoxide hydrolase a. Synthesis of enantiomerically pure bioactive compounds b. Regio- and enantioselective hydrolysis of epoxide 148 WO 00/58517 PCT/US0O/08245 c. Aromatic and olefinic epoxidation by monooxygenases to form epoxides d. Resolution of racemic epoxides e. Hydrolysis of steroid epoxides 5 9 Nitrile hydratase/nitrilase a. Hydrolysis of aliphatic nitriles to carboxamides b. Hydrolysis of aromatic, heterocyclic, unsaturated aliphatic nitriles to corresponding acids 10 c. Hydrolysis of acrylonitrile d. Production of aromatic and carboxamides, carboxylic acids (nicotinamide, picolinamide, isonicotinamide) e. Regioselective hydrolysis of acrylic dinitrile f. a-amino acids from a-hydroxynitriles 15 10 Transaminase a. Transfer of amino groups into oxo-acids 11 Amidase/Acylase 20 a. Hydrolysis of amides, amidines, and other C-N bonds b. Non-natural amino acid resolution and synthesis These exemplifications, while illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed 25 invention. Thus according to one aspect of this invention, the sequences of a plurality of progenitor nucleic acid templates are aligned in order to select one or more demarcation points, which demarcation points can be located at an area of 30 homology, and are comprised of one or more nucleotides, and which demarcation points are shared by at least two of the progenitor templates. The demarcation points can be used to delineate the boundaries of nucleic acid building blocks to be 149 WO 00/58517 PCTIUSOO/08245 generated. Thus, the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly of the progeny molecules. 5 Preferably a serviceable demarcation point is an area of homology (comprised of at least one homologous nucleotide base) shared by at least two progenitor templates. More preferably a serviceable demarcation point is an area of homology that is shared by at least half of the progenitor templates. More preferably still a serviceable demarcation point is an area of homology that is shared by at least 10 two thirds of the progenitor templates. Even more preferably a serviceable demarcation points is an area of homology that is shared by at least three fourths of the progenitor templates. Even more preferably still a serviceable demarcation points is an area of homology that is shared by at almost all of the progenitor templates. Even more preferably still a serviceable demarcation point is an area of 15 homology that is shared by all of the progenitor templates. The process of designing nucleic acid building blocks and of designing the mutually compatible ligatable ends of the nucleic acid building blocks to be assembled is illustrated in Figures 6 and 7. As shown, the alignment of a set of 20 progenitor templates reveals several naturally occurring demarcation points, and the identification of demarcation points shared by these templates helps to non stochastically determine the building blocks to be generated and used for the generation of the progeny chimeric molecules. 25 In a preferred embodiment, this invention provides that the ligation reassembly process is performed exhaustively in order to generate an exhaustive library. In other words, all possible ordered combinations of the nucleic acid building blocks are represented in the set of finalized chimeric nucleic acid molecules. At the same time, in a particularly preferred embodiment, the assembly 30 order (i.e. the order of assembly of each building block in the 5' to 3' sequence of each finalized chimeric nucleic acid) in each combination is by design (or non 150 WO 00/58517 PCT/USOO/08245 stochastic). Because of the non-stochastic nature of this invention, the possibility of unwanted side products is greatly reduced. In another preferred embodiment, this invention provides that the ligation 5 reassembly process is performed systematically, for example in order to generate a systematically compartmentalized library, with compartments that can be screened systematically, e.g. one by one. In other words this invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, an 10 experimental design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, it allows a potentially very large number of progeny molecules to be examined systematically in smaller groups. 15 Because of its ability to perform chimerizations in a manner that is highly flexible yet exhaustive and systematic as well, particularly when there is a low level of homology among the progenitor molecules, the instant invention provides for the generation of a library (or set) comprised of a large number of progeny molecules. Because of the non-stochastic nature of the instant ligation reassembly invention, the 20 progeny molecules generated preferably comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design. In a particularly preferred embodiment of this invention, such a generated library is comprised of preferably greater than 10 3 different progeny molecular species, more preferably greater than 105 different progeny molecular species, more preferably still 25 greater than 1010 different progeny molecular species, more preferably still greater than 10 5 different progeny molecular species, more preferably still greater than 1020 different progeny molecular species, more preferably still greater than 1030 different progeny molecular species, more preferably still greater than 1040 different progeny molecular species, more preferably still greater than 1050 different progeny 30 molecular species, more preferably still greater than 1060 different progeny molecular species, more preferably still greater than 1070 different progeny molecular species, more preferably still greater than 1080 different progeny 151 WO 00/58517 PCT/USOO/08245 molecular species, more preferably still greater than 10100 different progeny molecular species, more preferably still greater than 10110 different progeny molecular species, more preferably still greater than 10120 different progeny molecular species, more preferably still greater than 10130 different progeny 5 molecular species, more preferably still greater than 10140 different progeny molecular species, more preferably still greater than 10150 different progeny molecular species, more preferably still greater than 10175 different progeny molecular species, more preferably still greater than 10200 different progeny molecular species, more preferably still greater than 10300 different progeny 10 molecular species, more preferably still greater than 10400 different progeny molecular species, more preferably still greater than 10500 different progeny molecular species, and even more preferably still greater than 101000 different progeny molecular species. 15 In one aspect, a set of finalized chimeric nucleic acid molecules, produced as described is comprised of a polynucleotide encoding a polypeptide. According to one preferred embodiment, this polynucleotide is a gene, which may be a man-made gene. According to another preferred embodiment, this polynucleotide is a gene pathway, which may be a man-made gene pathway. This invention provides that 20 one or more man-made genes generated by this invention may be incorporated into a man-made gene pathway, such as a pathway operable in a eukaryotic organism (including a plant). It is appreciated that the power of this invention is exceptional, as there is 25 much freedom of choice and control regarding the selection of demarcation points, the size and number of the nucleic acid building blocks, and the size and design of the couplings. It is appreciated, furthermore, that the requirement for intermolecular homology is highly relaxed for the operability of this invention. In fact, demarcation points can even be chosen in areas of little or no intermolecular homology. For 30 example, because of codon wobble, i.e. the degeneracy of codons, nucleotide substitutions can be introduced into nucleic acid building blocks without altering the amino acid originally encoded in the corresponding progenitor template. 152 WO 00/58517 PCTUSOO/08245 Alternatively, a codon can be altered such that the coding for an original amino acid is altered. This invention provides that such substitutions can be introduced into the nucleic acid building block in order to increase the incidence of intermolecularly homologous demarcation points and thus to allow an increased number of couplings 5 to be achieved among the building blocks, which in turn allows a greater number of progeny chimeric molecules to be generated. In another exemplifaction, the synthetic nature of the step in which the building blocks are generated allows the design and introduction of nucleotides (e.g. 10 one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vitro process (e.g. by mutageneis) or in an in vivo process (e.g. by utilizing the gene splicing ability of a host organism). It is appreciated that in many instances the introduction of these nucleotides may also be desirable for many other reasons in addition to the potential 15 benefit of creating a serviceable demarcation point. Thus, according to another embodiment, this invention provides that a nucleic acid building block can be used to introduce an intron. Thus, this invention provides that functional introns may be introduced into a man-made gene of this 20 invention. This invention also provides that functional introns may be introduced into a man-made gene pathway of this invention. Accordingly, this invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced intron(s). 25 Accordingly, this invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced intron(s). Preferably, the artificially introduced intron(s) are functional in one or more host cells for gene splicing much in the way that naturally occurring introns serve functionally in gene splicing. This invention provides a 30 process of producing man-made intron-containing polynucleotides to be introduced into host organisms for recombination and/or splicing. 153 WO 00/58517 PCT/USOO/08245 The ability to achieve chimerizations, using couplings as described herein, in areas of little or no homology among the progenitor molecules, is particularly useful, and in fact critical, for the assembly of novel gene pathways. This invention thus provides for the generation of novel man-made gene pathways using synthetic 5 ligation reassembly. In a particular aspect, this is achieved by the introduction of regulatory sequences, such as promoters, that are operable in an intended host, to confer operability to a novel gene pathway when it is introduced into the intended host. In a particular exemplification, this invention provides for the generation of novel man-made gene pathways that is operable in a plurality of intended hosts (e.g. 10 in a microbial organism as well as in a plant cell). This can be achieved, for example, by the introduction of a plurality of regulatory sequences, comprised of a regulatory sequence that is operable in a first intended host and a regulatory sequence that is operable in a second intended host. A similar process can be performed to achieve operability of a gene pathway in a third intended host species, 15 etc. The number of intended host species can be each integer from 1 to 10 or alternatively over 10. Alternatively, for example, operability of a gene pathway in a plurality of intended hosts can be achieved by the introduction of a regulatory sequence having intrinsic operability in a plurality of intended hosts. 20 Thus, according to a particular embodiment, this invention provides that a nucleic acid building block can be used to introduce a regulatory sequence, particularly a regulatory sequence for gene expression. Preferred regulatory sequences include, but are not limited to, those that are man-made, and those found in archeal, bacterial, eukaryotic (including mitochondrial), viral, and prionic or 25 prion-like organisms. Preferred regulatory sequences include but are not limited to, promoters, operators, and activator binding sites. Thus, this invention provides that functional regulatory sequences may be introduced into a man-made gene of this invention. This invention also provides that functional regulatory sequences may be introduced into a man-made gene pathway of this invention. 30 Accordingly, this invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially 154 WO 00/58517 PCT/USOO/08245 introduced regulatory sequence(s). Accordingly, this invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced regulatory sequence(s). Preferably, an artificially introduced regulatory sequence(s) is operatively linked to one or more 5 genes in the man-made polynucleotide, and are functional in one or more host cells. Preferred bacterial promoters that are serviceable for this invention include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp. Serviceable eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs 10 from retrovirus, and mouse metallothionein-I. Particular plant regulatory sequences include promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or parts thereof. These promoters include, but are not limited to promoters showing constitutive expression, such as the 35S promoter of Cauliflower Mosaic Virus (CaMV) (Guilley et al., 15 1982), those for leaf-specific expression, such as the promoter of the ribulose bisphosphate carboxylase small subunit gene (Coruzzi et al., 1984), those for root specific expression, such as the promoter from the glutamin synthase gene (Tingey et al., 1987), those for seed-specific expression, such as the cruciferin A promoter from Brassica napus (Ryan et al., 1989), those for tuber-specific expression, such as 20 the class-I patatin promoter from potato (Rocha-Sasa et al., 1989; Wenzler et al., 1989) or those for fruit-specific expression, such as the polygalacturonase (PG) promoter from tomato (Bird et al., 1988). Other regulatory sequences that are preferred for this invention include 25 terminator sequences and polyadenylation signals and any such sequence functioning as such in plants, the choice of which is within the level of the skilled artisan. An example of such sequences is the 3' flanking region of the nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan, 1984). The regulatory sequences may also include enhancer sequences, such as found in the 35S promoter 30 of CaMV, and mRNA stabilizing sequences such as the leader sequence of Alfalfa Mosaic Cirus (AlMV) RNA4 (Brederode et al., 1980) or any other sequences functioning in a like manner. 155 WO 00/58517 PCT/USOO/08245 Man-made genes produced using this invention can also serve as a substrate for recombination with another nucleic acid. Likewise, a man-made gene pathway produced using this invention can also serve as a substrate for recombination with 5 another nucleic acid. In a preferred instance, the recombination is facilitated by, or occurs at, areas of homology between the man-made intron-containing gene and a nucleic acid with serves as a recombination partner. In a particularly preferred instance, the recombination partner may also be a nucleic acid generated by this invention, including a man-made gene or a man-made gene pathway. 10 Recombination may be facilitated by or may occur at areas of homology that exist at the one (or more) artificially introduced intron(s) in the man-made gene. The synthetic ligation reassembly method of this invention utilizes a plurality of nucleic acid building blocks, each of which preferably has two ligatable ends. 15 The two ligatable ends on each nucleic acid building block may be two blunt ends (i.e. each having an overhang of zero nucleotides), or preferably one blunt end and one overhang, or more preferably still two overhangs. A serviceable overhang for this purpose may be a 3' overhang or a 5' 20 overhang. Thus, a nucleic acid building block may have a 3' overhang or alternatively a 5' overhang or alternatively two 3' overhangs or alternatively two 5' overhangs. The overall order in which the nucleic acid building blocks are assembled to form a finalized chimeric nucleic acid molecule is determined by purposeful experimental design and is not random. 25 According to one preferred embodiment, a nucleic acid building block is generated by chemical synthesis of two single-stranded nucleic acids (also referred to as single-stranded oligos) and contacting them so as to allow them to anneal to form a double-stranded nucleic acid building block. 30 A double-stranded nucleic acid building block can be of variable size. The sizes of these building blocks can be small or large depending on the choice of the 156 WO 00/58517 PCT/USOO/08245 experimenter. Preferred sizes for building block range from 1 base pair (not including any overhangs) to 100,000 base pairs (not including any overhangs). Other preferred size ranges are also provided, which have lower limits of from 1 bp to 10,000 bp (including every integer value in between), and upper limits of from 2 5 bp to 100, 000 bp (including every integer value in between). It is appreciated that current methods of polymerase-based amplification can be used to generate double-stranded nucleic acids of up to thousands of base pairs, if not tens of thousands of base pairs, in length with high fidelity. Chemical synthesis 10 (e.g. phosphoramidite-based) can be used to generate nucleic acids of up to hundreds of nucleotides in length with high fidelity; however, these can be assembled, e.g. using overhangs or sticky ends, to form double-stranded nucleic acids of up to thousands of base pairs, if not tens of thousands of base pairs, in length if so desired. 15 A combination of methods (e.g. phosphoramidite-based chemical synthesis and PCR) can also be used according to this invention. Thus, nucleic acid building block made by different methods can also be used in combination to generate a progeny molecule of this invention. 20 The use of chemical synthesis to generate nucleic acid building blocks is particularly preferred in this invention & is advantageous for other reasons as well, including procedural safety and ease. No cloning or harvesting or actual handling of any biological samples is required. The design of the nucleic acid building blocks can be accomplished on paper. Accordingly, this invention teaches an advance in 25 procedural safety in recombinant technologies. Nonetheless, according to one preferred embodiment, a double-stranded nucleic acid building block according to this invention may also be generated by polymerase-based amplification of a polynucleotide template. In a non-limiting 30 exemplification, as illustrated in Figure 2, a first polymerase-based amplification reaction using a first set of primers, F 2 and R 1 , is used to generate a blunt-ended product (labeled Reaction 1, Product 1), which is essentially identical to Product A. 157 WO 00/58517 PCT/USOO/08245 A second polymerase-based amplification reaction using a second set of primers, F 1 and R 2 , is used to generate a blunt-ended product (labeled Reaction 2, Product 2), which is essentially identical to Product B. These two products are mixed and allowed to melt and anneal, generating potentially useful double-stranded nucleic 5 acid building blocks with two overhangs. In the example of Fig. 2, the product with the 3' overhangs (Product C) is selected by nuclease-based degradation of the other 3 products using a 3' acting exonuclease, such as exonuclease III. It is appreciated that a 5' acting exonuclease (e.g. red alpha) may be also be used, for example to select Product D instead. It is also appreciated that other selection means can also 10 be used, including hybridization-based means, and that these means can incorporate a further means, such as a magnetic bead-based means, to facilitate separation of the desired product. Many other methods exist by which a double-stranded nucleic acid building 15 block can be generated that is serviceable for this invention; and these are known in the art and can be readily performed by the skilled artisan. According to particularly preferred embodiment, a double-stranded nucleic acid building block that is serviceable for this invention is generated by first 20 generating two single stranded nucleic acids and allowing them to anneal to form a double-stranded nucleic acid building block. The two strands of a double-stranded nucleic acid building block may be complementary at every nucleotide apart from any that form an overhang; thus containing no mismatches, apart from any overhang(s). According to another embodiment, the two strands of a double 25 stranded nucleic acid building block are complementary at fewer than every nucleotide apart from any that form an overhang. Thus, according to this embodiment, a double-stranded nucleic acid building block can be used to introduce codon degeneracy. Preferably the codon degeneracy is introduced using the site saturation mutagenesis described herein, using one or more N,N,G/T cassettes or 30 alternatively using one or more N,N,N cassettes. 158 WO 00/58517 PCT/USOO/08245 Contained within an exemplary experimental design for achieving an ordered assembly according to this invention are: 1) The design of specific nucleic acid building blocks. 5 2) The design of specific ligatable ends on each nucleic acid building block. 3) The design of a particular order of assembly of the nucleic acid building blocks. An overhang may be a 3' overhang or a 5' overhang. An overhang may also 10 have a terminal phosphate group or alternatively may be devoid of a terminal phosphate group (having, e.g., a hydroxyl group instead). An overhang may be comprised of any number of nucleotides. Preferably an overhang is comprised of 0 nucleotides (as in a blunt end) to 10,000 nucleotides. Thus, a wide range of overhang sizes may be serviceable. Accordingly, the lower limit may be each 15 integer from 1-200 and the upper limit may be each integer from 2-10,000. According to a particular exemplification, an overhang may consist of anywhere from 1 nucleotide to 200 nucleotides (including every integer value in between). The final chimeric nucleic acid molecule may be generated by sequentially 20 assembling 2 or more building blocks at a time until all the designated building blocks have been assembled. A working sample may optionally be subjected to a process for size selection or purification or other selection or enrichment process between the performance of two assembly steps. Alternatively, the final chimeric nucleic acid molecule may be generated by assembling all the designated building 25 blocks at once in one step. In vitro-Shuffling The equivalents of some standard genetic matings may also be performed by shuffling in vitro. For example, a "molecular backcross" can be performed by 30 repeatedly mixing the hybrid's nucleic acid with the wild-type nucleic acid while selecting for the mutations of interest. As in traditional breeding, this approach can be used to combine phenotypes from different sources into a background of choice. 159 WO 00/58517 PCT/USOO/08245 It is useful, for example, for the removal of neutral mutations that affect unselected characteristics (i.e. immunogenicity). Thus it can be useful to determine which mutations in a protein are involved in the enhanced biological activity and which are not, an advantage which cannot be achieved by error-prone mutagenesis or cassette 5 mutagenesis methods. Large, functional genes can be assembled correctly from a mixture of small random polynucleotides. This reaction may be of use for the reassembly of genes from the highly fragmented DNA of fossils. In addition random nucleic acid 10 fragments from fossils may be combined with polynucleotides from similar genes from related species. It is also contemplated that the method of this invention can be used for the in vitro amplification of a whole genome from a single cell as is needed for a variety 15 of research and diagnostic applications. DNA amplification by PCR is in practice limited to a length of about 40 kb. Amplification of a whole genome such as that of E. coli (5, 000 kb) by PCR would require about 250 primers yielding 125 forty kb polynucleotides. This approach is not practical due to the unavailability of sufficient sequence data. On the other hand, random production of polynucleotides of the 20 genome with sexual PCR cycles, followed by gel purification of small polynucleotides will provide a multitude of possible primers. Use of this mix of random small polynucleotides as primers in a PCR reaction alone or with the whole genome as the template should result in an inverse chain reaction with the theoretical endpoint of a single concatemer containing many copies of the genome. 25 100 fold amplification in the copy number and an average polynucleotide size of greater than 50 kb may be obtained when only random polynucleotides are used. It is thought that the larger concatemer is generated by overlap of many smaller polynucleotides. The quality of specific PCR products obtained using 30 synthetic primers will be indistinguishable from the product obtained from unamplified DNA. It is expected that this approach will be useful for the mapping of genomes. 160 WO 00/58517 PCT/USOO/08245 The polynucleotide to be shuffled can be produced as random or non-random polynucleotides, at the discretion of the practitioner. 5 In vivo Shuffling In an embodiment of in vivo shuffling, the mixed population of the specific nucleic acid sequence is introduced into bacterial or eukaryotic cells under conditions such that at least two different nucleic acid sequences are present in each 10 host cell. The polynucleotides can be introduced into the host cells by a variety of different methods. The host cells can be transformed with the smaller polynucleotides using methods known in the art, for example treatment with calcium chloride. If the polynucleotides are inserted into a phage genome, the host cell can be transfected with the recombinant phage genome having the specific nucleic acid 15 sequences. Alternatively, the nucleic acid sequences can be introduced into the host cell using electroporation, transfection, lipofection, biolistics, conjugation, and the like. In general, in this embodiment, the specific nucleic acids sequences will be 20 present in vectors which are capable of stably replicating the sequence in the host cell. In addition, it is contemplated that the vectors will encode a marker gene such that host cells having the vector can be selected. This ensures that the mutated specific nucleic acid sequence can be recovered after introduction into the host cell. However, it is contemplated that the entire mixed population of the specific nucleic 25 acid sequences need not be present on a vector sequence. Rather only a sufficient number of sequences need be cloned into vectors to ensure that after introduction of the polynucleotides into the host cells each host cell contains one vector having at least one specific nucleic acid sequence present therein. It is also contemplated that rather than having a subset of the population of the specific nucleic acids sequences 30 cloned into vectors, this subset may be already stably integrated into the host cell. 161 WO 00/58517 PCT/USOO/08245 It has been found that when two polynucleotides which have regions of identity are inserted into the host cells homologous recombination occurs between the two polynucleotides. Such recombination between the two mutated specific nucleic acid sequences will result in the production of double or triple hybrids in 5 some situations. It has also been found that the frequency of recombination is increased if some of the mutated specific nucleic acid sequences are present on linear nucleic acid molecules. Therefore, in a preferred embodiment, some of the specific nucleic 10 acid sequences are present on linear polynucleotides. After transformation, the host cell transformants are placed under selection to identify those host cell transformants which contain mutated specific nucleic acid sequences having the qualities desired. For example, if increased resistance to a 15 particular drug is desired then the transformed host cells may be subjected to increased concentrations of the particular drug and those transformants producing mutated proteins able to confer increased drug resistance will be selected. If the enhanced ability of a particular protein to bind to a receptor is desired, then expression of the protein can be induced from the transformants and the resulting 20 protein assayed in a ligand binding assay by methods known in the art to identify that subset of the mutated population which shows enhanced binding to the ligand. Alternatively, the protein can be expressed in another system to ensure proper processing. 25 Once a subset of the first recombined specific nucleic acid sequences (daughter sequences) having the desired characteristics are identified, they are then subject to a second round of recombination. In the second cycle of recombination, the recombined specific nucleic acid 30 sequences may be mixed with the original mutated specific nucleic acid sequences (parent sequences) and the cycle repeated as described above. In this way a set of second recombined specific nucleic acids sequences can be identified which have 162 WO 00/58517 PCT/USOO/08245 enhanced characteristics or encode for proteins having enhanced properties. This cycle can be repeated a number of times as desired. It is also contemplated that in the second or subsequent recombination cycle, 5 a backcross can be performed. A molecular backcross can be performed by mixing the desired specific nucleic acid sequences with a large number of the wild-type sequence, such that at least one wild-type nucleic acid sequence and a mutated nucleic acid sequence are present in the same host cell after transformation. Recombination with the wild-type specific nucleic acid sequence will eliminate 10 those neutral mutations that may affect unselected characteristics such as immunogenicity but not the selected characteristics. In another embodiment of this invention, it is contemplated that during the first round a subset of the specific nucleic acid sequences can be generated as 15 smaller polynucleotides by slowing or halting their PCR amplification prior to introduction into the host cell. The size of the polynucleotides must be large enough to contain some regions of identity with the other sequences so as to homologously recombine with the other sequences. The size of the polynucleotides will range from 0.03 kb to 100 kb more preferably from 0. 2 kb to 10 kb. It is also 20 contemplated that in subsequent rounds, all of the specific nucleic acid sequences other than the sequences selected from the previous round may be utilized to generate PCR polynucleotides prior to introduction into the host cells. The shorter polynucleotide sequences can be single-stranded or 25 double-stranded. If the sequences were originally single-stranded and have become double-stranded they can be denatured with heat, chemicals or enzymes prior to insertion into the host cell. The reaction conditions suitable for separating the strands of nucleic acid are well known in the art. 30 The steps of this process can be repeated indefinitely, being limited only by the number of possible hybrids which can be achieved. After a certain number of 163 WO 00/58517 PCT/USOO/08245 cycles, all possible hybrids will have been achieved and further cycles are redundant. In an embodiment the same mutated template nucleic acid is repeatedly recombined and the resulting recombinants selected for the desired characteristic. 5 Therefore, the initial pool or population of mutated template nucleic acid is cloned into a vector capable of replicating in a bacteria such as E. coli. The particular vector is not essential, so long as it is capable of autonomous replication in E. coli. In a preferred embodiment, the vector is designed to allow the expression 10 and production of any protein encoded by the mutated specific nucleic acid linked to the vector. It is also preferred that the vector contain a gene encoding for a selectable marker. The population of vectors containing the pool of mutated nucleic acid 15 sequences is introduced into the E. coli host cells. The vector nucleic acid sequences may be introduced by transformation, transfection or infection in the case of phage. The concentration of vectors used to transform the bacteria is such that a number of vectors is introduced into each cell. Once present in the cell, the efficiency of homologous recombination is such that homologous recombination 20 occurs between the various vectors. This results in the generation of hybrids (daughters) having a combination of mutations which differ from the original parent mutated sequences. The host cells are then clonally replicated and selected for the marker gene 25 present on the vector. Only those cells having a plasmid will grow under the selection. The host cells which contain a vector are then tested for the presence of favorable mutations. Such testing may consist of placing the cells under selective 30 pressure, for example, if the gene to be selected is an improved drug resistance gene. If the vector allows expression of the protein encoded by the mutated nucleic acid sequence, then such selection may include allowing expression of the protein so 164 WO 00/58517 PCT/US00/08245 encoded, isolation of the protein and testing of the protein to determine whether, for example, it binds with increased efficiency to the ligand of interest. Once a particular daughter mutated nucleic acid sequence has been identified 5 which confers the desired characteristics, the nucleic acid is isolated either already linked to the vector or separated from the vector. This nucleic acid is then mixed with the first or parent population of nucleic acids and the cycle is repeated. It has been shown that by this method nucleic acid sequences having 10 enhanced desired properties can be selected. In an alternate embodiment, the first generation of hybrids are retained in the cells and the parental mutated sequences are added again to the cells. Accordingly, the first cycle of Embodiment I is conducted as described above. However, after the daughter nucleic acid sequences are identified, the host cells containing these 15 sequences are retained. The parent mutated specific nucleic acid population, either as polynucleotides or cloned into the same vector is introduced into the host cells already containing the daughter nucleic acids. Recombination is allowed to occur in 20 the cells and the next generation of recombinants, or granddaughters are selected by the methods described above. This cycle can be repeated a number of times until the nucleic acid or peptide having the desired characteristics is obtained. It is contemplated that in subsequent 25 cycles, the population of mutated sequences which are added to the preferred hybrids may come from the parental hybrids or any subsequent generation. In an alternative embodiment, the invention provides a method of conducting a "molecular" backcross of the obtained recombinant specific nucleic acid in order 30 to eliminate any neutral mutations. Neutral mutations are those mutations which do not confer onto the nucleic acid or peptide the desired properties. Such mutations may however confer on the nucleic acid or peptide undesirable characteristics. 165 WO 00/58517 PCT/USOO/08245 Accordingly, it is desirable to eliminate such neutral mutations. The method of this invention provide a means of doing so. In this embodiment, after the hybrid nucleic acid, having the desired 5 characteristics, is obtained by the methods of the embodiments, the nucleic acid, the vector having the nucleic acid or the host cell containing the vector and nucleic acid is isolated. The nucleic acid or vector is then introduced into the host cell with a large 10 excess of the wild-type nucleic acid. The nucleic acid of the hybrid and the nucleic acid of the wild-type sequence are allowed to recombine. The resulting recombinants are placed under the same selection as the hybrid nucleic acid. Only those recombinants which retained the desired characteristics will be selected. Any silent mutations which do not provide the desired characteristics will be lost through 15 recombination with the wild-type DNA. This cycle can be repeated a number of times until all of the silent mutations are eliminated. Thus the methods of this invention can be used in a molecular backcross to eliminate unnecessary or silent mutations. 20 Utility The in vivo recombination method of this invention can be performed blindly on a pool of unknown hybrids or alleles of a specific polynucleotide or sequence. However, it is not necessary to know the actual DNA or RNA sequence of the specific polynucleotide. 25 The approach of using recombination within a mixed population of genes can be useful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA and growth hormone. This approach may be used to generate proteins having altered specificity or activity. The approach may also be useful for 30 the generation of hybrid nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequences, 3 1 untranslated regions or 51 untranslated regions of genes. Thus this approach may be used to generate genes having 16 6 WO 00/58517 PCT/USOO/08245 increased rates of expression. This approach may also be useful in the study of repetitive DNA sequences. Finally, this approach may be useful to mutate ribozymes or aptamers. 5 Scaffold-like regions separating regions of diversity in proteins may be particularly suitable for the methods of this invention. The conserved scaffold determines the overall folding by self-association, while displaying relatively unrestricted loops that mediate the specific binding. Examples of such scaffolds are the immunoglobulin beta barrel, and the four-helix bundle. The methods of this 10 invention can be used to create scaffold-like proteins with various combinations of mutated sequences for binding. The equivalents of some standard genetic matings may also be performed by the methods of this invention. For example, a "molecular" backcross can be 15 performed by repeated mixing of the hybrid's nucleic acid with the wild-type nucleic acid while selecting for the mutations of interest. As in traditional breeding, this approach can be used to combine phenotypes from different sources into a background of choice. It is useful, for example, for the removal of neutral mutations that affect unselected characteristics (i.e. immunogenicity). Thus it can be useful to 20 determine which mutations in a protein are involved in the enhanced biological activity and which are not. Peptide Display Methods 25 The present method can be used to shuffle, by in vitro and/or in vivo recombination by any of the disclosed methods, and in any combination, polynucleotide sequences selected by peptide display methods, wherein an associated polynucleotide encodes a displayed peptide which is screened for a phenotype (e.g., for affinity for a predetermined receptor (ligand). 30 An increasingly important aspect of bio-pharmaceutical drug development and molecular biology is the identification of peptide structures, including the 167 WO 00/58517 PCT/USOO/08245 primary amino acid sequences, of peptides or peptidomimetics that interact with biological macromolecules. one method of identifying peptides that possess a desired structure or functional property, such as binding to a predetermined biological macromolecule (e.g., a receptor), involves the screening of a large library 5 or peptides for individual library members which possess the desired structure or functional property conferred by the amino acid sequence of the peptide. In addition to direct chemical synthesis methods for generating peptide libraries, several recombinant DNA methods also have been reported. One type 10 involves the display of a peptide sequence, antibody, or other protein on the surface of a bacteriophage particle or cell. Generally, in these methods each bacteriophage particle or cell serves as an individual library member displaying a single species of displayed peptide in addition to the natural bacteriophage or cell protein sequences. Each bacteriophage or cell contains the nucleotide sequence information encoding 15 the particular displayed peptide sequence; thus, the displayed peptide sequence can be ascertained by nucleotide sequence determination of an isolated library member. A well-known peptide display method involves the presentation of a peptide sequence on the surface of a filamentous bacteriophage, typically as a fusion with a 20 bacteriophage coat protein. The bacteriophage library can be incubated with an immobilized, predetermined macromolecule or small molecule (e.g., a receptor) so that bacteriophage particles which present a peptide sequence that binds to the immobilized macromolecule can be differentially partitioned from those that do not present peptide sequences that bind to the predetermined macromolecule. The 25 bacteriophage particles (i.e., library members) which are bound to the immobilized macromolecule are then recovered and replicated to amplify the selected bacteriophage sub-population for a subsequent round of affinity enrichment and phage replication. After several rounds of affinity enrichment and phage replication, the bacteriophage library members that are thus selected are isolated and the 30 nucleotide sequence encoding the displayed peptide sequence is determined, thereby identifying the sequence(s) of peptides that bind to the predetermined 168 WO 00/58517 PCTIUSOO/08245 macromolecule (e.g., receptor). Such methods are further described in PCT patent publications WO 91/17271, WO 91/18980, WO 91/19818 and WO 93/08278. The latter PCT publication describes a recombinant DNA method for the 5 display of peptide ligands that involves the production of a library of fusion proteins with each fusion protein composed of a first polypeptide portion, typically comprising a variable sequence, that is available for potential binding to a predetermined macromolecule, and a second polypeptide portion that binds to DNA, such as the DNA vector encoding the individual fusion protein. When transformed 10 host cells are cultured under conditions that allow for expression of the fusion protein, the fusion protein binds to the DNA vector encoding it. Upon lysis of the host cell, the fusion protein/vector DNA complexes can be screened against a predetermined macromolecule in much the same way as bacteriophage particles are screened in the phage-based display system, with the replication and sequencing of 15 the DNA vectors in the selected fusion protein/vector DNA complexes serving as the basis for identification of the selected library peptide sequence(s). Other systems for generating libraries of peptides and like polymers have aspects of both the recombinant and in vitro chemical synthesis methods. In these 20 hybrid methods, cell-free enzymatic machinery is employed to accomplish the in vitro synthesis of the library members (i.e., peptides or polynucleotides). In one type of method, RNA molecules with the ability to bind a predetermined protein or a predetermined dye molecule were selected by alternate rounds of selection and PCR amplification (Tuerk and Gold, 1990; Ellington and Szostak, 1990). A similar 25 technique was used to identify DNA sequences which bind a predetermined human transcription factor (Thiesen and Bach, 1990; Beaudry and Joyce, 1992; PCT patent publications WO 92/05258 and WO 92/14843). In a similar fashion, the technique of in vitro translation has been used to synthesize proteins of interest and has been proposed as a method for generating large libraries of peptides. These 30 methods which rely upon in vitro translation, generally comprising stabilized polysome complexes, are described further in PCT patent publications WO 88/08453, WO 90/05785, WO 90/07003, WO 91/02076, WO 91/05058, and WO 169 WO 00/58517 PCT/USOO/08245 92/02536. Applicants have described methods in which library members comprise a fusion protein having a first polypeptide portion with DNA binding activity and a second polypeptide portion having the library member unique peptide sequence; such methods are suitable for use in cell-free in vitro selection formats, among 5 others. The displayed peptide sequences can be of varying lengths, typically from 3-5000 amino acids long or longer, frequently from 5-100 amino acids long, and often from about 8-15 amino acids long. A library can comprise library members 10 having varying lengths of displayed peptide sequence, or may comprise library members having a fixed length of displayed peptide sequence. Portions or all of the displayed peptide sequence(s) can be random, pseudorandom, defined set kernal, fixed, or the like. The present display methods include methods for in vitro and in vivo display of single-chain antibodies, such as nascent scFv on polysomes or scfv 15 displayed on phage, which enable large-scale screening of scfv libraries having broad diversity of variable region sequences and binding specificities. The present invention also provides random, pseudorandom, and defined sequence framework peptide libraries and methods for generating and screening 20 those libraries to identify useful compounds (e.g., peptides, including single-chain antibodies) that bind to receptor molecules or epitopes of interest or gene products that modify peptides or RNA in a desired fashion. The random, pseudorandom, and defined sequence framework peptides are produced from libraries of peptide library members that comprise displayed peptides or displayed single-chain antibodies 25 attached to a polynucleotide template from which the displayed peptide was synthesized. The mode of attachment may vary according to the specific embodiment of the invention selected, and can include encapsulation in a phage particle or incorporation in a cell. 30 A method of affinity enrichment allows a very large library of peptides and single-chain antibodies to be screened and the polynucleotide sequence encoding the desired peptide(s) or single-chain antibodies to be selected. The polynucleotide can 170 WO 00/58517 PCT/USOO/08245 then be isolated and shuffled to recombine combinatorially the amino acid sequence of the selected peptide(s) (or predetermined portions thereof) or single-chain antibodies (or just VHI, VLI or CDR portions thereof). Using these methods, one can identify a peptide or single-chain antibody as having a desired binding affinity 5 for a molecule and can exploit the process of shuffling to converge rapidly to a desired high-affinity peptide or scfv. The peptide or antibody can then be synthesized in bulk by conventional means for any suitable use (e.g., as a therapeutic or diagnostic agent). 10 A significant advantage of the present invention is that no prior information regarding an expected ligand structure is required to isolate peptide ligands or antibodies of interest. The peptide identified can have biological activity, which is meant to include at least specific binding affinity for a selected receptor molecule and, in some instances, will further include the ability to block the binding of other 15 compounds, to stimulate or inhibit metabolic pathways, to act as a signal or messenger, to stimulate or inhibit cellular activity, and the like. The present invention also provides a method for shuffling a pool of polynucleotide sequences selected by affinity screening a library of polysomes 20 displaying nascent peptides (including single-chain antibodies) for library members which bind to a predetermined receptor (e.g., a mammalian proteinaceous receptor such as, for example, a peptidergic hormone receptor, a cell surface receptor, an intracellular protein which binds to other protein(s) to form intracellular protein complexes such as hetero-dimers and the like) or epitope (e.g., an immobilized 25 protein, glycoprotein, oligosaccharide, and the like). Polynucleotide sequences selected in a first selection round (typically by affinity selection for binding to a receptor (e.g., a ligand)) by any of these methods are pooled and the pool(s) is/are shuffled by in vitro and/or in vivo recombination to 30 produce a shuffled pool comprising a population of recombined selected polynucleotide sequences. The recombined selected polynucleotide sequences are subjected to at least one subsequent selection round. The polynucleotide sequences 171 WO 00/58517 PCT/USOO/08245 selected in the subsequent selection round(s) can be used directly, sequenced, and/or subjected to one or more additional rounds of shuffling and subsequent selection. Selected sequences can also be back-crossed with polynucleotide sequences encoding neutral sequences (i.e., having insubstantial functional effect on binding), 5 such as for example by back-crossing with a wild-type or naturally-occurring sequence substantially identical to a selected sequence to produce native-like functional peptides, which may be less immunogenic. Generally, during back crossing subsequent selection is applied to retain the property of binding to the predetermined receptor (ligand). 10 Prior to or concomitant with the shuffling of selected sequences, the sequences can be mutagenized. In one embodiment, selected library members are cloned in a prokaryotic vector (e.g., plasmid, phagemid, or bacteriophage) wherein a collection of individual colonies (or plaques) representing discrete library members 15 are produced. Individual selected library members can then be manipulated (e.g., by site-directed mutagenesis, cassette mutagenesis, chemical mutagenesis, PCR mutagenesis, and the like) to generate a collection of library members representing a kernal of sequence diversity based on the sequence of the selected library member. The sequence of an individual selected library member or pool can be manipulated 20 to incorporate random mutation, pseudorandom mutation, defined kernal mutation (i.e., comprising variant and invariant residue positions and/or comprising variant residue positions which can comprise a residue selected from a defined subset of amino acid residues), codon-based mutation, and the like, either segmentally or over the entire length of the individual selected library member sequence. The 25 mutagenized selected library members are then shuffled by in vitro and/or in vivo recombinatorial shuffling as disclosed herein. The invention also provides peptide libraries comprising a plurality of individual library members of the invention, wherein (1) each individual library 30 member of said plurality comprises a sequence produced by shuffling of a pool of selected sequences, and (2) each individual library member comprises a variable peptide segment sequence or single-chain antibody segment sequence which is 172 WO 00/58517 PCT/USOO/08245 distinct from the variable peptide segment sequences or single-chain antibody sequences of other individual library members in said plurality (although some library members may be present in more than one copy per library due to uneven amplification, stochastic probability, or the like). 5 The invention also provides a product-by-process, wherein selected polynucleotide sequences having (or encoding a peptide having) a predetermined binding specificity are formed by the process of: (1) screening a displayed peptide or displayed single-chain antibody library against a predetermined receptor (e.g., 10 ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching library members which bind to the predetermined receptor or epitope to produce a pool of selected library members, (2) shuffling by recombination the selected library members (or amplified or cloned copies thereof) which binds the predetermined epitope and has been thereby isolated and/or enriched from the library to generate a 15 shuffled library, and (3) screening the shuffled library against the predetermined receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching shuffled library members which bind to the predetermined receptor or epitope to produce a pool of selected shuffled library members. 20 Antibody Display and Screening Methods The present method can be used to shuffle, by in vitro and/or in vivo recombination by any of the disclosed methods, and in any combination, polynucleotide sequences selected by antibody display methods, wherein an 25 associated polynucleotide encodes a displayed antibody which is screened for a phenotype (e.g., for affinity for binding a predetermined antigen (ligand). Various molecular genetic approaches have been devised to capture the vast immunological repertoire represented by the extremely large number of distinct 30 variable regions which can be present in immunoglobulin chains. The naturally-occurring germ line immunoglobulin heavy chain locus is composed of separate tandem arrays of variable segment genes located upstream of a tandem 173 WO 00/58517 PCTIUSOO/08245 array of diversity segment genes, which are themselves located upstream of a tandem array of joining (i) region genes, which are located upstream of the constant region genes. During B lymphocyte development, V-D-J rearrangement occurs wherein a heavy chain variable region gene (VH) is formed by rearrangement to 5 form a fused D segment followed by rearrangement with a V segment to form a V-D-J joined product gene which, if productively rearranged, encodes a functional variable region (VH) of a heavy chain. Similarly, light chain loci rearrange one of several V segments with one of several J segments to form a gene encoding the variable region (VL) of a light chain. 10 The vast repertoire of variable regions possible in immunoglobulins derives in part from the numerous combinatorial possibilities of joining V and i segments (and, in the case of heavy chain loci, D segments) during rearrangement in B cell development. Additional sequence diversity in the heavy chain variable regions 15 arises from non-uniform rearrangements of the D segments during V-D-J joining and from N region addition. Further, antigen-selection of specific B cell clones selects for higher affinity variants having non-germline mutations in one or both of the heavy and light chain variable regions; a phenomenon referred to as "affinity maturation" or "affinity sharpening". Typically, these "affinity sharpening" 20 mutations cluster in specific areas of the variable region, most commonly in the complementarity-determining regions (CDRs). In order to overcome many of the limitations in producing and identifying high-affinity immunoglobulins through antigen-stimulated B cell development (i.e., 25 immunization), various prokaryotic expression systems have been developed that can be manipulated to produce combinatorial antibody libraries which may be screened for high-affinity antibodies to specific antigens. Recent advances in the expression of antibodies in Escherichia coli and bacteriophage systems (see "alternative peptide display methods". infra) have raised the possibility that virtually 30 any specificity can be obtained by either cloning antibody genes from characterized hybridomas or by de novo selection using antibody gene libraries (e.g., from Ig cDNA). 174 WO 00/58517 PCT/USOO/08245 Combinatorial libraries of antibodies have been generated in bacteriophage lambda expression systems which may be screened as bacteriophage plaques or as colonies of lysogens (Huse et al, 1989); Caton and Koprowski, 1990; Mullinax et 5 al, 1990; Persson et al, 1991). Various embodiments of bacteriophage antibody display libraries and lambda phage expression libraries have been described (Kang et al, 1991; Clackson et al, 1991; McCafferty et al, 1990; Burton et al, 1991; Hoogenboom et al, 1991; Chang et al, 1991; Breitling et al, 1991; Marks et al, 1991, p. 581; Barbas et al, 1992; Hawkins and Winter, 1992; Marks et al, 1992, p. 10 779; Marks et al, 1992, p. 16007; and Lowman et al, 1991; Lerner et al, 1992; all incorporated herein by reference). Typically, a bacteriophage antibody display library is screened with a receptor (e.g., polypeptide, carbohydrate, glycoprotein, nucleic acid) that is immobilized (e.g., by covalent linkage to a chromatography resin to enrich for reactive phage by affinity chromatography) and/or labeled (e.g., to 15 screen plaque or colony lifts). One particularly advantageous approach has been the use of so-called single-chain fragment variable (scfv) libraries (Marks et al, 1992, p. 779; Winter and Milstein, 1991; Clackson et al, 1991; Marks et al, 1991, p. 581; Chaudhary et 20 al, 1990; Chiswell et al, 1992; McCafferty et al, 1990; and Huston et al, 1988). Various embodiments of scfv libraries displayed on bacteriophage coat proteins have been described. Beginning in 1988, single-chain analogues of Fv fragments and their fusion 25 proteins have been reliably generated by antibody engineering methods. The first step generally involves obtaining the genes encoding VH and VL domains with desired binding properties; these V genes may be isolated from a specific hybridoma cell line, selected from a combinatorial V-gene library, or made by V gene synthesis. The single-chain Fv is formed by connecting the component V genes with an 30 oligonucleotide that encodes an appropriately designed linker peptide, such as (Gly-Gly-Gly-Gly-Ser)3 or equivalent linker peptide(s). The linker bridges the C-terminus of the first V region and N-terminus of the second, ordered as either 175 WO 00/58517 PCT/USOO/08245 VH-linker-VL or VL-linker-VH' In principle, the scfv binding site can faithfully replicate both the affinity and specificity of its parent antibody combining site. Thus, scfv fragments are comprised of VH and VL domains linked into a 5 single polypeptide chain by a flexible linker peptide. After the scfv genes are assembled, they are cloned into a phagemid and expressed at the tip of the M13 phage (or similar filamentous bacteriophage) as fusion proteins with the bacteriophage PIII (gene 3) coat protein. Enriching for phage expressing an antibody of interest is accomplished by panning the recombinant phage displaying a 10 population scfv for binding to a predetermined epitope (e.g., target antigen, receptor). The linked polynucleotide of a library member provides the basis for replication of the library member after a screening or selection procedure, and also 15 provides the basis for the determination, by nucleotide sequencing, of the identity of the displayed peptide sequence or VH and VL amino acid sequence. The displayed peptide (s) or single-chain antibody (e. g., scfv) and/or its VH and VL domains or their CDRs can be cloned and expressed in a suitable expression system. Often polynucleotides encoding the isolated VH and VL domains will be ligated to 20 polynucleotides encoding constant regions (CH and CL) to form polynucleotides encoding complete antibodies (e.g., chimeric or fully-human), antibody fragments, and the like. Often polynucleotides encoding the isolated CDRs will be grafted into polynucleotides encoding a suitable variable region framework (and optionally constant regions) to form polynucleotides encoding complete antibodies (e.g., 25 humanized or fully-human), antibody fragments, and the like. Antibodies can be used to isolate preparative quantities of the antigen by immunoaffinity chromatography. Various other uses of such antibodies are to diagnose and/or stage disease (e.g., neoplasia) and for therapeutic application to treat disease, such as for example: neoplasia, autoimmune disease, AIDS, cardiovascular disease, infections, 30 and the like. 176 WO 00/58517 PCT/USOO/08245 Various methods have been reported for increasing the combinatorial diversity of a scfv library to broaden the repertoire of binding species (idiotype spectrum) The use of PCR has permitted the variable regions to be rapidly cloned either from a specific hybridoma source or as a gene library from non-immunized 5 cells, affording combinatorial diversity in the assortment of VH and VL cassettes which can be combined. Furthermore, the VH and VL cassettes can themselves be diversified, such as by random, pseudorandom, or directed mutagenesis. Typically, VH and VL cassettes are diversified in or near the complementarity-determining regions (CDRS), often the third CDR, CDR3. Enzymatic inverse PCR mutagenesis 10 has been shown to be a simple and reliable method for constructing relatively large libraries of scfv site-directed hybrids (Stemmer et al, 1993), as has error-prone PCR and chemical mutagenesis (Deng et al, 1994). Riechmann (Riechmann et al, 1993) showed semi-rational design of an antibody scfv fragment using site-directed randomization by degenerate oligonucleotide PCR and subsequent phage display of 15 the resultant scfv hybrids. Barbas (Barbas et al, 1992) attempted to circumvent the problem of limited repertoire sizes resulting from using biased variable region sequences by randomizing the sequence in a synthetic CDR region of a human tetanus toxoid-binding Fab. 20 CDR randomization has the potential to create approximately I x 1020 CDRs for the heavy chain CDR3 alone, and a roughly similar number of variants of the heavy chain CDR1 and CDR2, and light chain CDR1-3 variants. Taken individually or together, the combination possibilities of CDR randomization of heavy and/or light chains requires generating a prohibitive number of bacteriophage clones to 25 produce a clone library representing all possible combinations, the vast majority of which will be non-binding. Generation of such large numbers of primary transformants is not feasible with current transformation technology and bacteriophage display systems. For example, Barbas (Barbas et al, 1992) only generated 5 x 107 transformants, which represents only a tiny fraction of the 30 potential diversity of a library of thoroughly randomized CDRS. 177 WO 00/58517 PCTIUSOO/08245 Despite these substantial limitations, bacteriophage display of scfv have already yielded a variety of useful antibodies and antibody fusion proteins. A bispecific single chain antibody has been shown to mediate efficient tumor cell lysis (Gruber et al, 1994). Intracellular expression of an anti-Rev scfv has been shown to 5 inhibit HIV-1 virus replication in vitro (Duan et al, 1994), and intracellular expression of an anti-p2lrar, scfv has been shown to inhibit meiotic maturation of Xenopus oocytes (Biocca et al, 1993). Recombinant scfv which can be used to diagnose HIV infection have also been reported, demonstrating the diagnostic utility of scfv (Lilley et al, 1994). Fusion proteins wherein an scFv is linked to a second 10 polypeptide, such as a toxin or fibrinolytic activator protein, have also been reported (Holvost et al, 1992; Nicholls et al, 1993). If it were possible to generate scfv libraries having broader antibody diversity and overcoming many of the limitations of conventional CDR mutagenesis 15 and randomization methods which can cover only a very tiny fraction of the potential sequence combinations, the number and quality of scfv antibodies suitable for therapeutic and diagnostic use could be vastly improved. To address this, the in vitro and in vivo shuffling methods of the invention are used to recombine CDRs which have been obtained (typically via PCR amplification or cloning) from nucleic 20 acids obtained from selected displayed antibodies. Such displayed antibodies can be displayed on cells, on bacteriophage particles, on polysomes, or any suitable antibody display system wherein the antibody is associated with its encoding nucleic acid(s). In a variation, the CDRs are initially obtained from mRNA (or cDNA) from antibody-producing cells (e.g., plasma cells/splenocytes from an immunized 25 wild-type mouse, a human, or a transgenic mouse capable of making a human antibody as in WO 92/03918, WO 93/12227, and WO 94/25585), including hybridomas derived therefrom. Polynucleotide sequences selected in a first selection round (typically by 30 affinity selection for displayed antibody binding to an antigen (e.g., a ligand) by any of these methods are pooled and the pool(s) is/are shuffled by in vitro and/or in vivo recombination, especially shuffling of CDRs (typically shuffling heavy chain CDRs 178 WO 00/58517 PCT/US00/08245 with other heavy chain CDRs and light chain CDRs with other light chain CDRs) to produce a shuffled pool comprising a population of recombined selected polynucleotide sequences. The recombined selected polynucleotide sequences are expressed in a selection format as a displayed antibody and subjected to at least one 5 subsequent selection round. The polynucleotide sequences selected in the subsequent selection round(s) can be used directly, sequenced, and/or subjected to one or more additional rounds of shuffling and subsequent selection until an antibody of the desired binding affinity is obtained. Selected sequences can also be back-crossed with polynucleotide sequences encoding neutral antibody framework 10 sequences (i.e., having insubstantial functional effect on antigen binding), such as for example by back-crossing with a human variable region framework to produce human-like sequence antibodies. Generally, during back-crossing subsequent selection is applied to retain the property of binding to the predetermined antigen. 15 Alternatively, or in combination with the noted variations, the valency of the target epitope may be varied to control the average binding affinity of selected scfv library members. The target epitope can be bound to a surface or substrate at varying densities, such as by including a competitor epitope, by dilution, or by other method known to those in the art. A high density (valency) of predetermined 20 epitope can be used to enrich for scfv library members which have relatively low affinity, whereas a low density (valency) can preferentially enrich for higher affinity scfv library members. For generating diverse variable segments, a collection of synthetic 25 oligonucleotides encoding random, pseudorandom, or a defined sequence kernal set of peptide sequences can be inserted by ligation into a predetermined site (e.g., a CDR). Similarly, the sequence diversity of one or more CDRs of the single-chain antibody cassette(s) can be expanded by mutating the CDR(s) with site-directed mutagenesis, CDR-replacement, and the like. The resultant DNA molecules can be 30 propagated in a host for cloning and amplification prior to shuffling, or can be used directly (i.e., may avoid loss of diversity which may occur upon propagation in a host cell) and the selected library members subsequently shuffled. 179 WO 00/58517 PCT/USOO/08245 Displayed peptide/polynucleotide complexes (library members) which encode a variable segment peptide sequence of interest or a single-chain antibody of interest are selected from the library by an affinity enrichment technique. This is 5 accomplished by means of a immobilized macromolecule or epitope specific for the peptide sequence of interest, such as a receptor, other macromolecule, or other epitope species. Repeating the affinity selection procedure provides an enrichment of library members encoding the desired sequences, which may then be isolated for pooling and shuffling, for sequencing, and/or for further propagation and affinity 10 enrichment. The library members without the desired specificity are removed by washing. The degree and stringency of washing required will be determined for each peptide sequence or single-chain antibody of interest and the immobilized predetermined 15 macromolecule or epitope. A certain degree of control can be exerted over the binding characteristics of the nascent peptide/DNA complexes recovered by adjusting the conditions of the binding incubation and the subsequent washing. The temperature, pH, ionic strength, divalent cations concentration, and the volume and duration of the washing will select for nascent peptide/DNA complexes within 20 particular ranges of affinity for the immobilized macromolecule. Selection based on slow dissociation rate, which is usually predictive of high affinity, is often the most practical route. This may be done either by continued incubation in the presence of a saturating amount of free predetermined macromolecule, or by increasing the volume, number, and length of the washes. In each case, the rebinding of 25 dissociated nascent peptide/DNA or peptide/RNA complex is prevented, and with increasing time, nascent peptide/DNA or peptide/RNA complexes of higher and higher affinity are recovered. Additional modifications of the binding and washing procedures may be 30 applied to find peptides with special characteristics. The affinities of some peptides are dependent on ionic strength or cation concentration. This is a useful characteristic for peptides that will be used in affinity purification of various 180 WO 00/58517 PCT/USO0/08245 proteins when gentle conditions for removing the protein from the peptides are required. One variation involves the use of multiple binding targets (multiple epitope 5 species, multiple receptor species), such that a scfv library can be simultaneously screened for a multiplicity of scfv which have different binding specificities. Given that the size of a scfv library often limits the diversity of potential scfv sequences, it is typically desirable to us scfv libraries of as large a size as possible. The time and economic considerations of generating a number of very large polysome 10 scFv-display libraries can become prohibitive. To avoid this substantial problem, multiple predetermined epitope species (receptor species) can be concomitantly screened in a single library, or sequential screening against a number of epitope species can be used. In one variation, multiple target epitope species, each encoded on a separate bead (or subset of beads), can be mixed and incubated with a 15 polysome-display scfv library under suitable binding conditions. The collection of beads, comprising multiple epitope species, can then be used to isolate, by affinity selection, scfv library members. Generally, subsequent affinity screening rounds can include the same mixture of beads, subsets thereof, or beads containing only one or two individual epitope species. This approach affords efficient screening, and is 20 compatible with laboratory automation, batch processing, and high throughput screening methods. A variety of techniques can be used in the present invention to diversify a peptide library or single-chain antibody library, or to diversify, prior to or 25 concomitant with shuffling, around variable segment peptides found in early rounds of panning to have sufficient binding activity to the predetermined macromolecule or epitope. In one approach, the positive selected peptide/polynucleotide complexes (those identified in an early round of affinity enrichment) are sequenced to determine the identity of the active peptides. Oligonucleotides are then synthesized 30 based on these active peptide sequences, employing a low level of all bases incorporated at each step to produce slight variations of the primary oligonucleotide sequences. This mixture of (slightly) degenerate oligonucleotides is then cloned into 181 WO 00/58517 PCT/USOO/08245 the variable segment sequences at the appropriate locations. This method produces systematic, controlled variations of the starting peptide sequences, which can then be shuffled. It requires, however, that individual positive nascent peptide/polynucleotide complexes be sequenced before mutagenesis, and thus is 5 useful for expanding the diversity of small numbers of recovered complexes and selecting variants having higher binding affinity and/or higher binding specificity. In a variation, mutagenic PCR amplification of positive selected peptide/polynucleotide complexes (especially of the variable region sequences, the amplification products of which are shuffled in vitro and/or in vivo and one or more 10 additional rounds of screening is done prior to sequencing. The same general approach can be employed with single-chain antibodies in order to expand the diversity and enhance the binding affinity/specificity, typically by diversifying CDRs or adjacent framework regions prior to or concomitant with shuffling. If desired, shuffling reactions can be spiked with mutagenic oligonucleotides capable 15 of in vitro recombination with the selected library members can be included. Thus, mixtures of synthetic oligonucleotides and PCR produced polynucleotides (synthesized by error-prone or high-fidelity methods) can be added to the in vitro shuffling mix and be incorporated into resulting shuffled library members (shufflants). 20 The present invention of shuffling enables the generation of a vast library of CDR-variant single-chain antibodies. One way to generate such antibodies is to insert synthetic CDRs into the single-chain antibody and/or CDR randomization prior to or concomitant with shuffling. The sequences of the synthetic CDR 25 cassettes are selected by referring to known sequence data of human CDR and are selected in the discretion of the practitioner according to the following guidelines: synthetic CDRs will have at least 40 percent positional sequence identity to known CDR sequences, and preferably will have at least 50 to 70 percent positional sequence identity to known CDR sequences. For example, a collection of synthetic 30 CDR sequences can be generated by synthesizing a collection of oligonucleotide sequences on the basis of naturally-occurring human CDR sequences listed in Kabat (Kabat et al, 1991); the pool (s) of synthetic CDR sequences are calculated to 182 WO 00/58517 PCT/USOO/08245 encode CDR peptide sequences having at least 40 percent sequence identity to at least one known naturally-occurring human CDR sequence. Alternatively, a collection of naturally-occurring CDR sequences may be compared to generate consensus sequences so that amino acids used at a residue position frequently (i.e., 5 in at least 5 percent of known CDR sequences) are incorporated into the synthetic CDRs at the corresponding position(s). Typically, several (e.g., 3 to about 50) known CDR sequences are compared and observed natural sequence variations between the known CDRs are tabulated, and a collection of oligonucleotides encoding CDR peptide sequences encompassing all or most permutations of the observed natural 10 sequence variations is synthesized. For example but not for limitation, if a collection of human VH CDR sequences have carboxy-terminal amino acids which are either Tyr, Val, Phe, or Asp, then the pool(s) of synthetic CDR oligonucleotide sequences are designed to allow the carboxy-terminal CDR residue to be any of these amino acids. In some embodiments, residues other than those which 15 naturally-occur at a residue position in the collection of CDR sequences are incorporated: conservative amino acid substitutions are frequently incorporated and up to 5 residue positions may be varied to incorporate non-conservative amino acid substitutions as compared to known naturally-occurring CDR sequences. Such CDR sequences can be used in primary library members (prior to first round screening) 20 and/or can be used to spike in vitro shuffling reactions of selected library member sequences. Construction of such pools of defined and/or degenerate sequences will be readily accomplished by those of ordinary skill in the art. The collection of synthetic CDR sequences comprises at least one member 25 that is not known to be a naturally-occurring CDR sequence. It is within the discretion of the practitioner to include or not include a portion of random or pseudorandom sequence corresponding to N region addition in the heavy chain CDR; the N region sequence ranges from 1 nucleotide to about 4 nucleotides occurring at V-D and D-J junctions. A collection of synthetic heavy chain CDR 30 sequences comprises at least about 100 unique CDR sequences, typically at least about 1,000 unique CDR sequences, preferably at least about 10,000 unique CDR sequences, frequently more than 50,000 unique CDR sequences; however, usually 183 WO 00/58517 PCT/USOO/08245 not more than about 1 x 10 6 unique CDR sequences are included in the collection, although occasionally 1 x 107 to 1 X 108 unique CDR sequences are present, especially if conservative amino acid substitutions are permitted at positions where the conservative amino acid substituent is not present or is rare (i.e., less than 0.1 5 percent) in that position in naturally-occurring human CDRS. In general, the number of unique CDR sequences included in a library should not exceed the expected number of primary transformants in the library by more than a factor of 10. Such single-chain antibodies generally bind of about at least 1 x 10 in-, preferably with an affinity of about at least 5 x 107 M- 1, more preferably with an affinity of at 10 least 1 x 108 M-1 to 1 x 109 M-1 or more, sometimes up to I x 101 M-1 or more. Frequently, the predetermined antigen is a human protein, such as for example a human cell surface antigen (e. g., CD4, CD8, IL-2 receptor, EGF receptor, PDGF receptor), other human biological macromolecule (e.g., thrombomodulin, protein C, carbohydrate antigen, sialyl Lewis antigen, Lselectin), or nonhuman disease 15 associated macromolecule (e.g., bacterial LPS, virion capsid protein or envelope glycoprotein) and the like. High affinity single-chain antibodies of the desired specificity can be engineered and expressed in a variety of systems. For example, scfv have been 20 produced in plants (Firek et al, 1993) and can be readily made in prokaryotic systems (Owens and Young, 1994; Johnson and Bird, 1991). Furthermore, the single-chain antibodies can be used as a basis for constructing whole antibodies or various fragments thereof (Kettleborough et al, 1994). The variable region encoding sequence may be isolated (e.g., by PCR amplification or subcloning) and 25 spliced to a sequence encoding a desired human constant region to encode a human sequence antibody more suitable for human therapeutic uses where immunogenicity is preferably minimized. The polynucleotide(s) having the resultant fully human encoding sequence(s) can be expressed in a host cell (e.g., from an expression vector in a mammalian cell) and purified for pharmaceutical formulation. 30 The DNA expression constructs will typically include an expression control DNA sequence operably linked to the coding sequences, including 184 WO 00/58517 PCT/USOO/08245 naturally-associated or heterologous promoter regions. Preferably, the expression control sequences will be eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells. Once the vector has been incorporated into the appropriate host, the host is maintained under conditions 5 suitable for high level expression of the nucleotide sequences, and the collection and purification of the mutant' "engineered" antibodies. As stated previously, the DNA sequences will be expressed in hosts after the sequences have been operably linked to an expression control sequence (i.e., 10 positioned to ensure the transcription and translation of the structural gene). These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors will contain selection markers, e.g., tetracycline or neomycin, to permit detection of those cells transformed with the desired DNA sequences (see, e.g., USPN 15 4,704,362, which is incorporated herein by reference). In addition to eukaryotic microorganisms such as yeast, mammalian tissue cell culture may also be used to produce the polypeptides of the present invention (see Winnacker, 1987), which is incorporated herein by reference). Eukaryotic 20 cells are actually preferred, because a number of suitable host cell lines capable of secreting intact immunoglobulins have been developed in the art, and include the CHO cell lines, various COS cell lines, HeLa cells, and myeloma cell lines, but preferably transformed Bcells or hybridomas. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an 25 enhancer (Queen et al, 1986), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters derived from immunoglobulin genes, cytomegalovirus, SV40, Adenovirus, Bovine Papilloma Virus, and the like. 30 Eukaryotic DNA transcription can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting sequences of between 10 to 300 185 WO 00/58517 PCT/USO0/08245 bp that increase transcription by a promoter. Enhancers can effectively increase transcription when either 51 or 31 to the transcription unit. They are also effective if located within an intron or within the coding sequence itself. Typically, viral enhancers are used, including SV40 enhancers, cytomegalovirus enhancers, polyoma 5 enhancers, and adenovirus enhancers. Enhancer sequences from mammalian systems are also commonly used, such as the mouse immunoglobulin heavy chain enhancer. Mammalian expression vector systems will also typically include a selectable 10 marker gene. Examples of suitable markers include, the dihydrofolate reductase gene (DHFR), the thymidine kinase gene (TK), or prokaryotic genes conferring drug resistance. The first two marker genes prefer the use of mutant cell lines that lack the ability to grow without the addition of thymidine to the growth medium. Transformed cells can then be identified by their ability to grow on 15 non-supplemented media. Examples of prokaryotic drug resistance genes useful as markers include genes conferring resistance to G418, mycophenolic acid and hygromycin. The vectors containing the DNA segments of interest can be transferred into 20 the host cell by well-known methods, depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment. lipofection, or electroporation may be used for other cellular hosts. Other methods used to transform mammalian cells include the use of Polybrene, protoplast fusion, liposomes, electroporation, and micro 25 injection (see, generally, Sambrook et al, 1982 and 1989). Once expressed, the antibodies, individual mutated immunoglobulin chains, mutated antibody fragments, and other immunoglobulin polypeptides of the invention can be purified according to standard procedures of the art, including 30 ammonium sulfate precipitation, fraction column chromatography, gel electrophoresis and the like (see, generally, Scopes, 1982). Once purified, partially or to homogeneity as desired, the polypeptides may then be used therapeutically or 186 WO 00/58517 PCT/US0O/08245 in developing and performing assay procedures, immunofluorescent stainings, and the like (see, generally, Lefkovits and Pernis, 1979 and 1981; Lefkovits, 1997). The antibodies generated by the method of the present invention can be used 5 for diagnosis and therapy. By way of illustration and not limitation, they can be used to treat cancer, autoimmune diseases, or viral infections. For treatment of cancer, the antibodies will typically bind to an antigen expressed preferentially on cancer cells, such as erbB-2, CEA, CD33, and many other antigens and binding members well known to those skilled in the art. 10 End-Selection This invention provides a method for selecting a subset of polynucleotides from a starting set of polynucleotides, which method is based on the ability to 15 discriminate one or more selectable features (or selection markers) present anywhere in a working polynucleotide, so as to allow one to perform selection for (positive selection) &/or against (negative selection) each selectable polynucleotide. In a preferred aspect, a method is provided termed end-selection, which method is based on the use of a selection marker located in part or entirely in a terminal region of a 20 selectable polynucleotide, and such a selection marker may be termed an "end selection marker". End-selection may be based on detection of naturally occurring sequences or on detection of sequences introduced experimentally (including by any mutagenesis 25 procedure mentioned herein and not mentioned herein) or on both, even within the same polynucleotide. An end-selection marker can be a structural selection marker or a functional selection marker or both a structural and a functional selection marker. An end-selection marker may be comprised of a polynucleotide sequence or of a polypeptide sequence or of any chemical structure or of any biological or 30 biochemical tag, including markers that can be selected using methods based on the detection of radioactivity, of enzymatic activity, of fluorescence, of any optical feature, of a magnetic property (e.g. using magnetic beads), of immunoreactivity, and of hybridization. 187 WO 00/58517 PCT/USOO/08245 End-selection may be applied in combination with any method serviceable for performing mutagenesis. Such mutagenesis methods include, but are not limited to, methods described herein (supra and infra). Such methods include, by way of 5 non-limiting exemplification, any method that may be referred herein or by others in the art by any of the following terms: "saturation mutagenesis", "shuffling", "recombination", "re-assembly", "error-prone PCR", "assembly PCR", "sexual PCR", "crossover PCR", "oligonucleotide primer-directed mutagenesis", "recursive (&/or exponential) ensemble mutagenesis (see Arkin and Youvan, 1992)", "cassette 10 mutagenesis", "in vivo mutagenesis", and "in vitro mutagenesis". Moreover, end selection may be performed on molecules produced by any mutagenesis &/or amplification method (see, e.g., Arnold, 1993; Caldwell and Joyce, 1992; Stemmer, 1994; following which method it is desirable to select for (including to screen for the presence of) desirable progeny molecules. 15 In addition, end-selection may be applied to a polynucleotide apart from any mutagenesis method. In a preferred embodiment, end-selection, as provided herein, can be used in order to facilitate a cloning step, such as a step of ligation to another polynucleotide (including ligation to a vector). This invention thus provides for end 20 selection as a serviceable means to facilitate library construction, selection &/or enrichment for desirable polynucleotides, and cloning in general. In a particularly preferred embodiment, end-selection can be based on (positive) selection for a polynucleotide; alternatively end-selection can be based on 25 (negative) selection against a polynucleotide; and alternatively still, end-selection can be based on both (positive) selection for, and on (negative) selection against, a polynucleotide. End-selection, along with other methods of selection &/or screening, can be performed in an iterative fashion, with any combination of like or unlike selection &/or screening methods and serviceable mutagenesis methods, all of 30 which can be performed in an iterative fashion and in any order, combination, and permutation. 188 WO 00/58517 PCT/USOO/08245 It is also appreciated that, according to one embodiment of this invention, end-selection may also be used to select a polynucleotide is at least in part: circular (e.g. a plasmid or any other circular vector or any other polynucleotide that is partly circular), &/or branched, &/or modified or substituted with any chemical group or 5 moiety. In accord with this embodiment, a polynucleotide may be a circular molecule comprised of an intermediate or central region, which region is flanked on a 5' side by a 5' flanking region (which, for the purpose of end-selection, serves in like manner to a 5' terminal region of a non-circular polynucleotide) and on a 3' side by a 3' terminal region (which, for the purpose of end-selection, serves in like 10 manner to a 3' terminal region of a non-circular polynucleotide). As used in this non-limiting exemplification, there may be sequence overlap between any two regions or even among all three regions. In one non-limiting aspect of this invention, end-selection of a linear 15 polynucleotide is performed using a general approach based on the presence of at least one end-selection marker located at or near a polynucleotide end or terminus (that can be either a 5' end or a 3' end). In one particular non-limiting exemplification, end-selection is based on selection for a specific sequence at or near a terminus such as, but not limited to, a sequence recognized by an enzyme that 20 recognizes a polynucleotide sequence. An enzyme that recognizes and catalyzes a chemical modification of a polynucleotide is referred to herein as a polynucleotide acting enzyme. In a preferred embodiment, serviceable polynucleotide-acting enzymes are exemplified non-exclusively by enzymes with polynucleotide-cleaving activity, enzymes with polynucleotide-methylating activity, enzymes with 25 polynucleotide-ligating activity, and enzymes with a plurality of distinguishable enzymatic activities (including non-exclusively, e.g., both polynucleotide-cleaving activity and polynucleotide-ligating activity). Relevant polynucleotide-acting enzymes thus also include any commercially 30 available or non-commercially available polynucleotide endonucleases and their companion methylases including those catalogued at the website http://www.neb.com/rebase, and those mentioned in the following cited reference 189 WO 00/58517 PCT/IUSOO/08245 (Roberts and Macelis, 1996). Preferred polynucleotide endonucleases include - but are not limited to - type II restriction enzymes (including type IIS), and include enzymes that cleave both strands of a double stranded polynucleotide (e.g. Not I, which cleaves both strands at 5'...GC/GGCCGC... 3') and enzymes that cleave only 5 one strand of a double stranded polynucleotide, i.e. enzymes that have polynucleotide-nicking activity, (e.g. N. BstNB I, which cleaves only one strand at 5'...GAGTCNNNN/N .. 3'). Relevant polynucleotide-acting enzymes also include type III restriction enzymes. 10 It is appreciated that relevant polynucleotide-acting enzymes also include any enzymes that may be developed in the future, though currently unavailable, that are serviceable for generating a ligation compatible end, preferably a sticky end, in a polynucleotide. 15 In one preferred exemplification, a serviceable selection marker is a restriction site in a polynucleotide that allows a corresponding type II (or type IIS) restriction enzyme to cleave an end of the polynucleotide so as to provide a ligatable end (including a blunt end or alternatively a sticky end with at least a one base overhang) that is serviceable for a desirable ligation reaction without cleaving the 20 polynucleotide internally in a manner that destroys a desired internal sequence in the polynucleotide. Thus it is provided that, among relevant restriction sites, those sites that do not occur internally (i.e. that do not occur apart from the termini) in a specific working polynucleotide are preferred when the use of a corresponding restriction enzyme(s) is not intended to cut the working polynucleotide internally. 25 This allows one to perform restriction digestion reactions to completion or to near completion without incurring unwanted internal cleavage in a working polynucleotide. According to a preferred aspect, it is thus preferable to use restriction sites 30 that are not contained, or alternatively that are not expected to be contained, or alternatively that unlikely to be contained (e.g. when sequence information regarding a working polynucleotide is incomplete) internally in a polynucleotide to 190 WO 00/58517 PCT/USOO/08245 be subjected to end-selection. In accordance with this aspect, it is appreciated that restriction sites that occur relatively infrequently are usually preferred over those that occur more frequently. On the other hand it is also appreciated that there are occasions where internal cleavage of a polypeptide is desired, e.g. to achieve 5 recombination or other mutagenic procedures along with end-selection. In accord with this invention, it is also appreciated that methods (e.g. mutagenesis methods) can be used to remove unwanted internal restriction sites. It is also appreciated that a partial digestion reaction (i.e. a digestion reaction that 10 proceeds to partial completion) can be used to achieve digestion at a recognition site in a terminal region while sparing a susceptible restriction site that occurs internally in a polynucleotide and that is recognized by the same enzyme. In one aspect, partial digest are useful because it is appreciated that certain enzymes show preferential cleavage of the same recognition sequence depending on the location 15 and environment in which the recognition sequence occurs. For example, it is appreciated that, while lambda DNA has 5 EcoR I sites, cleavage of the site nearest to the right terminus has been reported to occur 10 times faster than the sites in the middle of the molecule. Also, for example, it has been reported that, while Sac II has four sites on lambda DNA, the three clustered centrally in lambda are cleaved 50 20 times faster than the remaining site near the terminus (at nucleotide 40,386). Summarily, site preferences have been reported for various enzymes by many investigators (e.g., Thomas and Davis, 1975; Forsblum et al, 1976; Nath and Azzolina, 1981; Brown and Smith, 1977; Gingeras and Brooks, 1983; Kruger et al, 1988; Conrad and Topal, 1989; Oller et al, 1991; Topal, 1991; and Pein, 1991; 25 to name but a few). It is appreciated that any empirical observations as well as any mechanistic understandings of site preferences by any serviceable polynucleotide acting enzymes, whether currently available or to be procured in the future, may be serviceable in end-selection according to this invention. 30 It is also appreciated that protection methods can be used to selectively protect specified restriction sites (e.g. internal sites) against unwanted digestion by enzymes that would otherwise cut a working polypeptide in response to the presence 191 WO 00/58517 PCT/USO0/08245 of those sites; and that such protection methods include modifications such as methylations and base substitutions (e.g. U instead of T) that inhibit an unwanted enzyme activity. It is appreciated that there are limited numbers of available restriction enzymes that are rare enough (e.g. having very long recognition 5 sequences) to create large (e.g. megabase-long) restriction fragments, and that protection approaches (e.g. by methylation) are serviceable for increasing the rarity of enzyme cleavage sites. The use of M.Fnu II (mCGCG) to increase the apparent rarity of Not I approximately twofold is but one example among many (Qiang et al, 1990; Nelson et al, 1984; Maxam and Gilbert, 1980; Raleigh and Wilson, 1986). 10 According to a preferred aspect of this invention, it is provided that, in general, the use of rare restriction sites is preferred. It is appreciated that, in general, the frequency of occurrence of a restriction site is determined by the number of nucleotides contained therein, as well as by the ambiguity of the base requirements 15 contained therein. Thus, in a non-limiting exemplification, it is appreciated that, in general, a restriction site composed of, for example, 8 specific nucleotides (e.g. the Not I site or GC/GGCCGC, with an estimated relative occurrence of 1 in 48, i.e. 1 in 65,536, random 8-mers) is relatively more infrequent than one composed of, for example, 6 nucleotides (e.g. the Sma I site or CCC/GGG, having an estimated 20 relative occurrence of 1 in 4 6, i.e. 1 in 4,096, random 6-mers), which in turn is relatively more infrequent than one composed of, for example, 4 nucleotides (e.g. the Msp I site or C/CGG, having an estimated relative occurrence of 1 in 44, i.e. 1 in 256, random 4-mers). Moreover, in another non-limiting exemplification, it is appreciated that, in general, a restriction site having no ambiguous (but only 25 specific) base requirements (e.g. the Fin I site or GTCCC, having an estimated relative occurrence of 1 in 45, i.e. I in 1024, random 5-mers) is relatively more infrequent than one having an ambiguous W (where W = A or T) base requirement (e.g. the Ava II site or G/GWCC, having an estimated relative occurrence of 1 in 4x4x2x4x4 - i.e. 1 in 512 - random 5-mers), which in turn is relatively more 30 infrequent than one having an ambiguous N (where N = A or C or G or T) base requirement (e.g. the Asu I site or G/GNCC, having an estimated relative occurrence of 1 in 4x4x1x4x4, i.e. 1 in 256 - random 5-mers). These relative occurrences are 192 WO 00/58517 PCT/USOO/08245 considered general estimates for actual polynucleotides, because it is appreciated that specific nucleotide bases (not to mention specific nucleotide sequences) occur with dissimilar frequencies in specific polynucleotides, in specific species of organisms, and in specific groupings of organisms. For example, it is appreciated 5 that the % G+C contents of different species of organisms are often very different and wide ranging. The use of relatively more infrequent restriction sites as a selection marker include - in a non-limiting fashion - preferably those sites composed at least a 4 10 nucleotide sequence, more preferably those composed at least a 5 nucleotide sequence, more preferably still those composed at least a 6 nucleotide sequence (e.g. the BamH I site or G/GATCC, the Bgl II site or A/GATCT, the Pst I site or CTGCA/G, and the Xba I site or T/CTAGA), more preferably still those composed at least a 7 nucleotide sequence, more preferably still those composed of an 8 15 nucleotide sequence nucleotide sequence (e.g. the Asc I site or GG/CGCGCC, the Not I site or GC/GGCCGC, the Pac I site or TTAAT/TAA, the Pme I site or GTTT/AAAC, the Srf I site or GCCC/GGGC, the Sse838 I site or CCTGCA/GG, and the Swa I site or ATTT/AAAT), more preferably still those composed of a 9 nucleotide sequence, and even more preferably still those composed of at least a 10 20 nucleotide sequence (e.g. the BspG I site or CG/CGCTGGAC). It is further appreciated that some restriction sites (e.g. for class IIS enzymes) are comprised of a portion of relatively high specificity (i.e. a portion containing a principal determinant of the frequency of occurrence of the restriction site) and a portion of relatively low specificity; and that a site of cleavage may or may not be contained 25 within a portion of relatively low specificity. For example, in the Eco57 I site or CTGAAG(16/14), there is a portion of relatively high specificity (i.e. the CTGAAG portion) and a portion of relatively low specificity (i.e. the N16 sequence) that contains a site of cleavage. 30 In another preferred embodiment of this invention, a serviceable end selection marker is a terminal sequence that is recognized by a polynucleotide-acting enzyme that recognizes a specific polynucleotide sequence. In a preferred aspect of 193 WO 00/58517 PCT/US00/08245 this invention, serviceable polynucleotide-acting enzymes also include other enzymes in addition to classic type II restriction enzymes. According to this preferred aspect of this invention, serviceable polynucleotide-acting enzymes also include gyrases, helicases, recombinases, relaxases, and any enzymes related 5 thereto. Among preferred examples are topoisomerases (which have been categorized by some as a subset of the gyrases) and any other enzymes that have polynucleotide cleaving activity (including preferably polynucleotide-nicking activity) &/or 10 polynucleotide-ligating activity. Among preferred topoisomerase enzymes are topoisomerase I enzymes, which is available from many commercial sources (Epicentre Technologies, Madison, WI; Invitrogen, Carlsbad, CA; Life Technologies, Gathesburg, MD) and conceivably even more private sources. It is appreciated that similar enzymes may be developed in the future that are serviceable 15 for end-selection as provided herein. A particularly preferred topoisomerase I enzyme is a topoisomerase I enzyme of vaccinia virus origin, that has a specific recognition sequence (e.g. 5'...AAGGG... 3') and has both polynucleotide-nicking activity and polynucleotide-ligating activity. Due to the specific nicking-activity of this enzyme (cleavage of one strand), internal recognition sites are not prone to 20 polynucleotide destruction resulting from the nicking activity (but rather remain annealed) at a temperature that causes denaturation of a terminal site that has been nicked. Thus for use in end-selection, it is preferable that a nicking site for topoisomerase-based end-selection be no more than 100 nucleotides from a terminus, more preferably no more than 50 nucleotides from a terminus, more 25 preferably still no more than 25 nucloetides from a terminus, even more preferably still no more than 20 nucleotides from a terminus, even more preferably still no more than 15 nucleotides from a terminus, even more preferably still no more than 10 nucleotides from a terminus, even more preferably still no more than 8 nucleotides from a terminus, even more preferably still no more than 6 nucleotides 30 from a terminus, and even more preferably still no more than 4 nucleotides from a terminus. 194 WO 00/58517 PCT/USOO/08245 In a particularly preferred exemplification that is non-limiting yet clearly illustrative, it is appreciated that when a nicking site for topoisomerase-based end selection is 4 nucleotides from a terminus, nicking produces a single stranded oligo of 4 bases (in a terminal region) that can be denatured from its complementary 5 strand in an end-selectable polynucleotide; this provides a sticky end (comprised of 4 bases) in a polynucleotide that is serviceable for an ensuing ligation reaction. To accomplish ligation to a cloning vector (preferably an expression vector), compatible sticky ends can be generated in a cloning vector by any means including by restriction enzyme-based means. The terminal nucleotides (comprised of 4 terminal 10 bases in this specific example) in an end-selectable polynucleotide terminus are thus wisely chosen to provide compatibility with a sticky end generated in a cloning vector to which the polynucleotide is to be ligated. On the other hand, internal nicking of an end-selectable polynucleotide, e.g. 15 500 bases from a terminus, produces a single stranded oligo of 500 bases that is not easily denatured from its complementary strand, but rather is serviceable for repair (e.g. by the same topoisomerase enzyme that produced the nick). This invention thus provides a method - e.g. that is vaccinia topoisomerase 20 based &/or type II (or IIS) restriction endonuclease-based &/or type III restriction endonuclease-based &/or nicking enzyme-based (e.g. using N. BstNB I) - for producing a sticky end in a working polynucleotide, which end is ligation compatible, and which end can be comprised of at least a 1 base overhang. Preferably such a sticky end is comprised of at least a 2-base overhang, more 25 preferably such a sticky end is comprised of at least a 3-base overhang, more preferably still such a sticky end is comprised of at least a 4-base overhang, even more preferably still such a sticky end is comprised of at least a 5-base overhang, even more preferably still such a sticky end is comprised of at least a 6-base overhang. Such a sticky end may also be comprised of at least a 7-base overhang, or 30 at least an 8-base overhang, or at least a 9-base overhang, or at least a 10-base overhang, or at least 15-base overhang, or at least a 20-base overhang, or at least a 195 WO 00/58517 PCT/USOO/08245 25-base overhang, or at least a 30-base overhang. These overhangs can be comprised of any bases, including A, C, G, or T. It is appreciated that sticky end overhangs introduced using topoisomerase or 5 a nicking enzyme (e.g. using N. BstNB I) can be designed to be unique in a ligation environment, so as to prevent unwanted fragment reassemblies, such as self dimerizations and other unwanted concatamerizations. According to one aspect of this invention, a plurality of sequences (which 10 may but do not necessarily overlap) can be introduced into a terminal region of an end-selectable polynucleotide by the use of an oligo in a polymerase-based reaction. In a relevant, but by no means limiting example, such an oligo can be used to provide a preferred 5' terminal region that is serviceable for topoisomerase I-based end-selection, which oligo is comprised of: a 1-10 base sequence that is convertible 15 into a sticky end (preferably by a vaccinia topoisomerase I), a ribosome binding site (i.e. and "RBS", that is preferably serviceable for expression cloning), and optional linker sequence followed by an ATG start site and a template-specific sequence of 0 100 bases (to facilitate annealment to the template in the a polymerase-based reaction). Thus, according to this example, a serviceable oligo (which may be 20 termed a forward primer) can have the sequence: 5'[terminal sequence = (N)I. lo][topoisomerase I site & RBS = AAGGGAGGAG] [linker = (N)- oo][start codon and template-specific sequence = ATG(N)oi oo]3'. Analogously, in a relevant, but by no means limiting example, an oligo can 25 be used to provide a preferred 3' terminal region that is serviceable for topoisomerase I-based end-selection, which oligo is comprised of: a 1-10 base sequence that is convertible into a sticky end (preferably by a vaccinia topoisomerase I), and optional linker sequence followed by a template-specific sequence of 0-100 bases (to facilitate annealment to the template in the a 30 polymerase-based reaction). Thus, according to this example, a serviceable oligo (which may be termed a reverse primer) can have the sequence: 5'[terminal 196 WO 00/58517 PCT/USOO/08245 sequence = (N) 1 .io][topoisomerase I site = AAGGG][linker = (N) 1
-
100 ][template specific sequence = (N)oioo]3'. It is appreciated that, end-selection can be used to distinguish and separate 5 parental template molecules (e.g. to be subjected to mutagenesis) from progeny molecules (e.g. generated by mutagenesis). For example, a first set of primers, lacking in a topoisomerase I recognition site, can be used to modify the terminal regions of the parental molecules (e.g. in polymerase-based amplification). A different second set of primers (e.g. having a topoisomerase I recognition site) can then be used to generate 10 mutated progeny molecules (e.g. using any polynucleotide chimerization method, such as interrupted synthesis, template-switching polymerase-based amplification, or interrupted synthesis; or using saturation mutagenesis; or using any other method for introducing a topoisomerase I recognition site into a mutagenized progeny molecule as disclosed herein) from the amplified template molecules. The use of topoisomerase I-based end 15 selection can then facilitate, not only discernment, but selective topoisomerase I-based ligation of the desired progeny molecules. Annealment of a second set of primers to thusly amplified parental molecules can be facilitated by including sequences in a first set of primers (i.e. primers used for 20 amplifying a set parental molecules) that are similar to a toposiomerase I recognition site, yet different enough to prevent functional toposiomerase I enzyme recognition. For example, sequences that diverge from the AAGGG site by anywhere from 1 base to all 5 bases can be incorporated into a first set of primers (to be used for amplifying the parental templates prior to subjection to mutagenesis). In a specific, but non-limiting 25 aspect, it is thus provided that a parental molecule can be amplified using the following exemplary - but by no means limiting - set of forward and reverse primers: Forward Primer: 5' CTAGAAGAGAGGAGAAAACCATG(N)io.ioo 3', and Reverse Primer: 5' GATCAAAGGCGCGCCTGCAGG(N)io.ioo 3' 30 According to this specific example of a first set of primers, (N)io-ioo represents preferably a 10 to 100 nucleotide-long template-specific sequence, more preferably a 10 197 WO 00/58517 PCT/USOO/08245 to 50 nucleotide-long template-specific sequence, more preferably still a 10 to 30 nucleotide-long template-specific sequence, and even more preferably still a 15 to 25 nucleotide-long template-specific sequence. 5 According to a specific, but non-limiting aspect, it is thus provided that, after this amplification (using a disclosed first set of primers lacking in a true topoisomerase I recognition site), amplified parental molecules can then be subjected to mutagenesis using one or more sets of forward and reverse primers that do have a true topoisomerase I recognition site. In a specific, but non-limiting aspect, it is thus provided that a parental 10 molecule can be used as templates for the generation of a mutagenized progeny molecule using the following exemplary - but by no means limiting - second set of forward and reverse primers: Forward Primer: 5' CTAGAAGGGAGGAGAAAACCATG 3' 15 Reverse Primer: 5' GATCAAAGGCGCGCCTGCAGG 3' (contains Asc I recognition sequence) It is appreciated that any number of different primers sets not specifically mentioned can be used as first, second, or subsequent sets of primers for end-selection 20 consistent with this invention. Notice that type II restriction enzyme sites can be incorporated (e.g. an Asc I site in the above example). It is provided that, in addition to the other sequences mentioned, the experimentalist can incorporate one or more N,N,G/T triplets into a serviceable primer in order to subject a working polynucleotide to saturation mutagenesis. Summarily, use of a second and/or subsequent set of primers can 25 achieve dual goals of introducing a topoisomerase I site and of generating mutations in a progeny polynucleotide. Thus, according to one use provided, a serviceable end-selection marker is an enzyme recognition site that allows an enzyme to cleave (including nick) a 30 polynucleotide at a specified site, to produce a ligation-compatible end upon denaturation of a generated single stranded oligo. Ligation of the produced polynucleotide end can then be accomplished by the same enzyme (e.g. in the case 198 WO 00/58517 PCT/USOO/08245 of vaccinia virus toposiomerase I), or alternatively with the use of a different enzyme. According to one aspect of this invention, any serviceable end-selection markers, whether like (e.g. two vaccinia virus toposiomerase I recognition sites) or unlike (e.g. a class II restriction enzyme recognition site and a vaccinia virus 5 toposiomerase I recognition site) can be used in combination to select a polynucleotide. Each selectable polynucleotide can thus have one or more end selection markers, and they can be like or unlike end-selection markers. In a particular aspect, a plurality of end-selection markers can be located on one end of a polynucleotide and can have overlapping sequences with each other. 10 It is important to emphasize that any number of enzymes, whether currently in existence or to be developed, can be serviceable in end-selection according to this invention. For example, in a particular aspect of this invention, a nicking enzyme (e.g. N. BstNB I, which cleaves only one strand at 5'...GAGTCNNNN/N ... 3') can 15 be used in conjunction with a source of polynucleotide-ligating activity in order to achieve end-selection. According to this embodiment, a recognition site for N. BstN BI - instead of a recognition site for topoisomerase I - should be incorported into an end-selectable polynucleotide (whether end-selection is used for selection of a mutagenized progeny molecule or whether end-selection is used apart from any 20 mutagenesis procedure). It is appreciated that the instantly disclosed end-selection approach using topoisomerase-based nicking and ligation has several advantages over previously available selection methods. In sum, this approach allows one to achieve direction 25 cloning (including expression cloning). Specifically, this approach can be used for the achievement of: direct ligation (i.e. without subjection to a classic restriction purification-ligation reaction, that is susceptible to a multitude of potential problems from an initial restriction reaction to a ligation reaction dependent on the use of T4 DNA ligase); separation of progeny molecules from original template molecules 30 (e.g. original template molecules lack topoisomerase I sites that not introduced until after mutagenesis), obviation of the need for size separation steps (e.g. by gel chromatography or by other electrophoretic means or by the use of size-exclusion 199 WO 00/58517 PCT/USOO/08245 membranes), preservation of internal sequences (even when topoisomerase I sites are present), obviation of concerns about unsuccessful ligation reactions (e.g. dependent on the use of T4 DNA ligase, particularly in the presence of unwanted residual restriction enzyme activity), and facilitated expression cloning (including 5 obviation of frame shift concerns). Concerns about unwanted restriction enzyme based cleavages - especially at internal restriction sites (or even at often unpredictable sites of unwanted star activity) in a working polynucleotide - that are potential sites of destruction of a working polynucleotide can also be obviated by the instantly disclosed end-selection approach using topoisomerase-based nicking and 10 ligation. Two-Hybrid Based Screening Assays 15 Shuffling can also be used to recombinatorially diversify a pool of selected library members obtained by screening a two-hybrid screening system to identify library members which bind a predetermined polypeptide sequence. The selected library members are pooled and shuffled by in vitro and/or in vivo recombination. The shuffled pool can then be screened in a yeast two hybrid system to select library 20 members which bind said predetermined polypeptide sequence (e. g., and SH2 domain) or which bind an alternate predetermined polypeptide sequence (e.g., an SH2 domain from another protein species). An approach to identifying polypeptide sequences which bind to a 25 predetermined polypeptide sequence has been to use a so-called "two-hybrid" system wherein the predetermined polypeptide sequence is present in a fusion protein (Chien et al, 1991). This approach identifies protein-protein interactions in vivo through reconstitution of a transcriptional activator (Fields and Song, 1989), the yeast Gal4 transcription protein. Typically, the method is based on the properties 30 of the yeast Gal4 protein, which consists of separable domains responsible for DNA-binding and transcriptional activation. Polynucleotides encoding two hybrid proteins, one consisting of the yeast Gal4 DNA-binding domain fused to a 200 WO 00/58517 PCT/US00/08245 polypeptide sequence of a known protein and the other consisting of the Gal4 activation domain fused to a polypeptide sequence of a second protein, are constructed and introduced into a yeast host cell. Intermolecular binding between the two fusion proteins reconstitutes the Gal4 DNA-binding domain with the Gal4 5 activation domain, which leads to the transcriptional activation of a reporter gene (e.g., lacz, HIS3) which is operably linked to a Gal4 binding site. Typically, the two-hybrid method is used to identify novel polypeptide sequences which interact with a known protein (Silver and Hunt, 1993; Durfee et al, 1993; Yang et al, 1992; Luban et al, 1993; Hardy et al, 1992; Bartel et al, 1993; and Vojtek et al, 1993). 10 However, variations of the two-hybrid method have been used to identify mutations of a known protein that affect its binding to a second known protein (Li and Fields, 1993; Lalo et al, 1993; Jackson et al, 1993; and Madura et al, 1993). Two-hybrid systems have also been used to identify interacting structural domains of two known proteins (Bardwell et al, 1993; Chakrabarty et al, 1992; Staudinger et al, 1993; 15 and Milne and Weaver 1993) or domains responsible for oligomerization of a single protein (Iwabuchi et al, 1993; Bogerd et al, 1993). Variations of two-hybrid systems have been used to study the in vivo activity of a proteolytic enzyme (Dasmahapatra et al, 1992). Alternatively, an E. coli/BCCP interactive screening system (Germino et al, 1993; Guarente, 1993) can be used to identify interacting 20 protein sequences (i.e., protein sequences which heterodimerize or form higher order heteromultimers). Sequences selected by a two-hybrid system can be pooled and shuffled and introduced into a two-hybrid system for one or more subsequent rounds of screening to identify polypeptide sequences which bind to the hybrid containing the predetermined binding sequence. The sequences thus identified can be 25 compared to identify consensus sequence(s) and consensus sequence kernals. In general, standard techniques of recombination DNA technology are described in various publications (e.g. Sambrook et al, 1989; Ausubel et al, 1987; and Berger and Kimmel, 1987), each of which is incorporated herein in its entirety 30 by reference. Polynucleotide modifying enzymes were used according to the manufacturer's recommendations. Oligonucleotides were synthesized on an Applied Biosystems Inc. Model 394 DNA synthesizer using ABI chemicals. If desired, PCR 201 WO 00/58517 PCT/USO0/08245 amplimers for amplifying a predetermined DNA sequence may be selected at the discretion of the practitioner. One microgram samples of template DNA are obtained and treated with U.V. 5 light to cause the formation of dimers, including TT dimers, particularly purine dimers. U.V. exposure is limited so that only a few photoproducts are generated per gene on the template DNA sample. Multiple samples are treated with U.V. light for varying periods of time to obtain template DNA samples with varying numbers of dimers from U.V. exposure. 10 A random priming kit which utilizes a non-proofreading polymease (for example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems) is utilized to generate different size polynucleotides by priming at random sites on templates which are prepared by U.V. light (as described above) and extending along 15 the templates. The priming protocols such as described in the Prime-It II Random Primer Labeling kit may be utilized to extend the primers. The dimers formed by U.V. exposure serve as a roadblock for the extension by the non-proofreading polymerase. Thus, a pool of random size polynucleotides is present after extension with the random primers is finished. 20 The present invention is further directed to a method for generating a selected mutant polynucleotide sequence (or a population of selected polynucleotide sequences) typically in the form of amplified and/or cloned polynucleotides, whereby the selected polynucleotide sequences(s) possess at least one desired 25 phenotypic characteristic (e.g., encodes a polypeptide, promotes transcription of linked polynucleotides, binds a protein, and the like) which can be selected for. One method for identifying hybrid polypeptides that possess a desired structure or functional property, such as binding to a predetermined biological macromolecule (e.g., a receptor), involves the screening of a large library of polypeptides for 30 individual library members which possess the desired structure or functional property conferred by the amino acid sequence of the polypeptide. 202 WO 00/58517 PCT/USOO/08245 In one embodiment, the present invention provides a method for generating libraries of displayed polypeptides or displayed antibodies suitable for affinity interaction screening or phenotypic screening. The method comprises (1) obtaining a first plurality of selected library members comprising a displayed polypeptide or 5 displayed antibody and an associated polynucleotide encoding said displayed polypeptide or displayed antibody, and obtaining said associated polynucleotides or copies thereof wherein said associated polynucleotides comprise a region of substantially identical sequences, optimally introducing mutations into said polynucleotides or copies, (2) pooling the polynucleotides or copies, (3) producing 10 smaller or shorter polynucleotides by interrupting a random or particularized priming and synthesis process or an amplification process, and (4) performing amplification, preferably PCR amplification, and optionally mutagenesis to homologously recombine the newly synthesized polynucleotides. 15 It is a particularly preferred object of the invention to provide a process for producing hybrid polynucleotides which express a useful hybrid polypeptide by a series of steps comprising: (a) producing polynucleotides by interrupting a polynucleotide amplification or synthesis process with a means for blocking or interrupting the 20 amplification or synthesis process and thus providing a plurality of smaller or shorter polynucleotides due to the replication of the polynucleotide being in various stages of completion; (b) adding to the resultant population of single- or double-stranded polynucleotides one or more single- or double-stranded oligonucleotides, wherein 25 said added oligonucleotides comprise an area of identity in an area of heterology to one or more of the single- or double-stranded polynucleotides of the population; (c) denaturing the resulting single- or double-stranded oligonucleotides to produce a mixture of single-stranded polynucleotides, optionally separating the shorter or smaller polynucleotides into pools of polynucleotides having various 30 lengths and further optionally subjecting said polynucleotides to a PCR procedure to amplify one or more oligonucleotides comprised by at least one of said polynucleotide pools; 203 WO 00/58517 PCTIUSOO/08245 (d) incubating a plurality of said polynucleotides or at least one pool of said polynucleotides with a polymerase under conditions which result in annealing of said single-stranded polynucleotides at regions of identity between the single stranded polynucleotides and thus forming of a mutagenized double-stranded 5 polynucleotide chain; (e) optionally repeating steps (c) and (d); (f) expressing at least one hybrid polypeptide from said polynucleotide chain, or chains; and (g) screening said at least one hybrid polypeptide for a useful activity. 10 In a preferred aspect of the invention, the means for blocking or interrupting the amplification or synthesis process is by utilization of U.V. light, DNA adducts, DNA binding proteins. In one embodiment of the invention, the DNA adducts, or polynucleotides 15 comprising the DNA adducts, are removed from the polynucleotides or polynucleotide pool, such as by a process including heating the solution comprising the DNA fragments prior to further processing. Having thus disclosed exemplary embodiments of the present invention, it 20 should be noted by those skilled in the art that the disclosures are exemplary only and that various other alternatives, adaptations and modifications may be made within the scope of the present invention. Accordingly, the present invention is not limited to the specific embodiments as illustrated herein. 25 Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following examples are to be considered illustrative and thus are not limiting of the remainder of the disclosure in any way whatsoever. 204 WO 00/58517 PCT/USOO/08245 Example 1 Generation of Random Size Polynueleotides Using U,V. Induced Photoproducts One microgram samples of template DNA are obtained and treated with U.V. light to cause the formation of dimers, including TT dimers, particularly purine 5 dimers. U.V. exposure is limited so that only a few photoproducts are generated per gene on the template DNA sample. Multiple samples are treated with U.V. light for varying periods of time to obtain template DNA samples with varying numbers of dimers from U.V. exposure. A random priming kit which utilizes a non-proofreading polymease (for 10 example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems) is utilized to generate different size polynucleotides by priming at random sites on templates which are prepared by U.V. light (as described above) and extending along the templates. The priming protocols such as described in the Prime-It II Random Primer Labeling kit may be utilized to extend the primers. The dimers formed by 15 U.V. exposure serve as a roadblock for the extension by the non-proofreading polymerase. Thus, a pool of random size polynucleotides is present after extension with the random primers is finished. 205 WO 00/58517 PCT/US0O/08245 Example 2 Isolation of Random Size Polynucleotides Polynucleotides of interest which are generated according to Example 1 are are gel isolated on a 1.5% agarose gel. Polynucleotides in the 100-300 bp range are 5 cut out of the gel and 3 volumes of 6 M NaI is added to the gel slice. The mixture is incubated at 50 *C for 10 minutes and 10 pl of glass milk (Bio 101) is added. The mixture is spun for 1 minute and the supernatant is decanted. The pellet is washed with 500 pl of Column Wash (Column Wash is 50% ethanol, 10mM Tris-HCI pH 7.5, 100 mM NaCl and 2.5 mM EDTA) and spin for 1 minute, after which the 10 supernatant is decanted. The washing, spinning and decanting steps are then repeated. The glass milk pellet is resuspended in 20pl of H 2 0 and spun for 1 minute. DNA remains in the aqueous phase. 206 WO 00/58517 PCT/USO0/08245 Example 3 Shuffling of Isolated Random Size 100-300bp Polynucleotides The 100-300 bp polynucleotides obtained in Example 2 are recombined in an annealing mixture (0.2 mM each dNTP, 2.2 mM MgCl 2 , 50 mM KCI, 10 mM Tris 5 HCl ph 8.8, 0.1% Triton X-100, 0.3 pt; Taq DNA polymerase, 50 ptl total volume) without adding primers. A Robocycler by Stratagene was used for the annealing step with the following program: 95 'C for 30 seconds, 25-50 cycles of [95 *C for 30 seconds, 50 - 60 *C (preferably 58 *C) for 30 seconds, and 72 *C for 30 seconds] and 5 minutes at 72 IC. Thus, the 100-300 bp polynucleotides combine to yield 10 double-stranded polynucleotides having a longer sequence. After separating out the reassembled double-stranded polynucleotides and denaturing them to form single stranded polynucleotides, the cycling is optionally again repeated with some samples utilizing the single strands as template and primer DNA and other samples utilizing random primers in addition to the single strands. 15 207 WO 00/58517 PCT/USOO/08245 Example 4 Screening of Polypeptides from Shuffled Polynucleotides The polynucleotides of Example 3 are separated and polypeptides are expressed therefrom. The original template DNA is utilized as a comparative 5 control by obtaining comparative polypeptides therefrom. The polypeptides obtained from the shuffled polynucleotides of Example 3 are screened for the activity of the polypeptides obtained from the original template and compared with the activity levels of the control. The shuffled polynucleotides coding for interesting polypeptides discovered during screening are compared further for secondary 10 desirable traits. Some shuffled polynucleotides corresponding to less interesting screened polypeptides are subjected to reshuffling. 208 WO 00/58517 PCT/USOO/08245 Example 5 Directed Evolution an Enzyme by Saturation Mutagenesis Site-Saturation Mutagenesis: To accomplish site-saturation mutagenesis every 5 residue (316) of a dehalogenase enzyme was converted into all 20 amino acids by site directed mutagenesis using 32-fold degenerate oligonucleotide primers, as follows: 1. A culture of the dehalogenase expression construct was grown and a preparation 10 of the plasmid was made 2. Primers were made to randomize each codon - they have the common structure
X
2 0NN(G/T)X 2 0 3. A reaction mix of 25 ul was prepared containing -50 ng of plasmid template, 125 ng of each primer, IX native Pfu buffer, 200 uM each dNTP and 2.5 U 15 native Pfu DNA polymerase 4. The reaction was cycled in a Robo96 Gradient Cycler as follows: Initial denaturation at 95 0 C for 1 min 20 cycles of 95'C for 45 sec, 53*C for 1 min and 72 0 C for 11 min Final elongation step of 72"C for 10 min 20 5. The reaction mix was digested with 10 U of DpnI at 37"C for 1 hour to digest the methylated template DNA 6. Two ul of the reaction mix were used to transform 50 ul of XLl-Blue MRF' cells and the entire transformation mix was plated on a large LB-Amp-Met plate yielding 200-1000 colonies 25 7. Individual colonies were toothpicked into the wells of 96-well microtiter plates containing LB-Amp-IPTG and grown overnight 8. The clones on these plates were assayed the following day 30 209 WO 00/58517 PCT/USOO/08245 Screening: Approximately 200 clones of mutants for each position were grown in liquid media (384 well microtiter plates) and screened as follows: 1. Overnight cultures in 384-well plates were centrifuged and the media 5 removed. To each well was added 0.06 mL 1 mM Tris/S02- pH 7.8. 2. Made 2 assay plates from each parent growth plate consisting of 0.02 mL cell suspension. 3. One assay plate was placed at room temperature and the other at elevated temperature (initial screen used 55C) for a period of time (initially 30 10 minutes). 4. After the prescribed time 0.08 mL room temperature substrate (TCP saturated 1 mM Tris/S0 4 2 - pH 7.8 with 1.5 mM NaN 3 and 0.1 mM bromothymol blue) was added to each well. 5. Measurements at 620 nm were taken at various time points to generate a 15 progress curve for each well. 6. Data were analyzed and the kinetics of the cells heated to those not heated were compared. Each plate contained 1-2 columns (24 wells) of unmutated 20F12 controls. 7. Wells that appeared to have improved stability were re-grown and tested 20 under the same conditions. Following this procedure nine single site mutations appeared to confer increased thermal stability on the enzyme. Sequence analysis was performed to determine of the exact amino acid changes at each position that were specifically 25 responsible for the improvement. In sum, the improvement was conferred at 7 sites by one amino acid change alone, at an eighth site by each of two amino acid changes, and at a ninth site by each of three amino acid changes. Several mutants were then made each having a plurality of these nine beneficial site mutations in combination; of these two mutants proved superior to all the other mutants, 30 including those with single point mutations. 210 WO 00/58517 PCT/US00/08245 Example 6 Direct expression cloning using end-selection An esterase gene was amplified using 5'phosphorylated primers in a standard 5 PCR reaction (10 ng template; PCR conditions: 3' 94 C; [1' 94 C; 1' 50 C; 1'30" 68 C] x 30; 10' 68 C. Forward Primer = 9511 TopF (CTAGAAGGGAGGAGAATTACATGAAGCGGCTTTTAGCCC) 10 Reverse Primer = 9511 TopR (AGCTAAGGGTCAAGGCCGCACCCGAGG) The resulting PCR product (ca. 1000 bp) was gel purified and quantified. A vector for expression cloning, pASK3 (Institut fuer Bioanalytik, Goettingen, Germany), was cut with Xba I and Bgl II and dephosphorylated with 15 CIP. 0.5 pmoles Vaccina Topoisomerase I (Invitrogen, Carlsbad, CA) was added to 60 ng (ca. 0.1 pmole) purified PCR product for 5' 37 C in buffer NEB I (New England Biolabs, Beverly, MA) in 5 pl total volume. 20 The topogated PCR product was cloned into the vector pASK3 (5 pl, ca. 200 ng in NEB I) for 5' at room temperature. This mixture was dialyzed against H 2 0 for 30'. 2 pl were used for electroporation of DH1OB cells (Gibco BRL, Gaithersburg, MD). 25 Efficiency: Based on the actual clone numbers this method can produce 2 x 106 clones per ptg vector. All tested recombinants showed esterase activity after induction with anhydrotetracycline. 211 WO 00/58517 PCT/US0O/08245 Example 7 Dehalogenase Thermal Stability This invention provides that a desirable property to be generated by directed 5 evolution is exemplified in a limiting fashion by an improved residual activity (e.g. an enzymatic activity, an immunoreactivity, an antibiotic acivity, etc.) of a molecule upon subjection to altered environment, including what may be considered a harsh enviroment, for a specified time. Such a harsh environment may comprise any combination of the following (iteratively or not, and in any order or permutation): an 10 elevated temperature (including a temperature that may cause denaturation of a working enzyme), a decreased temperature, an elevated salinity, a decreased salinity, an elevated pH, a decreased pH, an elevated pressure, a decreassed pressure, and an change in exposure to a radiation source (including uv radiation, visible light, as well as the entire electromagnetic spectrum). 15 The following example shows an application of directed evolution to evolve the ability of an enzyme to regain &/or retain activity upon exposure to an elevated temperature. Every residue (316) of a dehalogenase enzyme was converted into all 20 amino 20 acids by site directed mutagenesis using 32-fold degenerate oligonucleotide primers. These mutations were introduced into the already rate-improved variant Dhla 20F12. Approximately 200 clones of each position were grown in liquid media (384 well microtiter plates) to be screened. The screening procedure was as follows: 25 1. Overnight cultures in 384-well plates were centrifuged and the media removed. To each well was added 0.06 mL 1 mM Tris/S0 4 2 pH 7.8. 2. The robot made 2 assay plates from each parent growth plate consisting of 0.02 mL cell suspension. 3. One assay plate was placed at room temperature and the other at elevated 30 temperature (initial screen used 55C) for a period of time (initially 30 minutes). 212 WO 00/58517 PCT/US00/08245 4. After the prescribed time 0.08 mL room temperature substrate (TCP saturated 1 mM Tris/S0 4 2 pH 7.8 with 1.5 mM NaN 3 and 0.1 mM bromothymol blue) was added to each well. TCP = trichloropropane. 5. Measurements at 620 nm were taken at various time points to generate a 5 progress curve for each well. 6. Data were analyzed and the kinetics of the cells heated to those not heated were compared. Each plate contained 1-2 columns (24 wells) of un-mutated 20F12 controls. 7. Wells that appeared to have improved stability were regrown and tested 10 under the same conditions. Following this procedure nine single site mutations appeared to confer increased thermal stability on Dhla-20F12. Sequence analysis showed that the following changes were beneficial: 15 D89G F91 S T159L G189Q, G189V 20 1220L N238T W251Y P302A, P302L, P302S, P302K P302RS306R 25 Only two sites (189 and 302) had more than one substitution. The first 5 on the list were combined (using G 189Q) into a single gene (this mutant is referred to as "Dhla5"). All changes but S306R were incorporated into another variant referred to as Dhla8. 30 Thermal stability was assessed by incubating the enzyme at the elevated temperature (55'C and 80'C) for some period of time and activity assay at 30'C. Initial rates 213 WO 00/58517 PCT/USOO/08245 were plotted vs. time at the higher temperature. The enzyme was in 50 mM Tris/S0 4 pH 7.8 for both the incubation and the assay. Product (C~) was detected by a standard method using Fe(N0 3
)
3 and HgSCN. Dhla 20F12 was used as the de facto wild type. The apparent half-life (Tu/ 2 ) was calculated by fitting the data to an 5 exponential decay function. These results are shown in Figure 1. 214 WO 00/58517 PCT/USOO/08245 LITERATURE CITED Unless otherwise indicated, all references cited herein (supra and infra) are incorporated by reference in their entirety. 5 Barret AJ, et al., eds.: Enzyme Nomenclature: Recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology. San Diego: Academic Press, Inc., 1992. Boyce COL, ed.: Novo's Handbook of Practical Biotechnology. 2 nd ed. Bagsvaerd, 10 Denmark, 1986. Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic Synthesis: A Comprehensive Handbook. Vol. 1. New York: VCH Publishers, 1995. 15 Drauz K, Waldman H, eds.: Enzyme Catalysis in Organic Synthesis: A Comprehensive Handbook. Vol. 2. New York: VCH Publishers, 1995. Foster GD, Taylor SC, eds.: Plant Virology Protocols: From Virus Isolation to Transgenic Resistance. Methods in Molecular Biology, Vol. 81. New Jersey: 20 Humana Press Inc., 1998. Franks F, ed.: Protein Biotechnology: Isolation. Characterization, and Stabilization. New Jersey: Humana Press Inc., 1993. 25 Godfrey T, West S, eds.: Industrial Enzymology. 2 ed. London: Macmillan Press Ltd, 1996. Gottschalk G: Bacterial Metabolism. 2 nd ed. New York: Springer-Verlag Inc., 1986. 30 Gresshoff PM, ed.: Technology Transfer of Plant Biotechnology. Current Topics in Plant Molecular Biology. Boca Raton: CRC Press, 1997. 215 WO 00/58517 PCT/USOO/08245 Griffin HG, Griffin AM, eds.: PCR Technology: Currrent Innovations. Boca Raton: CRC Press, Inc., 1994. Hansen G, Chilton MD: Lessons in gene transfer to plants by a gifted microbe. Curr 5 Top Microbiol Immunol 240:21-57, 1999. Hartmann HT, et al.: Plant Propagation: Principles and Practices. 6 th ed. New Jersey: Prentice Hall, Inc., 1997. 10 Perun TJ, Propst CL, eds.: Computer-Aided Drug Design: Methods and Applications. New York: Marcel Dekker, Inc., 1989. Owen MRL, Pen J: Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins. Chichester: John Wiley & Sons, 1996. 15 Segel IH: Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. New York: John Wiley & Sons, Inc., 1993. White JS, White DC: Source Book of Enzymes. Boca Raton: CRC Press, 1997. 20 Wong CH, Whitesides GM: Enzymes in Synthetic Organic Chemistry. Vol. 12. New York: Elsevier Science Publications, 1995. WO 97/35966; Filed Mar. 20, 1997, Published Oct. 2, 1997. Minshull J, Stemmer 25 WP: Mehtods and Compositions for Cellular and Metabolic Engineering. WO 98/31837; Filed Jan. 16, 1998, Published July 23, 1998. Delcardayre SB, Tobin MB, Stemmer WP, Minshull, J: Evolution of Whole Cells and Organisms by Recursive Sequence Recombination. 30 WO 98/37223; Filed Feb. 18 1998, Published Aug. 27, 1998. Pang SZ, Gonsalves D, Jan FJ: DNA Construct to Confer Multiple Traits on Plants. 216 WO 00/58517 PCT/USOO/08245 Alting-Mecs MA and Short JM: Polycos vectors: a system for packaging filamentous phage and phagemid vectors using lambda phage packaging extracts. Gene 137:1, 93-100, 1993. 5 Arkin AP and Youvan DC: An algorithm for protein engineering: simulations of recursive ensemble mutagenesis. Proc Natl Acad Sci USA 89(16):7811-7815, (Aug 15) 1992. 10 Arnold FH: Protein engineering for unusual environments. Current Opinion in Biotechnology 4(4):450-455, 1993. Ausubel FM, et al Editors. Current Protocols in Molecular Biology, Vols. 1 and 2 and supplements. (a.k.a. "The Red Book") Greene Publishing Assoc., Brooklyn, 15 NY, @1987. Ausubel FM, et al Editors. Current Protocols in Molecular Biology, Vols. 1 and 2 and supplements. (a.k.a. "The Red Book") Greene Publishing Assoc., Brooklyn, NY, @1989. 20 Ausubel FM, et al Editors. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. Greene Publishing Assoc., Brooklyn, NY, @1989. 25 Ausubel FM, et al Editors. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 2 "d Edition. Greene Publishing Assoc., Brooklyn, NY, @ 1992. Barbas CF 3d, Bain JD, Hoekstra DM. Lerner RA: Semisynthetic combinatorial 30 antibody libraries: a chemical solution to the diversity problem. Proc Natl Acad Sci USA 89(10):4457-4461, 1992. 217 WO 00/58517 PCT/USOO/08245 Bardwell AJ, Bardwell L, Johnson DK, Friedberg EC: Yeast DNA recombination and repair proteins RadI and Rad10 constitute a complex in vivo mediated by localized hydrophobic domains. Mol Microbiol 8(6):1177-1188, 1993. 5 Bartel P, Chien CT, Sternglanz R, Fields S: Elimination of false positives that arise in using the two-hybrid system. Biotechniques 14(6):920-924, 1993. Beaudry AA and Joyce GF: Directed evolution of an RNA enzyme. Science 257(5070):635-641, 1992. 10 Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques. Academic Press, Inc., San Diego, CA, @1987. (Cumulative Subject Index: Volumes 135-139, 141-167, 1990, 272 pp.) 15 Bevan M: Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12(22):8711-21, 1984. Biocca S, Pierandrei-Amaldi P, Cattaneo A: Intracellular expression of anti-p2lras single chain Fv fragments inhibits meiotic maturation of xenopus oocytes. Biochem 20 Biophys Res Commun 197(2):422-427, 1993. Bird et al. Plant Mol Biol 11:651, 1988.. Bogerd HP, Fridell RA, Blair WS, Cullen BR: Genetic evidence that the Tat 25 proteins of human immunodeficiency virus types 1 and 2 can multimerize in the eukaryotic cell nucleus. J Virol 67(8):5030-5034, 1993. Brederode FT, Koper-Zawrthoff EC, Bol JF: Complete nucleotide sequence of alfalfa mosaic virus RNA 4. Nucleic Acids Research 8(10):2213-23, 1980. 30 Breitling F, Dubel S, Seehaus T, Klewinghaus I, Little M: A surface expression vector for antibody screening. Gene 104(2):147-153, 1991. 218 WO 00/58517 PCT/USOO/08245 Brown NL, Smith M: Cleavage specificity of the restriction endonuclease isolated from Haemophilus gallinarum (Hga I). Proc Natl Acad Sci U SA 74(8):3213-6, (Aug) 1977. 5 Burton DR, Barbas CF 3d, Persson MA, Koenig S, Chanock RM, Lerner RA: A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proc Natl Acad Sci USA 88(22):10134-7, (Nov 15) 1991. 10 Caldwell RC and Joyce GF: Randomization of genes by PCR mutagenesis. PCR Methods Appl 2(10):28-33, 1992. Caton AJ and Koprowski H: Influenze virus hemagglutinin-specific antibodies 15 isolatedf froma combinatorial expression library are closely related to the immune response of the donor. Proc Nati Acad Sci USA 87(16):6450-6454, 1990. Chakraborty T, Martin JF, Olson EN: Analysis of the oligomerization of myogenin and E2A products in vivo using a two-hybrid assay system. JBiol Chem 20 267(25):17498-501, 1992. Chang CN, Landolfi NF, Queen C: Expression of antibody Fab domains on bacteriophage surfaces. Potential use for antibody selection. JImmunol 147(10):3610-4, (Nov 15) 1991. 25 Chaudhary VK, Batra JK, Gallo MG, Willingham MC, FitzGerald DJ, Pastan I: A rapid method of cloning functional variable-region antibody genes in Escherichia coli as single-chain immunotoxins. Proc Natl Acad Sci USA 87(3):1066-1070, 1990. 30 219 WO 00/58517 PCT/USOO/08245 Chien CT, Bartel PL, Stemglanz R, Fields S: The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc NatlAcadSci USA 88(21):9578-9582, 1991. 5 Chiswell DJ, McCafferty J: Phage antibodies: will new 'coliclonal' antibodies replace monoclonal antibodies? Trends Biotechnol 10(3):80-84, 1992. Chothia C and Lesk AM: Canonical structures for the hypervariable regions of immunoglobulins. JMol Biol 196)4):901-917, 1987. 10 Chothia C, Lesk AM, Tramontano A, Levitt M, Smith-Gill SJ, Air G, Sheriff S, Padlan EA, Davies D, Tulip WR, et al: Conformations of immunoglobulin hypervariable regions. Nature 342(6252):877-883, 1989. 15 Clackson T, Hoogenboom HR, Griffiths AD, Winter G: Making antibody fragments using phage display libraries. Nature 352(6336):624-628, 1991. Conrad M, Topal MD: DNA and spermidine provide a switch mechanism to regulate the activity of restriction enzyme Nae I. Proc Natl Acad Sci USA 86(24):9707-11, 20 (Dec) 1989. Coruzzi G, Broglie R, Edwards C, Chua NH: Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5 bisphosphate carboxylase. EMBO J 3(8):1671-9, 1984. 25 Dasmahapatra B, DiDomenico B, Dwyer S, Ma J, Sadowski I, Schwartz J: A genetic system for studying the activity of a proteolytic enzyme. Proc Nati Acad Sci USA 89(9):4159-4162, 1992. 30 Davis LG, Dibner MD, Battey JF. Basic Methods in Molecular Biology. Elsevier, New York, NY, @1986. 220 WO 00/58517 PCT/USOO/08245 Delegrave S and Youvan DC. Biotechnology Research 11:1548-1552, 1993. DeLong EF, Wu KY, Prezelin BB, Jovine RV: High abundance of Archaea in Antarctic marine picoplankton. Nature 371(6499):695-697, 1994. 5 Deng SJ, MacKenzie CR, Sadowska J, Michniewicz J, Young NM, Bundle Dr, Narang SA: Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display. JBiol Chem 269(13):9533-9538, 1994. 10 Duan L, Bagasra 0, Laughlin MA, Oakes JW, Pomerantz RJ: Potent inhibition of human immunodeficiency virus type 1 replication by an intracellular anti-Rev single-chain antibody. Proc Natl Acad Sci USA 91(11):5075-5079, 1994. Durfee T, Becherer K, Chen PL, Yeh SH, Yang Y, Kilburn AE, Lee WH, Elledge 15 SJ: The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev 7(4):555-569, 1993. Ellington AD and Szostak JW: In vitro selection of RNA molecules that bind specific ligands. Nature 346(6287):818-822, 1990. 20 Fields S and Song 0: A novel genetic system to detect protein-protein interactions. Nature 340(6230):245-246, 1989. Firek S, Draper J, Owen MR, Gandecha A, Cockburn B, Whitelam GC: Secretion 25 of a functional single-chain Fv protein in transgenic tobacco plants and cell suspension cultures. Plant Mol Biol 23(4):861-870, 1993. Forsblom S, Rigler R, Ehrenberg M, Philipson L: Kinetic studies on the cleavage of adenovirus DNA by restriction endonuclease Eco RI. Nucleic Acids Res 30 3(12):3255-69, (Dec) 1976. 221 WO 00/58517 PCTIUSOO/08245 Germino FJ, Wang ZX, Weissman SM: Screening for in vivo protein-protein interactions. Proc Nat? Acad Sci USA 90(3):933-937, 1993. Gingeras TR, Brooks JE: Cloned restriction/modification system from Pseudomonas 5 aeruginosa. Proc Nat? Acad Sci USA 80(2):402-6, 1983 (Jan). Gluzman Y: SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23(1):175-182, 1981. 10 Gruber M, Schodin BA, Wilson ER, Kranz DM: Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli. JImmunol 152(11):5368-5374, 1994. Guarente L: Strategies for the identification of interacting proteins. Proc Nat? Acad 15 Sci USA 90(5):1639-1641, 1993. Guilley H, Dudley RK, Jonard G, Balazs E, Richards KE: Transcription of Cauliflower mosaic virus DNA: detection of promoter sequences, and characterization of transcripts. Cell 30(3):763-73, 1982. 20 Hardy CF, Sussel L, Shore D: A RAP 1-interacting protein involved in transcriptional silencing and telomere length regulation. Genes Dev 6(5):801-814, 1992. 25 Hawkins RE and Winter G: Cell selection strategies for making antibodies from variable gene libraries: trapping the memory pool. Eur JImmunol 22(3):867-870, 1992. Holvoet P, Laroche Y, Lijnen HR, Van Hoef B, Brouwers E, De Cock F, Lauwereys 30 M, Gansemans Y, Collen D: Biochemical characterization of single-chain chimeric plasminogen activators consisting of a single-chain Fv fragment of a fibrin-specific antibody and single-chain urokinase. Eur JBiochem 210(3):945-952, 1992. 222 WO 00/58517 PCT/US0O/08245 Honjo T, Alt FW, Rabbitts TH (eds): Immunoglobulin genes. Academic Press: San Diego, CA, pp. 361-368, (D1989. 5 Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Judson P, Winter G: Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 19(15):4133 4137, 1991. 10 Huse WD, Sastry L, Iverson SA, Kang AS, Alting-Mees M, Burton DR, Benkovic SJ, Lerner RA: Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda. Science 246(4935):1275-1281, 1989. Huston JS, Levinson D, Mudgett-Hunter M, Tai MS, Novotney J, Margolies MN, 15 Ridge RJ, Bruccoleri RE, Haber E, Crea R, et al: Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc Nati Acad Sci USA 85(16):5879-5883, 1988. 20 Iwabuchi K, Li B, Bartel P, Fields S: Use of the two-hybrid system to identify the domain of p53 involved in oligomerization. Oncogene 8(6):1693-1696, 1993. Jackson AL, Pahl PM, Harrison K, Rosamond J, Sclafani RA: Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol Cell Biol 25 13(5):2899-2908, 1993. Johnson S and Bird RE: Methods Enzymol 203:88, 1991. Kabat et al: Sequences of Proteins of Immunological Interest, 4th Ed. U.S. 30 Department of Health and Human Services, Bethesda, MD (1987) 223 WO 00/58517 PCT/USOO/08245 Kang AS, Barbas CF, Janda KD, Benkovic SJ, Lerner RA: Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc Natl Acad Sci USA 88(10):4363-4366, 1991. 5 Kettleborough CA, Ansell KH, Allen RW, Rosell-Vives E, Gussow DH, Bendig MM: Isolation of tumor cell-specific single-chain Fv from immunized mice using phage-antibody libraries and the re-construction of whole antibodies from these antibody fragments. Eur JImmunol 24(4):952-958, 1994. 10 Kruger DH, Barcak GJ, Reuter M, Smith HO: EcoRlI can be activated to cleave refractory DNA recognition sites. Nucleic Acids Res 16(9):3997-4008, (May 11) 1988. Lalo D, Carles C, Sentenac A, Thuriaux P: Interactions between three common 15 subunits of yeast RNA polymerases I and III. Proc Natl Acad Sci USA 90(12):5524-5528, 1993. Laskowski M Sr: Purification and properties of venom phosphodiesterase. Methods Enzymol 65(1):276-84, 1980. 20 Lefkovits I and Pernis B, Editors. Immunological Methods, Vols. I and II. Academic Press, New York, NY. Also Vol. III published in Orlando and Vol. IV published in San Diego. @ 1979-. 25 Ivan Lefkovits, Editor. Immunology methods manual : the comprehensive sourcebook of techniques. Academic Press, San Diego, @1997. Lemer RA, Kang AS, Bain JD, Burton DR, Barbas CF 3d: Antibodies without immunization. Science 258(5086):1313-1314, 1992. 30 Leung, D.W., et al, Technique, 1:11-15, 1989. 224 WO 00/58517 PCT/USOO/08245 Li B and Fields S: Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J 7(10):957-963, 1993. 5 Lilley GG, Doelzal 0, Hillyard CJ, Bernard C, Hudson PJ: Recombinant single chain antibody peptide conjugates expressed in Escherichia coli for the rapid diagnosis of HIV. JImmunol Methods 171(2):211-226, 1994. Lowman HB, Bass SH, Simpson N, Wells JA: Selecting high-affinity binding 10 proteins by monovalent phage display. Biochemistry 30(45):10832-10838, 1991. Luban J, Bossolt KL, Franke EK, Kalpana GV, Goff SP: Human immunodeficiency virus type 1 Gag protein binds to cyclophilins A and B. Cell 73(6):1067-1078, 1993. 15 Madura K, Dohmen RJ, Varshavsky A: N-recognin/Ubc2 interactions in the N-end rule pathway. JBiol Chem 268(16):12046-54, (Jun 5) 1993. Marks JD, Hoogenboom HR, Bonnert TP, McCafferty J, Griffiths AD, Winter G: 20 By-passing immunization. Human antibodies from V-gene libraries displayed on phage. JMol Biol 222(3):581-597, 1991. Marks JD, Griffiths Ad, Malmqvist M, Clackson TP, Bye JM, Winter G: By passing immunization: building high affinity human antibodies by chain shuffling. 25 Biotechnology (N Y) 10(7):779-783, 1992. Marks JD, Hoogenboom HR, Griffiths AD, Winter G: Molecular evolution of proteins on filamentous phage. Mimicking the strategy of the immune system. J Biol Chem 267(23):16007-16010, 1992. 30 Maxam AM, Gilbert W: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol 65(1):499-560, 1980. 225 WO 00/58517 PCT/US0O/08245 McCafferty J, Griffiths AD, Winter G, Chiswell DJ: Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348(6301):552-554, 1990. Miller JH. A Short Course in Bacterial Genetics: A Laboratory Manual and 5 Handbook for Escherichia coli and Related Bacteria (see inclusively p. 445). Cold Spring Harbor Laboratory Press, Plainview, NY, @ 1992. Milne GT and Weaver DT: Dominant negative alleles of RAD52 reveal a DNA repair/ recombination complex including Rad5l and Rad52. Genes Dev 7(9):1755 10 1765,1993. Mullinax RL, Gross EA, Amberg JR, Hay BN, Hogrefe HH, Kubtiz MM, Greener A, Alting-Mees M, Ardourel D, Short JM, et al: Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage lambda 15 immunoexpression library. Proc natl Acad Sci USA 87(20):8095-9099, 1990. Nath K, Azzolina BA: in Gene Amplification and Analysis (ed. Chirikjian JG), vol. 1, p. 113, Elsevier North Holland, Inc., New York, New York, @1981. 20 Needleman SB and Wunsch CD: A general method applicable to the search for similarities in the amino acid sequence of two proteins. JMol Biol 48(3):443-453, 1970. Nelson M, Christ C, Schildkraut I: Alteration of apparent restriction endonuclease 25 recognition specificities by DNA methylases. Nucleic Acids Res 12(13):5165-73, 1984 (Jul 11). Nicholls PJ, Johnson VG, Andrew SM, Hoogenboom HR, Raus JC, Youle RJ: Characterization of single-chain antibody (sFv)-toxin fusion proteins produced in 30 vitro in rabbit reticulocyte lysate. JBiol Chem 268(7):5302-5308, 1993. 226 WO 00/58517 PCT/USO0/08245 Oller AR, Vanden Broek W, Conrad M, Topal MD: Ability of DNA and spermidine to affect the activity of restriction endonucleases from several bacterial species. Biochemistry 30(9):2543-9, (Mar 5) 1991. 5 Owens RJ and Young RJ: The genetic engineering of monoclonal antibodies. J Immunol Methods 168(2):149-165, 1994. Pearson WR and Lipman DJ: Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85(8):2444-2448, 1988. 10 Pein CD, Reuter M, Meisel A, Cech D, Kruger DH: Activation of restriction endonuclease EcoRII does not depend on the cleavage of stimulator DNA. Nucleic Acids Re s 19(19):5139-42, (Oct 11) 1991. 15 Persson MA, Caothien RH, Burton DR: Generation of diverse high-affinity human monoclonal antibodies by repertoire cloning. Proc Natl Acad Sci USA 88(6):2432 2436, 1991. Queen C, Foster J, Stauber C, Stafford J: Cell-type specific regulation of a kappa 20 immunoglobulin gene by promoter and enhance elements. Immunol Rev 89:49-68, 1986. Qiang BQ, McClelland M, Poddar S, Spokauskas A, Nelson M: The apparent specificity of NotI (5'-GCGGCCGC-3') is enhanced by M.FnuDII or M.BepI 25 methyltransferases (5'-mCGCG-3'): cutting bacterial chromosomes into a few large pieces. Gene 88(l):101-5, (Mar 30) 1990. Raleigh EA, Wilson G: Escherichia coli K-12 restricts DNA containing 5 methylcytosine. Proc Natl Acad Sci U S A 83(23):9070-4, (Dec) 1986. 30 Reidhaar-Olson JF and Sauer RT: Combinatorial cassette mutagenesis as a probe of the informational content of protein sequences. Science 241(4861):53-57, 1988. 227 WO 00/58517 PCT/USOO/08245 Riechmann L and Weill M: Phage display and selection of a site-directed randomized single-chain antibody Fv fragment for its affinity improvement. Biochemistry 32(34):8848-8855, 1993. 5 Roberts RJ, Macelis D: REBASE--restriction enzymes and methylases. Nucleic Acids Res 24(1):223-35, (Jan 1) 1996. Ryan AJ, Royal CL, Hutchinson J, Shaw CH: Genomic sequence of a 12S seed 10 storage protein from oilseed rape (Brassica napus c.v. jet neuf). Nucl Acids Res 17(9):3584, 1989. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, @ 1982. 15 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Second Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, @1989. 20 Scopes RK. Protein Purification: Principles and Practice. Springer-Verlag, New York, NY, @ 1982. Silver SC and Hunt SW 3d: Techniques for cloning cDNAs encoding interactive transcriptional regulatory proteins. Mol Biol Rep 17(3):155-165, 1993. 25 Smith TF, Waterman MS. Adv Appl Math 2: 482-end of article, 1981. Smith TF, Waterman MS: Overlapping genes and information theory. J Theor Biol 91(2):379-80, (Jul 21) 1981. 30 Smith TF, Waterman MS: Identification of common molecular subsequences. JMol Biol 147(1):195-7, (Mar 25) 1981. 228 WO 00/58517 PCT/USOO/08245 Smith TF, Waterman MS, Fitch WM: Comparative biosequence metrics. JMol Evol S18(1):38-46, 1981. Staudinger J, Perry M, Elledge SJ, Olson EN: Interactions among vertebrate helix 5 loop-helix proteins in yeast using the two-hybrid system. JBiol Chem 268(7):4608 4611, 1993. Stemmer WP, Morris SK, Wilson BS: Selection of an active single chain Fv antibody from a protein linker library prepared by enzymatic inverse PCR. 10 Biotechniques 14(2):256-265, 1993. Stemmer WP: DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc Natl Acad Sci USA 91(22):10747 10751, 1994. 15 Sun D, Hurley LH: Effect of the (+)-CC-1065-(N3-adenine)DNA adduct on in vitro DNA synthesis mediated by Escherichia coli DNA polymerase. Biochemistry 31:10, 2822-9, (Mar 17) 1992, 20 Tague BW, Dickinson CD, Chrispeels MJ: A short domain of the plant vacuolar protein phytohemagglutinin targets invertase to the yeast vacuole. Plant Cell 2(6):533-46, (June) 1990. Takahashi N, Kobayashi I: Evidence for the double-strand break repair model of 25 bacteriophage lambda recombination. Proc Natl Acad Sci U S A 87(7):2790-4, (Apr) 1990. Thiesen HJ and Bach C: Target Detection Assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on SP 1 protein. Nucleic Acids Res 30 18(11):3203-3209, 1990. Thomas M, Davis RW: Studies on the cleavage of bacteriophage lambda DNA with EcoRI Restriction endonuclease. JMol Biol 91(3):315-28, (Jan 25) 1975. 229 WO 00/58517 PCT/USOO/08245 Tingey SV, Walker EL, Corruzzi GM: Glutamine synthetase genes of pea encode distinct polypeptides which are differentially expressed in leaves, roots and nodules. EMBOJ 6(l):1-9, 1987. 5 Topal MD, Thresher RJ, Conrad M, Griffith J: NaeI endonuclease binding to pBR322 DNA induces looping. Biochemistry 30(7):2006-10, (Feb. 19) 1991. Tramontano A, Chothia C, Lesk AM: Framework residue 71 is a major determinant 10 of the position and conformation of the second hypervariable region in the VH domains of immunoglobulins. JMol Biol 215(1):175-182, 1990. Tuerk C and Gold L: Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249(4968):505-510, 15 1990. van de Poll ML, Lafleur MV, van Gog F, Vrieling H, Meerman JH: N-acetylated and deacetylated 4'-fluoro-4-aminobiphenyl and 4-aminobiphenyl adducts differ in their ability to inhibit DNA replication of single-stranded M13 in vitro and of single 20 stranded phi X174 in Escherichia coli. Carcinogenesis 13(5):751-8, (May) 1992. Vojtek AB, Hollenberg SM, Cooper JA: Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74(l):205-214, 1993. 25 Wenzler H, Mignery G, Fisher L, Park W: Sucrose-regulated expression of a chimeric potato tuber gene in leaves of transgenic tobacco plants. Plant Mol Biol 13(4):347-54, 1989. Williams and Barclay, in Immunoglobulin Genes, The Immunoglobulin Gene 30 Superfamily 230 WO 00/58517 PCT/USOO/08245 Winnacker EL. From Genes to Clones: Introduction to Gene Technology. VCH Publishers, New York, NY, @1987. Winter G and Milstein C: Man-made antibodies. Nature 349(6307):293-299, 1991. 5 Yang X, Hubbard EJ, Carlson M: A protein kinase substrate identified by the two hybrid system. Science 257(5070):680-2, (Jul 31) 1992. 10 USPN 4,683,195; Filed Feb. 7, 1986, Issued Jul 28. 1987. Mullis KB, Erlich HA, Arnheim N, Horn GT, Saiki RK, Scharf SJ: Process for Amplifying, Detecting, and/or Cloning Nucleic Acid Sequences. USPN 4,683,202; Filed Oct. 25, 1985, Issued Jul. 28, 1987. Mullis KB: Process for 15 Amplifying Nucleic Acid Sequences. USPN 4,704,362; Filed Nov. 5, 1979, Issued Nov. 3, 1987. Itakura K, Riggs AD: Recombinant Cloning Vehicle Microbial Polypeptide Expression. 20 WO 88/08453; Filed Apr. 14, 1988, Published Nov. 3, 1988. Alakhov JB, Baranov, VI, Ovodov SJ, Ryabova LA, Spirin AS: Method of Obtaining Polypeptides in Cell Free Translation System. WO 90/05785; Filed Nov. 15, 1989, Published May 31, 1990. Schultz P: Method 25 for Site-Specifically Incorporating Unnatural Amino Acids into Proteins. WO 90/07003; Filed Jan. 27, 1989, Published June 28, 1990. Baranov VI, Morozov IJ, Spirin AS: Method for Preparative Expression of Genes in a Cell-free System of Conjugated Transcription/translation. 30 WO 91/02076; Filed June 14, 1990, Published Feb. 21, 1991. Baranov VI, Ryabova LA, Yarchuk OB, Spirin AS: Method for Obtaining Polypeptides in a Cell-free System. 231 WO 00/58517 PCT/USOO/08245 WO 91/05058; Filed Oct. 5, 1989, Published Apr. 18, 1991. Kawasaki G: Cell-free Synthesis and Isolation of Novel Genes and Polypeptides. 5 WO 91/17271; Filed May 1, 1990, Published Nov. 14, 1991. Dower WJ, Cwirla SE: Recombinant Library Screening Methods. WO 91/18980; Filed May 13, 1991, Published Dec. 12, 1991. Devlin JJ: Compositions and Methods for Indentifying Biologically Active Molecules. 10 WO 91/19818; Filed June 20, 1990, Published Dec. 26, 1991. Dower WJ, Cwirla SE, Barrett RW: Peptide Library and Screening Systems. WO 92/02536; Filed Aug. 1, 1991, Published Feb. 20, 1992. Gold L, Tuerk C: 15 Systematic Polypeptide Evolution by Reverse Translation. WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992. Lonberg N, Kay RM: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. 20 WO 92/03918; Filed Aug. 28, 1991, Published Mar. 19, 1992. Lonberg N, Kay RM: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. WO 92/05258; Filed Sept. 17, 1991, Published Apr. 2, 1992. Fincher GB: Gene Encoding Barley Enzyme. 25 WO 92/14843; Filed Feb. 21, 1992, Published Sept. 3, 1992. Toole JJ, Griffin LC, Bock LC, Latham JA, Muenchau DD, Krawczyk S: Aptamers Specific for Biomolecules and Method of Making. 30 WO 93/08278; Filed Oct. 15, 1992, Published Apr. 29, 1993. Schatz PJ, Cull MG, Miller JF, Stemmer WP: Peptide Library and Screening Method. 232 WO 00/58517 PCT/US00/08245 WO 93/12227; Filed Dec 17, 1992, Published June 24, 1993. Lonberg, N; Kay RM: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. WO 93/12227; Filed Dec. 17, 1992, Published June 24, 1993. Lonberg N, Kay RM: 5 Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994. Lonberg, N, Kay RM: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. 10 WO 94/25585; Filed Apr. 25, 1994, Published Nov. 10, 1994. Lonberg N, Kay RM: Transgenic Non-human Animals Capable of Producing Heterologous Antibodies. Arslan T, Abraham AT, Hecht SM: Structurally altered substrates for DNA 15 topoisomerase I. Effects of inclusion of a single 3'-deoxynucleotide within the scissile strand. Nucleosides Nucleotides 1998 Jan-Mar;17(1-3):515-30. Aupeix K, Toulme JJ: Binding of chemically-modified oligonucleotides to the double-stranded stem of an RNA hairpin. Nucleosides Nucleotides 1999 Jun 20 Jul;18(6-7):1647-50. Bazzanini R, Manfredini S, Durini E, Groschel B, Cinatl J, Balzarini J, De Clercq E, Imbach JL, Perigaud C, Gosselin G: Prodrugs of Ara-CMP and Ara-AMP with a S acyl-2-thioethyl (SATE) biolabile phosphate protecting group: synthesis and 25 biological evaluation. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):971-2. Blackburn GM, Liu X, Rosler A, Brenner C: Two hydrolase resistant analogues of diadenosine 5',5"'-P1,P3-triphosphate for studies with Fhit, the human fragile histidine triad protein. Nucleosides Nucleotides 1998 Jan-Mar; 17(1-3):301-8. 30 233 WO 00/58517 PCT/USOO/08245 Bridson PK, Lin X, Melman N, Ji XD, Jacobson KA: Synthesis and adenosine receptor affinity of 7-beta-D-ribofuranosylxanthine. Nucleosides Nucleotides 1998 Apr;17(4):759-68. 5 Brodin P, Gottikh M, Auclair C, Mouscadet JF: Inhibition of HIV-1 integration by mono- & bi-functionalized triple helix forming oligonucleotides. Nucleosides Nucleotides 1999 Jun-Jul; 18(6-7):1717-8. Creighton TE: Proteins Structures and Molecular Principles. New York: W. H. 10 Freeman and Co., 1984. De Clercq E: Carbocyclic adenosine analogues as S-adenosylhomocysteine hydrolase inhibitors and antiviral agents: recent advances. Nucleosides Nucleotides 1998 Jan-Mar;17(1-3):625-34. 15 de Zwart M, Link R, von Frijtag Drabbe Kunzel JK, Cristalli G, Jacobson KA, Townsend-Nicholson A, IJzerman AP: A functional screening of adenosine analogues at the adenosine A2B receptor: a search for potent agonists. Nucleosides Nucleotides 1998 Jun; 17(6):969-85. 20 Egron D, Arzumanov AA, Dyatkina NB, Krayevsky A, Imbach JL, Aubertin AM, Gosselin G, Perigaud C: Synthesis, anti-HIV activity and stability studies of 3' azido-2',3'-dideoxythymidine 5'-fluorophosphate. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):983-4 234 WO 00/58517 PCT/USOO/08245 Gianolio DA, McLaughlin LW: Synthesis and triplex forming properties of pyrimidine derivative containing extended functionality. Nucleosides Nucleotides 1999 Aug;18(8):1751-69. 5 Gottikh MB, Volkov EM, Romanova EA, Oretskaya TS, Shabarova ZA: Synthesis of oligonucleotide-intercalator conjugates capable to inhibit HIV- 1 DNA integration. Nucleosides Nucleotides 1999 Jun-Jul; 18(6-7):1645-6. 10 Hotoda H, Koizumi M, Ohmine T, Furukawa H, Nishigaki T, Abe K, Kosaka T, Tsutsumi S, Sone J, Kaneko M: Biologically active oligodeoxyribonucleotides. 10: anti-HIV- 1 activity and stability of modified hexanucleotides containing glycerol skeleton. Nucleosides Nucleotides 1998 Jan-Mar; 17(1-3):243-52. JP10113194; Filed 19971022, Published 19980506. Donnelly, JJ ;Dwarki, VJ ;Liu, 15 MA ;Montgomery, DL ;Parker, S ;Shiver, JW ;Ulmer JB: Nucleic Acid Preparation. Kang SH, Sinhababu AK, Cho MJ: Synthesis and biological activity of bis(pivaloyloxymethyl) ester of 2'-azido-2'-deoxyuridine 5'-monophosphate. Nucleosides Nucleotides 1998 Jun; 17(6):1089-98. 20 Krayevsky A, Arzumanov A, Shirokova E, Dyatkina N, Victorova L, Jasko M, Alexandrova L: dNTP modified at triphosphate residues: substrate properties towards DNA polymerases and stability in human serum. Nucleosides Nucleotides 1998 Jan-Mar;17(1-3):681-93. 25 235 WO 00/58517 PCT/USOO/08245 Krayevsky AA, Dyatkina NB, Semizarov DG, Victorova LS, Shirokova EA, Theil F, Von Janta Lipinski MJ, Gosselin G, Imbach JL: Reasons and limits of substrate activity of modified L-dNTP in DNA biosynthesis. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):863-4. 5 Kvasyuk EI, Mikhailopulo IA, Suhadolnik RJ, Henderson EE, Muto NF, Iacono KT, Homon J, Pfleiderer W: Synthesis and biological activity of 2',5'-oligoadenylate trimers containing 5'-terminal 5'-amino-5'-deoxy- and 5'-amino-3',5' dideoxyadenosine derivatives. Nucleosides Nucleotides 1999 Jun-Jul; 18(6-7):1483 10 4. Liu J, Skradis A, Kolar C, Kolath J, Anderson J, Lawson T, Talmadge J, Gmeiner WH: Increased cytotoxicity and decreased in vivo toxicity of FdUMP[10] relative to 5-FU. Nucleosides Nucleotides 1999 Aug; 18(8):1789-802. 15 Lutz MJ, Will DW, Breipohl G, Benner SA, Uhlmann E: Synthesis of a monocharged peptide nucleic acid (PNA) analog and its recognition as substrate by DNA polymerases. Nucleosides Nucleotides 1999 Mar; 18(3):393-40 1. 20 Monaco V, van de Wetering KI, Meeuwenoord NJ, van den Elst HA, Stuivenberg HR, Visse R, van der Kaaden JC, Moolenaar GF, Verhoeven EE, Goosen N, van der Marel GA, van Boom JH: Synthesis and biological evaluation of modified DNA fragments for the study of nucleotide excision repair in E. coli. Nucleosides Nucleotides 1999 Jun-Jul;18(6-7):1339-41. 25 Morozova OV, Kolpashchikov DM, Ivanova TM, Godovikova TS: Synthesis of new photocross-linking 5-C-base-substituted UTP analogs and their application in highly selective affinity labelling of the tick-borne encephalitis virus RNA replicase proteins. Nucleosides Nucleotides 1999 Jun-Jul; 18(6-7):1513-4. 30 236 WO 00/58517 PCT/USOO/08245 Nguyen-Ba N, Chan L, Quimpere M, Turcotte N, Lee N, Mitchell H, Bedard J: Design and SAR study of a novel class of nucleotide analogues as potent anti HCMV agents. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):821-7. 237 WO 00/58517 PCT/USO0/08245 Pandolfi D, Rauzi F, Capobianco ML: Evaluation of different types of end-capping modifications on the stability of oligonucleotides toward 3'- and 5'-exonucleases. Nucleosides Nucleotides 1999 Sep; 18(9):2051-69. 5 Pankiewicz KW, Lesiak-Watanabe K: Novel mycophenolic adenine bis(phosphonate)s as potent anticancer agents and inducers of cells differentiation. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):927-32. Perrin DM, Garestier T, Helene C: Expanding the catalytic repertoire of nucleic acid 10 catalysts: simultaneous incorporation of two modified deoxyribonucleoside triphosphates bearing ammonium and imidazolyl functionalities. Nucleosides Nucleotides 1999 Mar; 18(3):377-91. Pfundheller HM, Koshkin AA, Olsen CE, Wengel J: Evaluation of oligonucleotides 15 containing two novel 2'-O-methyl modified nucleotide monomers: a 3'-C-allyl and a 2'-O,3'-C-linked bicyclic derivative. Nucleosides Nucleotides 1999 Sep;18(9):2017 30. Ramasamy KS, Stoisavljevic V: Synthesis and biophysical studies of modified 20 oligonucleotides containing acyclic amino alcohol nucleoside analogs. Nucleosides Nucleotides 1999 Aug; 18(8):1845-61. Schinazi RF, Lesnikowski ZJ: Boron containing oligonucleotides. Nucleosides Nucleotides 1998 Jan-Mar;17(1-3):635-47. 25 Secrist JA 3rd, Parker WB, Allan PW, Bennett LL Jr, Waud WR, Truss JW, Fowler AT, Montgomery JA, Ealick SE, Wells AH, Gillespie GY, Gadi VK, Sorscher EJ: Gene therapy of cancer: activation of nucleoside prodrugs with E. coli purine nucleoside phosphorylase. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):745-57. 30 238 WO 00/58517 PCT/USOO/08245 Shirokova EA, Shipitsin AV, Victorova LS, Dyatkina NB, Goryunova LE, Beabealashvilli RS, Hamilton CJ, Roberts SM, Krayevsky AA: Modified nucleoside 5'-triphosphonates as a new type of antiviral agents. Nucleosides Nucleotides 1999 Apr-May; 18(4-5):1027-8. 5 Srivastava TK, Friedhoff P, Pingoud A, Katti SB: Application of oligonucleoside methylphosphonates in the studies on phosphodiester hydrolysis by Serratia endonuclease. Nucleosides Nucleotides 1999 Sep; 18(9):1945-60. 10 Stattel JM, Yanachkov I, Wright GE: Synthesis and biochemical study of N2-(p-n butylphenyl)-2'-deoxyguanosine 5'-(alpha,beta-imido)triphosphate (BuPdGMPNHPP): a non-substrate inhibitor of B family DNA polymerases. Nucleosides Nucleotides 1998 Aug; 17(8):1505-13. Terato H, Morita H, Ohyama Y, Ide H: Novel modification of 5-formyluracil by 15 cysteine derivatives in aqueous solution. Nucleosides Nucleotides 1998 Jan Mar;17(1-3):131-41. Tomikawa A, Seno M, Sato-Kiyotaki K, Ohtsuki C, Hirai T, Yamaguchi T, Kawaguchi T, Yoshida S, Saneyoshi M: Synthetic nucleosides and nucleotides. 40. 20 Selective inhibition of eukaryotic DNA polymerase alpha by 9-(beta-D arabinofuranosyl)-2-(p-n-butylanilino) adenine 5'-triphosphate (BuAaraATP) and its 2'-up azido analog: synthesis and enzymatic evaluations. Nucleosides Nucleotides 1998 Jan-Mar;17(1-3):487-501. US5580859; Filed 19940318, Issued 19961203. Felgner, PL. ;Wolff, JA. ;Rhodes, 25 GH. ;Malone, RW. ;Carson, DA.: Delivery of exogenous DNA sequences in a mammal. US5589466; Filed 19950126, Issued 19961231. Felgner, PL. ;Wolff, JA. ;Rhodes, GH. ;Malone, RW. ;Carson, DA.: Induction of a protective immune response in a mammal by injecting a DNA sequence. 30 US5641665; Filed 19941128, Issued 19970624. Hobart, PM. ;Margalith, M ;Parker, SE. ;Khatibi, S: Plasmids suitable for IL-2 expression. 239 WO 00/58517 PCT/USOO/08245 US5693622; Filed 19950607, Issued 19971202. Wolff, JA. ;Duke, DJ. ;Felgner, PL.: Expression of exogenous polynucleotide sequences cardiac muscle of a mammal. US5703055; Filed 19940126, Issued 19971230. Felgner, PL. ;Wolff, JA ;Rhodes, GH. ;Malone, RW ;Carson, DA.: Generation of antibodies through lipid mediated 5 DNA delivery. US5846946; Filed 19960614, Issued 19981208. Huebner, RC. ;Norman, JA. ;Liang, X ;Carner, KR. ;Barbour, AG. ;Luke, CJ.: Compositions and methods for administering Borrelia DNA. US5910488; Filed 19951201, Issued 19990608. Nabel, GJ. ;Nabel, EG. ;Lew, D; 10 Marquet, M: Plasmids suitable for gene therapy. Victorova LS, Semizarov DG, Shirokova EA, Alexandrova LA, Arzumanov AA, Jasko MV, Krayevsky AA: Human DNA polymerases and retroviral reverse transcriptases: selectivity in respect to dNTPs modified at triphosphate residues. 15 Nucleosides Nucleotides 1999 Apr-May; 18(4-5):1031-2. von Janta-Lipinski M, Gaertner K, Lehmann C, Scheer H, Schildt J, Matthes E: Protein and RNA of human telomerase as targets for modified oligonucleotides. Nucleosides Nucleotides 1999 Jun-Jul; 18(6-7):1719-20 20 W09011092; Filed 19900321, Al Published 19901004. Felgner, PL. ;Wolff, JA;Rhodes, GH. ;Malone, RW ;Carson, DA.: Expression Of Exogenus Polynucleotide Sequences In A Vertebrate. W09314778; Filed 19930121, Al Published 19930805. Rhodes, GH. ;Dwarki, VJ.;Felgner, PL;Wang-Felgner, J;Manthorpe, M: Ex Vivo Gene Transfer. 25 W09421797; Filed 19940314, Al Published 19940929. Donnelly, JJ. ;Dwarki, VJ. ;Liu, MA. ;Montgomery, DL. ;Parker, SE. ;Shiver, JW. ;Ulmer, JB.: Nucleic Acid Pharmaceuticals. W09633736; Filed 19960426, Al Published 19961031. Baruch DI; Pasloske BL; Howard, RJ: Malaria Peptides and Vaccines. 240 WO 00/58517 PCT/USOO/08245 W09735992; Filed 19970317, Al Published 19971002. Hobart, PM. ;Liang, X: Tetracycline Inducible/Repressible Systems. W09926663; Filed 19981120, A2 Published 19990603. Horton, H ;Parker, S;Manthorpe, M; Felgner, P: Treatment Of Cancer Using Cytokine-Expressing 5 Polynucleotides And Compositions Therefor. W09941368; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmer WP, Whalen RG; Howard, R: Optimization of Immunomodulatory Properties of Genetic Vaccines. 10 W09941369; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmer WP, Whalen RG; Howard, R: Genetic Vaccine Vector Engineering. W09941383; Filed 19990210, Al Published 19990819. Punnonen J, Bass, SH, Whalen, RG, Howard, R, Stemmer, WP: Antigen Library Immunization. W09941402; Filed 19990210, A2 Published 19990819. Punnonen J, Stemmer, WP, 15 Howard R, Patten PA: Targeting of Genetic Vaccine Vectors. 241
Claims (13)
- 2. The method of claim 1 for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 3' exonuclease treatment that acts on 3' underhangs and blunt ends, to liberate 3'-terminal but not 5' terminal nucleotides; whereby said 3' exonuclease is exemplified, in a non-limiting fashion, by treatment with an exonuclease, such as exonuclease III, to liberate 3'-terminal but not 5' terminal nucleotides from a starting double stranded polynucleotide, leaving a remaining strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner. 243 WO 00/58517 PCT/USOO/08245
- 3. The method of claim 1 for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 5' exonuclease treatment that acts on 5' underhangs to liberate 5'-terminal nucleotides; whereby said 5' exonuclease is exemplified, in a non-limiting fashion, by treatment with an exonuclease, such as red alpha gene product, to liberate 5'-terminal nucleotides from a starting double stranded polynucleotide, leaving a remaining strand that is partially or completely free of its original partner so that, if desired, the remaining strand may be used to achieve hybridization to another partner.
- 4. The method of claim 1 for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby said treatment is exemplified, in a non-limiting fashion, by subjection to an exonuclease treatment, such as treatment with Mung Bean Nuclease or treatment with SI Nuclease or treatment with E.coli DNA Polymerase, that acts on overhanging ends, including on unhybridized ends, to liberate nucleotides from an unhybridized single-stranded end of an annealed nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened but hybridized end to facilitate polymerase-based extension and/or ligase mediated ligation of the treated end. 244 WO 00/58517 PCT/USOO/08245
- 5. The method of claim 1 for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 3' exonuclease treatment that acts on 3' underhangs and blunt ends, to liberate 3'-terminal but not 5' terminal nucleotides; and (ii) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby the exonuclease-mediated reassembly process is comprised of a dual treatment, that can be performed, for example, non-simultaneously, with both an exonuclease that liberates terminal nucleotides from underhangs or blunt ends as well as an exonuclease that liberates terminal nucleotides from overhangs such as unhybridized ends. 245 WO 00/58517 PCTIUSOO/08245
- 6. The method of claim 1 for producing a mutagenized progeny polynucleotide, wherein the step of (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease-mediated reassembly process so as to produce a progeny polynucleotide set; is comprised of: (i) subjecting a starting or parental polynucleotide set to a 5' exonuclease treatment that acts on 5' underhangs to liberate 5'-terminal nucleotides; and (ii) subjecting a starting or parental polynucleotide set to an exonuclease treatment that liberates terminal nucleotides from nucleic acid overhangs; whereby the exonuclease-mediated reassembly process is comprised of a dual treatment, that can be performed, for example, non-simultaneously, with both an exonuclease that liberates terminal nucleotides from underhangs or blunt ends as well as an exonuclease that liberates terminal nucleotides from overhangs such as unhybridized ends. 246 WO 00/58517 PCT/USOO/08245
- 7. A method f6r producing a mutagenized progeny polynucleotide having at least one desirable property comprised of the step of: (a) subjecting a starting or parental polynucleotide set to an in vitro exonuclease mediated reassembly process so as to produce a progeny polynucleotide set; and (b) subjecting the progeny polynucleotide set to an end selection-based screening and enrichment process, so as to select for a desirable subset of the progeny polynucleotide set; whereby the above steps can be performed iteratively and in any order and in combination; whereby the end selection-based process creates ligation-compatible ends; whereby the creation of ligation-compatible ends is optionally used to facilitate one or more intermolecular ligations, that are preferably directional ligations, within members of the progeny polynucleotide set so as to achieve assembly &/or reassembly mutagenesis; whereby the creation of ligation-compatible ends serves to facilitate ligation of the progeny polynucleotide set into an expression vector system and expression cloning; whereby the expression cloning of the progeny polynucleotide set serves to generate a polypeptide set; whereby the generated polypeptide set can be subjected to an expression screening process; and whereby expression screening of the progeny polypeptide set provides a means to identify a desirable species, e.g. a mutant polypeptide or alternatively a polypeptide fragment, that has a desirable property, such as a specific enzymatic activity. 247 WO 00/58517 PCT/USOO/08245
- 8. A method for generating a mutagenized progeny polynucleotide from a collection of progenitor polynucleotides, comprising: a) annealing a poly-binding nucleic acid strand to two mono-binding nucleic acid strands to generate an annealed heteromeric complex of nucleic acid strands; wherein the poly-binding nucleic acid strand and the two mono-binding nucleic acid strands are each derived from a different molecular species in said collection of progenitor polynucleotides; wherein the said collection of progenitor polynucleotides is preferably comprised of nonidentical though possibly related progenitor polynucleotides, as exemplified by a collection of genes encoding dehalogenases; and wherein the poly-binding nucleic acid strand to two mono-binding nucleic acid strands each have at least a 7 nucleotide-long sequence of identity to the progenitor polynucleotides from which it is derived; b) and subjecting the unhybridized single-stranded ends of the annealed mono binding nucleic acid strands in the heteromeric complex to an exonuclease treatment that degrades said unhybridized ends; whereby the annealment of working poly-binding and mono-binding strands derived from nonidentical polynucleotides thus allows one to generate a chimerization of said nonidentical polynucleotides; whereby, in a library of said annealed complexes of nucleic acid strands, many component strands have unhybridizable ends that are suboptimal or not serviceable for priming polymerase-based extension; and whereby the exonuclease treatment removes such unhybridizable ends to convert the annealed complexes of nucleic acid strands into better primers for polymerase-based extension. 248 WO 00/58517 PCT/USOO/08245
- 9. The method of claim 8, further comprising the step of: c) subjecting the annealed heteromeric complex to polymerase-based extension.
- 10. The method of claim 9, further comprising the step of: d) subjecting the annealed nucleic acid strands to a ligase treatment; whereby subjection to ligase treatment is exemplified by subjection to T4 DNA Ligase treatment to achieve intermolecular ligation between the two annealed mono-binding strands, which thus become covalently linked forming a chimerized strand.
- 11. The method of claim 10, further comprising the step of: e) separating the poly-binding nucleic acid strand from the ligated mono-binding nucleic acid strands; whereby the separation of a poly-binding nucleic acid strand from ligated mono binding nucleic acid strands to which it is annealed can be achieved, for example, by either denaturation or by exposure to an enzymatic activity that selectively acts on the poly-binding nucleic acid strands.
- 12. The method of claim 11, further comprising the step of: f) generating a nucleic acid strand that is complementary to the ligated mono binding nucleic acid strand; whereby the resultant product is comprised of a double stranded mutagenized progeny polynucleotide. 249 WO 00/58517 PCT/USOO/08245
- 13. The method of any of claims 1-12 wherein the mutagenized progeny polynucleotide is a gene or gene pathway.
- 14. The method of 13 further comprising: expressing the generated mutagenized progeny polypeptide in a suitable host; whereby said expression leads to the generation of a product of the polypeptide that can be detected by expression screening. 250
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2005203018A AU2005203018A1 (en) | 1999-03-26 | 2005-07-11 | Exonuclease-mediated nucleic acid reassembly in directed evolution |
AU2005225057A AU2005225057A1 (en) | 1999-03-26 | 2005-10-19 | Synthetic ligation reassembly in directed evolution |
AU2009212959A AU2009212959B2 (en) | 1999-06-14 | 2009-09-03 | Synthetic ligation reassembly in directed evolution |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/276,860 US6352842B1 (en) | 1995-12-07 | 1999-03-26 | Exonucease-mediated gene assembly in directed evolution |
US09276860 | 1999-03-26 | ||
US09/332,835 US6537776B1 (en) | 1999-06-14 | 1999-06-14 | Synthetic ligation reassembly in directed evolution |
US09332835 | 1999-06-14 | ||
PCT/US2000/008245 WO2000058517A1 (en) | 1999-03-26 | 2000-03-27 | Exonuclease-mediated nucleic acid reassembly in directed evolution |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2005203018A Division AU2005203018A1 (en) | 1999-03-26 | 2005-07-11 | Exonuclease-mediated nucleic acid reassembly in directed evolution |
Publications (1)
Publication Number | Publication Date |
---|---|
AU4039400A true AU4039400A (en) | 2000-10-16 |
Family
ID=26958167
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU40394/00A Abandoned AU4039400A (en) | 1999-03-26 | 2000-03-27 | Exonuclease-mediated nucleic acid reassembly in directed evolution |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1092041A4 (en) |
JP (1) | JP2004500019A (en) |
AU (1) | AU4039400A (en) |
CA (1) | CA2329122A1 (en) |
MX (1) | MXPA00011569A (en) |
WO (1) | WO2000058517A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU783823B2 (en) * | 1999-11-09 | 2005-12-08 | Bayer Schering Pharma Aktiengesellschaft | Method for the production of biopolymers with modified properties |
Families Citing this family (52)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6936289B2 (en) | 1995-06-07 | 2005-08-30 | Danisco A/S | Method of improving the properties of a flour dough, a flour dough improving composition and improved food products |
US6326204B1 (en) | 1997-01-17 | 2001-12-04 | Maxygen, Inc. | Evolution of whole cells and organisms by recursive sequence recombination |
US6951719B1 (en) | 1999-08-11 | 2005-10-04 | Proteus S.A. | Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained |
US6991922B2 (en) | 1998-08-12 | 2006-01-31 | Proteus S.A. | Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation |
US6500639B2 (en) | 1998-10-07 | 2002-12-31 | Maxygen, Inc. | DNA shuffling to produce nucleic acids for mycotoxin detoxification |
US6368861B1 (en) | 1999-01-19 | 2002-04-09 | Maxygen, Inc. | Oligonucleotide mediated nucleic acid recombination |
EP1073710A4 (en) * | 1999-02-04 | 2007-12-19 | Verenium Corp | Non-stochastic generation of genetic vaccines and enzymes |
US6531316B1 (en) | 1999-03-05 | 2003-03-11 | Maxyag, Inc. | Encryption of traits using split gene sequences and engineered genetic elements |
US6686515B1 (en) | 1999-11-23 | 2004-02-03 | Maxygen, Inc. | Homologous recombination in plants |
US6479262B1 (en) | 2000-05-16 | 2002-11-12 | Hercules, Incorporated | Solid phase enzymatic assembly of polynucleotides |
US6858422B2 (en) | 2000-07-13 | 2005-02-22 | Codexis, Inc. | Lipase genes |
CA2846761A1 (en) | 2000-12-01 | 2002-09-06 | Verenium Corporation | Enzymes having dehalogenase activity and methods of use thereof |
EP1356037B1 (en) | 2001-01-25 | 2011-03-09 | Evolva Ltd. | A library of a collection of cells |
US8008459B2 (en) | 2001-01-25 | 2011-08-30 | Evolva Sa | Concatemers of differentially expressed multiple genes |
BR0209154A (en) | 2001-05-18 | 2004-07-20 | Danisco | Process of preparing a dough with an enzyme |
EP1840211A1 (en) | 2001-10-31 | 2007-10-03 | Danisco A/S | Pyranosone dehydratase from phanerochaete chrysosporium |
ES2375492T3 (en) | 2003-01-17 | 2012-03-01 | Danisco A/S | PROCEDURE FOR THE IN-SITU PRODUCTION OF AN EMULSIONANT IN A FOOD. |
EP2119771B1 (en) | 2003-12-24 | 2018-08-22 | DuPont Nutrition Biosciences ApS | Proteins |
WO2008090395A1 (en) | 2007-01-25 | 2008-07-31 | Danisco A/S | Production of a lipid acyltransferase from transformed bacillus licheniformis cells |
EP2275522A3 (en) | 2004-07-16 | 2011-09-21 | Danisco A/S | Enzymatic oil-degumming method |
GB0421598D0 (en) | 2004-09-29 | 2004-10-27 | Cambridge Advanced Tech | Modification of plant development and morphology |
GB0422052D0 (en) | 2004-10-04 | 2004-11-03 | Dansico As | Enzymes |
GB0423139D0 (en) | 2004-10-18 | 2004-11-17 | Danisco | Enzymes |
SI1844144T1 (en) * | 2005-01-10 | 2010-07-30 | Medimmune Ltd | Method of mutagenesis |
GB0500417D0 (en) | 2005-01-10 | 2005-02-16 | Cambridge Antibody Tech | Method of mutagenesis |
US8143046B2 (en) | 2007-02-07 | 2012-03-27 | Danisco Us Inc., Genencor Division | Variant Buttiauxella sp. phytases having altered properties |
WO2008121992A2 (en) | 2007-03-30 | 2008-10-09 | Research Foundation Of State University Of New York | Attenuated viruses useful for vaccines |
US9228211B2 (en) | 2007-12-21 | 2016-01-05 | Dupont Nutrition Biosciences Aps | Process of water degumming an edible oil |
KR20110136825A (en) | 2009-03-09 | 2011-12-21 | 바이오아트라, 엘엘씨 | Mirac proteins |
GB0908770D0 (en) | 2009-04-24 | 2009-07-01 | Danisco | Method |
US20120058222A1 (en) | 2009-05-19 | 2012-03-08 | Danisco A/S | Use |
AR077042A1 (en) | 2009-06-12 | 2011-07-27 | Danisco | METHOD TO TREAT A COMPOSITION CONTAINING PYROPHIOPHYTIN |
GB0920089D0 (en) | 2009-11-17 | 2009-12-30 | Danisco | Method |
CN102844418B (en) | 2010-03-12 | 2015-11-25 | 杜邦营养生物科学有限公司 | Method |
WO2011114251A1 (en) | 2010-03-18 | 2011-09-22 | Danisco A/S | Foodstuff |
AR081950A1 (en) | 2010-06-17 | 2012-10-31 | Danisco | SEED TREATMENT PROCESS CONTAINING OIL |
GB201011513D0 (en) | 2010-07-08 | 2010-08-25 | Danisco | Method |
US20140051146A1 (en) | 2011-02-23 | 2014-02-20 | Dupont Nutrition Biosciences Aps | Method |
ES2649912T3 (en) | 2011-02-23 | 2018-01-16 | Dupont Nutrition Biosciences Aps | Enzymatic treatment of chlorophyll in vegetable oils |
AR085251A1 (en) | 2011-02-23 | 2013-09-18 | Danisco | PROCESS TO TREAT VEGETABLE OIL |
MX2013011617A (en) | 2011-04-08 | 2013-11-21 | Danisco Us Inc | Compositions. |
WO2013104660A1 (en) | 2012-01-13 | 2013-07-18 | Dupont Nutrition Biosciences Aps | Process for treating a plant oil comprising hydrolysing chlorophyll or a chlorophyll derivative and involving partial caustic neutralisation |
WO2013104659A2 (en) | 2012-01-13 | 2013-07-18 | Dupont Nutrition Biosciences Aps | Process |
WO2013160374A1 (en) | 2012-04-27 | 2013-10-31 | Dupont Nutrition Biosciences Aps | Process for refining crude plant oil involving enzymatic hydrolysis and gum recycling |
WO2013160372A1 (en) | 2012-04-27 | 2013-10-31 | Dupont Nutrition Biosciences Aps | Process for treating plant oil involving addition of serial doses of chlorophyll or chlorophyll derivative degrading enzyme |
US10226744B2 (en) | 2012-10-19 | 2019-03-12 | Danisco Us Inc | Stabilization of biomimetic membranes |
DK3083936T3 (en) | 2013-12-19 | 2018-10-22 | Danisco Us Inc | USE OF HYDROPHOBINES TO INCREASE GAS TRANSFER IN AEROBE FERMENTATION PROCESSES |
EP3126509A1 (en) | 2014-04-01 | 2017-02-08 | DuPont Nutrition Biosciences ApS | Method for increasing crude palm oil yields |
EP3172329A1 (en) | 2014-10-24 | 2017-05-31 | Danisco US Inc. | Method for producing alcohol by use of a tripeptidyl peptidase |
DK3209773T3 (en) | 2014-10-24 | 2020-06-15 | Dupont Nutrition Biosci Aps | PROLINTOLERANT TRIPEPTIDYLPEPTIDASES AND APPLICATIONS THEREOF |
BR112018015589A2 (en) | 2016-02-25 | 2019-10-01 | Dupont Nutrition Biosci Aps | A method for producing protein hydrolyzate employing an aspergillus fumigatus tripeptidyl peptidase |
EP3491128B1 (en) * | 2016-07-29 | 2021-09-08 | New England Biolabs, Inc. | Methods and compositions for preventing concatemerization during template- switching |
Family Cites Families (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0316018A3 (en) * | 1985-03-29 | 1989-07-26 | Cetus Oncology Corporation | Modification of dna sequences |
US4959312A (en) * | 1985-05-31 | 1990-09-25 | The University Of Tennessee Research Corporation | Full spectrum mutagenesis |
JP3096722B2 (en) * | 1990-01-17 | 2000-10-10 | 日本ケミカルリサーチ株式会社 | Method for preparing primer for polymerase chain reaction and method for amplifying DNA using the same |
WO1991012341A1 (en) * | 1990-02-12 | 1991-08-22 | Fred Hutchinson Cancer Research Center | Improved method for ordered deletions from a fixed point in a cloned insert |
US6117679A (en) * | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
US5830696A (en) * | 1996-12-05 | 1998-11-03 | Diversa Corporation | Directed evolution of thermophilic enzymes |
JP2000501606A (en) * | 1995-12-07 | 2000-02-15 | リコンビナント バイオカタリシス,インコーポレーテッド | Method for screening enzyme activity |
US5965408A (en) * | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
US5789166A (en) * | 1995-12-08 | 1998-08-04 | Stratagene | Circular site-directed mutagenesis |
IL120338A0 (en) * | 1997-02-27 | 1997-06-10 | Gesher Israel Advanced Biotecs | Single step DNA fragments assembly |
GB9712512D0 (en) * | 1997-06-16 | 1997-08-20 | Bioinvent Int Ab | A method for in vitro molecular evolution of protein function |
-
2000
- 2000-03-27 MX MXPA00011569A patent/MXPA00011569A/en not_active Application Discontinuation
- 2000-03-27 WO PCT/US2000/008245 patent/WO2000058517A1/en active Application Filing
- 2000-03-27 CA CA002329122A patent/CA2329122A1/en not_active Abandoned
- 2000-03-27 JP JP2000608795A patent/JP2004500019A/en active Pending
- 2000-03-27 EP EP00919763A patent/EP1092041A4/en not_active Withdrawn
- 2000-03-27 AU AU40394/00A patent/AU4039400A/en not_active Abandoned
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU783823B2 (en) * | 1999-11-09 | 2005-12-08 | Bayer Schering Pharma Aktiengesellschaft | Method for the production of biopolymers with modified properties |
Also Published As
Publication number | Publication date |
---|---|
MXPA00011569A (en) | 2004-12-03 |
EP1092041A4 (en) | 2001-09-19 |
WO2000058517A1 (en) | 2000-10-05 |
JP2004500019A (en) | 2004-01-08 |
CA2329122A1 (en) | 2000-10-05 |
EP1092041A1 (en) | 2001-04-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6635449B2 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
CA2374667C (en) | Synthetic ligation reassembly in directed evolution | |
US6773900B2 (en) | End selection in directed evolution | |
US6358709B1 (en) | End selection in directed evolution | |
US6709841B2 (en) | Exonuclease-mediated gene assembly in directed evolution | |
US6696275B2 (en) | End selection in directed evolution | |
AU4039400A (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
US6764835B2 (en) | Saturation mutageneis in directed evolution | |
AU3879300A (en) | End selection in directed evolution | |
US6939689B2 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
AU2009212959B2 (en) | Synthetic ligation reassembly in directed evolution | |
US20040023327A1 (en) | End selection in directed evolution | |
AU2005203018A1 (en) | Exonuclease-mediated nucleic acid reassembly in directed evolution | |
Class et al. | Patent application title: SYNTHETIC LIGATION REASSEMBLY IN DIRECTED EVOLUTION Inventors: Jay M. Short (Del Mar, CA, US) | |
AU2005203719A1 (en) | End selection in directed evolution |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS: AMEND INVENTORS TO DELETE: GERHARD JOHANN FREY AND TSOTNE DAVID DJAVAKHISHVILI |