WO2000060059A2 - Alpha-amylase variants - Google Patents
Alpha-amylase variants Download PDFInfo
- Publication number
- WO2000060059A2 WO2000060059A2 PCT/DK2000/000148 DK0000148W WO0060059A2 WO 2000060059 A2 WO2000060059 A2 WO 2000060059A2 DK 0000148 W DK0000148 W DK 0000148W WO 0060059 A2 WO0060059 A2 WO 0060059A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alpha
- amylase
- seq
- variant
- termamyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates, inter alia , to novel variants of parent Termamyl-like alpha-amylases, notably variants exhibiting altered properties, m particular altered cleavage pattern (relative to the parent) which are advantageous with respect to applications of the variants m, m particular, industrial starch processing (e.g., starch liquefaction or saccha ⁇ fication) .
- industrial starch processing e.g., starch liquefaction or saccha ⁇ fication
- Alpha-Amylases (alpha-1 , 4-glucan-4-glucanohydrolases, EC 3.2.1.1) constitute a group of enzymes which catalyze hydrolysis of starch and other linear and branched 1 , 4-glucos ⁇ d ⁇ c oligo- and polysaccharides .
- alpha-amylase such as Termamyl-like alpha-amylases variants are known from, e . g. , WO 90/11352, WO
- 96/23874 provides three-dimensional, X-ray crystal structural daua for a Termamyl-like alpha-amylase, reffered to as BA2 , which consists of the 300 N-termmal ammo acid residues of the B .
- amyloliquefaciens alpha-amylase comprising the ammo acid sequence shown m SEQ ID NO: 6 herein and ammo acids 301-483 of the C-termmal end of the B .
- lichemformis alpha-amylase comprising the ammo acid sequence shown m SEQ ID NO: 4 herein (the latter being available commercially under the tradename
- TermamylTM Bacillus alpha-amylases
- Bacillus alpha-amylases Bacillus alpha-amylases
- Bacillus alpha-amylases which m the present context are embraced withm the meaning of the term "Termamyl-like alpha-amylases"
- WO 96/23874 further ⁇ escribes methodology for designing, on the basis of an analysis of the structure of a parent Termamyl-like alpha-amylase, variants of the parent Termamyl-like alpha-amylase which exhibit altered properties relative to the parent.
- WO 96/23874 and WO 97/41213 discloses Termamyl-like alpha-amylase variants with an altered cleavage pattern containing mutations the ammo acid residues V54,
- the present invention relates to novel alpha-amylolytic variants (mutants) of a Termamyl-like alpha-amylase, m particular variants exhibiting altered cleavage pattern
- the inventors have surprisingly found variants with altered properties, m particular altered cleavage pattern which have improved reduced capability of cleaving an substrate close to the branching point, and further have improved substrate specificity and/or improved specific activity, comparison to the WO 96/23874 and WO 97/41213 (Novo Nordisk) disclosed Termamyl-like alpha-amylase variants with an altered cleavage pattern containing mutations the ammo acid residues V54, D53, Y56, Q333, G57 and A52 of the sequence shown m SEQ ID NO: 4 herein.
- the invention further relates to DNA constructs encoding variants of the invention, to composition comprising variants of the invention, to methods for preparing variants of the invention, and to the use of variants and compositions of the invention, alone or m combination with other alpha-amylolytic enzymes, m various industrial processes, e . g. , starch liquefaction, and detergent compositions, such as laundry, dish washing and hard surface cleaning compositions; ethanol production, such as fuel, drinking and industrial ethanol production; desizmg of textiles, fabrics or garments etc.
- various industrial processes e . g. , starch liquefaction, and detergent compositions, such as laundry, dish washing and hard surface cleaning compositions
- ethanol production such as fuel, drinking and industrial ethanol production
- ammo acid residues When one or more alternative ammo acid residues may be inserted m a given position it is indicated as A30N,E or A3 ON or A30E Furthermore, when a position suitable for modification is identified herein without any specific modification being suggested, or A3 OX, it is to be understood that any ammo acid residue may be substituted for the ammo acid residue present m the position.
- a modification of an alanme m position 30 is mentioned, but not specified, or specified as "X" , it is to be understood that the alanme may be deleted or substituted for any other ammo acid, i.e., any one of: R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V.
- the Termamyl-like alpha-amylase It is well known that a number of alpha-amylases produced by Bacillus spp. are highly homologous on the ammo acid level. For instance, the B . licheniformis alpha-amylase comprising the ammo acid sequence shown m SEQ ID NO: 4 (commercially available as TermamylTM) has been found to be about 89% homologous with the B . amyloliquefaciens alpha-amylase comprising the ammo acid sequence shown m SEQ ID NO: 6 and about 79% homologous with the B. stearothermophilus alpha- amylase comprising the ammo acid sequence shown m SEQ ID NO: 8.
- homologous alpha-amylases include an alpha-amylase derived from a strain of the Bacillus sp . NCIB 12289, NCIB 12512, NCIB 12513 or DSM 9375, all of which are described m detail m WO 95/26397, and the #707 alpha-amylase described by Tsukamoto et al . , Biochemical and Biophysical Research Communications, 151 (1988), pp. 25-31. Still further homologous alpha-amylases include the alpha- amylase produced by the B.
- licheniformis strain described m EP 0252666 (ATCC 27811) , and the alpha-amylases identified m WO 91/00353 and WO 94/18314.
- Other commercial Termamyl-like B . lichemformis alpha-amylases are OptithermTM and TakathermTM (available from Solvay) , MaxamylTM (available from Gist- brocades/Genencor) , Spezym AATM and Spezyme Delta AATM (available from Genencor) , and KeistaseTM (available from Daiwa) .
- alpha-amylases Because of the substantial homology found between these alpha-amylases, they are considered to belong to the same class of alpha-amylases, namely the class of "Termamyl-like alpha- amylases" . Accordingly, in the present context, the term "Termamyl-like alpha-amylase” is intended to indicate an alpha-amylase, which at the amino acid level exhibits a substantial homology to
- TermamylTM i . e .
- the B . licheniformis alpha-amylase having the amino acid sequence shown in SEQ ID NO : 4 herein.
- a Termamyl-like alpha-amylase is an alpha-amylase, which has the amino acid sequence shown in SEQ ID NO : 2, 4, 6, or 8 herein, and the amino acid sequence shown in SEQ ID NO: 1 or 2 of WO 95/26397 or in Tsukamoto et al .
- the "homology" may be determined by use of any conventional algorithm, preferably by use of the GAP progamme from the GCG package version 7.3 (June 1993) using default values for GAP penalties, which is a GAP creation penalty of 3.0 and GAP extension penalty of 0.1, (Genetic Computer Group (1991) Programme Manual for the GCG Package, version 7, 575 Science Drive, Madison, Wisconsin, USA 53711) .
- GAP penalties which is a GAP creation penalty of 3.0 and GAP extension penalty of 0.1, (Genetic Computer Group (1991) Programme Manual for the GCG Package, version 7, 575 Science Drive, Madison, Wisconsin, USA 53711) .
- a structural alignment between Termamyl and a Termamyl- like alpha-amylase may be used to identify equivalent/corresponding positions m other Termamyl-like alpha- amylases.
- One method of obtaining said structural alignment is to use the Pile Up programme from the GCG package using default values of gap penalties, i.e., a gap creation penalty of 3.0 and gap extension penalty of 0.1.
- Other structural alignment methods include the hydrophobic cluster analysis (Gaboriaud et al . , (1987), FEBS LETTERS 224, pp. 149-155) and reverse threading (Huber, T ; Torda, AE, PROTEIN SCIENCE Vol. 7, No. 1 pp. 142- 149 (1998) .
- the immunological cross reactivity may be assayed using an antibody raised against, or reactive with, at least one epitope of the relevant Termamyl-like alpha-amylase.
- the antibody which may either be monoclonal or polyclonal, may be produced by methods known in the art, e . g. , as described by Hudson et al . , Practical Immunology, Third edition (1989) , Blackwell Scientific Publications.
- the immunological cross-reactivity may be determined using assays known m the art, examples of which are Western Blotting or radial immunodiffusion assay, e . g. , as described by Hudson et al . , 1989. In this respect, immunological cross- reactivity between the alpha-amylases having the ammo acid sequences SEQ ID NOS: 2, 4, 6, or 8 , respectively, have been found .
- the oligonucleotide probe used m the characterization of the Termamyl-like alpha-amylase m accordance with property in) above may suitably be prepared on the basis of the full or partial nucleotide or ammo acid sequence of the alpha-amylase m question.
- Suitable conditions for testing hybridization involve presoakmg m 5xSSC and prehybndizmg for 1 hour at ⁇ 40°C m a solution of 20% formamide, 5xDenhardt ' s solution, 50mM sodium phosphate, pH 6.8, and 50mg of denatured sonicated calf thymus DNA, followed by hybridization m the same solution supplemented with lOOmM ATP for 18 hours at ⁇ 40°C, followed by three times washing of the filter m 2xSSC, 0.2% SDS at 40°C for 30 minutes (low stringency) , preferred at 50°C (medium stringency) , more preferably at 65°C (high stringency) , even more preferably at ⁇ 75°C (very high stringency) . More details about the hybridization method can be found m Sambrook et al . ,
- derived from is intended not only to indicate an alpha-amylase produced or producible by a strain of the organism m question, but also an alpha-amylase encoded by a DNA sequence isolated from such strain and produced a host organism transformed with said DNA sequence.
- the term is intended to indicate an alpha-amylase, which is encoded by a DNA sequence of synthetic and/or cDNA origin and which has the identifying characteristics of the alpha-amylase in question.
- the parent alpha-amylase may be a variant of a naturally occurring alpha- amylase, i.e. a variant, which is the result of a modification (insertion, substitution, deletion) of one or more ammo acid residues of the naturally occurring alpha-amylase.
- the parent alpha-amylase may be a hybrid alpha-amylase, i.e., an alpha-amylase, which comprises a combination of partial ammo acid sequences derived from at least two alpha-amylases.
- the parent hybrid alpha-amylase may be one, which on the basis of ammo acid homology and/or immunological cross- reactivity and/or DNA hybridization (as defined above) can be determined to belong to the Termamyl-like alpha-amylase family.
- the hybrid alpha-amylase is typically composed of at least one part of a Termamyl-like alpha-amylase and part (s) of one or more other alpha-amylases selected from Termamyl-like alpha-amylases or non-Termamyl -like alpha-amylases of microbial (bacterial or fungal) and/or mammalian origin.
- the parent hybrid alpha-amylase may comprise a combination of partial ammo acid sequences deriving from at least two Termamyl-like alpha-amylases, or from at least one Termamyl-like and at least one non-Termamyl-like bacterial alpha-amylase, or from at least one Termamyl-like and at least one fungal alpha-amylase.
- the Termamyl-like alpha-amylase from which a partial ammo acid sequence derives may, e . g. , be any of those specific Termamyl-like alpha-amylases referred to herein.
- the parent alpha-amylase may comprise a C- termmal part of an alpha-amylase derived from a strain of B . licheniformis , and a N-termmal part of an alpha-amylase derived from a strain of B . amyloliquefaciens or from a strain of B . stearothermophilus .
- the parent alpha-amylase may comprise at least 430 ammo acid residues of the C-terminal part of the B . lichemformis alpha-amylase, and may, e . g . , comprise a) an ammo acid segment corresponding to the 37 N-terminal ammo acid residues of the B .
- amyloliquefaciens alpha-amylase having the ammo acid sequence shown SEQ ID NO: 6 and an ammo acid segment corresponding to the 445 C-termmal ammo acid residues of the B .
- lichemformis alpha-amylase having the ammo acid sequence shown m SEQ ID NO: 4, or b) an ammo acid segment corresponding to the 68 N-termmal ammo acid residues of the B .
- stearothermophilus alpha-amylase having the ammo acid sequence shown m SEQ ID NO: 8 and an ammo acid segment corresponding to the 415 C-termmal ammo acid residues of the B .
- 145mformis alpha-amylase having the ammo acid sequence shown m SEQ ID NO : 4.
- the parent Termamyl-like alpha- amylase is a hybrid Termamyl-like alpha-amylase identical to the Bacillus liche formis alpha-amylase shown m SEQ ID NO: 4, except that the N-termmal 35 ammo acid residues (of the mature protein) is replaced with the N-termmal 33 ammo acid residues of the mature protein of the Bacillus amyloliquefaciens alpha- amylase (BAN) shown m SEQ ID NO: 6.
- Said hybrid may further have the following mutations: H156Y+A181T+N190F+A209V+Q264S (using the numbering SEQ ID NO: 4) referred to as LE174.
- Another preferred parent hybrid alpha-amylase is LE429 shown SEQ ID NO: 2.
- the non-Termamyl-like alpha-amylase may, e . g. , be a fungal alpha-amylase, a mammalian or a plant alpha-amylase or a bacterial alpha-amylase (different from a Termamyl-like alpha- amylase) .
- alpha-amylases include the Aspergillus oryzae TAKA alpha-amylase, the A . mger acid alpha- amylase, the Bacillus subtilis alpha-amylase, the porcine pancreatic alpha-amylase and a barley alpha-amylase. All of these alpha-amylases have elucidated structures, which are markedly different from the structure of a typical Termamyl-like alpha-amylase as referred to herein.
- the fungal alpha-amylases mentioned above i.e., derived from A . mger and A . oryzae, are highly homologous on the ammo acid level and generally considered to belong to the same family of alpha-amylases.
- the fungal alpha-amylase derived from Aspergillus oryzae is commercially available under the tradename
- a particular variant of a Termamyl-like alpha-amylase (variant of the invention) is referred to - m a conventional manner - by reference to modification ⁇ e . g. , deletion or substitution) of specific ammo acid residues m the ammo acid sequence of a specific Termamyl-like alpha-amylase, it is to be understood that variants of another Termamyl-like alpha-amylase modified m the equivalent position (s) (as determined from the best possible am o acid sequence alignment between the respective ammo acid sequences) are encompassed thereby.
- a preferred embodiment of a variant of the invention is one derived from a B .
- liche formis alpha-amylase (as parent Termamyl-like alpha-amylase), e.g., one of those referred to above, such as the B . licheniformis alpha-amylase having the ammo acid sequence shown m SEQ ID NO: 4.
- the construction of the variant of interest may be accomplished by cultivating a microorganism comprising a DNA sequence encoding the variant under conditions which are conducive for producing the variant. The variant may then subsequently be recovered from the resulting culture broth. This is described m detail further below.
- the invention relates to a variant of a parent Termamyl-like alpha-amylase, comprising an alteration at one or more positions selected from the group of: W13, G48, T49, S50, Q51, A52 , D53 , V54 , G57, G107, G108, Alll, S168, M197, wherein (a) the alteration (s) are independently
- the variant has alpha-amylase activity and (c) each position corresponds to a position of the ammo acid sequence of the parent Termamyl-like alpha-amylase having the ammo acid sequence of SEQ ID NO: 4.
- the above variants of the invention comprise a mutation m a position corresponding to at least one of the following mutations m the ammo acid sequence shown m SEQ ID NO : 4 :
- T49Q T49K, T49R, A52T, A52L, A52I, A52V, A52M, A52F, A52Y,
- a variant of the invention comprises at least one mutation m a position corresponding to the following mutations m the ammo acid sequence shown m SEQ ID NO:
- V54X m particular V54I , N, , Y, F, L;
- G107X m particular G107A, V, S, T, I , , C;
- G108X m particular G108A, V, S , T, I , L; A111V,I,L;
- a variant of the invention comprises the following mutations corresponding to the following mutations m the ammo acid sequence shown SEQ ID NO: 4:
- a variant of the invention comprises at least one mutation corresponding to the following mutations m the ammo acid sequence shown SEQ ID NO: 4: T49L+G107A;
- All of the above-mentioned variants of the invention have altered properties (meaning increased or decreased properties) , m particular at least one of the following properties relative to the parent alpha-amylase: reduced ability to cleave a substrate close to the branching point, improved substrate specificity and/or improved specific activity, altered substrate binding, altered thermal stability, altered pH/activity profile, altered pH/stability profile, altered stability towards oxidation, altered Ca 2 " dependency.
- mutations including am o acid substitutions and/or deletions
- altered stability particular improved stability (i.e., higher or lower), at especially low pH ( i . e . , pH 4-6)
- improved stability i.e., higher or lower
- pH i.e., pH 4-6
- Altered Ca 2+ stability means the stability of the enzyme under Ca 2+ depletion has been improved, i.e., higher or lower stability.
- mutations including ammo acid substitutions
- m particular improved Ca 2+ stability i.e., higher or lower stability, at especially low pH (i.e., pH 4-6) include any of the mutations listed m the m "Altered properties'' section above.
- important mutations with respect to obtaining variants exhibiting altered specific activity, m particular increased or decreased specific activity, especially at temperatures from 60-100°C, preferably 70-95°C, especially 80-90°C include any of the mutations listed the m "Altered properties'' section above. Tne specific activity of LE174 and LE429 was determined to 16,000 NU/mg using the Phadebas ® assay described m the "Materials and Methods" section.
- alpha-amylase which is capable of degrading the starch molecules into long, branched oligosaccharides, rather than an alpha-amylase, which gives rise to formation of shorter, branched oligosaccharides (like conventional Termamyl-like alpha-amylases) .
- Short, branched oligosaccharides are not hydrolyzed satisfactorily by pullulanases, which are used after alpha-amylase treatment m the liquefaction process, or simultaneously with a saccharifying amyloglucosidase
- the product mixture present after the glucoamylase treatment contains a significant proportion of short, branched, so-called limit-dextr , viz. the trisaccha ⁇ de panose.
- limit-dextr a saccharifying amyloglucosidase
- thermostable alpha-amylase which does not suffer from this disadvantage, would be a significant improvement, as no separate mactivation step would be required.
- the aim of the present invention is to arrive at a mutant alpha-amylase having appropriately modified starch- degradation characteristics but retaining the thermostability of the parent Termamyl-like alpha-amylase. Accordingly, the invention relates to a variant of a Termamyl-like alpha-amylase, which has an improved reduced ability to cleave a substrate close to the branching point, and further has improved substrate specificity and/or improved specific activity.
- variants comprising at least one of the following mutations are expected to prevent cleavage close to the branching point: V54L, I,F,Y,W,R,K,H,E,Q; D53L,I,F,Y,W; Y56W; Q333W;
- Termamyl-like alpha-amylases may be used.
- other commercial Termamyl-like alpha-amylases can be used.
- An unexhaustive list of such alpha-amylases is the following: Alpha-amylases produced by the B . licheniformis strain described m EP 0252666 (ATCC 27811) , and the alpha-amylases identified m WO 91/00353 and WO 94/18314.
- Other commercial Termamyl-like B . licheniformis alpha-amylases are OptithermTM and TakathermTM
- Termamyl-like alpha-amylase may suitably be used as backbone for preparing variants of the invention.
- the parent Termamyl-like alpha-amylase is a hybrid alpha-amylase of SEQ ID NO: 4 and SEQ ID NO: 6.
- the parent hybrid Termamyl-like alpha-amylase may be a hybrid alpha-amylase comprising the 445 C-termmal ammo acid residues of the B .
- This hybrid is referred to as LE174.
- the LE174 hybrid may be combined with a further mutation 1201F to form a parent hybrid Termamyl-like alpha-amylase having the following mutations H156Y+A181T+N190F+A209V+Q264S+I201F (using SEQ ID NO: 4 for the numbering) .
- This hybrid variant is shown m SEQ ID NO: 2 and is used the examples below, and is referred to as LE429.
- LE174 or LE429 (SEQ ID NO: 2) or B . licheniformis alpha-amylase shown m SEQ ID NO: 4 comprising one or more of the following mutations may be used as backbone (using SEQ ID NO: 4 for the numbering of the mutations) : E119C, S130C, D124C R127C A52all possible ammo acid residues;
- V129all possible ammo acid residues A269all possible ammo acid residues;
- H133 all possible am o acid residues, particular H133Y; H205all possible ammo acid residues, m particular H205H,
- A210 all possible ammo acid residues, particular A210S,
- T412 all possible ammo acid residues, m particular T412A;
- B . lichemformis alpha-amylase shown m SEQ ID NO:
- the mutations/alterations, particular substitutions, deletions and insertions may according to the invention be made m one or more of the following positions to improve the reduced ability to cleave a substrate close to the branching point, and to improve substrate specificity and/or improved specific activity: W13, G48, T49, S50, Q51, A52 , D53 , V54 , G57, G107, G108, Alll, S168, M197 (using the SEQ ID NO: 4 numbering) wherein (a) the alteration (s) are independently
- the variant has alpha-amylase activity and (c) each position corresponds to a position of the ammo acid sequence of the parent Termamyl-like alpha-amylase having the ammo acid sequence of SEQ ID NO: 4.
- a variant of the invention comprises at least one mutation m a position corresponding to the following mutations m the ammo acid sequence shown SEQ ID NO : 4 : V54N, A52S, A52S+V54N, T49L, T49+G107A, A52S+V54N+T49L+G107A, A52S+V54N+T49L, G107A, Q51R, Q51R+A52S, A52N; or T49F+G107A, T49V+G107A, T49D+G107A, T49Y+G107A, T49S+G107A, T49N+G107A, T49I+G107A, T49L+A52S+G107A, T49L+A52T+G107A, T49L+A52F+G107A, T49L+A52L+G107A, T49L+A52I+G107A, T49L+A52I+G107A, T49L+A52V+G
- a variant of the invention comprises at least one mutation m a position corresponding to the following mutations m the ammo acid sequence shown m SEQ ID NO : 4 : W13F,L, I,V, Y,A; G48A,V, S,T, I,L; *48aD or *48aY (i.e., insertion of D or Y) ; T49X; *49aX (i.e., insertion of any ammo acid residue) S50X, in particular D, Y, , T, V, I ;
- A52X in particular A52S ,N, T, F, L, I , V;
- G107X in particular G107A, V, S , T, I , L, C;
- G108X in particular G108A, V, S , T, I , L;
- a variant of the invention comprises at least one mutation in a position corresponding to the following mutations in the ammo acid sequence shown in SEQ ID NO: 4 :
- a variant of the invention comprises at least one mutation in a position corresponding to the following mutations in the amino acid sequence shown m SEQ ID NO: 4 :
- a variant of the invention comprises one or more modifications addition to those outlined above.
- one or more prolme residues present m the part of the alpha-amylase 5 variant which is modified is/are replaced with a non-prolme residue which may be any of the possible, naturally occurring non-prolme residues, and which preferably is an alanme, glycme, serine, threonine, valme or leucine .
- one or more cysteme lo residues present among the ammo acid residues with which the parent alpha-amylase is modified is/are replaced with a non- cysteme residue such as serine, alanme, threonine, glycme, valme or leucine.
- a variant of the invention may - either as the 15 only modification or m combination with any of the above outlined modifications - be modified so that one or more Asp and/or Glu present m an ammo acid fragment corresponding to the ammo acid fragment 185-209 of SEQ ID NO. 4 is replaced by an Asn and/or Gin, respectively.
- the 20 replacement m the Termamyl-like alpha-amylase, of one or more of the Lys residues present m an ammo acid fragment corresponding to the ammo acid fragment 185-209 of SEQ ID NO : 4 by an Arg .
- the DNA sequence encoding a parent alpha-amylase may be isolated from any cell or microorganism producing the alpha- amylase in question, using various methods well known in the art.
- a genomic DNA and/or cDNA library should be constructed using chromosomal DNA or messenger RNA from the organism that produces the alpha-amylase to be studied.
- homologous, labelled oligonucleotide probes may be synthesized and used to identify alpha-amylase-encoding clones from a genomic library prepared from the organism in question.
- a labelled oligonucleotide probe containing sequences homologous to a known alpha-amylase gene could be used as a probe to identify alpha-amylase-encoding clones, using hybridization and washing conditions of lower stringency.
- Yet another method for identifying alpha-amylase-encoding clones would involve inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming alpha- amylase-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar containing a substrate for alpha-amylase, thereby allowing clones expressing the alpha-amylase to be identified.
- an expression vector such as a plasmid
- transforming alpha- amylase-negative bacteria with the resulting genomic DNA library
- the DNA sequence encoding the enzyme may be prepared synthetically by established standard methods, e.g., the phosphoroamidite method described by S.L. Beaucage and M.H. Caruthers (1981) or the method described by Matthes et al . (1984) .
- the phosphoroamidite method oligonucleotides are synthesized, e.g., in an automatic DNA synthesizer, purified, annealed, ligated and cloned in appropriate vectors.
- the DNA sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin or mixed genomic and cDNA origin, prepared by ligatmg fragments of synthetic, genomic or cDNA origin (as appropriate, the fragments corresponding to various parts of the entire DNA sequence) , m accordance with standard techniques.
- the DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described m US 4,683,202 or R.K. Saiki et al . ( 1988 ) .
- mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis.
- a smgle-stranded gap of DNA, bridging the alpha-amylase-encoding sequence is created m a vector carrying the alpha-amylase gene.
- the synthetic nucleotide, bearing the desired mutation is annealed to a homologous portion of the smgle-stranded DNA.
- Random mutagenesis is suitably performed either as localised or region- speciflc random mutagenesis m at least three parts of the gene translating to the ammo acid sequence shown m question, or withm the whole gene.
- the random mutagenesis of a DNA sequence encoding a parent alpha-amylase may be conveniently performed by use of any method known m the art .
- a further aspect of the present invention relates to a method for generating a variant of a parent alpha-amylase, e.g., wherein the variant exhibits a reduced capability of cleaving an oligo-saccharide substrate close to the branching point, and further exhibits improved substrate specificity and/or improved specific activity relative to the parent, the method: (a) subjecting a DNA sequence encoding the parent alpha- amylase to random mutagenesis,
- Step (c) of the above method of the invention is preferably performed using doped primers.
- the random mutagenesis may be performed by use of a suitable physical or chemical mutagenizmg agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis.
- the random mutagenesis may be performed by use of any combination of these mutagenizmg agents.
- the mutagenizmg agent may, e . g. , be one, which induces transitions, transversions, inversions, scrambling, deletions, and/or insertions.
- Examples of a physical or chemical mutagenizmg agent suitable for the present purpose include ultraviolet (UV) lr-radiation, hydroxylamine, N-methyl-N 1 -nitro-N-nitrosoguamdme (MNNG) , 0- methyl hydroxylamine, nitrous acid, ethyl methane sulphonate
- the mutagenesis is typically performed by incubating the DNA sequence encoding the parent enzyme to be mutagenized m the presence of the mutagenizmg agent of choice under suitable conditions for the mutagenesis to take place, and selecting for mutated DNA having the desired properties.
- the mutagenesis is performed by the use of an oligonucleotide
- the oligonucleotide may be doped or spiked with the three non-parent nucleotides during the synthesis of the oligonucleotide at the positions, which are to be changed. The doping or spiking may be done so that codons for unwanted amino acids are avoided.
- the doped or spiked oligonucleotide can be incorporated into the DNA encoding the alpha-amylase enzyme by any published technique, using e . g. , PCR, LCR or any DNA polymerase and ligase as deemed appropriate.
- the doping is carried out using "constant random doping", which the percentage of wild type and mutation in each position is predefined.
- the doping may be directed toward a preference for the introduction of certain nucleotides, and thereby a preference for the introduction of one or more specific amino acid residues.
- the doping may be made, e . g. , so as to allow for the introduction of 90% wild type and 10% mutations in each position.
- a doping scheme is based on genetic as well as protein- structural constraints.
- the doping scheme may be made by using the DOPE program, which, inter alia, ensures that introduction of stop codons is avoided.
- DOPE program which, inter alia, ensures that introduction of stop codons is avoided.
- a mutator strain of E . coli (Fowler et al . , Molec . Gen. Genet., 133, 1974, pp. 179-191), S . cereviseae or any other microbial organism may be used for the random mutagenesis of the DNA encoding the alpha-amylase by, e . g. , transforming a plasmid containing the parent glycosylase into the mutator strain, growing the mutator strain with the plasmid and isolating the mutated plasmid from the mutator strain.
- the mutated plasmid may be subsequently transformed into the expression organism.
- the DNA sequence to be mutagenized may be conveniently present a genomic or cDNA library prepared from an organism expressing the parent alpha-amylase. Alternatively, the DNA sequence may be present on a suitable vector such as a plasmid or a bacteriophage, which as such may be incubated with or otherwise exposed to the mutagenising agent.
- the DNA to be mutagenized may also be present m a host cell either by being integrated in the genome of said cell or by being present on a vector harboured in the cell. Finally, the DNA to be mutagenized may be in isolated form.
- the DNA sequence to be subjected to random mutagenesis is preferably a cDNA or a genomic DNA sequence.
- Such amplification may be performed in accordance with methods known m the art, the presently preferred method being PCR-generated amplification using oligonucleotide primers prepared on the basis of the DNA or amino acid sequence of the parent enzyme.
- the mutated DNA is expressed by culturing a suitable host cell carrying the DNA sequence under conditions allowing expression to take place.
- the host cell used for this purpose may be one which has been transformed with the mutated DNA sequence, optionally present on a vector, or one which was carried the DNA sequence encoding the parent enzyme during the mutagenesis treatment.
- suitable host cells are the following: gram positive bacteria such as Bacillus subtilis, Bacillus licheniformis , Bacillus lentus , Bacillus brevis, Bacillus stearothermophilus , Bacillus alkalophilus , Bacillus amyloliquefaciens , Bacillus coagulans , Bacillus circulans, Bacillus lautus , Bacillus megaterium, Bacillus thuringiensis, Streptomyces lividans or Streptomyces murinus; and gram-negative bacteria such as E. coli .
- the mutated DNA sequence may further comprise a DNA sequence encoding functions permitting expression of the mutated DNA sequence. Localised random mutagenesis
- the random mutagenesis may be advantageously localised to a part of the parent alpha-amylase m question. This may, e . g. , be advantageous when certain regions of the enzyme have been identified to be of particular importance for a given property of the enzyme, and when modified are expected to result in a variant having improved properties. Such regions may normally be identified when the tertiary structure of the parent enzyme has been elucidated and related to the function of the enzyme.
- the localised, or region-specific, random mutagenesis is conveniently performed by use of PCR generated mutagenesis techniques as described above or any other suitable technique known in the art.
- the DNA sequence encoding the part of the DNA sequence to be modified may be isolated, e . g. , by insertion into a suitable vector, and said part may be subsequently subjected to mutagenesis by use of any of the mutagenesis methods discussed above.
- a DNA sequence encoding the variant produced by methods described above, or by any alternative methods known in the art can be expressed, in enzyme form, using an expression vector which typically includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and, optionally, a repressor gene or various activator genes.
- the recombinant expression vector carrying the DNA sequence encoding an alpha-amylase variant of the invention may be any vector, which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on Lhe host cell into which it is to be introduced.
- the vector may be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, a bacteriophage or an extrachromosomal element, minichromosome or an artificial chromosome.
- the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome (s) into which it has been integrated.
- the DNA sequence should be operably connected to a suitable promoter sequence.
- the promoter may be any DNA sequence, which shows transcriptional activity m the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell .
- suitable promoters for directing the transcription of the DNA sequence encoding an alpha-amylase variant of the invention, especially m a bacterial host are the promoter of the lac operon of E.
- coli the Streptomyces coelicolor agarase gene agA promoters, the promoters of the Bacillus licheniformis alpha- amylase gene ( amyL) , the promoters of the Bacillus stearothermophilus maltogenic amylase gene ( a yM) , the promoters of the Bacillus amyloliquefaciens alpha-amylase ( amyQ) , the promoters of the Bacillus subtilis xylA and xylB genes etc.
- useful promoters are those derived from the gene encoding A .
- oryzae TAKA amylase Rhizomucor miehei aspartic protemase, A . niger neutral alpha- amylase, A . niger acid stable alpha-amylase, A . niger glucoamylase, Rhizomucor miehei lipase, A . oryzae alkaline protease, A . oryzae triose phosphate isomerase or A . nidulans acetamidase.
- the expression vector of the invention may also comprise a suitable transcription terminator and, m eukaryotes, polyadenylation sequences operably connected to the DNA sequence encoding the alpha-amylase variant of the invention. Termination and polyadenylation sequences may suitably be derived from the same sources as the promoter.
- the vector may further comprise a DNA sequence enabling the vector to replicate the host cell m question.
- a DNA sequence enabling the vector to replicate the host cell m question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUBHO, pE194, pAMBl and pIJ702.
- the vector may also comprise a selectable marker, e.g., a gene the product of which complements a defect m the host cell, such as the dal genes from B . subtilis or B . lichemformis , or one which confers antibiotic resistance such as ampicillm, kanamycm, chloramphenicol or tetracyclm resistance.
- a selectable marker e.g., a gene the product of which complements a defect m the host cell, such as the dal genes from B . subtilis or B . lichemformis , or one which confers antibiotic resistance such as ampicillm, kanamycm, chloramphenicol or tetracyclm resistance.
- the vector may comprise Aspergillus selection markers such as amdS , argB, niaD and sC, a marker giving rise to hygromycm resistance, or the selection may be accomplished by co-transformation, e.g., as described
- Bacillus alpha-amylases mentioned herein comprise a pre-region permitting secretion of the expressed protease into the culture medium. If desirable, this pre-region may be replaced by a different preregion or signal sequence, conveni- ently accomplished by substitution of the DNA sequences encoding the respective preregions .
- the cell of the invention is advantageously used as a host cell the recombinant production of an alpha-amylase variant of the invention.
- the cell may be transformed with the DNA construct of the invention encoding the variant, conveniently by integrating the DNA construct (m one or more copies) m the host chromosome. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained m the cell . Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e . g. , by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described above m connection with the different types of host cells.
- the cell of the invention may be a cell of a higher organism such as a mammal or an insect, but is preferably a microbial cell, e . g. , a bacterial or a fungal (including yeast) cell.
- a microbial cell e . g. , a bacterial or a fungal (including yeast) cell.
- suitable bacteria are gram-positive bacteria such as Bacillus subtilis, Bacillus licheniformis , Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus , Bacillus amyloliquefaciens , Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Ba cillus thuringiensis, or Stre tomyces lividans or Streptomyces murinus, or gramnegative bacteria such as E. coli .
- the transformation of the bacteria may, for instance, be effected by protoplast transformation or by using competent cells in a manner known per se .
- the yeast organism may favourably be selected from a species of Saccharomyces or Schizosaccharomyces , e. g. , Saccharomyces cerevisiae .
- the filamentous fungus may advantageously belong to a species of Aspergillus, e . g. , Aspergillus oryzae or Aspergil lus niger.
- Fungal cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se . A suitable procedure for transformation of Aspergillus host cells is described in EP 238 023.
- the present invention relates to a method of producing an alpha-amylase variant of the invention, which method comprises cultivating a host cell as described above under conditions conducive to the production of the variant and recovering the variant from the cells and/or culture medium.
- the medium used to cultivate the cells may be any conven- tional medium suitable for growing the host cell in question and obtaining expression of the alpha-amylase variant of the invention. Suitable media are available from commercial suppliers or may be prepared according to published recipes ( e . g. , as described m catalogues of tne American Type Culture Collection) .
- the alpha-amylase variant secreted from the host cells may conveniently be recovered from the culture medium by well-known procedures, including separating the cells from the medium by centrifugation or filtration, and precipitating protemaceous components of the medium by means of a salt such as ammonium sulphate, followed by the use of chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
- alpha-amylase variants of this invention possess valuable properties allowing for a variety of industrial applications.
- enzyme variants of the invention are applicable as a component m washing, dishwashing and hard surface cleaning detergent compositions.
- Numerous variants are particularly useful m the production of sweeteners and ethanol, e.g., fuel, drinking or industrial ethanol, from starch, and/or for textile desizmg.
- Conditions for conventional starch- conversion processes, including starch liquefaction and/or saccharification processes, are described m, e . g. , US 3,912,590 and m EP patent publications Nos. 252 730 and 63 909.
- a "traditional" process for conversion of starch to fructose syrups normally consists of three consecutive enzymatic processes, viz. a liquefaction process followed by a sacchari- fication process and an lsome ⁇ zation process.
- starch is degraded to dextrms by an alpna-amylase (e . g. , TermamylTM) at pH values between 5.5 and 6.2 and at temperatures of 95-160°C for a period of approx. 2 hours.
- an alpna-amylase e . g. , TermamylTM
- 1 mM of calcium is added (40 ppm free calcium ions) .
- the dextrms are converted into dextrose by addition of a glucoamylase (e . g. , AMGTM) and a debranchmg enzyme, such as an isoamylase or a pullulanase ⁇ e . g. , PromozymeTM) .
- a glucoamylase e . g. , AMGTM
- a debranchmg enzyme such as an isoamylase or a pullulanase ⁇ e . g. , PromozymeTM
- the pH is reduced to a value below 4.5, maintaining the high temperature (above 95°C) , and the liquefying alpha-amylase activity is denatured.
- the tem- 5 perature is lowered to 60 °C, and glucoamylase and debranching enzyme are added.
- the saccharification process proceeds for 24-72 hours.
- the pH is increased to a value in the range of 6-8, preferably pH 7.5, and the calcium is lo removed by ion exchange .
- the dextrose syrup is then converted into high fructose syrup using, e . g. , an immmobilized gluco- seisomerase (such as SweetzymeTM) .
- At least one enzymatic improvement of this process could be envisaged: Reduction of the calcium dependency of the is liquefying alpha-amylase. Addition of free calcium is required to ensure adequately high stability of the alpha-amylase, but free calcium strongly inhibits the activity of the glucoseisomerase and needs to be removed, by means of an expensive unit operation, to an extent, which reduces the level
- alpha-amylase which is stable and highly active at low concentrations of free calcium ( ⁇ 40 ppm) is required.
- a Termamyl-like alpha-amylase should have a pH optimum at a pH in the range of 4.5-6.5, preferably in the range of 4.5-5.5.
- the invention also relates to a composition
- a composition comprising a
- the invention also relates to a composition
- a composition comprising a mixture of one or more variants according the invention derived from (as the parent Termamyl-like alpha- amylase) the B . stearothermophilus alpha-amylase having the sequence shown m SEQ ID NO: 8 and a hybrid alpha-amylase comprising a part of the B . amyloliquefaciens alpha-amylase shown m SEQ ID NO : 6 and a part of the B . licheniformis alpha- amylase shown m SEQ ID NO: 4.
- the latter mentioned hybrid Termamyl-like alpha-amylase comprises the 445 C-termmal ammo acid residues of the B .
- Said latter mentioned hybrid alpha-amylase may suitably comprise the following mutations: H156Y+A181T+N190F+A209V+Q264S (using the numbering m SEQ ID NO: 4)
- said latter mentioned hybrid alpha-amylase may suitably comprise the following mutations: H156Y+A181T+N190F+A209V+Q264S+I201F (using the SEQ ID NO: 4)
- m SEQ ID NO: 2 (shown m SEQ ID NO: 2) is used for preparing variants of the invention, which variants may be used m compositions of the invention.
- An alpha-amylase variant of the invention or a composition of the invention may m an aspect of the invention be used for starch liquefaction, m detergent composition, such as laundry, dish wash compositions and hard surface cleaning, ethanol production, such as fuel, drinking and industrial ethanol production, desizmg of textile, fabric and garments.
- m detergent composition such as laundry, dish wash compositions and hard surface cleaning
- ethanol production such as fuel, drinking and industrial ethanol production, desizmg of textile, fabric and garments.
- LE174 is a hybrid Termamyl-like alpha-amylase being identical to the Termamyl sequence, i.e., the Bacillus lichemformi s alpha-amylase shown m SEQ ID NO: 4, except that the N- termmal 35 ammo acid residues (of the mature protein) has oeen replaced by the N-termmal 33 residues of BAN (mature protein), i.e., the Bacillus amyloliquefaciens alpha-amylase snown m SEQ ID NO: 6, which further have following mutations: H156Y+A181T+N190F+A209V+Q264S (SEQ ID NO: 4) .
- LE429 is a hybrid Termamyl-like alpha-amylase being identical to the Termamyl sequence, i.e., the Bacillus lichemformi s alpha-amylase shown m SEQ ID NO: 4, except that the N- termmal 35 ammo acid residues (of the mature protein) has been replaced by the N-termmal 33 residues of BAN (mature protein), i.e., the Bacillus amyloliquefaciens alpha-amylase shown m SEQ ID NO: 6, which further have following mutations:
- H156Y+A181T+N190F+A209V+Q264S+I201F (SEQ ID NO: 4) .
- LE429 is shown as SEQ ID NO: 2 and was constructed by SOE-PCR (Higuchi et al . 1988, Nucleic Acids Research 16:7351).
- DextrozymeTM E a balanced mixture of glucoamylase (AMG) and pullulanase obtainable from selected strains of Aspergillus mger and Bacillus deramificans (available from Novo Nordisk A/S)
- the culture is shaken at 37°C at 270 rpm for 5 days. Cells and cell debris are removed from the fermentation broth by cent ⁇ fugation at 4500 rpm m 20-25 minutes. Afterwards the supernatant is filtered to obtain a completely clear solution. The filtrate is concentrated and washed on an UF- filter (10000 cut off membrane) and the buffer is changed to 20mM Acetate pH 5.5. The UF-filtrate is applied on a S-sepharose F.F. and elution is carried out by step elution with 0.2M NaCl 5 m the same buffer. The eluate is dialysed against lOmM Tris, pH 9.0 and applied on a Q-sepharose F.F.
- One Kilo alpha-amylase Unit (1 KNU) is the amount of enzyme is which breaks down 5.26 g starch (Merck, Amylum Solubile, Erg. B
- Phadebas ® tablets as substrate.
- Phadebas tablets (Phadebas ® 3 Amylase Test, supplied by Pharmacia Diagnostic) contain a cross- linked insoluble blue-coloured starch polymer, which has been mixed with bovine serum albumin and a buffer substance and tabletted.
- the test is performed m a water bath at the temperature of interest .
- the alpha-amylase to be tested is diluted m x ml of 50 mM Britton- Robmson buffer. 1 ml of this alpha-amylase solution is added to the 5 ml 50 mM Britton-Robmson buffer.
- the starch is hydrolysed by the alpha-amylase giving soluble blue fragments.
- the absorbance of the resulting blue solution measured spectrophotomet ⁇ cally at 620 nm, is a function of the alpha- amylase activity.
- the measured 620 nm absorbance after 10 or 15 minutes of incubation is m the range of 0.2 to 2.0 absorbance units at 620 nm. In this absorbance range there is linearity between activity and absorbance (Lambert -Beer law) . The dilution of the enzyme must therefore be adjusted to fit this criterion. Under a specified set of conditions (temp., pH, reaction time, buffer conditions) 1 mg of a given alpha- amylase will hydrolyse a certain amount of substrate and a blue colour will be produced. The colour intensity is measured at 620 nm. The measured absorbance is directly proportional to the specific activity (activity/mg of pure alpha-amylase protein) of the alpha-amylase m question under the given set of conditions.
- the specific activity is determined using the Phadebas assay (Pharmacia) as activity/mg enzyme.
- the variant is stored m 20 mM TRIS ph 7.5 , 0.1 mM, CaCl 2 and tested at 30°C, 50 mM Britton-Robmson, 0.1 mM CaCl 2 .
- the pH activity is measured at pH 4.0, 4.5, 5.0, 5.5, 6.0, 7.0, 8.0, 9.5, 9.5, 10, and 10.5, using the Phadebas assay described above.
- AGU One Novo Amyloglucosidase Unit
- AGU is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute at 37°C and pH 4.3.
- a detailed description of the analytical method (AEL-SM-0131) is available on request from Novo Nordisk.
- the activity is determined as AGU/ml by a method modified after (AEL-SM-0131) using the Glucose GOD-Perid kit from Boehrmger Mannheim, 124036. Standard: AMG-standard, batch 7- 1195, 195 AGU/ml.
- microL substrate 1% maltose m 50 mM Sodium acetate, pH 4.3
- 25 microL enzyme diluted m sodium acetate is added.
- the reaction is stopped after 10 minutes by adding 100 microL 0.25 M NaOH.
- 20 microL is transferred to a 96 well microtitre plate and 200 microL GOD-Perid solution is added.
- the absorbance is measured at 650 nm and the activity calculated AGU/ml from the AMG-standard.
- the specific activity m AGU/mg is then calculated from the activity (AGU/ml) divided with the protein concentration (mg/ml) .
- Termamyl (B . lichemformis alpha-amylase SEQ ID NO: 4) is expressed m B . subtilis from a plasmid denoted pDN1528.
- This plasmid contains the complete gene encoding Termamyl, a yL, the expression of which is directed by its own promoter. Further, the plasmid contains the origin of replication, on , from plasmid pUBHO and the cat gene from plasmid pC194 conferring resistance towards chloramphenicol.
- pDN1528 is shown m Fig. 9 of WO 96/23874. A specific mutagenesis vector containing a major part of the coding region of SEQ ID NO: 3 was prepared.
- pJeENl The important features of this vector, denoted pJeENl , include an origin of replication derived from the pUC plasmids, the cat gene conferring resistance towards chloramphenicol, and a frameshift-containing version of the bla gene, the wild type of which normally confers resistance towards ampicillm (amp phenotype) . This mutated version results m an amp s phenotype.
- the plasmid pJeENl is shown m Fig. 10 of WO 96/23874, and che E . coli origin of replication, ori , bla, cat, the 5 '-truncated version of the Termamyl amylase gene, and selected restriction sites are indicated on the plasmid.
- Mutations are introduced m a yL by the method described by Deng and Nickoloff (1992, Anal. Biochem. 200, pp. 81-88) except that plasmids with the "selection primer" (primer #6616; see below) incorporated are selected based on the amp R phenotype of transformed E. coli cells harboring a plasmid with a repaired bla gene, instead of employing the selection by restriction enzyme digestion outlined by Deng and Nickoloff. Chemicals and enzymes used for the mutagenesis were obtained from the ChameleonO mutagenesis kit from Stratagene (catalogue number 200509) .
- the truncated gene containing the desired alteration, is subcloned into pDN1528 as a Pstl-EcoRI fragment and transformed into the protease- and amylase-depleted Bacillus subtilis strain SHA273 (described m W092/11357 and WO95/10603) m order to express the variant enzyme.
- the Termamyl variant V54W was constructed by the use of the following mutagenesis primer (written 5 ' to 3 ' , left to right) : PG GTC GTA GGC ACC GTA GCC CCA ATC CGC TTG (SEQ ID NO: 9)
- the Termamyl variant A52W + V54W was constructed by the use of the following mutagenesis primer (written 5 ' to 3 ' , left to right) : PG GTC GTA GGC ACC GTA GCC CCA ATC CCA TTG GCT CG (SEQ ID NO: 10)
- Primer #6616 (written 5' to 3', left to right; P denotes a 5' phosphate) :
- the Termamyl variant V54E was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) : PGG TCG TAG GCA CCG TAG CCC TCA TCC GCT TG (SEQ ID NO: 12)
- the Termamyl variant V54M was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant V54I was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- Termamyl variants Y290E and Y290K were constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- Y represents an equal mixture of C and T.
- the presence of a codon encoding either Glutamate or Lysme m position 290 was verified by DNA sequencing.
- the Termamyl variant N190F was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) : PCA TAG TTG CCG AAT TCA TTG GAA ACT TCC C (SEQ ID NO: 16)
- the Termamyl variant N188P+N190F was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant H140K+H142D was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant H156Y was constructed by the use of the following mutagenesis primer (written 5'-3', left to right) :
- the Termamyl variant A181T was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant A209V was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant Q264S was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant S187D was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant DELTA (K370-G371-D372 ) (i.e., deleted of ammo acid residues nos. 370, 371 and 372) was constructed by the use of the following mutagenesis primer (written 5' -3', left to right) :
- the Termamyl variant DELTA (D372 -S373 -Q374) was constructed by the use of the following mutagenesis primer (written 5' -3', left to right):
- the Termamyl variants A181T and A209V were combined to A181T+A209V by digesting the A181T containing pDN1528-l ⁇ ke plasmid (i.e., pDN1528 containing withm amyL the mutation resulting m the A181T alteration,) and the A209V-contammg pDN1528-l ⁇ ke plasmid (i.e., pDN1528 containing withm a yL the mutation resulting m the A209V alteration) with restriction enzyme Clal which cuts the pDN1528-l ⁇ ke plasmids twice resulting m a fragment of 1116 bp and the vector-part (i.e.
- the fragment containing the A209V mutation and the vector part containing the A181T mutation were purified by QIAquick gel extraction kit (purchased from QIAGEN) after separation on an agarose gel. The fragment and the vector were ligated and transformed into the protease and amylase depleted Bacillus subtili s strain referred to above. Plasmid from amy+ (clearing zones on starch containing agar-plates) and chloramphenicol resistant transformants were analysed for the presence of both mutations on the plasmid.
- H156Y and A209V were combined utilizing restriction endonucleases Acc65I and EcoRI , giving H156Y+A209V.
- H156Y +A209V and A181T+A209V were combined into H156Y+
- Primer 19364 (sequence 5' -3') : CCT CAT TCT GCA GCA GCA GCC GTA AAT GGC ACG CTG (SEQ ID NO : 26)
- Primer 1C CTC GTC CCA ATC GGT TCC GTC (SEQ ID NO : 29)
- PCR2 An approximately 400 bp fragment was amplified m another PCR denoted PCR2 with primers 19363 and 1C on template pDN152 8 .
- PCR1 and PCR2 were purified from an agarose gel and used as templates m PCR3 with primers 19364 and 1C, which resulted m a fragment of approximately 520 bp . This fragment thus contains one part of DNA encoding the N-terminus from BAN fused to a part of DNA encoding Termamyl from the 35th ammo acid.
- the 520 bp fragment was subcloned into a pDN1528-l ⁇ ke plasmid (containing the gene encoding Termamyl variant H156Y+ A181T+A209V) by digestion with restriction endonucleases Pstl and SacII, ligation and transformation of the B . subtilis strain as previously described.
- the DNA sequence between restriction sites Pstl and SacII was verified by DNA sequencing m extracted plasmids from amy+ and chloramphenicol resistant transformants .
- N190F was combined with BAN (1-35)+ H156Y+ A181T+A209V giving BAN (1-35)+ H156Y+ A181T+N190F+A209V by carrying out mutagenesis as described above except that the sequence of amyL m pJeENl was substituted by the DNA sequence encoding Termamyl variant BAN (1-35)+ H156Y+ A181T+A209V
- BAN(l-35)+ H156Y+ A181T+A209V+Q264S and BAN(l-35)+ H156Y+ A181T+N190F+A209V were combined into BAN (1-35)+ H156Y+ A181T+N190F+A209V+Q264S utilizing restriction endonucleases BsaHI (BsaHI site was introduced close to the A209V mutation) and Pstl.
- I201F was combined with BAN(l-35)+ H156Y+ A181T+N190F+A209V+Q264S giving BAN(l-35)+ H156Y+ A181T+N190F+A209V+Q264S+I201F (SEQ ID NO: 2) by carrying out mutagenesis as described above.
- the mutagenesis primer AM100 was used, introduced the I201F substitution and removed simultaneously a Cla I restriction site, which facilitates easy pm-pomtmg of mutants.
- thermostable B . licheniformis alpha- amylase consisting comprising the 445 C-termmal ammo acid residues of the B . li cheniformi s alpha-amylase shown m SEQ ID NO: 4 and the 37 N-termmal ammo acid residues of the alpha- is amylase derived from B .
- amyloliquefaciens shown m SEQ ID NO: 6 and further comprising the following mutations: H156Y+A181T+N190F+A209V+Q264S+I201F (the construction of this variant is described m Example 1, and the ammo acid sequence shown m SEQ ID NO : 2) has a reduced capability of cleaving an 20 substrate close to the branching point.
- Gene specific primer 27274 and mutagenic primer AM115 are 30 used to amplify by PCR an approximately 440 bp DNA fragment from a pDN1528-l ⁇ ke plasmid (harbouring the BAN(1-
- the 440 bp fragment is purified from an agarose gel and used 35 as a Mega-primer together with primer 113711 m a second PCR carried out on the same template.
- the resulting approximately 630 bp fragment is digested with restriction enzymes EcoR V and Acc65 I and the resulting approximately 370 bp DNA fragment is purified and ligated with the pDN1528-like plasmid digested with the same enzymes.
- Competent Bacillus subtili s SHA273 (amylase and protease low) cells are transformed with the ligation and Chlorampenicol resistant transformants are checked by DNA sequencing to verify the presence of the correct mutations on the plasmid.
- Primer 27274 5' CATAGTTGCCGAATTCATTGGAAACTTCCC 3' (SEQ ID NO : 31)
- LE314 Construction of LE314: BAN/Termamyl hybrid + H156Y+A181T+N190F+ A209V+Q264S + A52S is carried our in a similar way, except that mutagenic primer AMI16 is used.
- LE315 Construction of LE315: BAN/Termamyl hybrid + H156Y+A181T+N190F+ A209V+Q264S + A52S+V54N is carried our m a similar way, except that mutagenic primer AMI17 is used.
- AM117 5' GGAACGAGCCAATCGGATAACGGCTACGGTGC 3' (SEQ ID NO : 35)
- Construction LE317 BAN/Termamyl hybrid + H156Y+A181T+N190F+ A209V+Q264S + T49L+G107A is carried our m a similar way, except that mutagenic primer AMI18 and mutagenic primer AMI19 s are used simultaneously.
- H156Y+A181T+N190F+A209V+Q264S + Q51R+A52S is carried our m a similar way, except that mutagenic primer AM121 is used.
- H156Y+A181T+N190F+ A209V+Q264S + A52N is carried our m a similar way, except that mutagenic primer AM122 is used.
- DextrozymeTM E was used to provide glucoamylase and pullulanase activities
- Substrates for saccharification were prepared by dissolving common corn starch in deionized water and adjusting the dry substance to approximately 30% w/w. The pH was adjusted to 5.5 (measured at 60°C) , and aliquots of substrate corresponding to 10 g dry weight were transferred to blue cap glass flasks.
- the parent alpha-amylase for the variants is LE429.
- Example 3 The experiment in Example 3 was repeated for a number of other LE429 variants under the same conditions.
- Example 3 The experiment in Example 3 was repeated for a number of LE429 variants, except that the liquefaction was carried out at
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Detergent Compositions (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE60034558T DE60034558T2 (de) | 1999-03-30 | 2000-03-28 | Alpha-amylase-varianten |
| EP00912415A EP1165762B1 (en) | 1999-03-30 | 2000-03-28 | Alpha-amylase variants |
| JP2000609551A JP4668426B2 (ja) | 1999-03-30 | 2000-03-28 | α−アミラーゼ変異体 |
| CA2365438A CA2365438C (en) | 1999-03-30 | 2000-03-28 | Alpha-amylase variants |
| BRPI0009362A BRPI0009362B8 (pt) | 1999-03-30 | 2000-03-28 | variante de uma alfa-amilase precursora, e, uso de uma variante de alfa-amilase |
| DK00912415T DK1165762T3 (da) | 1999-03-30 | 2000-03-28 | Alpha-amylase varianter |
| MXPA01009812A MXPA01009812A (es) | 1999-03-30 | 2000-03-28 | Variantes de alfa-amilasa. |
| AU34193/00A AU3419300A (en) | 1999-03-30 | 2000-03-28 | Alpha-amylase variants |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DKPA199900437 | 1999-03-30 | ||
| DKPA199900437 | 1999-03-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000060059A2 true WO2000060059A2 (en) | 2000-10-12 |
| WO2000060059A3 WO2000060059A3 (en) | 2001-05-10 |
Family
ID=8093533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2000/000148 Ceased WO2000060059A2 (en) | 1999-03-30 | 2000-03-28 | Alpha-amylase variants |
Country Status (15)
| Country | Link |
|---|---|
| EP (3) | EP2290060B1 (https=) |
| JP (1) | JP4668426B2 (https=) |
| KR (1) | KR100808517B1 (https=) |
| CN (1) | CN1252256C (https=) |
| AR (1) | AR023214A1 (https=) |
| AT (1) | ATE360686T1 (https=) |
| AU (1) | AU3419300A (https=) |
| BR (1) | BRPI0009362B8 (https=) |
| CA (1) | CA2365438C (https=) |
| DE (1) | DE60034558T2 (https=) |
| DK (3) | DK2290060T3 (https=) |
| ES (3) | ES2286012T3 (https=) |
| MX (1) | MXPA01009812A (https=) |
| RU (1) | RU2231547C2 (https=) |
| WO (1) | WO2000060059A2 (https=) |
Cited By (191)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002092797A2 (en) | 2001-05-15 | 2002-11-21 | Novozymes A/S | Alpha-amylase variant with altered properties |
| WO2002031124A3 (en) * | 2000-10-13 | 2003-02-27 | Novozymes As | Alpha-amylase variant with altered properties |
| WO2002010355A3 (en) * | 2000-08-01 | 2003-09-12 | Novozymes As | Alpha-amylase mutants with altered stability |
| WO2003014358A3 (de) * | 2001-08-07 | 2003-09-18 | Henkel Kgaa | Wasch- und reinigungsmittel mit hybrid-alpha-amylasen |
| WO2004106533A1 (en) | 2003-05-30 | 2004-12-09 | Novozymes A/S | Alcohol product processes |
| WO2006069289A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes North America, Inc | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2006037484A3 (de) * | 2004-10-01 | 2006-07-13 | Henkel Kgaa | Alpha-amylase-varianten mit erhöhter lösungsmittelstabilität, verfahren zu deren herstellung sowie wasch- und reinigungsmittel mit diesen alpha-amylase-varianten |
| WO2007035730A2 (en) | 2005-09-20 | 2007-03-29 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2007076388A2 (en) | 2005-12-22 | 2007-07-05 | Novozymes North America, Inc. | Processes for producing a fermentation product |
| WO2007109750A2 (en) | 2006-03-22 | 2007-09-27 | Novozymes North America, Inc. | Fermentation processes |
| WO2007113292A3 (en) * | 2006-04-04 | 2007-11-29 | Novozymes As | Mashing process |
| WO2008134259A1 (en) | 2007-04-24 | 2008-11-06 | Novozymes North America, Inc. | Detoxifying pre-treated lignocellulose-containing materials |
| WO2009030713A1 (en) | 2007-09-03 | 2009-03-12 | Novozymes A/S | Detoxifying and recycling of washing solution used in pretreatment of lignocellulose-containing materials |
| EP1975229A3 (en) * | 2000-10-13 | 2009-03-18 | Novozymes A/S | Alpha-amylase variant with altered properties |
| WO2010008841A2 (en) | 2008-06-23 | 2010-01-21 | Novozymes A/S | Processes for producing fermentation products |
| WO2010039812A2 (en) | 2008-09-30 | 2010-04-08 | Novozymes North America, Inc. | Improvement of enzymatic hydrolysis of pre-treated lignocellulose-containing material with distillers dried grains |
| US7713723B1 (en) | 2000-08-01 | 2010-05-11 | Novozymes A/S | Alpha-amylase mutants with altered properties |
| WO2010059413A2 (en) | 2008-11-20 | 2010-05-27 | Novozymes, Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
| WO2010074999A1 (en) * | 2008-12-15 | 2010-07-01 | Danisco Us Inc. | Hybrid alpha-amylases |
| WO2010078392A2 (en) | 2008-12-31 | 2010-07-08 | Novozymes North America, Inc. | Processes of producing fermentation products |
| WO2010078391A2 (en) | 2008-12-30 | 2010-07-08 | Novozymes North America, Inc. | Improvement of enzymatic hydrolysis of pretreated lignocellulose-containing material with dissolved air flotation sludge |
| WO2011008785A2 (en) | 2009-07-17 | 2011-01-20 | Novozymes A/S | A method of analyzing cellulose decay in cellulosic material hydrolysis |
| WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011066560A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011087836A2 (en) | 2009-12-22 | 2011-07-21 | Novozymes A/S | Pullulanase variants and uses thereof |
| WO2011092136A1 (en) | 2010-01-29 | 2011-08-04 | Novozymes A/S | Biogas production process with enzymatic pre-treatment |
| WO2011100161A1 (en) | 2010-02-09 | 2011-08-18 | Novozymes North America, Inc. | Addition of alpha - glucosidase and cobalt for producing fermentation products from starch |
| WO2011082425A3 (en) * | 2010-01-04 | 2011-09-29 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2011123505A1 (en) | 2010-03-30 | 2011-10-06 | Novozymes North America, Inc. | Processes of producing a fermentation product |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2012018775A1 (en) | 2010-08-02 | 2012-02-09 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2012064351A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
| WO2012068047A2 (en) | 2010-11-19 | 2012-05-24 | Novozymes North America, Inc. | Processes of producing a fermentation product |
| WO2012093041A1 (en) | 2011-01-04 | 2012-07-12 | Novozymes A/S | Process for producing biogas from pectin and lignocellulose containing material |
| WO2012109119A2 (en) | 2011-02-07 | 2012-08-16 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2013000945A1 (en) | 2011-06-28 | 2013-01-03 | Novozymes A/S | Biogas from enzyme-treated bagasse |
| WO2013006756A2 (en) | 2011-07-06 | 2013-01-10 | Novozymes A/S | Alpha amylase variants and polynucleotides encoding same |
| WO2013016115A1 (en) | 2011-07-22 | 2013-01-31 | Novozymes North America, Inc. | Processes for pretreating cellulosic material and improving hydrolysis thereof |
| WO2013029496A1 (en) | 2011-08-26 | 2013-03-07 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2013036526A1 (en) | 2011-09-06 | 2013-03-14 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2013053801A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2013055676A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes North America, Inc. | Processes for producing fermentation products |
| WO2013082486A1 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Processes for producing fermentation products |
| WO2013083801A2 (en) | 2011-12-09 | 2013-06-13 | Novozymes A/S | Biogas from substrates comprising animal manure and enzymes |
| WO2013096652A1 (en) | 2011-12-21 | 2013-06-27 | Novozymes, Inc. | Methods for determining the degradation of a biomass material |
| WO2013148993A1 (en) | 2012-03-30 | 2013-10-03 | Novozymes North America, Inc. | Processes of producing fermentation products |
| EP2623591A3 (en) * | 2008-06-06 | 2013-11-20 | Danisco US Inc. | Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties |
| WO2014027062A1 (en) | 2012-08-17 | 2014-02-20 | Novozymes A/S | Thermostable asparaginase variants and polynucleotides encoding same |
| US8785365B2 (en) | 2004-10-01 | 2014-07-22 | Basf Se | Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants |
| US8809031B2 (en) | 2007-03-23 | 2014-08-19 | Danisco Us Inc. | Enhanced amylase production by N-terminal addition to mature amylase protein |
| WO2014177541A2 (en) | 2013-04-30 | 2014-11-06 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2014194054A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194032A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194117A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194034A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014206960A1 (en) | 2013-06-26 | 2014-12-31 | Novozymes A/S | Process for manufacturing a feed composition |
| WO2015007639A1 (en) | 2013-07-17 | 2015-01-22 | Novozymes A/S | Pullulanase chimeras and polynucleotides encoding same |
| WO2015035914A1 (en) | 2013-09-11 | 2015-03-19 | Novozymes A/S | Processes for producing fermentation products |
| WO2015089447A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of the bacillus gibsonii-clade |
| WO2015089441A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of bacillus species |
| WO2015095358A1 (en) | 2013-12-18 | 2015-06-25 | E. I. Du Pont De Nemours And Company | Cationic poly alpha-1,3-glucan ethers |
| WO2015123323A1 (en) | 2014-02-14 | 2015-08-20 | E. I. Du Pont De Nemours And Company | Poly-alpha-1,3-1,6-glucans for viscosity modification |
| WO2015138283A1 (en) | 2014-03-11 | 2015-09-17 | E. I. Du Pont De Nemours And Company | Oxidized poly alpha-1,3-glucan as detergent builder |
| WO2015143144A1 (en) | 2014-03-19 | 2015-09-24 | Novozymes A/S | Method for enhancing activity of an x143 polypeptide |
| WO2015195777A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
| WO2015195960A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
| WO2016061438A1 (en) | 2014-10-17 | 2016-04-21 | Danisco Us Inc. | Serine proteases of bacillus species |
| WO2016062875A2 (en) | 2014-10-23 | 2016-04-28 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2016069557A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases of bacillus species |
| WO2016069569A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069548A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069544A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069552A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016106011A1 (en) | 2014-12-23 | 2016-06-30 | E. I. Du Pont De Nemours And Company | Enzymatically produced cellulose |
| US9434932B2 (en) | 2011-06-30 | 2016-09-06 | Novozymes A/S | Alpha-amylase variants |
| WO2014083096A3 (en) * | 2012-11-30 | 2016-10-13 | Novozymes A/S | Mixture of two enzymes for cleaning or detergent compositions |
| WO2016201069A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Low-density enzyme-containing particles |
| WO2016201044A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Osmotic burst encapsulates |
| WO2016201040A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc. | Water-triggered enzyme suspension |
| WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2016205127A1 (en) | 2015-06-18 | 2016-12-22 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
| WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
| WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
| WO2017083226A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| WO2017083228A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| WO2017083229A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
| WO2017112540A1 (en) | 2015-12-22 | 2017-06-29 | Novozymes A/S | Processes for producing fermentation products |
| WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
| WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
| EP3305894A1 (en) * | 2001-02-21 | 2018-04-11 | BASF Enzymes LLC | Enzymes having alpha amylase activity and methods of use thereof |
| WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
| WO2018098381A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Improved yeast for ethanol production |
| WO2018102348A1 (en) | 2016-11-29 | 2018-06-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
| WO2018156705A1 (en) | 2017-02-24 | 2018-08-30 | Danisco Us Inc. | Compositions and methods for increased protein production in bacillus licheniformis |
| EP3372680A1 (en) | 2013-04-30 | 2018-09-12 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
| WO2018183662A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Delayed release enzyme formulations for bleach-containing detergents |
| WO2018184004A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Alpha-amylase combinatorial variants |
| WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
| EP3415624A1 (en) | 2014-01-22 | 2018-12-19 | Novozymes A/S | Pullulanase variants and polynucleotides encoding same |
| WO2019006077A1 (en) | 2017-06-30 | 2019-01-03 | Danisco Us Inc | PARTICLES CONTAINING LOW AGGLOMERATION ENZYME |
| WO2019005755A1 (en) | 2017-06-28 | 2019-01-03 | Novozymes A/S | POLYPEPTIDES HAVING TREHALASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME |
| WO2019030165A1 (en) | 2017-08-08 | 2019-02-14 | Novozymes A/S | POLYPEPTIDES HAVING TREHALASE ACTIVITY AND THEIR USE IN A PRODUCTION PROCESS OF FERMENTATION PRODUCTS |
| WO2019036721A2 (en) | 2017-08-18 | 2019-02-21 | Danisco Us Inc | VARIANTS OF ALPHA-AMYLASES |
| WO2019040412A1 (en) | 2017-08-23 | 2019-02-28 | Danisco Us Inc | METHODS AND COMPOSITIONS FOR EFFICIENT GENETIC MODIFICATION OF BACILLUS LICHENIFORMIS STRAINS |
| WO2019055455A1 (en) | 2017-09-15 | 2019-03-21 | Novozymes A/S | MIXTURES OF ENZYMES AND METHODS FOR IMPROVING THE NUTRITIONAL QUALITY OF ANIMAL FEED |
| WO2019055261A1 (en) | 2017-09-13 | 2019-03-21 | Danisco Us Inc | MODIFIED 5 'NON-TRANSLATED REGION (UTR) SEQUENCES FOR INCREASED PROTEIN PRODUCTION IN BACILLUS |
| WO2019083831A1 (en) | 2017-10-23 | 2019-05-02 | Novozymes A/S | METHODS FOR LACTIC ACID REDUCTION IN A BIOCARBURIZER FERMENTATION SYSTEM |
| WO2019089898A1 (en) | 2017-11-02 | 2019-05-09 | Danisco Us Inc | Freezing point depressed solid matrix compositions for melt granulation of enzymes |
| WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019125683A1 (en) | 2017-12-21 | 2019-06-27 | Danisco Us Inc | Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant |
| WO2019135868A1 (en) | 2018-01-03 | 2019-07-11 | Danisco Us Inc | Mutant and genetically modified bacillus cells and methods thereof for increased protein production |
| WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
| WO2019156670A1 (en) | 2018-02-08 | 2019-08-15 | Danisco Us Inc. | Thermally-resistant wax matrix particles for enzyme encapsulation |
| WO2019161227A1 (en) | 2018-02-15 | 2019-08-22 | Novozymes A/S | Improved yeast for ethanol production |
| US10457924B2 (en) | 2011-10-28 | 2019-10-29 | Danisco Us Inc | Variant maltohexaose-forming alpha-amylase variants |
| WO2019231944A2 (en) | 2018-05-31 | 2019-12-05 | Novozymes A/S | Processes for enhancing yeast growth and productivity |
| WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| EP3587569A1 (en) | 2014-03-21 | 2020-01-01 | Danisco US Inc. | Serine proteases of bacillus species |
| WO2020023411A1 (en) | 2018-07-25 | 2020-01-30 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
| WO2020028443A1 (en) | 2018-07-31 | 2020-02-06 | Danisco Us Inc | Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid |
| WO2020047215A1 (en) | 2018-08-30 | 2020-03-05 | Danisco Us Inc | Enzyme-containing granules |
| WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
| WO2020076697A1 (en) | 2018-10-08 | 2020-04-16 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
| WO2020077331A2 (en) | 2018-10-12 | 2020-04-16 | Danisco Us Inc | Alpha-amylases with mutations that improve stability in the presence of chelants |
| WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2020160126A1 (en) | 2019-01-31 | 2020-08-06 | Novozymes A/S | Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed |
| WO2020206058A1 (en) | 2019-04-02 | 2020-10-08 | Novozymes A/S | Process for producing a fermentation product |
| WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
| WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
| WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
| WO2021025872A1 (en) | 2019-08-06 | 2021-02-11 | Novozymes A/S | Fusion proteins for improved enzyme expression |
| WO2021026201A1 (en) | 2019-08-05 | 2021-02-11 | Novozymes A/S | Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct |
| WO2021030267A1 (en) | 2019-08-14 | 2021-02-18 | Danisco Us Inc | Compositions and methods for increased protein production in bacillus licheniformis |
| WO2021055395A1 (en) | 2019-09-16 | 2021-03-25 | Novozymes A/S | Polypeptides having beta-glucanase activity and polynucleotides encoding same |
| WO2021080948A2 (en) | 2019-10-24 | 2021-04-29 | Danisco Us Inc | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2021096857A1 (en) | 2019-11-11 | 2021-05-20 | Danisco Us Inc | Compositions and methods for enhanced protein production in bacillus cells |
| WO2021119304A1 (en) | 2019-12-10 | 2021-06-17 | Novozymes A/S | Microorganism for improved pentose fermentation |
| WO2021126966A1 (en) | 2019-12-16 | 2021-06-24 | Novozymes A/S | Processes for producing fermentation products |
| WO2021146411A1 (en) | 2020-01-15 | 2021-07-22 | Danisco Us Inc | Compositions and methods for enhanced protein production in bacillus licheniformis |
| WO2021163030A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
| EP3872174A1 (en) | 2015-05-13 | 2021-09-01 | Danisco US Inc. | Aprl-clade protease variants and uses thereof |
| WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
| WO2022090564A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
| WO2022178432A1 (en) | 2021-02-22 | 2022-08-25 | Danisco Us Inc. | Methods and compositions for producing proteins of interest in pigment deficient bacillus cells |
| WO2022199418A1 (en) | 2021-03-26 | 2022-09-29 | Novozymes A/S | Detergent composition with reduced polymer content |
| WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
| WO2023023644A1 (en) | 2021-08-20 | 2023-02-23 | Danisco Us Inc. | Polynucleotides encoding novel nucleases, compositions thereof and methods thereof for eliminating dna from protein preparations |
| WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
| WO2023039270A2 (en) | 2021-09-13 | 2023-03-16 | Danisco Us Inc. | Bioactive-containing granules |
| CN115820606A (zh) * | 2022-07-13 | 2023-03-21 | 青岛蔚蓝生物集团有限公司 | 高比活淀粉酶突变体及其应用 |
| EP4163305A1 (en) | 2013-12-16 | 2023-04-12 | Nutrition & Biosciences USA 4, Inc. | Use of poly alpha-1,3-glucan ethers as viscosity modifiers |
| WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114988A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
| US11920170B2 (en) | 2015-12-09 | 2024-03-05 | Danisco Us Inc. | Alpha-amylase combinatorial variants |
| WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
| WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
| WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
| WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024137248A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization |
| WO2024137246A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137704A2 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast |
| WO2024137252A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Process for reducing syrup viscosity in the backend of a process for producing a fermentation product |
| WO2024137250A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024163584A1 (en) | 2023-02-01 | 2024-08-08 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024186819A1 (en) | 2023-03-06 | 2024-09-12 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024191711A1 (en) | 2023-03-16 | 2024-09-19 | Nutrition & Biosciences USA 4, Inc. | Brevibacillus fermentate extracts for cleaning and malodor control and use thereof |
| WO2024258820A2 (en) | 2023-06-13 | 2024-12-19 | Novozymes A/S | Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase |
| WO2025071996A1 (en) | 2023-09-28 | 2025-04-03 | Danisco Us Inc. | Variant cutinase enzymes with improved solubility and uses thereof |
| WO2025085351A1 (en) | 2023-10-20 | 2025-04-24 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2025128568A1 (en) | 2023-12-11 | 2025-06-19 | Novozymes A/S | Composition and use thereof for increasing hemicellulosic fiber solubilization |
| WO2026008449A2 (en) | 2024-07-04 | 2026-01-08 | Novozymes A/S | A process for producing a fermentation product and a concentrated protein co-product |
| WO2026024921A1 (en) | 2024-07-25 | 2026-01-29 | The Procter & Gamble Company | Detergent composition comprising a subtilisin variant and methods of use |
| WO2026050315A1 (en) | 2024-08-29 | 2026-03-05 | Danisco Us Inc. | Subtilisin variants and methods of use |
| US12577548B2 (en) | 2013-03-11 | 2026-03-17 | Danisco Us Inc. | Alpha-amylase combinatorial variants |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2417547A1 (en) | 2000-07-28 | 2003-01-28 | Henkel Kommanditgesellschaft Auf Aktien | Novel amylolytic enzyme extracted from bacillus sp. a 7-7 (dsm 12368) and washing and cleaning agents containing this novel amylolytic enzyme |
| CN104357424A (zh) * | 2004-07-07 | 2015-02-18 | 杜邦营养生物科学有限公司 | 多肽 |
| EP2258837A1 (en) * | 2004-09-10 | 2010-12-08 | Novozymes North America, Inc. | Methods for preventing, removing, reducing, or disrupting biofilm |
| EP1926753B1 (en) * | 2004-12-22 | 2010-11-24 | Novozymes A/S | Hybrid enzymes consisting of an endo-amylase first amino acid sequence and a carbohydrate-binding module as second amino acid sequence |
| KR20090101193A (ko) * | 2006-12-21 | 2009-09-24 | 다니스코 유에스 인크. | 바실러스 종 195 의 알파-아밀라아제 폴리펩티드에 대한 조성물 및 용도 |
| EP2215201A2 (en) * | 2007-11-05 | 2010-08-11 | Danisco US Inc. | Alpha-amylase variants with altered properties |
| US9896673B2 (en) * | 2010-02-10 | 2018-02-20 | Novozymes A/S | Compositions of high stability alpha amylase variants |
| CN105802940B (zh) * | 2016-04-18 | 2019-04-16 | 广西大学 | 一种地衣芽胞杆菌高温α-淀粉酶突变体及其应用 |
| US10808234B2 (en) | 2018-05-04 | 2020-10-20 | Fornia Biosolutions, Inc. | Variant amylase enzyme compositions and methods |
| CN109207458B (zh) * | 2018-10-31 | 2021-06-25 | 福州大学 | 耐热型中温α-淀粉酶及其应用 |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3912590A (en) | 1973-01-03 | 1975-10-14 | Novo Industri As | Procedure for liquefying starch |
| JPS57174089A (en) | 1981-04-20 | 1982-10-26 | Novo Industri As | Chain dividing enzyme product |
| US4760025A (en) | 1984-05-29 | 1988-07-26 | Genencor, Inc. | Modified enzymes and methods for making same |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| DK122686D0 (da) | 1986-03-17 | 1986-03-17 | Novo Industri As | Fremstilling af proteiner |
| US5234823A (en) | 1986-06-30 | 1993-08-10 | Novo Industri A/S | Chimeric enzymes |
| DK311186D0 (da) | 1986-06-30 | 1986-06-30 | Novo Industri As | Enzymer |
| ES2052565T3 (es) | 1986-07-09 | 1994-07-16 | Novo Nordisk As | Un procedimiento para licuar una suspension de almidon o granos amilaceos. |
| DE3909096A1 (de) | 1989-03-20 | 1990-09-27 | Garabed Antranikian | Alpha-amylase |
| CA2030554C (en) | 1989-06-29 | 2001-08-28 | Wilhelmus J. Quax | Mutant microbial .alpha.-amylases with increased thermal, acid, and/or alkaline stability |
| CA2082279C (en) | 1990-05-09 | 2007-09-04 | Grethe Rasmussen | Cellulase preparation comprising an endoglucanase enzyme |
| EP0563169B2 (en) | 1990-12-21 | 2006-04-12 | Novozymes A/S | ENZYME MUTANTS HAVING A LOW DEGREE OF VARIATION OF THE MOLECULAR CHARGE OVER A pH RANGE |
| CZ293163B6 (cs) | 1993-02-11 | 2004-02-18 | Genencor International, Inc. | Mutanta alfa-amylázy, její použití, kódová DNA pro tuto mutantu, vektor pro expresi, hostitelské buňky, čisticí prostředek a prostředek pro zkapalnění škrobu |
| CN1189558C (zh) | 1993-10-08 | 2005-02-16 | 诺沃奇梅兹有限公司 | 淀粉酶变体 |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| DK0753057T3 (da) | 1994-03-29 | 2006-01-30 | Novozymes As | Alkalisk Bacillus-amylase |
| DE4422198C2 (de) | 1994-06-24 | 1997-08-28 | Audi Ag | Verfahren zum Steuern der elektrischen Beheizung eines Katalysators |
| AR000862A1 (es) | 1995-02-03 | 1997-08-06 | Novozymes As | Variantes de una ó-amilasa madre, un metodo para producir la misma, una estructura de adn y un vector de expresion, una celula transformada por dichaestructura de adn y vector, un aditivo para detergente, composicion detergente, una composicion para lavado de ropa y una composicion para la eliminacion del |
| DK2199378T3 (da) * | 1995-02-03 | 2012-10-29 | Novozymes As | alfa-amylase mutanter |
| EP0904360B1 (en) * | 1996-04-30 | 2013-07-31 | Novozymes A/S | alpha-AMYLASE MUTANTS |
| AU1461497A (en) * | 1996-12-09 | 1998-07-03 | Genencor International, Inc. | Proteins Having Increased Stability |
| US6080568A (en) * | 1997-08-19 | 2000-06-27 | Genencor International, Inc. | Mutant α-amylase comprising modification at residues corresponding to A210, H405 and/or T412 in Bacillus licheniformis |
-
2000
- 2000-03-28 DK DK10181113.1T patent/DK2290060T3/en active
- 2000-03-28 CN CNB008059497A patent/CN1252256C/zh not_active Expired - Lifetime
- 2000-03-28 WO PCT/DK2000/000148 patent/WO2000060059A2/en not_active Ceased
- 2000-03-28 DK DK00912415T patent/DK1165762T3/da active
- 2000-03-28 CA CA2365438A patent/CA2365438C/en not_active Expired - Lifetime
- 2000-03-28 MX MXPA01009812A patent/MXPA01009812A/es unknown
- 2000-03-28 JP JP2000609551A patent/JP4668426B2/ja not_active Expired - Lifetime
- 2000-03-28 DK DK07106717.7T patent/DK1818396T3/da active
- 2000-03-28 AU AU34193/00A patent/AU3419300A/en not_active Abandoned
- 2000-03-28 ES ES00912415T patent/ES2286012T3/es not_active Expired - Lifetime
- 2000-03-28 BR BRPI0009362A patent/BRPI0009362B8/pt active IP Right Grant
- 2000-03-28 RU RU2001129163/13A patent/RU2231547C2/ru active
- 2000-03-28 ES ES07106717.7T patent/ES2496568T3/es not_active Expired - Lifetime
- 2000-03-28 EP EP10181113.1A patent/EP2290060B1/en not_active Expired - Lifetime
- 2000-03-28 KR KR1020017012076A patent/KR100808517B1/ko not_active Expired - Lifetime
- 2000-03-28 AT AT00912415T patent/ATE360686T1/de active
- 2000-03-28 DE DE60034558T patent/DE60034558T2/de not_active Expired - Lifetime
- 2000-03-28 EP EP00912415A patent/EP1165762B1/en not_active Expired - Lifetime
- 2000-03-28 ES ES10181113.1T patent/ES2618608T3/es not_active Expired - Lifetime
- 2000-03-28 EP EP07106717.7A patent/EP1818396B1/en not_active Expired - Lifetime
- 2000-03-30 AR ARP000101431A patent/AR023214A1/es not_active Application Discontinuation
Cited By (260)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002010355A3 (en) * | 2000-08-01 | 2003-09-12 | Novozymes As | Alpha-amylase mutants with altered stability |
| EP2298903A3 (en) * | 2000-08-01 | 2011-10-05 | Novozymes A/S | Alpha-amylase mutants with altered properties |
| US7713723B1 (en) | 2000-08-01 | 2010-05-11 | Novozymes A/S | Alpha-amylase mutants with altered properties |
| EP1975229A3 (en) * | 2000-10-13 | 2009-03-18 | Novozymes A/S | Alpha-amylase variant with altered properties |
| WO2002031124A3 (en) * | 2000-10-13 | 2003-02-27 | Novozymes As | Alpha-amylase variant with altered properties |
| EP3305894A1 (en) * | 2001-02-21 | 2018-04-11 | BASF Enzymes LLC | Enzymes having alpha amylase activity and methods of use thereof |
| US10612012B2 (en) | 2001-05-15 | 2020-04-07 | Novozymes A/S | Alpha-amylase variant with altered properties |
| US8617837B2 (en) | 2001-05-15 | 2013-12-31 | Novozymes A/S | Method of hydrolyzing soluble starch with an alpha-amylase variant |
| EP2159279A3 (en) * | 2001-05-15 | 2010-05-12 | Novozymes A/S | Alpha-amylase variant with altered properties |
| US9080137B2 (en) | 2001-05-15 | 2015-07-14 | Novozymes A/S | Alpha-amylase variant with altered properties |
| WO2002092797A2 (en) | 2001-05-15 | 2002-11-21 | Novozymes A/S | Alpha-amylase variant with altered properties |
| US9670471B2 (en) | 2001-05-15 | 2017-06-06 | Novozymes A/S | Alpha-amylase variant with altered properties |
| EP3000881A3 (en) * | 2001-05-15 | 2016-07-20 | Novozymes A/S | Alpha-amylase variant with altered properties |
| US7498158B2 (en) | 2001-05-15 | 2009-03-03 | Novozymes A/S | Alpha-amylase variant with altered properties |
| US9796968B2 (en) | 2001-05-15 | 2017-10-24 | Novozymes A/S | Alpha-amylase variant with altered properties |
| EP2264160A3 (en) * | 2001-05-15 | 2011-08-31 | Novozymes A/S | Alpha-amylase variant with altered properties |
| WO2002092797A3 (en) * | 2001-05-15 | 2004-03-25 | Novozymes As | Alpha-amylase variant with altered properties |
| DE10138753B4 (de) * | 2001-08-07 | 2017-07-20 | Henkel Ag & Co. Kgaa | Wasch- und Reinigungsmittel mit Hybrid-Alpha-Amylasen |
| WO2003014358A3 (de) * | 2001-08-07 | 2003-09-18 | Henkel Kgaa | Wasch- und reinigungsmittel mit hybrid-alpha-amylasen |
| WO2004106533A1 (en) | 2003-05-30 | 2004-12-09 | Novozymes A/S | Alcohol product processes |
| US8785365B2 (en) | 2004-10-01 | 2014-07-22 | Basf Se | Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants |
| DE102004047777B4 (de) | 2004-10-01 | 2018-05-09 | Basf Se | Alpha-Amylase-Varianten mit erhöhter Lösungsmittelstabilität, Verfahren zu deren Herstellung sowie deren Verwendung |
| US9353361B2 (en) | 2004-10-01 | 2016-05-31 | Basf Se | Alpha-amylase variants stabilized against dimerization and/or multimerization, method for the production thereof, and detergents and cleansers containing these alpha-amylase variants |
| WO2006037484A3 (de) * | 2004-10-01 | 2006-07-13 | Henkel Kgaa | Alpha-amylase-varianten mit erhöhter lösungsmittelstabilität, verfahren zu deren herstellung sowie wasch- und reinigungsmittel mit diesen alpha-amylase-varianten |
| US8080401B2 (en) | 2004-10-01 | 2011-12-20 | Henkel Ag & Co. Kgaa | Alpha-amylase variants having an elevated solvent stability, method for the production thereof and detergents and cleansers containing these alpha-amylase variants |
| DE102004047776B4 (de) | 2004-10-01 | 2018-05-09 | Basf Se | Gegen Di- und/oder Multimerisierung stabilisierte Alpha-Amylase-Varianten, Verfahren zu deren Herstellung sowie deren Verwendung |
| WO2006069289A2 (en) | 2004-12-22 | 2006-06-29 | Novozymes North America, Inc | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2007035730A2 (en) | 2005-09-20 | 2007-03-29 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2007076388A2 (en) | 2005-12-22 | 2007-07-05 | Novozymes North America, Inc. | Processes for producing a fermentation product |
| WO2007109750A2 (en) | 2006-03-22 | 2007-09-27 | Novozymes North America, Inc. | Fermentation processes |
| US9145537B2 (en) | 2006-04-04 | 2015-09-29 | Novozymes A/S | Mashing process |
| WO2007113292A3 (en) * | 2006-04-04 | 2007-11-29 | Novozymes As | Mashing process |
| US8809031B2 (en) | 2007-03-23 | 2014-08-19 | Danisco Us Inc. | Enhanced amylase production by N-terminal addition to mature amylase protein |
| WO2008134259A1 (en) | 2007-04-24 | 2008-11-06 | Novozymes North America, Inc. | Detoxifying pre-treated lignocellulose-containing materials |
| EP3219804A1 (en) | 2007-04-24 | 2017-09-20 | Novozymes North America, Inc. | Detoxifying pre-treated lignocellulose-containing materials |
| WO2009030713A1 (en) | 2007-09-03 | 2009-03-12 | Novozymes A/S | Detoxifying and recycling of washing solution used in pretreatment of lignocellulose-containing materials |
| EP2623591A3 (en) * | 2008-06-06 | 2013-11-20 | Danisco US Inc. | Geobacillus stearothermophilus alpha-amylase (AMYS) variants with improved properties |
| WO2010008841A2 (en) | 2008-06-23 | 2010-01-21 | Novozymes A/S | Processes for producing fermentation products |
| WO2010039812A2 (en) | 2008-09-30 | 2010-04-08 | Novozymes North America, Inc. | Improvement of enzymatic hydrolysis of pre-treated lignocellulose-containing material with distillers dried grains |
| EP2857515A2 (en) | 2008-11-20 | 2015-04-08 | Novozymes Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
| WO2010059413A2 (en) | 2008-11-20 | 2010-05-27 | Novozymes, Inc. | Polypeptides having amylolytic enhancing activity and polynucleotides encoding same |
| WO2010074999A1 (en) * | 2008-12-15 | 2010-07-01 | Danisco Us Inc. | Hybrid alpha-amylases |
| US8841107B2 (en) | 2008-12-15 | 2014-09-23 | Danisco Us Inc. | Hybrid alpha-amylases |
| US9803181B2 (en) | 2008-12-15 | 2017-10-31 | Danisco Us Inc. | Hybrid alpha-amylases |
| WO2010078391A2 (en) | 2008-12-30 | 2010-07-08 | Novozymes North America, Inc. | Improvement of enzymatic hydrolysis of pretreated lignocellulose-containing material with dissolved air flotation sludge |
| WO2010078392A2 (en) | 2008-12-31 | 2010-07-08 | Novozymes North America, Inc. | Processes of producing fermentation products |
| WO2011008785A2 (en) | 2009-07-17 | 2011-01-20 | Novozymes A/S | A method of analyzing cellulose decay in cellulosic material hydrolysis |
| WO2011066560A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011066576A1 (en) | 2009-11-30 | 2011-06-03 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011068803A1 (en) | 2009-12-01 | 2011-06-09 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011087836A2 (en) | 2009-12-22 | 2011-07-21 | Novozymes A/S | Pullulanase variants and uses thereof |
| US12252720B2 (en) | 2010-01-04 | 2025-03-18 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US9416355B2 (en) | 2010-01-04 | 2016-08-16 | Novozymes North America, Inc. | Alpha-amylase variants and polynucleotides encoding same |
| EP3101127A1 (en) * | 2010-01-04 | 2016-12-07 | Novozymes A/S | Alpha-amylase variants with improved stability |
| US11603522B2 (en) | 2010-01-04 | 2023-03-14 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2011082425A3 (en) * | 2010-01-04 | 2011-09-29 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US10550373B2 (en) | 2010-01-04 | 2020-02-04 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2011092136A1 (en) | 2010-01-29 | 2011-08-04 | Novozymes A/S | Biogas production process with enzymatic pre-treatment |
| WO2011100161A1 (en) | 2010-02-09 | 2011-08-18 | Novozymes North America, Inc. | Addition of alpha - glucosidase and cobalt for producing fermentation products from starch |
| WO2011123505A1 (en) | 2010-03-30 | 2011-10-06 | Novozymes North America, Inc. | Processes of producing a fermentation product |
| WO2011126897A2 (en) | 2010-03-30 | 2011-10-13 | Novozymes A/S | Methods for enhancing by-products from fermentation processes |
| EP3070171A1 (en) | 2010-03-30 | 2016-09-21 | Novozymes A/S | Processes of producing a fermentation product |
| WO2011127802A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2011127820A1 (en) | 2010-04-14 | 2011-10-20 | Novozymes A/S | Processes for producing fermentation products |
| WO2012018775A1 (en) | 2010-08-02 | 2012-02-09 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2012064350A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides Having Glucoamylase Activity and Polynucleotides Encoding Same |
| WO2012064351A1 (en) | 2010-11-08 | 2012-05-18 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2012068047A2 (en) | 2010-11-19 | 2012-05-24 | Novozymes North America, Inc. | Processes of producing a fermentation product |
| WO2012093041A1 (en) | 2011-01-04 | 2012-07-12 | Novozymes A/S | Process for producing biogas from pectin and lignocellulose containing material |
| WO2012109119A2 (en) | 2011-02-07 | 2012-08-16 | Novozymes North America, Inc. | Process of producing a fermentation product |
| WO2013000945A1 (en) | 2011-06-28 | 2013-01-03 | Novozymes A/S | Biogas from enzyme-treated bagasse |
| US10167458B2 (en) | 2011-06-30 | 2019-01-01 | Novozymes A/S | Alpha-amylase variants |
| US9434932B2 (en) | 2011-06-30 | 2016-09-06 | Novozymes A/S | Alpha-amylase variants |
| US10752889B2 (en) | 2011-06-30 | 2020-08-25 | Novozymes A/S | Alpha-amylase variants |
| US11091748B2 (en) | 2011-06-30 | 2021-08-17 | Novozymes A/S | Alpha-amylase variants |
| US12012623B2 (en) | 2011-06-30 | 2024-06-18 | Novozymes A/S | Alpha-amylase variants |
| WO2013006756A2 (en) | 2011-07-06 | 2013-01-10 | Novozymes A/S | Alpha amylase variants and polynucleotides encoding same |
| WO2013016115A1 (en) | 2011-07-22 | 2013-01-31 | Novozymes North America, Inc. | Processes for pretreating cellulosic material and improving hydrolysis thereof |
| WO2013029496A1 (en) | 2011-08-26 | 2013-03-07 | Novozymes A/S | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| WO2013036526A1 (en) | 2011-09-06 | 2013-03-14 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2013053801A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2013055676A1 (en) | 2011-10-11 | 2013-04-18 | Novozymes North America, Inc. | Processes for producing fermentation products |
| US10457924B2 (en) | 2011-10-28 | 2019-10-29 | Danisco Us Inc | Variant maltohexaose-forming alpha-amylase variants |
| US11898177B2 (en) | 2011-10-28 | 2024-02-13 | Danisco Us Inc. | Variant maltohexaose-forming alpha-amylase variants |
| US12338467B2 (en) | 2011-10-28 | 2025-06-24 | Danisco Us Inc. | Variant maltohexaose-forming α-amylase variants |
| WO2013082486A1 (en) | 2011-12-02 | 2013-06-06 | Novozymes A/S | Processes for producing fermentation products |
| WO2013083801A2 (en) | 2011-12-09 | 2013-06-13 | Novozymes A/S | Biogas from substrates comprising animal manure and enzymes |
| WO2013096652A1 (en) | 2011-12-21 | 2013-06-27 | Novozymes, Inc. | Methods for determining the degradation of a biomass material |
| WO2013148993A1 (en) | 2012-03-30 | 2013-10-03 | Novozymes North America, Inc. | Processes of producing fermentation products |
| EP4209595A1 (en) | 2012-03-30 | 2023-07-12 | Novozymes North America, Inc. | A method of dewatering whole stillage |
| WO2014027062A1 (en) | 2012-08-17 | 2014-02-20 | Novozymes A/S | Thermostable asparaginase variants and polynucleotides encoding same |
| WO2014083096A3 (en) * | 2012-11-30 | 2016-10-13 | Novozymes A/S | Mixture of two enzymes for cleaning or detergent compositions |
| US12577548B2 (en) | 2013-03-11 | 2026-03-17 | Danisco Us Inc. | Alpha-amylase combinatorial variants |
| WO2014177541A2 (en) | 2013-04-30 | 2014-11-06 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| EP3372680A1 (en) | 2013-04-30 | 2018-09-12 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2014194054A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194034A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194117A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| WO2014194032A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
| EP3636662A1 (en) | 2013-05-29 | 2020-04-15 | Danisco US Inc. | Novel metalloproteases |
| EP3260538A1 (en) | 2013-05-29 | 2017-12-27 | Danisco US Inc. | Novel metalloproteases |
| EP4159854A1 (en) | 2013-05-29 | 2023-04-05 | Danisco US Inc | Novel metalloproteases |
| EP3882346A1 (en) | 2013-05-29 | 2021-09-22 | Danisco US Inc. | Novel metalloproteases |
| WO2014206960A1 (en) | 2013-06-26 | 2014-12-31 | Novozymes A/S | Process for manufacturing a feed composition |
| WO2015007639A1 (en) | 2013-07-17 | 2015-01-22 | Novozymes A/S | Pullulanase chimeras and polynucleotides encoding same |
| WO2015035914A1 (en) | 2013-09-11 | 2015-03-19 | Novozymes A/S | Processes for producing fermentation products |
| EP3712274A1 (en) | 2013-09-11 | 2020-09-23 | Novozymes A/S | Processes for producing fermentation products |
| EP3910057A1 (en) | 2013-12-13 | 2021-11-17 | Danisco US Inc. | Serine proteases of the bacillus gibsonii-clade |
| WO2015089441A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of bacillus species |
| EP3514230A1 (en) | 2013-12-13 | 2019-07-24 | Danisco US Inc. | Serine proteases of bacillus species |
| EP3553173A1 (en) | 2013-12-13 | 2019-10-16 | Danisco US Inc. | Serine proteases of the bacillus gibsonii-clade |
| WO2015089447A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of the bacillus gibsonii-clade |
| EP4163305A1 (en) | 2013-12-16 | 2023-04-12 | Nutrition & Biosciences USA 4, Inc. | Use of poly alpha-1,3-glucan ethers as viscosity modifiers |
| EP3789407A1 (en) | 2013-12-18 | 2021-03-10 | Nutrition & Biosciences USA 4, Inc. | Cationic poly alpha-1,3-glucan ethers |
| WO2015095358A1 (en) | 2013-12-18 | 2015-06-25 | E. I. Du Pont De Nemours And Company | Cationic poly alpha-1,3-glucan ethers |
| EP3415624A1 (en) | 2014-01-22 | 2018-12-19 | Novozymes A/S | Pullulanase variants and polynucleotides encoding same |
| WO2015123323A1 (en) | 2014-02-14 | 2015-08-20 | E. I. Du Pont De Nemours And Company | Poly-alpha-1,3-1,6-glucans for viscosity modification |
| WO2015138283A1 (en) | 2014-03-11 | 2015-09-17 | E. I. Du Pont De Nemours And Company | Oxidized poly alpha-1,3-glucan as detergent builder |
| WO2015143144A1 (en) | 2014-03-19 | 2015-09-24 | Novozymes A/S | Method for enhancing activity of an x143 polypeptide |
| EP3587569A1 (en) | 2014-03-21 | 2020-01-01 | Danisco US Inc. | Serine proteases of bacillus species |
| EP4155398A1 (en) | 2014-03-21 | 2023-03-29 | Danisco US Inc. | Serine proteases of bacillus species |
| EP3919599A1 (en) | 2014-06-19 | 2021-12-08 | Nutrition & Biosciences USA 4, Inc. | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
| WO2015195960A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
| WO2015195777A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
| WO2016061438A1 (en) | 2014-10-17 | 2016-04-21 | Danisco Us Inc. | Serine proteases of bacillus species |
| WO2016062875A2 (en) | 2014-10-23 | 2016-04-28 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2016069569A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| EP4403631A2 (en) | 2014-10-27 | 2024-07-24 | Danisco US Inc. | Serine proteases |
| EP3550017A1 (en) | 2014-10-27 | 2019-10-09 | Danisco US Inc. | Serine proteases |
| WO2016069548A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069552A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069544A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
| WO2016069557A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases of bacillus species |
| WO2016106011A1 (en) | 2014-12-23 | 2016-06-30 | E. I. Du Pont De Nemours And Company | Enzymatically produced cellulose |
| EP4219704A2 (en) | 2015-05-13 | 2023-08-02 | Danisco US Inc | Aprl-clade protease variants and uses thereof |
| EP3872174A1 (en) | 2015-05-13 | 2021-09-01 | Danisco US Inc. | Aprl-clade protease variants and uses thereof |
| WO2016201044A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Osmotic burst encapsulates |
| WO2016201069A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Low-density enzyme-containing particles |
| WO2016201040A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc. | Water-triggered enzyme suspension |
| EP4234693A2 (en) | 2015-06-17 | 2023-08-30 | Danisco US Inc | Bacillus gibsonii-clade serine proteases |
| WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2016205127A1 (en) | 2015-06-18 | 2016-12-22 | Novozymes A/S | Polypeptides having trehalase activity and the use thereof in process of producing fermentation products |
| EP4483721A2 (en) | 2015-11-05 | 2025-01-01 | Danisco US Inc. | Paenibacillus and bacillus spp. mannanases |
| WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
| WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
| EP4141113A1 (en) | 2015-11-05 | 2023-03-01 | Danisco US Inc | Paenibacillus sp. mannanases |
| WO2017083226A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| WO2017083229A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| WO2017083228A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
| US10876074B2 (en) | 2015-11-13 | 2020-12-29 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
| US10844324B2 (en) | 2015-11-13 | 2020-11-24 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
| US10822574B2 (en) | 2015-11-13 | 2020-11-03 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
| US12480110B2 (en) | 2015-12-09 | 2025-11-25 | Danisco Us Inc. | Alpha-amylase combinatorial variants |
| US11920170B2 (en) | 2015-12-09 | 2024-03-05 | Danisco Us Inc. | Alpha-amylase combinatorial variants |
| WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
| WO2017112540A1 (en) | 2015-12-22 | 2017-06-29 | Novozymes A/S | Processes for producing fermentation products |
| WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| EP3845642A1 (en) | 2016-05-05 | 2021-07-07 | Danisco US Inc. | Protease variants and uses thereof |
| WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
| WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
| EP4151726A1 (en) | 2016-06-17 | 2023-03-22 | Danisco US Inc | Protease variants and uses thereof |
| WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
| EP4527923A2 (en) | 2016-06-17 | 2025-03-26 | Danisco US Inc | Protease variants and uses thereof |
| WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
| WO2018098381A1 (en) | 2016-11-23 | 2018-05-31 | Novozymes A/S | Improved yeast for ethanol production |
| WO2018102348A1 (en) | 2016-11-29 | 2018-06-07 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2018112123A1 (en) | 2016-12-15 | 2018-06-21 | Danisco Us Inc. | Polypeptides with endoglucanase activity and uses thereof |
| EP4212622A2 (en) | 2016-12-21 | 2023-07-19 | Danisco US Inc. | Bacillus gibsonii-clade serine proteases |
| WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
| WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
| EP4424805A2 (en) | 2016-12-21 | 2024-09-04 | Danisco Us Inc | Bacillus gibsonii-clade serine proteases |
| EP4520820A2 (en) | 2016-12-21 | 2025-03-12 | Danisco Us Inc | Protease variants and uses thereof |
| WO2018156705A1 (en) | 2017-02-24 | 2018-08-30 | Danisco Us Inc. | Compositions and methods for increased protein production in bacillus licheniformis |
| WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
| WO2018184004A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Alpha-amylase combinatorial variants |
| WO2018183662A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Delayed release enzyme formulations for bleach-containing detergents |
| WO2018222990A1 (en) | 2017-06-02 | 2018-12-06 | Novozymes A/S | Improved yeast for ethanol production |
| EP4015524A1 (en) | 2017-06-28 | 2022-06-22 | Novozymes A/S | Polypeptides having trehalase activity and polynucleotides encoding same |
| WO2019005755A1 (en) | 2017-06-28 | 2019-01-03 | Novozymes A/S | POLYPEPTIDES HAVING TREHALASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME |
| WO2019006077A1 (en) | 2017-06-30 | 2019-01-03 | Danisco Us Inc | PARTICLES CONTAINING LOW AGGLOMERATION ENZYME |
| WO2019030165A1 (en) | 2017-08-08 | 2019-02-14 | Novozymes A/S | POLYPEPTIDES HAVING TREHALASE ACTIVITY AND THEIR USE IN A PRODUCTION PROCESS OF FERMENTATION PRODUCTS |
| WO2019036721A2 (en) | 2017-08-18 | 2019-02-21 | Danisco Us Inc | VARIANTS OF ALPHA-AMYLASES |
| WO2019040412A1 (en) | 2017-08-23 | 2019-02-28 | Danisco Us Inc | METHODS AND COMPOSITIONS FOR EFFICIENT GENETIC MODIFICATION OF BACILLUS LICHENIFORMIS STRAINS |
| WO2019055261A1 (en) | 2017-09-13 | 2019-03-21 | Danisco Us Inc | MODIFIED 5 'NON-TRANSLATED REGION (UTR) SEQUENCES FOR INCREASED PROTEIN PRODUCTION IN BACILLUS |
| WO2019055455A1 (en) | 2017-09-15 | 2019-03-21 | Novozymes A/S | MIXTURES OF ENZYMES AND METHODS FOR IMPROVING THE NUTRITIONAL QUALITY OF ANIMAL FEED |
| WO2019083831A1 (en) | 2017-10-23 | 2019-05-02 | Novozymes A/S | METHODS FOR LACTIC ACID REDUCTION IN A BIOCARBURIZER FERMENTATION SYSTEM |
| WO2019089898A1 (en) | 2017-11-02 | 2019-05-09 | Danisco Us Inc | Freezing point depressed solid matrix compositions for melt granulation of enzymes |
| WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2019113413A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US11326153B2 (en) | 2017-12-08 | 2022-05-10 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| US11384347B2 (en) | 2017-12-08 | 2022-07-12 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019113415A1 (en) | 2017-12-08 | 2019-06-13 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
| WO2019125683A1 (en) | 2017-12-21 | 2019-06-27 | Danisco Us Inc | Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant |
| WO2019135868A1 (en) | 2018-01-03 | 2019-07-11 | Danisco Us Inc | Mutant and genetically modified bacillus cells and methods thereof for increased protein production |
| WO2019148192A1 (en) | 2018-01-29 | 2019-08-01 | Novozymes A/S | Microorganisms with improved nitrogen utilization for ethanol production |
| WO2019156670A1 (en) | 2018-02-08 | 2019-08-15 | Danisco Us Inc. | Thermally-resistant wax matrix particles for enzyme encapsulation |
| WO2019161227A1 (en) | 2018-02-15 | 2019-08-22 | Novozymes A/S | Improved yeast for ethanol production |
| WO2019231944A2 (en) | 2018-05-31 | 2019-12-05 | Novozymes A/S | Processes for enhancing yeast growth and productivity |
| WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
| WO2020023411A1 (en) | 2018-07-25 | 2020-01-30 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
| US12584119B2 (en) | 2018-07-31 | 2026-03-24 | Danisco Us Inc | Variant alpha-amylases having amino acid substitutions that lower the PKA of the general acid |
| WO2020028443A1 (en) | 2018-07-31 | 2020-02-06 | Danisco Us Inc | Variant alpha-amylases having amino acid substitutions that lower the pka of the general acid |
| WO2020047215A1 (en) | 2018-08-30 | 2020-03-05 | Danisco Us Inc | Enzyme-containing granules |
| WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
| WO2020076697A1 (en) | 2018-10-08 | 2020-04-16 | Novozymes A/S | Enzyme-expressing yeast for ethanol production |
| WO2020077331A2 (en) | 2018-10-12 | 2020-04-16 | Danisco Us Inc | Alpha-amylases with mutations that improve stability in the presence of chelants |
| WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
| WO2020160126A1 (en) | 2019-01-31 | 2020-08-06 | Novozymes A/S | Polypeptides having xylanase activity and use thereof for improving the nutritional quality of animal feed |
| WO2020206058A1 (en) | 2019-04-02 | 2020-10-08 | Novozymes A/S | Process for producing a fermentation product |
| WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
| WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
| WO2021021458A1 (en) | 2019-07-26 | 2021-02-04 | Novozymes A/S | Microorganisms with improved nitrogen transport for ethanol production |
| WO2021026201A1 (en) | 2019-08-05 | 2021-02-11 | Novozymes A/S | Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct |
| WO2021025872A1 (en) | 2019-08-06 | 2021-02-11 | Novozymes A/S | Fusion proteins for improved enzyme expression |
| WO2021030267A1 (en) | 2019-08-14 | 2021-02-18 | Danisco Us Inc | Compositions and methods for increased protein production in bacillus licheniformis |
| WO2021055395A1 (en) | 2019-09-16 | 2021-03-25 | Novozymes A/S | Polypeptides having beta-glucanase activity and polynucleotides encoding same |
| WO2021080948A2 (en) | 2019-10-24 | 2021-04-29 | Danisco Us Inc | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2021096857A1 (en) | 2019-11-11 | 2021-05-20 | Danisco Us Inc | Compositions and methods for enhanced protein production in bacillus cells |
| WO2021119304A1 (en) | 2019-12-10 | 2021-06-17 | Novozymes A/S | Microorganism for improved pentose fermentation |
| WO2021126966A1 (en) | 2019-12-16 | 2021-06-24 | Novozymes A/S | Processes for producing fermentation products |
| WO2021146411A1 (en) | 2020-01-15 | 2021-07-22 | Danisco Us Inc | Compositions and methods for enhanced protein production in bacillus licheniformis |
| WO2021163030A2 (en) | 2020-02-10 | 2021-08-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
| WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
| WO2022090564A1 (en) | 2020-11-02 | 2022-05-05 | Novozymes A/S | Glucoamylase variants and polynucleotides encoding same |
| WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
| WO2022178432A1 (en) | 2021-02-22 | 2022-08-25 | Danisco Us Inc. | Methods and compositions for producing proteins of interest in pigment deficient bacillus cells |
| WO2022199418A1 (en) | 2021-03-26 | 2022-09-29 | Novozymes A/S | Detergent composition with reduced polymer content |
| WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
| WO2023023644A1 (en) | 2021-08-20 | 2023-02-23 | Danisco Us Inc. | Polynucleotides encoding novel nucleases, compositions thereof and methods thereof for eliminating dna from protein preparations |
| WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
| WO2023039270A2 (en) | 2021-09-13 | 2023-03-16 | Danisco Us Inc. | Bioactive-containing granules |
| WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2023114988A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Variant maltopentaose/maltohexaose-forming alpha-amylases |
| WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
| CN115820606A (zh) * | 2022-07-13 | 2023-03-21 | 青岛蔚蓝生物集团有限公司 | 高比活淀粉酶突变体及其应用 |
| WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
| WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
| WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
| WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024137704A2 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast |
| WO2024137246A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137250A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same |
| WO2024137252A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Process for reducing syrup viscosity in the backend of a process for producing a fermentation product |
| WO2024137248A1 (en) | 2022-12-19 | 2024-06-27 | Novozymes A/S | Compositions comprising arabinofuranosidases and a xylanase, and use thereof for increasing hemicellulosic fiber solubilization |
| WO2024163584A1 (en) | 2023-02-01 | 2024-08-08 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024186819A1 (en) | 2023-03-06 | 2024-09-12 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2024191711A1 (en) | 2023-03-16 | 2024-09-19 | Nutrition & Biosciences USA 4, Inc. | Brevibacillus fermentate extracts for cleaning and malodor control and use thereof |
| WO2024258820A2 (en) | 2023-06-13 | 2024-12-19 | Novozymes A/S | Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase |
| WO2025071996A1 (en) | 2023-09-28 | 2025-04-03 | Danisco Us Inc. | Variant cutinase enzymes with improved solubility and uses thereof |
| WO2025085351A1 (en) | 2023-10-20 | 2025-04-24 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2025128568A1 (en) | 2023-12-11 | 2025-06-19 | Novozymes A/S | Composition and use thereof for increasing hemicellulosic fiber solubilization |
| WO2026008449A2 (en) | 2024-07-04 | 2026-01-08 | Novozymes A/S | A process for producing a fermentation product and a concentrated protein co-product |
| WO2026024922A1 (en) | 2024-07-25 | 2026-01-29 | Danisco Us Inc. | Subtilisin variants and methods of use |
| WO2026024921A1 (en) | 2024-07-25 | 2026-01-29 | The Procter & Gamble Company | Detergent composition comprising a subtilisin variant and methods of use |
| WO2026050315A1 (en) | 2024-08-29 | 2026-03-05 | Danisco Us Inc. | Subtilisin variants and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| DK1818396T3 (da) | 2014-08-11 |
| EP2290060A1 (en) | 2011-03-02 |
| EP1165762B1 (en) | 2007-04-25 |
| ES2286012T3 (es) | 2007-12-01 |
| JP4668426B2 (ja) | 2011-04-13 |
| MXPA01009812A (es) | 2002-06-21 |
| AR023214A1 (es) | 2002-09-04 |
| BR0009362A (pt) | 2001-12-26 |
| KR20010108369A (ko) | 2001-12-07 |
| DK2290060T3 (en) | 2017-03-06 |
| DE60034558D1 (de) | 2007-06-06 |
| BRPI0009362B8 (pt) | 2019-08-20 |
| ES2618608T3 (es) | 2017-06-21 |
| DK1165762T3 (da) | 2007-09-03 |
| BRPI0009362B1 (pt) | 2018-11-21 |
| EP1818396A3 (en) | 2007-12-19 |
| CN1252256C (zh) | 2006-04-19 |
| ATE360686T1 (de) | 2007-05-15 |
| EP1165762A2 (en) | 2002-01-02 |
| KR100808517B1 (ko) | 2008-02-29 |
| CA2365438A1 (en) | 2000-10-12 |
| CA2365438C (en) | 2015-07-14 |
| EP2290060B1 (en) | 2016-12-07 |
| WO2000060059A3 (en) | 2001-05-10 |
| EP1818396B1 (en) | 2014-06-18 |
| CN1346404A (zh) | 2002-04-24 |
| DE60034558T2 (de) | 2007-12-27 |
| RU2231547C2 (ru) | 2004-06-27 |
| ES2496568T3 (es) | 2014-09-19 |
| JP2002540785A (ja) | 2002-12-03 |
| EP1818396A2 (en) | 2007-08-15 |
| AU3419300A (en) | 2000-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1165762B1 (en) | Alpha-amylase variants | |
| US10113157B2 (en) | Alpha-amylase variants | |
| JP4855632B2 (ja) | 変更された性質を有するα−アミラーゼ突然変異体 | |
| EP1131418B1 (en) | Alpha-amylase variants | |
| US8465957B2 (en) | Alpha-amylase variants | |
| AU2005202164B2 (en) | Alpha-amylase variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 00805949.7 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000912415 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2365438 Country of ref document: CA Ref document number: 2365438 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IN/PCT/2001/1302/CHE Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020017012076 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 34193/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/009812 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2000 609551 Country of ref document: JP Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020017012076 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000912415 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2000912415 Country of ref document: EP |