Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
  • C12N1/20—Bacteria; Culture media therefor
  • C12N1/205—Bacterial isolates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
  • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
  • C12R2001/00—Microorganisms ; Processes using microorganisms
  • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
  • C12R2001/185—Escherichia

Definitions

• the present invention relates to mutant 1 ,3-propanediol dehydrogenase having an altered Km for 1 ,3-propanediol.
• the present invention provides the nucleic acid and amino acid sequence of the mutant form of 1 ,3-propanediol dehydrogenase.
• the present invention also provides expression vectors and host cells comprising mutant 1 ,3-propanediol dehydrogenase.
• 1 ,3-Propanediol is a monomer having potential utility in the production of polyester fibers and the manufacture of polyurethanes and cyclic compounds.
• the production of 1 ,3- propanediol has been disclosed in United States patent 5,686,276 issued November 11 , 1997 and WO 98/21341.
• One representative pathway for the production of 1 ,3-propanediol from glucose can be accomplished by the following series of steps. Glucose is converted in a series of steps by enzymes of the glycolytic pathway to dihydroxyacetone phosphate (DHAP) and 3-phosphoglyceraldehyde (3-PG).
• DHAP dihydroxyacetone phosphate
• 3-PG 3-phosphoglyceraldehyde
• Glycerol is then formed by either hydrolysis of DHAP to dihydroxyacetone (DHA) followed by reduction, or reduction of DHAP to glycerol 3-phosphate (G3P) followed by hydrolysis.
• the hydrolysis step can be catalyzed by any number of cellular phosphatases which are known to be specific or non-specific with respect to their substrates or the activity can be introduced into the host by recombination.
• the reduction step can be catalyzed by a NAD + (or NADP + ) linked host enzyme or the activity can be introduced into the host by recombination. It is notable that the dha regulon contains a glycerol dehydrogenase (E.C. 1.1.1.6) which catalyzes the reversible reaction of Equation 3.
• Glycerol is converted to 1 ,3-propanediol via the intermediate 3-hydroxypropionaldehye (3-HP) as has been described in detail above.
• the intermediate 3-HP is produced from glycerol (Equation 1 ) by a dehydratase enzyme which can be encoded by the host or can introduced into the host by recombination.
• This dehydratase can be glycerol dehydratase (E.C. 4.2.1.30), diol dehydratase (E.C. 4.2.1.28), or any other enzyme able to catalyze this transformation.
• Glycerol dehydratase is encoded by the dha regulon.
• 1 ,3-Propanedioi is produced from 3-HP (Equation 2) by a NAD + - (or NADP + ) linked host enzyme or the activity can introduced into the host by recombination.
• This final reaction in the production of 1 ,3-propanediol can be catalyzed by 1 ,3-propanediol dehydrogenase (E.C. 1.1.1.202) or other alcohol dehydrogenases.
• dhaB glycerol dehydratase
• dhaT 1 ,3-propanediol oxidoreductase
• dhaD glycerol dehydrogenase
• dhaK dihydroxyacetone kinase
• Nucleic acid and amino acid sequences for a 1 ,3-propanediol dehydrogenase that have been disclosed in the art, including Klebsiella pneumoniae GenBank accession # U30903 (Williard, 1994, "Investigation of the Klebsiella pneumoniae 1 ,3-propanediol pathway: Characterization and expression of glycerol dehydratase and 1 ,3-propanediol oxidoreductase" Thesis Chemical Engineering, University of Wisconsin-Madison);
• Citrobacter freundii GenBank accession # U09771 (Daniel, R. et al., 1995, Purification of 1 ,3-propanediol dehydrogenase from Citrobacter freundii: cloning, sequencing, and overexpression of the corresponding gene in Escherichia coli. J. Bacteriol. 177:2151-2156); and Clostridium pasteurianum GenBank accession # AF006034 (Luers,F.
• the present invention relates to the discovery of a mutant form of 1 ,3-propanediol dehydrogenase (PDD) isolated from a derivative of E.blattae capable of growth in the presence of at least 105 g/l 1 ,3-propanediol, levels normally toxic to wild-type E.blattae.
• PDD 1 ,3-propanediol dehydrogenase
• the present invention is therefore based in part upon the discovery that the mutant form of PDD is associated with E.blattae's resistance to normally toxic levels of 1 ,3-propanediol.
• the present invention is also based in part upon the finding that this mutant PDD has an altered Km for 1 ,3-propanediol and NAD.
• the present invention provides a mutant PDD having a Km for 1 ,3- propanediol that is increased over the wild-type PDD Km for 1 ,3-propanediol.
• the Km of the mutant PDD is about 3 times the Km of wild-type PDD for 1 ,3- propanediol.
• the mutant PDD has a Km of about 80 mM for 1 ,3- propanediol.
• the mutant PDD is obtainable from E.blattae ATCC accession number PTA-92.
• the mutant PDD comprises a mutation corresponding to residue His105 to Leu in E.blatte PDD as shown in Figure 3.
• the mutant PDD comprises the amino acid shown in SEQ ID NO:2 and is encoded by nucleic acid having the sequence as shown in SEQ ID NO:1.
• the present invention also provides expression vectors and host cells comprising the isolated nucleic acid having the sequence as shown in SEQ ID NO:1.
• the host cell includes Citrobacter, Enterobacter, Clostridium, Klebsiella, Aerobacter, Lactobacillus, Aspergillus, Saccharomyces, Schizosaccharomyces,
• the present invention relates to methods for producing 1 ,3- propanediol comprising the use of a microorganism comprising mutant PDD.
• Figure 1 provides the nucleic acid sequence (SEQ ID NO:1 ) for the mutant 1 ,3- propanediol dehydrogenase (PDD).
• Figure 2 provides the amino acid sequence (SEQ ID NO:2) for the mutant 1 ,3- propanediol dehydrogenase (PDD).
• FIG. 3 provides an amino acid alignment of PDDs from various microorganisms.
• Eb_GEBT represents the ATCC deposited E.blattae mutant PDD
• Eb_429T and Eb_907T are wild-type E.blattae (ATCC accession number 33429);
• Kpn is Klebsiella pneumoniae (GenBank accession # U30903);
• Cfu is Citrobacter freundii (GenBank accession number U09771 ) and
• Cpast is Clostridium pasteurianum (GenBank accession number AF006034).
• 1 ,3-propanediol dehydrogenase or “PDD” (also known in the art as “oxidoreductase”) refer to the polypeptide(s) responsible for an enzyme activity that is capable of catalyzing the reduction of 3-hydroxypropionaldehyde to 1 ,3-propanediol.
• 1 ,3-Propanediol dehydrogenase includes, for example, the polypeptide encoded by the dhaT gene.
• the present invention encompasses 1 ,3-propanediol dehydrogenase from any source including, but not limited to E.blatte, K. pneumoniae, C.freundii, C. pasteurianum.
• mutant refers to any genetic change that occurs in the nucleic acid of a microorganism and may or may not reflect a phenotypic change within the microorganism.
• a mutation may comprise a single base pair change, deletion or insertion; a mutation may comprise a change, deletion or insertion in a large number of base pairs; a mutation may also comprise a change in a large region of DNA, such as through duplication or inversion.
• the amino acid sequence of a mutant 1 ,3- propanediol dehydrogenase can be derived from a precursor 1 ,3-propanediol dehydrogenase by the substitution, deletion or insertion of one or more amino acids of the naturally occurring 1 ,3-propanediol dehydrogenase.
• Methods for modifying genes e.g., through site-directed oligonucleotide mutagenesis have been described in the art.
• the invention is not limited to the mutation of the E.blattae PDD shown in Figures 1 and 2, or the E.blattae deposited with the ATCC and having accession number PTA-92 but encompasses all PDDs containing amino acid residues at positions which are equivalent to the particular identified residue in E.blattae.
• a residue is equivalent if it is either homologous (i.e., corresponds in position for either the primary or tertiary structure) or analogous to a specific residue or portion of that residue in E.blattae PDD (i.e., having the same or similar functional capacity to combine, react, or interact chemically or structurally).
• the amino acid sequence of a PDD is directly compared to the E.blattae PDD primary sequence (shown in Figure 2) and particularly to a set of residues known to be invariant to all PDDs for which sequences are known (see, e.g., Figure 3).
• the present invention encompasses the equivalent residue change in ail sources of 1 ,3-propanediol dehydrogenase as long as the mutant form is able to alter the Km of the activity for 1 ,3-propanediol. In a preferred embodiment, the Km of the mutant form is increased for 1 ,3-propanediol.
• the nucleic acid sequence of SEQ ID NO:1 was obtained via PCR techniques.
• the present invention also encompasses the 1 ,3-propanediol dehydrogenase of E.blattae having ATCC accession number PTA-92 and corresponding mutations in other microbial sources of the 1 ,3-propanediol dehydrogenases.
• Km refers to affinity of the enzyme for the substrate. A high Km reflects a low affinity; a low Km reflects a high affinity.
• carbon substrate and “carbon source” refer to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.
• host cell or "host organism” refer to a microorganism capable of receiving foreign or heterologous genes and of expressing those genes to produce an active gene product.
• nucleic acid refers to a nucleotide or polynucleotide sequence, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be double-stranded or single-stranded, whether representing the sense or antisense strand.
• the terms “native” and “wild-type” refer to a gene as found in nature with its own regulatory sequences.
• amino acid refers to peptide or protein sequences or portions thereof.
• expression refers to the transcription and translation to gene product from a gene coding for the sequence of the gene product.
• Plasmid refers to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules.
• Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
• Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell.
• Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
• isolated or “purified” as used herein refer to a nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
• the present invention relates to mutant 1 ,3-propanediol dehydrogenase (PDD) characterized by having an increased Km for 1 ,3 propanediol.
• PDD mutant 1 ,3-propanediol dehydrogenase
• Polynucleotide sequence as shown in SEQ ID NO:1 encodes the 1 ,3-propanediol dehydrogenase (SEQ ID NO:2) having the mutation of His to Leu at residue 105 as shown in Figure 3.
• SEQ ID NO:2 1 ,3-propanediol dehydrogenase
• the present invention encompasses all such polynucleotides.
• the present invention encompasses nucleic acid encoding PDD comprising a mutation corresponding to E.blatte residue His 105 to Leu as shown in Figure 3.
• pneumoniae is given in GenBank accession number U30903; PDD from C. freundii is given in GenBank accession number U09771 ; for PDD from C. pasteurianum is given in GenBank accession number AF00034.
• the present invention also encompasses mutant PDD obtainable from E.blattae having ATCC accession number PTA-92.
• PCR polymerase chain reaction
• the present invention provides a variety of vectors and transformation and expression cassettes suitable for the cloning, transformation and expression of mutant PDD as well as other proteins associated with 1 ,3-propanediol production into a suitable host cell.
• Suitable vectors will be those which are compatible with the bacterium employed.
• Suitable vectors can be derived, for example, from a bacteria, a virus (such as bacte ophage T7 or a M-13 derived phage), a cosmid, a yeast or a plant. Protocols for obtaining and using such vectors are known to those in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual - volumes 1 ,2,3 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1989)).
• the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration.
• Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.
• Initiation control regions or promoters which are useful to drive expression of PDD in the desired host cell, are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitable for the present invention including but not limited to CYC1 , HIS3, GAL1 , GAL10, ADH1 , PGK, PHO5, GAPDH, ADC1 , TRP1 , URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, trp, IP
• DNA encoding the enzymes are linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.
• cassettes are used to transform appropriate host cells.
• Introduction of the cassette containing mutant 1 ,3-propanediol dehydrogenase, either separately or together with other proteins necessary for the production of 1 ,3-propanediol, into the host ceil may be accomplished by known procedures such as by transformation (e.g., using calcium-permeabiiized cells, electroporation) or by transfection using a recombinant phage virus. (Sambrook et al., supra.).
• Suitable host cells for the recombinant production of 1 ,3-propanediol may be either prokaryotic or eukaryotic and will be limited only by the host cell ability to express active enzymes.
• Preferred hosts will be those typically useful for production of glycerol or 1 ,3-propanediol such as Citrobacter, Enterobacter, Clostridium, Klebsiella, Aerobacter, Lactobacillus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Debaryomyces, Mucor, Torulopsis,
• Methylobacter Escherichia, Salmonella, Bacillus, Streptomyces and Pseudomonas. Most preferred in the present invention are E. coli, Klebsiella species and Saccharomyces species.
• Fermentation media in the present invention must contain suitable carbon substrates.
• suitable substrates may include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose, or mixtures thereof, and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt.
• the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated.
• Preferred carbon substrates are monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates. More preferred are sugars such as glucose, fructose, sucrose and single carbon substrates such as methanol and carbon dioxide. Most preferred is glucose.
• fermentation media In addition to an appropriate carbon source, fermentation media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for glycerol production. Particular attention is given to Co(ll) salts and/or vitamin
• Preferred growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast Malt Extract (YM) broth.
• Other defined or synthetic growth media may also be used and the appropriate medium for growth of the particular microorganism will be known by someone skilled in the art of microbiology or fermentation science.
• agents known to modulate catabolite repression directly or indirectly e.g., cyclic adenosine 2':3'-monophosphate or cyclic adenosine 2':5'-monophosphate, may also be incorporated into the reaction media.
• agents known to modulate enzymatic activities e.g., sulphites, bisulphites and alkalis
• agents known to modulate enzymatic activities e.g., sulphites, bisulphites and alkalis
• Suitable pH ranges for the fermentation are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is preferred as range for the initial condition.
• Reactions may be performed under aerobic or anaerobic conditions where anaerobic or microaerobic conditions are preferred.
• Example 1 describes the kinetic changes associated with the mutant PDD shown in SEQ ID NO:2.
• Growth - Cells were grown in a complex medium at 30C 500 ml in a 2800 ml fembach with shaking at 225 rpm for 20 hr.
• the medium consists of KH2PO4, 5.4 g/L; (NH4)2SO4, 1.2 g/L; MgSO47H2O, 0.4 g/L; yeast extract, 2.0 g/L; tryptone, 2.0 g/L; and glycerol, 9.2 g/L in tap water.
• the pH was adjusted to 7.1 with KOH before autoclaving (Honda, et al., 1980, J. Bacteriol, 143:1458-1465).
• Extract prep - Cells were harvested by centrifugation with care to avoid anaerobic conditions. Pellets were resuspended in 100 mM Tricine pH 8.2 containing 50 mM KCI and 1 mM DTT. Cells were disrupted by passage through a French pressure cell. Crude extracts were clarified by centrifugation at 20K X g for 20 min followed by 100K X g for 1 hr to yield the high speed supernatant (HSS) fraction.
• HSS high speed supernatant
• Partial purification of PDD - HSS was separated on a 16 X 100 Poros 20HQ column.
• the buffers were A, 50 mM HEPES, pH 7.4 containing 100 uM MnCI and B, A buffer containing 500 mM KCI.
• the column was loaded and developed at 10 ml/min.
• the gradient was 10 CV wash, a linear gradient to 70% B in 10 CV, and 1 CV to 100% B.
• the activity was detected in the very early fractions of the gradient. Pooled column fractions of the 33429 strain were used as collected for assays after the addition of additional of DTT to 1mM.
• the active fractions from strain GEB031 were pooled and concentrated on a PM30 membrane and used as concentrated after the addition of additional 1mM DTT.
• Example 2 Cloning and sequencing the 1 ,3-propanediol dehydrogenase genes (dhaT) from E. blattae.
• the dhaT genes were amplified by PCR from genomic DNA from E. blattae as template DNA using synthetic primers (primer 1 and primer 2) based on the K. pneumoniae dhaT sequence and incorporating an Xbal site at the 5' end and a BamHI site at the 3' end.
• the product was subcloned into pCR-Blunt ll-TOPO (Invitrogen). The cloning cbaTwere then sequenced was standard techniques.
• Primer 1 5' TCTGATACGGGATCCTCAGAATGCCTGGCGGAAAAT3 '
• nucleic acid sequence generated via PCR methods may comprise inadvertent errors.
• the present invention also encompasses nucleic acid encoding PDD obtainable from E.blattae having ATCC accession number PTA- 92.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Health & Medical Sciences (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Genetics & Genomics (AREA)
• Biotechnology (AREA)
• General Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Medicinal Chemistry (AREA)
• Tropical Medicine & Parasitology (AREA)
• Virology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Molecular Biology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Enzymes And Modification Thereof (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Publications (2)

Family

ID=22465381

Family Applications (1)

Country Status (12)

Cited By (2)

Families Citing this family (8)

Family Cites Families (2)

• 2000
  • 2000-05-14 US US09/570,778 patent/US6468773B1/en not_active Expired - Lifetime
  • 2000-05-16 MX MXPA01011766A patent/MXPA01011766A/es active IP Right Grant
  • 2000-05-16 BR BR0010752-2A patent/BR0010752A/pt not_active IP Right Cessation
  • 2000-05-16 CN CNB008077436A patent/CN1187448C/zh not_active Expired - Lifetime
  • 2000-05-16 AT AT00932432T patent/ATE485378T1/de not_active IP Right Cessation
  • 2000-05-16 CA CA2373312A patent/CA2373312C/en not_active Expired - Lifetime
  • 2000-05-16 JP JP2000618463A patent/JP4646411B2/ja not_active Expired - Lifetime
  • 2000-05-16 EP EP00932432A patent/EP1185667B1/en not_active Expired - Lifetime
  • 2000-05-16 IL IL14617200A patent/IL146172A0/xx unknown
  • 2000-05-16 AU AU50155/00A patent/AU777718B2/en not_active Expired
  • 2000-05-16 DE DE60045125T patent/DE60045125D1/de not_active Expired - Lifetime
  • 2000-05-16 WO PCT/US2000/013286 patent/WO2000070057A2/en not_active Ceased
• 2001
  • 2001-11-16 US US09/991,138 patent/US6558933B2/en not_active Expired - Lifetime

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events