WO1998054212A2 - Das protein des humanen ryanodinrezeptors vom typ 3 sowie dafür kodierende dna-moleküle - Google Patents

Das protein des humanen ryanodinrezeptors vom typ 3 sowie dafür kodierende dna-moleküle Download PDF

Info

Publication number
WO1998054212A2
WO1998054212A2 PCT/EP1998/002926 EP9802926W WO9854212A2 WO 1998054212 A2 WO1998054212 A2 WO 1998054212A2 EP 9802926 W EP9802926 W EP 9802926W WO 9854212 A2 WO9854212 A2 WO 9854212A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
polypeptide
hryr3
ryr3
cell
Prior art date
Application number
PCT/EP1998/002926
Other languages
English (en)
French (fr)
Other versions
WO1998054212A3 (de
Inventor
Yasuhiro Hakamata
Seiichiro Nishimura
Edward L. Barsoumian
Original Assignee
Boehringer Ingelheim International Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Ingelheim International Gmbh filed Critical Boehringer Ingelheim International Gmbh
Priority to US09/424,783 priority Critical patent/US6780608B1/en
Priority to EP98929337A priority patent/EP0984986A2/de
Priority to CA002291960A priority patent/CA2291960A1/en
Priority to JP50018299A priority patent/JP2002504813A/ja
Publication of WO1998054212A2 publication Critical patent/WO1998054212A2/de
Publication of WO1998054212A3 publication Critical patent/WO1998054212A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/12—Drugs for disorders of the metabolism for electrolyte homeostasis
    • A61P3/14—Drugs for disorders of the metabolism for electrolyte homeostasis for calcium homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the subject matter of the invention comprises nucleic acids and protein of the human ryanodine receptor of type 3 (hRyR3), chimeric ryanodine receptors with parts of the human receptor as well as methods for the production of these proteins Procedure for the identification of activators or inhibitors of hRyR3
  • Cytoplasmic calcium plays an important role in cell activation, neurotransmitter release, muscle contraction and other biological processes. It is increased by the influence of extracellular calcium through voltage-activated and other ion channels and via the calcium release of intracellular preliminary rates.
  • intracellular calcium channel There are currently two intracellular calcium channel releases known 1, 4,5-trisphosphate receptors (IP3R) and the ryanodine receptors (RyR)
  • IP3R 4,5-trisphosphate receptors
  • RyR ryanodine receptors
  • RyR1 mainly in skeletal muscle
  • RyR2 in cardiac muscle and brain
  • RyR3 in brain and smooth muscle
  • the RyR3 is also used in non- excitable cells How human T-lymphocytes are expressed
  • a role of RyR3 in cell proliferation is postulated (Hakamata, Y et al FEBS Lett, 352 (1994), 206-210).
  • RyR3 The function of RyR3 has been the subject of a number of speculations. Although calcium appears to be an important physiological ligand for RyR3, there are some indications that calcium-induced calcium release is a problem differs from that of other RyR It is assumed that an endogenous RyR3 is responsible for the significantly lower calcium sensitivity of the remaining calcium release activity of RyR1 -def ⁇ z ⁇ enten mouse muscle cells. RyR3 has been shown in some cases to be insensitive to caffeine, the main substance used for RyR activation. Since RyR3 is expressed in non-excitable cells that have practically no voltage-activated calcium channels, it seems possible that RyR3 is regulated by other mechanisms than the other RyR RyR3-deficient mouse mutants have an increased locomotive activity.
  • the cDNA sequences of RyR1, RyR2 and for the rabbit RyR3 (rRyR3) are already known, while the nuclear acid sequence of RyR3 in humans (hRyR3) has not yet been investigated
  • the object of the present invention was to provide the nuclear acid sequence of the human ryanodine receptor of type 3, its amino acid sequence and the determination of structural and physiological peculiarities which distinguish the hRyR3 from all other RyR
  • the present invention relates to polypeptides which are characterized in that they have approximately 96% amino acid sequence identity with the rRyR3.
  • the present invention comprises the human ryanodine receptor type 3 (hRyR3) with the amino acid sequence according to FIG. 7
  • the provided polypeptides and functional derivatives of the hRyR3 now make it possible for the first time to compare the human RyR3 with RyR types of other species and to show differences
  • polypeptides according to the invention provided comprise the human RyR3 and its "functional derivatives"
  • the term “functional derivative” on which the present invention is based means a component with the biological activity which is essentially similar to the biological activity of the native hRyR3.
  • the biological ability relates both to the binding capacity of inhibitors and activators such as Caffeine as well as other physiological ligands of the native receptor as well as the release of intracellular calcium.
  • a “functional derivative” also includes parts of the hRyR, the biological properties of which have been changed by fragments of other proteins such as other RyR Example of a chimeric receptor referenced from hRyR3 and rRyR2
  • the term “functional derivatives” is intended to include “fragments", variants "and” chemical derivatives ".
  • the term” fragment refers to any polypeptide which, when measured on the native receptor, represents a reduced form andhas at least one binding site for a ligand of hRyR
  • a “variant” comprises molecules which are essentially derived in function and structure from the native hRyR3, such as, for example, allelic forms. Accordingly, the expression “variant” includes, for example, the molecules which have a similar activity but, for example, a modified amino acid sequence chemical derivative includes additional chemical groups that are normally not part of the molecule. These groups can, for example, increase or decrease the biological activity of the molecule
  • One aspect of the present invention relates to chimeric polypeptides, which are characterized in that, in addition to at least one fragment of the human ryanodine receptor of type 3 (hRyR3), they contain at least one further one
  • the present invention relates to chimeric polypeptides which are characterized in that, in addition to a fragment of the hRyR3, they contain at least one further fragment from the family of non-human ryanodine receptors
  • the present invention relates to chimeras
  • Polypeptides which are characterized in that they are next to a fragment of the hRyR3 contain at least one fragment of the rabbit ryanodine receptor type 2 (rRyR2)
  • the present invention relates to a chimeric polypeptide, which is characterized in that it contains a fragment of rRyR2 in the region of amino acid 1300 of hRyR3, which gives high sensitivity to calcium or caffeine due to the fact that in comparison to the other RyR types lower calcium release activity of the RyR3, the measurement of the calcium release by known activators such as caffeine is inaccurate or even impossible. This is of great importance for the identification of possible inhibitors or activators of the biological action of the RyR3. It has now surprisingly been found that a chimeric polypeptide, which has an increased calcium or caffeine sensitivity, can be produced from a type 3 RyR fragment and another protein.
  • a chimeric polypeptide is made up of a hRyR3 portion and a non-human portion, such as a fragment of Kan ⁇ nchen-rRyR2, presented Surprisingly, it was found that replacing the hRyR3 in the region of amino acid 1300 with part of the rRyR2 gives increased sensitivity to caffeine or calcium. This increased calcium or caffeine sensitivity now enables the person skilled in the art in highly sensitive test systems, for example in vivo cell systems To determine activators and inhibitors by their influence on the intracellular calcium content
  • a further aspect of the present invention comprises nucleic acids which code for the polypeptides according to the invention with the biological activity of the native hRyR3.
  • Nucleic acids include DNA and also RNA. All nucleic acids according to the invention are distinguished by the fact that they hybridize with a nucleic acid according to the polypeptide sequences according to the invention under stringent conditions Under permanent conditions, DNA sequences hybridize with more than 85% homology and preferably with a homology of more than 90%.
  • the invention comprises all the nucleic acid sequences necessary for the recombinant presentation of the polypeptides according to the invention.
  • the sequences thus include all additional sequences necessary for the recombinant production of the polypeptides, e.g. Vector and host nucleic acids.
  • the present invention provides a method for producing the polypeptides according to the invention, which is characterized in that a nucleic acid according to the invention is introduced into a cell or a cell-free in vitro translation system.
  • the method is further characterized in that the nucleic acid can be part of an expression vector.
  • Appropriate usable expression vectors, cells, cell-free in vitro translation systems and the necessary methods for producing the polypeptides are familiar to the person skilled in the field of molecular biology.
  • a still further aspect of the present invention relates to the use of the polypeptides and / or nucleic acids according to the invention as a pharmaceutical or as part of a pharmaceutical, or the use of the polypeptides and / or nucleic acids for the production of a pharmaceutical for the treatment of hRyR3-associated diseases.
  • the invention also encompasses nucleic acids as a pharmaceutical or as a component of a pharmaceutical which is complementary to the nucleic acid of one of the proteins according to the invention.
  • Such complementary nucleic acids are known to the person skilled in the art under the name “antisense” nucleic acids and their therapeutic importance is familiar to the person skilled in the art.
  • An additional aspect of the present invention relates to methods for the detection of the polypeptides according to the invention and their nucleic acids.
  • polypeptides according to the invention now make it possible for the first time to provide highly specific immunological methods for detecting these polypeptides in low concentrations.
  • the invention relates to methods for the detection of the invention O
  • polypeptides which are characterized in that the polypeptide is detected immunologically, immunological methods such as e.g. the production, purification and use of monoclonal and polyclonal antibodies for the quantitative and qualitative highly specific detection of peptides are known to the person skilled in the art from the prior art.
  • the invention also includes the molecular biological detection of the nucleic acid coding for the polypeptides. Molecular biological evidence is well known to those skilled in the field of molecular biology and includes, among others. Hybridization and PCR (polymerase chain reaction) methods.
  • the method for detecting a nucleic acid according to the invention is characterized in that a nucleic acid complementary to this nucleic acid or to a part of this nucleic acid is used for hybridization.
  • Another aspect of the present invention includes the use of the polypeptides and / or nucleic acids provided for determining possible inhibitors and activators of hRyR3. Accordingly, the present invention also encompasses methods for the in vitro and / or in vivo identification of activators and / or inhibitors of hRyR3, which are characterized in that a nucleic acid according to the invention is introduced and expressed in a cell or a cell-free system, the expression product is exposed to a potential inhibitor or activator and the ion flow mediated by the expression product is measured.
  • the term in vitro refers to cell-free, the term in vivo to cell systems.
  • activators and / or inhibitors are introduced into membrane-enclosed cell-free systems which express the polypeptides according to the invention and, after adding potential activators and inhibitors, the change in the ion concentration in the membrane-enclosed space is determined.
  • the present invention provides for the first time, by expressing the polypeptides according to the invention in RyR-deficient cells, a system in vivo that enables activators and inhibitors of hRyR3 to be determined in isolated cells. Methods for the expression of polypeptides in cells and cell-free systems using the corresponding nucleic acid are known to the person skilled in the art from the prior art.
  • the invention in a very special embodiment also includes the injection of the polypeptides into these cells and systems for the identification of inhibitors and / or activators according to the methods described above. Potential inhibitors and activators are identified by demonstrating the changed influence of the expression product on the cell.
  • the changed influence of the peptide or expression product can be measured by the mediated ion flow or by the change in the ion concentration in the membrane-enclosed space. Generally, the concentration of intracellular calcium ions is measured.
  • An exemplary experimental setup of such a method for determining activators or inhibitors consists, for example, of a hRyR3-expressing cell system or cell-free system which has no or only little endogenous ryanodine receptor activity, with a measurable change in the ion concentration within the cell system after the addition of potential inhibitors or activators or the membrane-enclosed space is determined.
  • Systems for determining activators and inhibitors are already known for the RyR1 and RyR2.
  • the present invention comprises the detection of the polypeptides according to the invention and / or the hRyR3, for the diagnosis of pathologically changed tissues.
  • the polypeptides and / or nucleic acids according to the invention can be used to produce a diagnostic agent which enables a method for diagnosing pathological conditions, such as overexpression or the lack of hRyR3 in tissues, to be carried out, which is characterized in that is that the presence, overexpression or deficiency of one of the polypeptides according to the invention is detected.
  • a very special embodiment of the present invention relates to methods for diagnosing pathological conditions through the immunological detection of the polypeptides according to the invention by antibody binding.
  • a person skilled in the art understands a pathological condition of a tissue to be any deviation from the normal physiological conditions as is evident in the majority of clearly healthy tissue.
  • the overexpression or the deficiency of the polypeptides according to the invention in tissues and cells can be determined both by immunological methods and by the molecular-biological detection of the nucleic acid coding for the polypeptides.
  • the present invention therefore comprises methods for diagnosing pathological conditions, which are characterized in that the nucleic acid coding for the polypeptide according to the invention is detected.
  • Appropriate Molecular biological evidence is well known to the person skilled in the field of molecular biology and includes, among other things, hybridization methods and PCR (polymerase chain reaction) methods.
  • the present invention allows the person skilled in the art for the first time to display highly specific hRyR3 hybridization probes with which the presence or lack of nucleic acids of hRyR3 in tissues can be detected.
  • Highly specific probes can now be developed for the detection of hRyR3 by PCR ("polymerase chain reaction").
  • pathological conditions in tissues can be detected by molecular biological methods
  • the sequence and molecular-physiological characterization of the cDNA sequence of the native peptide of the hRyR3 according to the invention is disclosed below.
  • the cDNA sequence was identified and characterized by molecular biological hybridization methods known to the person skilled in the art and subsequent sequencing of several overlapping cDNA clones (see Example 1)
  • the primary structure of the native polypeptide according to the invention has been determined by comparing the corresponding reading frame of the amino acid sequence of the rabbit RyR3 (Hakamata Y et al FEBS Lett 312! (1992), 229-235).
  • the amino acid sequence of the native polypeptide is 4866 amino acids long and corresponds to a molecular weight of 551046 Since FIG.
  • the amino acid sequence of the hRyR3 derived from the cDNA shows the amino acid sequence of the hRyR3 derived from the cDNA.
  • the nucleotide sequence GAGCCATGG in the region around the translational initiation codon agrees well with the consensus initiation sequence CCA (G) CCATGG (Kozack M Nucleic Acids Res 12 (1984), 857-872)
  • the 3 non-coding region is 873 nucleotides long (without the poly (da) region), the polyadenylation signal AATAAA (Goeddel, DV et al Nature 290 (1981), 20- 26) is located 21 nucleotides above the poly (da) region.
  • the amino acid sequence comparison shows in each case over 90% (approx.
  • hRyR3 / rRyR3 identity between hRyR3 / rRyR3, or over 60% identity between hRyR3 / rRyR2 (approx. 69%) and hRyR3 / RyR1 (approx. 67%)
  • the hydropathicity profile of the hRyR3 is comparable to that of rabbit rRyR3, rRyR2, rRyR1 and human RyR1 insofar as there is no hydrophobic amino terminal sequence indicating a signal sequence and that the remaining areas are mainly hydrophilic and that there are four strongly hydrophobic segments (named M1, M2, M3 and M4) in the carboxy-terminal end.
  • the carboxy-terminal region in the region of the M3 and M4 segments Es is particularly well preserved in all RyR there are also clear differences.
  • RyR2 has an EF hand consensus sequence in this region (Moncrief, NDJ Mol Evol 30 (1990) , 522-562) (in the region of amino acids 1336-1347) and a nucleotide binding consensus sequence GXGXXG (Wierenga, RK Nature 302 (1983), 842-844) (amino acid residues 1324-1329) (Nakai, J et al FEBS Lett 271 (1990) , 169-177) Furthermore, the region immediately in front of the M1 segment differs in that there is a divergence between hRyR3 and rRyR3.
  • the hRyR3 has four repeating sequences in two tandem pairs (amino acid residues 841 -954, 955-1070, 2600-271 1 and 2712-2791) Potential ligand binding sites can be determined via proposed consensus amino acid sequences. A sequence similar to the motif of the EF hand (Moncrief, NDJ Mol Evol 30 (1990), 522-562) can be seen in amino acid residues 3928-3939, a region which is also in r RyR3, RyR2 and RyR1 is relatively well preserved.
  • amino acids 3465-3476 consisting of an amphipathic helix with two groups of positive charges that are separated by a hydrophobic region (Blumenthal, DK Proc Natl Acad Sei USA) 82 (1985), 3187-3191), particularly well preserved in rRyR3, rRyR2 and rRyR1.
  • the molecule has four copies of the nucleotide binding consensus sequence GXGXXG (Wierenga, RK Nature 302 (1983), 842-844) (amino acid residues 697-702, 699 -704, 1 135-1 140, 2235-2240 and 2524-2529), of which the amino acids 2235-2240 are well preserved in rRyR3, rRyR2 and rRyR3.
  • the functional analysis of the RyR3 has so far not been able to show any direct evidence of its function as a calcium release channel.
  • the functional recombinant expression of the hRyR3 by mouse myotubes without the skeletal muscle isoform of the RyR (Nakai, J et al Nature 380 (1996), 72-75).
  • FIG. 2B shows a caffeine reaction of the chimeric RyR expressed in dyspedic myotubes.
  • non-injected dyspedic myotubes show no reaction to 1 mM caffeine (Fig.
  • a very special embodiment of the present invention relates to the detection of hRyR3 in tissues. This is possible with hRyR3-specific probes and the Northem blot analysis of mRNA from various human tissues. It can be shown that, although in the whole brain only a weak signal for RNA can be observed, an approximately 16 kb RNA piece with hRyR cDNA samples in a relatively large amount in limited brain areas such as the caudate nucleus, amygdala and hippocampus and in somewhat smaller amounts in the corpus callosum, substantia nigra and thalamus (FIG. 3) hybridized The limited distribution of RyR3 in the human brain allows the following assumptions.
  • the RyR is also directly coupled to L-type calcium channels in the brain. While P-type and other types of calcium channels are exposed throughout the brain, the R -Type calcium channel only in the very limited regions of the brain, such as in the caudate nucleus and hippocampus (Nndom e, T et al FEBS Lett 308 (1992), 7-13) With a similar distribution of R-type calcium channel and RyR3 it is likely that the RyR3 can interact directly with the R-type calcium channel in these regions Regions of the RyR3 expression also roughly correspond to the areas in which the "delayed neuronal death" after hypoxia takes place in the brain, it is likely that this type of RyR plays an important role in pathological conditions. The increased locomotor activity of RyR3-deficient mice reflects this distribution of the RyR3
  • RNA species that hybridizes with hRyR3 cDNA samples also succeeds outside the brain in skeletal muscle (FIG. 4).
  • the size of the RNA species of these tissues of approximately 16 kb corresponds to the species in the brain
  • a weak signal suggests the existence of RyR3 mRNA in heart tissue.
  • the distribution of mRNA outside the brain differs from that of rabbits because the RyR3 expression in rabbit skeletal muscle is undetectable. Due to the high content of RyR1 mRNA in skeletal muscle there is a Small contribution due to cross-hybridization of RyR3 samples with RyR1 mRNA not excluded.
  • the RyR3 expression varies between the species and that the RyR3 expression is more pronounced in human skeletal muscle than in other species. It is known that an acute increase in intracellular calcium in human Skeletal muscle triggers malignant hyperthermia (MH) (MacLennan, DH and Philips, MS Science 256 (1992), 789-794) although MH is associated with mutations in RyR1 (Gillard, EF et al Genomics 1_ (1991), 751-755) , only 5% of the MH trap shows a mutation in position 614 of the RyR1 gene by Arg to Cys substitution. The abundant expression of RyR3 in human skeletal muscle makes it very likely that RyR3 is involved in variant forms of MH. There is also the possibility that the RyR3 could also be involved in other disorders of intracellular calcium regulation
  • the hRyR3 is present in pathological conditions in humans and can be detected in pathologically modified tissues.
  • tissue-specific distribution of the RyR3 in human Brain is related to the cell-specific calcium regulation in the production.
  • RyR3-mRNA is expressed in several human cell lines (Fig. 5). Abundant expression can be found in U373, a cell from malignant astrocytoma, a weak expression in IMR-32 from malignant neuroblastoma cells and an even lower expression in H4 from malignant neurogoma cells.
  • the RyR2 expression in IMR-32 no other RyR types are detectable in U373 or H4.
  • Oligo (dT) and random primer cDNA libraries from human brain (nucleus caudatus) from Clontech (USA) were used, which were isolated from poly (A) + RNA and cloned into ⁇ gt10 phages.
  • the interfaces of the residual endonucleases are identified by numbers (in brackets ), which describe the 5 ' terminal nucleotide resulting from the cleavage; the nucleotide residues are numbered in the 5 ' -3 ' direction, starting with the first residue of the ATG Tnplet, which encodes the methionine which is likely to initiate.
  • RNA (A) + RNA (Clontech) from the human brain was incubated together with RNase H'Reverse Transk ⁇ ptase from Moloney 's murine leukemia virus (Gibco BRL) with a random spammer.
  • the first synthesized cDNA- Strand was according to the manufacturer's instructions (TaKaRa LA PCR Kit) using a DNA Thermal Cycler's (Perkin-Elmer Corp) amplified After a hot start (1 min, 94 ° C) the samples were 30 cycles of 20 s at 98 ° C and Exposed for 5 min at 68 ° C.
  • Primer pairs for phBRR501 were phBRR51 - and ph95R950 for phBRR51 - and phpRR5150 for phBRR5150 were each 25-nucleotiddohgomers of bases 2949-2973 (upper polymer, AGTGGATAAACTTGCAGAAAATGCA) and 3495-3519 (lower primer, TGGGGAGCTGCTGATCACCAATAAA) for phBRR51 - Synthetic 20-nucleotide OHGomers of bases 11369-1 1388 (upper primer, TTGATGAATCTGGACAGCAC) and 12353-12372 (lower primer, ACGTGTTAGAAATTGCGGGT) of the phBRR79 and phBRR91 clones.
  • the entire protein coding sequence of human RyR3 was cloned into the EcoRI / NotI site of pCI-neo (Promega) and resulted in hNRR9.
  • the cDNA insert was constructed from the following fragments EcoRI (Vector) / Mrol (1232) obtained from lhBRR22, Mrol (1232) / H ⁇ ndlll (2956) from lhBRR61, H ⁇ ndlli (2956) / Bcll (3506) from lhBRR501,
  • Caffeine was injected by local injection a "w ⁇ de-t ⁇ pped" pipette (10-50 mm diameter) applied.
  • Normal rodent-Ringer solution of the following composition was used as a washing solution (mM) 145 NaCl, 5 KCI, 2 CaC-2, 1 MgCl 2 , 10 HEPES, pH 7 4 adjusted with NaOH.
  • the temperature was 20-22 ° C
  • MTN Multiple Tissue Northern
  • Each lane of the MTN blots contains approximately 2 ⁇ g poly (A) + RNA from the following brain regions amygdala, nucleus caudatus, corpus callosum , Hippocampus, whole brain, substantia nigra, subthalamic nucleus and thalamus
  • Each lane of the other MTN blot contains approximately 2 mg poly (A) + RNA of the following human tissues heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas
  • Each lane of the third blot contains approximately 20 mg of total RNA from the following human cell lines (Hakamata Y, et al FEBS Lett 312 (1992), 229-235) SK-N-MC (derived from original neuroblastoma), IMR-32 (neuroblastoma), HEL-299 (pulmonary fibroblast), H4 (
  • the sample was mixed with the Klenow fragment of DNA polymerase and [ 32 P] dCTP (Feinberg, AP & Vogelstein, B Anal Biochem 132 (1983), 6-13) by random oligonucleotide polymer.
  • the blot was hybridized at 42 ° C. and washed three times with 0.3 ⁇ SSC, 0.1% SDS at 50 ° C. 4 Luminescence determination
  • the luminescence determination was carried out (Maeda, A et al, Anal Biochem 242, (1996), 58-66).
  • the cells (1 ⁇ 10 5 cells / vessel) were included in the solution of the calcium assay of the following composition transfers (mM) 140 NaCl, 5 KCI, 1, 5 MgCl 2 , 2.5 CaCl 2 , 5 glucose and 10 HEPES, pH 7.4 adjusted with NaOH, including 2.5 mM coelenterazine, the intermediate substrate of Aequo ⁇ n, and incubated at 37 ° C for 6 h
  • the system for luminescence measurement consisted of the spectrofluorometer CAF-1 10 (Jasco) (Hakamata Y et al, FEBS Lett 352, (1994), 206-210), which with a Luminescence unit PL-03 (Jasco)
  • the mobilization of intracellular calcium was induced by injection of caffeine in a final concentration of 10 mM and ryanodine receptor of 100
  • FIG. 3 shows the distribution of human RyR3 in human brain by Northern blot analysis of different regions of the brain with cDNA samples for human RyR3 mRNAs. 2 mg poly (A) + RNA were used in each case. Autoradiography was carried out at -70 ° C for 7 days with an intensifying screen
  • FIG. 5 shows the distribution of human RyR3 in human cell lines by Northern blot analysis of human RyR mRNA expression in rabbit skeletal muscle, rabbit heart, rabbit whole brain and human cell lines such as neuroblastoma (SK-N-MC, IMR-32), lung fibroblasts ( HEL-299), Neurog oma (H4), Neuroblastoma (SK-N-SH), embryonic kidney cells (HEK293) and astrocytoma (U373) with cDNA probes for human RyR3 mRNAs. 20 mg total RNA were used in each case. Autoradiography was carried out at -70 ° C for 4 days with an intensifying screen
  • the inconsistent reaction is probably not due to the fact that the ryanodine receptor does not reach the site of action as described recently (Penner, R et al, FEBS Lett 259, (1989), 217-221)
  • the time of adding caffeine and ryanodine receptor is marked by small bars
  • Figure 8 shows the DNA sequence of the human ryanodine receptor

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Der Gegenstand der Erfindung umfaßt Nukleinsäuren und Protein des humanen Ryanodinrezeptors vom Typ 3 (hRyR3), chimäre Ryanodinrezeptoren mit Anteilen des menschlichen Rezeptors sowie Verfahren zur Herstellung dieser Proteine. Ein weiterer Gegenstand der vorliegenden Erfindung betrifft den Nachweis von Ryanodinrezeptoren in menschlichen Geweben zur Diagnose pathologischer Zustände und Verfahren zur Identifizierung von Aktivatoren oder Inhibitoren des hRyR3.

Description

Das Protein des humanen Ryanodinrezeptors vom Typ 3 sowie dafür kodierende DNA-Moleküle
Beschreibung
Der Gegenstand der Erfindung umfaßt Nukleinsäuren und Protein des humanen Ryanodinrezeptors vom Typ 3 (hRyR3), chimare Ryanodinrezeptoren mit Anteilen des menschlichen Rezeptors sowie Verfahren zur Herstellung dieser Proteine Ein weiterer Gegenstand der vorliegenden Erfindung betrifft den Nachweis von Ryanodinrezeptoren in menschlichen Geweben zur Diagnose pathologischer Zustande und Verfahren zur Identifizierung von Aktivatoren oder Inhibitoren des hRyR3
Zytoplasmatisches Kalzium spielt eine wichtige Rolle in der Zellaktivierung, Neurotransmitterfreisetzung, Muskelkontraktion und anderen biologischen Prozessen Es wird durch den Einfluß extrazellularen Kalziums durch span- nungsaktivierte und andere lonenkanale und über die Kalziumfreisetzung intrazellularer Vorrate erhöht Zur Zeit sind zwei intrazellulare Kalziumfrei- setzungskanale bekannt, die Inositol 1 ,4,5-trιsphosphatrezeptoren (IP3R) und die Ryanodinrezeptoren (RyR) Bei der Kalziumfreisetzung durch IP3R wird von einem ubiquitaren Mechanismus ausgegangen, der für viele Zellen beschrieben wurde Dagegen werden drei Typen von RyR-mRNA, RyR1 , RyR2 und RyR3 gewebespezifisch expπmiert, RyR1 hauptsächlich in Skelettmuskel, RyR2 in Herzmuskel und Gehirn und RyR3 in Gehirn und glatter Muskulatur Im Gehirn wird der RyR3 nur in sehr begrenzten Bereichen stark expπmiert, wie z B Hippocampus, Nucleus caudatus, Corpus callosum und Thalamus Der RyR3 wird auch in nicht-erregbaren Zellen wie menschlichen T-Lymphozyten expπmiert Eine Rolle des RyR3 in der Zellproliferation wird postuliert (Hakamata, Y et al FEBS Lett , 352 (1994), 206-210) Für RyR1 und RyR2 wurde gezeigt, daß bei der Erregungs-Kontraktions-Kopplung von Skelett- und Herzmuskel spannungsaktivierte Kalziumkanale direkt den RyR1 in Skelettmuskel und wahrscheinlich auch in Neuronen aktivieren, wahrend das Kalzium der spannungsaktivierten Kanäle ein Ausloser zur Öffnung von RyR2 in Herzmuskel ist (kalziuminduzierte Kalziumfreisetzung)
Die Funktion des RyR3 ist Gegenstand einer Reihe von Spekulationen Obwohl Kalzium ein wichtiger physiologischer Ligand von RyR3 zu sein scheint, spricht einiges dafür, daß die kalziuminduzierte Kalziumfreisetzung sich von derjenigen anderer RyR unterscheidet Es wird angenommen, daß ein endogener RyR3 für die wesentlich geringere Kalziumempfindlichkeit der restlichen Kalziumfreisetzungsaktivitat von RyR1 -defιzιenten Mausmuskelzellen verantwortlich ist RyR3 ist nachweislich in einigen Fallen gegenüber Koffein unem- pfindlich, der hauptsachlich zur RyR-Aktivierung verwendeten Substanz. Da RyR3 in nicht-erregbaren Zellen expπmiert wird, die praktisch über keine spannungsaktivierten Kalziumkanale verfugen, scheint es möglich, daß RyR3 durch andere Mechanismen reguliert wird als die übrigen RyR RyR3-defιzιente Mausmutanten weisen eine erhöhte lokomotoπsche Aktivität auf. Die cDNA- Sequenzen von RyR1 , RyR2 und für den Kanιnchen-RyR3 (rRyR3) sind bereits bekannt, wahrend die Nuklemsauresequenz des RyR3 im Menschen (hRyR3) noch nicht untersucht wurde
Trotz vielfaltiger Teilmformationen über den RyR3 sind seine molekularphysio- logischen Eigenschaften, seine Bedeutung in pathologischen Zustanden sowie Verfahren zur Beurteilung möglicher Inhibitoren und Aktivatoren seiner Aktivität weitgehend oder sogar völlig unbekannt Auch geht die Übertragung zur Zeit vorhandener Informationen aus Untersuchungen mit isolierten RyR3 nichthumanen Ursprungs auf den Menschen mit einer nicht unerheblichen Unsicherheit einher
Aufgabe der vorliegenden Erfindung war die Bereitstellung der Nuklemsauresequenz des humanen Ryanodinrezeptors vom Typ 3, seine Aminosaure- sequenz sowie die Feststellung struktureller und physiologischer Besonder- heiten, die den hRyR3 von allen anderen RyR unterscheiden
Die Aufgabe konnte mit der vorliegenden Erfindung im Rahmen der Beschreibung und der Patentansprüche gelost werden, indem Polypeptide zur Verfugung gestellt werden, die dadurch gekennzeichnet sind, daß sie mindestens 90 % Aminosauresequenzidentitat mit dem Kaninchen-Ryanodin- Rezeptor vom Typ 3 (rRyR3) aufweisen
In einer besonderen Ausfuhrungsform betrifft die vorliegende Erfindung Polypeptide, die dadurch gekennzeichnet sind, daß sie ca 96 % Aminosauresequenzidentitat mit dem rRyR3 aufweisen In einer speziellen Ausfuhrungsform umfasst die vorliegende Erfindung den humanen Ryanodinrezeptor vom Typ 3 (hRyR3) mit der Aminosauresequenz gemäß Figur 7 Die bereitgestellten Polypeptide und funktioneilen Derivate des hRyR3 ermöglichen es nun erstmals, den humanen RyR3 mit RyR-Typen anderer Spezies zu vergleichen und Unterschiede aufzuzeigen
Die bereitgestellten erfindungsgemaßen Polypeptide umfassen den humanen RyR3 sowie seine "funktionellen Derivate"
Unter dem der vorliegenden Erfindung zugrundeliegenden Begriff "funktionelles Derivat" ist im Rahmen der Erfindung eine Komponente mit der biologischen Aktivität, die im wesentlichen ähnlich der biologischen Aktivität des nativen hRyR3 ist, gemeint Die biologische Fähigkeit bezieht sich sowohl auf das Bindungsvermogen von Inhibitoren und Aktivatoren wie Koffein als auch von weiteren physiologischen Liganden des nativen Rezeptors sowie die Freisetzung von intrazellularem Kalzium Ein "funktionelles Derivat" umfasst aber auch Teile der hRyR, dessen biologische Eigenschaften durch Fragmente anderer Proteine wie z B anderer RyR verändert wurden In einer besonderen Ausfuhrungsform sei hier auf das Beispiel eines chimaren Rezeptors aus hRyR3 und rRyR2 verwiesen Der Ausdruck "funktionelle Derivate" soll "Fragmente", Varianten" und "chemische Derivate" umfassen Der Ausdruck "Fragment" bezieht sich auf jedes Polypeptid, das gemessen am nativen Rezeptor, eine verkleinerte Form darstellt und mindestens eine Bindungsstelle für einen Liganden des hRyR aufweist
Eine "Variante" umfasst Moleküle, die im wesentlichen in Funktion und Struktur vom nativen hRyR3 abgeleitet sind, wie z B allele Formen Demnach beinhaltet der Ausdruck "Variante" z B die Moleküle, die eine ähnliche Aktivität, aber z B eine veränderte Aminosauresequenz haben Ein chemisches Derivat schließt zusätzliche chemische Gruppen ein, die normalerweise nicht Teil des Moleküls sind Diese Gruppen können z B die biologische Aktivität des Moleküls verstarken oder abschwachen
Ein Aspekt der vorliegenden Erfindung betrifft chimare Polypeptide, die dadurch gekennzeichnet sind, daß sie neben mindestens einem Fragment des humanen Ryanodinrezeptors vom Typ 3 (hRyR3) mindestens ein weiteres
Fragment eines anderen Polypeptids enthalten
In einer besonderen Ausfuhrungsform betrifft die vorliegende Erfindung chimare Polypeptide, die dadurch gekennzeichnet sind, daß sie neben einem Fragment des hRyR3 mindestens ein weiteres Fragment aus der Familie der nicht humanen Ryanodinrezeptoren enthalten
In einer speziellen Ausfuhrungsform betrifft die vorliegende Erfindung chimare
Polypeptide, die dadurch gekennzeichnet sind, daß sie neben einem Fragment des hRyR3 mindestens ein Fragment des Kaninchen-Ryanodin-Rezeptors Typ 2 (rRyR2) enthalten
In einer weiteren besonderen Ausfuhrungsform betrifft die vorliegende Erfindung ein chimares Polypeptid, daß dadurch gekennzeichnet ist, daß es im Bereich der Aminosäure 1300 des hRyR3 ein Fragment des rRyR2 enthalt, welches hohe Kalzium- bzw Koffeinempfindlichkeit verleiht Aufgrund der im Vergleich zu den anderen RyR-Typen geringeren Kalzium- freisetzungsaktivitat des RyR3 ist die Messung der Kalziumfreisetzung durch bekannte Aktivatoren wie z B Koffein ungenau oder sogar nicht möglich Dies hat große Bedeutung für die Identifizierung möglicher Inhibitoren oder Aktivatoren der biologischen Wirkung des RyR3 Es wurde nun überraschenderweise gefunden, daß ein chimares Polypeptid, das über eine erhöhte Kalzium- bzw Koffeinempfindlichkeit verfugt, aus einem Fragment des RyR vom Typ 3 und einem anderen Protein hergestellt werden kann In einer besonderen Ausfuhrungsform wird ein chimares Polypeptid aus einem Anteil hRyR3 und einem nichthumanen Anteil, wie z B einem Fragment des Kanιnchen-rRyR2, vorgestellt Überraschenderweise wurde gefunden, daß das Ersetzen des hRyR3 im Bereich der Aminosäure 1300 durch einen Teil des rRyR2 eine erhöhte Koffein- bzw Kalziumempfindlichkeit vermittelt Diese erhöhte Kalzium- bzw Koffeinempfindlichkeit ermöglicht nun dem Fachmann in hochsensiblen Testsystemen, z B in vivo Zellsystemen, Aktivatoren und Inhibitoren durch ihren Einfluß auf den intrazellularen Kalziumgehalt zu bestimmen
Ein weiterer Aspekt der vorliegenden Erfindung umfasst Nukleinsäuren die für die erfindungsgemaßen Polypeptide mit der biologischen Aktivität des nativen hRyR3 kodieren Nukleinsäuren umfassen DNA sowie auch RNA Alle erfindungsgemaßen Nukleinsäuren zeichnen sich dadurch aus, daß Sie mit einer Nukleinsaure entsprechend der erfindungsgemaßen Polypeptid- Sequenzen unter stπngenten Bedingungen hybridisieren Unter stπngenten Bedingungen hybridisieren DNA-Sequenzen mit mehr als 85 % Homologie und bevorzugt mit einer Homologie von mehr als 90 % Unter stπngenten Bedingungen versteht der Fachmann auf dem Gebiet der Molekularbiologie Hybπdisierungsbedingungen wie sie z B in "Molecular Cloning, A Laboratory Manual, 2nd Ed , Sambrook, Fπtsch, Maniatis, Cold Spring Harbor Press, 1989" und "Haymes, B D et al , Nucleic Acid Hybridisation, a Practical Approach, IRL Press, Washington, DC (1985)" beschrieben werden In einer weiteren bevorzugten Ausfuhrungsform kodieren diese DNA-Molekule für chimare Polypeptide, die neben einem Anteil hRyR3 mindestens ein weiteres DNA-Fragment enthalten, das z.B. aus der Familie der Ryanodinrezeptoren stammen kann. In einer besonderen Ausführungsform wird eine Nukleinsäure für ein chimares Polypeptid aus einem Fragment des hRyR3 zur Verfügung gestellt, dessen Bereich um die Aminosäure 1300 durch ein Fragment des Kaninchen RyR2 ersetzt wurde.
In einer weiteren besonderen Ausführungsform umfasst die Erfindung alle zur rekombinanten Darstellung der erfindungsgemäßen Polypeptide notwendigen Nukleinssäuresequenzen. Die Sequenzen schließen somit alle zusätzlichen Sequenzen ein, die zur rekombinanten Herstellung der Polypeptide notwendig sind, wie z.B. Vektor- und Wirtsnukleinsäuren.
In einem zusätzlichen Aspekt wird von der vorliegenden Erfindung ein Verfahren zur Herstellung der erfindungsgemäßen Polypeptide bereitgestellt, daß dadurch gekennzeichnet ist, daß eine erfindungsgemäße Nukleinsäure in eine Zelle oder ein zellfreies In-Vitro-Translations-System eingebracht wird. Ferner ist das Verfahren dadurch gekennzeichnet, daß die Nukleinsäure Bestandteil eines Expressionsvektors sein kann. Entsprechende verwendbare Expressionsvektoren, Zellen, zellfreie In-Vitro-Translations-Systeme sowie die notwendigen Methoden zur Herstellung der Polypeptide sind dem Fachmann auf dem Gebiet der Molekularbiologie geläufig.
Ein noch weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung der erfindungsgemäßen Polypeptide und/oder Nukleinsäuren als Pharma- zeutikum oder als Bestandteil eines Pharmazeutikums, bzw. die Verwendung der Polypeptide und/oder Nukleinsäuren zur Herstellung eines Pharmazeutikums zur Behandlung von hRyR3 assoziierten Erkrankungen. Ferner umfasst die Erfindung jedoch auch Nukleinsäuren als Pharmazeutikum oder als Bestandteil eines Pharmazeutikums, die der Nukleinsäure eines der erfindungsgemäßen Proteine komplementär ist. Solche komplementären Nukleinsäuren sind dem Fachmann unter dem Namen "Antisense"-Nuklein- säuren bekannt und ihre therapeutische Bedeutung ist dem Fachmann geläufig.
Ein zusätzlicher Aspekt der vorliegenden Erfindung betrifft Verfahren zum Nachweis der erfindungsgemäßen Polypeptide sowie deren Nukleinsäuren.
Die erfindungsgemäßen Polypeptide ermöglichen nun erstmals die Bereitstellung hochspezifischer immunologischer Methoden, diese Polypeptide in geringen Konzentrationen nachzuweisen. In einer besonderen Ausführungsform betrifft die Erfindung Verfahren zum Nachweis der erfindungsgemäßen o
Polypeptide, die dadurch gekennzeichnet sind, daß das Polypeptid immunologisch nachgewiesen wird, immunologische Methoden, wie z.B. die Herstellung, Reinigung und Anwendung monoklonaler und polyklonaler Antikörper zum quantitativen und qualitativen hochspezifischen Nachweis von Peptiden sind dem Fachmann aus dem Stand der Technik bekannt. Ferner umfasst die Erfindung in einer weiteren besonderen Ausführungsform auch den molekularbiologischen Nachweis der für die Polypeptide kodierenden Nukleinsäure. Molekularbiologische Nachweise sind dem Fachmann auf dem Gebiet der Molekularbiologie bestens bekannt und umfassen u.a. Hybridisierungs- und PCR- (Polymerase Chain Reaction) Methoden. In einer besonderen Ausführungsform ist das Verfahren zum Nachweis einer erfindungsgemäßen Nukleinsäure dadurch gekennzeichnet, daß eine zu dieser Nukleinsäure oder zu einem Teil dieser Nukleinsäure komplementäre Nukleinsäure zur Hybridisierung eingesetzt wird.
Ein weiterer Aspekt der vorliegenden Erfindung umfasst die Verwendung der bereitgestellten Polypeptide und/oder Nukleinsäuren zur Bestimmung möglicher Inhibitoren und Aktivatoren des hRyR3. Demzufolge umfasst die vorliegende Erfindung auch Verfahren zur in vitro- und/oder in vivo- Identifizierung von Aktivatoren und/oder Inhibitoren des hRyR3, die dadurch gekennzeichnet sind, daß eine erfindungsgemäße Nukleinsäure in eine Zelle oder ein zellfreies System eingebracht und exprimiert wird, das Expressionsprodukt einem potentiellen Inhibitor oder Aktivator ausgesetzt wird und der durch das Expressionsprodukt vermittelte lonenfluß gemessen wird. Der Begriff in vitro bezieht sich auf zellfreie, der Begriff in vivo auf Zellsysteme. In einer besonderen Ausführungsform werden Aktivatoren und/oder Inhibitoren in membranumschlossene zellfreie Systeme eingebracht, die die erfindungsgemäßen Polypeptide exprimieren und nach Zusatz potentieller Aktivatoren und Inhibitoren die Änderung der lonenkonzentration im membranumschlossenen Raum bestimmt. In einer ganz besonderen Ausführungsform stellt die vorliegende Erfindung erstmals durch die Expression der erfindungsgemäßen Polypeptide in RyR-defizienten Zellen ein System in vivo zur Verfügung, daß es ermöglicht, Aktivatoren und Inhibitoren des hRyR3 in isolierten Zellen zu bestimmen. Methoden zur Expression von Polypeptiden in Zellen und zellfreien Systemen unter Verwendung der entsprechenden Nukleinsäure sind dem Fachmann aus dem Stand der Technik bekannt. Neben der Expression der erfindungsgemäßen Polypeptide in Zellen oder zellfreien Systemen umfasst die Erfindung in einer ganz besonderen Ausführungsform auch die Injektion der Polypeptide in diese Zellen und Systeme zur Identifikation von Inhibitoren und/oder Aktivatoren nach den oben beschriebenen Methoden. Die Identifizierung von potentiellen Inhibitoren und Aktivatoren erfolgt durch Nachweis des veränderten Einflusses des Expressionsprodukts auf die Zelle. Der veränderte Einfluss des Peptids bzw. Expressionsprodukts ist durch den vermittelten lonenfluss meßbar bzw. durch die Veränderung der lonenkon- zentration im membranumschlossenen Raum. Im allgemeinen wird die Konzentration intrazellulärer Kalziumionen gemessen. Ein beispielhafter Versuchsaufbau eines solchen Verfahrens zur Bestimmung von Aktivatoren oder Inhibitoren besteht z.B. aus einem hRyR3 exprimierenden Zellsystem oder zellfreien System, das über keinerlei oder nur geringe endogene Ryanodinrezeptoraktivität verfügt, wobei nach dem Zusatz von potentiellen Inhibitoren oder Aktivatoren eine meßbare Änderung der lonenkonzentration innerhalb des Zellsystems oder des membranumschlossenen Raums bestimmt wird. Für den RyR1 und RyR2 sind Systeme zur Bestimmung von Aktivatoren und Inhibitoren bereits bekannt.
In einem weitereren zusätzlichen Aspekt umfasst die vorliegende Erfindung den Nachweis der erfindungsgemäßen Polypeptide und/oder des hRyR3, zur Diagnose von pathologisch veränderten Geweben. In einem weiteren Aspekt der vorliegenden Erfindung können die erfindungsgemäßen Polypeptide und/oder Nukleinsäuren zur Herstellung eines Diagnostikums verwendet werden, welches die Durchführung eines Verfahrens zur Diagnose von pathologischen Zuständen, wie z.B. die Überexpression oder der Mangel an hRyR3 in Geweben, ermöglicht, das dadurch gekennzeichnet ist, daß das Vorhandensein, die Überexpression oder der Mangel eines der erfindungsgemäßen Polypeptide nachgewiesen wird. Eine ganz besondere Ausführungsform der vorliegenden Erfindung betrifft Verfahren zur Diagnose pathologischer Zustände durch den immunologischen Nachweis der erfindungsgemäßen Polypeptide durch Antikörperbindung. Unter einem pathologischen Zustand eines Gewebes versteht der Fachmann jegliche Abweichung der physiologischen Normalverhältnisse wie sie bei der Mehrheit eindeutig gesunder Gewebe ausgeprägt sind. Die Feststellung der Überexpression oder des Mangels der erfindungsgemäßen Polypeptide in Geweben und Zellen kann sowohl durch immunologische Methoden als auch durch den molekular- biologischen Nachweis der für die Polypeptide kodierenden Nukleinsäure erfolgen. In einer weiteren besonderen Ausführungsform umfasst die vorliegende Erfindung deshalb Verfahren zur Diagnose pathologischer Zustände, die dadurch gekennzeichnet sind, daß die für das erfindungsgemäße Polypeptid kodierende Nukleinsäure nachgewiesen wird. Entsprechende molekularbiologische Nachweise sind dem Fachmann auf dem Gebiet der Molekularbiologie bestens bekannt und umfassen u a Hybπdisierungs- methoden und PCR- (Polymerase Chain Reaction) Methoden Ferner erlaubt die vorliegende Erfindung durch Bereitstellung der Nukleinsauresequenz des hRyR3 dem Fachmann erstmals die Darstellung hochspezifischer hRyR3- Hybπdierungssonden, mit denen die Gegenwart oder der Mangel an Nukleinsäuren des hRyR3 in Geweben nachgewiesen werden kann Auch können nun hochspezifische Sonden zum Nachweis des hRyR3 durch PCR ("Polymerase Chain Reaction") entwickelt werden Dadurch können erfindungs- gemäß pathologische Zustande in Geweben durch molekularbiologische Methoden nachgewiesen werden
In einer bevorzugten Ausfuhrungsform wird im folgenden die Sequenz und molekularphysioiogische Charakterisierung der cDNA-Sequenz des erfindungs- gemäßen nativen Peptids des hRyR3 offenbart Die cDNA Sequenz wurde durch dem Fachmann bekannte molekularbiologische Hybndisierungs- methoden und anschließendes Sequenzieren mehrerer überlappender cDNA- Klone identifiziert und charakterisiert (Siehe Beispiel 1 ) Die Primarstruktur des erfindungsgemaßen nativen Polypeptids ist durch den Vergleich des korrespondierenden Leserasters der Aminosauresequenz des Kaninchen- RyR3 bestimmt worden (Hakamata Y et al FEBS Lett 312! (1992), 229-235) Die Aminosauresequenz des nativen Polypeptids ist 4866 Aminosäuren lang und entspricht einem Molekulargewicht von 551046 Da Fig 1 zeigt die aus der cDNA abgeleitete Aminosauresequenz des hRyR3 Die Nukleotidsequenz GAGCCATGG im Bereich um das translationale Initiationskodon stimmt gut mit der Konsensusinitationssequenz CCA(G)CCATGG uberein (Kozack M Nucleic Acids Res 12 (1984), 857-872) Die 3 -nichtkodierende Region ist 873 Nukleotide lang (ohne den poly (da)-Bereιch), das Polyadenylierungs- signal AATAAA (Goeddel, D V et al Nature 290 (1981 ), 20-26) befindet sich 21 Nukleotide oberhalb des poly (da)-Bereιchs Der Aminosauresequenzver- gleich weist jeweils über 90% (ca 96 %) Identität zwischen hRyR3/rRyR3 auf, bzw über 60% Identität zwischen hRyR3/rRyR2 (ca 69 %) sowie hRyR3/RyR1 (ca 67 %) Das Hydropathizitatsprofil des hRyR3 ist vergleichbar mit denen von Kanιnchen-rRyR3, rRyR2, rRyR1 sowie humanem RyR1 insoweit, daß keine hydrophobe aminoterminale Sequenz die eine Signalsequeπz anzeigt, vorhanden ist und, daß die restlichen Bereiche hauptsächlich hydrophil sind sowie, daß sich vier stark hydrophobe Segmente (benannt als M1 , M2, M3 und M4) im carboxy-terminalen Ende befinden Besonders gut konserviert in allen RyR ist die carboxyterminale Region im Bereich der M3- und M4-Segmente Es sind auch deutliche Unterschiede vorhanden So fehlt z B sowohl in hRyR3 als auch in rRyR3 in der Nahe der Aminosäure 1300 ein Bereich von etwa 100 Aminosäuren, RyR2 hat in dieser Region eine EF-Hand-Konsensussequenz (Moncrief, N D J Mol Evol 30 (1990), 522-562) (im Bereich der Aminosäuren 1336-1347) und eine Nukleotidbindungskonsensussequenz GXGXXG (Wierenga, R K Nature 302 (1983), 842-844) (Aminosaurereste 1324-1329) (Nakai, J et al FEBS Lett 271 (1990), 169-177) Desweiteren unterscheidet sich die Region direkt vor dem M1 -Segment, in der eine Divergenz zwischen hRyR3 und rRyR3 besteht Der hRyR3 verfugt über vier sich wiederholende Sequenzen in zwei Tandempaaren (Aminosaurereste 841 -954, 955-1070, 2600-271 1 und 2712-2791 ) Potentielle Ligandenbindungsstellen sind über vorgeschlagene Konsensusaminosauresequenzen bestimmbar Eine dem Motif der EF-Hand (Moncrief, N D J Mol Evol 30 (1990), 522-562) ähnliche Sequenz ist bei Aminosaureresten 3928-3939 erkennbar, eine Region, die auch in rRyR3, RyR2 und RyR1 relativ gut konserviert ist Desweiteren ist eine potentielle Calmodulin-Bindungsstelle (Aminosäuren 3465-3476), bestehend aus einer amphipathischen Helix mit zwei Gruppen positiver Ladungen, die durch eine hydrophobe Region getrennt sind (Blumenthal, D K Proc Natl Acad Sei U S A 82 (1985), 3187-3191 ), besonders gut in rRyR3, rRyR2 und rRyR1 konserviert Das Molekül weist vier Kopien der Nukleotidbindungs- konsensussequenz GXGXXG (Wierenga, R K Nature 302 (1983), 842-844) (Aminosaurereste 697-702, 699-704, 1 135-1 140, 2235-2240 und 2524-2529) auf, von denen die Aminosäuren 2235-2240 in rRyR3, rRyR2 und rRyR3 gut konserviert sind Durch Verwendung der Konsensussequenz RXXS T, ergeben sich 21 potentielle Posphorylierungsstellen für Ca2+/Calmodulιn-abhangιge Proteinkinasen, von denen vier (Seπnrest 2707 und die Threoninreste 130, 290, und 4150) in rRyR3, rRyR2 und rRyR3 konserviert sind Es sind zwei potentielle cAMP-abhangige Phosphorylierungsstellen (Threoninreste 1244 und 4158), definiert als KRXXS/T oder RRXS T (Kemp, B E and Pearson R B Trends Biochem Sei 15 (1990), 342-346), vorhanden, die jedoch nicht in rRyR konserviert sind All diese potentiellen Bindungsstellen sind auf der wahrscheinlich zytoplasmatischen Seite, entsprechend des Transmembran- topologiemodels (Takeshima, H et al Nature 339 (1989), 439-445), angeordnet Argininrest 613 oder 614, dessen Ersatz durch Cystein in RyR1 mit maligner Hyperthermie (MH) in Schwein und Mensch assoziiert ist, ist in allen drei Typen von RyR konserviert Es ist nun möglich, durch Vergleich der Pπmarstruktur des hRyR3 mit anderen Ryanodinrezeptoren, quantitative und qualitative Aussagen über seine molekularen Eigenschaften zu machen Dem Fachmann auf dem Gebiet der Proteinchemie bietet die Pπmarstruktur des nativen Proteins desweiteren die Möglichkeit, Struktur- und Bindungsmodelle, die bei der Aufklarung der physiologischen Funktion und der Bestimmung möglicher Inhibitoren und Aktivatoren dieses Rezeptors hilfreich sind, zu entwerfen
Die funktionelle Untersuchung des RyR3 hat bis jetzt noch keinen direkten Nachweis seiner Funktion als Kalziumfreisetzungskanal zeigen können In einer besonderen Ausfuhrungsform der vorliegenden Erfindung wurde nun erstmals die funktionelle rekombinante Expression des des hRyR3 durch Myotuben aus Mausen ohne die Skelettmuskelisoform des RyR (Nakai, J et al Nature 380 (1996), 72-75) gezeigt Die Expression des Wιldtyp-hRyR3 in Myotuben aus RyR1 -defιzιenten (dyspedischen) Mausen durch Injektion der cDNA in die Kerne ist möglich, aber bedingt durch eine endogene Koffeinreaktion der dyspedischen Myotuben durch Koffein schlecht nachweisbar, da der Unterschied zwischen der Koffeinreaktion von nicht- injizierten Myotuben und mit RyR3-cDNA injizierten Myotuben nur undeutlich ist (10 mM Koffein) Dieses Ergebnis war nicht unerwartet, da hRyR3 in humanen T-Lymphozyten auch keine Koffeinreaktion aufzeigen (Hakamata, Y et al Febbs Lett 352 (1994), 206-210) Es wird angenommen, daß Koffein durch die Verstärkung der Kalziumempfindlichkeit auf den RyR wirkt Deshab wurde in erfinderischer Weise die Aufgabe gelost eine erhöhte Kalziumempfindlichkeit in den RyR3 einzubringen Ausgehend von der Annahme daß die fehlende Region um den Aminosaurerest 1300 die kalziumempfindlichkeitsbestimmende Region enthalt, ist es möglich, ein chimares RyR-Molekul herzustellen, in dem die fehlende Region durch eine Sequenz des RyR2 ersetzt wird, welcher eine hohe Kalziumempfindlichkeit aufweist Ein solches chimares Molekül des RyR kann z B zu einem Drittel aus der rRyR2-Amιnosauresequenz im N-Terminus und zu zwei Dritteln aus der hRyR3-Sequenz im C-Terminus bestehen (Fig 2A) Fig 2B zeigt eine Koffeinreaktion des in dyspedischen Myotuben exprimierten chimaren RyR Der chimare RyR reagiert auf 1 mM Koffein (Fig 2B, n=5 von 20) Dagegen zeigen nicht-injizierte dyspedische Myotuben keinerlei Reaktion auf 1 mM Koffein (Fig 2B, n=0 von 20) Dadurch wird erstmals gezeigt, daß chimare RyR intrazellulare Kalziumkanale ausbilden können, die auf Koffein reagieren Basierend auf der Strukturvorhersage der RyR-Aminosauresequenz egt die kanalbildende Region des RyR im C- terminalen Zehntel der RyR-Molekule (Takeshima, H et al Nature 339 (1989), 439-445, Nakai, J et al FEBS Lett 271 (1990), 169-177 Hakamata, Y et al FEBS Lett 312 (1992), 229-235, Zorzato, F et al J Biol Chem 265 (1990). 2244-2256) Es ist davon auszugehen, daß die C-terminalen zwei Drittel des hRyR3 die Kalziumfreisetzungskanalaktivitat beinhalten und, daß das N- terminale Drittel der RyR-Sequenz die Region, die die Koffein und/oder Kalziumempfindlichkeit bestimmt, enthalt
Eine ganz besonderen Ausfuhrungsform der vorliegenden Erfindung betrifft den Nachweis von hRyR3 in Geweben Dieses ist mit hRyR3-spezιfιschen Sonden und der Northem-Blot-Analyse von mRNA aus diversen menschlichen Geweben möglich Es kann gezeigt werden, daß, obwohl in Gesamtgehirn nur ein schwaches Signal für RNA beobachtet werden kann, ein ca 16 kb großes RNA-Stuck mit hRyR-cDNA-Proben in relativ großer Menge in begrenzten Gehirnbereichen wie Nucleus caudatus, Amygdala und Hippocampus sowie in etwas geringeren Mengen in Corpus callosum, Substantia nigra und Thalamus (Fig 3) hybridisiert Die begrenzte Verteilung von RyR3 im menschlichen Gehirn ermöglicht die folgenden Annahmen Es ist bekannt, daß der RyR auch im Gehirn direkt an L-Typ-Kalziumkanale gekoppelt ist Wahrend P-Typ und andere Typen von Kalziumkanalen im ganzen Gehirn expπmiert werden, wird der R-Typ-Kalziumkanal nur in den sehr begrenzten Regionen des Gehirns, wie im Nucleus caudatus und Hippocampus expπmiert (Nndome, T et al FEBS Lett 308 (1992), 7-13) Bei einer ähnlichen Verteilung von R-Typ-Kalziumkanal und RyR3 ist es wahrscheinlich, daß der RyR3 direkt mit dem R-Typ- Kalziumkanal in diesen Regionen wechselwirken kann Da die Regionen der RyR3-Expressιon auch grob mit den Gebieten korrespondieren, in denen der "verzögerte neuronale Tot" nach Hypoxie im Gehirn stattfindet ist es wahrscheinlich, daß dieser Typ des RyR eine wichtige Rolle in pathologischen Zustanden spielt Die erhöhte lokomotorische Aktivität von RyR3-defιzιenten Mausen reflektiert diese Verteilung des RyR3
In einem weiteren Ausfuhrungsbeispiel kann gezeigt werden, daß auch außerhalb des Gehirns in Skelettmuskel der Nachweis einer RNA-Spezies gelingt, die mit hRyR3-cDNA-Proben hybridisiert (Fig 4) Die Große der RNA- Spezies dieser Gewebe von ca 16 kb entspricht der Spezies im Gehirn Ein schwaches Signal legt die Existenz von RyR3-mRNA in Herzgewebe nahe Die Verteilung von mRNA außerhalb des Gehirns unterscheidet sich vom Kaninchen, da die RyR3-Expressιon in Kaninchenskelettmuskel nicht nachweisbar ist Bedingt durch den großen Gehalt an RyR1 -mRNA in Skelettmuskel ist ein geringer Beitrag durch Kreuzhybπdisierung von RyR3- Proben mit RyR1 -mRNA nicht ausgeschlossen Allerdings führte mRNA aus Herz zu einem wesentlich geringeren Hybπdisierungsignal, trotz der höheren Homologie von RyR3 mit RyR2 im Vergleich zu RyR1 Dieses, zusammen mit der Isolierung von RyR3-cDNA aus einer cDNA-Bibhothek aus Skelettmuskel, deutet daraufhin, daß RyR3 tatsächlich in Herzmuskel exprimiert wird Zudem ist RyR3 in Skelettmuskel anderer Spezies wie z B Maus, Vogel und Frosch nachweisbar
In einem weiteren Ausfuhrungsbeispiel zum Nachweis des hRyR3 wird gezeigt, daß die RyR3-Expressιon zwischen den Spezies variiert und, daß die RyR3- Expression in humanem Skelettmuskel starker ausgeprägt ist als in anderen Spezies Es ist bekannt, daß eine akute Erhöhung von intrazellularem Kalzium in menschlichem Skelettmuskel maligne Hyperthermie (MH) auslost (MacLennan, D H and Philips, M S Science 256 (1992), 789-794) Obwohl MH mit Mutationen von RyR1 assoziiert wird (Gillard, E F et al Genomics 1 _ (1991 ), 751 -755), weisen nur 5 % der MH-Falle eine Mutation in Position 614 des RyR1 -Gens durch Arg zu Cys Substitution auf Die reichliche Expression von RyR3 in menschlichem Skelettmuskel macht eine Beteiligung des RyR3 an Varianten Formen von MH sehr wahrscheinlich Zudem besteht die Möglichkeit, daß der RyR3 auch an anderen Störungen der intrazellularen Kalziumregulation beteiligt sein konnte
In einer weiteren ganz besonderen Ausfuhrungsform wurde deshalb festgestellt, daß der hRyR3 bei pathologischen Zustanden im Menschen vorhanden ist und in pathologisch veränderten Geweben nachgewiesen werden kann Zu diesem Zweck wurde an Zellinien, abgeleitet aus humanen Gehirntumoren, gezeigt, daß die gewebespezifische Verteilung des RyR3 in menschlichem Gehirn in Zusammenhang mit der zellspezifischen Kalziumregulation bei der Pro feration steht RyR3-mRNA wird in mehreren menschlichen Zellinien exprimiert (Fig 5) Eine reichliche Expression ist in U373 feststellbar, einer Zelle aus malignem Astrozytoma, eine schwache Expression in IMR-32 aus malignen Neuroblastomazellen sowie einer noch geringeren Expression in H4 aus malignen Neurog omazellen Trotz der RyR2- Expression in IMR-32 sind keine weiteren RyR-Typen in U373 oder H4 feststellbar RyR3-Expressιon in den neuronalen Zellen SK-N-MC oder SK-N- SH konnte trotz ihrer Malignitat nicht nachgewiesen werden U373 und H4 reagierten auf Ryanodin, nicht jedoch auf Koffein mit einer Erhöhung des intrazellularen Kalziums, wahrend eine Koffeinreaktion unter gleichen Bedingungen in RyR2-expπmιerenden CHO-Kaninchenzellen nachweisbar ist (Fig 6) Die Ryanodin- und Koffeinreaktionen von U373 und H4 ist auch in T- Lymphozyten zu beobachten, ein typisches Merkmal für RyR3 (Hakamata, Y FEBS Lett 352 (1994), 206-210) Beispiele
1 Klonierung der cDNA
Es wurden Oligo (dT)- und Zufalls-Primer- cDNA-Bibiotheken aus menschlichem Gehirn (Nucleus caudatus) der Firma Clontech (USA) verwendet, die aus poly(A)+RNA isoliert und in λgt10 Phagen einkloniert wurden Das Durchsuchen der cDNA-Bibliotheken (-3,0 x 105 PIaques) mit dem Fragment Pstl(9790)/EcoRI(1 1834) aus dem Kaninchen RyR3 cDNA-Klon pBRR74 (9) führte zu λhBRR79 Die Schnittstellen der Restπktionsendo- nukleasen werden durch Zahlen (in Klammern) gekennzeichnet, die das aus der Spaltung hervorgehende 5'-termιnale Nukleotid beschreiben die Nukleotidreste sind in 5 '-3 '-Richtung nummeπert, angefangen mit dem ersten Rest des ATG-Tnplets, das das wahrscheinlich initiierende Methionin kodiert Das Subklonieren des cDNA-lnserts von λhBRR79 in die EcoRI Schnittstelle von pBluescπpt SK(-) (Stratagene) führte zu phBRR79 Die Bibliothek wurde neun mal mit verschiedenen Proben durchsucht
Figure imgf000015_0001
Desweiteren wurden zwei zusatzliche Klone durch RT-PCR gewonnen 1 μg poly(A)+RNA (Clontech) aus menschlichem Gehirn wurde zusammen mit RNase H'Reverse Transkπptase aus Moloney's murinem Leukemievirus (Gibco BRL) mit Zufallspπmer inkubiert Der erste synthetisierte cDNA- Strang wurde entsprechend der Herstellerangaben (TaKaRa LA PCR Kit) mit Hilfe eines DNA Thermal Cycler's (Perkin-Elmer Corp ) amplifiziert Nach einem Heißstart (1 min, 94 °C) wurden die Proben 30 Zyklen von 20 s bei 98°C und 5 min bei 68°C ausgesetzt Primerpaare für phBRR501 waren jeweils synthetische 25-Nukleotιdohgomere der Basen 2949-2973 (oberer Pπmer, AGTGGATAAACTTGCAGAAAATGCA) und 3495-3519 (unterer Primer, TGGGGAGCTGCTGATCACCAATAAA) der phBRR61 - und der phBRR51 -Klone Pπmerpaare für phBRR502 waren jeweils synthetische 20- Nukleotidohgomere der Basen 11369-1 1388 (oberer Primer, TTGATGAATCTGGACAGCAC) und 12353-12372 (unterer Primer, ACGTGTTAGAAATTGCGGGT) der phBRR79- und der phBRR91 -Klone Die cDNA-Klone zur Nukleotidsequenzanalyse waren phBRR22 (mit den Nukleotiden -86 bis 1263), phBRR61 (991 -3103), phBRR501 (2949-3519), phBRR51 (3435-5253), phBRR53 (4444-7346), phBRR41 1 (7330-9900), phBRR79 (8358-1 1408), phBRR502 (1 1369-12372) und phBRR91 (1 1468- 15486) Alle cDNA-Einschube außer phBRR501 und phBRR502 wurden in die EcoRI-Schnittstelle von pBluescnpt SK(-) subkloniert Das 0,6-kb Hιndlll(2956)/-Bcll(3506) Fragment von phBRR501 wurde in die BamHI/Hindlll Schnittstelle und das 0,5-kb Apal(1 1451 )/Accl(1 1930) Fragment von phBRR502 in die AccI/Apal Schnittstelle von pBluescnpt SK(-) subkloniert
Beide Strange der resultierenden cDNA und die PCR-Produkte der Reversen Transkπptase wurden über die Dideoxy-Ketten-Terminations- Methode sequenziert (Sanger, F et al Proc Natl Acad Sei U S A , 74, (1977), 5463-5467)
2 Physiologische Charakterisierung
Die gesamte proteinkodierende Sequenz des humanen RyR3 wurde in die EcoRI/Notl-Schnittstelle von pCI-neo (Promega) einkloniert und resultierte in hNRR9 Das cDNA-lnsert wurde aus den folgenden Fragmenten konstruiert EcoRI(Vector)/Mrol(1232) erhalten aus lhBRR22, Mrol(1232)/Hιndlll(2956) aus lhBRR61 , Hιndlli(2956)/ Bcll(3506) aus lhBRR501 ,
Bcll(3506)/PmaCI(4750) aus lhBRR51 , PmaCI(4750)/ Pstl(7339) aus lhBRR53, Pstl(7339)/Clal(9559) aus lhBRR41 1 , Clal(9559)/Spel(10569) aus lhBRR79, Spel(10569)/Apal(1 1451 ) aus lhBRR407,
Apal(1 1451 )/EcoRI(1 1815) aus lhBRR502, EcoRI(1 1815)/EcoRI(14861 ) aus lhBRR91 Das Expressionsplasmid der chimaren Ryanodine Receptor- cDNA aus humanem RyR3 und dem Kanιnchen-RyR2 wurde wie folgt konstruiert Das Sall(vector)/PmaCI(5038) Fragment aus der Kaninchen- RyR2 cDNA (Nakai, J et al FEBS Lett 271 (1990), 169-177) und das PmaCI(4750)/Notl(vector) Fragment aus der humanen RyR3-cDNA wurde in die Sall/Notl-Schnittstelle von pCI-neo giert Kulturen von Myotuben aus RyR1 -defιzιenten (dyspedischen) Mausen und cDNA-Injektion sind bereits bekannt (Nakai, J et al , Nature 380, (1996), 72-75) Fluoreszenzanderungen (dimensionsiose willkürliche Einheiten) wurden nach der Beladung der Myotuben mit Fluo-3 AM gemessen (Garcia, J , und Beam, K G , J Gen Physiol 103, (1994), 107-123) Koffein wurde durch lokale Injektion mit Hilfe einer "wιde-tιpped"-Pιpette (10-50 mm Durchmesser) appliziert Als Waschlosung wurde normale Nager-Ringer-Losung der folgenden Zusammensetzung verwendet (mM) 145 NaCI, 5 KCI, 2 CaC-2, 1 MgCI2, 10 HEPES, pH 7 4 mit NaOH eingestellt Die Temperatur betrug 20- 22°C
3 Northern Blot Analyse
Zur Northem-Blotanalyse von humanem Gehirn und anderen Geweben wurden kaufliche Multiple Tissue Northern (MTN) Blots (Clontech) verwendet Jede Bahn der MTN-Blots enthalt ungefähr 2 μg poly(A)+RNA aus den folgenden Hirnregionen Amygdala, Nukleus caudatus, Corpus callosum, Hippocampus, Gesamtgehirn, Substantia nigra, subthalamischen Nucleus and Thalamus Jede Bahn des anderen MTN-Blots enthalt ungefähr 2 mg poly(A)+ RNA der folgenden humanen Gewebe Herz, Gehirn, Placenta, Lunge, Leber, Skeletmuskel, Niere und Pankreas Jede Bahn des dritten Blots enthalt ungefähr 20 mg Gesamt-RNA der folgenden humanen Zellinien (Hakamata Y , et al FEBS Lett 312 (1992), 229-235) SK-N-MC (abgeleitet aus ursprünglichen Neuroblastoma), IMR-32 (Neuroblastoma), HEL-299 (Lungenfibroblast), H4 (Neuroghoma), SK-N-SH (Neuroblastoma), HEK-293 (embryonale Nierenzelle) und U373 (Astrocytoma) Da die aus cDNA-Teilen des humanen Ryanodin-Rezeptors gewonnenen Sonden nur schwache Signale ermöglichten, wurde für die Northern Blot Analyse das 14,9-kb Nall(Vector)/Notl(Vector) Fragment aus phNRR9 verwendet Die Probe wurde mit dem Klenow-Fragment der DNA-Polymerase und [32P] dCTP (Feinberg, A P & Vogelstein, B Anal Biochem 132 (1983), 6-13) durch Zufallsoligonukleotidpπmer hergestellt Der Blot wurde bei 42°C hybridisiert und drei mal mit 0,3 x SSC, 0, 1 % SDS bei 50°C gewaschen 4 Lumineszenz-Bestimmung
Die Lumineszenz-Bestimmung wurde wie erst kurzlich veröffentlicht durchgeführt (Maeda, A et al , Anal Biochem 242, (1996), 58-66) Dazu wurden die Zellen (1 x 105 Zellen / Gefäß) in die Losung des Kalzium-Assays mit der folgenden Zusammensetzung transferiert (mM) 140 NaCI, 5 KCI, 1 ,5 MgCI2, 2,5 CaCI2, 5 Glukose und 10 HEPES, PH 7,4 mit NaOH eingestellt, einschließlich 2,5 mM Coelenterazin, das intermediäre Substrat von Aequoπn, und bei 37°C für 6 h inkubiert Das System zur Lumineszenz-Messung bestand aus dem Spektrofluorometer CAF-1 10 (Jasco) (Hakamata Y et al , FEBS Lett 352, (1994), 206-210), das mit einer Lumineszenz-Einheit PL-03 (Jasco) verbunden ist Die Mobilisierung intrazellularen Kalziums wurde durch Injection von Koffein in einer Endkonzentration von 10 mM und Ryanodinrezeptor von 100 mM induziert Die Gesamtmenge der Aequoπn-Aktivitat wurde nach der Permeabilisierung der Zellen mit Digitonin in einer Endkonzentration von 200 mg/ml gemessen Die Ethanolkonzentration betrug 0,5% oder weniger, da es unter diesen Bedingungen nicht zu einer Kalziumfreisetzung kommt
Legenden zu den Figuren
Fig. 1 vergleicht die Aminosauresequenzen der RyR-lsoformen, durch Ausrichtung der abgeleiten Aminosauresequenz des humanen RyR3 (oben) mit dem Kanιnchen-RyR3 (obere Mitte), dem Kanιnchen-RyR2 (untere Mitte) und dem Kanιnchen-RyR1 (unten) Vier identische Reste in der gleichen Position sind durch durchgezogene Linien eingerahmt, wahrend Folgen von vier identischen oder konservierten Resten mit gestrichelten Linien umrahmt sind Die Aminosaurereste sind, angefangen am initiierenden Methionin, nummeπert Die mutmaßlichen Transmembransegmente M1 bis M4 sind gekennzeichnet, die Enden eines jeden Segments sind durch den Vergleich mit dem Kanιnchen-RyR3 bestimmt worden Vier sich wiederholende Sequenzen, die in Tandempaaren vorkommen sind durch Pfeile gekennzeichnet
Fig. 2 zeigt die Reaktion des chimaren humanen RyR3 in dyspedischen Myotuben aus RyR1 -defιzιenten (despedischen) Mausen auf Koffein A, Schematische Darstellung der Struktur des chimaren RyR aus Kaninchen- RyR2 (offenes Rechteck) und humanem RyR3 (gefülltes Rechteck) B, Intrazellulares Kalziumsignal als Reaktion auf Koffein in dyspedischen Myotuben, die den chimaren humann RyR3 expπmieren (a) Nicht-injizierte dyspedische Myotuben reagieren nicht auf 1 mM Koffein (n=20) (b) Dyspedische Myotuben, in die chimare humane RyR3- cDNA injiziert wurde, reagieren auf 1 mM Koffein (n = 5 von 20) Der Verlauf der Basislinie wurde möglicherweise durch das Ausbleichen des Farbstoffs hervorgerufen
Fig. 3 zeigt die Verteilung des humanen RyR3 in humanem Gehirn durch die Northern-Blot-Analyse verschiedener Regionen des Gehirns mit cDNA- Proben für humane RyR3-mRNAs Es wurden jeweils 2 mg poly (A)+RNA verwendet Die Autoradiographie wurde bei -70°C über 7 Tage mit einem intensivierenden Schirm durchgeführt
Fig. 4 zeigt die Exponierung von humanem RyR3 durch die Northern-Blot- Analyse verschiedener humaner Gewebe mit cDNA-Proben für humane RyR3-mRNAs Es wurden jeweils 2 mg poly (A)+ RNA verwendet Die Autoradiographie wurde bei -70°C über 7 Tage mit einem intensivierenden Schirm durchgeführt
Fig. 5 zeigt die Verteilung des humanen RyR3 in humanen Zellinien durch die Northern-Blot-Analyse der humanen RyR-mRNA Expression in Kaninchenskelettmuskel, Kaninchenherz, Kaninchengesamtgehirn und humanen Zellinien wie Neuroblastoma (SK-N-MC, IMR-32), Lungenfibroblasten (HEL-299), Neurog oma (H4), Neuroblastoma (SK-N- SH), embryonale Niereπzellen (HEK293) und Astrocytoma (U373) mit cDNA- Sonden für humane RyR3- mRNAs Es wurden jeweils 20 mg Gesamt-RNA verwendet Die Autoradiographie wurde bei -70°C über 4 Tage mit einem intensivierenden Schirm durchgeführt
Fig. 6 zeigt die Zunahme von intrazellularem Kalzium in U373-Zellen nach Zugabe von Koffein und Ryanodin A CHO-Zellen transfiziert mit Kaninchen RyR2-cDNA, (Maeda, A et al , Anal Biochem 242, (1996), 58-66) zeigen einen klaren Anstieg des intracellularen Kalzium als Reaktion auf Koffein (n=1 1 von 1 1 ) B Koffein fuhrt zu keinem Effekt in U373-Zellen (n=7) C Ryanodin lost vorübergehende Kalziumschwankungen aus (n=2 out of 4) Einige Zellen reagieren nicht auf die Ryanodin-Zugabe (n=2 out of 4) Die uneinheitliche Reaktion ist wahrscheinlich nicht darauf zurückzuführen, daß der Ryanodin- Rezeptor den Wirkort nicht erreicht wie kürzlich beschrieben (Penner, R et al , FEBS Lett 259, (1989), 217-221 ) Der Zeitpunkt der Zugabe von Koffein und Ryanodin-Rezeptor ist durch kleine Balken markiert
Fig. 7 zeigt die aus der DNA-Sequenz abgeleitete Aminosauresequenz der humanen Ryanodinrezeptors
Fig. 8 zeigt die DNA-Sequenz des humanen Ryanodinrezeptors

Claims

Patentansprüche
1 Polypeptid, dadurch gekennzeichnet, daß es mindestens 90 % Aminosaure- sequenzidentitat mit dem Kaninchen-Ryanodin-Rezeptor vom Typ 3 (rRyR3) aufweist oder ein funktionelles Derivat hiervon
2 Polypeptid, gemäß Anspruch 1 dadurch gekennzeichnet, daß es ca 96% Aminosauresequenzidentitat mit dem rRyR3 aufweist oder ein funktionelles Derivat hiervon
3 Polypeptid, gemäß Anspruch 1 oder 2 dadurch gekennzeichnet, daß es sich um den humanen Ryanodinrezeptor vom Typ 3 (hRyR3) mit der Aminosauresequenz gemäß Figur 7 oder ein funktionelles Derivat hiervon handelt
4 Chimares Polypeptid dadurch gekennzeichnet, daß es mindestens ein Fragment des Polypeptids gemäß einem der Ansprüche 1 bis 3 und mindestens ein weiteres Fragment eines anderen Polypeptids enthalt
5 Chimares Polypeptid gemäß Anspruch 4 dadurch gekennzeichnet, daß das andere Protein aus der Familie der nicht humanen Ryanodinrezeptoren ausgewählt ist
6 Chimares Polypeptid gemäß Anspruch 4 oder 5 dadurch gekennzeichnet, daß das Fragment des anderen Proteins vom Kaninchen-Ryanodin-Rezeptor Typ 2 (rRyR2) stammt
7 Chimares Polypeptid gemäß einem der Ansprüche 4 bis 6 dadurch gekennzeichnet, daß es im Bereich der Aminosäure 1300 des hRyR3 ein
Fragment des rRyR2 enthalt, welches hohe Kalzium- bzw Koffeinempfindlichkeit verleiht
8 Nukleinsäure kodierend für ein Polypeptid gemäß einem der Ansprüche 1 bis 7
9 Nukleinsäure dadurch gekennzeichnet daß sie unter stringenten Bedingungen mit einer Nukleinsäure gemäß Anspruch 8 hybridisiert 10 Verfahren zur Herstellung eines Polypeptids, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß Anspruch 8 oder 9 in eine Zelle oder ein zellfreies In-Vitro-Translations-System eingebracht wird
11 Verfahren gemäß Anspruch 10, dadurch gekennzeichnet, daß die Nukleinsäure Bestandteil eines Expressionsvektors ist
12 Pharmazeutikum, dadurch gekennzeichnet, daß es ein Polypeptid gemäß einem der Ansprüche 1 bis 7 und/oder eine Nukleinsäure gemäß Anspruch 8 oder 9 enthalt
13 Pharmazeutikum, dadurch gekennzeichnet, daß es eine Nukleinsäure die einer Nukleinsäure gemäß Anspruch 8 oder 9 komplementär ist enthalt
14 Verfahren zum Nachweis einer Nukleinsäure gemäß Anspruch 8 oder 9, oder eines Polypeptids gemäß einem der Ansprüche 1 bis 7
15 Verfahren zum Nachweis einer Nukleinsäure gemäß Anspruch 8 oder 9, dadurch gekennzeichnet, daß eine zu dieser Nukleinsäure oder einem Teil dieser Nukleinsäure komplementäre Nukleinsäure zur Hybridisierung eingesetzt wird
16 Verfahren zum Nachweis eines Polypeptids gemäß einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, daß das Polypeptid immunologisch nachgewiesen wird
17 Verwendung der Polypeptide gemäß einem der Ansprüche 1 bis 7 oder der Nukleinsäuren gemäß Anspruch 8 oder 9 zur Identifizierung von Aktivatoren und/oder Inhibitoren des hRyR3
18 Verfahren zur Identifizierung von Aktivatoren und/oder Inhibitoren des hRyR3, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß Anspruch 10 in eine Zelle oder ein zellfreies System eingebracht und exprimiert wird, das Expressionsprodukt einem potentiellen Inhibitor oder Aktivator ausgesetzt wird und der durch das Expressionsprodukt vermittelte lonenfluß gemessen wird
19 Verfahren zur Identifizierung von Aktivatoren und/oder Inhibitoren des hRyR3, dadurch gekennzeichnet, daß eine Nukleinsäure gemäß Anspruch 10 in eine Zelle oder ein membranumschiossenes zellfreies System eingebracht und exprimiert wird, ein potentieller Inhibitor oder Aktivator zugesetzt wird und die lonenkonzentration im membranumschlossenen Raum bestimmt wird
20 Verfahren zur Diagnose von pathologischen Zustanden in Geweben, dadurch gekennzeichnet, daß das Vorhandensein, die Uberexpression oder der Mangel eines Polypeptids gemäß einem der Ansprüche 1 bis 7 nachgewiesen wird
21 Verfahren nach Anspruch 20, dadurch gekennzeichnet, daß der Nachweis des Polypeptids immunologisch durch Antikorperbindung erfolgt
22 Verfahren nach Anspruch 21 , dadurch gekennzeichnet, daß die für das Polypeptid kodierende Nukleinsäure nachgewiesen wird
23 Verwendung der Polypeptide gemäß einem der Ansprüche 1 bis 7 und/oder Nukleinsäuren gemäß einem der Ansprüche 8 bis 9 zur Herstellung eines Pharmazeutikums zur Behandlung von hRyR3 assoziierten Erkrankungen
PCT/EP1998/002926 1997-05-28 1998-05-18 Das protein des humanen ryanodinrezeptors vom typ 3 sowie dafür kodierende dna-moleküle WO1998054212A2 (de)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US09/424,783 US6780608B1 (en) 1997-05-28 1998-05-18 Human type 3 ryanodine receptor protein and DNA molecules coding therefor
EP98929337A EP0984986A2 (de) 1997-05-28 1998-05-18 Das protein des humanen ryanodinrezeptors vom typ 3 sowie dafür kodierende dna-moleküle
CA002291960A CA2291960A1 (en) 1997-05-28 1998-05-18 Human type 3 ryanodine receptor protein and dna molecules coding therefor
JP50018299A JP2002504813A (ja) 1997-05-28 1998-05-18 型３ヒトリアノジン受容体のタンパク質及びそれをコードするｄｎａ分子

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19722317.6 1997-05-28
DE19722317A DE19722317C1 (de) 1997-05-28 1997-05-28 Das Protein des humanen Ryanodinrezeptors vom Typ 3 sowie dafür kodierende DNA-Moleküle

Publications (2)

Publication Number Publication Date
WO1998054212A2 true WO1998054212A2 (de) 1998-12-03
WO1998054212A3 WO1998054212A3 (de) 1999-03-11

Family

ID=7830730

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1998/002926 WO1998054212A2 (de) 1997-05-28 1998-05-18 Das protein des humanen ryanodinrezeptors vom typ 3 sowie dafür kodierende dna-moleküle

Country Status (6)

Country Link
US (1) US6780608B1 (de)
EP (1) EP0984986A2 (de)
JP (1) JP2002504813A (de)
CA (1) CA2291960A1 (de)
DE (1) DE19722317C1 (de)
WO (1) WO1998054212A2 (de)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NO314277B1 (no) * 1999-06-08 2003-02-24 Unifob Stiftelsen Universitets Deteksjon av ryanodin-reseptor-antistoff
US8022058B2 (en) * 2000-05-10 2011-09-20 The Trustees Of Columbia University In The City Of New York Agents for preventing and treating disorders involving modulation of the RyR receptors
US7718644B2 (en) 2004-01-22 2010-05-18 The Trustees Of Columbia University In The City Of New York Anti-arrhythmic and heart failure drugs that target the leak in the ryanodine receptor (RyR2) and uses thereof
US7879840B2 (en) 2005-08-25 2011-02-01 The Trustees Of Columbia University In The City Of New York Agents for preventing and treating disorders involving modulation of the RyR receptors
US8710045B2 (en) 2004-01-22 2014-04-29 The Trustees Of Columbia University In The City Of New York Agents for preventing and treating disorders involving modulation of the ryanodine receptors
US7704990B2 (en) 2005-08-25 2010-04-27 The Trustees Of Columbia University In The City Of New York Agents for preventing and treating disorders involving modulation of the RyR receptors
US20070196856A1 (en) * 2006-02-23 2007-08-23 Allergan, Inc. Methods of determining activity of ryanodine receptor modulators
WO2007143112A2 (en) * 2006-06-02 2007-12-13 The Trustees Of Columbia University In The City Of New York Methods for diagnosing disorders and diseases associated with ryanodine receptors and methods for identifying compounds that affect ryanodine receptors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004328A1 (en) * 1989-09-25 1991-04-04 The University Of Toronto Innovations Foundation Diagnosis for malignant hyperthermia

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004328A1 (en) * 1989-09-25 1991-04-04 The University Of Toronto Innovations Foundation Diagnosis for malignant hyperthermia

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HAKAMATA, Y. et al. Involve- ment of the brain type of ryanodine receptor in T-cell proliferation. FEBS Letters, 1994, Band 352, Seiten 206- 210, insbesondere der ganze Artikel (in der Beschreibung ge- nannt), XP002900281 *
HAKAMATA, Y. et al. Primary structure and distribution of a novel ryanodine re- ceptor/calcium release channel from rabbit brain. FEBS Letters, November 1992, Band 312, Seiten 229-235, insbesondere der ganze Ar- tikel (in der Beschreibung ge- nannt), XP002900282 *
MCPHERSON, P.S. et al. So- lubilization and Biochemical Characterization of the High Affinity (3H)Ryanodine Re- ceptor from Rabbit Brain Membranes. The Journal of Biological Chemistry, October 1990, Band 265, Nr. 29, Seiten 18454-18460, insbe- sondere der ganze Artikel, XP002900283 *

Also Published As

Publication number Publication date
US6780608B1 (en) 2004-08-24
WO1998054212A3 (de) 1999-03-11
DE19722317C1 (de) 1998-10-08
CA2291960A1 (en) 1998-12-03
EP0984986A2 (de) 2000-03-15
JP2002504813A (ja) 2002-02-12

Similar Documents

Publication Publication Date Title
DE69836131T2 (de) Neue menschliche delta3-zusammensetzung und deren therapeutische und diagnostische verwendungen
DE19964269B4 (de) Verfahren zur Detektion des Proliferationspotentials von Zellen
DE69731834T2 (de) Agouti verwandtes gen
DE69838334T2 (de) Kdr, ein menschlicher tyrosin kinase rezeptor
DE69838905T2 (de) Transkriptionsfaktor islet-brain 1 (ib1)
DE69834432T2 (de) G-protein gekoppelter rezeptor
DE69634412T3 (de) Regulierte gene und ihre verwendungen
DE69839123T2 (de) Prostattumor polynukleotid- und antigenzusammensetzungen
DE69926764T2 (de) Methoden zur bestimmung von komponenten zur modulation des körpergewichts
DE69534351T2 (de) Motorneuronlebenserhaltungsgen: ein Gen für spinale Muskelatrophie
DE69837085T2 (de) Crsp-proteine (cystein-reiche, sekretierte proteine), die dafür kodierenden nukleinsäuren und ihre verwendungen
DE69334146T2 (de) Peptide mit gdp-austauschfaktorartiger wirkung, dafür kodierende nukleinsäuresequenzen, ihre herstellung und verwendung
DE69837267T2 (de) Kcnq kaliumkanäle und verfahren zur deren modulierung
DE69819505T2 (de) Mit smad wechselwirkende polypeptide und verwendungen davon
DE69332798T2 (de) Ikaros: ein regulatorisches gen bei der t-zell differenzierung
DE19722317C1 (de) Das Protein des humanen Ryanodinrezeptors vom Typ 3 sowie dafür kodierende DNA-Moleküle
DE69131421T3 (de) Für den rezeptor des granulozytenkolonie stimulierenden faktors kodierende dns
DE69633131T2 (de) Rezeptor des y-y5 neuropeptids
DE69535590T2 (de) Für den bradykinin-b1-rezeptor kodierende dna
DE60307061T2 (de) Verfahren zum nachweis von liganden des leptinrezeptors
DE69924120T2 (de) Für ataxin-2-bindende proteine kodierende nukleinsäure, damit verwandten produkten und verfahren zur deren anwendung
DE60036548T2 (de) Neue kalium-kanäle und dafür kodierende gene
DE69734890T2 (de) Rdgb-proteine
DE69936733T2 (de) Vaskulärer endothelialer wachstumsfaktor x
DE69737561T2 (de) Klonierte rezeptoren des glukagon-ähnlichen peptids-2

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP MX US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): CA JP MX US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998929337

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: PA/a/1999/010809

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2291960

Country of ref document: CA

Ref country code: CA

Ref document number: 2291960

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1999 500182

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09424783

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1998929337

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998929337

Country of ref document: EP